Gene expression analysis of monospecies Salmonella Typhimurium biolms using

Differential Fluorescence Induction

Kim Hermans, T.L. Anh Nguyen, Stefanie Roberfroid, Geert Schoofs, Tine Verhoeven, David De Coster,
Jos Vanderleyden , Sigrid C.J. De Keersmaecker
Centre of Microbial and Plant Genetics, Department of Microbial and Molecular Systems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 20, 3001 Leuven, Belgium
a b s t r a c t a r t i c l e i n f o
Article history:
Received 28 September 2010
Received in revised form 10 January 2011
Accepted 14 January 2011
Available online 21 January 2011
Keywords:
Salmonella
Biolm
DFI
Bacterial biolmformation is an important cause of environmental persistence of food-borne pathogens, such
as Salmonella Typhimurium. As the ensemble of bacterial cells within a biolm represents different
physiological states, even for monospecies biolms, gene expression patterns in these multicellular
assemblages show a high degree of heterogeneity. This heterogeneity might mask differential gene
expression that occurs only in subpopulations of the entire biolm population when using methods that
average expression output. In an attempt to address this problem and to rene expression analysis in biolm
studies, we used the Differential Fluorescence Induction (DFI) technique to gain more insight in S.
Typhimuriumbiolmgene expression. Using this single cell approach, we were able to identify 26 genetic loci
showing biolm specic increased expression. For a selected number of identied genes, we conrmed the
DFI results by the construction of dened promoter fusions, measurement of relative gene expression levels
and construction of mutants. Overall, we have shown for the rst time that the DFI technique can be used in
biolm research. The fact that this analysis revealed genes that have not been linked with Salmonella biolm
formation in previous studies using different approaches illustrates that no single technique, in casu biolm
formation, is able to identify all genes related to a given phenotype.
2011 Elsevier B.V. All rights reserved.
1. Introduction
During the last decades, it has become increasingly clear that
bacteria, including pathogens such as Salmonella enterica serovar
Typhimurium (S. Typhimurium), grow predominantly as biolms in
most of their natural habitats, rather than in planktonic mode (Hall-
Stoodley et al., 2004). S. Typhimurium is a Gram-negative, entero-
pathogenic bacterium that causes host-specic diseases ranging from
self-limiting food-borne gastroenteritis to life-threatening systemic
infections. Salmonella is capable of forming microcolonies and even
mature biolms on a wide diversity of surfaces, ranging from abiotic
(Kusumaningrumet al., 2003; Latasa et al., 2005; Romling et al., 1998)
to biotic (Barak et al., 2008; Boddicker et al., 2002; Brandl and
Mandrell, 2002; Prouty et al., 2002) ones. Bacterial biolms can be
dened as structured communities of bacterial cells enclosed in a self-
produced matrix, adhering to inert or living surfaces (Costerton et al.,
1999). Biolm formation has been stated as a potential cause of the
emerging (multi)drug resistance (Lewis, 2008), because of the
protecting action of the self-produced matrix (Fux et al., 2005) and
adaptation mechanisms of the bacteria residing in these multicellular
structures. Furthermore, Salmonella biolm formation is an important
survival strategy in non-host environments, which are fundamentally
different from typical host environments (Mouslim et al., 2002;
Romling et al., 2007), a strategy to induce chronic infections
(Costerton et al., 1995; Davey and O'Toole, 2000) and even a possible
way to colonize host organisms (Boddicker, et al., 2002; Prouty and
Gunn, 2003). Taken together, Salmonella biolm formation can be
seen as an essential and integral part of the pathogen's life cycle and a
source of reappearing infections by this pathogen (Rasschaert et al.,
2007).
Bacterial cells residing in biolms are not only physiologically
distinct from planktonic cells (with different gene expression
patterns), but also vary from each other spatially, temporally and
genetically as the biolm formation proceeds (Sauer et al., 2002;
Stewart and Franklin, 2008; Stoodley et al., 2002). High-throughput
DNA microarray studies have been conducted to study biolm
formation in many model organisms and have identied a large
number of genes showing differential expression under biolm
conditions (e.g. (Beenken et al., 2004; Beloin et al., 2004; Hamilton
et al., 2009; Ren et al., 2004; Schembri et al., 2003; Shemesh et al.,
2008; Whiteley et al., 2001)). This transcriptional proling technique,
however, generates a global value for the whole biolm population
(An and Parsek, 2007; Lazazzera, 2005; Stewart and Franklin, 2008)
and as such, differences in gene expression patterns of subpopulations
within biolms are not taken into account.
Journal of Microbiological Methods 84 (2011) 467478
Corresponding authors: Tel.: +32 16321631; fax: +32 16321966.
E-mail address: jozef.vanderleyden@biw.kuleuven.be (J. Vanderleyden).
0167-7012/$ see front matter 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.mimet.2011.01.012
Contents lists available at ScienceDirect
Journal of Microbiological Methods
j our nal homepage: www. el sevi er. com/ l ocat e/ j mi cmet h
In an attempt to address this problem and to rene expression
analysis in biolm studies, we decided to use the Differential
Fluorescence Induction (DFI) single cell approach to study Salmonella
biolm formation. This technique was introduced by the Falkow group
to sort S. Typhimurium clones differentially expressing GFP in low pH
environments and within host cells (Valdivia and Falkow, 1996, 1997).
DFI basically is an enrichment strategy using fragments of bacterial
genomic DNA, cloned upstream of a promoterless gfp, and a ow
cytometer with sorting module to monitor promoter activity. In this
study, the genetic enrichment was performed by alternating rounds of
positive (biolm-inducing) and negative (planktonic conditions)
selection of the bacterial population. This resulted progressively in the
generation of bacterial subpopulations showing enrichment in biolm
upregulated inserts. Subsequent sequence determination of the
genomic inserts in these enriched pools led to identication of DNA
sequences that caused increased expression of the promoterless gfp
gene in biolm conditions in non-host environments. Using this
enrichment technique in a biolm context, we identied 26 genetic
loci showingSalmonella biolmspecic inductionof which17coincided
with promoter regions of already annotated genes. For a selected
number of DFI identied genes, we conrmed the results of the
screening by the construction of dened promoter fusions. We also
measuredrelative gene expressionlevels withqRT-PCRfor a selectionof
DFI-retrieved genes to compare differential expression directly at the
RNAlevel. Finally, for some of the identiedgenes, we investigated their
impact on Salmonella biolm formation by constructing and analyzing
corresponding mutants.
2. Materials and methods
2.1. Bacterial strains, plasmids and media
All strains and plasmids used in this study are listed in Table 1. In
the planktonic state, S. Typhimurium strains were grown with
aeration at 37 C in Luria-Bertani (LB) broth (Sambrook and Russel,
2001) or on LB plates containing 15 g/l agar (Invitrogen). If appro-
priate, antibiotics were added at the following concentrations:
ampicillin (Ap), 100 g/ml; chloramphenicol (Cm), 25 g/ml and
streptomycin (Sm), 25 g/ml. Tryptic soy broth (BD Biosciences,
30 g/l) diluted 1/20 (TSB 1/20) was used for biolm formation assays
(De Keersmaecker et al., 2005).
Standard protocols were used for molecular cloning (Sambrook
and Russel, 2001). Restriction enzymes were purchased from New
England Biolabs and used according to the manufacturer's instruc-
tions. Cloning steps were performed using E. coli DH5 and E. coli
TOP10F (Sambrook and Russel, 2001) and the nal, constructed
plasmids were electroporated to the S. Typhimurium SL1344 strains
using a Bio-Rad gene pulser. All primers used, as well as their
purposes, are listed in Table 2. The sequences used for primer
construction were obtained from the complete genome sequence of S.
TyphimuriumSL1344 (Hoiseth and Stocker, 1981), as available via the
website of the Sanger Institute (U.K.), (http://www.sanger.ac.uk/
Projects/Salmonella). Reporter plasmids pCMPG5521, pCMPG5532,
pCMPG5533 and pCMPG5539 were constructed by cloning the PCR-
amplied csgD, potF, STM1851 and csgB promoter regions, respec-
tively, as a BamHI (for pCMPG5521 and pCMPG5539) or XbaI/BamHI
(for pCMPG5532 and pCMPG5533) fragment into pFPV25. Comple-
mentation plasmids pCMPG5522, pCMPG5531 and pCMPG5538 were
constructed by cloning the PCR-amplied potF, potFGHI and sitABCD
coding sequences, as EcoRI (pCMPG5522) and XbaI/BamHI
(pCMPG5531, pCMPG5538) fragments downstream of the constitu-
tive nptII promoter into the RK2 based plasmid pFAJ1708 (Dombrecht
et al., 2001). As such, complementation experiments were performed
using this nptII promoter to drive expression of the mentioned genes.
Correct orientation of all fragments was checked by PCR and
restriction analysis. S. Typhimurium SL1344 mutants were con-
structed using the one-step chromosomal inactivation protocol, as
previously described by Datsenko and Wanner (Datsenko and
Table 1
Bacterial strains and plasmids.
Name Description Reference
Strains
E. coli DH5 F

endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG

80dlacZM15 (lacZYA-argF)U169, hsdR17(r
K

m
K
+
),

Gibco BRL
E. coli TOP10F F {lacIq Tn10(TetR)} mcrA (mrr-hsdRMS-mcrBC)
80lacZM15 lacX74 deoR recA1 araD139 (ara-leu)7697 galU
galK rpsL (StrR) endA1 nupG
Invitrogen
S. Typhimurium SL1344 Parent strain, xyl hisG rpsL; virulent; Sm
R
(Hoiseth and Stocker, 1981)
CMPG 5521 S. Typhimurium SL1344, potF::Cm This work
CMPG 5522 S. Typhimurium SL1344, potF This work
CMPG 5537 S. Typhimurium SL1344, STM1851 This work
CMPG5579 S. Typhimurium SL1344, csgD This work
CMPG5584 S. Typhimurium SL1344, sitA::Cm This work
CMPG5589 S. Typhimurium SL1344, cpxP This work
CMPG10301 S. Typhimurium SL1344, sanA This work
CMPG10305 S. Typhimurium SL1344, fhuA::Cm This work
CMPG10309 S. Typhimurium SL1344, csgB This work
Plasmids
pCMPG5521 csgD promoter cloned BamHI in pFPV25 This work
pCMPG5522 potF cloned EcoRI in pFAJ1708 This work
pCMPG5531 potF cloned XbaI/BamHI in pFAJ1708 This work
pCMPG5532 potF promoter cloned XbaI/BamHI in pFPV25 This work
pCMPG5533 STM1851 promoter cloned XbaI/BamHI in pFPV25 This work
pCMPG5538 sitABCD cloned XbaI/BamHI in pFAJ1708 This work
pCMPG5539 csgB promoter cloned BamHI in pFPV25 This work
pCP20 p, ts-rep-[ciI857]() ts, Ap
R
, Cm
R
(Datsenko and Wanner, 2000)
pFPV25 Promoter-trap vector constructed by inserting an EcoRI-HindIII fragment containing a
promoterless gfpmut3 (Cormack, et al., 1996) into plasmid pED350 (colE1, bla, mob)
(Derbyshire and Willetts, 1987); Ap
R
(Valdivia and Falkow, 1996)
pFPV25.1 0.6 kb Sau3AI fragment inserted in the BamHI site of pFPV25, containing the promoter region
of S. Typhimurium rpsM encoding for the ribosomal protein S13 (constitutive promoter); Ap
R
(Valdivia and Falkow, 1996)
pKD3 Plasmid used as template for construction of Salmonella mutants; Ap
R
, Cm
R
(Datsenko and Wanner, 2000)
pKD46 Lambda Red helper plasmid, Ap
R
(Datsenko and Wanner, 2000)
pFAJ1708 Derivative of RK-2; Ap
R
; Tc
R
; contains nptII promoter of pUC18-2 (Dombrecht et al., 2001)
468 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
Wanner, 2000) starting from plasmid pKD4 and using plasmids
pKD46 and pCP20. These mutants were created by specically
deleting the entire coding sequences of the respective genes. To
minimize polar effects the antibiotic resistance cassettes were
removed using the pCP20 helper plasmid encoding an FLP recombi-
nase. Operon disruptions were obtained without removing the
antibiotic resistance cassettes, containing a transcription termination
signal, from the rst gene of the respective operons. All strains and
constructs were veried by PCR and sequencing analysis.
2.2. Biolm assays
Two different biolm assays were used: biolms were formed
using the peg system and at the bottom of petri dishes. Biolm peg-
assay experiments were performed as previously described by De
Keersmaecker, et al. (2005). Briey, the device used for biolm
formation is a platform carrying 96 polystyrene pegs (Nunc no.
445497) that ts as a microtiter plate lid with a peg hanging into each
microtiter plate well (Nunc no. 269787). For biolm formation, an
overnight culture of S. Typhimurium wild-type or mutant was diluted
1:100 into TSB 1/20 broth, and 200 l (approximately 10
7
cells/ml)
was added to each well of the microtiter plate. The pegged lid was
placed onto the microtiter plate and the plate was incubated for 48 h
at 16 C or 25 C without shaking. The biolms developed on the
surface of the pegs, and after 24 h the lid was transferred into a new
plate with a fresh medium. The optical density at 595 nm(OD
595
) was
measured for the planktonic cells in the rst plate using a Synergy MX
microtiter plate reader (Biotek Instruments, Inc) to get an idea of the
growth characteristics of the tested strains/mutants. For quantica-
tion of the amount of biolm formed, the pegs were washed once in
200 l phosphate buffered saline solution (PBS). The remaining
attached bacteria were stained for 30 min with 200 l crystal violet
staining solution (0.1% (wt/vol) in an isopropanolmethanolPBS
solution (1:1:18 [vol/vol])). Excess stain was rinsed off by placing the
pegs in a 96-well plate lled with 200 l distilled water per well. After
the pegs were air dried (30 min), the dye bound to the adherent cells
was extracted with 30% glacial acetic acid (200 l). The OD
570
of each
well was measured using the Synergy MX microtiter plate reader and
the results are an indirect measure for the biolm forming capacity of
the tested strains/mutants.
Biolm formation on the bottom of small polystyrene petri dishes
(60 mmdiameter, Greiner Bio-One) was performedbyadding10 ml of a
1:100 dilution of the particular S. Typhimurium strain into TSB 1/20
broth, with addition of Ap when appropriate. After 48 h stationary
incubation at 25 C, the bacteria formed a biolm layer at the bottom.
This layer was scraped off, passed through a 25 gauge syringe and
vortexed to break up bacterial clumps when used in the DFI workow
because cell aggregates could cause false results (Rieseberg et al., 2001).
Table 2
Primers used in this study.
Primer Sequence (from 5 to 3) Purpose
a
PRO 4 GTGCCACCTGACGTCTAAGAAACC FW, sequencing pFPV25
PRO 0406 CATATGTATATCTCCTTCTTAAATCTAG RV, sequencing pFPV25
PRO0404 GGAGGATCCAGATCATAATTTGTCG FW, amplication csgD and csgB promoter region
PRO0560 GGAGGATCCAGCTTCTTATCCGCTTCCATCATATCC RV, amplication csgD and csgB promoter region
PRO 0703 TCCCTTCCGATAATCAGGCAGTCG FW, amplication of potF
PRO 0704 CAAACGGTGGAATGCCCGATAGC RV, amplication of potF
PRO 0752 CATGTTTTAAACCACGCCTAATGGGTTCATTTGTTAACGGATTTCAGAAGGAAAGCGATGGTGTAGGCTGGAGCTGCTTC FW, D&W construction CMPG5521 and 5522
PRO 0753 AACGATACAAACGGTGGAATGCCCGATAGCGCACGCTTATCAGGCCATACCGTTAATAAACATATGAATATCCTCCTTA RV, D&W construction CMPG5521 and 5522
PRO 0987 AGGGGATCAAGATCTGATCAAGAGACAGG FW, sequencing pFAJ1708
PRO 0988 ATCGGGGGATCAAGCCCGCCTAATGAGCG RV, sequencing pFAJ1708
PRO 1382 TGGACGGCTAAACTGGTCGTACCACAATTAGCGTATTAACGGAGAGCACGGTGTAGGCTGGAGCTGCTTC FW, D&W construction CMPG5537
PRO 1383 ATGAGAAAAGGAAGAATAAATAACCCGCCTGGCGACGGGTTCTTTTTGAGCATATGAATATCCTCCTTA RV, D&W construction CMPG5537
PRO 1814 TGAAAAGGTATGCACATTTCAGGCATGTTTTAA FW, amplication of potFGHI
PRO 1815 AAGCTTAATGATGCCGCGACCCGCGCGGCAACGCAT RV, amplication of potFGHI
PRO1900 CGCATTGGCGCTTTTGA FW, qRT-PCR STM1851
PRO1901 GCTCCCCCGGCGATT RV, qRT-PCR STM1851
PRO2356 GCAAAGGCTATATTCGATGATTAATTAACCACATTGTTGCGAGGGATACTGTGTAGGCTGGAGCTGCTTC FW, D&W construction CMPG5584 and 5588
PRO2357 ACCGTTGCGATACGTCACCGTGACTTGATCAACGGTAATCGCAGATTGACTCATATGAATATCCTCCTTA RV, D&W construction CMPG5584 and 5588
PRO2358 GTAAACTGTCTCTCGTTGAATCGCGACAGAAAAGATTTTGGGAGCAAGCGGTGTAGGCTGGAGCTGCTTC FW, D&W construction CMPG5589
PRO2359 TCATGTGGGGGAAGACAGGGATGGTGTCTATGGCAAGGAAAACAGGGTTGTCATATGAATATCCTCCTTA RV, D&W construction CMPG5589
PRO2361 AGCAAAGGCTATATTCGATGATTAA FW, amplication of sitABCD
PRO2794 AGGAAATCCTTCCAGCGCCATAAGACTACTCTATATTATGA RV, amplication of sitABCD
PRO 2365 ACGCGGAAGAAGACGCGCAAAAAAC FW, amplication potF promoter region
PRO 2366 CCATCAGAGCACCCGCAACCAGACC RV, amplication potF promoter region
PRO 2367 ACCCGCGTGAACTGGTACGTGATGG FW, amplication STM1851 promoter region
PRO 2368 TCGGCATCGTCGATTTCAAAAGCGC RV, amplication STM1851 promoter region
PRO2622 TCGGGTACAGTAGCCTGATCGTACTTTCATCCTGGTATCGAGTTTCCTGCGTGTAGGCTGGAGCTGCTTC FW, D&W construction CMPG10301
PRO2623 CGGGAGTAGCAGAAAGGCTAATATGACAAATATCGTCTGTACATCCATGATCATATGAATATCCTCCTTA RV, D&W construction CMPG10301
PRO2624 AATAATAATTATCGTTTACGTTATCATTCACTTTCATCAGAGATATACCAGTGTAGGCTGGAGCTGCTTC FW, D&W construction CMPG10305 and 10306
PRO2625 CGGGCACGGCAAGCCGTGCCCAAAAAGAAATTAGAAACGGAAGGTTGCCGTCATATGAATATCCTCCTTA RV, D&W construction CMPG10305 and 10306
PRO3366 ACGCTACTGAAGACCAGGAACAC FW, qRT-PCR csgD
PRO3367 GCATTCGCCACGCAGAATA RV, qRT-PCR csgD
PRO3380 GTCAGCACGTTCCGGTATTTG FW, qRT-PCR rpsS
PRO3381 GCGAATTCACCCAGTTTGTGA RV, qRT-PCR rpsS
PRO3890 CGGCTGACGCCAAAAATAA FW, qRT-PCR potF
PRO3891 TCAGGGCGCAGCAGATAAT RV, qRT-PCR potF
PRO4349 TCGACCAGGCAGGGAATTATA FW, qRT-PCR csgB
PRO4350 CTGGCATCGTTGGCATTG RV, qRT-PCR csgB
PRO4353 CGACGCTCCATACGACCAAT FW, qRT-PCR gyrB
PRO4354 CGGCGAAGCGTTAGAAAAAC RV, qRT-PCR gyrB
PRO4355 CCGACCGAACTGTTTGATGA FW, qRT-PCR purA
PRO4356 CATATTCGTTACCCTGCTTGCA RV, qRT-PCR purA
a
FW: forward primer; RV: reverse primer, D&W: Datsenko and Wanner protocol (Datsenko and Wanner, 2000).
469 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
2.3. S. Typhimurium SL1344 promoter-probe library construction
As previously reported by Valdivia and Falkow (1996), S.
Typhimurium SL1344 genomic DNA was partially digested with
Sau3AI and size-fractionated by agarose gel electrophoresis. DNA
fragments of 0.41.6 kb were recovered and inserted into the BamHI
site upstream of the promoterless gfpmut3 gene in pFPV25. gfpmut3
encodes a highly stable GFP variant (up to 24 h (Cormack et al.,
1996)). The plasmid library was electroporated into S. Typhimurium
SL1344, resulting in a pooled library of around 20,500 clones,
subdivided into random pools of approximately 500 clones each.
2.4. Flow-cytometric analysis
Bacterial cell suspensions were analyzed using a FACSCalibur
(Becton Dickinson). Instrument settings were empirically optimized
to our needs, whereby bacteria harboring pFPV25 and pFPV25.1 were
used as negative and positive control, respectively. Fluorescence, side
and forward scatter data were collected for 10
4
cells using logarithmic
ampliers. Bacteria were distinguished from other particles (cell
fragments and culture debris) by applying forward scatter (FSC) as
primary threshold (value 254) and uorescence (FL1) as secondary
threshold. Prior to each analysis, the light scatter and uorescence
parameters were calibrated with CaliBRITE 3 (Becton Dickinson),
according to the manufacturer's recommendations.
2.5. DFI enrichment of biolm-specic promoters
To identify biolm-induced S. Typhimurium SL1344 promoters,
constructed library pools (approximately 500 clones per sorting
round) were cultured overnight and subjected to biolm-inducing
growth conditions using small polystyrene petri dishes at 25 C. After
48 h of induction, the culture was analyzed by uorescence-activated
cell sorting (FACS) and the bacterial population that exhibited
uorescence intensity exceeding that of an identically treated
SL1344/pFPV25 (negative control) culture was sorted (at single cell
mode (Bumann, 2002)), by gating the corresponding population at
the computer terminal. 10
4
clones were sorted onto a 0.22 m
membrane lter (Millipore) and grown overnight in fresh LB broth,
supplemented with Ap and Sm. This rst-passage sublibrary was
1:100 diluted in 5 ml TSB 1/20 medium, supplemented with Ap. After
overnight growth (TSB 1/20, 25 C, aeration), planktonic, non-
uorescent bacteria were sorted (10
4
clones) and grown as described
above. This non-uorescent subpopulation was again subjected to
biolm-inducing conditions and uorescent bacteria were collected
as described above. This protocol was repeated until a total of 5 sorts
was obtained (3 positive and 2 negative). After the last positive sort,
the enriched pool was cultured overnight and plated out on LB agar
plates with Ap and Sm to obtain single colonies. These single colonies
were transferred to 96-well plates, cultured overnight and individu-
ally proled as further described.
2.6. Individual proling and sequence determination of potentially
biolm-inuenced promoter fusions
Biolms of the picked clones were formed using the peg-system at
25 C and uorescence induction was assessed using FACS analysis,
after sonicating the pegs in 200 l FACSFlow Sheath Fluid (Becton
Dickinson) for 20 min. Fluorescence proles were also obtained for
the 96 clones grown under planktonic conditions (TSB 1/20 broth,
25 C, aeration) after similar sonication. Graphical overlays were
made of biolm-inducing versus planktonic conditions to determine
the uorescence distribution of the clones. The instrument settings as
applied in the sorting steps were maintained. Quantitative measure-
ments and overlays were made with the CELLQuest Pro software
program (version 4.0.2.; Becton Dickinson). Subsequently, the DNA
sequences of interesting promoter-trap library clones (i.e., the ones
that gave differential expression) were determined under BigDye
terminator cycling conditions (Applied Biosystems) using primers
PRO-4 and PRO-0406, on a 3730xl DNA analyzer (Applied Biosys-
tems). Sequencing reactions were performed by Macrogen (Korea).
These sequences were compared with the available, complete genome
sequence of S. Typhimurium LT2 (McClelland et al., 2001), showing
high similarity with the S. Typhimurium SL1344 sequence, by using
the BLASTn algorithm (Altschul et al., 1990).
2.7. Investigation of bacterial growth
Growth curves of wild-type and mutant strains were recorded
using a Bioscreen C system (Oy Growth Curves Ab Ltd). Overnight
cultures of the strains were 1:1000 diluted into LB and TSB 1/20 broth
into three separate wells of a 100 well honeycomb plate (three
biological repeats) and grown at 25 C for 48 h. The experiment was
performed under continuous shaking conditions and the optical
density (OD
595
), reecting the bacterial growth, was measured every
15 min.
2.8. qRT-PCR analysis
For RNA isolation, the strains were grown in planktonic conditions
for 24 h in TSB 1/20 with aeration. Approximately 5 x 10
8
cells/ml
were added to a 1/5 volume ice-cold phenol:ethanol mixture (5:95)
and transferred to a microcentrifuge tube which was immediately
frozen in liquid nitrogen and stored at 80 C. For RNA isolation of
biolm cells, bacteria were grown in biolms at the bottom of petri
dishes for 24 h as described above. After the medium was removed,
cells fromthe biolmwere scraped fromthe plate in a mixture of 1 ml
TSB 1/20 and 200 l ice-cold phenol:ethanol (5:95), transferred to a
microcentrifuge tube, quick-frozen in liquid nitrogen and stored at
80 C.
Total RNA was isolated from the cells using the RNeasy Mini Kit
(Qiagen), according to the manufacturer's instructions, and subsequent
DNase treatment was performed using the TURBO DNA-free Kit
(Ambion) according to the manufacturer's instructions. DNA contam-
ination of the RNA samples was checked by PCR. 100 ng of Dnase-
treated RNA was reverse transcribed using the RevertAid H Minus First
strand cDNA Synthesis Kit (Fermentas), according to manufacturer's
recommendations. After dilution of cDNA, 5 l of cDNA (2 ng/l), 0.9 l
of each specic primer (20 M) and 3.2 l of RT-qPCR grade water
(Ambion) were mixed with 10 l of Power SYBR Green PCR Master Mix
(Applied Biosystems) and qRT-PCR reactions were performed on a
StepOne-Plus System (Applied Biosystems). In order to conrm that
there was no background contamination, a negative control was
included in each run. For each target gene, PCR efciency was
determined. Melt curve analysis was performed to ensure that a single
gene product was amplied. RT-PCR primers, listed in Table 2, were
designed using Primer Express 3.0 (Applied Biosystems) and purchased
from Integrated DNA Technologies, Inc (Leuven, Belgium). gyrB, purA
and rpsS showed an almost invariant expression between the tested
conditions and were used as endogeneous controls to normalize the
target gene's expression. Each reaction was at least performed in
triplicate and data were analyzed using the StepOne(version 2.1) and
DataAssist(version 2.0) software from Applied Biosystems.
3. Results
3.1. CsgD is important in S. Typhimurium SL1344 biolm formation
In order to validate the DFI technique for its use under biolm
conditions, we needed a control gene which is known to be involved
in Salmonella biolm formation and which could be used in a spiking
experiment (Section 3.2.). As already shown in the enterobacteria
470 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
E. coli (Prigent-Combaret et al., 2001) and S. TyphimuriumATCC14028
(Romling, 2005), a csgD mutant is impaired in multicellular
behaviour. CsgD can be seen as a master regulator that triggers a
whole cascade of gene expressions related to biolm formation
(Grantcharova et al., 2010; Romling, 2005; Romling, et al., 1998). We
rst investigated whether csgD is also involved in S. Typhimurium
SL1344 biolm formation. SL1344 is the routinely used Salmonella
strain in our laboratory. This strain has not yet been investigated
extensively for its biolmformation capacity, although there are some
specic differences considering biolm formation between this
S. Typhimurium strain and the S. Typhimurium ATCC14028 strain
(Garcia et al., 2004). We constructed a SL1344 csgD mutant
(CMPG5579) and tested its biolm forming capacity. Site-specic
deletion of csgD resulted in an 8090% reduction of biolm formation
capacity. To test the expression of csgD in SL1344 under biolm
conditions using the DFI technique, the entire promoter region of csgD
(i.e., total intergenic region between csgB and csgD (Gerstel et al., 2003;
Gerstel and Romling, 2003)) was cloned in front of the promoterless
gfpmut3 to yield pCMPG5521. S. Typhimurium SL1344 harboring this
plasmid showed uorescence upregulation under biolm-inducing
Fig. 1. Flow-cytometric analysis of the biolm induction of selected clones and constructs. Histograms (counts vs. uorescence (FL1-H)) showing visual overlays of planktonic FACS
proles (grey shaded) with biolm-induced FACS proles (black lines). The curves represent populations of 10
4
cells. (A) SL1344 containing pCMPG5521 (csgD promoter), (B) Clone
02_10 (potF promoter), (C) Clone 22.5_47 (STM1851 promoter), (D) Skewed prole of clone 00.5_42 (sequence in kefC), (E) Skewed prole of clone 1717.5_3 (region in
STM4012 and STM4013), (F) SL1344 containing pCMPG5532 (potF promoter), (G) SL1344 containing pCMPG5533 (STM1851 promoter), and (H) SL1344 containing pCMPG5539
(csgB promoter).
471 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
conditions (Fig. 1A). Hence, the SL1344 csgDpromoter can be seen as an
example of a SL1344 biolm-induced promoter. The prole of csgD
expression illustrates what a FACS prole of a clear biolm-induced
gene looks like: csgD is already to some extent expressed in planktonic
conditions (as compared to the negative control), but there is a drastic
upregulationof GFPmut3expressionunder control of the csgDpromoter
in biolm-inducing conditions.
3.2. Proof of concept: an optimized DFI workow is able to identify
S. Typhimurium SL1344 biolm upregulated genes
The DFI technique was applied to performa genome-wide screening
to identify S. Typhimurium SL1344 promoters specically induced
under biolm conditions by using the SL1344 promoter-trap library, as
specied in Materials and methods. To prove that this strategy indeed
succeeded in isolating Salmonella biolm-induced promoters, we rst
performed a spiking experiment with the promoter fusion construct of
csgD (pCMPG5521), a gene shown to be important in S. Typhimurium
SL1344 biolm formation (Section 3.1.).
SL1344 containing pCMPG5521 was spiked into a random library
pool of the promoter trap library. This pool was grown under biolm
conditions and the most uorescent bacteria of the pool's total
population (0.3 to 5%) were isolated by cell sorting. This sorted
sublibrary was expected to contain specically biolm-induced
promoters as well as constitutive promoter fusions. Most of the
constitutive promoters were discarded by FACS after a planktonic,
negative selection round, where the least uorescent bacteria in this
sublibrary, represented by approximately the lowest 10% of the total
uorescent population, were collected and cultured. In the next
biolm-inducing, positive sort, the pool of biolm-induced promoter
fusions was enriched. Again, the most uorescent bacteria were
sorted. Subsequent negative and positive sorts allowed further
enrichment, as shown in Fig. 2A. This enrichment was further
conrmed using DNA restriction analysis. Plasmid DNA isolated
before the rst and after the last sort was digested with appropriate
enzymes to cut out the DNA inserts. As the sorting progressed, the
complexity of DNA inserts drastically decreases, as visualized on
agarose gel (Fig. 2B). Valdivia and Falkow previously showed that
DNA inserts with a stimulus-dependent promoter activity repre-
sented a third to half of the total population of DNA inserts present in
the DFI-enriched pools (Valdivia and Falkow, 1996). The remaining
stimulus-independent uorescent clones probably represented con-
stitutive promoter fusions that could not be separated from stimulus-
inducible fusions with the FACS collection parameters used. These
promoters, however, were discarded through downstream analysis.
Indeed, after the nal enrichment round, single colonies were
collected and individually proled for their biolm-inducible GFP
expression. To this end, each isolated colony was grown under
planktonic and biolm conditions, after which the corresponding GFP
expression proles were compared. According to these proles (48
individually proled clones out of an initial pool of 500), there was a
good degree of prole-reciprocity, meaning that most proles were
retrieved more than once after the enrichment (data not shown). This
shows that the chosen number of proled clones for each enriched
pool was a good coverage estimation to get a clear view of the clones
in the enriched sublibrary. Of clones containing promoter fusions
showing differential expression between both conditions, plasmid
DNA was isolated and the determined sequences of the corresponding
inserted DNA fragments were analyzed with the BLASTn algorithm
(Altschul et al., 1990). We were able to isolate the specic csgD FACS
prole (Fig. 1A), as well as its sequence out of this spiked pool. This
illustrates that the optimized DFI workow was well designed to
identify biolm-induced genes in subsequent experiments.
3.3. Isolation of biolm-induced promoters by DFI
All random pools of the SL1344 promoter-probe library were
grown under biolm-inducing conditions and subjected to the
optimized DFI parameters to identify specic biolm upregulated
promoter fragments, as elaborated in Section 3.2. Subsequent
analysis, as outlined in Materials and methods Section 2.6., resulted
in a set of biolm upregulated promoters (and their corresponding
genes) (Table 3). Inductions of uorescence under biolm conditions
ranged from1.3 to 13.1, with one clone (1414.5_43) showing no real
induction of uorescence as measured by dividing the mean
uorescence value of the respective clone under biolm-induced
conditions by its corresponding value under planktonic conditions.
This clone, however, showed a biolm prole with a sharper peak in
the uorescence-count histogram with just a little variation around
the mean, while under planktonic conditions there was a more
attened peak with more variation accounting for a lower than one
value in Table 3. Similar phenomena have been encountered in other
studies using DFI as well (Barker et al., 1998; Marra et al., 2002).
Additionally, some proles did not show a fold-induction of GFPmut3
expression in the main population. However, under biolm-inducing
conditions, only part of the population had an increased GFPmut3
Fig. 2. Visualization of the DFI enrichment. (A). FACS prole (counts vs. uorescence intensity (FL-1 H)) of the enrichment of biolm-induced clones by DFI: a, rst biolm-inducing
sort (grey line); b, third biolm-inducing sort (black line); c, negative control (SL1344/pFPV25, promoterless gfpmut3) (dotted line); and d, positive control (SL1344/pFPV25.1,
constitutive promoter upstream of gfpmut3) (grey line). (B). DNA-agarose gel showing the DFI enrichment towards biolm-induced promoters as the screening progressed: lane 1,
Smartladder (Eurogentec) with 400 bp and 1600 bp indications; lane 2, EcoRI/XbaI digest of pool 0.51, prior to enrichment; lane 3, EcoRI/XbaI digest of pool 0.51, after the total
enrichment process (3 positive alternated by 2 negative sortings); lanes 4 and 5, same as lanes 2 and 4, respectively, but for the pool 1.52. The band around 4800 bp represents the
EcoRI/XbaI digested form of the pFPV25 plasmid. The arrows clearly indicate the enriched, biolm upregulated fragments.
472 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
expression and exhibited a skewed expression prole (tail) (Fig. 1DE).
This could point to a certain degree of bistable expression of the
corresponding genes under these conditions.
Of all 26 retrieved clones, 17 coincided with promoter regions of
annotated genes (McClelland et al., 2001), whereas 9 mapped to
regions with putative unknown regulatory elements in intergenic
regions as well as inside annotated genes (Table 3). Five of the 17
clones with fragments mapping into promoter regions of already
annotated genes, corresponded to promoters of putative genes with
unknown functions (STM0275, STM1255, STM1851, STM3071 and
STM4423), 2 to hypothetical proteins (ybeL (STM0653), sanA
(STM2184)) and 10 to well-annotated genes being fhuA (STM0191),
fes (STM0586), potF (STM0877), csgB (STM1143), narK (STM1765),
iroN (STM2777), nrdH (STM2805), sitA (STM2861), nirB (STM3474)
and cpxP (STM4060). According to the fully annotated genome
(McClelland et al., 2001), these genes are involved in the following
processes: polyamine transport (potF), iron (sitA) and siderophore
transport (iroN, fhuA), nitrogen metabolism (narK, nirB), curli
biosynthesis (csgB), oxidative stress responses (nrdH), enterochelin
biosynthesis processes (fes) and the Cpx envelope stress response
pathway (cpxP).
3.4. Conrmation of DFI screen results
Because the results of our screen are based on a randomly
constructed DNA library, we subsequently decided to make dened
promoter fusions of some of the obtained results. The rationale behind
this is that, although sequence analysis pointed at the fragments listed
in Table 3 as being responsible for driving GFPmut3 expression, it
cannot be excluded that the uorescence expression could be the
result of unwanted DNA scrambling occurring during the promoter-
probe library construction. In addition to csgD conrmation (Section
3.1., Fig. 1A), three other genes were chosen for these initial
conrmation studies: csgB, as already being documented to be
important in Salmonella biolms (Barnhart and Chapman, 2006;
Romling, 2005); potF, as a link between polyamine metabolism and
biolm formation has been shown in related organisms (Shah and
Swiatlo, 2008) and STM1851, as not yet been functionally identied.
In clone 02_10 (Fig. 1B), GFPmut3 expression is driven by a DNA
fragment containing the potF promoter (Table 3). PotF is the
periplasmic binding protein of an ABC transporter encoded by the
potFGHI operon, responsible for the uptake of the polyamine
putrescine (Igarashi and Kashiwagi, 1999; Pistocchi et al., 1993).
Table 3
S. Typhimurium promoters showing upregulation in biolm conditions.
Clone
a
Sequence reading into gfpmut3
b
Function
c
Prole
d
00.5_41 sequence in kefC KefC (STM0086): glutathione-regulated potassium-efux
system protein
skewed biolm expression
4.55_48 fhuA promoter FhuA (STM0191): outer membrane protein
receptor/transporter for ferrichrome, colicin M,
and phages T1, T5, and 80
2.1-fold induction
1216_44 STM0275 promoter STM0275: putative cytoplasmic protein 2.5-fold induction
44.5_45 fes promoter Fes (STM0586): enterobactin/ferric enterobactin
esterase
1.4-fold induction
11.5_47 ybeL promoter YbeL (STM0653): hypothetical protein 1.4-fold induction
02_10 potF promoter PotF (STM0877): putrescine transporter subunit,
periplasmic-binding component of ABC superfamily
1.4-fold induction
812_4 csgB promoter CsgB (STM1143): curlin minor subunit 13.1-fold fold induction
1216_11 STM1255 promoter STM1255: putative ABC transporter periplasmic binding protein 2.8-fold induction
0.51_3 intergenic sequence between STM1606
and STM1607 in orientation of STM1607
STM1606: putative benzoate membrane transport protein,
STM1607: putative outer membrane lipoprotein
skewed biolm expression
1414.5_43 sequence in sohB SohB (STM1716): putative periplasmic protease b1-fold induction
6.57_42 intergenic sequence between tdk and hns
in orientation of tdk
H-NS (STM1751): global DNA-binding transcriptional
dual regulator H-NS, Tdk (STM1750): thymidine kinase
1.7-fold induction
04_36 narK promoter NarK (STM1765): nitrite extrusion protein 2.8-fold induction
15.516_27 intergenic sequence between
STM1839 and yobF in orientation of yobF
YobF(STM1838): putative cytoplasmic protein, STM1839:
hypothetical protein
2.7-fold induction
22.5_47 STM1851 promoter STM1851: putative cytoplasmic protein 7.9-fold induction
5.56_48 intergenic sequence between phsA
and sopA in orientation of sopA
PhsA (STM2065): thiosulfate reductase precursor,
SopA (STM2066): secreted effector protein
skewed biolm expression
1.52_47 sanA promoter SanA (STM2184): hypothetical protein (similar to E. coli
vancomycin sensitivity gene)
skewed biolm expression
15.516 _9 sequence in STM2532 STM2532: putative inner membrane lipoprotein 3.5-fold induction with skewed
biolm expression
33.5_45 iroN promoter IroN (STM2777): TonB-dependent siderophore receptor protein skewed biolm expression
04_3 nrdH promoter NrdH (STM2805): glutaredoxin-like protein 1.6-fold induction
00.5 _47 sitA promoter SitA (STM2861): Fur regulated Salmonella iron transporter 6.1-fold induction
48_6 STM3071 promoter STM3071: putative DNA-binding protein 3.3-fold induction
48_18 nirB promoter NirB (STM3474): nitrite reductase large subunit 2.7-fold induction
2020.5_47 cpxP promoter CpxP (STM4060): periplasmic repressor skewed biolm expression
1717.5_3 sequence in STM4012 and 4013 in
orientation of STM4013
STM4012: putative coproporphyrinogen III oxidase and related FeS
oxidoreductase, STM4013: putative membrane-associated
metal-dependent hydrolase
skewed biolm expression
0.51_26 sequence in yjdB YjdB (STM4293): putative cell division protein (hypothetical
61.6 kDa protein in basS/pmrA-adiY intergenic region)
skewed biolm expression
1515.5_45 STM4423 promoter STM4423: putative DNA-binding protein 1.3-fold induction
a
Numbers refer to the position of the respective clone in microplates as retrieved during the experimental workow.
b
Intergenic region refers to the intergenic region in between the relevant genes in the fully annotated S. Typhiumurium LT2 genome.
c
The function of the genes was derived from GenBank (Benson et al., 2002).
d
Skewed biolm expression reects the situation in which a part of the clonal population showed an upregulated GFPmut3 expression under biolm conditions as compared to
planktonic conditions, often observed as a slight upregulation in the right tail of the histogram (counts vs. FL1-H) under biolm conditions. Fold induction represents the mean
uorescence value of biolm-induced bacteria divided by the mean uorescence value of the same clone under planktonic conditions. Values below 1 and values just exceeding 1
represent proles of which the biolm-induced form is not really shifted to a more uorescent value, but of which a higher number of cells expresses the same uorescence level as
compared to the planktonic form.
473 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
Polyamines have been shown to have pleiotropic roles in bacterial
pathogens, as reviewed by Shah and Swiatlo (2008), with direct
and indirect effects on biolm formation in for example Vibrio
cholerae (Karatan et al., 2005), Yersinia pestis (Patel et al., 2006) and
Pseudomonas putida (Sauer and Camper, 2001). Plasmid pCMPG5532,
containing the potF promoter region in front of the gfpmut3 of
pFPV25, was constructed. The expression proles clearly showed the
upregulation of the dened potF promoter fusion under biolm-
inducing conditions, thereby conrming our DFI results (Fig. 1F).
Clone 22.5_47 showed an approximately 8-fold upregulation of
uorescence in biolm growth conditions (Fig. 1C). The sequence
driving GFPmut3 expression corresponds to the STM1851 promoter
(Table 3). STM1851 encodes a small putative cytoplasmic protein of
79 amino acid residues with 88% sequence identity to the E. coli
hypothetical protein YebV. The plasmid pCMPG5533, carrying the
STM1851 promoter region upstreamof the gfpmut3 of pFPV25, gave a
similar expression pattern as the one from the random clone 2
2.5_47, as can be seen from Fig. 1G, conrming our DFI results and
verifying it is indeed the STM1851 promoter region responsible for
the uorescence expression. Similar phenomena were observed for
clone 812_4 and the dened csgB promoter construct (pCMPG5539).
Indeed, clone 812_4, in which the csgB promoter region drives the
GFPmut3 expression, showed an approximately 13-fold induction of
uorescence under biolm growth conditions (Table 3). CsgB
functions as a nucleator in the assembly of curli (coiled surface
structures) on the cell surface. Plasmid pCMPG5539 (Fig. 1H), carrying
the dened csgB promoter region upstream of the gfpmut3 of pFPV25,
gave similar expression patterns as the ones from the random clone
812_4, conrming the involvement of this gene during biolm
formation.
3.5. qRT-PCR analysis of a selection of DFI-retrieved genes
qRT-PCR was used to investigate whether some selected biolm
upregulated genomic inserts in the DFI screen showed also differential
expression at the RNA level and hence would have been isolated using
traditional transcriptomic approaches. For this analysis, RNA was
isolated from S. Typhimurium SL1344 planktonic and biolm cells
respectively, as described in Materials and methods Section 2.8., and
the results are shown in Fig. 3. Expression levels were checked for the
same loci as in the initial conrmation studies: csgD, csgB, potF and
STM1851. In all cases, except for STM1851, there was a higher level of
expression in the biolm sample as compared to the planktonic
sample (which was chosen as the reference sample). As such, this
analysis shows that the DFI results and the qRT-PCR results in terms of
differential expression are similar for csgD, csgB and potF, but different
for STM1851. This implicates that csgD, csgB and potF by using the
appropriate cut-off value could have been picked up using a
traditional transcriptomic approach. STM1851, on the other hand
would not have been picked up for the selected timepoint. This
illustrates the fact that differences in terms of expression levels for a
given gene not necessarily match in differential screens and hence
that differential screens can be seen as complementary approaches.
3.6. Mutational analysis of DFI identied genes
As this is the rst use of the DFI technique in relation to biolms,
some DFI isolated genes were further chosen for an initial follow-up
mutational study based on diverse criteria. The curli structural subunit
encoded csgB gene was chosen because it has been documented, as
part of the curli operon, to be important in Salmonella biolms
(Barnhart and Chapman, 2006; Romling, 2005). Most of the work on
Salmonella curli, however, was done with strains different from strain
SL1344 used in this study. Recently Hamilton and colleagues also
showed upregulation of this gene in mature SL1344 biolms, but
mutational analysis in SL1344 has not yet been reported (Hamilton,
et al., 2009). The polyamine uptake system encoded potFGHI (Shah
and Swiatlo, 2008) as well as genes involved in iron metabolism (iron
(sitABCD) and siderophore (fhuACDB) transport) (White et al., 2010;
Yang et al., 2007) and the Cpx regulon gene cpxP (Beloin, et al., 2004)
were chosen because these processes have been linked to biolm
formation in related organisms. An additional inclusion criterium for
having selected cpxP is the fact that its promoter showed a skewed
expression prole and not a fold induction prole as is the case for
potFGHI, sitABCD and fhuACDB in the DFI isolation. STM1851 was
chosen because it showed a very high level of upregulation under
biolm growth, as can be seen from Table 3 and Fig. 1C and G, and
because it is a gene without known function so far. sanA, nally, was
chosen because nothing is known about the function of this
hypothetical gene in Salmonella and because it showed a skewed
expression prole.
Firstly, S. Typhimurium SL1344 potF and potFGHI mutants were
constructed to investigate the possible roles of the gene and/or operon
in the biolmprocess (Fig. 4). Deletion of potF in SL1344 (CMPG5522)
background resulted only in a small but reproducible reduction in
Fig. 3. qRT-PCR analysis of a selection of DFI-retrieved genes. The transcription of a
selection of DFI-retrieved genes was examined by qRT-PCR analysis of RNA extracted
from planktonic and biolm cells, as elaborated in Experimental procedures. Values
represent mean fold expression normalized to the endogeneous control genes gyrB,
purA and rpsS. These genes were shown to be expressed at comparable levels between
the tested conditions for S. Typhimurium SL1344. The normalized level of expression of
the genes of interest in the planktonic samples was set at 1 and is shown in grey, the
respective biolm samples are shown in black. Error bars represent the standard
deviation of at least three independent reactions.
Fig. 4. Biolm formation by potF mutants. The level of biolm formation is expressed as a
percentage of wild-type SL1344 biolm formation. The data are representative for three
independent repetitions, and the error bars show standard deviations of at least three
measurements. CMPG5522: potF mutant; pCMPG5522/CMPG5522: complemented
potF mutant; CMPG5521: potF::Cm mutant; pCMPG5531/CMPG5521: complemented
potF::Cm mutant; pCMPG5531/SL1344: SL1344 wild-type strain harboring pCMPG5531.
474 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
biolm formation at 16 C (around 20%), while no signicant
reduction could be noticed at 25 C (data not shown). This reduction
could be complemented by electroporation of pCMPG5522, contain-
ing the potF gene driven by a constitutive promoter. CMPG5521, in
which the whole potFGHI operon is disrupted, showed a further
reduction in biolm formation (up to 40%) (Fig. 4), which could
almost be fully complemented by introducing the complete operon on
a plasmid (pCMPG5531). The same effect was seen for biolm
formation at 25 C (data not shown). For none of these mutants any
signicant effect on planktonic growth was observed (data not
shown), indicating that inactivation of the potFGHI locus affects a
property required for Salmonella to fully develop a biolm. More
importantly, the mutational analysis of the potFGHI locus allowed a
direct phenotypic validation of results obtained with the DFI
screening. To make sure the complementation plasmid backbone,
the RK2 based pFAJ1708, did not itself impact on biolm formation, as
was shown for some IncP plasmids (Ghigo, 2001), we showed in a
control experiment that an SL1344 wild-type strain harboring
pFAJ1708 does not show any signicant changes in biolm formation
capacity.
Secondly, we constructed a disruption mutant (CMPG5584) of the
sitABCD encoding iron transport system, another identied ABC
transporter (Table 3). This mutant showed a 90% reduced biolm
formation capacity, and this could be complemented by introducing
the complete operon on a plasmid (pCMPG5538) (Fig. 5). Thirdly, an
fhuACDB disruption mutant (CMPG10305) also showed a drastic
reduction in biolm growth (Fig. 5). No signicant growth defects
were encountered for these iron metabolism related mutants
(CMPG5584 and CMPG10305) as shown by Bioscreen analysis (data
not shown). Links between iron metabolism and biolm formation
have been documented in other bacteria (e.g. (Banin et al., 2005;
Karatan and Watnick, 2009)), showing that this is an important
environmental factor governing biolmbehaviour in bacteria. Fourth-
ly, deletion of csgB (CMPG10309) showed the anticipated large
reduction (up to 95%) in biolm formation.
Fifthly, deletion of STM1851 (CMPG5537) did not show a clear
reductionin the amount of biolmformed by this mutant as compared
to the wild-type S. Typhimurium SL1344 strain (Fig. 5). However,
because the dened STM1851 promoter plasmid pCMPG5533 showed
a clear upregulationunder biolmgrowthconditions, it is possible that
this gene is not strictly necessary for biolm formation but is being
upregulatedas a consequence of adaptationto the biolmlife style and
growth. Similar effects were obtained for deletions of cpxP
(CMPG5589) and sanA (CMPG10301), as can be seen on Fig. 5.
In summary, we can group the tested DFI genes in three categories:
genes shown to be upregulated under biolm growth in our DFI
screen and of which the corresponding mutants are hindered in
biolm formation in the used biolm test system (potFGHI, sitABCD
and fhuACDB, csgB); genes shown to be upregulated under biolm
growth in our DFI screen but of which the corresponding mutant did
not show a reduction in biolm formation in our test system
(exemplied by mutant STM1851); and genes shown to have a
skewed expression prole under biolmgrowth in our DFI screen that
did not showa reduction in biolmformation in our test system(cpxP
and sanA). As not all the DFI identied genes have been fully tested yet
phenotypically by mutational analysis, it is likely that more categories
of biolm genes will be recognized in the future.
4. Discussion
To our knowledge, this is the rst reported study exploiting the
high-throughput DFI promoter-capture approach (Valdivia and
Falkow, 1996) to isolate a series of promoter constructs upregulated
under bacterial biolm growth conditions. Using this approach we
were able to identify promoters (and their corresponding genes) that
show increased expression under S. Typhimurium biolm conditions.
Because we have been working specically under non-host condi-
tions, we propose the identied genetic elements to be important
during biolm growth in the transmission phase of the pathogen;
more specically, under similar conditions as the ones we applied
through our screen, which are for instance expected to be encoun-
tered in some parts of food processing industries (Leriche and
Carpentier, 2000). Moreover, because of our sampling point (48 h),
the identied genetic determinants are thought to be predominantly
involved in the maturation stage of Salmonella biolm formation. In
contrast to the screening of mutant libraries, DFI does not exclude the
identication of genes that are essential for bacterial survival. Further
on, it allows the identication of promoters that are upregulated
during biolmgrowth and that drive the expression of genes that may
be important for aspects of biolm physiology, but not necessary for
biolm formation (as shown in the Results section).
Although some of the identied genes have already been
documented for mechanisms known to be important in biolm
formation, such as polyamine (potF) (Shah and Swiatlo, 2008) and
iron metabolismassociated genes (sitA, iroN, fhuA and fes) (Yang et al.,
2007), we report here for the rst time their importance in the
particular case of S. Typhimurium SL1344 biolm formation. A recent
metabolomic S. Typhimurium ATCC14028 biolm study, highlighting
the importance of the metabolic responses to extracellular matrix
production, however, identied fhuA as biolm-induced under the
experimental conditions tested using lux promoter fusions (White,
et al., 2010). Further on, only one of the identied genes, csgB, as part
of the curli biosynthesis operon csgDEFG-csgBAC, has already been
conclusively shown to be important during Salmonella biolm growth
(Barnhart and Chapman, 2006; Hamilton et al., 2009; Romling, 2005;
White et al., 2010). Except from csgB, only the hypothetical protein
encoded by ybeL, showing similarities to an E. coli putative alpha
helical protein without known function, was also found as being
upregulated in a recently performed S. Typhimurium SL144 biolm
microarray/proteomics study (Hamilton et al., 2009). It cannot be
excluded that differences in the used biolm formation conditions
between both studies might be responsible for the limited overlap of
identied genes in both studies. However, as the microarray approach
and the here applied single cell DFI approach are intrinsically
different, we favour the idea that such approaches have a clear
added value in identifying genes that are important for a given
process and therefore will help in better understanding of it. Next to
the above mentioned hypothetical gene ybeL, we also found some
Fig. 5. Biolm formation by some mutants in identied genes. The level of biolm
formation is expressed as a percentage of wild-type SL1344 biolm formation. The data
are representative for three independent repetitions, and the error bars show standard
deviations of at least three measurements. CMPG5537: STM1851 mutant; CMPG5584:
sitA::Cm mutant; pCMPG5538/CMPG5584: complemented sitA::Cm mutant;
pCMPG5538/SL1344: SL1344 wild-type strain harboring pCMPG5538; CMPG5589:
cpxP mutant; CMPG10301: sanA mutant; CMPG10305: fhuA::Cm mutant;
CMPG10309: csgB mutant.
475 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
other genes with unknown function (FUNgenes) that are upregulated
during SL1344 biolm growth (STM0275, STM1255, STM1851,
STM3071 and STM4423) and even another hypothetical gene, sanA.
Given the signicant number of FUN genes in the S. Typhimurium
genome, and the increasing number of biolm related functional
genomics studies, it is to be expected that previously uncharacterized
Salmonella genes will be found to be related to social behaviour
processes, as also recently illustrated by Barak et al. (2009).
Remarkably, STM1255 encodes a putative ABC transporter periplas-
mic binding protein. Together with potF, sitA and fhuA, this makes 4
out of 17 (24%) annotated, DFI-retrieved genes that are involved in
surface and transport properties. Similar importance of diverse
nutrient uptake systems under Salmonella biolm growth has been
notied by White et al. (2010), further elaborating the link between
biolm formation, matrix production and metabolic changes such as
starvation. Therefore, some of our current research is focusing on the
relationship between these transport systems and the homeostasis of
the biolm matrix.
Comprehensive validation of the generated DFI results would
require phenotypic conrmation (mutant analysis, qRT-PCR analysis
and/or microscopic analysis) of all identied genetic loci, but was
beyond the scope of our study. Using dened promoter constructs for
a set of identied promoters we conrmed unambiguously their role
in SL1344 biolmformation, thereby validating our DFI screen (Fig. 1).
qRT-PCR analysis of the same panel of identied promoters further
conrmed these results but also showed the complementarity
between different approaches because STM1851, for example,
would not have been picked up using a traditional transcriptomic
approach (Fig. 3). Initial follow-up mutational analysis of some of the
identied genes substantiated their role in SL1344 biolm growth
(Figs. 4 and 5). Some identied promoters, however, showed an
upregulation under biolm growth conditions, as revealed by the DFI
results (Table 3), but did not show a clear reduction in the amount of
biolm formed in the corresponding mutational analysis. It is likely
that these genes are important for adaptation to the biolm
physiology, rather than for the biolm formation itself.
Apart from the isolated annotated promoters, we also isolated 9
clones of which the genomic inserts are within an annotated gene
and/or of which the predicted transcription of all genetic elements
within this region are in the opposite direction from that of the
reporter gfpmut3 gene. This reects a major advantage of the DFI
strategy to study gene expression. Indeed, it is not biased by prior
knowledge of gene annotation because of the use of a random
promoter-probe library and as such it holds great promise for the
identication of new regulatory elements. Similar observations were
made in a recent RIVET screening study to identify genetic loci of
Enterococcus faecalis involved in this opportunistic pathogen's biolm
formation (Ballering et al., 2009). It is possible that some of these 9
identied clones represent artefacts inherent to the use of promoter-
probe libraries to perform a genome wide screening (Rediers et al.,
2005) or might encode biolm upregulated small non-coding RNAs
(sRNAs) or peptides. However, none of the identied genetic loci were
previously predicted or identied as being sRNAs (Sittka et al., 2008).
Alternatively, these sequences might arise from antisense transcrip-
tion. Recent work by Dornenburg and colleagues showed widespread
transcription of antisense RNAs (approximately 1000 antisense RNAs
on 4000 mRNAs) in E. coli (Dornenburg et al., 2010). Massive
antisense transcription was also found in the -proteobacterium
Heliobacter pylori (Sharma et al., 2010). Moreover, and further
stressing the importance of our results, Koide and co-workers were
recently able to unambiguously show the prevalence of transcrip-
tional promoters within operons and coding sequences, as well as
environmental modulation of operon architectures, using an archaeal
model system (Koide et al., 2009). Because of the relatively large
number of non-annotated, intergenic or in-gene hits found in our
screen, we are currently considering a further, alternative screening
strategy combining DFI enrichment with tiling microarrays. Extracted
biolmenriched (or repressed) sublibrary pools directly hybridized to
S. Typhimuriumtiling arrays (Santiviago et al., 2009) should be able to
give a better understanding and delineation of the exact genomic
regions driving GFP expression under the used environmental
conditions. Furthermore, and in line with the ndings by Koide et
al. (Koide et al., 2009), we are presently constructing GFP transcrip-
tional fusions with some of the here identied in-gene sequences to
check their corresponding transcriptional activity. This could not only
lead to a better understanding of our results, but also could improve
the S. Typhimurium gene annotation.
Our DFI screening did, except for the earlier mentioned csgB (and
to a lesser extent fhuA), not sort out well-known genes implicated in
Salmonella biolm formation, such as the genes involved in curli,
cellulose and LPS production or genes required for motility (Gerstel
and Romling, 2003; Kim and Wei, 2009; Lapidot and Yaron, 2009;
Prouty and Gunn, 2003; Prouty et al., 2002; Solano et al., 2002). One
can think of different reasons to explain this discrepancy. An obvious
explanation for this could be the fact that these genes are also
expressed to a certain basal threshold level in planktonic conditions
and therefore were not enriched during the subsequent selection
rounds. The differences of Salmonella strains used and applied biolm
formation conditions in the different studies could also explain the
different outputs. It has been shown that strain background as well as
biolm formation conditions have a large impact on the importance
and consequently the expression patterns of the genes involved
(Garcia et al., 2004; Prouty and Gunn, 2003; Solano et al., 2002). In
general, it is important to state that no single technique is able to
identify all factors important for a given process (Mahan et al., 2000;
Rediers et al., 2005), but rather complementary techniques have to be
used. In this sense, the DFI technique can be added to those already
widely used in biolm research such as high-throughput microarrays
(Beloin et al., 2004; Hamilton et al., 2009; Schembri et al., 2003;
Whiteley et al., 2001), mutagenesis (Prigent-Combaret et al., 1999;
Weiss-Muszkat et al., 2010), proteomics (Hamilton et al., 2009; Sauer
et al., 2002) and metabolomics (Gjersing et al., 2007; White et al.,
2010) to generate a more exhaustive list of biolm determinants.
Acknowledgements
KH is a research assistant of the FWO-Vlaanderen. At the time of
experiments, SDK was a post-doctoral researcher of the FWO-
Vlaanderen. This work was also partially nancially supported by
the Industrial Research Fund of the Katholieke Universiteit Leuven
(KP/06/014) and the Centre of Excellence SymBioSys (Research
Council K.U.Leuven EF/05/007).
We thank Prof. S. Falkow for kindly providing the pFPV25 and
pFPV25.1 plasmids and Prof. C. Detweiler for a skillful training in the
DFI technology.
Appendix A. Supplementary data
Supplementary data to this article can be found online at
doi:10.1016/j.mimet.2011.01.012.
References
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment
search tool. Journal of Molecular Biology 215, 403410.
An, D., Parsek, M.R., 2007. The promise and peril of transcriptional proling in biolm
communities. Current Opinion in Microbiology 10, 292296.
Ballering, K.S., Kristich, C.J., Grindle, S.M., Oromendia, A., Beattie, D.T., Dunny, G.M.,
2009. Functional genomics of Enterococcus faecalis: multiple novel genetic
determinants for biolm formation in the core genome. Journal of Bacteriology
191, 28062814.
Banin, E., Vasil, M.L., Greenberg, E.P., 2005. Iron and Pseudomonas aeruginosa biolm
formation. Proceedings of the National Academy of Sciences of the United States of
America 102, 1107611081.
476 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
Barak, J.D., Liang, A., Narm, K.E., 2008. Differential attachment to and subsequent
contamination of agricultural crops by Salmonella enterica. Applied and Environ-
mental Microbiology 74, 55685570.
Barak, J.D., Gorski, L., Liang, A.S., Narm, K.E., 2009. Previously uncharacterized
Salmonella enterica genes required for swarming play a role in seedling
colonization. Microbiology 155, 37013709.
Barker, L.P., Brooks, D.M., Small, P.L., 1998. The identication of Mycobacterium
marinum genes differentially expressed in macrophage phagosomes using
promoter fusions to green uorescent protein. Molecular Microbiology 29,
11671177.
Barnhart, M.M., Chapman, M.R., 2006. Curli biogenesis and function. Annual Review of
Microbiology 60, 131147.
Beenken, K.E., Dunman, P.M., McAleese, F., Macapagal, D., Murphy, E., Projan, S.J., et al.,
2004. Global gene expression in Staphylococcus aureus biolms. Journal of
Bacteriology 186, 46654684.
Beloin, C., Valle, J., Latour-Lambert, P., Faure, P., Kzreminski, M., Balestrino, D., et al.,
2004. Global impact of mature biolm lifestyle on Escherichia coli K-12 gene
expression. Molecular Microbiology 51, 659674.
Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Rapp, B.A., Wheeler, D.L., 2002.
GenBank. Nucleic acids research 30, 1720.
Boddicker, J.D., Ledeboer, N.A., Jagnow, J., Jones, B.D., Clegg, S., 2002. Differential binding
to and biolm formation on, HEp-2 cells by Salmonella enterica serovar
Typhimurium is dependent upon allelic variation in the mH gene of the m
gene cluster. Molecular Microbiology 45, 12551265.
Brandl, M.T., Mandrell, R.E., 2002. Fitness of Salmonella enterica serovar Thompson in the
cilantro phyllosphere. Applied and Environmental Microbiology 68, 36143621.
Bumann, D., 2002. Examination of Salmonella gene expression in an infected
mammalian host using the green uorescent protein and two-colour ow
cytometry. Molecular Microbiology 43, 12691283.
Cormack, B.P., Valdivia, R.H., Falkow, S., 1996. FACS-optimized mutants of the green
uorescent protein (GFP). Gene 173, 3338.
Costerton, J.W., Lewandowski, Z., Caldwell, D.E., Korber, D.R., Lappin-Scott, H.M., 1995.
Microbial biolms. Annual Review of Microbiology 49, 711745.
Costerton, J.W., Stewart, P.S., Greenberg, E.P., 1999. Bacterial biolms: a common cause
of persistent infections. Science 284, 13181322 (New York, N.Y.).
Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proceedings of the National Academy of
Sciences of the United States of America 97, 66406645.
Davey, M.E., O'Toole, G.A., 2000. Microbial biolms: fromecology to molecular genetics.
Microbiology and Molecular Biology Reviews 64, 847867.
De Keersmaecker, S.C., Varszegi, C., van Boxel, N., Habel, L.W., Metzger, K., Daniels, R., et
al., 2005. Chemical synthesis of (S)-4, 5-dihydroxy-2, 3-pentanedione, a bacterial
signal molecule precursor, and validation of its activity in Salmonella typhimurium.
The Journal of Biological Chemistry 280, 1956319568.
Derbyshire, K.M., Barken, K.B., 1987. Mobilization of the non-conjugative plasmid
RSF1010: a genetic analysis of its origin of transfer. Mol Gen Genet. 206, 154160.
Dombrecht, B., Vanderleyden, J., Michiels, J., 2001. Stable RK2-derived cloning vectors
for the analysis of gene expression and gene function in gram-negative bacteria.
Molecular Plant-Microbe Interactions 14, 426430.
Dornenburg, J.E., DeVita, A.M., Palumbo, M.J., Wade, J.T., 2010. Widespread antisense
transcription in Escherichia coli. mBio 1 (1), e0002400010. doi:10.1128/
mBio.0024-0010.
Fux, C.A., Costerton, J.W., Stewart, P.S., Stoodley, P., 2005. Survival strategies of
infectious biolms. Trends in Microbiology 13, 3440.
Garcia, B., Latasa, C., Solano, C., Garcia-del Portillo, F., Gamazo, C., Lasa, I., 2004. Role of
the GGDEF protein family in Salmonella cellulose biosynthesis and biolm
formation. Molecular Microbiology 54, 264277.
Gerstel, U., Romling, U., 2003. The csgD promoter, a control unit for biolm formation in
Salmonella typhimurium. Research in Microbiology 154, 659667.
Gerstel, U., Park, C., Romling, U., 2003. Complex regulation of csgD promoter activity by
global regulatory proteins. Molecular Microbiology 49, 639654.
Ghigo, J.M., 2001. Natural conjugative plasmids induce bacterial biolm development.
Nature 412, 442445.
Gjersing, E.L., Herberg, J.L., Horn, J., Schaldach, C.M., Maxwell, R.S., 2007. NMR
metabolomics of planktonic and biolm modes of growth in Pseudomonas
aeruginosa. Analytical Chemistry 79, 80378045.
Grantcharova, N., Peters, V., Monteiro, C., Zakikhany, K., Romling, U., 2010. Bistable
expression of CsgD in biolm development of Salmonella enterica serovar
Typhimurium. Journal of Bacteriology 192, 456466.
Hall-Stoodley, L., Costerton, J.W., Stoodley, P., 2004. Bacterial biolms: from the natural
environment to infectious diseases. Nature Reviews 2, 95108.
Hamilton, S., Bongaerts, R.J., Mulholland, F., Cochrane, B., Porter, J., Lucchini, S., et al.,
2009. The transcriptional programme of Salmonella enterica serovar Typhimurium
reveals a key role for tryptophan metabolism in biolms. BMC Genomics 10, 599.
Hoiseth, S.K., Stocker, B.A., 1981. Aromatic-dependent Salmonella typhimurium are non-
virulent and effective as live vaccines. Nature 291, 238239.
Igarashi, K., Kashiwagi, K., 1999. Polyamine transport in bacteria and yeast. The
Biochemical Journal 344 (Pt 3), 633642.
Karatan, E., Watnick, P., 2009. Signals, regulatory networks, and materials that build and
break bacterial biolms. Microbiology and Molecular Biology Reviews 73, 310347.
Karatan, E., Duncan, T.R., Watnick, P.I., 2005. NspS, a predicted polyamine sensor,
mediates activation of Vibrio cholerae biolm formation by norspermidine. Journal
of Bacteriology 187, 74347443.
Kim, S.H., Wei, C.I., 2009. Molecular characterization of biolm formation and
attachment of Salmonella enterica serovar Typhimurium DT104 on food contact
surfaces. Journal of Food Protection 72, 18411847.
Koide, T., Reiss, D.J., Bare, J.C., Pang, W.L., Facciotti, M.T., Schmid, A.K., et al., 2009.
Prevalence of transcription promoters within archaeal operons and coding
sequences. Molecular Systems Biology 5, 285.
Kusumaningrum, H.D., Riboldi, G., Hazeleger, W.C., Beumer, R.R., 2003. Survival of
foodborne pathogens on stainless steel surfaces and cross-contamination to foods.
International Journal of Food Microbiology 85, 227236.
Lapidot, A., Yaron, S., 2009. Transfer of Salmonella enterica serovar Typhimurium from
contaminated irrigation water to parsley is dependent on curli and cellulose, the
biolm matrix components. Journal of Food Protection 72, 618623.
Latasa, C., Roux, A., Toledo-Arana, A., Ghigo, J.M., Gamazo, C., Penades, J.R., et al., 2005.
BapA, a large secreted protein required for biolm formation and host colonization
of Salmonella enterica serovar Enteritidis. Molecular Microbiology 58, 13221339.
Lazazzera, B.A., 2005. Lessons from DNA microarray analysis: the gene expression
prole of biolms. Current Opinion in Microbiology 8, 222227.
Leriche, V., Carpentier, B., 2000. Limitation of adhesion and growth of Listeria
monocytogenes on stainless steel surfaces by Staphylococcus sciuri biolms. Journal
of Applied Microbiology 88, 594605.
Lewis, K., 2008. Multidrug tolerance of biolms and persister cells. Current Topics in
Microbiology and Immunology 322, 107131.
Mahan, M.J., Heithoff, D.M., Sinsheimer, R.L., Low, D.A., 2000. Assessment of bacterial
pathogenesis by analysis of gene expression in the host. Annual Review of Genetics
34, 139164.
Marra, A., Asundi, J., Bartilson, M., Lawson, S., Fang, F., Christine, J., et al., 2002.
Differential uorescence induction analysis of Streptococcus pneumoniae identies
genes involved in pathogenesis. Infection and Immunity 70, 14221433.
McClelland, M., Sanderson, K.E., Spieth, J., Clifton, S.W., Latreille, P., Courtney, L., et al.,
2001. Complete genome sequence of Salmonella enterica serovar TyphimuriumLT2.
Nature 413, 852856.
Mouslim, C., Hilbert, F., Huang, H., Groisman, E.A., 2002. Conicting needs for a
Salmonella hypervirulence gene in host and non-host environments. Molecular
Microbiology 45, 10191027.
Patel, C.N., Wortham, B.W., Lines, J.L., Fetherston, J.D., Perry, R.D., Oliveira, M.A., 2006.
Polyamines are essential for the formation of plague biolm. Journal of Bacteriology
188, 23552363.
Pistocchi, R., Kashiwagi, K., Miyamoto, S., Nukui, E., Sadakata, Y., Kobayashi, H., et al.,
1993. Characteristics of the operon for a putrescine transport system that maps at
19 minutes on the Escherichia coli chromosome. The Journal of Biological Chemistry
268, 146152.
Prigent-Combaret, C., Vidal, O., Dorel, C., Lejeune, P., 1999. Abiotic surface sensing and
biolm-dependent regulation of gene expression in Escherichia coli. Journal of
Bacteriology 181, 59936002.
Prigent-Combaret, C., Brombacher, E., Vidal, O., Ambert, A., Lejeune, P., Landini, P., et al.,
2001. Complex regulatory network controls initial adhesion and biolm formation
in Escherichia coli via regulation of the csgD gene. Journal of Bacteriology 183,
72137223.
Prouty, A.M., Gunn, J.S., 2003. Comparative analysis of Salmonella enterica serovar
Typhimuriumbiolmformation on gallstones and on glass. Infection and Immunity
71, 71547158.
Prouty, A.M., Schwesinger, W.H., Gunn, J.S., 2002. Biolm formation and interaction with
the surfaces of gallstones by Salmonella spp. Infection and Immunity 70, 26402649.
Rasschaert, G., Houf, K., De Zutter, L., 2007. Impact of the slaughter line contamination
on the presence of Salmonella on broiler carcasses. Journal of Applied Microbiology
103, 333341.
Rediers, H., Rainey, P.B., Vanderleyden, J., De Mot, R., 2005. Unraveling the secret lives of
bacteria: use of in vivo expression technology and differential uorescence
induction promoter traps as tools for exploring niche-specic gene expression.
Microbiology and Molecular Biology Reviews 69, 217261.
Ren, D., Bedzyk, L.A., Setlow, P., Thomas, S.M., Ye, R.W., Wood, T.K., 2004. Gene expression
inBacillus subtilis surface biolms withandwithout sporulationandtheimportance of
yveR for biolm maintenance. Biotechnology and Bioengineering 86, 344364.
Rieseberg, M., Kasper, C., Reardon, K.F., Scheper, T., 2001. Flow cytometry in
biotechnology. Applied Microbiology and Biotechnology 56, 350360.
Romling, U., 2005. Characterization of the rdar morphotype, a multicellular behaviour
in Enterobacteriaceae. Cellular and Molecular Life Sciences 62, 12341246.
Romling, U., Sierralta, W.D., Eriksson, K., Normark, S., 1998. Multicellular and
aggregative behaviour of Salmonella typhimuriumstrains is controlled by mutations
in the agfD promoter. Molecular Microbiology 28, 249264.
Romling, U., Pesen, D., Yaron, S., 2007. Biolms of Salmonella enterica. In: Rhen, M.,
Maskell, D., Mastroeni, P., Threlfall, E.J. (Eds.), Salmonella Molecular Biology and
Pathogenesis. Horizon Press, Norfolk, UK, pp. 127145.
Sambrook, J., Russel, D.W., 2001. Molecular Cloning: A Laboratory Manual 3rd Edition.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
Santiviago, C.A., Reynolds, M.M., Porwollik, S., Choi, S.H., Long, F., Andrews-Polymenis,
H.L., et al., 2009. Analysis of pools of targeted Salmonella deletion mutants identies
novel genes affecting tness during competitive infection in mice. PLoS Pathogens
5, e1000477.
Sauer, K., Camper, A.K., 2001. Characterization of phenotypic changes in Pseudomonas
putida in response to surface-associated growth. Journal of Bacteriology 183,
65796589.
Sauer, K., Camper, A.K., Ehrlich, G.D., Costerton, J.W., Davies, D.G., 2002. Pseudomonas
aeruginosa displays multiple phenotypes during development as a biolm. Journal
of Bacteriology 184, 11401154.
Schembri, M.A., Kjaergaard, K., Klemm, P., 2003. Global gene expression in Escherichia
coli biolms. Molecular Microbiology 48, 253267.
Shah, P., Swiatlo, E., 2008. A multifaceted role for polyamines in bacterial pathogens.
Molecular Microbiology 68, 416.
477 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478
Sharma, C.M., Hoffmann, S., Darfeuille, F., Reignier, J., Findeiss, S., Sittka, A., et al., 2010.
The primary transcriptome of the major human pathogen Helicobacter pylori.
Nature 464, 250255.
Shemesh, M., Tam, A., Kott-Gutkowski, M., Feldman, M., Steinberg, D., 2008. DNA-
microarrays identication of Streptococcus mutans genes associated with biolm
thickness. BMC Microbiology 8, 236.
Sittka, A., Lucchini, S., Papenfort, K., Sharma, C.M., Rolle, K., Binnewies, T.T., et al., 2008.
Deep sequencing analysis of small noncoding RNA and mRNA targets of the global
post-transcriptional regulator, Hfq. PLoS Genetics 4, e1000163.
Solano, C., Garcia, B., Valle, J., Berasain, C., Ghigo, J.M., Gamazo, C., et al., 2002. Genetic
analysis of Salmonella enteritidis biolm formation: critical role of cellulose.
Molecular Microbiology 43, 793808.
Stewart, P.S., Franklin, M.J., 2008. Physiological heterogeneity in biolms. Nature
Reviews 6, 199210.
Stoodley, P., Sauer, K., Davies, D.G., Costerton, J.W., 2002. Biolms as complex
differentiated communities. Annual Review of Microbiology 56, 187209.
Valdivia, R.H., Falkow, S., 1996. Bacterial genetics by ow cytometry: rapid isolation of
Salmonella typhimurium acid-inducible promoters by differential uorescence
induction. Molecular Microbiology 22, 367378.
Valdivia, R.H., Falkow, S., 1997. Fluorescence-based isolation of bacterial genes
expressed within host cells. Science 277, 20072011.
Weiss-Muszkat, M., Shakh, D., Zhou, Y., Pinto, R., Belausov, E., Chapman, M.R., et al.,
2010. Biolmformation by and multicellular behavior of Escherichia coli O55:H7, an
atypical enteropathogenic strain. Applied and Environmental Microbiology 76,
15451554.
White, A.P., Weljie, A.M., Apel, D., Zhang, P., Shaykhutdinov, R., Vogel, H.J., et al., 2010. Aglobal
metabolic shift is linked to Salmonella multicellular development. PLoS ONE 5, e11814.
Whiteley, M., Bangera, M.G., Bumgarner, R.E., Parsek, M.R., Teitzel, G.M., Lory, S., et al.,
2001. Gene expression in Pseudomonas aeruginosa biolms. Nature 413, 860864.
Yang, L., Barken, K.B., Skindersoe, M.E., Christensen, A.B., Givskov, M., Tolker-Nielsen, T.,
2007. Effects of iron on DNA release and biolm development by Pseudomonas
aeruginosa. Microbiology 153, 13181328.
478 K. Hermans et al. / Journal of Microbiological Methods 84 (2011) 467478