Synthesis of Short-Chain-Length/Medium-Chain Length

Polyhydroxyalkanoate (PHA) Copolymers in Peroxisomes

of Transgenic Sugarcane Plants
David J. Anderson & Annathurai Gnanasambandam &
Edwina Mills & Michael G. OShea & Lars K. Nielsen &
Stevens M. Brumbley
Received: 5 May 2011 / Accepted: 15 June 2011 / Published online: 16 August 2011
# Springer Science+Business Media, LLC 2011
Abstract Metabolic engineering of crops is a potential route
to economically viable production of polyhydroxyalkanoates
(PHAs), biodegradable and renewable alternatives to conven-
tional plastics. In particular, short-chain-length (SCL)/medi-
um-chain-length (MCL) PHA copolymers have attracted
commercial interest for their wide range of potential applica-
tions. To date, examples of SCL/MCL PHA copolymer
production in plant peroxisomes have involved single trans-
gene approaches in transgenic Arabidopsis. We attempted to
produce SCL/MCL PHA copolymers using a multigene
strategy in peroxisomes of the high biomass food and
industrial crop, sugarcane (Saccharum hybrids). Our ap-
proach involved peroxisomal targeting of a 3-ketothiolase,
acetoacetyl-CoA reductase, enoyl-CoA hydratase and PHA
synthase, as well as plastid targeting of a acyl-ACP
thioesterase and 3-ketoacyl-ACP synthase to increase perox-
isomal -oxidation flux. Of 143 transgenic sugarcane lines
generated by co-bombardment with the six transgenes, six
were identified with PHA copolymers at up to 0.015% leaf
dry mass, consisting mainly of saturated C
4
C
16
3-
hydroxyalkanoic acids. One line with high acetoacetyl-CoA
reductase and low 3-ketothiolase transcript levels had
increased 3-hydroxybutyrate content, and acyl-ACP thioes-
terase and 3-ketoacyl-ACP synthase expression were associ-
Communicated by: Robert Birch
D. J. Anderson
:
A. Gnanasambandam
:
E. Mills
:
M. G. OShea
:
S. M. Brumbley
BSES Limited,
50 Meiers Road,
Indooroopilly, QLD 4068, Australia
D. J. Anderson
e-mail: danderson@uq.edu.au
A. Gnanasambandam
e-mail: annathurai.gnanasambandam@dpi.vic.gov.au
E. Mills
e-mail: emills@bses.org.au
M. G. OShea
e-mail: moshea@bses.org.au
D. J. Anderson
:
A. Gnanasambandam
:
E. Mills
:
M. G. OShea
:
L. K. Nielsen
:
S. M. Brumbley
Cooperative Research Centre for Sugar Industry Innovation
through Biotechnology, The University of Queensland,
Brisbane, QLD 4072, Australia
L. K. Nielsen
e-mail: lars.nielsen@uq.edu.au
L. K. Nielsen
:
S. M. Brumbley
Australian Institute for Bioengineering and Nanotechnology,
The University of Queensland,
Brisbane, QLD 4072, Australia
Present Address:
S. M. Brumbley (*)
Department of Biological Science, The University of North Texas,
1155 Union Circle, # 305220,
Denton, TX 76203-5017, USA
e-mail: stevens.brumbley@unt.edu
Present Address:
D. J. Anderson
School of Agricultural and Food Sciences,
The University of Queensland,
Brisbane, QLD 4072, Australia
Present Address:
A. Gnanasambandam
Department of Primary Industries,
Horsham, VIC 3400, Australia
Tropical Plant Biol. (2011) 4:170184
DOI 10.1007/s12042-011-9080-7
ated with altered MCL monomer profiles. SCL/MCL PHA
copolymer from the highest-yielding line showed a weight-
average molecular weight of 111 KDa and polydispersity
index of 1.2. Transmission electron microscopy of leaf
sections fromthis line indicated the presence of PHA granules
in peroxisomes. This work demonstrates SCL/MCL PHA
copolymer biosynthesis in sugarcane peroxisomes and pro-
vides a basis for further development of mechanisms for
controlling PHA composition in transgenic crop plants.
Keywords Polyhydroxyalkanoate
.
copolymer
.
Saccharum
.
Transgenic sugarcane
.
Peroxisome
Abbreviations
ACP Acyl carrier protein
DM Dry mass
HPLC High performance liquid chromatography
PDI Polydispersity index
PHA polyhydroxyalkanoate
PHB polyhydroxybutyrate
SCL short-chain-length
MCL medium-chain-length
GC-MS gas chromatographymass spectrometry
GPC gel permeation chromatography
Introduction
Polyhydroxyalkanoates (PHAs) are polyesters of hydrox-
yacids synthesised by over 100 genera of bacteria as a
carbon and energy reserve (Steinbchel and Hein 2001;
Lenz and Marchessault 2005). They are biodegradable,
renewable, and exhibit a wide range of physical properties,
making them a potential alternative to petrochemical-
derived plastics. (Steinbchel and Valentin 1995; Hazer
and Steinbchel 2007). PHAs are most commonly composed
of R-3-hydroxyalkanoic acids, and are classified by monomer
chain length as short-chain-length (SCL, three to five carbons),
or medium-chain-length (MCL, six to 16 carbons). SCL PHAs
such as polyhydroxybutyrate (PHB) are rigid and brittle with
limited practical uses, while MCL PHAs have elastomeric
properties but lack the mechanical strength required for many
consumer or biomedical products. SCL/MCL PHA copoly-
mers, containing both SCL and MCL monomers, can have a
range of properties to suit a wide variety of applications
(Satkowski et al. 2001; Philip et al. 2007). In the typified
pathway of Ralstonia eutropha, PHB is synthesised from two
molecules of acetyl-CoA by 3-ketothiolase (PhbA),
acetoacetyl-CoA reductase (PhbB) and PHA synthase (PhbC)
activities. Bacteria produce MCL PHAs either by diverting R-
3-hydroxyacyl-ACP intermediates from fatty acid biosynthe-
sis, or production of R-3-hydroxyacyl-CoAs from fatty acid -
oxidation intermediates (Steinbchel 2001). A number of
naturally occurring bacterial strains produce SCL/MCL PHA
copolymers, including Aeromonas caviae (Doi et al. 1995), A.
hydrophila (Lee et al. 2000), and various Pseudomonas
species (Lee et al. 1995; Kato et al. 1996).
Metabolic engineering of bacterial strains to produce
SCL/MCL PHA copolymers has focused on optimising
yield and monomer composition for particular applications
(Zou and Chen 2007). The family of PHA copolymers
developed by Proctor & Gamble and Kaneka under the
trade name Nodax are an example (Noda et al. 2005b).
Their high 3-hydroxybutyrate (H4:0) content (typically
~90 mol%) provides crystallinity for rigidity and strength,
while the smaller MCL proportion decreases melting
temperature and increases ductility for improved process-
ing. Extensive materials testing has demonstrated a range of
potential applications including flexible packaging, agricul-
tural films, moulded articles, disposable sanitary products,
synthetic paper and medical devices (Satkowski et al. 2001;
Noda et al. 2005b). Nonetheless, the higher cost of PHA
production by bacterial fermentation compared to chemical
synthesis of conventional plastics is a major barrier for
large-scale commercial production of PHAs. Engineering of
transgenic crops for PHA production offers a potential
solution, particularly if implemented as a value-added
product (Poirier and Gruys 2005; Bohlmann 2006; van
Beilen and Poirier 2008). However, there are significant
challenges for commercialisation of transgenic crops
producing PHAs, such as achieving economically viable
yields without affecting agronomic performance, regulatory
and market issues associated with transgenic crops, and the
development of more efficient recovery technologies
(Bohlmann 2006; Philip et al. 2007). For SCL/MCL PHA
copolymers, an additional challenge is to control monomer
composition for the required functionality. Attaining the
flexibility and control of composition that is currently
possible with bacterial fermentation in transgenic crops is
likely to be difficult and may restrict the number of viable
end product plastic types (van Beilen and Poirier 2008).
PHB has been produced in a number of plant species
with yields up to 40% dry mass (DM) when accumulated in
plastids (Bohmert et al. 2000), although yields above
approximately 4% DM have typically been associated with
adverse phenotypic effects (Poirier and Gruys 2005). MCL
PHA was first produced in plants using a peroxisomal-
targeted PHA synthase in transgenic Arabidopsis, relying
on supply of R-3-hydroxyacyl-CoAs from -oxidation
intermediates via an unknown mechanism, possibly involv-
ing an enoyl-CoA hydratase II and/or an R-3-hydroxyacyl-
CoA epimerase (Mittendorf et al. 1998). A small number of
studies have demonstrated SCL/MCL PHA copolymer
production in transgenic Arabidopsis with limited control
of monomer composition. In all examples of peroxisomal
Tropical Plant Biol. (2011) 4:170184 171
SCL/MCL PHA production, monomer composition has
been determined soley by the substrate preferences of the
PHA synthase, either natural or engineered (Mittendorf et
al. 1998; Arai et al. 2002; Matsumoto et al. 2005;
Matsumoto et al. 2006). SCL/MCL PHA copolymers with
small MCL contents below 1 mol% have also been
produced in plastids of transgenic Arabidopsis using an
engineered 3-ketoacyl-ACP synthase III (Matsumoto et al.
2009). Other control mechanisms for monomer composi-
tion have been demonstrated with MCL PHA production,
either providing or supplementing MCL monomers from
fatty acid biosynthesis intermediates in plastids (Romano et
al. 2005; Wang et al. 2005) or -oxidation intermediates in
peroxisomes (Mittendorf et al. 1999).
Sugarcane is a high biomass crop that currently
accounts for more than 87% of world sugar and 35%
of world bioethanol production, and is expected to
supply similar proportions of these commodities as their
production increases over the next decade (OECD/FAO,
2010). PHA might potentially be used as a value-adding
co-product in sugarcane either by production in leaves,
which are not usually harvested, or by production in the
culm, where it would need to be extracted along with
sugar. Our group investigated the potential of this crop
for producing PHA by demonstrating and characterising
accumulation of PHB at levels up to 2.5% leaf DM in
leaves of transgenic sugarcane plants using a plastid-
based strategy (Petrasovits et al. 2007; Purnell et al.
2007). More recently, we demonstrated peroxisomal
accumulation of PHB in sugarcane leaves at levels up to
1.6% DM (Tilbrook et al. 2011). Here we investigate the
feasibility of producing SCL/MCL PHA copolymer
in sugarcane. Our transgenic approach consisted of
peroxisome-targeted PHA synthesis enzymes to access
and polymerise substrates from fatty acid -oxidation, and
plastid-targeted enzymes for production of MCL fatty
acids to increase flux through -oxidation (Fig. 1). For co-
polymerisation of SCL and MCL monomers we selected
PhaC2, a PHA synthase with broad substrate specificity
from Pseudomonas fluorescens strain GK13 (Liebergesell
et al. 2002). When expressed in R. eutropha, PhaC2
produces PHA copolymers of variable composition
depending on fatty acid co-feed and concentration, with
H4:0 contents ranging from 21 to 94 mol% (Noda et al.
2005a). To increase H4:0 content, we used R. eutropha
PhbA and PhbB to produce R-3-hydroxybutyryl-CoA
monomers from the peroxisomal acetyl-CoA pool. Finally,
we attempted to increase the availability of MCL
R-3-hydroxyacyl-CoA monomers and PHA yield using an
R-specific enoyl Co-A hydratase (PhaJ), which in bacteria
supplies monomers for MCL PHA synthesis from fatty
acid -oxidation intermediates (Fig. 1). PhaJ2 from
Pseudomonas aeruginosa was selected for its high
stereo-specificity for R-enantiomers and high specific
activities for C
6
C
12
enoyl-CoAs (Tsuge et al. 2003).
To increase carbon flux through fatty acid -oxidation and
supplement MCL content, we used two enzymes that
together are responsible for the high caprate and laurate
content in seed storage lipids of Cuphea wrightii (Leonard
et al. 1998). FatB2 (Fig. 1) is a plastidal acyl-ACP
thioesterase that increases 16:0 seed oil content and causes
unusual accumulation of 10:0, 12:0 and 14:0 when
expressed in Arabidopsis (Leonard et al. 1998). When a
similar plastidial thioesterase was co-expressed with a
peroxisomal PHA synthase in developing seeds of Arabi-
dopsis, the unusual MCL fatty acids generated were
degraded and incorporated as PHA, indicating that plants
sense free fatty acids and upregulate -oxidation in
response (Poirier et al. 1999). KasA1 (Fig. 1) is a
3-ketoacyl-ACP synthase that catalyses extension of 6:0-
and 8:0-ACP, thereby enriching steady state levels of 8:0-
and 10:0-ACP in fatty acid biosynthesis. Co-expression of
KasA1 with FatB2 in Arabidopsis shifts the seed oil fatty
acid profile towards shorter chain lengths, but also
increases production of 12:0 (Leonard et al. 1998). In this
study we demonstrate synthesis of SCL/MCL PHA
copolymers in transgenic sugarcane, and compare mono-
mer contents with expression profiles of the six trans-
genes. We also characterise the molecular weight
distribution for a selected SCL/MCL PHA copolymer,
and investigate the subcellular site of PHA accumulation.
Fig. 1 Schematic diagram of strategy for SCL/MCL PHA copolymer
production in peroxisomes. FAB, fatty acid biosynthesis; FAD, fatty
acid degradation (-oxidation). Transgenic enzymes are indicated in
grey lettering
172 Tropical Plant Biol. (2011) 4:170184
Results
Production and Selection of PHA-Accumulating Transgenic
Sugarcane Plants
The phbA, phbB, phaC2 and phaJ2 genes were modified to
include the C-terminal peroxisomal type 1 targeting
sequence, RAVARL, which efficiently targets heterologous
proteins to peroxisomes in tobacco (Volokita 1991) and
maize (Hahn et al. 1999). This sequence has been used to
target R. eutropha PhbA and PhbC to sugarcane perox-
isomes, while ARL alone is sufficient for PhbB (Tilbrook et
al. 2010; Tilbrook et al. 2011). The FatB2 and KasA1
coding sequences contain native putative plastid-transit
peptides (Leonard et al. 1997; Slabaugh et al. 1998). All
transgenes were placed under the control of the maize Ubi-
1 promoter (Christensen et al. 1992) and nopaline synthase
terminator in direct gene transfer vectors. To facilitate the
recovery of transgenic lines expressing phaJ2, the 3-
aminoglycoside transferase II (nptII) selectable marker and
phaJ2 cassettes were combined in tandem on a single
vector, while expression cassettes for all other transgenes
were contained in separate vectors. Sugarcane embryogenic
callus was co-bombarded with a total of six vectors. Leaf
blade samples from glasshouse-grown sugarcane plants for
143 independent transgenic lines were screened by gas
chromatographymass spectrometry (GC-MS). Ethanol
trans-esterification was used for the screening process due
to problems with unwanted derivatives and loss of the more
volatile esters produced by methanol trans-esterification
during initial method establishment. GC-MS analysis of the
ethanol-transesterified chloroform extracts revealed six
lines with multiple ethyl 3-hydroxyester peaks (~4% of
total lines).
Synthesis of SCL/MCL PHA Copolymers
To enable conclusive identification and quantitative analysis
of monomer content using a full range of known standards,
the six lines were re-analysed using methanol trans-
esterification. GC-MS analysis of derivatised extracts
revealed a number of peaks containing the characteristic
m/z 103 ion corresponding to the methyl 3-hydroxypropionic
acid fragment, which is common to all methyl esters
of saturated 3-hydroxyalkanoic acids and unsaturated
3-hydroxyalkanoic acids with double bonds beyond the
third carbon. The six lines produced low yields of PHA
copolymers that consisted primarily of saturated 3-
hydroxyacid monomers with even-numbered carbon
chains ranging from C
4
C
16
(as shown for line J41 in
Fig. 2a). Small amounts of H5:0 (Fig. 2a) and traces of 3-
hydroxyoctadecanoic acid (H18:0) were also present in
some samples (Fig. 2b).
No methyl 3-hydroxyesters were detected in samples from
leaves of wild type or UKN transformed control plants
(transformed with the vector pUKN, containing only the
selectable marker cassette, kindly provided by Dr Priya Joyce),
with the exception of methyl 3-hydroxybutyrate, which was
detected at very low levels (equivalent to a mean value of
1.4 g/g DM PHB; Table 1). Ethanolysis of wild type and
UKN transformed control leaf samples produced similar
levels of the corresponding ethyl ester (data not shown),
indicating that the 3-hydroxyesters originated from the trans-
esterification reaction. Only line J41 had a H4:0 yield that was
clearly higher than wild type and UKN transformed control
levels (Table 1). Hence, low level H4:0 background is
probably present in all lines, and may comprise a substantial
proportion of the H4:0 content in lines J2, J40, J72 and J142.
The composition of PHA copolymers obtained was
consistent among replicate samples and broadly similar
across the six lines, with H8:0 comprising the largest molar
proportion in all cases. Conversely, H5:0 and H16:0
comprised the smallest and second smallest molar propor-
tions in most lines. Mean total PHA yields ranged from
17 g/g DM (J40) to 87 g/g DM (J41), while the
maximum total PHA yield for an individual sample was
155 g/g DM (0.0155%) for line J41 (Table 1). Since the
mean recovery of PHB standard applied to the ground
sample matrix through the entire extraction and analysis
process was 16.5% (Table 1), the measured yields are likely
to be ~six-fold underestimates of actual PHA contents,
assuming similar recoveries for each monomer species.
The PHA copolymer compositions contrast with the MCL
PHA copolymers obtained by Mittendorf et al. (1998) from
Arabidopsis seedlings expressing P. aeruginosa PhaC1,
which contained substantial proportions of unsaturated 3-
hydroxyalkanoic acids, as well as trace amounts of some
saturated 3-hydroxyalkanoic acids with uneven numbers of
carbons. However, close inspection of the GC-MS chromato-
grams revealed a number of minor peaks for the m/z 103 ion
that were not present in wild type or UKN transformed
controls (Fig. 2b). Due to the small size of the peaks relative
to background, identification of the mass spectra with total
ion chromatograms was not possible. Based on the m/z value
and comparison with the elution order under similar
conditions presented by Mittendorf et al. (1998), we
putatively assigned these as methyl esters of unsaturated 3-
hydroxyalkanoic acids or saturated 3-hydroxyalkanoic acids
with uneven numbers of carbons (Fig. 2b).
Comparison of Transgene Expression and PHA
Composition
Expression levels of the six transgenes for the peroxisome
strategy were determined in cDNA populations of all PHA-
producing lines except J171, which was lost under
Tropical Plant Biol. (2011) 4:170184 173
glasshouse conditions. We selected competitive PCR and
MassARRAY technology for transgene expression anal-
ysis for high sensitivity and amenability for multiplexing
(Ding and Cantor 2003; Oeth et al. 2004). This methodol-
ogy quantifies endogenous transcript using a synthetic
oligonucleotide differing from the target amplicon at one
base position as an internal control (the competitor).
Competitor and target PCR products are subjected to a
primer extension reaction and detected by matrix-assisted
laser desorption ionization time-of-flight mass spectrometry
(MALDI TOF MS). Since known quantities of the
competitor are used, absolute quantities of a transcript can
be determined within a sample without reference to an
external standard. From expression data for actin, 18S RNA
and glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
genes, the latter two were selected and used for normal-
isation with the geNORM algorithm (Vandesompele et al.
2002) to obtain final transcript levels (Table 2). No
transcripts for any of the six transgenes were detected in
wild type or UKN transformed control lines. As expected,
Fig. 2 Comparison of GCMS
chromatograms for methanol-
transesterified chloroform
extracts from a UKN trans-
formed control line (inverted)
and line J41. a Major saturated
methyl 3-hydroxyester peaks.
Chromatograms shown were
collected in selective ion
monitoring mode and consist
of ions with m/z ratios of 71, 74
and 103, except for the internal
standard region from 11.56-
11.8 min, which shows ions with
m/z ratios of 77, 105, and 136.
b Minor putative unsaturated
methyl 3-hydroxyester saturated
methyl 3-hydroxyesters with
odd numbers of carbons. i-std,
internal standard (methyl
benzoate). Chromatograms
show only the m/z ratio 103 ion.
Methyl esters are indicated by
their corresponding 3-
hydroxyalkanoic acid label
174 Tropical Plant Biol. (2011) 4:170184
phaC2 transcripts were present in all five PHA-producing
lines analysed, all at similar levels ranging from 3.0 to 6.7
fM. Despite inclusion of the nptII selectable marker on the
same vector, phaJ2 expression was only detected in lines
J72 and J142 at very low levels. Transcripts for phbA and
phbB were absent in lines J2 and J40, respectively, but
present in all others. However, all phbA levels were at or
below 2.7 fM, whereas phbB transcripts were expressed at
levels up to 13.4 fM. Line J41, the only line with a H4:0
yield clearly above wild-type levels, had both the lowest
level of phbA transcripts and the highest level of phbB
transcripts of any line that co-expressed phbA.
Four lines showed FatB2 transcript expression, with the
highest level in J142, while all five lines tested showed
varying levels of KasA1 transcript expression (Table 2).
When expressed in transgenic Arabidopsis, FatB2 elevates
wild type 16:0 and generates novel 14:0, 12:0 and 10:0
(Leonard et al. 1998). Superimposed on the wild type profile
of beta-oxidation intermediates, FatB2 could be expected to
increase H10:0-H16:0 proportions. Line J2 functions as a
FatB2-negative control, with its KasA1 expression expected
to have little or no effect on the fatty acid profile in the
absence of FatB2 (Leonard et al. 1998). The closest
approximation to a FatB2-positive, KasA1-negative line
obtained was J72, which had the second highest FatB2 and
lowest KasA1 transcript levels. Molar proportions of H10:0,
H12:0, H14:0 and H16:0 were all greater in J72 compared to
J2 (Fig. 3a). As expected, the FatB2-expressing lines J40 and
J142 also had larger combined H10:0-H16:0 proportions
than J2 (Fig. 3a). However, line J41 did not, possibly due to
dilution by large H4:0 and H8:0 proportions. Given the
results of Leonard et al. (1998), co-expression of FatB2 and
KasA1 would be expected to increase H10:0 and H12:0 at
the expense of H14:0 and H16:0 when compared as
proportions of total H10:0-H16:0 content. Accordingly, all
lines co-expressing FatB2 and KasA1 had molar proportions
shifted towards H10:0 and H12:0 relative to J2 (Fig. 3b),
which lacked FatB2 expression.
J41 SCL/MCL PHA Copolymer has a Moderate Molecular
Weight and Low Polydispersity
The molecular weight distributions of copolymers produced
by lines J2, J40, J41, J72 and J142 were investigated by gel
permeation chromatography (GPC) using scaled-up PHA
extractions. Chloroform extracts of line J41 showed a single
peak that was not present in wild type or UKN transformed
control samples (data not shown). Although a chloroform
extract of line J2 also contained a single peak at the same
retention time, it was not sufficiently large for analysis. No
peaks were observed for lines J40, J72 or J142, probably
due to their very low PHA yields. Based on chloroform
solubility and absence from wild type and UKN trans-
formed control extracts, we concluded that the peaks
identified for lines J2 and J41 represented PHA. The PHA
copolymer in line J41 showed a weight-average molecular
weight (M
w
) of 111 KDa and a polydispersity index (PDI)
of 1.2 (Table 3). Standards of bacterial origin for PHB and
poly[3-hydroxybutyrate-co-3-hydroxyhexanoate] (PHB-
PHHx) had larger molecular weights of 2.3710
5
and
6.7110
5
, respectively, as well as larger PDI values of 3.0
and 3.4, respectively. To assess the effect of the extraction
process on molecular weight distribution, 5 g of the PHB
standard was extracted following application onto the
ground wild type sugarcane leaf matrix and analysed. The
extraction process resulted in a 20.7% reduction in Mw
compared to the non-extracted value (Table 3). It is known
Table 1 Yields of chloroform-extractable PHA from wild type, spiked wild type and mature transgenic leaf samples
Line (no. replicate extractions) WT (2), UKN (1) WT+PHB (5) J2 (3) J40 (4) J41 (5) J72 (5) J142 (5) J171 (4)
Total PHA (g/g DM) Max. 2.1 7.2 33.8 18.5 154.8 30.0 121.0 113.3
Mean 1.4 6.7 27.0 16.7 86.7 22.5 67.5 80.4
SE 0.4 0.2 3.5 0.6 17.1 2.3 20.9 18.2
H4:0 (g/g DM) Mean 1.4 6.7 3.2 1.6 15.7 1.6 1.9 3.2
SE 0.4 0.2 0.6 0.2 1.6 0.1 0.1 0.3
DM dry mass; WT wild type; UKN UKN transformed control; WT+PHB wild type spiked with 5 g PHB. The number of independent replicate
extractions is indicated in brackets next to the line label. Samples consisted of pooled blade tissue from the six oldest, non-senescent leaves from
one plant, and thus extractions from this material are analytical replicates
Table 2 Absolute transcript expression levels for five PHA-producing
lines determined using competitive PCR and MassARRAYtechnology
Line phbA phbB phaC2 phaJ2 FatB2 KasA1
J2 13.4 3.9 0.8
J40 1.5 4.2 6.3 1.4
J41 0.4 11.7 3.0 5.6 0.6
J72 2.7 3.2 4.0 0.1 7.3 0.5
J142 1.1 2.2 6.7 0.1 28.5 5.1
The fM values shown represent the mean of two replicate analyses of
the same cDNA sample. R
2
values for all standard curves were >0.9
Tropical Plant Biol. (2011) 4:170184 175
that the molecular weight distribution of PHB extracted
from bacteria can be influenced by the extraction process
used (Holmes 1988). Hence the data for line J41 are
probably an underestimate of the actual Mw.
Compared to PHA copolymer from line J41, PHB extracted
fromleaves of the transgenic sugarcane line TA4 (Petrasovits et
al. 2007) and analysed in this study showed a ~7-fold higher
molecular weight of 8.4510
5
and a ~4-fold higher PDI of 5.0
(Table 5). Poirier et al. (1995a) reported a similarly high
molecular weight but larger PDI value for PHB produced by
transgenic Arabidopsis suspension cells (Table 3). In both
cases, PHB biosynthesis involved R. eutropha PhbC. Using
P. aeruginosa PhaC1, Mittendorf et al. (1998) reported a
lower M
w
and more polydisperse distribution for MCL PHA
copolymers produced in transgenic Arabidopsis than for line
J41 PHA copolymer, while Nakashita et al. (1999) reported a
lower Mw but similar polydispersity for PHB produced in
transgenic tobacco using A. caviae PhaC (Table 3).
Accumulation of PHA Copolymer in Peroxisomes
To investigate the subcellular localisation of the PHA copoly-
mers, we examined leaf sections of the PHA-producing lines by
transmission electron microscopy. Characteristically, peroxi-
somes are (1) bounded by a single membrane, (2) spheroid in
shape, ranging from 0.21.7 m in diameter, and (3) contain a
coarsely granular or fibrillar matrix, occasionally with amor-
phous or paracrystalline inclusions (Huang et al. 1983; Fig. 4a).
While most peroxisomes from line J41 appeared normal, a
small proportion from various leaf cell types contained
electron-lucent, granular inclusions approximately 0.1
0.2 m in size (Fig. 4bd) surrounded by a thin, electron-
dense layer. These features are typical of the appearance of
PHA granules produced in bacteria as well as various plant
organelles (Poirier and Gruys 2005), which reflects a structure
consisting of a PHA core surrounded by a phospholipid
membrane embedded with PHA synthase and other protein
molecules (Rehm 2003). The granules observed here are also
highly similar to PHB granules produced in sugarcane leaf
peroxisomes (Tilbrook et al. 2011). No inclusions were found
in UKN transformed control (Fig. 4a) or wild type leaf
peroxisomes (data not shown). Based on the cellular location,
absence from wild type and UKN transformed control samples,
and close resemblance to typical bacterial and plant PHA
granules, we conclude that the granules consist of PHA
copolymer. No inclusions that were clearly identifiable as PHA
granules were found in leaf cell peroxisomes of lines J2, J40,
J72 or J142 (data not shown). It may be that PHA inclusions
were more rare or difficult to identify in these lines due their
lower PHA yields and/or lower SCL monomer contents.
Discussion
Evaluation of Mechanisms for Regulating PHA Copolymer
Composition
We aimed to produce PHA copolymers with regulated mono-
mer content in sugarcane peroxisomes using three mecha-
nisms. The first mechanism drewon peroxisomal acetyl Co-A
to increase H4:0 content using 3-ketothiolase and acetoacetyl-
CoAreductase activities. Auseful comparison to the results of
this study is provided by the recent demonstration by our
Fig. 3 Compositions of chloroform-extractable PHA copolymers
from transgenic lines as determined by GC-MS. a Total monomer
proportions. b H10:0 H16:0 monomer proportions only. Mean
mol% values are shown within bars for each monomer series, and the
number of independent sample extractions is indicated in brackets
next to the line label. Samples consisted of pooled blade tissue of the
six oldest, non-senescent leaves from one plant, and thus extractions
from this material are analytical replicates. Error bars show SE
176 Tropical Plant Biol. (2011) 4:170184
Table 3 Comparison of molecular weight distributions of PHAs from lines J41 and TA4 to standards, and PHAs previously produced in
transgenic plants
Sample M
w
10
3
M
n
10
3
M
w
/M
n
PHA source PHA synthase Reference
Line J41 111.4 94.0 1.2 Sugarcane leaves
(peroxisomes)
P. fluorescens PhaC2 This study
Line TA4
(PHB producer)
845.1 168.0 5.0 Sugarcane leaves
(plastids)
R. eutropha PhbC (Petrasovits et al. 2007);
this study
PHB 237.3 79.2 3.0 Standard from
R. eutropha
R. eutropha PhbC This study
Wild type sugarcane
leaves+PHB
188.2 81.5 2.3 Standard from
R. eutropha, applied
onto ground leaf matrix
R. eutropha PhbC This study
PHB-PHHx 671.5 196.2 3.4 Standard from A. hydrophila A. hydrophila PhaC This study
PHB 615.0 58.7 10.5 Arabidopsis suspension
cells cytoplasm
R. eutropha PhbC (Poirier et al. 1995b)
MCL PHA
copolymers
23.7 5.5 4.3 Arabidopsis seedlings
(peroxisomes)
P. aeruginosa PhaC1 (Mittendorf et al. 1998)
PHB 57.6 32.0 1.8 Tobacco leaves
(cytoplasm)
A. caviae PhaC (Nakashita et al. 1999)
PHB-PHHx poly[3-hydroxybutyrate-co-3-hydroxyhexanoate]
Fig. 4 Transmission electron
micrographs of leaf sections
from a UKN transformed
control line and PHA-producing
line J41. a Peroxisomes within a
UKN transformed control line
bundle sheath cell (image kindly
provided by Ms. Kimberley
Tilbrook); (b-d) PHA inclusions
within peroxisomes of line
J41 mestome sheath (b), phloem
companion (c) and bundle
sheath (d) cells. Labels: c,
chloroplast; cw, cell wall; i,
inclusion; m, mitochondrion; n,
nucleus; p, peroxisome; v,
vacuole; ve, vesicle. Scale bars:
(a) 500 nm; (b-d) 250 nm
Tropical Plant Biol. (2011) 4:170184 177
group of PHB production in sugarcane peroxisomes. Tilbrook
et al. (2011) observed PHB at levels up to 1.6% DM in
leaves of transgenic sugarcane plants containing the same
peroxisome-targeted R. eutropha PhbA and PhbB enzymes
in combination with R. eutropha PhbC. This indicates that
PhaC2 was a key limiting factor for yield in this study, which
could be due to either incomplete silencing of the phaC2
transgene, low PhaC2 activity in the sugarcane peroxisome
context, or both. While the modest (~1.5-fold) increase in
H4:0 content in line J41 compared to the other lines (Fig. 3a,
Table 4) holds some promise that PhbA and PhbB may be
useful for boosting the H4:0 content of PHA copolymers
produced in peroxisomes, analysis of a larger number of
lines would be required to demonstrate an effect. Evaluation
of the effect of PhaA and PhaB would be facilitated by
higher PHA copolymer yields, which might be achieved via
optimised PHA synthase expression and/or the use of
alternate PHA synthases with broad substrate specificities.
The second mechanism used FatB2 and KasA1 to supply
unusual MCL fatty acids from plastid fatty acid biosynthesis.
The PHA composition and transgene expression data provided
some evidence that FatB2 may have increased H10:0-H16:0
contents, and in combination with KasA1, shifted the
distribution within H10:0-H16:0 towards H12:0 and H10:0
(Fig. 3, Table 2). However, no conclusions about the effect
can be made with the small number of transgenic lines
obtained. Since carbon flux through fatty acid biosynthesis in
sugarcane leaves is expected to be low compared to tissues
such as developing Arabidopsis seeds, any effects of FatB2
and KasA1 are likely to be subtle and may require a large
number of lines to establish.
Finally, the third mechanism attempted to enhance diversion
of MCL -oxidation intermediates with an R-specific enoyl-
CoA hydratase. No conclusions could be made about this
mechanism due to the lack of any substantial phaJ2 expression
(Table 2). This was unexpected since phaJ2 was contained on
Table 4 Sources and primers used for amplification of transgenes
Vector Gene(s) Source
organism
Genbank
accession
Forward primer
(5'-3')
Reverse primer
(5'-3')
Amplicon
size (base
pairs)
pATS phbA R. eutropha J04987 TGAGGATCCAT
GACTGACGTTG
TCATCGTATCCG
ACTGAGCTCTTAT
AATCTGGCAACA
GCACGTTTGCGCT
CGACTGCCAGCG
1218
pBTS phbB R. eutropha J04987 TGAGGATCCAT
GACTCAGCGCA
TTGCGTATG
ACTGAGCTCTTAT
AATCTGGCAACA
GCACGGCCCATAT
GCAGGCCGCCG
777
pC2TS phaC2 P. fluorescens AX105569 CAGTGATCAAT
GCGAGAGAAAC
AGGTGTCG
ACTGAGCTCTTAT
AATCTGGCAACA
GCACGGCGCACGT
GCACGTAGGTGC
1719
pFB2 FatB2 C. wrightii U56104 AAAGGATCCAA
ACATGGTGGTG
GCTGC
TCGGAGCTCTTTCA
TGTTGATATCGCC
1251
pKA1 KasA1 C. wrightii U67316 GGCAGATCTTT
GGTGTTTCAAT
GGCGG
TGGGAGCTCGGCA
TTAAGCTACTAAC
G
1689
pJ2K phaJ2 P. aeruginosa AB040026 CGCGGATCCAT
GGCGCTCGATC
CTGAG
ACTGAGCTCTTAT
AATCTGGCAACA
GCACGGTCCGGCC
GCTCTGGCGG
908
pJ2K nptII E. coli E00425 CCGAAGCTTGA
ATACGAATTCC
CGATC
CCGAAGCTTGAAT
ACGAATTCCCGAT
C
3312
Restrict ion enzyme sites: BamHI, BclI, BglII, SacI, Hind III. Bases encoding the peroxisome targeting signal RAVARL are indicated in bold
type.
178 Tropical Plant Biol. (2011) 4:170184
the same vector as the selectable marker, and all five other
genes used for the strategy were expressed at 10-fold or greater
levels in at least some lines. One possible explanation is that the
lack of phaJ2 expression was caused by efficient transgene
silencing, which is a known problem in sugarcane (Mudge et
al. 2009; Birch et al. 2010). Another possibility is that
expression of PhaJ2 is harmful, and that only lines with low
or no expression were recovered through the somatic embryo-
genesis and selection process. Some Arabidopsis double
mutants for genes encoding core -oxidation enzymes have
known embryo-lethal phenotypes (Goepfert and Poirier 2007).
Consistent with the small proportion of natural lipids with
odd-numbered carbon chains, only trace amounts of putative
H7:0, H9:0, H11:0 and H13:0 were detected (Fig. 2b).
However, higher levels of H5:0 were present, as noted
previously for PHA copolymers produced in plant perox-
isomes (Arai et al. 2002; Matsumoto et al. 2006; Tilbrook et
al. 2011). It has been suggested that this phenomenon may
be due to an unknown metabolic flux (Arai et al. 2002),
possibly via condensation of propanoyl-CoA and acetyl-
CoA to yield 3-ketopentanoyl-CoA, and subsequent reduc-
tion to 3-hydroxypentanoyl-CoA (Matsumoto et al. 2006). It
is also interesting that H8:0 was the most abundant monomer
by molar proportion in all lines (Fig. 3a). A similar
abundance of H8:0 and 3-hydroxyoctenoic acid (H8:1) was
observed by Mittendorf et al. (1998) in MCL PHA
copolymers produced by Arabidopsis seedlings expressing
peroxisomal P. aeruginosa PhaC1 PHA synthase. H8:0 was
also the dominant saturated monomer in PHA accumulated
in Arabidopsis seeds using the same peroxisome-targeted
PHA synthase (Poirier et al. 1999). Mittendorf et al. (1998)
concluded that their results were consistent with trienoic and
dienoic fatty acids with cis double bonds at an even carbon
undergoing -oxidation via an epimerase pathway, which
involves direct production of R-3-hydroxyoctenoyl-CoA and
R-3-hydroxyoctanoyl-CoA intermediates, respectively.
In contrast, we did not detect any H8:1 and putatively
identified only trace peaks for other unsaturated PHA mono-
mers (Fig. 2b), probably reflecting the differences in fatty acid
metabolism between sugarcane leaves and Arabidopsis seed-
lings. The lack of H8:1 and scarcity of other unsaturated
monomers rules out -oxidation via an epimerase pathway as
an explanation for the high molar proportion of H8:0 in our
case. It is also unlikely that the substrate specificities of
PhaC2 are responsible, since the enzyme is capable of
producing PHAs with a broad range of MCL contents (Noda
et al. 2005b). An alternative explanation is that eight-carbon
-oxidation intermediates are present at higher steady state
levels compared to intermediates of other chain lengths. This
might be caused by differing chain-length specificities of
enzymes catalysing any of the four core -oxidation
reactions. For example, plants contain a family of acyl-
CoA oxidases with partially overlapping substrate specific-
ities that catalyse the first step of the -oxidation cycle
(Arent et al. 2008). Interestingly, the three acyl CoA oxidases
with known SCL or MCL activities all have comparatively
low specific activities for octanoyl-CoA, which forms the
overlap point for their specific activity profiles (Froman et al.
2000).
Physical Properties of SCL/MCL PHA Copolymer
Produced
The substantial MCL monomer content of the PHA
copolymer produced by line J41 (~65 mol%; Fig. 3a)
would be expected to exhibit very elastomeric properties,
and considerably higher H4:0 content would probably be
required for commercial applications. This might be achieved
in two ways. The first is to increase the availability of R-3-
hydroxybutyryl-CoA, as we have attempted in this study
using phbA and phbB. The second is to use an alternate PHA
synthase with substrate specificity characteristics that will
produce PHA with the required H4:0 content from the
available R-3-hydroxyacyl-CoAs in the peroxisome. For
example, Pseudomonas sp. 613 PhaC1 expressed in
Arabidopsis peroxisomes produced PHA copolymers with
an average of 40 mol% H4:0 (Matsumoto et al. 2006).
PHA copolymer from line J41 showed a low molecular
weight and polydispersity compared to bacterial PHB and
PHB-PHHx standards, but similar to some previous
examples of PHAs produced in plants. Low polydispersity
values such as that determined for J41 PHA copolymer are
not uncommon for biological polymers. For example, P. sp.
613 PhaC1 expressed in E. coli produced SCL/MCL PHA
copolymer with a PDI of 1.5 (Takase, 2004). Higher
molecular weights of 500,000-700,000 are typically re-
quired for commercial applications (Noda et al. 2005b).
This might be achieved using PHA synthases engineered for
production of higher molecular weight PHA, of which there
have been several examples (Nomura and Taguchi 2007).
Opportunities for Increasing PHA Yield in Plant
Peroxisomes
The maximum PHA yield of 0.015% DM obtained is lower
but comparable to several previous examples of PHA
copolymer production in Arabidopsis peroxisomes in vege-
tative leaves using other PHA synthases. It is approximately
3-fold less than for A. caviae PhaC (Arai et al. 2002); three-
quarters of the yield obtained with P. aeruginosa PhaC1
(Mittendorf, 1998); and two thirds that for P. sp. 61-3 PhaC1
(Matsumoto et al. 2006). A higher level of 0.4% DM MCL
PHAwas achieved by expression of P. aeruginosa PhaC1 in
7-day-old germinating seedlings, in which -oxidation is
strongly induced for mobilisation of seed lipid reserves
(Mittendorf et al. 1999). Nonetheless, PHB yields of 1.6%
Tropical Plant Biol. (2011) 4:170184 179
DM in sugarcane leaf peroxisomes (Tilbrook et al. 2011) and
approximately 2.0% DM in maize suspension cells (Hahn et
al. 1999) indicate that peroxisomes have the potential for
greater PHA production. As already noted, the PHA synthase
used may be a key determinant of PHA yield, and may
explain the large yield differences between studies pro-
ducing PHA copolymers with MCL content and those
producing PHB. It has been suggested that the high PHA
yields that occur in bacteria from-oxidation may be enabled
by a 3-hydroxyacyl-CoAepimerase or other activity that is not
present in plants, and that metabolic channeling of intermedi-
ates in plant peroxisomes may also limit yields (van Beilen
and Poirier 2008). If this is the case, R-specific enoyl-CoA
hydratases may hold potential for yield improvement if
expression can be achieved. PHA yield might also be
improved by increasing the activities of the PHA synthase
and other enzymes, either through optimisation of transgene
expression or the use of engineered enzymes.
Methods
Gene Constructs
All transformation vectors were based on the pU3Z-mcs-nos
vector (McQualter et al. 2005) which is a modification of
pAHC20 (Christensen and Quail 1996) that contains the
maize ubi-1 promoter and nos terminator. Transgenes were
amplified using the primers listed in Table 4 from plasmids
containing the genes. The plasmids were kindly provided by:
Prof. Yves Poirier, University of Lausanne, Switzerland
(phbA and phbB); Dr. Phil Green, The Proctor and Gamble
Company, Cincinnati, Ohio, USA (phaC2); Dr. Priya Joyce,
BSES Limited (nptII); Dr. Mary Slabaugh, Oregon State
University, Corvallis, Oregon, USA (FatB2 and KasA1);
Prof. Y. Doi, RIKEN Institute, Saitama, Japan (phaJ2). The
amplification products were digested with BamHI/SacI,
except for the phaC2 and KasA1 products, which were
digested with BclI/SacI and BglII/SacI, respectively. The
digested transgene amplification products were cloned into
pU3Z-mcs-nos digested with BamHI/SacI. To construct
pJ2K, phaJ2 was inserted into pU3Z-mcs-nos to create an
intermediate vector, pJ2. pJ2 was linearized with HindIII and
ligated to the amplified Ubi-1 promoter::nptII::nos terminator
cassette with compatible ends produced by digestion with
HindIII. A clone with the phaJ2 and nptII cassettes oriented
in the same direction to each other and the amp
R
gene was
selected as the transformation vector pJ2K.
Sugarcane Transformation
Embryogenic callus cultures of commercial sugarcane
cultivar Q117 were initiated and maintained as described
by Bower et al. (1996). Essentially, 4 days following
subculture, nodular embryogenic callus pieces of 3 to 5 mm
diameter were arranged to cover a circle of approximately
3 cm diameter on MSC
3
medium supplemented with 0.2 M
mannitol and 0.2 M sorbitol as an osmotic treatment for 4 h
prior to bombardment and 4 h after bombardment. Calli
were bombarded with 1 m DNA-coated gold micro-
projectiles (Bio-Rad Laboratories, Hercules, CA, USA)
using the Bio-Rad PDS-1000 system (Bio-Rad Laborato-
ries) at 1200 psi. Microprojectile preparation and bombard-
ment were carried out according to the manufacturers
instructions. Following bombardment, embryogenic calli
were cultured on MSC3 medium in darkness without
selection for 3 days. They were then transferred to MSC3
medium containing 50 mg/L G418 (Geneticin

, Life
Technologies Corporation, Carlsbad, California) in darkness
and subcultured every 2 weeks to provide escape-free
selection. After 810 weeks, actively growing calli were
placed on MSC0 medium (MSC3 medium without 2,4-D)
containing 50 mg/L G418. Regeneration of plants from callus
occurred 812 weeks after transfer to MSC0. Only one shoot
was recovered from each antibiotic-resistant callus clump to
ensure that each transgenic line was derived from an
independent transformation event. Regenerating plants were
maintained at 28C under fluorescent lights until ready for
establishment in pots in a containment glasshouse.
PHA Extractions and GC-MS Analysis
Samples for PHA extractions were taken from pooled leaf
blade tissue of the six oldest, non-senescing leaves of
primary stalks of 1314 month-old sugarcane plants. The
excised tissue was freeze dried for at least 18 h before
storage at 20C until use. The PHA extraction method for
initial screening of transgenic lines was adapted from Arai
et al. (2002). Approximately 100 mg freeze dried leaf blade
tissue was pulverised for 20 min at 30 Hz in a Retsch
MM300 ball mill (Retsch GmbH, Haan, Germany). Ground
powder was transferred to glass centrifuge tubes (Corning
#8142-10 with #9998 phenolic/PTFE seal cap, Corning,
NY, USA, supplemented with custom-made 1 mm thick
PTFE seal) and weighed. To remove lipids and other
contaminants, the powder was extracted with 8 mL
n-hexanes at 55C, centrifuged at 3000g, and the superna-
tant discarded. This extraction was repeated six times over
24 h, followed by an identical extraction protocol with
methanol, then evaporated to dryness. PHA was extracted
from the dried powder with 4 mL chloroform overnight at
55C. All extractions were performed at 55C with constant
mixing in a Hybaid rotary hybridisation oven (Thermo-
Electron Corp. Waltham, MA, USA). The PHA-containing
chloroform was extracted twice with 4 mL water to remove
solids, then evaporated to a volume of 0.5 mL. The
180 Tropical Plant Biol. (2011) 4:170184
chloroform extract was subjected to ethanolysis by adding
1.7 mL ethanol, 0.2 mL concentrated HCl, and incubating at
100C for 4 h. Following ethanolysis, 2 g of methyl 3-
hydroxypentanoate was added as an extraction standard for
the remaining steps. The chloroform phase was recovered by
extraction with 7 mL 0.9 M NaCl and neutralised by
extraction with 2 mL saturated Na
2
CO
3
. Methyl 3-
hydroxybutyrate was added as an internal standard and the
purified chloroform phase analysed on an Agilent 6890 gas
chromatograph (Agilent HP-5MS 30 m column, 250 m
internal diameter, 0.25 m film) coupled to an Agilent 5973
mass spectrometer (Agilent Technologies, Santa Clara, CA,
USA). Methyl 3-hydroxybutyrate and the target standards
ethyl-3-hydroxybutyrate and ethyl-3-hexanoate were pur-
Table 5 Primer and competitor sequences used for transgene expression analysis.
Gene Amplicon size
(base pairs)
Forward PCR primer Reverse PCR primer Extension primer Target sequence [ALLELE/
competitor]
18S RNA 90 ACGTTGGATGTCCGCA
TAGCTAGTTAGCAG
ACGTTGGATGTTGGTG
GAGCGATTTGTCTG
TTTGTCTGGTTA
ATTCCGTTAA
ATGGGTGCATCTTTGCTTG
GGGCAGAGATAACAACC
TTCTTG[C/a]CACCACCC
TTCAGATGCGCAGCAGC
CTTGTCCTTGTCAGTGAA
GAPDH 106 ACGTTGGATGATGGGT
GCATCTTTGCTTGG
ACGTTGGATGTTCACT
GACAAGGACAAGGC
GCATCTGAAGGG
TGGTGC
ATGGGTGCATCTTTGCTTG
GGGCAGAGATAACAACC
TTCTTG[C/a]CACCACCCT
TCAGATGCGCAGCAGCC
TTGTCCTTGTCAGTGAA
Actin 85 ACGTTGGATGAAAGG
CCAACAGGGAGAAGA
ACGTTGGATGCGTACA
TGGCAGGAACATTG
ACATTGAAAGTCT
CGAACATAATCC
CGTACATGGCAGGAACATT
GAAAGTCTCGAACATAAT
C[A/c]GGGTCATCTTCTCC
CTGTTGGCCTTT
phbA-TS 72 ACGTTGGATGAAATCC
ACCCGTCGGCACCT
ACGTTGGATGGGATAC
GATGACAACGTCAG
GACAACGTCAGT
CATGG
AAATCCACCCGTCGGCAC
CTCCGCTTCAAGGTCGA
CTCTAGAGGA[T/a]CCATG
ACTGACGTTGTCATCGTA
TCC
phbB-TS 117 ACGTTGGATGAATGGC
GGTTCCGATACCAC
ACGTTGGATGTCGGC
ACCTCCGCTTCAAG
CTCTAGAGGATCC
ATGAC
AATGGCGGTTCCGATACCA
CCCATGCCGCCGGTCACA
TACGCAATGCGCTG[A/g]G
TCATGGATCCTCTAGAGTC
GACGCTAGACAAGTCAG
ATTCTC
phaC2-TS 120 ACGTTGGATGTGCGC
GTTCATGTAGTTAGC
ACGTTGGATGTCGGC
ACCTCCGCTTCAAG
CTCCCGACACCT
GTTTC
TGCGCGTTCATGTAGTTAGC
GGGGACCGGCAAGGCTC
CCGACACCTGTTTC[T/c]C
TCGCATTGATCCTCTAGAG
TCGACCTTGAAGCGGAG
GTGCCGA
phaJ2-TS 94 ACGTTGGATGGTAGT
TCAGGAGCACCTCAG
ACGTTGGATGTCGGC
ACCTCCGCTTCAAG
CCCCAGCACCTC
AGGATCGAG
GTAGTTCAGGAGCACCTCA
GGATCGAG[C/t]GCCATGG
ATCCTCTAGAGTCGACCTT
GAAGCGGAGGTGCCGA
FatB2 118 ACGTTGGATGCTAGGT
GCTGGAACAGGGAA
ACGTTGGATGTCGGC
ACCTCCGCTTCAAG
TGGAACAGGGA
AGAATGC
CTAGGTGCTGGAACAGGGA
AGAATGC[A/t]GAACTTGC
TGCAGCAGCCACCACCAT
GTTTGGATCCTCTAGAGTC
GACCTTGAAGCGGAGGTG
CCGA
KasA1 113 ACGTTGGATGGTACA
GAATGGGGACGCAAC
ACGTTGGATGTCGGC
ACCTCCGCTTCAAG
GACGCAAC
CATGGAAGC
GTACAGAATGGGGACGCAA
CCATGGAAGC[G/c]GCGGC
CGCCATTGAAACACCAAA
GATCCTCTAGAGTCGACCT
TGAAGCGGAGGTGCCGA
The universal 5 PCR primer tag is indicated in bold type
Tropical Plant Biol. (2011) 4:170184 181
chased from Sigma Aldrich (St Louis, Missouri); methyl 3-
hydroxypentanoate from Fluka AG (Buchs, Switzerland).
A modified version of this method was used for final
analyses of PHA-producing lines, with the following
modifications: (1) Methyl 3-hydroxybutyrate and methyl
3-hydroxypentanoate were replaced by methyl benzoate,
which was added prior to methanolysis, acting as an
extraction standard for subsequent steps and an internal
standard for GC-MS analysis; (2) The chloroform extract
was subjected to methanolysis rather than ethanolysis
using the same procedure, by replacing ethanol with the
same quantity of methanol. This was superior to the
methanolysis method used initially, which used methanol
containing 3% v/v sulphuric acid and produced unwanted
derivatives that interfered with analysis. The problem of
loss of volatile methyl 3-hydroxyesters was resolved in
the improved method by using the glass centrifuge tubes
and custom-made PTFE seals described above for the
methanolysis reaction. Methyl benzoate and the target
standard methyl 3-hydroxyhexanoate were purchased
from Sigma Aldrich. Additional target standards methyl
3-hydroxyoctanoate, methyl 3-hydroxydecanoate, methyl
3-hydroxydodecanoate, methyl 3-hydroxytetradecanoate
and methyl 3-hydroxyoctadecanoate were purchased from
Larodan Fine Chemicals AB (Malm, Sweden). Quantita-
tion of targets was performed in selective ion monitoring
mode using ions with m/z ratios 71, 74, and 103 for methyl
3-hydroxyesters and 77, 105, and 136 for methyl benzoate.
Gel Permeation Chromatography
PHA was extracted from approximately 2.5 g freeze
dried leaf blade tissue using the same method as for GC-
MS samples, but without the derivatisation and purifi-
cation steps. The chloroform extract was concentrated to
a final volume of 300 L, and 100 L used for
injection. Separations were performed on a Shimadzu
10A HPLC equipped with four columns in series:
Phenogel guard, Phenogel Linear-2 mixed bed
column (10010,000 KDa), Phenogel 10
4
(5500
KDa), Phenogel 10
3
(175 KDa) (all 5 m bore,
3007.8 mm; Phenomenex, Torrance, CA, USA; order as
listed; chloroform mobile phase at 1 mL/min). Peaks were
observed with a refractive index detector. ReadyCal
polystyrene standards (Fluka AG, Buchs, Switzerland)
were used for M
w
calibration.
Transgene Expression Analysis
Leaf blade samples for RNA extractions were taken from
developing leaves of young secondary stalks of 2526
month-old sugarcane plants. The excised tissue was immedi-
ately frozen in liquid nitrogen before storage at 80Cuntil use.
Total RNAwas extracted from100 mg of leaf blade tissue using
an RNeasy kit (QIAGEN GmbH, Hilden, Germany) including
optional on-column DNase treatment according to manufac-
turers instructions. Reverse transcription was performed using
2 g total RNAwith an Omniscript kit and random hexamers
(QIAGEN GmbH, Hilden, Germany) according to manufac-
turers instructions. Competitive PCR and Mass Array
TM
(Sequenom Inc., San Diego, CA) was carried out by the
Australian Genome Research Facility (The University of
Queensland, QLD, Australia) according to the methodology
of Ding and Cantor (2003). Primers used are listed in Table 5.
Transmission Electron Microscopy
Samples were prepared according to Bohmert et al. (2000),
except that leaves were fixed in 3% glutaraldehyde.
Electron microscopy was performed with a JEOL 1010
electron microscope (JEOL, Tokyo, Japan) equipped with a
Veleta TEM digital camera and iTEM imaging software
(Olympus Soft Imaging Systems, GMBH, Mnster, Germany).
Acknowledgements This work was funded jointly by the Australian
Government through the Co-operative Research Centre for Sugarcane
Industry Innovation through Biotechnology (CRCSIIB) and BSES
Limited. AG was a recipient of a Smart State Fellowship awarded by
the Department of State Development, Trade and Innovation of the
Queensland Government. We wish to thank Ms. Liz Burns (BSES
Limited) for assistance with initial GC-MS screening; Mr. Niall Masel,
BSES Limited, for assistance with GPC analysis; Dr. Deb Stenzel,
Queensland University of Technology, and Ms. Kimberley Tilbrook,
The University of Queensland, for assistance with transmission
electron microscopy.
References
Arai Y, Nakashita H, Suzuki Y et al (2002) Synthesis of a novel class
of polyhydroxyalkanoates in Arabidopsis peroxisomes, and their
use in monitoring short-chain-length intermediates of beta-
oxidation. Plant Cell Physiol 43:555562
Arent S, Pye VE, Henriksen A (2008) Structure and function of plant
acyl-CoA oxidases. Plant Physiol Biochem 46:292301
Birch RG, Bower RS, Elliott AR (2010) Highly efficient, 5-sequence-
specific transgene silencing in a complex polyploid. Trop Plant
Biol 3:8897
Bohlmann GM (2006) Polyhydroxyalkanoate production in crops. In:
Bozell JJ (ed) Feedstocks for the future: renewables for the
production of chemicals and materials. American Chemical
Society Symposium Series 921, vol 921. Oxford University
Press, Oxford, pp 253270
Bohmert K, Balbo I, Kopka J et al (2000) Transgenic Arabidopsis
plants can accumulate polyhydroxybutyrate to up to 4% of their
fresh weight. Planta 211:841845
Bower R, Elliott AR, Potier BAM et al (1996) High-efficiency,
microprojectile-mediated cotransformation of sugarcane, using
visible or selectable markers. Mol Breed 2:239249
Christensen AH, Sharrock RA, Quail PH (1992) Maize polyubiquitin
genesstructure, thermal perturbation of expression and tran-
182 Tropical Plant Biol. (2011) 4:170184
script splicing, and promoter activity following transfer to
protoplasts by electroporation. Plant Mol Biol 18:675689
Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors
for high-level expression of selectable and/or screenable marker
genes in monocotyledonous plants. Transgenic Res 5:213218
Ding CM, Cantor CR (2003) A high-throughput gene expression
analysis technique using competitive PCR and matrix-assisted
laser desorption ionization time-of-flight MS. Proc Natl Acad Sci
USA 100:30593064
Doi Y, Kitamura S, Abe H (1995) Microbial synthesis and character-
ization of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate).
Macromol 28:48224828
Froman BE, Edwards PC, Bursch AG et al (2000) ACX3, a novel
medium-chain acyl-coenzyme A oxidase from Arabidopsis. Plant
Physiol 123:733741
Goepfert S, Poirier Y (2007) Beta-oxidation in fatty acid degradation
and beyond. Curr Opin Plant Biol 10:245251
Hahn JJ, Eschenlauer AC, Sleytr UB et al (1999) Peroxisomes as sites
for synthesis of polyhydroxyalkanoates in transgenic plants.
Biotechnol Prog 15:10531057
Hazer B, Steinbchel A (2007) Increased diversification of polyhy-
droxyalkanoates by modification reactions for industrial and
medical applications. App Microbiol Biotechnol 74:112
Holmes PA (1988) Biologically produced PHA polymers and
copolymers. In: Bassett DC (ed) Developments in Crystalline
Polymers2. Elsevier Applied Science Publ, London/New
York, pp 165
Huang AHC, Trelease RN, Moore TS (1983) Plant peroxisomes.
Academic, New York
Kato M, Bao HJ, Kang CK et al (1996) Production of a novel
copolyester of 3-hydroxybutyric acid and medium chain length
3-hydroxyalkanoic acids by Pseudomonas sp. 613 from sugars.
App Microbiol Biotechnol 45:363370
Lee EY, Jendrossek D, Schirmer A et al (1995) Biosynthesis of
copolyesters consisting of 3-hydroxybutyric acid and medium-
chain length 3-hydroxyalkanoic acids from 1,3-butanediol or
from 3-hydroxybutyrate by Pseudomonas sp. A33. App Micro-
biol Biotechnol 42:901909
Lee SH, Oh DH, Ahn WS et al (2000) Production of poly(3-
hydroxybutyrate-co-3-hydroxyhexanoate) by high-cell-density
cultivation of Aeromonas hydrophila. Biotechnol Bioeng
67:240244
Lenz RW, Marchessault RH (2005) Bacterial polyesters: Biosynthesis,
biodegradable plastics and biotechnology. Biomacromol 6:18
Leonard JM, Slabaugh MB, Knapp SJ (1997) Cuphea wrightii
thioesterases have unexpected broad specificities on saturated
fatty acids. Plant Mol Biol 34:669679
Leonard JM, Knapp SJ, Slabaugh MB (1998) A Cuphea beta-
ketoacyl-ACP synthase shifts the synthesis of fatty acids towards
shorter chains in Arabidopsis seeds expressing Cuphea FatB
thioesterases. Plant J 13:621628
Liebergesell M, Fallis P, Dong J et al (2002) Polyhydroxyalkanoate
synthase genes. US Patent 6,475,734,
Matsumoto K, Nagao R, Murata T et al (2005) Enhancement of poly
(3-hydroxybutyrate-co-3-hydroxyvalerate) production in the
transgenic Arabidopsis thaliana by the in vitro evolved highly
active mutants of polyhydroxyalkanoate (PHA) synthase from
Aeromonas caviae. Biomacromol 6:21262130
Matsumoto K, Arai Y, Nagao R et al (2006) Synthesis of short-chain-
length/medium-chain-length polyhydroxyalkanoate (PHA)
copolymers in peroxisome of the transgenic Arabidopsis thaliana
harboring the PHA synthase gene from Pseudomonas sp 613. J
Polymers Env 14:369374
Matsumoto K, Murata T, Nagao R et al (2009) Production of short-
chain-length/medium-chain-length polyhydroxyalkanoate (PHA)
copolymer in the plastid of Arabidopsis thaliana using an
engineered 3-ketoacyl-acyl carrier protein synthase III. Bioma-
cromol 10:686690
McQualter RB, Fong Chong B, Baker A et al (2005) Initial evaluation
of sugarcane as a production platform for p-hydroxybenzoic acid.
Plant Biotechnol J 3:2941
Mittendorf V, Robertson EJ, Leech RM et al (1998) Synthesis of
medium-chain-length polyhydroxyalkanoates in Arabidopsis
thaliana using intermediates of peroxisomal fatty acid beta-
oxidation. Proc Natl Acad Sci USA 95:1339713402
Mittendorf V, Bongcam V, Allenbach L et al (1999) Polyhydroxyalka-
noate synthesis in transgenic plants as a new tool to study carbon
flow through beta-oxidation. Plant J 20:4555
Mudge SR, Osabe K, Casu RE et al (2009) Efficient silencing of
reporter transgenes coupled to known functional promoters in
sugarcane, a highly polyploid crop species. Planta 229:549558
Nakashita H, Arai Y, Yoshioka K et al (1999) Production of
biodegradable polyester by a transgenic tobacco. Biosci Bio-
technol Biochem 63:870874
Noda I, Bond EB, Green PR et al (2005a) Preparation, properties, and
utilization of biobased biodegradable Nodax
TM
copolymers. In:
Cheng HN, Gross RA (eds) Polymer Biocatalysis and Biomate-
rials. American Chemical Society Symposium Series, vol 900.
Oxford University Press, Oxford, pp 280291
Noda I, Green PR, Satkowski MM et al (2005b) Preparation and
properties of a novel class of polyhydroxyalkanoate copolymers.
Biomacromol 6:580586
Nomura CT, Taguchi S (2007) PHA synthase engineering toward
superbiocatalysts for custom-made biopolymers. App Microbiol
Biotechnol 73:969979
Oeth P, Correll D, Jurinke C (2004) Multiplexed gene expression
analysis using competitive PCR and MassARRAY
TM
. In:
Sequenom Application Notes. Sequenom Inc. http://www.
sequenom.com/Assets/pdfs/appnotes/Multiplexing_for_Ge
ne_Expression_Analysis.pdf Cited 30 June 2008
Petrasovits LA, Purnell MP, Nielsen LK et al (2007) Production of
polyhydroxybutyrate in sugarcane. Plant Biotechnol J 5:162172
Philip S, Keshavarz T, Roy I (2007) Polyhydroxyalkanoates: biode-
gradable polymers with a range of applications. J Chemical
Technol Biotechnol 82:233247
Poirier Y, Nawrath C, Somerville C (1995a) Production of polyhy-
droxyalkanoates, a family of biodegradable plastics and elasto-
mers, in bacteria and plants. Biotechnol 13:142150
Poirier Y, Somerville C, Schechtman LA et al (1995b) Synthesis of high-
molecular-weight poly([R]-()-3-hydroxybutyrate) in transgenic
Arabidopsis thaliana plant cells. Int J Biol Macromol 17:712
Poirier Y, Ventre G, Caldelari D (1999) Increased flow of fatty acids
toward beta-oxidation in developing seeds of Arabidopsis
deficient in diacylglycerol acyltransferase activity or synthesizing
medium-chain-length fatty acids. Plant Physiol 121:13591366
Poirier Y, Gruys KJ (2005) Production of polyhydroxyalkanoates in
transgenic plants. In: Doi Y, Steinbchel A (eds) Polyesters I:
biological systems and biotechnological production. Biopoly-
mers, vol 3a. Wiley-VCH, Weinheim, pp 281316
Purnell MP, Petrasovits LA, Nielsen LK et al (2007) Spatio-temporal
characterization of polyhydroxybutyrate accumulation in sugar-
cane. Plant Biotechnol J 5:173184
Rehm BHA (2003) Polyester synthases: natural catalysts for plastics.
Biochem J 376:1533
Romano A, van der Plas LHW, Witholt B et al (2005) Expression of
poly-3-(R)-hydroxyalkanoate (PHA) polymerase and acyl-CoA-
transacylase in plastids of transgenic potato leads to the synthesis
of a hydrophobic polymer, presumably medium-chain-length
PHAs. Planta 220:455464
Satkowski MM, Melik DH, Autran J-P et al (2001) Physical and
processing properties of polyhydroxyalkanoate copolymers. In:
Doi Y, Steinbchel A (eds) Polyesters II: properties and chemical
Tropical Plant Biol. (2011) 4:170184 183
synthesis. Biopolymers, vol 3b. Wiley VCH, Weinheim, pp 231
264
Slabaugh MB, Leonard JM, Knapp SJ (1998) Condensing enzymes
from Cuphea wrightii associated with medium chain fatty acid
biosynthesis. Plant J 13:611620
Steinbchel A, Valentin HE (1995) Diversity of bacterial polyhydrox-
yalkanoic acids. FEMS Micro Lett 128:219228
Steinbchel A (2001) Perspectives for biotechnological production
and utilization of biopolymers: metabolic engineering of poly-
hydroxyalkanoate biosynthesis pathways as a successful example.
Macromol Biosci 1:124
Steinbchel A, Hein S (2001) Biochemical and molecular basis of
microbial synthesis of polyhydroxyalkanoates in microorgan-
isms. In: Scheper T (ed) Advances in biochemical engineering/
biotechnology 71. Springer, Heidelberg, pp 81123
Tilbrook K, Gnanasambandam A, Schenk PM et al (2010) Efficient
targeting of polyhydroxybutyrate biosynthetic enzymes to plant
peroxisomes requires more than three amino acids in the
carboxyl-terminal signal. J Plant Physiol 167:329332
Tilbrook K, Gebbie L, Schenk PM et al (2011) Peroxisomal
polyhydroxyalkanoate biosynthesis is a promising strategy for
bioplastic production in high biomass crops. Plant Biotechnol J
(In press). doi:10.1111/j.1467-7652.2011.00600.x
Tsuge T, Taguchi K, Taguchi S et al (2003) Molecular characterization
and properties of (R)-specific enoyl-CoA hydratases from
Pseudomonas aeruginosa: metabolic tools for synthesis of
polyhydroxyalkanoates via fatty acid beta-oxidation. Int J Biol
Macromol 31:195205
van Beilen JB, Poirier Y (2008) Production of renewable polymers
from crop plants. Plant J 54:684701
Vandesompele J, De Preter K, Pattyn F et al (2002) Accurate normalization
of real-time quantitative RT-PCR data by geometric averaging of
multiple internal control genes. Genome Biol 3:112
Volokita M (1991) The carboxy-terminal end of glycolate oxidase directs
a foreign protein into tobacco leaf peroxisomes. Plant J 1:361366
Wang YH, Wu ZY, Zhang XH et al (2005) Synthesis of medium-chain-
length-polyhydroxyalkanoates in tobacco via chloroplast genetic
engineering. Chinese Sci Bull 50:11131120
Zou XH, Chen GQ (2007) Metabolic engineering for microbial
production and applications of copolyesters consisting of 3-
hydroxybutyrate and medium-chain-length 3-hydroxyalkanoates.
Macromol Biosci 7:174182
184 Tropical Plant Biol. (2011) 4:170184