Você está na página 1de 2

1) Considere o segmento de cadeia de DNA abaixo:

3' AAAGAACGATGATTTCGGATT 5'


a) Qual a sequncia de bases do mRNA correspondente?
b) Quantos tRNA sero utilizados na sntese?
c) Quantos aminocidos podero ser codificados?
d) Qual a sequncia de aminocidos codificados?

2) A taxa de replicao em bactrias corresponde a 450 nucletidos por
segundo, enquanto que em mamferos de 45 nucletidos. Quais as concluses
que podemos retirar desta informao?

3) Considere a sequncia de bases azotadas abaixo como parte de uma molcula
de cido nucleico:
5' UGAAUG 3'
a) De que cido nucleico ela faz parte?
b) Se da sequncia dada resultar um segmento de protena, quais os
aminocidos que estariam presentes?

4) Considera a sequncia de codes:
5 AUG CGA 3
Responde e justifica:
a) De que molcula do cido nucleico faz parte?
b) Qual o anticodo correspondente?
c) De que molcula a resposta b) faz parte?

5) Numa longa molcula de DNA isolou-se o seguinte segmento:
3 TAGAAATCCGATGTCCA 5
a) Representa a cadeia complementar;
b) Indica a molcula de mRNA que ser transcrita;
c) Considerando que a molcula de DNA constituda por um exo de 6
nucletidos, um intro de 5 e outro exo de 6, qual o mRNA funcional?

6) Molculas de rRNA so relativamente estveis, enquanto que o mRNA
degradado rapidamente. Discuta possveis causas e consequncias deste facto.
7) Apresenta as principais caractersticas do cdigo gentico.

8) A cadeia que no transcrita de um gene tem a seguinte sequncia:
5 CCGGCTGATTTAGAAATGATGTTATATATAATATAATGTGCCCAATG 3
Qual a constituio do polipeptdeo codificado por este gene?

9) Na embalagem de um antibitico, encontra-se uma bula que, entre outras
informaes, explica a ao da droga do seguinte modo:
O medicamento atua por inibio da sntese proteica bacteriana.
Essa afirmao permite concluir que o antibitico
a) impede a fotossntese realizada pelas bactrias causadoras da doena e,
assim, elas no se alimentam e morrem.
b) altera as informaes genticas das bactrias causadoras da doena, o que
impede manuteno e reproduo desses organismos.
c) dissolve as membranas das bactrias responsveis pela doena, o que dificulta
o transporte de nutrientes e provoca a morte delas.
d) elimina os vrus causadores da doena, pois no conseguem obter as
protenas que seriam produzidas pelas bactrias que parasitam.
e) interrompe a produo de protena das bactrias causadoras da doena, o
que impede sua multiplicao pelo bloqueio de funes vitais.

10) A purificao e anlise de uma molcula biolgica indicou a presena de
nove diferentes monmeros. Podemos afirmar que se trata de um(a):
a) cido nucleico. c) lpido.
b) glcido. d) protena.

11) Analisa as alternativas abaixo, relacionadas com o cdigo gentico:
I. Um mesmo codo pode codificar mais de um aminocido.
II. Um aminocido pode ser codificado por diferentes codes.
III. O cdigo usado na espcie humana o mesmo dos vrus.
Esto corretas:
a) I e II
b) I e III
c) II e III
d) Apenas II
e) I, II e III

BIOLOGIA E GEOLOGIA 11 ANO
OFICINA DE EXAMES CIDOS NUCLEICOS/SNTESE PROTEICA
NOME ________________________________________ N ____ TURMA ____
Proposta de respostas:
1.
a)5 UUU CUU GCU ACU AAA GCC UAA 3
b) 7
c) 6
d) phe - leu - ala - thr - lys - ala - STOP
2. O tamanho da molcula de DNA de uma bactria menor e menos
condensada que o DNA de um mamfero sendo que esta leva mais
tempo para desenrolar a mesma quantidade de nucletidos que o DNA
de procariotas.
3.
a) RNA
b) Nenhum: codo de finalizao
4.
a) mRNA
b) UAC e GCU
c) tRNA
5. a) 5 ATCTTTAGGCTACAGGT 3
b) 5 AUCUUUAGGCUACAGGU 3
c) AUCUUUACAGGU
6. O rRNA necessrio permanentemente na clula pois integra os
ribossomas e participa em todo e qualquer processo de sntese proteica,
enquanto que uma determinada molcula de mRNA s necessria para a
sntese de um determinado peptdeo, no momento em que este for
requerido pelo organismo. A sua degradao impede a acumulao
excessiva tanto do mRNA como tambm do seu produto especfico.
7. ()
8. PRO - ALA - ASP - LEU - GLU - MET - MET - LEU - TYR - ISO ISO
9. E. (A sntese de uma protena realizada pelos ribossomas e pelo retculo
endoplasmtico rugoso. Os antibiticos atuam em nvel de ribossomas,
inibindo essa sntese proteica. Com isso, as bactrias no conseguem
reproduzir e tm suas funes vitais comprometidas.
10. D
11. c