Você está na página 1de 70

MECHANICS OF CLAIM

CONSTRUCTION AND
DRAFTING
Connexios Life Sciences Pvt. Ltd.
Connexios Life Sciences !"!
#UID PRO #UO
PATENT S$STEM

RIGHTS v. DUT$

DUT$

SPECIFICATION

DESCRIPTION

SUFFICIENC$

ENA%LEMENT

%EST MODE

CLAIMS

CLEAR AND UNAM%IGUOUS


Connexios Life Sciences !"!
CLAIMS

C&'i(s define t)e (etes 'nd *o+nds of 'n invention

C&'i( Li(its t)e extent of ,-otection

.)'t is not c&'i(ed is disc&'i(ed/

C&'i(s dete-(ine t)e v'&+e of 0o+- ,'tent

E'c) c&'i( is ' -e,-esent'tion of 0o+- invention.

Sin1&e sentence endin1 2it) ' ,e-iod.


Connexios Life Sciences !"!
T)e D-'fte-3s Di&e(('

I(,&ic'tions of

C&'i(in1 too *-o'd&0

C&'i(in1 too n'--o2

C&'i(in1 4+st -i1)t5

T)is is 'n '-t 'nd -e6+i-es &ots of i('1in'tion

C&'i( (+st *e 'de6+'te&0 s+,,o-ted *0 t)e


desc-i,tion

M+st 'void

Not c&'i(in1 2)'t t)e c&ient 2'nts

C&'i(in1 2)'t t)e c&ient does not +se o- need


Connexios Life Sciences !"!
One 2'0 -o'd

C'nnot *-o'den t)e c&'i(s of ' 1-'nted


,'tent

C'nnot *-o'den t)e disc&os+-e 'nd t)e


c&'i(s *e0ond 2)'t )'s *een inc&+ded
2)en d-'ftin1 t)e ',,&ic'tion t)'t 2's
fi&ed

$o+ '-e -es,onsi*&e fo- 1ettin1 t)e sco,e


of ,-otection t)e invento- dese-ves
You do not get a second chance
Connexios Life Sciences !"!
PARTS OF CLAIM

T)-ee ,'-ts

Int-od+cto-0 P)-'se

Int-od+ces t)e s+*4ect ('tte- of t)e invention

%od0

defines ' ,'-tic+&'- e(*odi(ent of t)e invention

T-'nsition P)-'se

4oins t)e int-od+cto-0 ,)-'se 'nd t)e *od0 of


c&'i(

O,en ended v. c&ose ended c&'i(s


Connexios Life Sciences !"!
Ex'(,&e
Connexios Life Sciences !"!
Ex'(,&e
I claim a pencil having an eraser fastened
to one end.

Int-od+cto-0 ,)-'se 7 8' ,enci&9

T-'nsition ,)-'se : 8)'vin19

%od0 : 8'n e-'se- f'stened to one end9


Connexios Life Sciences !"!
T$PES OF CLAIMS

Inde,endent C&'i(s

Do not de,end on 'n0 ot)e- c&'i(

Gene-'&&0 defines t)e essenti'& nove&


fe't+-es of t)e (ost ,-efe--ed
e(*odi(ents of ' ,-od+ct o- ' ,-ocess.

A pencil having an eraser fastened to one end.


Connexios Life Sciences !"!
T$PES OF CLAIMS

De,endent C&'i(s

De,end on eit)e- 'n inde,endent c&'i( o- 'not)e-
de,endent c&'i(

M+&ti,&e7de,endent c&'i(s

The pencil as in claim 1, where said eraser is


fastened to said pencil on one end using an
adhesive.

The pencil as claimed in claim 1 and 2 wherein


the said adhesive is glue.
Connexios Life Sciences !"!
T$PES OF CLAIM

P-ocess C&'i(s

A P-ocess C&'i( is +sed fo- ,-ocess


inventions 'nd )'s to c&e'-&0 define t)e
ste,s invo&ved in t)e ,-ocess.

P-od+ct C&'i(s

A ,-od+ct c&'i( ('0 *e c&'i(ed 's 'n


',,'-'t+s; ' s0ste(; ' device; 'n '-tic&e o-
'n0 ot)e- ,-od+ct.
Connexios Life Sciences !"!
OTHER CLAIM T$PES

M'-<+s) C&'i(s

P-od+ct *0 ,-ocess c&'i(s

Fin1e-,-int c&'i(s

St-+ct+-e C&'i(

Co(,osition C&'i(

Gene Se6+ence c&'i(

Di'1nostic (et)od c&'i(


Connexios Life Sciences !"!
REMEM%ER
To Gene-'&i=e is t)e >e0
Connexios Life Sciences !"!
Exe-cise
Connexios Life Sciences !"!
Desc-i*e
Connexios Life Sciences !"!
T)e C't S't on t)e M't
Connexios Life Sciences !"!
P-io- A-t to *e exc&+ded
Connexios Life Sciences !"!
In ot)e- 2o-ds?.
8T)e fe&ine ('(('& occ+,0in1; ' 2)o&&0
if not enti-e&0 sedent'-0 ,osition; '
)o-i=ont'&&07s,-e'd 2oven texti&e f&oo-7
cove-in1; 's is so(eti(es *+t not '&2'0s
t)e c'se@.
Connexios Life Sciences !"!
In 0o+- *oot0
Connexios Life Sciences !"!
T'<e )o(e "
Gene-'&i=e to s+c) 'n extent t)'t 0o+-
,'tent is c&ose to ,-io- '-t *+t c'n *e
c&e'-&0 diffe-enti'ted f-o( t)e ,-io- '-t
Connexios Life Sciences !"!
CHEMICAL AND
PHARMACEUTICAL CLAIM
DRAFTING
Connexios Life Sciences !"!
T$PES OF CLAIMS

P-od+ct c&'i(s

P-ocess c&'i(s
Connexios Life Sciences !"!
PRODUCT RELATED CLAIMS

Ne2 C)e(ic'& entit0 inc&+din1 '


(o&ec+&e o- ' co(,o+nd

Co(*in'tion

Co(,ositions
Connexios Life Sciences !"!
NE. CHEMICAL ENTIT$
CLAIMS

A c)e(ic'& (o&ec+&e deve&o,ed in t)e


e'-&0 discove-0 st'1e 2)ic) &'te-
t-'ns&'tes into ' d-+1 ,-od+ct is 1ene-'&&0
-efe--ed to 's ' ne2 c)e(ic'& entit0.

Act+'& (o&ec+&'- st-+ct+-e of t)e NCE in t)e
c&'i(
Connexios Life Sciences !"!
Act+'& St-+ct+-e ex'(,&e

A compound having the formula



Scope of protection rendered by the claim stated in the
illustration is limited to the compound bearing the molecular
structure.
Connexios Life Sciences !"!
MAR>USH3 T$PE CLAIM

Inc&+de ' c)e(ic'& entit0 '&on1 2it) t)e


v'-io+s v'-i'nts of t)e s'(e

C&ose ended c&'i(s

C&'i( *0 1-o+,in1
Connexios Life Sciences !"!
Ex'(,&e5 M'-<+s) c&'i(

A compound having the formula


Wherein X is selected from a group consisting of Cl, Br, F and I.
Connexios Life Sciences !"!
FINGERPRINT CLAIM

.)en t)e ex'ct st-+ct+-e is not <no2n *+t


t)e c)'-'cte-istics of t)e st-+ct+-e is
s+fficient to distin1+is) t)e co(,o+nd
f-o( existin1 ,-io- '-t.
e.1.5
.)'t is c&'i(ed is
A chemical entity characterized y molecular
weight of 2!", having a p# of $.%, which has a
melting point of 12& degree 'elsius and a oiling
point of 1!" degree 'elsius.
Connexios Life Sciences !"!
PRODUCT %$ PROCESS
CLAIM
.)en t)e ,-od+ct c'nnot *e c&e'-&0
defined 'nd is *est defined *0 t)e
,-ocess of ,-e,'-in1 t)e s'(e
Connexios Life Sciences !"!
e1. Po&04+ice Potion
Connexios Life Sciences !"!
Ex'(,&e

Po&04+ice ,otion5

A ,otion t)'t t-'nsfo-(s one ,e-son to 'not)e-
,e-son )e desi-es to &oo< 'nd so+nd &i<e
.)'t is c&'i(ed is ' ,otion ,-e,'-ed *05

Mixin1 " &'ce2in1 f&ies t)'t )'ve *een ste2ed fo-


" d'0sA

" o+nce of c-+de Anti(on0A

B &eec)es t)'t )'ve *een 8+ns+cc+&'ted9A

" ,inc) of ,o2de-ed )o-n of ' %ico-n t)'t )'s *een


@&+n'- ext-'cted8A 'nd

Ext-'ct of T)e7T-'nsfi1+-ed7%ein17To7%e
fo&&o2ed *0 " d'0s of *-e2in1 in ' o'< *'--e&.
Connexios Life Sciences !"!
OMNI%US CLAIMS

Refe-ence is ('de to t)e s,ecific'tion

Us+'&&0 not '&&o2ed in (ost 4+-isdiction

It3s ' ,&'0 s'fe c&'i(in1 st-'te10


Connexios Life Sciences !"!
Ex'(,&e

A co(,o+nd fo- t-e'tin1 He(o,)i&i';


2)e-ein t)e co(,o+nd is s+*st'nti'&&0
's disc+ssed in t)e s,ecific'tion.
Connexios Life Sciences !"!
CHEMICAL COMPOSITION OR
COM%INATION CLAIMS

Nove& Co(*in'tion ,-od+ct ,'tents


inc&+din1 t2o o- (o-e '&-e'd0 <no2n
c)e(ic'& co(,o+nds.

T)ese co(,o+nds ('0 *e 'v'i&'*&e in t)e


,+*&ic do('in. %+t so &on1 's t)e
co(*in'tion is nove&; t)e0 c'n *e
,'tented.

A co(,osition c&'i( +s+'&&0 s)'&& inc&+de


seve-'& co(,onents *ot) essenti'& 'nd
non essenti'& fo- t)e invention.
Connexios Life Sciences !"!
Ex'(,&e "
.)'t is c&'i(ed is
A s)'(,oo co(,osition co(,-isin1

'. C D of A&<0& et)e- s+&,)'teA

*. "!D of Di(et)iconeA

c. D of i(id'=o&e 'nd

d. EFD 2'te-.
Connexios Life Sciences !"!
Ex'(,&e
What is claimed is
". A s)'(,oo co(,osition co(,-isin1

!7 F!D of 't &e'st one S+-f'ct'ntA

C7"CD of 't &e'st one conditionin1 '1entA

"7FD of 't &e'st one 'nti f+n1'& '1ent 'nd

2'te-.
. T)e s)'(,oo co(,osition 's c&'i(ed in c&'i( ";
2)e-ein t)e 'ntif+n1'& '1ent is se&ected f-o( ' 1-o+,
consistin1 of ,0-'=o&e; i(id'=o&e; t-i'=o&e; tet-'=o&e
'nd ,ent'=o&e.
F. T)e s)'(,oo co(,osition in c&'i( " 2)e-ein s'id 'nti
f+n1'& '1ent is i(id'=o&e.
Connexios Life Sciences !"!
Ex'(,&e F

A shampoo composition comprising

!7 F!D of 't &e'st one S+-f'ct'ntA

C7"CD of 't &e'st one conditionin1 '1entA

"7FD of 't &e'st one 'nti f+n1'& '1ent 'nd

.'te-
2)e-ein t)e 'ntif+n1'& '1ent is se&ected f-o( ' 1-o+,
consistin1 of ,0-'=o&e; i(id'=o&e; t-i'=o&e; tet-'=o&e 'nd
,ent'=o&e.
Connexios Life Sciences !"!
PROCESS RELATED CLAIMS

A ,-ocess c&'i( en+(e-'tes t)e ste,


2ise ,-ocess fo- ('n+f'ct+-in1 t)e
co(,o+nd o- fo-(+&'tion

Ste,s to *e en+(e-'ted in t)e &o1ic'&


o-de-.
Connexios Life Sciences !"!
Ex'(,&e

A process for preparing a modified


phosphocalcic compound comprising:
'G 'ddin1 ' 1e(7*i,)os,)onic 'cid o- 'n '&<'&i (et'& o-
'&<'&ine7e'-t) (et'& s'&t t)e-eof to ' s+s,ension of '
,-ec+-so- ,)os,)oc'&cic co(,o+nd in +&t-',+-e
2'te-A
*G sti--in1 t)e -e'ction (edi+( 't -oo( te(,e-'t+-e
'nd
cG -ecove-in1 t)e fo-(ed co(,o+nd t)e-e f-o( *0
cent-if+1'tion.
Connexios Life Sciences !"!
Exe-cise "

%i,)en0& P-o,ionic 'cid


Connexios Life Sciences !"!
Ro+1) St-+ct+-e
Connexios Life Sciences !"!
S'(,&e fo- Exe-cise "
A compound wherein the compound is

What is claimed is a compound wherein
ring P is an aromatic ring optionally haing substituent!s",
ring # is an aromatic ring optionally further haing substituent!s"
besides $%$C&&',
and X and % are each independently a spacer, or a salt thereof or a
prodrug thereof.
Connexios Life Sciences !"!
T'<e Ho(e 5

Not)in1 is +nf'i- 2)en 0o+ define t)e


sco,e of 0o+- invention.

Ex'(ine-s '-e '&2'0s stin10


Connexios Life Sciences !"!
%IOTECHNOLOG$ CLAIMS
Connexios Life Sciences !"!
T$PE OF CLAIMS

P-od+ct -e&'ted c&'i(s

P-ocess -e&'ted c&'i(s


Connexios Life Sciences !"!
PRODUCT RELATED CLAIMS

Gene se6+ence

A(ino Acid se6+ence

Hecto- 'nd )ost +sed fo- ex,-ession of


t)e 1ene

An 'nti*od0 '1'inst t)e ,-otein I


se6+ence 'nd ' <it ('de f-o( t)e
'nti*od0 I se6+ence
Connexios Life Sciences !"!
GENEIAMINO ACID
SE#UENCES5 Ex'(,&e5 "

.)'t is c&'i(ed is

An iso&'ted n+c&eic 'cid co(,-isin1 ' n+c&eic
'cid se6+ence
ATGGGCCTAACGTGAGGGAATTCGAAATT
O-

.)'t is c&'i(ed is

An iso&'ted n+c&eic 'cid (o&ec+&e co(,-isin1 '


n+c&eic 'cid Se6+ence of SE# ID no. ".
Connexios Life Sciences !"!
GENEIAMINO ACID
SE#UENCES5 Ex'(,&e5

A n+c&eic 'cid (o&ec+&e co(,-isin1 '


n+c&eic 'cid se6+ence t)'t )0*-idi=es to
SE# ID no." +nde- st-in1ent conditions.
Connexios Life Sciences !"!
GENEIAMINO ACID
SE#UENCES5
Ex'(,&e5 F
A n+c&eic 'cid (o&ec+&e co(,-isin1
"G SE# ID no."
OR
G ' n+c&eic 'cid se6+ence t)'t
)0*-idi=es to SE# ID no." +nde-
st-in1ent conditions
Connexios Life Sciences !"!
GENEIAMINO ACID
SE#UENCES5 Ex'(,&e5 B
.)'t is c&'i(ed is

An iso&'ted n+c&eic 'cid (o&ec+&e 2)ic)


encodes ' ,o&0,e,tide co(,-isin1 t)e
'(ino 'cid se6+ence
Met A&' As, As, C0s G&+ P)e H'& G&0 Se- A&'
H'&
O-

An iso&'ted n+c&eic 'cid (o&ec+&e 2)ic)


encodes ' ,o&0,e,tide co(,-isin1 t)e
'(ino 'cid se6+ence of SE# ID NO .
Connexios Life Sciences !"!
OTHER CLAIMS

Hecto-5

A vecto- co(,-isin1 ' n+c&eic 'cid (o&ec+&e
's c&'i(ed in C&'i( ".

Host Ce&&5

A t-'ns1enic )ost ce&& t)'t cont'ins t)e


vecto- co(,-isin1 ' n+c&eic 'cid (o&ec+&e
co(,-isin1 t)e n+c&eic 'cid se6+ence of
SE# ID no.".
Connexios Life Sciences !"!
ANTI%OD$

Iso&'ted Anti*od05

An iso&'ted 'nti*od0 o- f-'1(ent t)e-eof
co(,-isin1 t)e '(ino 'cid se6+ence of
of SE# ID no. .

Anti*od0 >it5

A <it co(,-isin1 t)e 'nti*od0 o-


f-'1(ent t)e-eof of c&'i( ".
Connexios Life Sciences !"!
PROCESS RELATED CLAIMS

Met)od of ex,-ession c&'i(s

%iotec)no&o1ic'& ,-ocess c&'i(s


Connexios Life Sciences !"!
METHOD OF EJPRESSION
CLAIMS
A (et)od of ex,-essin1 ' t'-1et ,-otein o-
,o&0,e,tide co(,-isin1 t)e ste,s of5

AG t-'nsfectin1 ' )ost ce&& 2it) t)e ex,-ession
vecto- of c&'i( A

%G c+&t+-in1 t)e )ost ce&& t-'nsfected 2it) t)e


ex,-ession vecto- +nde- conditions t)'t
,e-(it ex,-ession of t)e t'-1et ,-otein o-
,o&0,e,tideA 'nd

CG iso&'tin1 t)e t'-1et ,-otein o- ,o&0,e,tide.


Connexios Life Sciences !"!
%IOTECHNOLOGICAL PROCESS
CLAIMS
A ,-ocess fo- ('<in1 'n ins+&in ,-ec+-so- o-
'n ins+&in 'n'&o1 ,-ec+-so-; s'id (et)od
co(,-isin1
KiG c+&t+-in1 ' )ost ce&& co(,-isin1 '
,o&0n+c&eotide se6+ence encodin1 'n ins+&in
,-ec+-so- o- 'n ins+&in 'n'&o1 ,-ec+-so-
'cco-din1 to c&'i( " +nde- s+it'*&e c+&t+-e
conditions fo- ex,-ession of s'id ,-ec+-so-A
'nd
KiiG iso&'tin1 t)e ex,-essed ,-ec+-so-.
Connexios Life Sciences !"!
DIAGNOSTIC METHODS

P-od+ct

P-ocess
Connexios Life Sciences !"!
PRODUCT
A di'1nostic <it +sed fo- detectin1 ('&'-i'
'nti*odies in ' *io&o1ic'& s'(,&e co(,-isin1 of
t)e ,-otein encoded *0 SE# ID NO." 2)e-e t)e
s'id ,-otein is *-o+1)t in cont'ct 2it) t)e
*io&o1ic'& s'(,&e +nde- ',,-o,-i'te conditions
2)ic) '&&o2 t)e fo-('tion of 'n i((+ne
co(,&ex; 2)e-ein s'id ,e,tide is &'*e&ed 2it) '
detect'*&e &'*e&.
Connexios Life Sciences !"!
PROCESS
A (et)od fo- in vit-o di'1nosis of ('&'-i'
'nti*odies in ' *io&o1ic'& s'(,&e; co(,-isin1
KiG cont'ctin1 s'id *io&o1ic'& s'(,&e 2it) '
co(,osition co(,-isin1 ' ,-otein encoded *0
SE# ID no" +nde- ',,-o,-i'te conditions 2)ic)
'&&o2 t)e fo-('tion of 'n i((+ne co(,&ex;
2)e-ein s'id ,e,tide is &'*e&ed 2it) ' detect'*&e
&'*e&; 'nd
KiiG detectin1 t)e ,-esence of s'id i((+ne
co(,&exes vis+'&&0 o- (ec)'nic'&&0.
Connexios Life Sciences !"!
Exe-cise
An iso&'ted n+c&eic 'cid encodin1 '
flavonoid methyltransferase (o&ec+&e
*e'-in1 t)e SE# ID no " 'nd its '(ino
'cid se6+ence *e'-in1 SE# ID no
Connexios Life Sciences !"!
S'(,&e C&'i( Exe-cise
An iso&'ted n+c&eic 'cid (o&ec+&e 'cco-din1 to 'n0
one of c&'i(s " to F )'vin1 t)e n+c&eotide
se6+ence co(,-isin15
KiG ' nucleotide sequence set fo-t) in SE# ID NO5"A
KiiG ' nucleotide sequence capable of hybridizing
+nde- &o2 st-in1enc0 conditions to SE# ID NO5 " o-
its co(,&e(ent'-0 fo-(A
KivG ' n+c&eotide se6+ence c','*&e of encoding the
amino acid se6+ence set fo-t) in SE# ID NO5A
2)e-ein s'id n+c&eotide se6+ence encodes ' FMT
(o&ec+&e o- ' (+t'nt; ,'-t; f-'1(ent o- ,o-tion
t)e-eof o- ' f+nction'& 'ndIo- st-+ct+-'& e6+iv'&ent
o- )o(o&o1 t)e-eof.
Connexios Life Sciences !"!
MULTILATERAL
APPLICATION

C&'i( De,endenc0

Fi-st Medic'& Use

Second Medic'& Indic'tionIS2iss C&'i(INe2 Use


c&'i(

P-ocess C&'i(s

P-od+ct *0 ,-ocess

Gene Se6+ence5 Iso&'ted 'nd P+-ifiedIS0nt)etic

Met)od of t-e't(ent; Di'1nosis

Co(*in'tion C&'i(
Connexios Life Sciences !"!
DRAFTING TIPS
P-e d-'ftin1

Unde-st'nd t)e invention

Identif0 t)e c-+x of t)e invention

Conside- '&& ,ossi*&e e(*odi(ents

P&'n t)e st-+ct+-e

P&'0 t)e -o&e of ' devi&s 'dvoc'te


Connexios Life Sciences !"!
DRAFTING TIPS
.)i&e D-'ftin1

>ee, t)e invento- info-(ed.

D-'ft C&'i( o+t&ine *efo-e st'-tin1 to d-'ft t)e


desc-i,tion. Fin'&i=e t)e c&'i( 'fte-
s,ecific'tion is d-'fted

Avoid Unnecess'-0 info-('tion

>ee, in (ind t)e &eve& of PHOSITA 2)i&e


d-'ftin1 t)e c&'i(.
Connexios Life Sciences !"!
Fin'& T'<e )o(e5

%e f-+1'& 2it) 2o-ds

C&'-it0

Eve-0 2o-d Anc)o-ed

%e 1-eed0; %+t do not &ose foc+s of 2)'t


0o+- invention is
Connexios Life Sciences !"!
Re(e(*e-; Its '&& '*o+t5
PR!"#"$%&
!'AR"(Y&
")A*"%A("$%&
+$R#"*,(&
Connexios Life Sciences !"!
Fin'& Exe-cise5

He-*'& fo-(+&'tion 2it) (e&on ext-'ct5


Connexios Life Sciences !"!
Exe-cise F

He-*'& P-e,'-'tion

T)e (edicin'& ,-e,'-'tion co(,-ises of5



". Me&on Ext-'ct KB!DG

. A&oe He-' Ext-'ct K"!DG

F. S'ff-on KCDG

B. P','0' ext-'ct K!DG

C. .'te-
Connexios Life Sciences !"!
S'(,&e c&'i(s
". A ,e-son'& c'-e co(,osition co(,-isin1 of
'G !7E!D of (e&on ext-'ctA
*G !7"!D of (oist+-i=in1 '1entA
cG F7LD of 'nti oxid'tive '1entA
dG"!7F!D of c&e'nsin1 '1entA 'nd
eG ' s+it'*&e so&vent.
". T)e ,e-son'& c'-e co(,osition c&'i(ed in c&'i(
" 2)e-e in t)e s'id c&e'nsin1 '1ent is se&ected
f-o( ' 1-o+, consistin1 of ,','0' ext-'ct;
c+c+(*e- ext-'ct 'nd st-'2*e--0 ext-'ct.
. T)e ,e-son'& c'-e co(,osition c&'i(ed in c&'i(
" 'nd 2)e-e in t)e c&e'nsin1 '1ent is ,','0'
ext-'ct.
Connexios Life Sciences !"!
S'(,&e c&'i(s
B. T)e ,e-son'& c'-e co(,osition c&'i(ed
in c&'i( "; 2)e-e in t)e co(,osition is
'd(iniste-ed 's ' se-+(.
C. T)e ,e-son'& c'-e co(,osition c&'i(ed
in c&'i( "; 2)e-e in t)e co(,osition is
+sed fo- t-e't(ent of viti&i1o.
Connexios Life Sciences !"!
THAN>$OU FOR $OUR
PATIENCE
Hinit' R'd)'<-is)n'n
M'n'1e-; Inte&&ect+'& P-o,e-t0;
Connexios Life Sciences Pvt. Ltd.
vinit'.-Mconnexios.co(