Food Control 20 (2009) 376380

Contents lists available at ScienceDirect

Food Control
journal homepage: www.elsevier.com/locate/foodcont

Detection and characterization of virulence factors in lactose positive

and lactose negative Salmonella serovars isolated from seafood
Rakesh Kumar a,*, P.K. Surendran b, Nirmala Thampuran a
a
b

Microbiology, Fermentation and Biotechnology Division, Central Institute of Fisheries Technology, Mastyapuri P.O., Cochin 682 029, India
Poothuvallil, Dr. Surendran Lane, Perumpadappu, Palluruthy P.O., Cochin 282 006, India

a r t i c l e

i n f o

Article history:
Received 27 December 2007
Received in revised form 10 June 2008
Accepted 17 June 2008

Keywords:
Salmonella
Seafood
Lactose positive
Virulence genes

a b s t r a c t
This study is aimed to understand the prevalence of lactose positive (lac+) and lactose negative (lac ) Salmonella serovars in seafood and to determine the presence of virulence traits by PCR assay. Salmonella
serovars were isolated from sh, shrimp, crab, clam, mussel, oyster, squid and cuttlesh of sh market
and sh landing centers of Cochin, India. Lac Salmonella were identied in 18.9% of seafood samples,
whereas, 2% of seafood samples harboured lac+ Salmonella. The virulence factors in lac+ and lac Salmonella were characterized by amplication of three virulence genes i.e. invA, stn and mA genes. Results
exhibited that except m A gene in Salmonella IIIa isolates, all other lac+ and lac Salmonella serovars
showed the presence of invA, stn and mA genes. Thus, study highlighted the prevalence of virulent
lac+ and lac Salmonella serovars in seafood.
2008 Elsevier Ltd. All rights reserved.

1. Introduction
Salmonella serovars are causative agent of the largest number of
enteric infections to humans and the incidences of foodborne salmonellosis has been reported worldwide (DAoust, Maurer, & Bailey, 2001). Seafood is a frequent source of Salmonella
contamination. In USA, 7.4% of imported and 1.3% of domestic seafood samples showed the incidence of foodborne nontyphoidal Salmonella (Heinitz, Ruble, Wagner, & Tatini, 2000). Relatively, high
incidence of Salmonella contamination is reported from developing
countries. In India, detection of Salmonella from seafood has been
reported by Iyer and Shrivastava (1989), Nambiar and Iyer
(1991), and Hatha and Lakshmanaperumalsamy (1997). Salmonella
contamination in sh and shery products has also been reported
from other countries like Thailand (Rattagool, Wongchinda, &
Sanghtong, 1990), Hong Kong (Yam et al., 1999), and Spain (Martinez-Urtaza et al., 2004).
Lactose negative (lac ) Salmonella serovars are most commonly
isolated and identied from seafood, since they are more prevalent
in nature. It has been reported that less than 1% of all salmonellae
ferment lactose (Ewing, 1986). Nonetheless, several other factors
are also responsible for lower incidence of lactose positive (lac+)
Salmonella in food or seafood. Lac+ Salmonella serovars are sporadic
in presence. It is also difcult to identify them, as most of the members of the Enterobacteriaceae are Lac+, hence they escape undetected on selective media plates during analysis. This is because,
* Corresponding author. Tel.: +91 4842666845; fax: +91 4842668212.
E-mail address: rakesh_cift@rediffmail.com (R. Kumar).
0956-7135/$ - see front matter 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.foodcont.2008.06.005

differential media utilizes non-lactose fermentation as a major biochemical property and commonly used differential plating media
for isolation of Salmonella contains lactose. Littell (1977) has demonstrated that routine selective and differential media for Salmonella was not efcient enough to identify Salmonella arizonae
group. The prevalence of lac+ in Salmonella enterica subsp. arizoane,
Salmonella enterica subsp. diarizonae and Salmonella enterica subsp.
indica was reported to be 15, 85, and 22%, respectively and the natural habitat of Salmonella enterica subsp. salamae (II), subsp. arizonae (IIIa), subsp. diarizonae (IIIb), subsp. houtenae (IV) and subsp.
indica (VI) are considered to be cold blooded animals and environments (Popoff & Le Minor, 2005).
Thus, it is suspected that aquatic animals being cold blooded
may harbour naturally lac+ Salmonella serovars and actual incidence of lac+ Salmonella in seafood may be much higher than the
reported incidences. At present, it is very apparent that there is
no reported incidence of lac+ Salmonella in seafood. Outbreaks of
disease from lac+ Salmonella has been reported previously (Camara,
Cardoso, & de Almeido, 1989; Dube, 1983; Falcao, Trabulsi, Hickman, & Farmer, 1975; Ruiz, Nez, Sempere, Daz, & Gmez,
1995). In India, Salmonella arizonae (IIIa) infection in infants and
children has been reported by Mahajan et al. (2003).
The mechanism of virulence factor in Salmonella is well understood and most of genes responsible for virulence genes are clustered in a region called pathogenicity islands (SPI) in Salmonella
chromosome (Marcus, Brumell, Pfeifer, & Finley, 2000). Different
virulence genes such as inv, svp, stn and m have been identied
as major genes responsible for virulence factors in Salmonella.
The invasion (invA) gene found to be present in SPI and responsible

377

R. Kumar et al. / Food Control 20 (2009) 376380

for invasion in the gut epithelial tissue of human and animals,

whereas, stn gene causes enterotoxic effect to epithelial cells, leading to enteric disorder (Asten & Dijk, 2005; Hitchcock et al., 1986).
The mbrial protein type 1 has been implicated in Salmonella pathogenicity (Clegg & Gerlach, 1987). PCR based approach has been
successfully used for the detection of specic genes in Salmonella
(del Cerro, Soto, & Mendoza, 2003; Swamy, Barnhart, Lee, & Dreesen, 1996). The virulence factors of lac Salmonella serovars have
been well studied (Asten & Dijk, 2005; Groisman & Ochman,
1996) however, very few information on virulence factor of lac+
Salmonella is available.
The present studies focused on the incidence of lac+ and lac Salmonella serovars in seafood and characterize the major virulence
factors i.e. invasion (invA) gene, enterotoxin (stn) gene and mbriae
(mA) genes in lac and lac+ Salmonella serovars by PCR assay.
2. Material and methods
2.1. Salmonella identication
A total of 247 seafood samples including sh, shrimp, mussel,
crab, oyster, squid, cuttlesh, octopus, and clam samples from sh
landing centre and local sh market of Cochin (India) were analysed
during this study. Seafood samples were collected in sterile polythene bags, brought to the laboratory in ice box and immediately
(12 h) processed for the assay. Seafood samples included whole
body part of sh, shrimp, squid, cuttlesh and octopus, whereas,
soft muscle parts of crab, clam, oyster and mussel were used in
the study. Each 25 g of sample was homogenized with 225 ml of lactose broth in a stomacher 400 (Seward Medicals, UK) for 30 s and
incubated at 37 C for 24 h. Pre-enrichment samples were transferred into Rappaport Vassiliadis (RV) and tetrathionate (TT) broth
and incubated, respectively at 42 C and 43 C for 1824 h. Subsequently, selective plating onto xylose lysine desoxycholate agar
(XLD), bismuth sulphite agar (BSA), and Hektoen enteric agar
(HEA) at 37 C for 2448 h was carried out. Typical colonies of Salmonella lac+ and lac were further streaked on to MacConkey agar
for purication and conrmation of lactose fermenting isolates.
The key biochemical identication of both lac+ and lac Salmonella
isolates were carried out in lysine iron agar (LIA), triple sugar iron
agar (TSI), Simmons citrate agar, urea agar, indole, malonate, dulcitol, glucose, lactose, methyl red (MR), and Voges-Proskauer (VP) as
per USFDA method (Andrews & Hammack, 2001). Salmonella serotypes were identied with commercial antisera (BD, USA) as per
manufacturer instructions. Rare serovars were identied at National Salmonella and Escherichia coli Centre, CRI, Kasauli and National Salmonella Center (Vet.), Izatnagar, India. All dehydrated
media used in the study were procured from BBL to Difco, USA.
2.2. PCR assay for invA, stn and mA genes
All lac Salmonella serotypes, Salmonella Brancaster, Salmonella
Ohio, Salmonella Typhimurium, Salmonella Newport, Salmonella
Mbandaka, Salmonella Weltevreden, Salmonella Rissen, Salmonella

Braenderup, Salmonella 47:enx15:1,6 and lac+ serotypes (17::,

38:z:, 60:r:z and 45:a:enx) were characterized for different virulence genes by PCR assay. The assay was carried with 1 ml of overnight culture subjected to centrifugation at 10,000g, 2 min, at 4 C
in Centrifuge 5804 R (Eppendorf, Germany). The pellets were dissolved in 200 ll of TE buffer [10 mmol l 1 TrisHCl, 1 mmol l 1
EDTA (pH 8.0)] followed by boiling for 10 min and subsequent
chilling on ice. The cooled cell lysate was centrifuged at 10,000g
for 5 min at 4 C and 5 ll aliquot of DNA lysate was used as a template DNA for PCR assay. The nucleotide primers used for amplication of invA, stn and mA genes were as given in Table 1. A 25 ll
of PCR mixture contained 0.4 pmol ll 1 concentration of primer,
200 mmol l 1 of dNTP (Finnzyme), 1X reaction buffer (20 mmol l 1
TrisHCl (pH 8.0), 50 mmol l 1 KCl, 1.5 mmol l 1 MgCl2), 1U of Taq
polymerase (Dynazyme II, Finland) and 5 ll of sample DNA added
in each PCR tube. DNA amplication was carried out in Mastercycler personal (Eppendorf, Germany) with the following reaction
condition; initial denaturation at 95 C for 2 min, followed by
35 cycles of 95 C for 30 s, 64 C for 30 s, and 72 C for 30 s for invA
gene and 25 cycles of 95 C for 1 min, 55 C for 1 min, and 72 C for
1 min for stn gene. A nal extension of 5 min at 72 C was employed in both cases. The annealing temperature of mA gene
was kept at 58 C and a total of 25 cycles were used for the amplication of desired 85 bp amplicon (Cohen, Mechanda, & Lin, 1996).
The amplied products of invA and stn genes were determined by
electrophoresis on 2% agarose gel whereas, 85 bp mA gene product was on electrophoresized on 2.5% agarose gel. Gel images were
recorded using Alpha Innotech Corporation (USA) gel documentation system.
3. Results
Salmonella serovars were isolated from different seafood samples and 44 out of 247 samples were contaminated with Lac Salmonella serovars. About 2.0% of seafood samples were found to be
positive for lac+ Salmonella serovars. A total of 63 lac Salmonella
isolates and six strains of lac+ Salmonella serovars were isolated
and identied from sh samples (Table 2). The key biochemical
tests of lac Salmonella isolates were lactose negative, malonate
negative, ONPG negative and dulcitol positive results, whereas,
lac+ strains showed lactose positive, malonate variable (+/ ),
ONPG positive and dulcitol negative properties. Remaining biochemical results were similar for both lac and lac+ Salmonella isolates (Table 3). Serotyping of the Salmonella isolates revealed that
Salmonella Weltevreden, Salmonella Typhimurium and Salmonella
Braenderup were predormant serovars in seafood. Majority of Salmonella serovars were isolated from sh samples. Fish harboured
11 different Salmonella serovars and both lac and lac+ serovars
were prevalent. Lac Salmonella serovars were prevalent in sh,
prawn, and clam samples, whereas, lac+ were isolated only from
sh samples.
Presence of virulence traits, invA, stn, and mA genes fragments
were detected in all lac Salmonella serovars (Salmonella Brancaster, Salmonella Ohio, Salmonella Typhimurium, Salmonella Newport,

Table 1
Primer sequence and reaction parameters
Primer sequence

Annealing temperature (C)

No. of cycle

Product size (bp)

References

invA GTGAAATTATCGCCACGTTCGGGCAA
TCATCGCACCGTCAAAGGAACC
stn
CTTTGGTCGTAAAATAAGGCG
TGCCCAAAGCAGAGAGATTC
mA
CCTTTCTCCATCGTCCTGAA
TGGTGTTATCTGCCTGACCA

64

35

284

Rahn et al., 1992

55

33

260

Makino et al., 1999

58

25

85

Cohen et al., 1996

378

R. Kumar et al. / Food Control 20 (2009) 376380

Table 2
Biochemical tests for Lac and Lac+ Salmonella serotypes
Sl. No.

Test

Lac Serotypes

Lac+ Serotypes

1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.

TSI
LIA
Urease
Indole
Glucose
Lactose
Sucrose
Dulcitol
Malonate
ONPG
Tartarate
Mucate
Sorbitol
Salicin

Acid butt & Alkaline slant

Alkaline butt & Alkaline slant

Acid butt & Alkaline slant

Alkaline butt & Alkaline slant

Acid & Gas

Acid & Gas

+

+/
+
+

Fig. 3. Amplication of mA gene (85 bp) in Salmonella serotypes. Lanes 113;

Representative isolates of Sal. Brancaster, Sal. Ohio, Sal. Typhimurium, Sal. Newport,
Sal. Mbandaka, Sal. Weltreveden, Sal. Braenderup, and Sal. Rissen, Sal. 47:enx15:1,6,
Sal. 38:z:, Sal. 60:r:z, Sal. 45:a:enx, and Sal. 17:z36:, respectively, M; 100 bp DNA
ladder.
Table 4
Characterization of virulence genes

Table 3
Salmonella serotypes isolated from seafood
Subspecies

Serotypes

No. of
isolate

Lactose
property

Source

I
I
I

Brancaster
Ohio
Typhimurium

6
8
10

Lac
Lac
Lac

I
I
I
I
I
II
IIIa
IIIb
IIIb
VI

Newport
Mbandaka
Weltevreden
Rissen
Braenderup
47:enx15:1,6
17:z36:
38:z:
60:r:z
45:a:enx

8
5
12
3
9
2
3
1
1
1

Lac
Lac
Lac
Lac
Lac
Lac
Lac+
Lac+
Lac+
Lac+

Fish, Shrimp
Fish
Fish, Shrimp,
Mussel
Fish
Shrimp
Fish, Shrimp, Clam
Fish
Fish, Clam
Shrimp
Fish
Fish
Fish
Fish

Salmonella serotype

No. of Isolate

invA gene

stn gene

mA gene

Salmonella
Salmonella
Salmonella
Salmonella
Salmonella
Salmonella
Salmonella
Salmonella
Salmonella
Salmonella
Salmonella
Salmonella
Salmonella

7
8
10
8
5
12
3
6
2
3
1
1
1

+
+
+
+
+
+
+
+
+
+
+
+
+

+
+
+
+
+
+
+
+
+
+
+
+
+

+
+
+
+
+
+
+
+
+
+
+
+

Brancaster
Ohio
Typhimurium
Newport
Mbandaka
Weltevreden
Rissen
Braenderup
47:enx15:1,6
17:z36:
38:z:
60:r:z
45:a:enx

Salmonella Mbandaka, Salmonella Weltevreden, Salmonella Rissen,

Salmonella Braenderup, Salmonella 47:enx15:1,6) and lac+ Salmonella
serotypes also showed presence of invA, and stn genes (Figs. 1 and 2).
However, mA gene was not detected in Salmonella serotype
17:z36:. All serotypes irrespective of lactose biosynthesis property
produced 284 bp and 260 bp amplicons for invA gene and stn gene,
respectively (Table 4). Except serotype 17:z36:, all lac and lac+
serovars produced 85 bp mA gene product (Fig. 3).
4. Discussions

Fig. 1. Amplication of invA gene (284 bp) in Salmonella serotypes. Lanes 113;
Representative isolates of Sal. Brancaster, Sal. Ohio, Sal. Typhimurium, Sal. Newport,
Sal. Mbandaka, Sal. Weltreveden, Sal. Braenderup, and Sal. Rissen, Sal. 47:enx15:1,6,
Sal. 17:z36:, Sal. 38:z:, Sal. 60:r:z, Sal. 45:a:enx, respectively, M; 100 bp DNA
ladder.

Fig. 2. Amplication of stn gene (260 bp) in Salmonella serotypes. Lanes 113;
Representative isolates of Sal. Brancaster, Sal. Ohio, Sal. Typhimurium, Sal. Newport,
Sal. Mbandaka, Sal. Weltreveden, Sal. Braenderup, Sal. Rissen, Sal. 47:enx15:1,6, Sal.
17:z36:, Sal. 38:z:, Sal. 60:r:z, Sal. 45:a:enx, respectively, M; 100 bp DNA ladder.

This study was focussed on the detection of Salmonella serovars in

seafood with a more emphasis on lac+ Salmonella serovars and investigation highlighted the occurrence of both lac+ and lac Salmonella
serovars in seafood of Cochin (India). The results were apparent distinct as compared to similar study by Nambiar and Iyer (1991),
where prevalence of only lac Salmonella serovars in seafood were
reported. Similarly, lac Salmonella serovars were also isolated from
seafood other parts of the India (Hatha & Lakshmanaperumalsamy,
1997; Shabarinath, Kumar, Khushiramani, Karunasagar, & Karunasagar, 2007). There is a report of isolation of Salmonella arizonae
(IIIa) from frozen sh samples in processing factories of Cochin,
but the property of lactose utilization was not emphasized (Iyer &
Shrivastava, 1989). Lactose fermenting Salmonella Typhimurium in
cattle in the north eastern United States were identied with the
help of Levine-eosine methylene blue agar and isolation of lac+ Salmonella Typhimurium, Salmonella Tuebingen and Salmonella Newport were reported from different sources (Anand, Finlayson,
Garson, & Larson, 1980; Camara et al., 1989; Dube, 1983). Present
study also demonstrated that almost 2% of seafood samples were
contaminated with lactose fermenting Salmonella (Salmonella IIIa,
Salmonella IIIb and Salmonella VI). Blackburn and Ellis (1973), Rodriguez, Troncoso, and Ancizar (1983) isolated lac+ Salmonella serovars
from dairy products and calves. The contamination of coastal marine
areas and the tropical environments contribute signicantly in the

R. Kumar et al. / Food Control 20 (2009) 376380

higher incidences of Salmonella in seafood. The prevalence of Salmonella contamination in seafood originating from tropical Asia Pacic and African countries were reported high as compared to the
other part of the world (Heinitz et al., 2000). Salmonella serotypes
were isolated from oyster in the United Sates bays (Brands, Inman,
Gerba, & Mare, 2005) and 20 different Salmonella serotypes have
been isolated from shellsh production area of northeastern Spain
(Martinez-Urtaza et al., 2004).
Salmonella virulence genes play important role in the pathogenicity of the organism and Salmonella pathogenesis is dictated by
a group of genes responsible for colonization (Thiagarajan, Saeed,
Turek, & Asem, 1996) invasion (Porter & Curtiss, 1997), and spread
within its host (Libby et al., 1997). Adaptation to the host is inuenced by the distribution of mbrial and nonmbrial adhesins
among the salmonellae (Baumler et al., 1997). The virulence factors
in lac Salmonella spp. has been well studied (Asten & Dijk, 2005;
Groisman & Ochman, 1996) relatively very few reports on the
lac+ Salmonella serovars have gathered. To assess the virulence potential of Salmonella isolates, PCR amplication of different genes
were tried. Results showed that all Salmonella serovars contained
the invasion gene (invA). A similar study reported elsewhere, demonstrated the presence of invA gene in a collection of 630 strains
representing over 100 different serovars with a exception of Salmonella Senftenberg and Salmonella Litcheld. (Rahn et al., 1992).
However, later studies suggested that natural deletion was observed in the centisome 63 of pathogenicity islands of Salmonella
spp. (Ginocchio, Rahn, Clark, & Galan, 1997).
Characterization of stn gene in this study showed the amplication of target gene in all 69 Salmonella isolates and revealed the
presence of endotoxin gene in both lac+ and lac Salmonella serovars. Similar observation reported elsewhere indicated that Salmonella stn gene was prevalent among Salmonella enterica (Prager,
Fruth, & Tschape, 1995). In contrary to the previous report (Cohen
et al., 1996), present study demonstrated the conspicuous absence
of mA gene in lac+ Salmonella IIIa isolates associated with seafood.
This could be attributed to the possible genetic variation in mA
gene sequence of Salmonella IIIa isolate from seafood. The frequency of mA gene among Salmonella serovars in a earlier study
demonstrated in all strains, regardless of their ability to express
surface-associated mbriae and retained a considerable amount
of homologous DNA in that gene (Swenson, Clegg, & Old, 1991).
The most signicant aspect observed during this study was
detection of lac+ Salmonella serovars along with lac serovars. Isolation of different lac+ Salmonella IIIa, IIIb, and VI from seafood
(cold blooded animals) during this study indicated the possibility
of inherent lac+ Salmonella serovars in seafood animals. However,
further studies need to be carried out to unravel this aspect. Presence of lac+ Salmonella serovars causes virtual dilemma among
food microbiologist to isolate them successfully during analysis.
Though, Salmonella identication protocols are based on non-lactose biosynthesis property it is necessary that greater attention
be given to identify the lactose fermenting Salmonella serovars as
well. Present study also highlighted the prevalence of virulence
genes in both lac and lac+ Salmonella serovars from the non-outbreak seafood origin and observed that all strains were virulent
in nature, consequently, may cause gastroenteritis to the humans.
In depth studies need to be carried out on the incidence of lac+ Salmonella in seafood along with expression or animal model studies
to ascertain the functional properties of these genes.
Acknowledgments
Authors are thankful to the Director for his kind approval to
publish this paper and wish to thank directors of IVRI, Izatnager
and CRI, Kasauli, India for providing serotyping facility.

379

References
Anand, C. M., Finlayson, M. C., Garson, J. Z., & Larson, M. L. (1980). An institutional
outbreak of salmonellosis due to lactose-fermenting Salmonella Newport.
American Journal of Clinical Pathology, 74, 657660.
Andrews, W. H., & Hammack, T. S. (2001). Salmonella. In Bacteriological Analytical
Manual, Chapter 5, US Food and Drug Administration, Revision A (8th ed.),
Gaithersburg, MD: AOAC International.
Asten, A. J. A. M., & Dijk, J. E. (2005). Distribution of classic virulence factors
among Salmonella spp.. FEMS Immunology and Medical Microbiology, 44,
251259.
Baumler, A., Gilde, J., Tsolis, R. M., van der Velden, A. W. M., Ahmer, B. M. M., &
Heffron, F. (1997). Contribution of horizontal gene transfer and deletion events
to development of distinctive patterns of mbrial operons during evolution of
Salmonella serotypes. Journal of Bacteriology, 179, 317322.
Blackburn, B. O., & Ellis, E. M. (1973). Lactose-fermenting Salmonella typhimurium
from dried milk drying plats. Applied Microbiology, 26, 672674.
Brands, D. A., Inman, A. E., Gerba, C. P., & Mare, C. J. (2005). Prevalence of Salmonella
spp. in oysters in the United States. Applied and Environmental Microbiology, 71,
893897.
Camara, F. P., Cardoso, M. A., & de Almeido, D. F. (1989). Genetic analysis of lactosefermenting Salmonella typhimurium isolated in Rio de Janeiro. Revista da
Sociedade Brasileira de Medicina Tropical, 22, 8183.
Clegg, S., & Gerlach, G. F. (1987). Enterobacterial mbriae. Journal of Bacteriology,
169, 934938.
Cohen, H. J., Mechanda, S. M., & Lin, W. (1996). PCR amplication of the mA
gene sequence of Salmonella typhimurium, a specic method for detection of
Salmonella spp. Applied and Environmental Microbiology, 62, 43034308.
DAoust, J. Y., Maurer, J., & Bailey, J. S. (2001). Salmonella Species. In M. P. Doyle, L. R.
Beuchat, & T. J. Montville (Eds.), Food Microbiology: Fundamental and Formers
(pp. 141178). Washington, D.C.: ASM Press.
del Cerro, A., Soto, S. M., & Mendoza, M. C. (2003). Virulence and antimicrobialresistance gene proles determined by PCR-based procedures for Salmonella
isolated from samples of animal origin. Food Microbiology, 20, 431438.
Dube, S. D. (1983). Outbreak of food poisoning caused by lactose fermenting
Salmonella Tuebingen. Journal of Clinical Microbiology, 17, 688689.
Ewing, W. H. (1986). Differentiation of Enterobacteriaceae by biochemical reaction.
In Edwards and Ewings identication of Enterobactriaceae (4th ed.). New York:
Elsevier Science Publishing Co. Inc.
Falcao, D. P., Trabulsi, L. R., Hickman, F. W., & Farmer, J. J. III, (1975).
Unusual Enterobacteriaceae: Lactose-Positive Salmonella Typhimurium
which is endemic in Sao Paulo. Brazilian Journal of Clinical Microbiology, 2,
349353.
Ginocchio, C. C., Rahn, K., Clark, R. C., & Galan, J. E. (1997). Naturally occurring
deletions in the centisome 63 pathogenicity island of environmental isolates of
Salmonella spp. Infection and Immunity, 65, 12671272.
Groisman, E. A., & Ochman, H. (1996). Pathogenicity islands: Bacterial evolution in
quantum leaps. Cell, 87, 791794.
Hatha, A. A. M., & Lakshmanaperumalsamy, P. (1997). Prevalence of Salmonella in
sh and crustaceans from markets in Coimbatore, South India. Food
Microbiology, 14, 111114.
Heinitz, M. L., Ruble, R. D., Wagner, D. E., & Tatini, S. R. (2000). Incidence of
Salmonella in sh and seafood. Journal of Food Protection, 63, 579592.
Hitchcock, P. J., Leive, L., Lakela, P. H., Riestschel, E. T., Strittmatter, W., & Morrison,
D. C. (1986). Minireview: Lipopolysaccharide nomenclature- past, present and
future. Journal of Bacteriology, 184, 28572862.
Iyer, T. S. G., & Shrivastava, K. P. (1989). On the pattern of Salmonella serotypes in
shery products, frog legs and processing environments. Fishery Technology, 26,
131137.
Libby, S. J., Adams, L. G., Ficht, T. A., Allen, C., Whitford, H. A., & Buchmeir, A. A., et al.
(1997). The spv genes on the Salmonella Dublin virulence plasmid are required for
severe enteritis and systemic infection in the natural host. Infection and Immunity,
65, 17861792.
Littell, A. M. (1977). Plating medium for differentiating Salmonella arizonae
from other Salmonellae. Applied and Environmental Microbiology, 33, 485
487.
Mahajan, R. K., Khan, S. A., Chandel, D. S., Kumar, N., Hans, C., & Chaudhary, R.
(2003). Fatal case of Salmonella enterica subsp. arizonae gastroenteritis in
an infant with microcephaly. Journal of Clinical Microbiology, 41,
58305832.
Makino, S., Kurazono, H., Chongsanguam, M., Hayashi, H., Cheun, H., & Suzuki, S.,
et al. (1999). Establishment of the PCR system specic to Salmonella spp. and its
application for the inspection of food and fecal samples. Journal of Veterinary
Medical Science, 61, 12451247.
Marcus, S. L., Brumell, J. H., Pfeifer, C. G., & Finley, B. B. (2000). Salmonella
pathogenicity islands: Big virulence in small packages. Microbes and Infection, 2,
145156.
Martinez-Urtaza, J., Saco, M., Novoa, J., Perez-Pineiro, P., Peiteado, J., Lozano-Leon,
A., & Garcia-Martin, O. (2004). Inuence of environmental factors and human
activity on the presence of Salmonella serovars in a marine environment. Applied
and Environmental Microbiology, 70, 20892097.
Nambiar, V. N., & Iyer, K. M. (1991). Distribution of Salmonella serotypes in sh in
retail trade in Cochin. Fishery Technology, 28, 3337.
Popoff, M. Y., & Le Minor, L. E. (2005). Salmonella. In G. M. Garrity (Ed.), Bergeys
Manual of Systematic Bacteriology (2nd ed.). New York: Springer Science.

380

R. Kumar et al. / Food Control 20 (2009) 376380

Porter, S. B., & Curtiss, R. III, (1997). Effect of inv mutations on Salmonella
virulence and colonization in 1-day-old white Leghorn chicks. Avian Disease,
41, 4557.
Prager, R., Fruth, A., & Tschape, H. (1995). Salmonella enterotoxin (stn) gene is
prevalent among strain of Salmonella enterica, but not among Salmonella
bongori and other Enterobacteriaceae. FEMS Immunology and Medical
Microbiology, 12, 4750.
Rahn, K., Degrandis, S. A., Clarke, R. C., McEven, S. A., Galan, J. E., & Ginocochio, C.,
et al. (1992). Amplication of invA gene resequence of Salmonella Typhimurium
by polymerase chain reaction as a specic method of detection of Salmonella.
Molecular and Cellular Probes, 6, 271279.
Rattagool, P., Wongchinda, N., Sanghtong, N. (1990). Salmonella contamination in
Thai shrimp. FAO Fish Rep 401, 1823, Suppl. Rome: FAO.
Rodriguez, D., Troncoso, M., & Ancizar, J. A. (1983). Lactose-fermenting Salmonellae
from calves with diarrhoea. Revista Cubana de Ciencias Veterinarias, 14, 5559.
Ruiz, J., Nez, M. L., Sempere, M. A., Daz, J., & Gmez, J. (1995). Systemic infections
in three infants due to a lactose-fermenting strain of Salmonella Virchow.
European Journal of Clinical Microbiology and Infectious Diseases, 14, 454456.

Shabarinath, S., Kumar, H. S., Khushiramani, R., Karunasagar, I., & Karunasagar, I.
(2007). Detection and characterization of Salmonella associated with tropical
seafood. International Journal of Food Microbiology, 114, 227233.
Swamy, S. C., Barnhart, H. M., Lee, M. D., & Dreesen, D. W. (1996). Virulence
determinants invA and spvC in Salmonellae isolated from poultry products,
wastewater, and human sources. Applied and Environmental Microbiology, 62,
37683771.
Swenson, D. L., Clegg, S., & Old, D. C. (1991). The frequency of m genes among
Salmonella serovars. Microbial Pathogenesis, 10, 487492.
Thiagarajan, D., Saeed, M., Turek, J., & Asem, E. (1996). In vitro attachment and
invasion of chicken ovarian granulosa cells by Salmonella enteritidis phage type
8. Infection and Immunity, 64, 50155021.
Yam, W. C., Chan, C. Y., Ho Bella, S. W., Tam, T. Y., Kueh, C., & Lee, T. (1999).
Abundance of clinical enteric bacterial pathogens in coastal waters and
shellsh. Water Research, 56, 5156.