Você está na página 1de 23

Licenciatura em Bioqumica

2013/2014




1




















Biologia Molecular

Caderno de relatrios


















Turma 3 | Grupo 2
Alexandra Teixeira, Catarina Cunha, M Ins Silva

Docentes: Dr. Cludio Sunkel, Prof. Mariana Osswald
Licenciatura em Bioqumica
2013/2014




2

Extrao de DNA genmico de Drosophila Melanogaster


Objetivos

Purificao de DNA genmico de
Drosophila melagnoster; avaliao dos efeitos da
ao de tratamentos fsicos distintos na
integridade do DNA isolado.


Alteraes ao procedimento
experimental

Durante o isolamento do DNA foi
suprimido o passo da sua lavagem (adicionar ao
DNA precipitado 500 l de uma soluo de
lavagem de etanol 70% (frio) e centrifugar a 12000
rpm durante 2 minutos a 4
o
C).
Na anlise espectrofotomtrica, foram
colocados na cuvette 690 l de gua ultra-pura
e 10 l da amostra de DNA (resultando numa
diluio a 70x e no 140x como descrito no
procedimento).
No estudo da ao dos diferentes
tratamentos fsicos na integridade do DNA
genmico, foram colocados em todos os tubos
eppendorf 9 l da amostra de gDNA, em vez de 10
l. O tubo sujeito a aquecimento a 95
o
C sofreu
este processo durante 5 minutos (e no 10).

Resultados experimentais

Determinao da concentrao e grau de pureza
do DNA por espectrofotometria

Abs
260 nm
= 0.104
Abs
280 nm
= 0.061

Abs
260 nm

Abs
280 nm

= 1.70





=

c = 0.02 (g/ml)
-1
cm
-1
l = 1 cm

0.104 = 0.02 * 1 * c c = 5.2 g/ml

Antes da diluio a 70x :

c = 5.2 * 70 = 364 g/ml


Clculo dos pesos moleculares das amostras



Figura 1 Eletroforese em gel de agarose.
Marcador de pares de bases (1); gDNA (DNA
genmico) (2); gDNA vortexado intensamente (3);
gDNA aquecido a 95C (4); gDNA pipetado
mltiplas vezes (5); os poos de (6) a (10) so
referentes aos trabalhos Extrao de DNA
plasmdico de Escherichia coli e Anlise
eletrofortica de DNA digerido com enzimas de
restrio.


Grau de
pureza da
amostra
Concentrao
de DNA na
amostra
1 2 3 4 5 6 7 8 9 10
Licenciatura em Bioqumica
2013/2014




3

log(PM) = -0.2596 d + 4.5036
R = 0.9926
0.00
0.50
1.00
1.50
2.00
2.50
3.00
3.50
4.00
4.50
1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 9.0
L
o
g

(
P
M
)
Distncia migrada / cm
Tabela 1 Valores referentes aos pesos
moleculares do marcador, distncia migrada de
cada banda e ao logaritmo dos pesos moleculares.

PM / pb d
migrada
/cm log (PM)
10000 2.2 4.00
8000 2.4 3.90
6000 2.7 3.78
5000 3.1 3.70
4000 3.4 3.60
3000 3.8 3.48
2500 4.1 3.40
2000 4.5 3.30
1500 5.0 3.18
1000 5.9 3.00
800 6.4 2.90
600 6.8 2.78
400 7.5 2.60
200 8.2 2.30

A partir da regresso linear do logaritmo
dos pesos moleculares (log PM) em funo da
distncia migrada (d) obtm-se a seguinte
equao:
log (PM) = - 0.2596 d + 4.5036
r
2
= 0.9926














Grfico 1 Representao grfica da distncia
migrada pelos marcadores de peso molecular em
funo do logaritmo do seu peso molecular e
respetiva regresso linear.
Tabela 2 Distncias migradas por cada banda
dos poos 2 a 5 e respetivo peso molecular obtido
a partir da reta supra-referida.

Poo Distncia migrada/cm Peso molecular /Pb
2
2.0 9647
4.8 1809
8.1 252
3
2.0 9647
5.0 1605
5.9 937
8.2 237
4 No se observam bandas neste poo
5
1.9 10241
5.0 1605
5.8 995
8.2 237

Discusso dos resultados/ Concluso

Devido s ligaes duplas das bases
azotadas, o DNA absorve radiao ultravioleta a
260 nm (tal como certos tipos de RNA). Deste
modo, o mtodo espectrofotomtrico pode ser
usado com alguma fiabilidade na determinao da
concentrao de DNA numa amostra. A
concentrao obtida foi de 364 g/ml. de
relevncia determinar-se o grau de pureza da
amostra, dado pela diviso entre a absorvncia a
260 nm (proporcional quantidade de DNA) e a
absorvncia a 280 nm (proporcional quantidade
de fenol e protenas, cujos resduos aromticos
so responsveis pela absoro). Obteve-se um
grau de pureza de 1.70, concluindo-se que a
amostra se encontrava, possivelmente,
contaminada com protenas e fenol (valor inferior
a 1.8; seria pura caso o grau de pureza estivesse
contido entre 1.8 e 2.2). Uma alternativa a este
mtodo seria a utilizao da fluorescncia: o
brometo de etdeo intercalado entre as bases da
cadeia dos cidos nucleicos emite fluorescncia
(cuja intensidade proporcional massa total de
DNA), que quando comparada com uma srie de
padres com quantidade de DNA conhecida,
permite estimar a quantidade na amostra em
estudo.
Licenciatura em Bioqumica
2013/2014




4

Pela anlise eletrofortica, conclui-se que o
DNA genmico da Drosophila melagnoster tinha
um peso molecular de cerca de 10000 Pb ( o
componente mais pesado da amostra, logo migra
uma menor distncia no gel, correspondendo
primeira banda dos poos 2, 3 e 5). A presena de
outras bandas nestes poos pode indicar a
existncia de contaminao (para alm da com
protenas e fenol, determinada pelo mtodo
anteriormente descrito, o RNA tambm pode
estar presente, uma vez que contm bases
azotadas, logo, o brometo de etdeo intercala-se
entre elas): a ltima banda dos poos 2, 3 e 5
poder corresponder presena de mRNA e tRNA,
enquanto que as bandas intermdias, um pouco
difusas, podero ser relativas presena de rRNA
(das subunidades ribossomais grande e pequena),
j que para alm de mais pesado (e, portanto,
movimenta-se menos), tambm o RNA mais
abundante, da a maior intensidade das bandas.
Nos poos 3 e 5, essas bandas podero tambm
corresponder a possvel DNA fragmentado. De
modo a eliminar-se a contaminao com RNA,
poderia ter-se recorrido adio de RNAses, que
degradariam o RNA, tornando a amostra de DNA
mais pura. Quanto ao poo 4, o facto de se ter
submetido a amostra a elevadas temperaturas
poder ter levado ao supercoiling do gDNA,
fenmeno que o torna mais pequeno e, por isso,
h uma maior migrao no gel, o que explica o
facto de no se observar nenhuma banda nesse
poo (poder ter corrido mais que o marcador de
pesos moleculares). Por outro lado, tambm h a
hiptese das incorrecta pipetagem no poo,
levando disperso da amostra no gel antes da
eletroforese comear. Assim, partindo da primeira
possibilidade em relao ao poo 4, e dada a
semelhana entre os poos 2, 3 e 5, pode concluir-
se que apenas as altas temperaturas podem
destruir o gDNA, ao contrrio dos outros
tratamentos fsicos, mltiplas pipetagens e vrtex
vigoroso, que no aftam a integridade do gDNA.






















Licenciatura em Bioqumica
2013/2014




Extrao de DNA plasmdico de Escherichia coli

Objetivo

Preparar em pequena escala o plasmdeo
pSK polo de Escherichia coli (E.coli), separando e
isolando o DNA plasmdico da bactria.

Alteraes ao procedimento
experimental

Aps se colocar 1.5 mL de cultura num
tubo Eppendorf, procedeu-se centrifugao a
velocidade mxima durante apenas 1 minuto e
no durante 3 minutos como descrito no
protocolo.
Avanou-se o passo de deixar incubar 5
minutos temperatura ambiente aps adicionar 4
L de lisozima ao sedimento.
J no ltimo passo relativo extrao do
DNA plasmdico aplicaram-se 10 L de amostra
(ao invs dos 5 L referidos no protocolo) com 5
L de tampo de aplicao.
Na preparao do gel de agarose, no se
adicionou 1 L de brometo de etdeo mas sim 3
L.

Resultados experimentais










Figura 1 Eletroforese em gel de agarose.
Marcador de pares de bases (1); os poos de (2) a
(5) so referentes ao trabalho Extrao de DNA
genmico de Drosophila Melanogaster; DNA
plasmdico (6); os poos de (7) a (10) dizem
respeito ao trabalho Anlise eletrofortica de
DNA digerido com enzimas de restrio

Discusso dos resultados/ Concluso

De acordo com a observao da Figura 1,
possvel afirmar que o DNA plasmdico revela ter
um menor peso molecular que o DNA genmico,
uma vez que foi o que apresentou uma banda de
maior migrao no gel, o que seria de esperar na
medida em que estas pores de material
gentico so pequenos fragmentos do DNA
bacteriano circular.
Pela anlise dos resultados obtidos por
eletroforese, observa-se a existncia de 2 bandas
embora muito tnues - no poo 6, a nossa
amostra de DNA plasmdico. Relativamente
banda que migrou menos, infere-se que poder
corresponder a dsDNA (double-stranded DNA). Por
outro lado, a banda de interesse, aquela que
migrou mais no poo 6 que corresponde a DNA
plasmdico parcialmente purificado, (cccDNA -
covalently closed circular DNA), a que apresenta
menor peso molecular, uma vez que se trata de
uma forma mais compacta de DNA plasmdico
dado o super-enrolamento (supercoilling effect)
que lhe confere uma estrutura de menor raio
hidrodinmico que lhe permite uma maior
mobilidade ao longo dos poros do gel de agarose.
Por outro lado, ainda pode haver a
possibilidade do DNA plasmdico estar
contaminado com fragmentos de RNA uma vez
que este migra distncias prximas do DNA
plasmdico dado o seu pequeno tamanho, alm de
a banda detetada com menor peso ser larga. Pode
dizer-se que a banda apresenta um peso
molecular na ordem dos 200-400 pb, sendo este o
1 2 3 4

1
5
6 7
8 9 10
Licenciatura em Bioqumica
2013/2014
Caderno de relatrios de Biologia Molecular



6

intervalo de valores para o peso do DNA
plasmdico, podendo conter vestgios de RNA.
Uma forma de tirar dvidas relativamente a este
parmetro e de concluir com certeza a ausncia
de RNA seria a realizao do tratamento da
amostra com RNAses que degradam o RNA e
realizar nova eletroforese.







Licenciatura em Bioqumica
2013/2014




Anlise eletrofortica de DNA digerido com enzimas de
restrio

Objetivos

Estudar a ao das enzimas de restrio
EcoR I e Hind III na digesto de uma amostra de
DNA plasmdico e analisar o resultado dos cortes
atravs da eletroforese em gel de agarose.

Alteraes ao procedimento
experimental

Na preparao das amostras, procedeu-se
preparao de 4 tubos Eppendorf diferentes. O
primeiro tubo o de controlo continha apenas 2
L de DNA plasmdico e os restantes 18 L de
gua pura; o segundo tubo com EcoR I foi
preparado de acordo com o protocolo assim como
o terceiro tubo tubo com Hind III -; o ltimo tubo
Eppendorf preparado com as duas enzimas de
restrio continha 2 L de DNA plasmdico, 2 L
de tampo, 1 L de EcoR I e 1 L de Hind III e, por
fim, 14 L de gua pura.
A incubao a 37C durou apenas 45
minutos (aproximadamente).


Resultados experimentais
















Figura 1 Eletroforese em gel de agarose.
Marcador de pares de bases (1); os poos de (2) a
(5) so referentes ao trabalho Extrao de DNA
genmico de Drosophila Melanogaster; DNA
plasmdico (6); DNA plasmdico no digerido (7);
DNA digerido com EcoR I (8); DNA digerido com
Hind III (9); DNA digerido com EcoR I e com Hind III
(10)

Tabela 1 Valores referentes aos pesos
moleculares referentes ao marcador, distncia
migrada de cada banda e ao logaritmo dos pesos
moleculares

PM / pb d
migrada
/cm log (PM)
10000 2.2 4.00
8000 2.4 3.90
6000 2.7 3.78
5000 3.1 3.70
4000 3.4 3.60
3000 3.8 3.48
2500 4.1 3.40
2000 4.5 3.30
1500 5.0 3.18
1000 5.9 3.00
800 6.4 2.90
600 6.8 2.78
400 7.5 2.60
200 8.2 2.30

A partir da regresso linear do logaritmo
dos pesos moleculares (log PM) em funo da
distncia migrada (d) obtm-se a seguinte
equao:
log (PM) = - 0.2596 d + 4.5036
r
2
= 0.9926

Aplicando a equao obtida s bandas
correspondentes s amostras obtm-se os pesos
moleculares apresentados na tabela 4.



1
2
3 4 5 6 7 8
9
10
Licenciatura em Bioqumica
2013/2014




8



Tabela 2 Valores referentes s distncias de
migrao das bandas das amostras e respetivos
pesos moleculares


d
migrada
/cm PM/ pb
Controlo
2.6 6740
3.7 3492
EcoR I
3.1 4999
5.4 1264
Hind III 2.9 5633
Hind III
+ EcoR I
3.5 3936
5.0 1605
5.2 1425


Discusso dos resultados e Concluso

Analisando o gel de agarose da figura 3,
verifica-se que no poo 7 se identificam 2 bandas
e uma terceira muito tnue, sendo as 3 bandas
referentes s 3 formas de DNA plasmdico: DNA
circular, DNA linear de cadeia dupla e DNA
superenrolado.
No poo 8 com DNA digerido com EcorI
observam-se duas bandas, o que indica que
existem dois locais de corte no plasmdeo
recombinante. Originam-se, assim, dois
fragmentos com pesos moleculares de,
aproximadamente, 5000 e 1200 pb.
Pode concluir-se que apenas existe um local
de corte para a enzima de restrio HindIII
analisando o poo 9 -, originando uma banda
correspondente a um fragmento de DNA com
peso molecular de cerca de 5600 pb. A presena
de uma nica banda (correspondendo a um local
de corte) indica que o plasmdeo perde a sua
conformao circular e adquire uma conformao
linear
Tendo sido o plasmdeo digerido com as
duas enzimas (EcorI e HindIII) poo 10
observam-se trs bandas, indo de encontro ao
esperado. A insero do gene polo foi feita entre
um corte de EcoRI e HindIII. Assim, conclui-se que
o peso molecular do fragmento inserido de
aproximadamente 1200 pb.












































Licenciatura em Bioqumica
2013/2014




9

Elaborao do mapa de restrio de um plasmdeo recombinante

Objetivos

Elaborar o mapa de restrio de um
plasmdeo recombinante que contm um gene
que codifica para uma subunidade da NADH
desidrogenase.
Proceder-se anlise dos pesos
moleculares dos fragmentos obtidos aps
digesto dos plasmdeos com as enzimas de
restrio Sal I, Hind III, Pst I, Xho I, Pvu II, Sac I e
BamHI.

Alteraes ao procedimento
experimental

No houve quaisquer alteraes ao
procedimento experimental.

Resultados experimentais















Figura 1 Eletroforese onde se inseriu o
fragmento R
















Figura 2 Eletroforese onde se inseriu o
fragmento L



Tabela 1 Valores referentes aos pesos
moleculares referentes ao marcador, distncia
migrada de cada banda e ao logaritmo dos pesos
moleculares do fragmento L

PM /
pb
d
migrada
/cm
log
(PM)
23130 0.9 4.36
9416 1.3 3.97
6557 1.6 3.82
4361 2.0 3.64
2322 2.8 3.37
2027 3.0 3.31
564 4.7 2.75

Reta de calibrao:

log (PM) = - 0.3953 d + 4.5232




Licenciatura em Bioqumica
2013/2014




10

y = -0.3953x + 4.5232
R = 0.9602
0.00
0.50
1.00
1.50
2.00
2.50
3.00
3.50
4.00
4.50
5.00
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0
L
o
g

(
P
M
)
Distncia migrada / cm
y = -0.3962x + 4.5874
R = 0.9502
0.00
0.50
1.00
1.50
2.00
2.50
3.00
3.50
4.00
4.50
5.00
0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0
L
o
g
(
P
M
)
Distncia migrada / cm






Grfico 1 Representao grfica da distncia
migrada pelos marcadores de peso molecular em
funo do logaritmo do seu peso molecular e
respetiva regresso linear (correspondente
eletroforese relativa ao fragmento L)



Tabela 2 Valores referentes aos pesos
moleculares referentes ao marcador, distncia
migrada de cada banda e ao logaritmo dos pesos
moleculares do fragmento R
PM /
pb
d
migrada
/cm
log
(PM)
23130 1.1 4.36
9416 1.5 3.97
6557 1.8 3.82
4361 2.1 3.64
2322 2.9 3.37
2027 3.1 3.31
564 4.9 2.75


Reta de calibrao:

log (PM) = - 0.3962 d + 4.5874












Grfico 2 Representao grfica da distncia
migrada pelos marcadores de peso molecular em
funo do logaritmo do seu peso molecular e
respetiva regresso linear (correspondente
eletroforese relativa ao fragmento R)


Tabela 3 Enzimas de restrio utilizadas,
distncias migradas e respetivos pesos
moleculares das bandas dos fragmentos R e L

Enzima
Fragmento L Fragmento R
d
migrada
/cm
PM/
pb
d
migrada
/cm
PM/
pb
BamHI 2.5 3427 2.6 3608
Sal I
2.4 3754 2.5 3953
2.5 3427 2.6 3608
Hind III
2.2 4503 2.0 6237
3.0 2174 4.0 1006
Pst I
2.1 4932 2.0 6237
3.1 1985 3.7 1323
Xho I
1.9 5917 2.0 6237
3.8 1050 3.8 1207
Pvu II
1.8 6481 2.4 4330
4.7 463 2.7 3293
Sac I 1.7 7099 1.8 7486
Xho I +
Sac I
2.3 4112 2.1 5694
3.1 1985 3.8 1207
3.8 1050 6.0 162

Licenciatura em Bioqumica
2013/2014




11

Construo do mapa de restrio do vector
pGEM-3 com os fragmentos L e R

Exemplo para o fragmento L

Em primeiro lugar, possvel determinar o
peso molecular do pGEM-3 (sem o fragmento
inserido), atravs do corte do plasmdeo com a
enzima de restrio BamH I (apresenta apenas
uma banda, cujo peso molecular corresponder
ao do pGEM-3): 3427 pb.
Observando o poo relativo restrio da
Sal I, nota-se que um dos fragmentos correu uma
distncia muito semelhante ao pGEM-3 no poo
correspondente ao da enzima referida
anteriormente. Logo, esse corresponder ao vetor
(cujo peso molecular coincidente com o obtido
pela restrio da BamH I) e o outro componente
ser o fragmento L. Portanto, como base na tabela
3, este tem 3754 pb de peso molecular. Tendo
conhecimento que a Sal I corta o pGEM-3 na
posio 25, j , ento, possvel saber onde se
situa o fragmento, uma vez que foi inserido nesse
local de corte. O segundo corte situa-se no local
3779 (3754 pb + 25 pb).
Relativamente enzima Hind lll, sabe-se
que esta cisa em dois locais distintos, dado que se
observam duas bandas na eletroforese. Sabe-se,
ainda, que corta o pGEM-3 no local 7. Assim, o
outro local de corte ir situar-se no fragmento L
(pois o vetor s cortado uma nica vez), a cerca
de 2174 pb do primeiro, isto , na posio 2181
(chegar-se-ia a uma posio semelhante caso
fosse feito o processo inverso, isto , pelo lado
contrrio ao dos ponteiros do relgio, subtraindo
ao total o nmero de pares de bases do fragmento
maior obtido).
Quanto enzima Pst l, tal como a Hind lll,
tambm corta duas vezes o plasmdeo
recombinante, uma delas na posio 23 do vetor e
a outra no fragmento L, 1985 pb frente do
primeiro corte, portanto, no lugar 2008.
Em relao enzima de restrio Pvu II,
como nas anteriores, verificou-se a existncia de
duas bandas. Como o primeiro corte se d na
posio 104 do vetor (a 79 pb do local de insero
do fragmento), ento, localizar-se- na posio
3858 (79 pb + 3779 pb, n de pares onde termina
o fragmento). O outro local de corte ser no
fragmento, no local 3395 (3858 pb 463 pb).
O poo relativo restrio da enzima Sac I
tem apenas uma banda, cuja distncia migrada a
menor de todas as bandas observadas, logo, o
fragmento ter maior nmero de pares de bases,
pelo que se pode concluir que corresponder ao
plasmdeo recombinante (pGEM-3 + fragmento L),
que no seu total contm, segundo este raciocnio,
7099 pb. Sabendo que esta enzima digere o
pGEM-3 no local 56, o seu corte ser na posio
3810 (56 pb 25 pb = 31 pb; 3779 pb + 31 pb =
3810 pb, uma deduo anloga anterior).
Por fim, como a Xho l no corta o pGEM-3,
no seria possvel saber os seus dois locais de
corte (visto que se observaram duas bandas no
poo correspondente aos fragmentos obtidos
aps o seu corte) sem informao adicional, uma
vez que ambos se situaro no fragmento, do qual
no temos conhecimento. Assim, para a sua
localizao, necessrio recorrer aos resultados
da restrio simultnea da Xho I e Sac I. Em
conjunto, estas cortam em 3 stios distintos,
originando 3 fragmentos com diferentes pesos. J
se tendo determinado o local de corte da Sac I,
verifica-se que um dos locais de corte da Xho I
estar 1985 pb para trs desse, isto , na posio
1825, e o segundo corte estar 1050 pb para trs
desse, no local 775 (o peso molecular do
fragmento obtido entre estes cortes, 1050 pb,
coincidente com o obtido com a restrio da Xho I
isoladamente).
Foi utilizado o mesmo mtodo para a
construo do mapa de restrio relativo ao
plasmdeo recombinante resultante da insero
do fragmento R no pGEM-3, uma vez que as
enzimas de restrio usadas foram as mesmas.



Licenciatura em Bioqumica
2013/2014















Figura 3 Mapa de restrio resultante da ao de vrias enzimas de restrio no plasmdeo recombinante
(proveniente da insero do fragmento L no vector pGEM-3).












Figura 4 Mapa de restrio resultante da ao de vrias enzimas de restrio no plasmdeo recombinante
(proveniente da insero do fragmento L no vector pGEM-3.

Licenciatura em Bioqumica
2013/2014




Discusso dos resultados/ Concluso

Neste trabalho prtico foi possvel
compreender como se processa toda a
metodologia para a construo de um mapa de
restrio, desde a anlise eletrofortica
comparao dos pesos moleculares dos vrios
fragmentos, obtidos a partir da reta de calibrao
do grfico Log (Peso Molecular) = f (distncia
migrada).
De notar que este estudo permitiu uma
anlise relativa entre os cortes das vrias enzimas
de restrio, no sendo, portanto, de elevado
rigor. Por exemplo, a soma dos pesos moleculares
do vetor pGEM-3 e de cada fragmento no igual
ao peso molecular do plasmdeo recombinante
(pGEM-3 e o fragmento nele inserido) que dado,
supostamente, pela restrio com Sac I (no caso
do fragmento L, o peso molecular obtido para o
fragmento resultante do corte com Sac I foi de
7099 pb e no 3427 pb + 3754 pb = 7181 pb; no
fragmento R obteve-se 7486 pb e 7561 pb,
respetivamente). Por outro lado, a soma dos
pesos moleculares dos fragmentos resultantes, no
caso das enzimas que cisam mais do que uma vez,
deveria ser a mesma em todos os casos e igual ao
obtido com a restrio da Sac I. Contudo, embora
no sejam exatamente iguais, no diferem
significativamente. Estas observaes revelam
que, embora os resultados sejam relativamente
aproximados, este um bom mtodo para
determinar a localizao fsica, ainda que relativa,
dos locais de corte de vrias enzimas. Este tipo de
estudo ganha extrema relevncia quando se
pretende, por exemplo, escolher fragmentos de
DNA de menores dimenses para posterior
subclonagem ou identificar fragmentos de DNA
homlogos.

















Licenciatura em Bioqumica
2013/2014




14

PCR Polimerase Chain Reaction

Objetivos

Amplificar uma sequncia de DNA genmico
e de uma sequncia de cDNA por PCR.
Analisar a eficincia e caractersticas do
gDNA e do cDNA por eletroforese.

Alteraes ao procedimento
experimental

Na preparao das misturas de reao,
adicionou-se 4 L de dNTPs a cada tubo
Eppendorf e no os 8 L referidos no protocolo.
Realizaram-se 15 ciclos no amplificador
termocclico ao invs de 40 ciclos.

Resultados experimentais

Desenho dos primers
O primer sense foi obtido atravs das regras
existentes no protocolo e foi desenhado a partir
da cadeia 5-3. Por sua vez, o primer antisense foi
obtido a partir da cadeia 3-5 pois ter de ser
complementar s bases que compem a
sequncia escolhida, j que tem de a polimerizar.

Extremidade 5 da sequncia sense da poro para
amplificar:

5AGCTATGCTATGCTATGCTAGCCAGTCA
GCTGAACGTG3

5 GCTATGCTATGCTATGC 3 primer
sense

Este primer constitudo por 17
nucletidos: 8 so citosinas ou guaninas (47% de
G/C) e apresenta uma temperatura de hibridao
de 50C.

Extremidade 3 da sequncia antisense:

3AGATTAAGGTTCGGTTAACGGTTTTT CCTTGGC-5

3-CGGTTAACGGTTTTTCC-5 primer
antisense

Este primer, tal como o anterior,
constitudo por 17 nucletidos, dos quais 8 so
citosinas ou guaninas (47% de G/C) e tambm
apresenta uma temperatura de hibridao de
50C.
Desta forma, o par de primers pode ser
usado para efetuar PCR na medida em que ambos
tm um nmero total de nucletidos de 17
(dentro dos parmetros entre 17 a 25
nucletidos), o seu contedo em
guaninas+citosinas est dentro do estipulado
(entre 45 e 55%) e a T
o
m
de ambos a mesma.
Portanto, esto reunidas as condies necessrias
realizaoo de uma PCR eficaz.

Eletroforese
De forma a avaliar a quantidade de produto
obtido na PCR foi necessrio efetuar uma
eletroforese em gel de agarose 1%, apresentada
abaixo na imagem 1:


Figura 1 Resultado da eletroforese
respeitante amplificao do produto obtido por
PCR de cDNA (2) e gDNA (3), o poo 1 corresponde
aos marcadores de peso molecular.

1 2 3
Licenciatura em Bioqumica
2013/2014




15

[Nota: A eletroforese apresentada corresponde
ao PCR realizado na turma 2, uma vez que na
nossa turma no existiam bandas relativas aos
pesos moleculares, talvez porque aquando da
aplicao no poo, a soluo possa ter sido
difundida no gel e no entrar toda no poo, no
sendo observveis bandas e, portanto,
impossibilitanto o clculo do peso molecular das
amostras]


Procedeu-se medio das distncias
migradas pelo marcador de peso molecular, cujos
valores se apresentam na Tabela 1:

Tabela 1 Valores referentes aos pesos
moleculares referentes ao marcador, distncia
migrada de cada banda e ao logaritmo dos pesos
moleculares


Realizando-se a regresso linear do
logaritmo dos pesos moleculares (log PM) em
funo da distncia migrada (d) obtm-se a
seguinte representao grfica, alm da respetiva
equao da regresso linear que mais se ajusta
aos pontos e valor de coeficiente de correlao
(R
2
).

Figura 2 Representao grfica do
logaritmo de pesos moleculares do marcador em
funo da distncia percorrida, respetiva equao
da regresso linear e valor de coeficiente de
correlao


Depois de medir as distncias percorridas
por cada uma das amostras, aplicou-se a equao
obtida s bandas correspondentes s amostras
obtendo-se os pesos moleculares sumariados na
tabela 2.

Tabela 2 Valores referentes migrao de cDNA
e gDNA em gel de agarose e respetivo peso
molecular


d
migrada
/cm PM
cDNA 4,9 551
gDNA 4,7 659


Discusso dos resultados/ Concluso

O primeiro ponto do trabalho prtico era o
desenho dos primers a serem usados na reao de
PCR. O par de primers desenhados pode ser usado
para efetuar PCR na medida em que ambos tm
PM / pb d
migrada
/cm log (PM)
10000 1.9 4.00
8000 2.0 3.90
6000 2.2 3.78
5000 2.4 3.70
4000 2.6 3.60
3000 2.9 3.48
2500 3.1 3.40
2000 3.5 3.30
1500 3.7 3.18
1000 4.3 3.00
800 4.6 2.90
600 4.9 2.78
400 5.3 2.60
200 6.0 2.30
log (PM) = -0,3871 d + 4,6444
R = 0,9953
0.00
0.50
1.00
1.50
2.00
2.50
3.00
3.50
4.00
4.50
0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0
l
o
g

(
P
M
)
distncia migrada / cm
Licenciatura em Bioqumica
2013/2014




16

um nmero total de nucletidos de 17 (dentro dos
parmetros entre 17 a 25 nucletidos), o seu
contedo em guaninas+citosinas est dentro do
estipulado (entre 45 e 55%) e a T
o
m
de ambos a
mesma. Portanto, esto reunidas as condies
necessrias realizao de uma PCR eficaz e
obteno de sucesso na amplificao.
Para alm disso, na extremidade 3 de
ambos os primers detetam-se 2 resduos G ou C, o
que vai ajudar a uma correta hibridao neste
local devido s fortes interaes por pontes de
hidrognio entre os pares de bases G/C. Outro
fator importante a ausncia de sequncias
complementares na mesma cadeia, para impedir a
formao de estruturas secundrias e de
homologias entre primers, evitando o
emparelhamento entre eles. Estes dois aspetos
referidos anteriormente so cruciais para que a
formao de dmeros no ocorra, pois eles so
sintetizados preferencialmente em relao a
qualquer outro produto de PCR desejado.
No ponto relativo amplificao por PCR
importante referir que o gDNA mais pesado
que o cDNA (peso molecular mais elevado). Isto
est relacionado com o facto de o cDNA ser obtido
por complementaridade de bases com o mRNA
atravs da ao da enzima transcriptase reversa.
Assim, como no possui intres, dado que estes
so removidos durante o processamento do
mRNA (RNA splicing), o cDNA apresenta apenas a
regio codificante, sendo mais leve. O mesmo no
se passa com o gDNA que possui intres, exes e
fragmentos reguladores da expresso gnica, ou
seja, tem na sua constituio toda a informao
gentica.
Desta forma, de esperar que a distncia
migraada pelo cDNA seja maior na medida em que
tem um nmero de bases inferior ao gDNA.
Alm das bandas de interesse (as mais
evidentes), existe o aparecimento de outras
bandas de maior peso molecular (migram menor
distncia) e importante fazer uma discusso
consciente do seu aparecimento e a que
correspondem. Relativamente ao cDNA verifica-
se o aparecimento de 3 bandas extra, enquanto
que no gDNA possvel observar apenas uma,
alm da mais evidente.
Isto pode dever-se ao facto de, nas
reaes de PCR efetuadas, como foram realizados
menos ciclos do que os devidos (foram realizados
15 em vez de 40), o gel foi muito mais corrido,
levando ao aparecimento, alm do produto
obtido, da template que normalmente no
vsivel na eletroforese porque est bastante
diluda, mas provavelmente foi o que aconteceu
para a observao dessas bandas extra. Assim, as
bandas mais tnues nos poos 2 e 3 podem dever-
se a fragmentos de DNA obtidos nos primeiros
ciclos de PCR, pois neste caso o tamanho da
cadeia ainda no fixo. J a banda mais intensa
corresponde ao gene polo amplificado por PCR
propriamente dito.
















Licenciatura em Bioqumica
2013/2014




Transformao de Escherichia coli com DNA plasmdico

Objetivos

Transformar E.coli com DNA plasmdico.
Transformar as clulas com plasmdeo
pEMBL9, pEMBL9 CAT, pBR322 e pBR322 CAT.
Avaliar a eficincia da transformao.

Alteraes ao procedimento
experimental

No houve alteraes ao procedimento
experimental.

Resultados experimentais













Figura 1 - Placa com meio de cultura
LA/Amp . Controlo

Figura 2 - Placas com meios de cultura
LA/Amp e Mac/Amp incubadas com
plasmdeos pEMBL9
Figura 3 -Placas com meios de cultura LA/Amp e
Mac/Amp incubadas com plasmdeos pEMBL9-
CAT
Figura 4 - Placas com meios de cultura
LA/Amp e LA/Amp/tet incubadas com plasmdeos
pBR322

Figura 5 - Placas com meios de cultura
LA/Amp e LA/Amp/tet incubadas com plasmdeos
pBR322-CAT



Licenciatura em Bioqumica
2013/2014




18

















Figura 6 - Placa com meio de cultura
Mac/Lac/Clo incubada com plasmdeos pBR322-
CAT

















Figura 7 - Placa com meio de cultura
Mac/Lac/Clo incubada com plasmdeos pEMBL9













Figura 8 - Placa com meio de cultura
Mac/Lac/Clo incubada com plasmdeos pEMBL9-
CAT
Tabela 1 Contagem das colnias e avaliao da
cor para as diferentes placas




Tabela 2 Resultados observados aquando da
transferncia dos plasmdeos do seu meio inicial
para o meio Mac/Clo.

Discusso dos resultados e Concluso

Analisando os resultados obtidos, verifica-
se que ocorreu transformao das bactrias com
os diferentes tipos de plasmdeos usados, pois nos
meios contendo LA/Amp as colnias cresceram,
ou seja, o gene de resistncia ampicilina foi
incorporado e expresso com sucesso em todos os
plasmdeos. Ainda, a disparidade de nmero de
colnias que cresceram em LA/Amp nas placas
com diferentes plasmdeos prende-se com o facto
de uns serem mais resistentes que outros. Tal no
se verficou apenas para o controlo, visto que
neste caso as bactrias no tinham sido
transformadas e, naturalmente, no possuam a
resistncia ao antibitico.
Plasmdeo
Meio de
cultura
N de
colnias
Cor
Controlo LA/Amp 0 -
pEMBL9
LA/Amp 700 Amarelo
Mac/Lac/Amp 500 Vermelho
pEMBL9-
CAT
LA/Amp 100 Amarelo
Mac/Lac/Amp 50 Vermelho
pBR322
LA/Amp 25 Amarelo
LA/Amp/Tet 0 Amarelo
pBR322-
CAT
LA/Amp 100 Amarelo
LA/Amp/Tet 0 Amarelo
Plasmdeo
Meio de
Cultura
Crescimento
pBR 322 - CAT Mac/Clo No
pEMBL 9 Mac/Clo No
pEMBL 9 - CAT Mac/Clo Sim
Licenciatura em Bioqumica
2013/2014




19

Alm da resistncia ampicilina, o
plasmdeo pEMBL9 possui o gene que codifica
para a -galactosidase, e ento, quando est
presente em meio Mac/Lac/Amp (contm
lactose), crescem colnias de cor avermelhada.
Assim, este meio induziu a expresso da -
galactosidase e a cor vermelha apresentada deve-
se ao facto desta enzima dar origem a produtos
acdicos (cido pirvico) durante a gliclise, o que
faz diminuir o pH. Tal diminuio detetada pelo
indicador de MacConkey presente no meio em
questo que, quando o pH apresenta valores
baixos, indica a cor avermelhada. O mesmo no se
verificou para o pEMBL9-CAT, cujas colnias
cresceram mas apresentam cor amarela/branca,
uma vez o gene CAT, sendo inserido no meio do
gene que codifica para a -galactosidase, impediu
expresso da -galactosidase e assim, j no se
observa a degradao da lactose com a
consequente formao de cidos.
No que diz respeito s bactrias
transformadas com o plasmdeo pBR322, que
tinha na sua constituio genes que codificam
para a resistncia a dois antibiticos, a ampicilina
e a tetraciclina, seria de esperar um crescimento
tanto para o meio LA/Amp como para
LA/Amp/tet. No entanto, tal no se verificou para
o meio LA/Amp/tet, o que pode levar a inferir
que, provavelmente, o gene de resistncia
tetracicnlina no foi coreretamente inserido. Por
outro lado, na presena do gene CAT, a sua
insero feita no meio do gene que codifica para
a resistncia tetraciclina, ou seja, a resistncia
no expressa e as bactrias no sobrevivem ao
meio contendo este antibitico, observando-se
que na placa contendo pBR322-CAT em
LA/Amp/tet no h crescimento de colnias, como
seria de prever. Na placa contendo LA/Amp
continua a haver crescimento das colnias na
medida em que a insero do gene CAT no
implica a expresso do gene de resistncia
ampicilina, uma vez que no inserido na poro
referente a esta resistncia.
Finalmente, importante fazer referncia
resistncia das bactrias ao clorofenicol, que
induzida pela expresso do gene CAT. Sendo
assim, seria de esperar crescimento em meio
Mac/Clo das bactrias transformadas com
pEMBL9-CAT e pBR322-CAT , enquanto que as
com pEMBL9, por no ter sido inserido o gene
CAT, no devem crescer pois no so resistentes
ao clorofenicol. Contudo, apenas as bactrias
transformadas com pEMBL 9 CAT cresceram. A
razo para a ausncia de crescimento de bactrias
com pBR322 CAT poder prender-se com um
mau acondicionamento das colnias, uma
transferncia do meio inicial para o meio Mac/Clo
pouco eficiente, alm de se poder especular sobre
o facto de as colnias transferidas serem,
efetivamente, resistentes ao clorofenicol, na
medida em que as bactrias transformadas com
pBR322- CAT, apesar de terem o gene, podem no
conseguir express-lo devido falta dos
elementos do promotor para se dar a transcrio.






Licenciatura em Bioqumica
2013/2014




20

Sequenciao de DNA

Objetivos

Sequenciar um gene pelo mtodo de
Sanger. Isolar uma protena por mtodos
bioqumicos e determinar a sequncia dos
primeiros dez aminocidos da regio N-terminal.

Alteraes ao procedimento
experimental

No houve alteraes ao procedimento
experimental.

Resultados experimentais

Sequncia de aminocidos:
N terminal-Ser-Tyr-Cys-Leu-Pro-Met-Ser-Pro-
Arg-Ala-C terminal

Assim, temos diversas possibilidades para a
sequncia de nucletidos que codifica esta
sequncia de aminocidos:

T/A C/G T/C/G/A T A T/C T G
C/T C/T T A/G/C/T C C T/A/G/C

A sequncia reconhecida pela enzima de
restrio EcoRI :
GAATTC

A sequncia reconhecida pela enzima de
restrio HindIII :
AAGCTT

Pela anlise dos resultados da eletroforese
(em anexo), possvel determinar a sequncia de
aminocidos de 3 para 5 (cadeia antisense), pelo
que necessrio, posteriormente, formar a cadeia
complementar (cadeia sense 5 -> 3), obtendo-se
assim as sequncias:

Sequncia da amostra A

5 TAGCGAATTCACCAGGTTCCGAACATCGC
CATTCCAGGGAACTCATTGAGTCTAGCCTAACTAACG
ACCCATGTCGCCCCGTGAAAAGCTTCGCCTA-3

Sequncia da amostra B

5 TAGCGAATTCATTATCCCGATCTAGTAA
CGCATCCTCTAACTAGCGTGAATTATGTCATATTGCC
TGCCCATGTCCCCGCGTGCGAAGCTTCGCCTA-3

Sequncia da amostra C

5-TAGCGAATTCAATCGACCCAGGTCACAACC
TTCCGGCTCAAGCCTAACCTAGTTAAGACCCTATGTC
TCCCCGAGCTAAGCTTCGCCTA-3

Os locais de restrio de EcoRI e HindIII
esto sinalizados a azul e a verde, respetivamente;
a cinzento est assinalado o codo de iniciao.

O primer usado na amplificao por PCR
hibridou com cada uma das sequncias a negrito,
sendo as sequncias dos primers para cada um
dos clones as seguintes:

A- 3 - GGGTACAGCGGGGCA - 5

B- 3 - GGGTACAGGGGCGCA - 5

C- 3 GGATACAGAGGGGCT - 5

De modo a identificar qual dos clones
codifica a sequncia de aminocidos pretendida,
verifica-se qual a sequncia (A, B ou C) que
apresenta os codes que codificam para cada um
dos aminocidos da sequncia. Assim verifica-se
que o clone em causa o B.


5-TCATATTGCCTGCCCATGTCCCCGCGTGCG-3
N-terminal-Ser-Tyr-Cys-Leu-Pro-Met-Ser-Pro-Arg-
Ala-C-terminal





Licenciatura em Bioqumica
2013/2014




21



Discusso dos resultados/ Concluso

Pelo mtodo de Sanger, foi possvel
determinar a sequncia de nucletidos
correspondente sequncia de aminocidos
fornecida (obtida por espectroscopia de massa).
Para alm disso, foi descoberto o clone que
codifica para a sequncia de aminocidos em
causa.
Pode, ainda, determinar-se a sequncia
dos primers utilizados em cada um dos PCRs dos
diferentes clones. Analisando as sequncias
nucleotdicas, verificou-se a existncia de uma
sequncia comum aos trs: os dois primeiros
nucletidos so iguais, diferindo apenas no
terceiro. Portanto, codificam o mesmo
aminocido, a prolina.
O mtodo de Sanger o mais usado no
que se refere sequenciao de DNA. A
determinao da sequncia de um gene de
enorme relevncia, dada a possibilidade de, a
partir disso, se proceder caracterizao da
estrutura gentica, o que auxilia no estudo da
regulao e expresso desse gene. Tais estudos
so uma potencial ajuda ao nvel do progresso das
investigaes em vrios campos, como a medicina
(no que toca cura de diversas patologias,
nomeadamente com origem gentica).



















Licenciatura em Bioqumica
2013/2014




Clonagem de cDNA - -TUB

Objetivos

Clonar o gene de cDNA - -TUB.
Verificar experimentalmente o resultado da
transformao de bactrias com DNA com
diferentes tratamentos.


Alteraes ao procedimento
experimental

A digesto e purificao do DNA foi
realizada segundo o procedimento experimental
sem qualquer alterao. No entanto para se
proceder ligao, prepararam-se 4 tubos (A, B, C
e D) em vez de apenas um. Os tubos A, B, C e D
continham os volumes indicados abaixo de vetor,
insert, tampo (5x), T4 ligase e de gua.

Tabela 1 Volumes de vetor, insert,
tampo, T4 ligase e gua necessrios preparao
dos 4 tubos

A B C D
Vetor 5 L 5 L - 5 L
Insert 10L 10L 10L -
Tampo
(5x)
4 L 4 L 4 L 4 L
T4 ligase 1 L - 1 L 1 L
gua - 1 L 5 L 10 L

A transformao foi realizada em
laboratrio pelo que se assume que no tenha
havido alteraes ao procedimento experimental.

Resultados experimentais

Figura 1 Placas resultantes do
crescimento de colnias de bactrias
transformadas com a mistura reacional A e B,
respetivamente.


Figura 2 Placas resultantes do
crescimento de colnias de bactrias
transformadas com a mistura reacional C e D,
respetivamente


Discusso dos resultados/ Concluso

A reao A corresponde ao conjunto de
clulas incubadas em que se deveria verificar a
clonagem do gene, no entanto isto no acontece
pois no se verifica o aparecimento de colnias
amarelas que, no expressando o gene LAC, no
produzem |-galactosidase e, por isso, no
originam o abaixamento de pH. Observam-se,
nesta placa, apenas colnias vermelhas, o que
significa que produzem |-galactosidase que
degrada a lactose, originando cidos, levando
dimnuio do pH ( este fator que provoca a cor
vermelha das colnias). Assim, possvel concluir
que as bactrias do tubo A no incorporaram
cDNA, na medida em que este incorporado no
meio do gene LAC, impedindo a sua expresso.
Ora, se todas as colnias so vermelhas porque
o gene LAC expresso.
As placas B e C no apresentam colnias,
conforme o esperado. Na primeira (placa B) no
existe T4 ligase que permite que o insert se ligue
Licenciatura em Bioqumica
2013/2014




23

ao vetor ou que este recircularize, por isso, no se
esperava o crescimento de colnias. Na segunda
placa (C), no existe vetor pelo que tambm no
se pode verificar o crescimento de colnias pois o
insert no se pode ligar a si mesmo.
No que diz respeito placa D, observa-se o
crescimento de colnias com cor vermelha. Nesta
placa colocaram-se clulas sem insert pelo que as
colnias que se observam correspondem ao vetor
re-circularizado. As bactrias resistem ampicilina
e produzem |-galactosidase, o que faz com que
todas as colnias apresentem cor vermelha devido
diminuio do pH, como explicado para o caso
da reao A, em que, no havendo cDNA para ser
incorporado, o gene LAC continua a ser expresso.
Concuindo, a clonagem foi mal sucedida e
isso pode dever-se a vrios fatores: a purificao
do DNA pode no ter corrido bem, o rcio entre a
quantidade de insert e vetor pode no ter sido a
mais indicada para o processo ocorrer da melhor
forma e podem ter ocorrido problemas
enzimticos. No entanto, a inatividade da T4 ligase
um fator que no dever ser usado para a
argumentao na medida em que na placa D o
vetor recircularizou, ou seja, a T4 ligase est ativa
e portanto as bactrias cresceram nesse meio.