RESEARCH ARTICLE

Epidemiology, Risk Factors and Genotypes

of HBV in HIV-Infected Patients in the
Northeast Region of Colombia: High
Prevalence of Occult Hepatitis B and F3
Subgenotype Dominance
Henry Bautista-Amorocho1*, Yeny Zulay Castellanos-Domnguez1, Laura Andrea
Rodrguez-Villamizar2, Sindi Alejandra Velandia-Cruz1, Jeysson Andrey
Becerra-Pena1, Ana Elvira Farfan-Garca1

OPEN ACCESS
Citation: Bautista-Amorocho H, CastellanosDomnguez YZ, Rodrguez-Villamizar LA, VelandiaCruz SA, Becerra-Pena JA, et
al. (2014) Epidemiology, Risk Factors and
Genotypes of HBV in HIV-Infected Patients in the
Northeast Region of Colombia: High Prevalence of
Occult Hepatitis B and F3 Subgenotype
Dominance. PLoS ONE 9(12): e114272. doi:10.
1371/journal.pone.0114272
Editor: Jason Blackard, University of Cincinnati
College of Medicine, United States of America
Received: August 18, 2014
Accepted: November 9, 2014
Published: December 2, 2014
Copyright: 2014 Bautista-Amorocho et al. This
is an open-access article distributed under the
terms of the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the
original author and source are credited.
Data Availability: The authors confirm that all data
underlying the findings are fully available without
restriction. All relevant data are within the paper.
DNA and translated amino acid sequences can be
found in the GenBank with accession numbers
KM583833-47.
Funding: The study was funded by Universidad de
Santander - UDES research grant numbers 00112-2012 and 025-13 2013. The funders had no role
in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared
that no competing interests exist.

1. University of Santander (UDES), Bacteriology and Clinical Laboratory Program, Department of Health
Sciences, CliniUDES Research Group, Laboratory for Biomedical and Biotechnological Research (LBBR)
Bucaramanga, Santander, Colombia, 2. Industrial University of Santander (UIS), Department of Public Health,
School of Medicine, Research Group on Demography, Public Health and Health Systems (GUINDESS),
Bucaramanga, Santander, Colombia
*henrybau33@gmail.com

Abstract
Introduction: Chronic hepatitis B virus (HBV) infection is an increasing cause of
morbidity and mortality in human immunodeficiency virus (HIV)-infected individuals.
HIV-positive patients are commonly co-infected with HBV due to shared routes of
transmission.
Objectives: Our aim was to determine the risk factors, prevalence, genotypes, and
mutations of the Surface S gene of HBV, and occult hepatitis B infection (OBI)
among patients infected with HIV in a northeastern Colombian city.
Methods: A cross-sectional study was conducted with 275 HIV-positive patients
attending an outpatient clinic in Bucaramanga, Colombia during 20092010. Blood
samples were collected and screened for serological markers of HBV (anti-HBs,
anti-HBc and HBsAg) through ELISA assay. Regardless of their serological profile,
all samples were tested for the HBV S gene by nested-PCR and HBV genotypes
were determined by phylogenetic inference. Clinical records were used to examine
demographic, clinical, virological, immunological and antiretroviral therapy (ART)
variables of HIV infection.
Results: Participants were on average 3711 years old and 65.1% male. The
prevalence of HIV-HBV coinfection was 12% (95%CI 8.416.4) of which 3.3% had
active HBV infection and 8.7% OBI. The prevalence of HIV-HBV coinfection was
associated with AIDS stage and ART treatment. Sequence analysis identified

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

1 / 14

Occult Hepatitis B among Colombian HIV Patients

genotype F, subgenotype F3 in 93.8% of patients and genotype A in 6.2% of

patients. A C149R mutation, which may have resulted from failure in HBsAg
detection, was found in one patient with OBI.
Conclusions: The present study found a high prevalence of HIV-HBV coinfection
with an incidence of OBI 2.6-fold higher compared to active HBV infection. These
findings suggest including HBV DNA testing to detect OBI in addition to screening
for HBV serological markers in HIV patients.

Introduction
Hepatitis B virus (HBV) and human immunodeficiency virus (HIV) are major
public health problems, particularly in developing countries. Both viruses share
risk factors and transmission routes which accounts for a high frequency of HIVHBV coinfection [1]. Approximately, 35 million (32.238.8 million) individuals
worldwide are HIV carriers, of which 3 to 6 million have chronic hepatitis B
(CHB) for an estimated HIV-HBV coinfection incidence of 520% [2, 3].
In the last decade, mortality associated with acquired immunodeficiency
syndrome (AIDS) and opportunistic infections has substantially decreased in
regions with extensive use of antiretroviral therapy (ART). Nevertheless, liver
disease has emerged as one of the top-five causes of morbi-mortality among
people living with HIV [4, 5]. Compared to HBV mono-infection, HIV-HBV
coinfection is associated with a fivefold increase in the risk of CHB progression,
and a twofold increase in mortality due to end-stage liver disease [6]. ART classes,
such as lamivudine and tenofovir, exhibit dual activity in co-infected patients by
modifying the HBV serological profile and increasing drug resistance related to
mutant HBV strains [79].
Screening for HBV infection consists of immunoenzymatic assays that detect
surface antigens (HBsAg) and antibodies against the viral core (anti-HBc) [10].
Some individuals infected with HBV are HBsAg negative; a clinical condition
known as occult HBV infection (OBI) [1113]. These individuals are eventually
diagnosed using molecular biology techniques for viral DNA isolation in blood or
liver tissue. Unfortunately, in developing countries such as Colombia, molecular
testing for HIV-HBV coinfection is not always performed.
A variety of hypotheses have been put forward to explain the mechanism of
OBI: formation of HBsAg antibodies against S antigen (anti-HBs) immune
complexes, low levels of HBV DNA replication, mutations in the S gene
immunogenic domain, and viral interference mediated by the hepatitis C virus
[1315]. Similar to the end stage of CHB, OBI can result in adverse clinical
outcomes such as acute liver failure, cirrhosis or cellular hepatocarcinoma (CHC)
[1617].
The prevalence of HIV-HBV coinfection varies according to the burden of HBV
infection across and within countries [18]. Studies in Colombia have indicated

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

2 / 14

Occult Hepatitis B among Colombian HIV Patients

that HBV is endemic with regional variations (low, intermediate and high
endemicity patterns) [19]. Epidemiological reports have shown an increase in the
incidence of HBV from 3.1 cases per 100,000 inhabitants in 2008 to 4.8 in 2012
[20, 21]. Despite the implementation of public health strategies to reduce the
burden of HIV and HBV in Colombia, both viral infections have increased over
the last decade. To date, no studies have been conducted to establish the incidence
of simultaneous coinfection of HIV with OBI, and HBV genotype distribution
among HIV patients in Colombia.
The objective of this study was to determine the prevalence of HBV and OBI
among patients living with HIV in northeast Colombia, a geographic region with
low HBV endemicity. In addition, we aimed to identify genotypes, subtypes and
mutations of the HBV S gene, and explore associations with clinical, virological
and immunological HIV variables. Our purpose is to provide knowledge to
support strategies for the prevention, surveillance and control of the burden of
disease caused by HBV and HIV infections in Colombia.

Material and Methods

Study design and participants
A cross-sectional study with non-probabilistic sampling was conducted among
individuals who attended an outpatient clinic for HIV patients in Bucaramanga
(the capital city of Santander) from January 2009 to July 2010. The region of study
comprised a catchment area of 30,537 km2 with approximately 2 million
inhabitants living in the Department of Santander in northeast Colombia. We
included patients who had been previously confirmed for HIV infection by
western blot after two positive ELISA tests. Socio-demographic, epidemiological,
and HIV-related clinical and laboratory data were collected from recent medical
records using a standardized form.

Serological tests and HBV infection definitions

Blood specimens were collected in sterile tubes and sera were frozen in small
aliquots at 280 C. All samples were tested in triplicate for HBsAg, anti-HBs, and
anti-HBc using commercial ELISA kits (Biokit, Spain). Active HBV infection was
defined as a positive HBsAg test. Both positive anti-HBs and anti-HBc tests
indicated a resolved infection. Anti-HBs positive status was an indicator of
vaccine-induced immunity. Isolated anti-HBc was confirmed when an anti-HBc
serological test was positive with no other positive biomarker. OBI was defined as
the detection of HBV DNA by nested PCR and HBsAg negative results. HIV-HBV
coinfection was defined as evidence of current exposure to HBV, including active
HBV infection and OBI.

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

3 / 14

Occult Hepatitis B among Colombian HIV Patients

HBV DNA purification and amplification of the S gene

DNA was isolated from 1 ml of serum from HIV positive patients with the
QIAamp Ultra Sense Virus kit (QIAgen, USA) according to the manufacturers
instructions. A 581 bp fragment of HBV S gene (HBs) was amplified with an inhouse nested PCR protocol and a Platinum Taq DNA polymerase High Fidelity
kit (Invitrogen, USA). We used PrimerSelect software (Lasergene 11.0,
DNASTAR, USA) to design two sets of primers derived from a conserved region
of the HBV genome. The outer primers were HBS1 forward (position 87-110 nts,
59ACCCTGTTCCGACTATTGCCTCTC 39) and HBS2 reverse (position 17461726 nts, 59 CCCCCAGCTCCTCCCAGTCCT 39). The inner primers were
HBS3 forward (position 131-154 nts, 59 AAGACTGGGGGCCCTGCTATGAAC
39) and HBS4 reverse (position 711-688 nts, 59 AGCCCTACGCACCACTGAACAAAT 39). First round amplification was performed in a volume of
50 ml, containing 2 mM MgSO4, 0.2 mM each dNTP, 1 U Platinum Taq DNA
high fidelity enzyme, 0.2 mM of each primer and 10 ml of sample DNA. After an
initial denaturation step at 94 C for 2 min, 35 amplification cycles were carried
out with denaturation at 94 C for 1 min, annealing at 55 C for 30 s and
elongation at 68 C for 2 min. The second PCR round was performed under the
same conditions, except 2 ml of the first-round product were loaded into the
reaction tube. To avoid false negative or false positive results, rigorous testing
procedures were followed to prevent sample cross-contamination. Experiments
were run with appropriate controls, and test results were considered valid only
when obtained in triplicate.

DNA sequencing and phylogenetic analysis

PCR products were analyzed by electrophoresis using 1.3% agarose gels. A 581 bp
fragment was excised with a commercially available QIAquick Gel Extraction Kit
(QIAgen, USA) according to the manufacturers instructions. Nucleotide
sequences were determined from both strands using primers HBS3 and HBS4, and
the resulting DNA was directly sequenced by automated dideoxy sequencing with
a genetic analyzer (Applied Biosystems, USA). HBV genotypes and subtypes were
determined by phylogenetic analysis with a panel of reference sequences from
genotypes A to H retrieved from GenBank. The sequences were aligned with the
Clustal Wallis algorithm using MegAlign software (Lasergene 11.0, DNASTAR,
USA). The Neighbor-Joining method was used to construct the phylogenetic tree
based on reliability bootstrap analysis with 1000 replicates using MEGA6 software.
Finally, evolutionary distances were computed with the Kimura 2-parameter
method [2224].

Analysis of mutations in the S region

The presence of mutations in the a antigenic loop and the major hydrophilic
region (MHR) were analyzed from amino acids 124147 and 100160 of HBsAg,

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

4 / 14

Occult Hepatitis B among Colombian HIV Patients

respectively. Translated amino acid sequences were compared with at least 15

reference sequences of the same genotype obtained from GenBank [25].

Statistical analysis
Statistical analysis was performed using Stata version 11.1 (StataCorp, USA).
Departure from normality of continuous variables was examined using the
Shapiro-Wilk test. The null hypothesis of no difference of categorical, and normal
and non-normally distributed continuous data was assessed using Chi-square, tstudent and U-Mann Whitney tests, respectively. P values less than 0.05 were
considered statistically significant. A binomial multiple regression analysis was
conducted to test the association between HIV-HBV coinfection prevalence and
patient clinical characteristics while adjusting for potential confounding variables.
Prevalence ratios (PR) were calculated with 95% confidence intervals (95% CIs)
around the estimate.

Ethics
The University of Santander (UDES) Ethics Committee board approved the study
protocol. All patients were invited to participate by their own physician and gave
written consent after receiving detailed information about the study. For minors,
the childs legal guardian signed the informed written consent. All patient data
was handled anonymously and recorded using a serial number. This study was
conducted in compliance with the Colombian Medical Code of Ethics and
performed in accordance with the ethical standards laid down in the 1964
Declaration of Helsinki.

Results
A total of 275 HIV-infected patients were recruited. Demographic, epidemiological, virological and immunological characteristics of all patients are summarized
in Table 1. The majority of participants were male (65.1%) of heterosexual
orientation (65.8%), with a mean age of 37.411.4 years (range from 4 to 66
years). The mean CD4 count was 384 cells/mm3 (Interquartile range IQR5 200
533). Mean CD4 counts for mono-infection and HIV-HBV coinfection groups
were 392.3 cells/mm3 and 323.0 cells/mm3, respectively. The median total HIV
viral load (log10) was 1.9 copies/ml (IQR51.63.9). According to WHO
guidelines [26], 36% of patients were in AIDS stage and 89.8% had received ART
treatment. A bivariate analysis revealed statistically significant differences between
HIV mono-infection and HIV-HBV coinfection groups in parameters such as
sexual orientation, ART treatment and AIDS stage (P#0.05) (Table 1).
The prevalence of HIV-HBV coinfection was 12% (95%CI 8.416.4). Among all
patients, 11.6% had resolved infection, 3.3% active HBV infection, 5.1% isolated
anti-HBc and 8.7% OBI. The immune response to HBV vaccine (titers>10 U/l)
was present in 21.8% of HIV patients (Table 2).

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

5 / 14

Occult Hepatitis B among Colombian HIV Patients

Table 1. Baseline characteristics of the study population.

Variable

Overall Population (n5275) HIV Mono-infection (n5242)

n (%)
n (%)

HIV-HBV Coinfection
(n533) n (%)

P Value

Sex
Male

179 (65.1)

153 (63.2)

26 (78.8)

Female

96 (34.9)

89 (36.8)

7 (21.2)

0.078a

Mean age (SD)

37.4 (11.4)

37.1 (11.7)

39.5 (8.7)

0.258b

Heterosexual

181 (65.8)

166 (68.6)

15 (45.5)

Homosexual

41 (14.9)

33 (13.6)

8 (24.2)

Sexual orientation
0.050a

Bisexual

16 (5.8)

14 (5.8)

2 (6.1)

Not registered

37 (13.5)

29 (12.0)

8 (24.2)

,200

68 (24.7)

57 (23.6)

11 (33.3)

>200

207 (75.3)

185 (76.4)

22 (66.7)

Median (IQR) HIV viral load (log10 copies/ 1.9 (1.63.9)

ml)

1.89 (1.63.9)

2.5 (1.64.7)

0.070c

AIDS stage

99 (36.0)

80 (33.1)

19 (57.6)

0.006a

ART treatment

247 (89.8)

220 (90.9)

27 (81.8)

0.053a

Total CD4 cells/mm3

0.222a

SD5Standard deviation; IQR5Interquartile range; ART5Antiretroviral therapy.

a
Chi square test; b t-student test; c U-Mann Whitney test.
doi:10.1371/journal.pone.0114272.t001

Multivariate analyses showed that the adjusted prevalence of HIV-HBV

coinfection was associated with having AIDS whereas ART treatment had a
protective effect against co-infection (Table 3). No differences in clinical
parameters were found among participants with HIV-HBV coinfection by OBI
status.
Among 275 HIV-infected patients, HBV-DNA was detected in 30 participants
(n56 active HBV infection and n524 OBI) from which 15 high-quality sequence
samples with OBI were obtained for phylogenetic and HBs mutation analysis. A
Table 2. Prevalence of different categories of HBV status among patients diagnosed with HIV in Bucaramanga, Colombia.
HBV status

95% CI

Susceptible

136

49.5

43.555.4

Vaccinated

60

21.8

16.926.7

Resolved infection

32

11.6

7.815.4

Active HBV infection

3.3

1.15.3

Isolated Anti-HBc

14

5.1

2.47.7

OBI

24

8.7

5.312.1

Total

275

100

doi:10.1371/journal.pone.0114272.t002

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

6 / 14

Occult Hepatitis B among Colombian HIV Patients

Table 3. Binomial multivariate model for HIV-HBV coinfection.

Variable

PR*

95% CI

ART treatment

0.4

0.21.0

Homosexual or bisexual orientation

1.5

0.72.9

AIDS stage

2.7

1.45.1

*PR5Prevalence ratio.
doi:10.1371/journal.pone.0114272.t003

phylogenetic tree based on a 425-nucleotide fragment of the HBV S gene revealed

that 14 strains belonged to genotype F subtype F3 (93.3%) and one to genotype A
(6.7%) (Figure 1). All HIV patients coinfected with OBI were analysed
individually (n524) (Table 4). The majority of these patients (75%) were male,
average age 39.8 9.6 years, and mean CD4 count 313.5 cells/mm3, (IQR5 146
458.5). The median HIV viral load (log10) was 2.49 copies/ml (IQR5 1.604.78)
and 50% were in AIDS stage. Surprisingly, the distribution of HBV serological
markers in OBI patients indicated that 12.5% were positive for anti-HBc, 4.2% for
anti-HBs, 58.3% were double positive (anti-HBs/anti-HBc) and 25% were
negative for all markers. There were three patients with four amino acid
substitutions in the MHR (Q101H; C149R; L158G; G159R). We did not detect
any mutations in the antigenic a determinant of HBsAg (amino acids 124147).

Discussion
The present study is a comprehensive cross-sectional analysis of HBV prevalence
in a large group of people living with HIV in northeast Colombia. To the best of
our knowledge, this is the first report describing high HIV-OBI coinfection and
viral genotypes in the country, regardless of serological HBV markers. Our results
confirm the high prevalence of HBV, F3 subgenotype dominance, absence of
mutations in the a antigen determinant of the HBsAg in OBI patients, and low
hepatitis B vaccine coverage, with most HIV-mono-infected individuals
susceptible to HBV infection.
The prevalence of HIV-HBV coinfection in HIV patients, defined as HBV
exposure and positive results in serological markers of HBV infection, varies
worldwide. Mexico and France have reported up to 70% coinfection rates [27, 28].
Coinfection rates in South Africa are around 30%, [29] and 34.7% the United
States [30]. Our data showed an overall prevalence (past and current HBV
infection) of 28.7%; an estimate that is lower than those of other Latin American
countries such as Chile (46.3%), Cuba (45.5%) and Brazil (3055.1%) [3135]. A
previous population-based study conducted in Medellin (Colombia) yielded an
HIV-HBV coinfection rate of 38.6% [36] and an active HBV infection rate of
2.1%, which is similar to the 3% prevalence identified by our study in
Bucaramanga. Remarkably, the endemicity of HBV mono-infection in the two
Colombian cities has been classified as low [19].

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

7 / 14

Occult Hepatitis B among Colombian HIV Patients

Figure 1. Phylogenetic relationship based on a 425 bp fragment of the small HBs gene (nucleotides
234659 from EcoRI site) of 15 isolates from HIV patients with OBI (GenBank accession numbers
KM583833- KM583847). The phylogenetic tree was constructed using the neighbor-joining method with a
1000-bootstrap replicate analysis indicating the percentage of occurrences (numbers on the nodes). Isolates
were portrayed with mfollowed by BUCPAT, the patients code and Colombia. Each sequence retrieved from
the GenBank is designated by the corresponding genotype, accession number and country of origin.
doi:10.1371/journal.pone.0114272.g001

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

8 / 14

Occult Hepatitis B among Colombian HIV Patients

Table 4. HIV and HBV biomarkers in patients coinfected with OBI.

HIV viral load
(log10 copies/ AIDS
ml)
Stage

Positive serological marker

for HBV

HBV
Genotype

HBsAg changes in
the amino acid
sequence

Anti-HBs/Anti-HBc

F3

wt

Patient Code

Age

Sex

CD4 counts
(cells/ml)

40

428

4,91

No

39

339

1,60

No

Anti-HBs/Anti-HBc

47

678

1,70

Yes

Anti-HBs/Anti-HBc

F3

wt

25

210

1,92

Yes

Anti-HBs/Anti-HBc

F3

wt

22

38

168

1,60

Yes

None

24

37

144

5,06

No

None

F3

wt

34

21

45

4,81

Yes

Anti-HBc

49

42

416

3,51

No

Anti-HBs/Anti-HBc

53

49

219

2,48

Yes

Anti-HBs/Anti-HBc

54

55

600

1,60

No

Anti-HBs/Anti-HBc

F3

G50A

59

54

392

3,94

No

Anti-HBs/Anti-HBc

F3

wt

61

47

448

1,87

No

Anti-HBs/Anti-HBc

F3

wt

66

45

117

2,22

No

Anti-HBs/Anti-HBc

F3

S31T

71

35

201

1,60

Yes

Anti-HBs/Anti-HBc

72

35

471

3,87

No

Anti-HBs/Anti-HBc

73

56

576

1,60

Yes

Anti-HBs/Anti-HBc

F3

wt

76

44

129

5,65

Yes

Anti-HBs/Anti-HBc

S31N/Q101H

90

25

77

4,74

Yes

None

104

29

148

4,81

No

None

F3

G50A

130

41

123

5,23

No

None

F3

C149R

183

51

668

2,50

No

None

F3

wt

207

33

306

1,60

Yes

Anti-HBs

268

33

469

1,60

Yes

Anti-HBc

F3

L158G/G159R

272

35

153

4,63

Yes

Anti-HBc

F3

wt

M: male; F: female; wt: wild type. Bold case letters correspond to amino acid changes in the MHR of the HBsAg.
doi:10.1371/journal.pone.0114272.t004

Our findings reveal a high (8.7%) prevalence of HIV-OBI coinfection with large
heterogeneity in the HBV serological profile. Most previous studies examining
OBI in HIV patients have included participants with isolated anti-HBc and other
serological markers, with prevalence estimates ranging from 5 to 45% depending
on the geographic location, the pattern of HBV endemicity, and the relative
sensitivity of viral DNA assays [37, 38]. In this study, we found OBI in 12.5% of
patients with isolated anti-HBc; a lower proportion than those reported in Brazil
and Mexico (20%) but higher than the 5.6% reported in Argentina [37 39,40]. A
number of molecular mechanisms leading to OBI have been proposed including
mutations in the a determinant, located among amino acids 124147 of HBsAg,
and other viral strategies that impair or reduce HBs gene expression [1315]. We
did not find amino acid substitutions in the a antigenic loop in patients coinfected with HIV-OBI. Mutations in the MHR (Q101H, C149R, L158G and
G159R) were identified in three patients (one of which did not have any hepatitis

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

9 / 14

Occult Hepatitis B among Colombian HIV Patients

B serological markers). In a biological model, transfection of HBV genotype A

clones in HepG2 cells revealed that the C149R mutation severely impaired HBV
secretion in vitro [41]. The mutation G159R has been observed in Iran among
HBsAg-positive individuals with genotype D whereas mutation Q101H was found
in an OBI patient in India [42, 43]. Taken together, these data confirm that
mutations in the a antigenic loop or MHR in the HBs gene are not the sole
factors associated with OBI.
Another potential mechanism of OBI is suggested by the simultaneous presence
of HBV DNA and anti-HBs, implying viral persistence after apparent infection
resolution. In the present study, 58.3% of HIV-OBI coinfections were identified as
anti-HBs/anti-HBc carriers. Previous findings in Africa have shown incidence
rates of an anti-HBs/anti-HBc serological profile of 25% and 33.4% among
Nigerian and Ghanaian patients with OBI, respectively. [44, 45]. Our sequence
analysis indicated that five anti-HBs/anti-HBc OBI samples were HBV wild-type
strains, two of which had amino acid substitutions outside the MHR in the HBs
gene. OBI reactivation in the presence of anti-HBs-positive status and past
exposure to HBV may cause chronic liver disease among HIV patients [46].
Bivariate analysis revealed differences in sexual orientation, ART treatment and
AIDS stage between the HIV mono-infection and HIV-HBV coinfection groups.
After adjusting for confounding factors in a multivariate analysis, the prevalence
of HIV-HBV coinfection was positively associated with AIDS, whereas ART
treatment was found to have a protective effect. The association with AIDS likely
represents a higher immunosuppression stage in patients with HIV-HBV coinfection as they had lower CD4 count means, even in the presence of a similar
proportion of patients with less than 200 cells/mm3. The role of the immune
system in the genesis of OBI remains controversial. Some authors have not
observed high CD4 counts among HIV-OBI co-infected patients while others have
not encountered any association with lower CD4 counts and OBI in HIV settings
[47, 49]. The apparent protective effect of ART treatment may be related to a
relative immune reconstitution in patients under regular treatment. These
findings are in line with a previous report suggesting that OBI should be seen as
an opportunistic reactivation of HBV whose replication is likely suppressed by
initiation and maintenance of ART treatment [47]
A recent study reported the predominance of male sex and homosexual
orientation, possibly due the high risk of exposure to HBV from unprotected
sexual intercourse [30]. Likewise, increased HIV-HBV coinfection among older
adults has been previously described [7, 48]. On the other hand, low CD4 has been
associated with OBI compared to isolated anti-HBc in HIV-coinfected patients
(P50.019) [48]. In contrast to previous studies, our results showed no differences
between the HIV mono-infection and HIV-HBV coinfection groups by sex, age or
CD4 count.
The phylogenetic tree analysis identified genotype F, subgenotype F3 in most
patients (93.8%) and genotype A in 6.2% of patients, as expected for the
Colombian population. Previously, in a multi-center blood donors study,
Alvarado-Mora et al. characterized F3 strains as the most prevalent subtype in the

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

10 / 14

Occult Hepatitis B among Colombian HIV Patients

country (75%) followed by the A2 subgenotype (15.3%) [50].To our knowledge,

this is the first report to describe HBV strains among HIV patients in Colombia.
Our study has some limitations. Firstly, even though we enrolled a large HIVinfected population, the small number of OBI and active HBV infection cases
precluded the estimation of differences in clinical and molecular parameters
between HIV-HBV co-infected subsets. Secondly, we did not sequence viral DNA
from HBsAg-positive patients to compare S gene between active HBV and OBI
cases. Third, the limited detection of mutations within the a determinant likely
reflects the use of direct sequence data rather than cloning or no comparison to
chronic HBV sequences from the same population. Fourthly, we did not measure
alanine aminotransferase (ALT) and aspartate aminotransferase (AST) to evaluate
liver injury and its association with HBV infection. Future studies are warranted
to analyze clinical, virological and epidemiological variables in a large group of
HIV-HBV coinfected patients in Colombia.
In summary, OBI is a public health problem among HIV-infected patients in
northeast Colombia that increases the risk of potential complications such as
acute liver failure, cirrhosis and CHC. Our results suggest that earlier diagnosis of
OBI should include molecular screening of all HIV-positive patients, regardless of
their serological HBV pattern. Furthermore, vaccination and anti-HBs antibody
screening is recommended to diminish HBV exposure in immune-naive HIV
patients.

Supporting Information
Text S1. Supplementary spreadsheet.
doi:10.1371/journal.pone.0114272.s001 (PDF)

Acknowledgments
We would like to thank the patients included in this study, the participating
institution, and the technical staff of the Department of Health Sciences
Bacteriology and Clinical Laboratory Program at the University of Santander UDES.

Author Contributions
Conceived and designed the experiments: HB YZC AEF. Performed the
experiments: HB YZC AEF SAV JAB. Analyzed the data: HB YZC LAR AEF.
Contributed reagents/materials/analysis tools: HB YZC LAR SAV YAB AEF.
Wrote the paper: HB YZC LAR AEF.

References
1. Rustgi VK, Hoofnagle JH, Gerin GL, Gelmann EP, Reichert CM, et al. (1984) Hepatitis B infection in
the acquired immunodeficiency syndrome. Ann Intern Med 101:795797.

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

11 / 14

Occult Hepatitis B among Colombian HIV Patients

2. Global report: UNAIDS report on the global AIDS epidemic (Nov 2013). Available: http://www.unaids.
org/en/media/unaids/contentassets/documents/epidemiology/2012/gr2012/20121120_UNAIDS_Global_
Report_2012_en.pdf. Accessed 2014 August 11.
3. Alter MJ (2006) Epidemiology of viral hepatitis and HIV co-infection. J Hepatol 44:S69.
4. Martnez E, Milinkovic A, Buira E, de Lazzari E, Leon A, et al. (2007) Incidence and causes of death
in HIV-infected persons receiving highly active antiretroviral therapy compared with estimates for the
general population of similar age and from the same geographical area. HIV Med 8:2518.
5. Martn-Carbonero L, Teixeira T, Poveda E, Plaza Z, Vispo E, et al. (2011) Clinical and virological
outcomes in HIV-infected patients with chronic hepatitis B on long-term nucleos(t)ide analogues. AIDS
25:739.
6. Chun HM, Roediger MP, Hullsiek KH, Thio CL, Agan BK, et al. (2012) Infectious Disease Clinical
Research Program HIV Working Group. Hepatitis B virus coinfection negatively impacts HIV outcomes in
HIV seroconverters. J Infect Dis 205:18593.
7. Liang SH, Chen TJ, Lee SS, Tseng FC, Huang CK, et al. (2010) Risk factors of isolated antibody
against core antigen of hepatitis B virus: association with HIV infection and age but not hepatitis C virus
infection. J Acquir Immune Defic Syndr 54:1228.
8. Kew MC (2010) Hepatocellular carcinoma in African Blacks: Recent progress in etiology and
pathogenesis. World J Hepatol 2:6573.
9. Day SL, Odem-Davis K, Mandaliya KN, Jerome KR, Cook L, et al. (2013) Prevalence, Clinical and
Virologic Outcomes of Hepatitis B Virus Co-Infection in HIV-1 Positive Kenyan Women on Antiretroviral
Therapy. PLoS One 8: e59346.
10. Badur S, Akgun A (2001) Diagnosis of hepatitis B infections and monitoring of treatment. J Clin Virol
21:22937.
11. Raimondo G, Allain JP, Brunetto MR, Buendia MA, Chen DS, et al. (2008) Statements from the
Taormina expert meeting on occult hepatitis B virus infection. J Hepatol 49:6527.
12. Zobeiri M (2013) Occult Hepatitis B: Clinical Viewpoint and Management. Hepat Res Treat 259148:1-7.
13. Schmeltzer P, Sherman KE (2010) Occult hepatitis B: clinical implications and treatment decisions. Dig
Dis Sci 55:332835.
14. Raimondo G, Caccamo G, Filomia R, Pollicino T (2013) Occult HBV infection. Semin Immunopathol
35:3952.
15. Samal J, Kandpal M, Vivekanandan P (2012) Molecular mechanisms underlying occult hepatitis B
virus infection. Clin Microbiol Rev 25:14263.
16. Shi Y, Wu YH, Wu W, Zhang WJ, Yang J, et al. (2012) Association between occult hepatitis B infection
and the risk of hepatocellular carcinoma: a meta-analysis. Liver Int 32:23140.
17. Ikeda K, Kobayashi M, Someya T, Saitoh S, Hosaka T, et al. (2009) Occult hepatitis B virus infection
increases hepatocellular carcinogenesis by eight times in patients with non-B, non-C liver cirrhosis: a
cohort study. J Viral Hepat 16:43743.
18. Te HS, Jensen DM (2010) Epidemiology of hepatitis B and C viruses: a global overview. Clin Liver Dis
14:121.
19. Alvarado-Mora MV, Fernandez MF, Gomes-Gouvea MS, de Azevedo Neto RS, Carrilho FJ, et al.
(2011) Hepatitis B (HBV), hepatitis C (HCV) and hepatitis delta (HDV) viruses in the Colombian
populationhow is the epidemiological situation? PLoS One 296:e18888.
20. Otero JA, Uribe JC, Hormiga CM (2013) Perfil de morbilidad y mortalidad de Santander. Revista del
Observatorio de Salud Publica de Santander 2:354. Available: http://web.saludsantander.gov.co/index.
php?option5com_docman&task5doc_download&gid5500&Itemid521 Accessed 2014 Jun 13.
21. Ministerio de Salud y Proteccion Social. Instituto Nacional de Salud (11 Jun 2014). Protocolo de
vigilancia en salud publica. Hepatitis B, C y coinfeccion hepatitis B-Delta. Available: http://www.ins.gov.
co/lineas-de-accion/subdireccion-vigilancia/sivigila/protocolos%20sivigila/
pro%20hepatitis%20b%20c%20y%20delta.pdf Accessed 2014 August 11.
22. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic
trees. Mol Biol Evol 4:406425.

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

12 / 14

Occult Hepatitis B among Colombian HIV Patients

23. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary
Genetics Analysis version 6.0. Mol Biol Evol 30:27259.
24. Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through
comparative studies of nucleotide sequences. J Mol Evol 16:111120.
25. Avellon A, Echevarria JM (2006) Frequency of hepatitis B virus a determinant variants unselected
Spanish chronic carriers. J Med Virol 78:2436.
26. World Health Organization (March, 2014). To the 2013 consolidated guidelines on the use of
antiretroviral drugs for treating and preventing HIV infection recommendations for a public health
approach supplement. Available: http://www.who.int/hiv/pub/guidelines/arv2013/arvs2013upplement_
march2014/en/Accessed 2014 August 11.
27. Torres-Baranda R, Bastidas-Ramrez BE, Maldonado-Gonzalez M, Sanchez-Orozco LV, VazquezVals E, et al. (2006) Occult hepatitis B in Mexican patients with HIV, an analysis using nested
polymerase chain reaction. Ann Hepatol 5:3440.
28. Attia KA, Eholie S, Messou E, Danel C, Polneau S, et al. (2012) Prevalence and virological profiles of
hepatitis B infection in human immunodeficiency virus patients. World J Hepatol 4:21823.
29. Mphahlele M, Lukhwareni A, Burnett R, Moropeng L, Ngobeni J (2006) High risk of ocullt hepatitis B
virus infection in HIV- positive patients from South Africa. J Clin Virol 35:1420.
30. Tyson GL, Kramer JR, Duan Z, Davila JA, Richardson PA, et al. (2013) Prevalence and predictors of
hepatitis B virus coinfection in a United States cohort of hepatitis C virus-infected patients. Hepatology
58:53845.
31. Mendes-Correa MC, Barone AA, Cavalheiro N, Tengan FM, Guastini C (2000) Prevalence of
hepatitis B and C in the sera of patients with HIV infection in Sao Paulo, Brazil. Rev Inst MedTrop Sao
Paulo 42:815.
32. Souza MG, Passos ADC, Machado AA, Figueiredo JFC, Esmeraldino LE (2004) Coinfeccao HIV e
vrus da hepatite B: prevalencia e fatores de risco. Rev Soc Bras Med Trop 37:3915.
33. Marchesini AM, Pra-Baldi ZP, Mesquita F, Bueno R, Buchalla CM (2007) Hepatitis B and C among
injecting drug users living with HIV in Sao Paulo, Brazil. Rev Saude Publ 41:5763.
34. Braga WSM, Castilho MC, Santos ICV, Moura MAS, Segurado AC (2006) Low prevalence of hepatitis
B virus, hepatitis D virus and hepatitis C virus among patients with human immunodeficiency virus or
acquired immunodeficiency syndrome in the Brazilian Amazon basin. Rev Soc Bras Med Trop 39:519
22.
35. De Almeida Pereira RAR, Mussi ADH, Silva VCA, Souto FJD (2006) Hepatitis B virus infection in HIVpositive population in Brazil: results of survey in the state of Mato Grosso and acomparative analysis with
other regions of Brazil. BMC Infect Dis 6:17.
36. Hoyos-Orrego A, Massaro-Ceballos M, Ospina-Ospina M, Gomez-Builes C, Vanegas-Arroyave N,
et al. (2006) Serological markers and risk factors for hepatitis B and C viruses in patients infected with
human immunodeficiency virus. Rev Inst Med Trop Sao Paulo 48:3216.
37. Gupta S, Singh S (2010) Occult hepatitis B virus infection in ART-nave HIV-infected patients seen at a
tertiary care centre in north India. BMC Infect. Dis 10:53.
38. Lo Re V 3rd, Frank I, Gross R, Dockter J, Linnen JM, et al. (2007) Prevalence, risk factors, and
outcomes for occult hepatitis B virus infection among HIV-infected patients. J Acquir Immune Defic
Syndr 44:31520.
39. Sucupira MV, Mello FC, Santos EA, Niel C, Rolla VC, et al. (2006) Patterns of hepatitis B virus
infection in Brazilian human immunodeficiency virus infected patients: high prevalence of occult infection
and low frequency of lamivudine resistant mutations. Mem Inst Oswaldo Cruz 101:65560.
40. Quarleri J, Moretti F, Bouzas MB, Laufer N, Carrillo MG, et al. (2007) Hepatitis B virus genotype
distribution and its lamivudine-resistant mutants in HIV-coinfected patients with chronic and occult
hepatitis B. AIDS Res Hum Retroviruses23:52531.
41. Kwei K, Tang X, Lok AS, Sureau C, Garcia T, et al. (2013) Impaired Virion Secretion by Hepatitis B
Virus Immune Escape Mutants and Its Rescue by Wild-Type Envelope Proteins or a Second-Site
Mutation. J Virol 87:2352.
42. Moradi A, Zhand S, Ghaemi A, Javid N, Tabarraei A (2012) Mutations in the S gene region of hepatitis
B virus genotype D in Golestan Province-Iran. Virus Genes 44:3827.

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

13 / 14

Occult Hepatitis B among Colombian HIV Patients

43. Pal A, Panigrahi R, Biswas A, Datta S, Sarkar N, et al. (2013) Influence of HIV-associated degree of
immune suppression on molecular heterogeneity of hepatitis B virus among HIV co-infected patients.
Virology 436:13442.
44. Opaleye OO, Oluremi AS, Atiba AB, Adewumi MO, Mabayoje OV, et al. (2014) Occult Hepatitis B
Virus Infection among HIV Positive Patients in Nigeria. J Trop Med 2014:796121.
45. Zahn A, Li C, Danso K, Candotti D, Owusu-Ofori S, et al. (2008) Molecular characterization of occult
hepatitis B virus in genotype E-infected subjects. J Gen Virol 89:40918.
46. Awerkiew S, Daumer M, Reiser M, Wend UC, Pfister H, et al. (2006) Reactivation of an occult hepatitis
B virus escape mutant in an anti-HBs positive, anti-HBc negative lymphoma patient. J Clin Virol 38:83
86.
47. Cohen Stuart JW, Velema M, Schuurman R, Boucher CA, Hoepelman AI (2009) Occult hepatitis B in
persons infected with HIV is associated with low CD4 counts and resolves during antiretroviral therapy.
J Med Virol 81:4415.
48. Rodrguez L, Mesa FC, Aragon U, Daz B, Rivero J (2000) Hepatitis B virus exposure in human
immunodeficiency virus seropositive cuban patients. Mem Inst Oswaldo Cruz 95:2435.
49. Nebbia G, Garcia-Diaz A, Ayliffe U, Smith C, Dervisevic S, et al. (2007) Predictors and kinetics of
occult hepatitis B virus infection in HIV-infected persons. J Med Virol 79:14641471.
50. Alvarado Mora MV, Romano CM, Gomes-Gouvea MS, Gutierrez MF, Botelho L, et al. (2011)
Molecular characterization of the Hepatitis B virus genotypes in Colombia: a Bayesian inference on the
genotype F. Infect Genet Evol11:1038.

PLOS ONE | DOI:10.1371/journal.pone.0114272 December 2, 2014

14 / 14