443

J. Phycol.



37,

443451 (2001)

PHYLOGENETIC POSITION OF

KOLIELLA

(CHLOROPHYTA) AS INFERRED FROM
NUCLEAR AND CHLOROPLAST SMALL SUBUNIT rDNA

1

Agnieszka Katana, Jan Kwiatowski, Krzysztof Spalik,

2

Bo ena Zakry

Department of Plant Systematics and Geography, Warsaw University, Aleje Ujazdowskie 4, PL-00-478 Warszawa, Poland

El bieta Szalacha

Faculty of Horticulture, Warsaw Agricultural University, Nowoursynowska St. 166, PL-02-787 Warszawa, Poland

and
Hanna Szyma ska

Department of Plant Systematics and Geography, Warsaw University, Aleje Ujazdowskie 4, PL-00-478 Warszawa, Poland
z
.
s
z
.
n

The phylogenetic position of

Koliella

, a chloro-
phyte characterized by

Klebsormidium

type cell divi-
sion, was inferred from analyses of partial 18S rDNA
and partial 16S rDNA. Parsimony and distance analy-
ses of separate and combined data sets indicated
that the members of

Koliella

belonged to Trebouxio-
phyceae, and high decay indices and bootstrap val-
ues supported this affinity. However, the genus ap-
peared to be polyphyletic.

Koliella spiculiformis

, the
nomenclatural type of the genus, was allied with

Nan-

nochloris eucaryota

and the true chlorellas (

Chlorella
vulgaris

,

C. lobophora

,

C. sorokiniana

, and

C. kessleri

).

The close relatives of

Koliella longiseta

(

Raphidonema
longiseta

) and

Koliella sempervirens

appeared to be

Stichococcus bacillaris

and some species traditionally
classified in

Chlorella

that were characterized by the
production of secondary carotenoids under nitrogen-
deficient conditions. This clade was also supported
by the presence of a relatively phylogenetically stable
group I intron (1506) in the 18S rRNA gene. Because
of the presence of

Klebsormidium

type cell division,
some authors regarded the members of

Koliella

as
closely related to charophytes. Molecular analyses,
however, did not confirm this affinity and suggested
that a

Klebsormidium

type cell division is homoplastic
in green plants.

Key index words:

16S rDNA; 18S rDNA; Chlorophyta;

Koliella

; molecular phylogeny;

Raphidonema

; Tre-
bouxiophyceae

Koliella

is a relatively small genus of green algae
containing 26 species, most of which grow in fresh wa-
ter, but some thrive in the surface layers of alpine gla-
ciers and snow (Hindk 1996b). The species produce
short two-celled filaments that fragment easily into
spindle-shaped unicells, sometimes arranged into
pseudo-filaments. Two-celled or unicelled organiza-
tion distinguishes this genus from closely related

Raphidonema

, which members form multicelled fila-
ments (Hindk 1963); these two genera are merged
by some authors (e.g. Skuja 1969, Hoham 1973). Al-
though traditionally classified in the chlorophycean
order Ulotrichales, these algae show proximity to the
charophycean lineage of green plants (Streptophyta
sensu Bremer 1985) due to their characteristic cell di-
vision, denoted as the

Klebsormidium

type (Floyd et al.
1972, Pickett-Heaps 1972, 1976, Chappell and Floyd
1981, Lokhorst and Star 1998) or type VII (Van den

Hoek et al. 1995). Type VII mitosis occurs also in

Chlo-
rokybus

and

Stichococcus

(Pickett-Heaps 1974, Lokhorst
et al. 1988). The basal positions of

Chlorokybus

and

Klebsormidium

in streptophytes have been confirmed
using different sets of molecular data: 18S rDNA (Wil-
cox et al. 1993, Sluiman et al. 1997),

rbc

L (Manhart
1994), and

cox

2 (Qiu et al. 1998). However, Delwiche
et al. (1995) in the analysis of

tuf

A sequences have

shown that

Koliella longiseta

(

Raphidonema



longiseta

)
is excluded from the charophycean algae, although
these authors were not able to identify its affinities
with any great confidence. Type VII cell division, the
only unequivocal common character of Klebsormidi-
ales (Van den Hoek et al. 1995), may therefore be a
poor indicator of taxonomic position. The delimita-
tion of Klebsormidiales is important because these
species represent one of the simplest morphologies
among streptophytes. The identification of plesiomor-
phies preserved in basal branches of this group may
help to elucidate the early stages of land plant evolu-
tion (Graham 1993).
Our aim is to establish the phylogenetic position of

Koliella

within green algae based on two independent
sources of data: nuclear and chloroplast DNA of small
subunits (SSU) of rRNA. This genus is exemplified by
three species,

Koliella longiseta

,

Koliella sempervirens

, and

Koliella spiculiformis

, which were also used in the cyto-
logical studies (Pickett-Heaps 1976, Lokhorst and Star
1998). The first was also included in the

tuf

A phyloge-
netic analysis of Delwiche et al. (1995). The strains of

K. sempervirens

and

K. spiculiformis

were the same as
those used by Lokhorst and Star (1998). To verify the
exclusion of

Koliella

from streptophytes and its inclu-
sion into Trebouxiophyceae, we also provide partial

1

Received 6 July 2000. Accepted 6 March 2001.

2

Author for correspondence: e-mail kspalik@ibb.waw.pl.

444

AGNIESZKA KATANA ET AL.

T

ABLE

1. Accessions of chlorophytes and streptophytes examined for nuclear and chloroplast SSU rDNA sequence variation.

Taxon
GenBank accession no.
16S rDNA 18S rDNA

Ankistrodesmus stipitatus

(Chodat) Legnerov X56100

Anthoceros laevis

L. U18491

Auxenochlorella protothecoides

(W. Krger) Kalina et Pun ochar.
(

Chlorella protothecoides

W. Krger) X65688 X56101

Bracteacoccus aerius

H.W. Bisch. & H.C. Bold U63101

Bulbochaete hiloensis

(Nordst.) Tiffany U83132

Chaetopeltis orbicularis

Berthold U83125
T

ABLE

1 (continued)
c

sequences of nuclear and/or chloroplast SSU of the
following representatives of these groups:

Coleochaete
sieminskiana

,

Nitella



flexilis

, and

Stichococcus bacillaris.

material and methods

Accessions and protocols.

Seventy-three taxa were included in
the analyses (Table 1), 69 of which were represented by the se-
quences of nuclear SSU rDNA and 27 by the sequences of chlo-
roplast SSU rDNA. Both sequences are known for 23 of these.
The eight sequences generated in this study are deposited in
GenBank under accession numbers listed in Table 1.
The material for DNA extraction was obtained either from
cultures or collected in the field (Table 2). This material was
examined using a light microscope and its identity verified.
Voucher specimens of

C. sieminskiana

and

Nitella flexilis

, as well
as the photographs of the remaining species, were deposited in
the herbarium of the Department of Plant Systematics and Ge-
ography, Warsaw University. Total DNA was extracted using
Plant DNeasy Extraction Kit (Qiagen, Inc., Valencia, CA). The
fragment of 18S rDNA analyzed corresponds to positions 19
1769 of the sequence obtained from

Coleochaete orbicularis

,
whereas the chosen fragment of 16S rDNA corresponds to posi-
tions 3151129 of the sequence obtained from the same species.
Primers for PCR amplification and sequencing are shown in
Table 3. Standard double-stranded PCR amplifications were per-
formed using the following reaction conditions: preincubation at
95



C for 5 min and then 25 cycles, each including 1 min at 95



C,
1 min at annealing temperature (55



C and 54



C for 18S and 16S,
respectively), and 2 min at 72



C. Each PCR product was electro-
phoresed in a 1% agarose gel, stained with ethidium bromide,
and then excised and eluted using the QIAEX II Gel Extraction
Kit (Qiagen). Cycle sequencing reactions were performed using
the purified PCR product, AmpliTaq DNA polymerase, and fluo-
rescent Big Dye terminators (Perkin-Elmer Corp., Norwalk, CT).
The products were resolved by electrophoresis using ABI Prism
310 DNA sequencer (PE Applied Biosystems, Foster City, CA).
The readings were manually edited, and the contig sequences
were obtained using SeqMan computer program of LASERGENE
(DnaStar, Inc., Madison, WI).

Phylogenetic analyses.

The sequences were aligned using Clus-
talX (Thompson et al. 1997). The resulting matrix was manually
checked and adjusted if necessary. External primer sequences,
introns, and ambiguous positions were excluded from the anal-
ysis. The alignments were deposited with EMBL, accession
numbers ALIGN

000083 and ALIGN

000085 for 16S and
18S, respectively. The NEXUS files are also available online
from http://www.bot.uw.edu.pl/

jmkwiato/aln.html. The data
for nuclear and chloroplast SSU sequences were analyzed sepa-
rately and combined using PAUP* 4.0 (Swofford 1998). Parsi-
mony analysis was performed using Heuristic Search option
with MULPARS, tree-bisection-reconnection branch swapping,
and random addition with 500 replicates. Gaps were generally
coded as missing data, although several searches with gaps
treated as the fifth base were also carried out. Before the com-
bined analysis, the two data sets were tested for incongruence
using the method of Farris et al. (1995) (implemented in PAUP*
4.0). Distance trees were generated using neighbor joining with
different distance measures available in PAUP*. Because of
computational limitation, maximum likelihood searches were
performed only for the combined data set using a spectrum of
transition/transversion (Ti/Tv) ratios (0.52.5) and assuming
equal or unequal rates of substitution per site, the latter exhib-
iting the gamma distribution among sites (with

0.5, 1, or
2). Also, a single heuristic search was initiated with the Ti/Tv
ratio, nucleotide frequencies, proportion of invariable sites,
and the shape parameter estimated via maximum likelihood.
Robustness of the parsimony and distance trees was esti-
mated by nonparametric bootstrap analysis with 1000 replicates
(Felsenstein 1985). Maximum likelihood bootstrapping was
performed with 100 replicates using the Ti/Tv ratio, nucleotide
frequencies, proportion of invariable sites, and the shape pa-
rameter estimated for the maximum likelihood tree with the
highest likelihood. For the most parsimonious trees, the stabil-
ity of nodes was also measured using the decay index (Bremer
1994); the heuristic searches were performed in PAUP* using
constrained trees generated by AutoDecay 4.0.2 (Eriksson 1998).
The sequence of

Mantoniella squamata

, one of the earliest di-
verging prasinophytes (Friedl 1997, Nakayama et al. 1998), was
used to root the trees. We also considered an alternative root-
ing using

Mesostigma viride

, a unicellular flagellate chlorophyte
that was placed among streptophytes in class Mesostigmato-
phyceae by Marin and Melkonian (1999) but regarded as the
earliest lineage of green plants by Lemieux et al. (2000). This
alternative rooting did not affect the conclusions regarding the
phylogenetic position of

Koliella.

results

Sequence analysis.

Seventeen of the aligned sequences
of 18S rDNA were 246 bp shorter from the 5

end
and 15 were 392 bp shorter from the 3

end due to
various external primers used by different authors. Of
the aligned 1865 positions (Table 4), 522 were phylo-
genetically informative and the ratio of terminal taxa
(69) to informative characters was 1:7.6. Mean pair-
wise uncorrected sequence divergence was 8.1%, rang-
ing from 0.2% to 17.9%.
Ten of the analyzed 18S rDNA sequences comprised
one or two group I introns that were located at five sites
corresponding to the following positions of SSU rDNA
of

Escherichia coli

(Bhattacharya et al. 1996): 516 (

K. spi-
culiformis

), 943 (

Dunaliella salina

,

K. spiculiformis

), 1046
(

Choricystis minor

,

Ankistrodesmus stipitatus

), 1506 (

Cos-
marium botrytis

,

Mesotaenium caldariorum

,

Mougeotia sca-
laris

,

Chlorella mirabilis

,

Chlorella ellipsoidea

,

K. sempervi-
rens

), and 1512 (

Choricystis minor

). The presence of
introns 1506 and 1512 could not be verified in several
sequences that were shorter from the 3

end (

Stichococ-
cus bacillaris

,

K. longiseta

, and

Spirogyra grevilleana

).

PHYLOGENETIC POSITION OF

KOLIELLA

445
TABLE 1. Continued.
Taxon
GenBank accession no.
16S rDNA 18S rDNA
Chaetosphaeridium ovalis G.M. Sm. AF181094
Chara hispida L. U18496
Chara sp. X75519
Characium hindakii K.W. Lee et H.C. Bold M63000
Characium perforatum K.W. Lee et H.C. Bold M62999
Characium vacuolatum K.W. Lee et H.C. Bold M63001
Chlamydomonas debaryana Gorozh. AF008240
Chlamydomonas fimbriata H. Ettl U70784
Chlamydomonas moewusii Gerloff X15850 U41174
Chlamydomonas reinhardtii P.A. Dang. X03269 M32703
Chlamydomonas segnis H. Ettl (C. pallidostigmatica J.M. King) L39865
Chlorella ellipsoidea Gerneck X12742 D13324
Chlorella kessleri Fott et Novkov D11346 X56105
Chlorella lobophora Andreyeva X63504
Chlorella mirabilis Andreyeva X65100 X74000
Chlorella sorokiniana Shihira et Krauss X65689 X62441
Chlorella vulgaris Beij. D11347 X13688
Chlorococcum oleofaciens Trainor et H.C. Bold U41176
Chlorokybus atmophyticus Geitler M95612
Choricystis minor (Skuja) Fott X89012
Coenocystis inconstans Hanagata et Chihara AB017435
Coleochaete orbicularis auct., non Prings.
a
U24579 M95611
Coleochaete sieminskiana Szym. AF278750 AF278745
Cosmarium botrytis Menegh. X79498
Dictyochloropsis reticulata (Tscherm.-Woess) Tscherm.-Woess Z47207
Dunaliella salina (Dunal) Teodor. M84320
Klebsormidium flaccidum (Ktz.) P.C. Silva, Mattox et W.H. Blackw. X75522 M95613
Koliella longiseta (Vischer) Hindk (Raphidonema longiseta Vischer) AF278749 U18520
Koliella sempervirens (Chodat) Hindk AF278743 AF278747
Koliella spiculiformis (Vischer) Hindk AF278744 AF278746
Lamprothamnium papulosum (Wallr.) J. Groves (L. macropogon A. Braun) U18508
Leptosira obovata Vischer Z68695
Lycopodium digitatum Dill. ex A. Braun U24587
Lycopodium tristachyum Pursh U18511
Mantoniella squamata (Manton & Parke) Desikachary X90641 X73999
Marchantia polymorpha L. X04465 X75521
Mesostigma viride Lauterborn AF166114 AJ250108
Mesotaenium caldariorum (Lagerh.) Hansg. X75763
Microthamnion kuetzingianum Ngeli Z38974
Mougeotia scalaris Hassal X70705
Mychonastes homosphaera Kalina et Pun ochar. AB025423
Myrmecia astigmatica Vinatzer Z47208
Myrmecia biatorellae Boye-Petersen Z28971
Myrmecia bisecta Reisigl Z47209
Myrmecia israeliensis (Chantan. et H.C. Bold) Friedl (Friedmania israeliensis Chantan. M62995
et H.C. Bold)
Nannochloris eucaryota (C. Wilh. et al.) K. Menzel et A. Wild X76084 X06425
(Nanochlorum eucaryotum C. Wilh. et al.)
Nephroselmis olivacea F. Stein AF137379 X74754
Nitella flexilis (L.) Agardh AF278748 U05261
Osmunda cinnamomea L. U24594 U18516
Parietochloris pseudoalveolaris (Deason et H.C. Bold) Shin Watan. et G.L. Floyd M63002
Polytrichum formosum Hedw. X80982
Prototheca wickerhamii Tubaki et Soneda X74309 X56099
Pycnococcus provasolii Guillard AF122889
Pyramimonas disomata Butcher AB017121
Scenedesmus costato-granulatus Hortob. X91265
Scherffelia dubia (Scherff.) Pascher X68484
Spirogyra grevilleana (Hassal) Ktz. U18523
Spirogyra maxima (Hassal) Wittr. U24596
Stichococcus bacillaris Ngeli AF278751 U18524
Stigeoclonium helveticum Vischer U83131
Tetraselmis convolutae (Parke et Manton) R.E. Norris et al. U05039
Tetraselmis striata Butcher X70802
Trebouxia asymmetrica Friedl et Grtner Z21553
Trebouxia impressa Ahmadjian Z21551
Trebouxia magna P.A. Archibald Z21552
Ulothrix zonata (Weber et Mohr) Ktz. Z47999
Ulva rigida C. Agardh AJ005414
Synonyms used in GenBank are given in parentheses. Accession numbers for sequences obtained in this study are in boldface.
a
For the identity of Coleochaete orbicularis Prings., see Szyma ska and Spalik (1993).
c
n
446 AGNIESZKA KATANA ET AL.
The alignment of partial 16S rDNA sequences re-
sulted in a matrix of 978 characters (Table 4). The ra-
tio of terminal taxa (27) to informative positions
(242) was 1:9.0. Mean pairwise sequence divergence
was 12.9%, with range of 1.423.1%.
Phylogenetic inference. Unweighted parsimony analy-
sis of the 18S rDNA sequences resulted in five most
parsimonious trees, each of 3212 steps (Table 4, Fig.
1). The differences between those trees were minor
and included some rearrangements of smaller branches.
Prasinophytes were paraphyletic with respect to strep-
tophytes and chlorophytes. Chlorophytes included three
major branches: Ulvophyceae, Chlorophyceae, and Tre-
bouxiophyceae. The last two, however, were supported
neither by high bootstrap values nor high decay indices.
All three species of Koliella were placed within Tre-
bouxiophyceae but belonged to two separate lineages.
Koliella spiculiformis, the nomenclatural type of the ge-
nus, was sister to Nannochloris eucaryota (with bootstrap
support and decay index of 99.6% and 7, respec-
tively), and both were grouped with several species of
Chlorella, including C. vulgaris (92.3% and 5). Koliella
sempervirens and K. longiseta were sister taxa (91.5% and
4) and were closely related to Stichococcus bacillaris and
some other species of Chlorella (96.3% and 7). This af-
finity was supported by shared presence of 1506 intron
(also found in three representatives of Zygnematales:
Cosmarium botrytis, Mesotaenium caldariorum, and Mougeotia
scalaris). Additional parsimony analyses with gaps treated
as a fifth base produced trees that differed with re-
spect to some internal nodes, but the position and the
affinities of Koliella species were virtually identical.
Similar relationships were also inferred using neigh-
bor joining with several distance measures.
Two equally parsimonious trees were found in a
heuristic search of 16S rDNA sequences (Table 4, Fig.
2). Contrary to the affinities inferred from 18S rDNA
data, the chlorophytes were not monophyletic in this
analysis: Chlorophyceae, represented by three species
of Chlamydomonas, were sister to a clade comprising
Streptophyta, Trebouxiophyceae, and Nephroselmis oli-
vacea. However, the content of these subclades was
the same as in the previous analyses. Again, the mem-
bers of Koliella were placed in two distinct lineages of
Trebouxiophyceae, although their affinities were not
as evident as in the 18S rDNA trees. Koliella spiculifor-
mis was grouped with Nannochloris eucaryota, although
with lower bootstrap support (54.6%) and decay in-
dex (1) than in the 18S rDNA analyses. This branch
was sister to a clade containing several species of
TABLE 2. Source of the algal material used in this study.
Species Origin of the material
Coleochaete sieminskiana Bia e Wigierskie lake, Poland, 30 October 1997, Szyma ska (WA)
Koliella longiseta J801, Department of Botany, Charles University, Praha, Czech Republic
Koliella sempervirens Hindk 1961/11 (CCALA
a
)
Koliella spiculiformis Vischer 1940/208 (CCALA
a
)
Nitella flexilis Bia e Wigierskie lake, Poland, 28 August 1998, Szyma ska (WA)
Stichococcus bacillaris Institute of Microbiology, Warsaw University, Warszawa, Poland
a
Culture Collection of Autotrophic Organisms of the Institute of Botany, Academy of Science of the Czech Republic, T ebo ,
Czech Republic.
WA, Warsaw University.
l n
l n
r n
TABLE 3. Nuclear and chloroplast SSU rDNA primers used for
PCR amplification and sequencing.
Primer 5 sequence 3
16S rDNA
294313F TGGGGAATTTTCCGCAATGG
70727F ACCCCAGTAGTCCTAGCTGTA
77898R AGGCGGGACACTTAACGCGTT
113151R TGTAGCACGTGTGTCGCCCAG
18S rDNA
F AACCTGGTTGATCCTGCCAGT
40223F GCTACCACATCCAAGGAAGGCA
41637R ATTTGCGCGCCTGCTGCCTTCC
895916F GTCAGAGGTGAAATTCTTGGAT
898919R TAAATCCAAGAATTTCACCTCT
1275304F ATGGCCGTTCTTAGTTGGTGGAGTGATTTG
132344F CGAACGAGACCTCAGCCTGCTA
130839R CTCGTTCGTTAACGGAATTAACC
163657R GGTAGGAGCGACGGGCGGTGTG
R TGATCCTTCTGCAGGTTCACCTACG
18S rDNA introns of
Koliella spiculiformis
70725R CGAGCTCGCCACGGGATTG
86388F GGCTTTGGGGAACTCGAGTGTGGTGA
141233R GTGCCGGCGGGGTCATCAAAAA
173456R AGAAACACCAACCCGCAGGACTT
173559F AGTCCTGCGGGTTGGTGTTTCTTAC
External primers F and R for 18S rDNA are from Krantz et al.
(1995); the remaining ones were designed for this study. The
numbers in the names of primers for 16S and 18S rDNA refer
to the positions in the sequences from Coleochaete orbicularis.
The third set of primers was used for sequencing of the two
introns present in the 18S rDNA of Koliella spiculiformis.
TABLE 4. Comparison of the three data sets of chlorophytes
and outgroup used to infer the phylogenetic position of Koliella.
18S
rDNA
16S
rDNA Combined
Number of taxa 69 27 23
Total number of aligned characters 1865 978 2843
Excluded 80 167 247
Constant 1031 453 1725
Uninformative 232 114 353
Informative 522 244 518
Length of most parsimonious tree 3212 1061 2192
Number of most parsimonious trees 5 2 2
Consistency indices
With uninformative characters 0.370 0.511 0.575
Without uninformative characters 0.311 0.444 0.476
Retention index 0.600 0.607 0.598
PHYLOGENETIC POSITION OF KOLIELLA 447
true chlorellas (i.e., including C. vulgaris, the type of
the genus). This affinity was, however, supported by
99.7% bootstrap value and decay index of 13. Koliella
sempervirens and K. longiseta were clustered with the
same members of Trebouxiophyceae as in the 18S
rDNA analysis (Chlorella ellipsoidea, C. mirabilis, and Sti-
chococcus bacillaris); however, the bootstrap support
values and decay indices for this clade and its internal
nodes were low. Neighbor-joining trees (not shown)
were similar to those obtained from parsimony and
also confirmed the polyphyly of Koliella and place-
ment of its members in monophyletic Trebouxio-
phyceae.
The null hypothesis that nuclear and chloroplast
SSU data sets are incongruent was rejected with P
0.001. Combined parsimony analysis resulted in the
two most parsimonious trees of 2192 steps (Table 4,
Fig. 3). The order of branching of major clades was
similar as in the 18S rDNA tree, that is, streptophytes
were sister to a lineage including Chlorophyceae and
Trebouxiophyceae, the last two clades supported by
high bootstrap values and decay indices. The position
of the Koliella species was identical as in the 18S rDNA
tree. Neighbor-joining trees (not shown) were generally
congruent to those derived from parsimony searches.
The maximum likelihood tree (Fig. 4) obtained from
heuristic search with Ti/Tv ratio, nucleotide frequencies,
proportion of invariable sites, and the shape parameter
estimated via maximum likelihood (ln likelihood
14208.09; base frequencies A: 0.240, C: 0.234, G:
FIG. 1. One of five most par-
simonious trees (length 3212) in-
ferred from partial nuclear SSU
rDNA sequences. Decay indices/
bootstrap values (50%) are
shown along respective nodes.
Boldface indicates members of
Koliella; species with Klebsormidium
type cell division are underlined.
Brackets refer to major lineages
identified within green plants.
Branch lengths are proportional
to the number of substitutions
(note scale bar).
448 AGNIESZKA KATANA ET AL.
FIG. 2. One of two most parsimoni-
ous trees (length 1061) inferred from
partial sequences of chloroplast SSU
rRNA gene. Boldface and underlining
indicate members of Koliella and spe-
cies with Klebsormidium type cell divi-
sion, respectively. Decay indices/boot-
strap values (50%) are given along
respective nodes. Brackets refer to
major lineages identified within green
plants. Branch lengths are proportional
to the number of substitutions (note
scale bar).
FIG. 3. One of two most parsimo-
nious trees (length 2192) inferred from
combined partial sequences of nuclear
and chloroplast SSU rRNA genes. Bold-
face and underlining indicate mem-
bers of Koliella and species with Klebsor-
midium type cell division, respectively.
Decay indices/bootstrap values (50%)
are given along nodes. Brackets refer
to major lineages identified within green
plants. Branch lengths are proportional
to the number of substitutions (note scale
bar).
PHYLOGENETIC POSITION OF KOLIELLA 449
0.256, T: 0.270; Ti/Tv 1.713; proportion of invari-
able sites 0.420; 0.604) had a similar topology to
the maximum parsimony trees. Generally, in all trees
obtained from the analyses of combined data, Koliella
was polyphyletic and placed within Trebouxiophyceae,
whereas the species with Klebsormidium type cell divi-
sion belonged to different lineages of green plants.
discussion
Koliella is usually classified in family Elakato-
trichaceae, which also includes Raphidonema, Raphi-
donemopsis, and Elakatothrix (Stewart and Mattox 1975,
Lokhorst 1991). Recently, Hindk (1996a,b) proposed
a new classification of unbranched filamentous chlo-
rophytes, in which Koliella, Raphidonemopsis, and four
other genera are placed in family Koliellaceae, whereas
Raphidonema, Stichococcus, and Klebsormidium are re-
tained in Ulotrichaceae, both families classified in or-
der Ulotrichales. Hindk (1996a,b) stated that based
on recent analyses, the monophyly of Ulotrichales
sensu Fott (1967) was not supported; however, he
kept the traditional system because of its wide accep-
tance by hydrobiologists. The classification of Hindk
(1996a,b) is therefore inconsistent. For instance, he
indicated that Koliellas closest relatives were Raphido-
nemopsis and Elakatothrix, despite placing the latter in
a different family.
Alternatively, Elakatotrichaceae and Klebsormidi-
aceae constitute order Klebsormidiales (Lokhorst 1991),
one of the five lineages of green algae that are placed
in streptophytes (Stewart and Mattox 1975, Mattox
and Stewart 1984, Huss and Kranz 1997). This classifi-
cation has only partly been supported by molecular
data. Two strains of Klebsormidium have recently been
excluded from streptophytes and placed in Treboux-
iophyceae (Sluiman et al. 1997), a class of green algae
separated from Chlorophyceae based on phylogenetic
analysis of nuclear SSU (Friedl 1995). Lokhorst and
Star (1998) place Raphidonema in this class, referring
this transfer to Sluiman et al. (1997); however, this ge-
nus is not listed in their account. The exclusion of K.
longiseta ( R. longiseta) from streptophytes has already
been suggested by Delwiche et al. (1995) based on the
phylogenetic analysis of tufA sequences. Our data indi-
cate that Koliella is polyphyletic and represents at least
two evolutionary lineages that belong to Trebouxio-
phyceae. Both separate and combined analyses of nu-
clear and chloroplast SSU rDNA show that the sister
taxon of K. spiculiformis, the nomenclatural type of the
genus, is Nannochloris eucaryota, and these two belong
to a larger clade that also includes true chlorellas, that
is, C. vulgaris, C. lobophora, C. sorokiniana, and C. kessleri
(Huss et al. 1999). The closest relatives of K. longiseta
and K. sempervirens are Stichococcus bacillaris and some
species traditionally classified in Chlorella that are char-
acterized by the production of secondary carotenoids
under nitrogen-deficient conditions (Huss et al. 1999).
This clade is also characterized by the presence of the
1506 group I intron in the 18S rRNA genes. This intron
FIG. 4. Maximum likelihood tree
obtained from combined partial se-
quences of nuclear and chloroplast SSU
rRNA genes. Boldface indicate mem-
bers of Koliella; species with Klebsormid-
ium type cell division are underlined.
Numbers along branches represent re-
sults of 100 bootstrap replicates (only
those 50% are indicated). Brackets
refer to major lineages identified within
green plants. Ln likelihood 14,208.09.
Scale bar, 5% divergence.
450 AGNIESZKA KATANA ET AL.
is relatively phylogenetically stable and is also present
in Zygnematales (Besendahl and Bhattacharya 1999).
The division of green algae into two distinct evolu-
tionary lineages, the Chlorophyta sensu Sluiman (1985)
and the Streptophyta sensu Bremer (1985); that is,
Charophyceae sensu Mattox and Stewart (1984) finds
confirmation both from phylogenetic analyses of mo-
lecular markers including 18S rDNA (e.g. Wilcox et
al. 1993, Huss and Kranz 1997) and rbcL (Manhart
1994) and from morphological data (Mattox and
Stewart 1984). The most important characters that de-
fine charophycean algae are the unilateral flagellar
root in zoids and open mitosis with persistent telo-
phase spindle (Mattox and Stewart 1984). Some mem-
bers of Elakatotrichaceae, including Koliella, may re-
produce asexually by biflagellate zoospores, whereas
K. longiseta exhibits oogamy (Van den Hoek et al.
1995, as Raphidonema); however, the ultrastructure of
their flagellar apparatus is unknown. These species
were placed in Klebsormidiales based on the presence
of Klebsormidium type cell division, originally described
for K. flaccidum (Floyd et al. 1972) and K. subtilissimum
(Rabenh.) P.C. Silva, Mattox et W.H. Blackw. (Pickett-
Heaps 1972) and subsequently found in Stichococcus
bacillaris (Pickett-Heaps 1974), Raphidonemopsis sessilis
Deason (Chappell and Floyd 1981), Klebsormidium mu-
cosum (Boye Peterson) Lokhorst & Star (Lokhorst and
Star 1985), and three species of Koliella: K. longiseta, K.
sempervirens, and K. spiculiformis (Pickett-Heaps 1976,
Lokhorst and Star 1998). The typical Klebsormidium
type cytokinesis is characterized by a complete break-
down of the nuclear envelope during metaphase
(open spindle); however, in K. sempervirens the lateral
nuclear envelope does not disintegrate during meta-
phase and anaphase, hence the spindle is semiclosed
(Lokhorst and Star 1998). Despite these differences,
Lokhorst and Star (1998) emphasized the general sim-
ilarity of the cell division pattern of the members of
Elakatotrichaceae to Klebsormidium, which suggests their
proximity. The results of molecular analyses strongly
suggest, however, that these similarities are homoplas-
tic: open mitosis occurs in several distantly related lin-
eages of green plants.
Supported by grants from the Polish Committee for Scientific
Research (KBN 6 P04C 030 14) and Warsaw University (BW
1485/10) awarded to H. Szyma ska and A. Katana, respectively.
We are grateful to T. Kalina and M. Przytocka-Jusiak for provid-
ing us with the cultures.
Besendahl, A. & Bhattacharya, D. 1999. Evolution analyses of small-
subunit rDNA coding regions and the 1506 group I introns of the
Zygnematales (Charophyceae, Streptophyta). J. Phycol. 35: 5609.
Bhattacharya, D., Friedl, T. & Damberger, S. 1996. Nuclear-encoded
rDNA group I introns: origin and phylogenetic relationships of in-
sertion site lineages in the green algae. Mol. Biol. Evol. 13:97889.
Bremer, K. 1985. Summary of green plant phylogeny and classifica-
tion. Cladistics 1:36985.
Bremer, K. 1994. Branch support and tree stability. Cladistics 10:
295304.
Chappell, D. F. & Floyd, G. L. 1981. Cell division in the weakly fila-
mentous Raphidonema sessile (Raphidonemopsis sessilis) (Chloro-
phyta). Trans. Am. Microsc. Soc. 100:7482.
n
Delwiche, C. F., Kuhsel, M. & Palmer, J. D. 1995. Phylogenetic anal-
ysis of tufA sequences indicates a cyanobacterial origin of all
plastids. Mol. Phylogenet. Evol. 4:11028.
Eriksson, T. 1998. AutoDecay, version 4.0 [program distributed by
the author]. Department of Botany, Stockholm University,
Stockholm.
Farris, J. S., Kllersj, M., Kluge, A. G. & Bult, C. 1995. Testing sig-
nificance of incongruence. Cladistics 10:3159.
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 39:78391.
Floyd, G. L., Steward, K. D. & Mattox, K. R. 1972. Cellular organiza-
tion, mitosis, and cytokinesis in the ulotrichalean alga Klebsor-
midium. J. Phycol. 8:17684.
Fott, B. 1967. Sinice a rasy. Academia, Praha. 520 pp.
Friedl, T. 1995. Inferring taxonomic positions and testing genus
level assignments in coccoid green lichen algae: a phylogenetic
analysis of 18S ribosomal RNA sequences from Dictyochloropsis
reticulata and from members of the genus Myrmecia (Chloro-
phyta, Trebouxiophyceae cl. nov.). J. Phycol. 31:6329.
Friedl, T. 1997. The evolution of the green algae. Plant Syst. Evol.
11(Suppl):87101.
Graham, L. E. 1993. Origin of Land Plants. Wiley, New York. 287 pp.
Hindk, F. 1963. Systematik der Gattungen Koliella gen. nov. und
Raphidonema Lagerh. Nova Hedwigia 6:95125.
Hindk, F. 1996a. New taxa and nomenclatorical changes in the
Ulotrichineae (Ulotrichales, Chlorophyta). Biologia (Bratislava)
51:35764.
Hindk, F. 1996b. Kl na ur ovanie nerozkonren ch vlknit ch
zelen ch rias (Ulotrichineae, Ulotrichales, Chlorophyceae).
Bull. Slov. Bot. Spol. Pri SAV 1(Suppl):177.
Hoham, R. W. 1973. Pleiomorphism in the snow alga, Raphidonema
nivale Lagerh. (Chlorophyta), and a revision of the genus
Raphidonema Lagerh. Syesis 6:25563.
Huss, V. A. R. & Kranz, H. D. 1997. Charophyte evolution and the
origin of land plants. Plant Syst. Evol. 11(Suppl):10314.
Huss, V. A. R., Frank, C., Hartmann, E. C., Hirmer, M., Kloboucek,
A., Seidel, B. M., Wenzeler, P. & Kessler, E. 1999. Biochemical
taxonomy and molecular phylogeny of the genus Chlorella
sensu lato (Chlorophyta). J. Phycol. 35:58798.
Krantz, H. D., Miks, D., Siegler, M.-L., Capesius, I., Seliseh, C. W. &
Huss, V. A. R. 1995. The origin of land plants: phylogenetic
relationships among charophytes, bryophytes, and vascular
plants inferred from complete small-subunit ribosomal RNA
gene sequences. J. Molec. Evol. 41:7484.
Lemieux, C., Otis, C. & Turmel, M. 2000. Ancestral chloroplast ge-
nome in Mesostigma viride reveals an early branch of green
plant evolution. Nature 403:64952.
Lokhorst, G. M. 1991. Synopsis of genera of Klebsormidiales and
Ulotrichales. Crypt. Bot. 2/3:27488.
Lokhorst, G. M., Sluiman, H. J. & Star, W. 1988. The ultrastructure
of mitosis and cytokinesis in the sarcinoid Chlorokybus atmophy-
ticus (Chlorophyta, Charophyceae) revealed by rapid freeze
fixation and freeze substitution. J. Phycol. 24:23748.
Lokhorst, G. M. & Star, W. 1985. Ultrastructure of mitosis and cyto-
kinesis in Klebsormidium mucosum nov. comb., formerly Ulothrix
verrucose (Chlorophyta). J. Phycol. 21:46676.
Lokhorst, G. M. & Star, W. 1998. Cell division in the genus Koliella
(Charophyceae) with emphasis on the cyclic behaviour of
cleavage-associated and cortical microtubules. Biologia (Brat-
islava) 53:36780.
Manhart, J. R. 1994. Phylogenetic analysis of green plant rbcL se-
quences. Mol. Phylogenet. Evol. 3:11427.
Marin, B. & Melkonian, M. 1999. Mesostigmatophyceae, a new class
of streptophyte green algae revealed by SSU rRNA sequence
comparisons. Protist 150:399417.
Mattox, K. R. & Stewart, K. D. 1984. Classification of the green al-
gae: a concept based on comparative cytology. In Irvine, D. E.
G. & John, D. M. [Eds.] Systematics of the Green Algae. London,
Academic Press, pp. 2972.
Nakayama, T., Marin, B., Kranz, H. D., Surek, B., Huss, V. A. R., In-
ouye, I. & Melkonian, M. 1998. The basal position of scaly
green flagellates among the green algae (Chlorophyta) is re-
vealed by analyses of nuclear-encoded SSU rRNA sequences.
Protist 149:36780.
c c y y
y
PHYLOGENETIC POSITION OF KOLIELLA 451
Pickett-Heaps, J. D. 1972. Cell division in Klebsormidium subtilissimum
(formerly Ulothrix subtilissima) and its possible phylogenetic sig-
nificance. Cytobios 6:16783.
Pickett-Heaps, J. D. 1974. Cell division in Stichococcus. Br. Phycol. J.
9:6373.
Pickett-Heaps, J. D. 1976. Cell division in Raphidonema longiseta.
Arch. Protistenk. 118:20914.
Qiu, Y., Cho, Y., Cox, J. C. & Palmer, J. D. 1998. The gain of three
mitochondrial introns identifies liverworts as the earliest land
plants. Nature 394:6714.
Skuja, H. 1969. Some algae and other protists. Vegetation of Am-
chitka Island, Aleutian Islands, Alaska. Geological Survey Paper
No. 648, U.S. Print. Office, Washington DC, pp. 505.
Sluiman, H. J. 1985. A cladistic evaluation of the lower and higher
green plants (Viridiplantae). Plant Syst. Evol. 149:21732.
Sluiman, H. J., Guihal, C., Friedl, T., Lokhorst, G. M. & Mann, D. G.
1997. Phylogeny of Klebsormidium and -like green algae based
on molecular (rDNA) and morphological evidence. Phycologia
36(Suppl):104.
Stewart, K. D & Mattox, K. R. 1975. Comparative cytology, evolution
and classification of the green algae, with some consideration
of the origin of other organisms with chlorophylls a and b. Bot.
Rev. 41:10435.
Swofford, D.L. 1998. PAUP*. Phylogenetic Analysis Using Parsimony
(*and other methods). Version 4. Sinauer Associates, Sunderland,
Massachusetts.
Szyma ska, H. & Spalik, K. 1993. Typification of names enumer-
ated in Pringsheim monograph of Coleochaete (Charophyceae).
Algol. Stud. 70:2937.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Hig-
gins, D. G. 1997. The ClustalX windows interface: flexible strat-
egies for multiple sequence alignment aided by quality analysis
tools. Nucleic Acids Res. 24:487682.
Van den Hoek, C., Mann, D. G. & Jahns, H. M. 1995. Algae. An Intro-
duction to Phycology. Cambridge, Cambridge University Press.
627 pp.
Wilcox, L. W., Fuerst, P. A. & Floyd, G. L. 1993. The phylogenetic
relationships of four Charophycean green algae inferred from
complete nuclear-encoded small subunit rRNA gene sequences.
Am. J. Bot. 80:102833.
n