Você está na página 1de 9

Original Article

Association of GPX1 polymorphism,


GPX activity and prostate cancer risk

Human and Experimental Toxicology


31(1) 2431
The Author(s) 2012
Reprints and permission:
sagepub.co.uk/journalsPermissions.nav
DOI: 10.1177/0960327111411499
het.sagepub.com

O Erdem1, A Eken1, C Akay1, Z Arsova-Sarafinovska2,


zgok4,
N Matevska3, L Suturkova3, K Erten4, Y O
A Dimovski3, A Sayal1 and A Aydn5

Abstract
Prostate cancer is the second most common cancer in men worldwide. Although the aetiology of this disease
remains largely unclear, several lines of evidence suggest that oxidative stress plays a role in prostate carcinogenesis. The antioxidant enzyme glutathione peroxidase 1 (GPX1) is part of the enzymatic antioxidant defence,
preventing oxidative damage to DNA, proteins and lipids by detoxifying hydrogen and lipid peroxides that may
contribute to prostate cancer development. Some studies indicate an association between GPX1 Pro198Leu
polymorphism and an increased risk of cancer. The purpose of the present study was to determine the possible
association of GPX1 Pro198Leu polymorphism and erythrocyte GPX activity with the risk of developing
prostate cancer and to clarify whether erythrocyte GPX activity levels were correlated with the GPX1
Pro198Leu genotype in the Turkish population. The GPX1 Pro198Leu genotype was determined in 33 prostate
cancer patients and 91 control individuals. As evident from our results, there was no difference between
genotype and/or allele frequencies in prostate cancer patients and controls. No significant difference was found
in GPX1 genotype or allele frequency between aggressive and non-aggressive prostate cancer patients. It can
be suggested with these findings that individual susceptibility of prostate cancer may be modulated by GPX1
polymorphism, but it needs further studies.
Keywords
prostate cancer; glutathione peroxidase 1; genetic polymorphism; oxidative stress

Introduction
Prostate cancer continues to be a major age-related
malignancy with most incidences occurring between
54 and 75 years and rapid onset after 45 years. Evidence from epidemiological, experimental and clinical studies suggests that prostate cancer cells are
exposed to an increased oxidative stress.1,2 Reactive
oxygen species (ROS), most notably the hydroxyl
radicals, generated endogenously by cellular metabolism are known to cause oxidative DNA damage that
has been implicated in prostate carcinogenesis.3
The antioxidant enzyme glutathione peroxidase 1
(GPX1) is part of the enzymatic antioxidant defence,
preventing oxidative damage to DNA, proteins and
lipids by detoxifying hydrogen and lipid peroxides.4,5
The cytosolic form of GPX1 belongs to a family of
selenium-dependent peroxidases that include cytosolic GPX,6 plasma-based GPX37 and phospholipids
hydroperoxidase GPX4.8 GPX1 knockout mice have

a normal phenotype but are highly sensitive to


oxidative stressors.9 Human GPX1 gene was found
to possess several polymorphisms. The GPX1 gene
has a GCG repeat polymorphism in exon 1, coding for
a polyalanine tract of five to seven alanine residues.
1
Department of Toxicology, Gulhane Military Medical Academy,
Etlik, Ankara, Turkey
2
Department of Drug Quality Control, Institute of Public Health,
Skopje, Republic of Macedonia
3
University St.Cyril and Methodius, Skopje, Republic of
Macedonia
4
Department of Urology, Gulhane Military Medical Academy,
Etlik, Ankara, Turkey
5
Department of Toxicology, Yeditepe University, 26 Agustos
Yerlesimi, Kayisdagi, Istanbul, Turkey

Corresponding author:
Ahmet Aydn, Department of Toxicology, Yeditepe University, 26
Agustos Yerlesimi, Kayisdagi, Istanbul 34755, Turkey
Email: ahmetaydin30@hotmail.com

Erdem O et al.

However, already there was a casecontrol study


published by Kote-Jarai et al.10 that showed no significant association between the GPX1 GCG repeat
polymorphism and prostate cancer. On the other hand,
GPX1 Pro198Leu is supposed to be functional. This
polymorphism is associated with C to T substitution
in the exon 2 of GPX1, which results in the amino
acid change from proline (Pro) to leucine (Leu) at
codon 198.11
Studies that examine the possible association of the
GPX1 Pro198Leu polymorphism with cancer have
given contradictory results. Some studies reported
that the Leu allele was associated with an increased
risk of breast cancer,4,12 while others could not confirm these results.13,14 No association was found
between the risk of basal cell carcinoma15 and colorectal cancer.16 However, most recent studies reported
that the variant Leu allele was associated with a
significant lower risk of lung cancer.17,18 The studies
conducted on humans do not explicitly support the
functional link between GPX1 genotype and GPX1
enzyme.11 Ravn-Haren et al.4 found that GPX1
activity was significantly lowered for the Leu allele
compared to the Pro allele. However, this result is not
consistent with one study,19 suggesting no correlation
between GPX1 activity and GPX1 genotype. Additionally, several factors have been observed to affect
the activity of GPX1. Dietary intake of selenium
increases GPX1 activity. Intake of fruit and vegetables, alcohol consumption and smoking may also
influence the enzyme activity.20 In the present study,
we evaluated the possible association of the following
three elements: GPX1 Pro198Leu polymorphism,
erythrocyte GPX activity and prostate cancer.

Materials and methods


Subjects
A total of 33 men diagnosed with primary, histologically confirmed prostate cancer (mean age: 67.52 +
9.31 years) and 91 controls (mean age: 64.57 +
8.72 years) were enrolled in the study. All patients
were recruited from the outpatient clinic of the
Urology Department of Gulhane Military Medical
Academy, Turkey. Age-matched male subjects, who
were admitted to the same hospital with histologically
confirmed non-neoplastic diseases, served as controls.
The study was approved by the Ethical Committee
of Gulhane Military Medical Academy. Written
informed consent was obtained from all participants
of the study before collecting blood specimens. A

25

questionnaire was used to elicit detailed information


on demographic and clinical variables, smoking, prior
disease history, and family history of cancer. None of
the participants were taking antioxidant or vitamin
supplements, including selenium, at the time of the
study. None of the subjects had a drinking habit, and
none of them had consumed any alcohol, starting at
least 48 h prior to blood collection.
All tumours were diagnosed histologically with
specimens obtained at biopsy or surgical resection
by a senior pathologist at the Department of the
Pathology. The cancerous tissue from prostate biopsies and prostatectomy specimens was graded according to the Gleason histopathological grading system,
based on the architecture of the glandular tissue,
glandular differentiation and cellular and nuclear
appearance.21

Genotyping of GPX1 polymorphism


Blood samples were drawn from the antecubital vein,
following an overnight fast, into tubes containing
ethylenediaminetetraacetic acid (EDTA). Erythrocyte
lysates were stored at 70 C until assayed, while
genomic DNA was extracted from peripheral blood
lymphocytes following standard proteinase K, phenol/chloroform extraction or ethanol precipitation
procedure.22
The GPX1 Pro198Leu polymorphism was genotyped by real-time polymerase chain reaction (PCR)
as described by Ratnasinghe et al.23 Briefly,
oligonucleotide sequences for primers and probes to
detect the C to T polymorphism in codon 198 were
PCR forward TGTGCCCCTACGCAGGTACA, PCR
reverse CCCCCGAGACAGCAGCA, C allele probe
VIC
CTGTCT CAAGGGCCCAGCTGTGCTAMRA and
T allele probe FAMCTGTCTCAAGGGCTCAGCTGT
GCCTTAMRA. Reactions (10 ml) contained approximately 20 ng genomic DNA isolated from whole blood,
2 TaqMan Master Mix, dual-labelled probes (100 nM
each) and PCR primers (900 nM each). The PCR
reaction was run on a Mx3005P QPCR System (Stratagene, La. Jolla, CA, USA) under the following conditions: 50 C for 2 min, 95 C for 10 min, followed by 40
cycles of 95 C for 15 s and 62 C for 1 min. Genotyping
was repeated on a random 10% samples and results were
identical to the original run.

Erythrocyte GPX activity


GPX activity was measured in erythrocyte lysates as
previously described by Eken et al.24 Briefly, a

26

Human and Experimental Toxicology 31(1)

reaction mixture containing 1 mmol/L Na2EDTA, 2 Table 1. Comparison of cases and controls by selected
mmol/L reduced glutathione, 0.2 mmol/L NADPH, demographic and clinical variables
4 mmol/L sodium azide and 1000 U glutathione Characteristic
Cases
Controls
p Valuea
reductase in 50 mmol/L TRIS buffer (pH 7.6) was
Age (years, mean + SD)
67.52 + 9.31 64.57 + 8.72
0.115
prepared. A total of 20 ml of erythrocyte lysate and Smoking status (n, %)
0.088
980 ml of the reaction mixture were mixed and incuNever
11 (33.3)
29 (31.9)
Current
4 (12.1)
19 (20.9)
bated for 5 min at 37 C. The reaction was initiated
18 (54.5)
43 (47.3)
by adding 8.8 mmol/L hydrogen peroxide and the PSAFormer
(ng/ml)
0.003100
0.00310.31
decrease of absorbance was recorded at 340 nm for Free PSA (ng/ml)
0.16 + 0.25 0.65 + 0.67
0.004
Risk level (n, %)
3 min. GPX activity is expressed in U/ml.
Non-aggressive disease
Aggressive disease

Statistical analysis
Demographic information stratified by casecontrol
status was tabulated as a mean + standard deviation
for continuous variables and a number (and percentage) for categorical variables. Pearsons w2 test was
used to assess group differences on categorical
variables and a two-sample t test was used to assess
group differences for continuous variables. Comparison of the erythrocyte GPX activity between cases
and controls was carried out by a two-sample t test.
A KruskalWallis non-parametric analysis of variance (ANOVA) was used to assess whether mean
concentration of erythrocyte GPX activities varied
by genotype among the controls. Allele and genotype
frequencies of cases and controls were compared with
values predicted by HardyWeinberg equilibrium
using the w2 test. Odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated to evaluate
the associations between GPX1 genotypes and prostate risk. Calculation for the casecontrol study was performed using the DeFinetti computer program, http://
ihg.gsf.de/cgi-bin/hw/hwa1.pl. In all cases, p values
0.05 were considered statistically significant.
Additionally, study subjects were stratified according to age (based on age at diagnosis for cases or age at
selection for controls) to evaluate the relationship of
the GPX1 polymorphism with early-onset prostate
cancer.
The association of the GPX1 polymorphism and
disease status was studied with refitted models for
non-aggressive and aggressive prostate cancer, respectively. Men diagnosed with high-grade cancer
(Gleason score of 710) were categorized as having
aggressive disease; those diagnosed with low-grade
prostate cancer (Gleason score 26) were categorized
as having non-aggressive disease.
For all analysis, we first examined the association
of GPX1 Pro/Leu and Leu/Leu genotype, using Pro/
Pro genotype as a reference. Next, as a result of the

10 (30.3)
23 (69.7)

SD: standard deviation, PSA: prostate specific antigen.


a
P from Pearsons w2 test (categorical variables) or a two-sample
t test (continuous variables).

Table 2. Comparison of GPX erythrocyte activity


between cases and controls
Parameter
Samples (n)
GPX activity
(mean + SD, U/ml)

Cases

Controls

p Valuea

33
7.14 + 1.20

91
8.17 + 1.56

0.0007

SD: standard deviation, GPX: glutathione peroxidase.


a
P from a two-sample t test.

lack of complete information on the functional significance of GPX1 Pro198Leu polymorphism, we analysed the data under the assumption of both
dominant (grouping heterozygous with homozygous
rare allele) and recessive models (grouping heterozygous with wild type).

Results
Subject characteristics
Table 1 shows a casecontrol comparison of selected
baseline subject characteristics. As expected, free
prostate specific antigen (PSA) levels were significantly
different in cases compared with controls. Age and
smoking status were not different in prostate cancer
cases compared to controls.

Erythrocyte GPX activity


As evident from the results shown in Table 2, we found
significantly lower erythrocyte GPX activity in the prostate cancer patients group versus controls (p < 0.001).

GPX1 polymorphism and prostate cancer risk


Table 3 shows the association between GPX1 genotype and prostate cancer risk in Turkish study group.

Erdem O et al.

27

Table 3. Association between GPX1 genotype and prostate cancer risk


GPX1 genotype
Genotype frequencies
Pro/Pro
Pro/Leu
Leu/Leu
Pro/Pro and Pro/Leu
Leu/Leu
Pro/Pro
Pro/Leu and Leu/Leu
Allele frequencies
Pro
Leu

Cases (n, %)

Controls (n, %)

OR

95% CI

(33.3)
(51.5)
(15.2)
(84.8)
(15.2)
(33.3)
(66.7)

40 (44.0)
41 (45.1)
10 (11.0)
81 (89.1)
10 (11.0)
40 (44.0)
51 (56.1)

1.00
0.62
1.82
1.00
0.8
1.00
1.57

Reference
0.221.76
0.516.44
Reference
0.361.76
Reference
0.683.61

39 (59.1)
27 (40.9)

121 (66.5)
61 (33.5)

1.00
1.16

Reference
0.592.28

11
17
5
28
5
11
22

p Value

0.367
0.350
0.572
0.288

0.660

GPX1: glutathione peroxidase 1, OR: odds ratio, CI: confidence interval.

The genotype distribution of GPX1 Pro198Leu was in


HardyWeinberg equilibrium among the controls.
The frequencies of the variant Leu allele were
40.9% and 33.5% in cases and controls, respectively.
Genotype frequencies were 33.3% (Pro/Pro), 51.5%
(Pro/Leu) and 15.2% (Leu/Leu) for cases, and the
respective frequencies were 44.0%, 45.1% and
11.0% for control individuals. As evident from our
results, there was no difference between genotype
and/or allele frequencies in prostate cancer cases and
controls.

GPX1 polymorphism and age at diagnosis of


prostate cancer
The relationship between the GPX1 polymorphism
and prostate cancer risk among the cases and the controls stratified by age at diagnosis (for cases) and age
at selection (for controls) is shown in Table 4. In the
group of men above 65 years, individuals with at least
one variant Leu allele (Pro/Leu or Leu/Leu) had
higher risk than homozygous carriers of Pro-allele
(OR, 5.96; 95% CI, 1.4824.08; p 0.008). Overall,
in this older age subgroup, the variant Leu allele was
associated with a higher risk of prostate cancer than
the Pro allele (OR, 2.79; 95% CI, 1.226.36; p
0.013).

GPX1 polymorphism, aggressive versus


non-aggressive prostate cancer
No significant difference was found in GPX1 genotype or allele frequency between subgroups of cases
divided by disease status (aggressive vs. nonaggressive prostate cancer; Table 5).

GPX1 genotype and GPX activity correlation


Table 6 shows GPX1 genotype and corresponding
GPX erythrocyte activity levels. When measured in
erythrocytes, the GPX activity was not significantly
different between the groups of individuals representing the Pro/Pro, Pro/Leu and Leu/Leu genetic
variants, both in cases and in control subjects.

Discussion
In the present study, we found there was no difference
between genotype and/or allele frequencies in prostate cancer cases and controls. Few studies have
investigated the relationship of GPX1 Pro198Leu and
prostate cancer risk.2,25 Choi et al.25 failed to find
associations between GPX1 Pro198Leu polymorphism and prostate cancer risk among men with a history
of smoking and/or asbestos exposure. Further analyses stratified by factors related to environmental
oxidative stress did not modify associations.25 On the
contrary, Arsova-Sarafinovska et al.2 found an overall
protective effect of the variant Leu allele of the GPX1
polymorphism on the prostate cancer risk.
Furthermore, in our study we found lower erythrocyte GPX activity in the cancer group than in the healthy
controls. These data confirmed our results obtained both
in Macedonian and Turkish populations. It was also
published in previous studies in which we reported that
lower GPx activity was associated with prostate
cancer.2,26 There are variable reports on the activity of
this enzyme in prostate cancer. Jung et al.27 found
no differences in the antioxidant enzymatic activities
of prostatic epithelial cell cultures between benign
and malign tissue. In other studies, malignant epithelial
cells in prostatic adenocarcinoma have been found

28

Human and Experimental Toxicology 31(1)

Table 4. GPX1 genotype and allele frequencies and ORs (95% CI) in cases and controls stratified by age at diagnosis (for
cases) and age at selection (for controls)
GPX1 genotype
Age 65 years
Genotype frequencies
Pro/Pro
Pro/Leu
Leu/Leu
Pro/Pro and Pro/Leu
Leu/Leu
Pro/Pro
Pro/Leu and Leu/Leu
Allele frequencies
Pro
Leu
Age 65 years
Genotype frequencies
Pro/Pro
Pro/Leu
Leu/Leu
Pro/Pro and Pro/Leu
Leu/Leu
Pro/Pro
Pro/Leu and Leu/Leu
Allele frequencies
Pro
Leu

Cases (n, %)

Controls (n, %)

OR

95% CI

8 (57.1)
4 (28.6)
2 (14.3)
12 (85.7)
2 (14.3)
8 (57.1)
6 (42.9)

20 (37.0)
26 (48.1)
8 (14.8)
46 (85.1)
8 (14.8)
20 (37.0)
34 (62.9)

1.00
0.39
0.63
1.00
0.958
1.00
0.44

Reference
0.11.46
0.113.6
Reference
0.185.11
Reference
0.131.46

20 (71.4)
8 (28.6)

66 (61.1)
42 (38.9)

1.00
0.63

Reference
0.251.56

3 (15.8)
13 (68.4)
3 (15.8)
16 (84.2)
3 (15.8)
3 (15.8)
16 (84.2)

19 (52.8)
15 (41.7)
2 (5.6)
34 (94.5)
2 (5.6)
19 (52.8)
17 (97.3)

1.00
5.49
9.5
1.00
0.34
1.00
5.96

Reference
1.3222.85
4.0982.73
Reference
0.091.3
Reference
1.4824.08

19 (50.0)
19 (50.0)

53 (73.6)
19 (26.4)

1.00
2.79

Reference
1.226.36

p Value

0.152
0.597
0.960
0.173

0.313

0.014
0.024
0.103
0.008

0.013

GPX1: glutathione peroxidase 1, OR: odds ratio, CI: confidence interval.

Table 5. GPX1 genotype and allele frequencies and ORs (%95 CI) in aggressive and non-aggressive prostate cancer
GPX1 genotype
Genotype frequencies
Pro/Pro
Pro/Leu
Leu/Leu
Pro/Pro and Pro/Leu
Leu/Leu
Pro/Pro
Pro/Leu and Leu/Leu
Allele frequencies
Pro
Leu

Non-aggressive prostate
cancerb (n, %)

OR

95% CI

(34.8)
(47.8)
(17.4)
(82.6)
(17.4)
(34.8)
(65.2)

3 (30.0)
6 (60.0)
1 (10.0)
9 (90.0)
1 (10.0)
3 (30.0)
7 (70.0)

1.00
0.69
1.5
1.00
1.26
1.00
0.8

Reference
0.133.6
0.1219.44
Reference
0.275.93
Reference
0.163.99

27 (58.7)
19 (41.3)

12 (60.0)
8 (40.0)

1.00
1.06

Reference
0.363.08

Aggressive prostate
cancera (n, %)
8
11
4
19
4
8
15

p Value

0.657
0.756
0.767
0.789

0.921

GPX1: glutathione peroxidase 1, OR: odds ratio, CI: confidence interval.


a
Aggressive prostate cancer: Gleason score 710.
b
Non-aggressive prostate cancer: Gleason score 26.

to express lower levels of antioxidant enzymes than do


benign prostatic epithelium28 or almost no superoxide dismutase (SOD), GPX and catalase (CAT)
enzyme.29 With the lowered GPX activity in the

cancer group, an accumulation of H2O2 might occur,


resulting in higher production of OH radicals. This
highly reactive oxidant molecule binds and oxidizes
DNA, lipids and proteins, and it reacts with structures

Erdem O et al.

29

Table 6. Erythrocyte GPX activity by the Pro198Leu polymorphism in the GPX1 gene in cases and controls
Cases (n 33)
GPX1 genotype
Pro/Pro
Pro/Leu
Leu/Leu
pb

GPX activity (U/ml)

7.42 + 1.50
7.05 + 0.99
6.81 + 1.24
0.6008

Controls (n 91)
n (%)

GPX activity (U/ml)a

n (%)

11 (33.3)
17 (51.5)
5 (15.2)

8.37 + 1.36
7.88 + 1.61
8.60 + 2.00
0.254

40 (44.0)
41 (45.1)
10 (11.0)

GPX1: glutathione peroxidase 1, GPX: glutathione peroxidase, SD: standard deviation, ANOVA: analysis of variance.
a
Values are indicated by mean + SD.
b
p from KruskalWallis non-parametric ANOVA test for difference in GPX activity by GPX1 genotype.

in its close neighbourhood. Any oxidative lesion that


is not repaired can lead to mutations, increasing the
risk of carcinogenesis.30
GPX is part of the defence system that neutralizes
hydrogen peroxide. Heterozygous and homozygous
carriers of the variant allele of the GPX1 Pro198Leu
polymorphism are at 1.8-fold (95% CI, 1.22.8) and
2.3-fold (95% CI, 1.33.8) higher risk of lung cancer,
respectively.15 Homozygous carriers of the variant
allele are at 1.9-fold (95% CI, 1.03.6) increased risk
of breast cancer.15 In this study, we determined the
erythrocyte GPX activity in 33 cases and 91 controls
and found no significant difference by genotype. Our
results agree with previous studies that investigated
the genotypeactivity relationship of the GPX1 polymorphism and reported no difference in activity by
genotype.2,19 Hansen et al.20 also did not find any
association between the GPX1 Pro198Leu polymorphism and colorectal cancer risk. On the contrary,
the results of Ravn-Haren et al.4 indicated that there
were relationships between a well-known GPX1 polymorphism, erythrocyte GPX activity and breast cancer risk among postmenopausal women. They found
that carriers of the variant T-allele of the GPX1
Pro198Leu polymorphism had a slightly higher risk
of breast cancer compared with homozygous wildtype individuals. Our findings might seem somewhat
contradictory: the effect of the GPX1 genotype on
prostate cancer risk would be expected if GPX
enzyme activity differs between the genotypes, such
that a low-activity allele would be associated with a
relatively high risk of prostate cancer due to less efficient prevention of oxidative damage to DNA caused
by oxygen radicals. Thus, we must consider explanations other than the GPX enzyme activity.
Additionally, different dietary and lifestyle factors
may influence GPX enzyme activity. In a recent
human intervention study, it was shown that the

intake of fruit and vegetables significantly increased


the activity of GPX in human erythrocytes.31 Several
studies have shown selenium intake to be associated
with GPX activity and gene expression4, particularly
in populations with a low daily intake, less than
40 mg per day.12,20,32 The actual dietary intake,
alcohol consumption or smoking of that specific day
may have influenced the GPX activity.20 Alcohol
induces lipid peroxidation and has been also reported
to decrease erythrocyte GPX activity in some human
studies but not in others.4,18 The complete story of the
GPX1 genotype is probably complex, a situation that
has proven true for many or most single-nucleotide
polymorphisms.
Risk of prostate cancer increases with age, indicating that inflammatory processes and cumulative exposure to ROS over the life course could be related to
carcinogenesis in the prostate. In this study, there was
an association in the subgroup of men older than 65
years, whereas no significant association was found
in the subgroup of younger men. Vogel et al.15 also
found that age at diagnosis of basal cell carcinoma did
not modify the association between genotype and
cancer risk. More studies are needed to draw a firm
conclusion on the associations between the GPX1
Pro198Leu polymorphism, GPX activity and age in
relation with cancer risk.
We also tested the associations stratified by disease
status, but the GPX1 genotype was not associated
with non-aggressive or aggressive prostate cancer.
This is an agreement with results from other
studies.2,25
In conclusion, prostate carcinoma in Turkish subjects is associated with alterations in systemic antioxidant activities, which may play an important role in
carcinogenesis. These changes in GPX1 activity may
break the balance between oxidative stress and antioxidant defences, and therefore influence the cancer

30

risk. In this context our findings suggest that ROS


may play an important role in prostate carcinogenesis,
and individual susceptibility of prostate cancer may
be modulated by GPX1 polymorphism. We expected
that intake of antioxidants would be protective against
prostate cancer risk particularly among individuals
with a lowered defence against oxidative stress.
Nonetheless, more functional studies of the GPX1
polymorphism in other oxidative stress response
genes in large-pooled studies will help to clarify their
role in prostate carcinogenesis. If confirmed by other
studies, these findings could improve the assessment
of prostate cancer risk and clinical management in
these patients.
Funding
This research was supported by grants from the Turkish
Scientific and Technical Research Association, Tubitak
(to AA) and grants from the Ministry of Education and
Science of the Republic of Macedonia (to AJD and AS).

Declaration of conflict of interest


The authors declared no conflicts of interest.

References
1. Khandrika L, Kumar B, Koul S, et al. Oxidative stress
in prostate cancer. Cancer Lett 2009; 282: 125136.
2. Arsova-Sarafinovska Z, Matevska N, Eken A, et al.
Glutathione peroxidase 1 (GPX1) genetic polymorphism, erythrocyte GPx activity, and prostate cancer risk.
Int Urol Nephrol 2009; 41: 6370.
3. Trzeciak AR, Nyaga SG, Jaruga P, et al. Cellular repair
of oxidatively induced DNA base lesions is defective
in prostate cancer cell lines, PC-3 and DU-145. Carcinogenesis 2007; 28: 13591370.
4. Ravn-Haren G, Olsen A, Tjonneland A, et al. Associations between GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, alcohol consumption and
breast cancer risk in a prospective cohort study. Carcinogenesis 2006; 27: 820825.
5. Arthur JR. The glutathione peroxidases. Cell Moll Life
Sci 2000; 57: 18251835.
6. Chu FF, Doroshow JH, and Esworthy RS. Expression,
characterization, and tissue distribution of a new cellular selenium-dependent glutathione peroxidase,
GSHPx-GI. J Biol Chem 1993; 268: 25712576.
7. Takahashi K, Akasaka M, Yamamoto Y, et al. Primary
structure of human plasma glutathione peroxidase
deduced from cDNA sequences. J Biochem 1990;
108: 145148.

Human and Experimental Toxicology 31(1)


8. Maiorino M, Chu FF, Ursini F, et al. Phospholipid
hydroperoxide glutathione peroxidase is the 18-kDa
selenoproteins expressed in human tumor cell lines.
J Biol Chem 1991; 266: 77287732.
9. de Haan JB, Bladier C, Griffiths P, et al. Mice with a
homozygous null mutation for the most abundant
glutathione peroxidase, GPX1, show increased susceptibility to the oxidative stress-inducing agents paraquat and hydrogen peroxide. J Biol Chem 1998; 273:
2252822536.
10. Kote-Jarai Z, Durocher F, Edwards SM, et al. Association between the GCG polymorphism of the selenium
dependent GPX1 gene and the risk of young onset
prostate cancer. Prostate Cancer Prostatic Dis 2002;
5: 189192.
11. Jablonska E, Gromadzinska J, Reszka E, et al. Association between GPx1 activity and plasma selenium concentration in humans. Eur J Nutr 2009; 48: 383386.
12. Hu YJ and Diamond AM. Role of glutathione peroxidase 1 in breast cancer: loss of heterozygosity and
allelic differences in the response to selenium. Cancer
Res 2003; 63: 33473351.
13. Knight JA, Onay UV, Wells S, et al. Genetic variants
of GPX1 and SOD2 and breast cancer risk at the
Ontario site of breast cancer family registry. Cancer
Epidemiol Biomark Prev 2004; 13: 146149.
14. Cox DG, Hankinson SE, Kraft P, et al. No association
between GPX1 Pro198Leu and breast cancer risk. Cancer Epidemiol Biomark Prev 2004; 13: 18211822.
15. Vogel U, Olsen A, Wallin H, et al. No association
between GPX Pro198Leu and risk of basal cell carcinoma. Cancer Epidemiol Biomark Prev 2004; 13:
14121413.
16. Hansen R, Saebo M, Skjelbred CF, et al. GPX Pro198Leu and OGG1 Ser326-Cys polymorphisms and risk of
development of colorectal adenomas and colorectal
cancer. Cancer Lett 2005; 29: 8591.
17. Yang P, Bamlet WR, Ebbert JO, et al. Glutathione
pathway genes and lung cancer risk in young and old
populations. Carcinogenesis 2004; 25: 19351944.
18. Raaschou-Nielsen O, Sorensen O, Hansen RD, et al.
GPX1 Pro198Leu polymorphism, interactions with
smoking and alcohol consumption, and risk for lung
cancer. Cancer Lett 2007; 247: 293300.
19. Forsberg L, de Faire U, Marklund SL, et al. Phenotype
determination of a common Pro-Leu polymorphism in
human glutathione peroxidase 1. Blood Cells Mol Dis
2000; 26: 423426.
20. Hansen RD, Krath BN, Frederiksen K, et al. GPX1
Pro198Leu polymorphism, erythrocyte GPX activity,
interaction with alcohol consumption and smoking,

Erdem O et al.

21.
22.

23.

24.

25.

26.

and risk of colorectal cancer. Mut Res 2009; 664:


1319.
Bostwick DG. Grading prostate cancer. Am J Clin
Pathol 1994; 102: 3856.
Poncz M, Solowiejczyk D, Harpel B, et al. Construction of human gene libraries from small amounts of
pheripheral blood: analysis of beta-like globin genes.
Hemoglobin 1982; 6: 2736.
Ratnasinghe D, Tangrea JA, Andersen MR, et al. Glutathione peroxidase codon 198 polymorphism variant
increases lung cancer risk. Cancer Res 2000; 60:
63816383.
Eken A, Aydn A, Sayal A, et al. The effects of hyperbaric oxygen treatment on oxidative stress and SCE
frequencies in humans. Clin Biochem 2005; 38:
11331137.
Choi JY, Neuhouser ML, Barnett M, et al. Polymorphisms in oxidative stress- related genes are not associated with prostate cancer risk in heavy smokers.
Cancer Epidemiol Biomarkers Prev 2007; 16: 1115
1120.
Aydin A, Arsova-Sarafinovska Z, Sayal A, et al. Oxidative stress and antioxidant status in non-metastatic

31

27.

28.

29.

30.

31.

32.

prostate cancer and benign prostatic hyperplasia. Clin


Biochem 2006; 39: 176179.
Jung K, Seidel B, Rudolph B, et al. Antioxidant
enzymes in malignant prostate cell lines and in primary
cultured prostatic cells. Free Radic Biol Med 1997; 23:
127133.
Baker AM, Oberley LW, Cohen MB. Expression of
antioxidant enzymes in human prostatic adenocarcinoma. Prostate 1997; 32: 229233.
Gate L, Paul J, Nguyen Ba G, et al. Oxidative stress
induced in pathologies: the role of antioxidants.
Biomed Pharmacother 1990; 53: 169180.
Forsberg L, de Faire U, and Morgenstern R. Oxidative
stress, human genetic variation, and disease. Arch Biochem Biophys 2001; 389: 8493.
Dragsted LO, Pedersen A, Hermetter A, et al. The 6-aday study: effects of fruit and vegetables on markers of
oxidative stress and antioxidative defense in healthy
nonsmokers. Am J Clin Nutr 2004; 79: 10601072.
Neve J. Human selenium supplementation as assessed
by changes in blood selenium concentration and glutathione peroxidase activity. J Trace Elem Med Biol
1995; 9: 6573.

Copyright of Human & Experimental Toxicology is the property of Sage Publications, Ltd. and its content may
not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written
permission. However, users may print, download, or email articles for individual use.