Você está na página 1de 80

Questes:

01. De que maneira os genes determinam o fentipo de um organismo?

02. Defina os seguintes termos, usados em gentica molecular:


a) cistron
b) cdon

03. Considere um segmento de molcula de DNA com a seguinte


seqncia de bases: AAT CAA AGA TTT CCG.
Quantos aminocidos poder ter, no mximo, uma molcula de protena
formada pelo segmento considerado?
a) 15
b) 10
c) 5
d) 3
e) 1

04. Analise as alternativas abaixo, relacionadas com o cdigo gentico:


I. Um mesmo cdon pode codificar mais de um aminocido.
II. Um aminocido pode ser codificado por diferentes cdons.
III. O cdigo usado na espcie humana o mesmo dos vrus.
Esto corretas:
a) I e II
b) I e III
c) II e III
d) Apenas II
e) I, II e III

05. Uma protena constituda por 350 aminocidos. Quantos


nucleotdeos apresenta a cadeia do ADN que codificou tal protena?
a) 150
b) 350
c) 450
d) 700
e) 1 050

06. (FUVEST) Qual o papel do RNA mensageiro e do RNA

transportador na sntese de protenas?

07. Uma clula terminou de sintetizar uma enzima constituda por uma
cadeia de 56 aminocidos. Quantas molculas de RNA-m e de RNA-t
foram usadas na biossntese?

08. Em relao sntese protica errado afirmar que:


a) Uma das fitas do DNA transcrita, formando-se uma molcula de
RNA mensageiro.
b) A traduo da fita do RNA mensageiro feita nos ribossomos.
c) Os ribossomos originam-se do nuclolo.
d) Cada RNA mensageiro codifica uma cadeia polipeptdica.
e) Cada RNA de transferncia possui um anticdon especfico, que se
prende ao aminocido que ir transportar at o ribossomo.

09. (UF - Sergipe) A seleo de cada aminocido que entra na


composio de cadeia polipeptdica determinada por uma seqncia
de:
a) 2 nucleotdeos do DNA;
b) 2 nucleotdeos do RNA;
c) 3 nucleotdeos do RNA;
d) 3 desoxirriboses do DNA;
e) 3 riboses do RNA mensageiro.

10. Considerando o seguinte esquema:

as etapas 1, 2 e 3 representam, respectivamente, os processos de:


a) replicao, transcrio e traduo;
b) replicao, traduo e transcrio;
c) transcrio, replicao e traduo;
d) transcrio, traduo e replicao;
e) traduo, replicao e transcrio.

Resoluo:
01. Atravs de sntese de protenas que, produzindo estruturas

celularesou funcionando como enzimas, determinam as caractersticas


de um organismo.
02. a) Cistron ou gene o segmento de DNA que, atravs das bases
nitrogenadas, codifica a seqncia de aminocidos de uma protena.
b) a seqncia de trs bases que codificam um cdigo.
03. C
04. C
05. E
06. RNA-m leva a mensagem gentica ao ribossomo.
RNA-t transporta aminocidos para os ribossomos.
07. Uma molcula de RNA-m e 56 molculas de RNA-t.
08. E

09. C

10. A

01. (Vunesp-SP) Erros podem ocorrer, embora em baixa freqncia, durante os processos de
replicao, transcrio e traduo do DNA. Entretanto, as conseqncias desses erros podem ser
mais graves, por serem herdveis, quando ocorrem:
a) na transcrio, apenas.
b) na replicao, apenas.
c) na replicao e na transcrio, apenas.
d) na transcrio e na traduo, apenas.
e) em qualquer um dos trs processos.

02. (UFSCar-SP) A droga cloranfenicol tem efeito antibitico por impedir que os ribossomos das
bactrias realizem sua funo. O efeito imediato desse antibitico sobre as bactrias sensveis a ele
inibir a sntese de:
a) ATP.
b) DNA.
c) protenas.
d) RNA mensageiro.
e) lipdios da parede bacteriana.

03. (Vunesp-SP) Considere o diagrama, que resume as principais etapas da sntese protica que
ocorre numa clula eucarionte.
Os processos assinalados como 1 e 2 e a organela representados no diagrama referem-se,
respectivamente, a:
a) transcrio, traduo e ribossomo.
b) traduo, transcrio e lisossomo.
c) duplicao, transcrio e ribossomo.
d) transcrio, duplicao e lisossomo.

e) traduo, duplicao e retculo endoplasmtico.

04. (UFSCar-SP) Um pesquisador, interessado em produzir, em tubo de ensaio, uma protena, nas
mesmas condies em que essa sntese ocorre nas clulas, utilizou ribossomos de clulas de rato,
RNA mensageiro de clulas de macaco, RNA transportador de clulas de coelho e aminocidos ativos
de clulas de sapo. A protena produzida teria uma seqncia de aminocidos idntica do:
a) rato.
b) sapo.
c) coelho.
d) macaco.
e) macaco e do rato.

05. (Fuvest-SP) De que maneira o DNA determina a seqncia de aminocidos das molculas de
protenas?

06. (Unirio-RJ) Supondo que o peso molecular mdio de uma aminocido de 100 unidades, quantos
nucleotdeos em mdia esto presentes em uma seqncia codificadora de RNA-m, responsvel pelo
seqenciamento dos aminocidos em um peptdeo com peso molecular de 27.000 unidades?
a) 810
b) 300
c) 270
d) 81.000
e) 2.700

07. (PUC-SP) (...) De outro lado, o galardo de qumica ficou com os inventores de ferramentas para
estudar protenas, os verdadeiros atores do drama molecular da vida. verdade que a Fundao
Nobel ainda fala no DNA como o diretor de cena a comandar a ao das protenas, mas talvez no
seja pretensioso supor que foi um lapso, e que o sinal emitido por essas premiaes aponta o
verdadeiro futuro da pesquisa biolgica e mdica muito alm dos genomas e de seu seqenciamento
(uma simples soletrao). (...) LEITE, Marcelo. De volta ao seqenciamento. Folha de S. Paulo
20/01/2002
O autor refere-se s protenas como atores do drama molecular e ao DNA como diretor de cena.
Essa referncia deve-se ao fato de:
a) no ocorrer uma correlao funcional entre DNA e protenas no meio celular.
b) o DNA controlar a produo de protenas e tambm atuar como catalisador de raes qumicas
celulares.
c) o material gentico ser constitudos por protenas.
d) as protenas no terem controle sobre o metabolismo celular.
e) o DNA controlar a produo de protenas e estas controlarem a atividade celular.

08. (Cesgranrio-RJ) Assinale a opo que associa corretamente os cidos nuclicos relacionados na
segunda coluna, em algarismos arbicos, com as funes apresentadas na primeira coluna, em
algarismos romanos.
I) Transmite a informao gentica para outras clulas.
II) Atravs da seqncia de suas bases, determina a posio dos aminocidos nas protenas.
III) Transporta os aminocidos, unindo o seu anticdon ao cdon do mensageiro.
1 RNA de transferncia.

2 RNA ribossmico.
3 DNA.
4 RNA mensageiro.
a) I 1, II 2, III 3
b) I 2, II 4, III 1
c) I 3, II 4, III 1
d) I 2, II 4, III 3
e) I 3, II 1, III 2

09. (Fuvest-SP) Existe um nmero muito grande de substncias com funes antibiticas. Essas
substncias diferem quanto maneira pela qual interferem no metabolismo celular. Assim, tetraciclina
liga-se aos ribossomos e impede a ligao do RNA transportador, a mitomicina inibe a ao da
polimerase do DNA e a estreptomicina causa erros na leitura dos cdons do RNA mensageiro.
Essas informaes permitem afirmar que:
I) a tetraciclina impede a transcrio e leva a clula bacteriana morte por falta de RNA mensageiro.
II) a mitomicina, por inibir a duplicao do DNA, impede a multiplicao da clula bacteriana.
III) a estreptomicina interfere na traduo e leva a clula bacteriana a produzir protenas defeituosas.
Das afirmativas acima:
a) apenas I correta.
b) apenas I e II so corretas.
c) apenas II e III so corretas.
d) apenas I e III so corretas.
e) I, II e III so corretas.

10. (Vunesp-SP) Em um segmento de cadeia ativa de DNA, que servir de molde para a fita de RNA
mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA
h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda:
a) Quantas uracilas e quantas guaninas comporo a fita do RNA mensageiro transcrito do DNA
ativado?
b) quantos aminocidos devero compor a cadeia de polipeptdeos que ser formada? Justifique sua
resposta.

Gabarito do seu teste

Resposta 01: letra b

Resposta 02: letra c

Resposta 03: letra a

Resposta 04: letra d

Resposta 05:
- Por meio do processo de sntese de RNA de diversos tipos: RNA mensageiro, RNA transportados e
RNA ribossmico. Atravs da transcrio do cdigo gentico e da posterior traduo do mesmo,
estabelece-se a seqncia de aminocidos que constituiro a molcula protica.

Resposta 06: letra a

Resposta 07: letra e

Resposta 08: letra c

Resposta 09: letra c

Resposta 10:
a) DNA:
- cadeia complementar: 30A 20C 12T 10G
- cadeia ativa:
30T 20G 12A 10C
RNA-mensageiro:
30A 20C 12U 10G
Portanto, o RNAm ter 12 uracilas e 10 guaninas.
b) A cadeia ativa apresenta 72 bases. Cada aminocido codificado por um cdon constitudo por 3
bases. Ento 72 bases (nucleotdeos) correspondem a 24 cdons que codificaro uma protena com
24 aminocidos.

Questo 1
(Uerj) Testes genticos: a cincia se antecipa doena. Com o avano no
mapeamento de 100 mil genes dos 23 pares de cromossomos do ncleo da clula
(Projeto Genoma, iniciado em 1990, nos EUA), j possvel detectar por meio de
exames de DNA (cido desoxirribonucleico) a probabilidade de uma pessoa
desenvolver doenas [...]. (O Globo, 10/08/1997).

Sabe-se que o citado mapeamento feito a partir do conhecimento da sequncia


de bases do DNA. O esquema abaixo que representa o pareamento tpico de
bases encontradas na molcula de DNA :

a)

b)

c)

d)
ver resposta

Questo 2
(PUC-PR) No esquema abaixo sobre a estrutura do DNA, os nmeros 1, 2 e 3
representam, respectivamente:

a)

Base nitrogenada, desoxirribose e fosfato;

b)

Base nitrogenada, fosfato e desoxirribose;

c)

Fosfato, desoxirribose e base nitrogenada;

d)

Fosfato, base nitrogenada e desoxirribose;

e)

Desoxirribose, fosfato e base nitrogenada.

ver resposta

Questo 3
Assinale a alternativa incorreta:
a)
O nome cido nucleico indica que as molculas de DNA e RNA so cidas e
foram identificadas, a princpio, no ncleo das clulas.
b)
O DNA encontrado no ncleo, formando os cromossomos e parte dos
nuclolos, e tambm em pequena quantidade na mitocndria e no cloroplasto.
c)
O cido ribonucleico encontrado no nuclolo, nos ribossomos, no citosol,
nas mitocndrias e nos cloroplastos.
d)
Tanto DNA como o RNA so formados pelo encadeamento de grande
nmero de molculas menores, os nucleotdeos.

e)
As bases existentes na molcula de DNA so a adenina, guanina, citosina e
uracila.
ver resposta

Questo 4
Assinale a alternativa que contm as palavras que completam a frase abaixo:
Existem cinco tipos principais de bases nitrogenadas: adenina, ______________, citosina, __________ e uracila. As duas primeiras possuem um duplo anel de
tomos de carbono e derivam de uma substncia chamada ____________, sendo,
por isso, denominadas bases ______________.
a)

Guanina, timina, purina, pricas.

b)

Timina, guanina, pirimidina, pricas.

c)

Timina, guanina, pirimidina, pricas.

d)

Timina, guanina, pricas, pirimdicas.

e)

Guanina, timina, purina, pirimidina.

ver resposta

Questo 5
As bases nitrogenadas podem ser divididas em bases pricas e pirimdicas.
Assinale a alternativa que contm os nomes das bases pirimdicas.
a)

Adenina, citosina e timina;

b)

Adenina, timina e uracila;

c)

Guanina, timina e uracila;

d)

Citosina, timina e uracila;

e)

Citosina, timina e guanina.

ver resposta

Questo 6
(PUCC-SP) Os itens abaixo referem-se estrutura, composio e funo dos
cidos nucleicos.
Estrutura: I) Dupla hlice; II) Cadeia simples.
Composio: 1) Presena de uracila; 2) Presena de timina.
Funo: a) sntese de protenas; b) transcrio gnica.
So caractersticas do cido ribonucleico:
a)

II 2 b

b)

I1a

c)

I2b

d)

II 1 a

e)

II 1 b

ver resposta

Respostas

Resposta Questo 1
letra a
Na molcula de DNA podemos encontrar as seguintes bases
nitrogenadas:adenina (A), citosina (C), guanina (G) e timina (T), sendo que a
basetimina (T) liga-se sempre adenina (A) por duas pontes de hidrognio, e

a base citosina (C) est sempre ligada guanina (G) por trs pontes de
hidrognio.
voltar a questo

Resposta Questo 2
letra c
1 tanto o DNA quanto o RNA possuem uma molcula de fosfato;
2 pentose, que no caso do DNA a desoxirribose;
3 base nitrogenada, que no caso do DNA pode ser adenina, guanina, citosina e
timina.
voltar a questo

Resposta Questo 3
letra e
As bases existentes na molcula de DNA so a adenina, guanina, citosina etimina.
voltar a questo

Resposta Questo 4
letra a
Existem cinco tipos principais de bases nitrogenadas: adenina, guanina, citosina, timina e uracila. As duas primeiras possuem um duplo anel de tomos de
carbono e derivam de uma substncia chamada purina, sendo, por isso,
denominadas bases pricas.
voltar a questo

Resposta Questo 5
letra d
Existem cinco tipos principais de bases nitrogenadas: adenina, guanina, citosina,
timina e uracila. As duas primeiras possuem um duplo anel de tomos de carbono
e derivam de uma substncia chamada purina, sendo, por isso,
denominadas bases purnicas ou pricas. As outras trs derivam de outro
composto com apenas um anel de carbono, chamado pirimidina, e so
denominadas bases pirimidnicas ou pirimdicas.
voltar a questo

Resposta Questo 6
letra d
O RNA (cido ribonucleico) formado por uma cadeia nica que se enrola sobre
si mesma.
Tanto DNA quanto RNA possuem em comum as bases nitrogenadas adenina,
citosina, guanina, mas somente no RNA que encontramos a base uracila.
O RNA responsvel pelo controle e sntese de protenas.

Questes de Vestibular
1. A respeito dos cidos nuclicos (DNA e RNA) podemos afirmar que:
A) gene um segmento de RNA capaz de produzir protena.
B) a uracila a base nitrogenada exclusiva do DNA.
C) a duplicao do DNA dita semiconservativa porque cada novo DNA conserva
metade do DNA antigo.
D) a pentose do DNA a ribose.
E) durante a transcrio, os dois segmentos do DNA permanecem ativos.

2. Para que possa ocorrer a sntese de protenas, devem ocorrer em


ordem os seguintes eventos:
A) replicao, transcrio e traduo.
B) transcrio, replicao e traduo.
C) transcrio e traduo.
D) traduo, transcrio e replicao.

E) replicao e transcrio.

3. A molcula de ADN constituda por:


A) uma cadeia de polipptidos unidos por pontes de hidrognio.
B) duas cadeias de polipptidos formando uma dupla hlice.
C) uma cadeia de nucletidos que tem a capacidade de se replicar.
D) duas cadeias de nucletidos unidas por pontes de hidrognio.
E) duas cadeias de bases azotadas unidas por polipptidos.

4. Numa molcula de ADN, a quantidade de...

A) adenina mais timina igual de citosina mais guanina.


B) citosina mais uracilo igual de timina mais adenina.
C) uracilo mais adenina igual de citosina mais guanina.
D) guanina mais timina igual de citosina mais uracilo.
E) adenina mais citosina igual de guanina mais timina.

5. O esquema seguinte representa duas cadeias de cidos nucleicos. Podemos concluir


que...

A) I e II correspondem a duas molculas de RNA.


B) I e II correspondem a duas cadeias de uma molcula de RNA.
C) I e II correspondem a duas cadeias de uma molcula de ADN.
D) I corresponde a uma cadeia de ADN e II a uma cadeia de RNA.

E) I corresponde a uma cadeia de RNA e II a uma cadeia de ADN.

6. O esquema seguinte referente estrutura do ADN. Os algarismos 1, 2 e 3


representam,respectivamente...

A) base azotada, desoxirribose e fosfato.


B) base azotada, fosfato e desoxirribose.
C) fosfato, desoxirribose e base azotada.
D)fosfato, base azotada e desoxirribose.
E) desoxirribose, fosfato e base azotada.

7. Leia as afirmativas abaixo:


I. A troca de uma nica base na molcula de DNA leva, obrigatoriamente,
substituio de uma aminocido na cadeia polipeptdica correspondente.
II. A duplicao do DNA ocorre de maneira semiconservativa.
III. A DNA polimerase uma enzima especial que est diretamente envolvida na
duplicao da molcula de DNA.
A afirmativa est CORRETA em:
a) I, II e III.
b) I e II, apenas.
c) I e III, apenas
d) II e III, apenas.
e) II, apenas.

8. (UFPE) O esquema da figura baixo relaciona-se com os cidos


nuclicos.

Assinale as afirmativas verdadeiras e as afirmativas falsas.


00) Em 1, o DNA est acoplado a uma cadeia de RNA, dando incio ao processo de
sntese de protenas.
11) Em 2, a dupla cadeia de nucleotdeos do DNA apresenta uma regio de
separao, com rompimento de pontes de hidrognio.
22) A RNA polimerase a enzima responsvel pela replicao do RNA.
33) Em 3, exemplificada a formao de uma molcula de RNA mensageiro,
contendo informaes transcritas a partir do DNA.
44) Uma molcula de DNA com a seqncia de bases GCGTATTATproduzir
um RNA-m com a seqncia de bases: CGCAUAAUA.

9. (PUCCamp-SP) Os itens a seguir referem-se estrutura, composio e funo


dos cidos nuclicos.
Estrutura:
I. dupla hlice
II. cadeia simples
Composio:
1. presena de uracila
2. presena de timina
Funo:
a. sntese de protenas
b. transcrio gnica
So caractersticas do cido ribonuclico:

a) I 1 a
b) I 2 b
c) II 1 a
d) II 1 b
e) II 2 b

10. (UFSM-RS) Numere a 2. Coluna de acordo com a 1.


Coluna 1
1 DNA
2 RNA
Coluna 2
( ) Dupla hlice
( ) Ribose
( ) Fita nica ou simples
( ) Desoxirribose
( ) Bases nitrogenadas: adenina, guanina, citosina, timina
( ) Bases nitrogenadas: adenina, guanina, citosina, uracila.
A seqncia correta :
a) 1 2 1 2 2 1
b) 2 1 1 2 2 2
c) 1 2 2 1 1 2
d) 2 1 2 1 1 2
e) 1 1 2 2 2 1

11. (Cefet-PR) Do melhoramento gentico passando pela engenharia


gentica, processos de clonagem e transgnicos, os conhecimentos
sobre os cidos nuclicos tm gerado tecnologias de grande utilidade
para a humanidade. Assinale a alternativa que contm uma proposio
incorreta acerca do funcionamento dos cidos nuclicos.
a) Transcrio gnica o processo de fabricao de RNA a partir de um modelo de
DNA.
b) As molculas de DNA so capazes de se reproduzir por meio de um processo
conhecido como duplicao semiconservativa.
c) Se uma cadeia de DNA apresenta a seqncia de bases: ATTGCTGCGCATT, a
outra cadeia apresenta na regio correspondente a seqncia complementar:
TAACGACGCGTAA.
d) O RNA diferencia-se do DNA principalmente por possuir como acar a pentose
e a base nitrogenada uracila em lugar da timina.
e) Cada aminocido codificado por um grupo de quatro bases chamado de cdon.

12.(UFRGS-RS) Cinco amostras com cidos nuclicos foram analisadas


quimicamente e apresentaram os seguintes resultados:
I) 1. amostra: ribose
II) 2. amostra: timina
III) 3. amostra: dupla hlice
IV) 4. amostra: uracila
V) 5. amostra: 20% de guanina e 30% de citosina
Entre estas amostras, quais se referem a DNA?
a) Apenas I e II.
b) Apenas I e III.
c) Apenas II e III.
e) Apenas II e IV.
e) Apenas II e V.

13. (PUC-MG) O maior projeto do final do sculo , sem dvida, o


Projeto Genoma Humano, que tem por objetivo seqenciar todos os
genes dos 23 cromossomos que compem a espcie humana. Uma
reportagem recente mostrou um gene totalmente seqenciado com o
seguinte trecho:
AAA AAT CAA GTA
Baseado em seus conhecimentos, identifique o segmento de RNA
mensageiro formado a partir desse filamento.
a) UUU UUA GUU CAU
b) UUU UUT GUU CTU
c) AAA AAU CAA GUA
d) TTT TTA GTT CAT
e) TTT UUA GUU CAT

14. (Fuvest-SP) Um pesquisador que pretende estudar


comparativamente a sntese de DNA e RNA em uma clula deve usar
nucleotdeos radioativos contendo:
a) timina e uracila
b) guanina e timina
c) citosina e guanina
d) adenina e timina
e) citosina e uracila

15.(Med. Santos-SP) Na hidrlise de cidos nuclicos, as bases


pirimdicas produzidas pelo RNA so:
a) citosina e guanina
b) adenina e uracila
c) citosina e timina
d) adenina e timina
e) citosina e uracila.

16.(UFMS) Os cidos nuclicos so as molculas mestras da vida. Elas


so responsveis pela sntese de todas as enzimas que controlam, de
alguma forma, a atividade celular. Relacione os cidos nuclicos com
suas caractersticas.
I) DNA
II) RNA
A) acar da molcula = desoxirribose
B) acar da molcula = ribose
C) presena de timina
D) presena de uracila
E) cadeia dupla
F) cadeia simples
G) capacidade de autoduplicao
Est(o) correta(s) a(s) associao(es):
01) I A
02) II B
04) II G
08) I C
16) I F
32) II E
64) II D

17. (FEPA) O DNA e o RNA so constitudos de muitas unidades, os


nucleotdeos. Cada nucleotdeo constitudo por um grupo fosfato,
uma pentose e uma base nitrogenada. A diferena entre DNA e RNA
est:
a) na pentose e nas bases nitrogenadas.
b) no fosfato e nas bases nitrogenadas.
c) na pentose e no fosfato.

d) na pentose, nas bases nitrogenadas e no fosfato.


e) apenas nas bases nitrogenadas.

18. (UFU-MG) Na medicina moderna, drogas conhecidas como antisense tm sido utilizadas com sucesso no bloqueio da expresso de
genes indesejveis. Essas drogas so, na realidade, seqncias de
nucleotdeos de RNA que tm complementaridade de bases com o
RNAm. Esses nucleotdeos (anti-sense), ligam-se ao RNAm, no
citoplasma, impedindo a expresso gnica. Baseando-se na afirmativa
anterior, marque a seqncia correta da droga anti-sense, para o
seguimento gnico hipottico: ATATGCAGCAGTATGa)
AUAUGCAGCAGUAUG
b) ATATGCAGCAGTATG
c) TATACGTCGTCATAC
d) UAUACGUCGUCAUAC
e) TATACGUGCUCATAC

19.(UFU-MG) As molculas de DNA formam, pelo menos, 3 tipos


diferentes de RNA, cujas funes so de grande importncia para a
clula viva. Quais so eles e que papel desempenham no metabolismo
celular?

RESPOSTAS:

1- Resposta: C
2- Resposta: C
3- Resposta: D
4- Resposta: E
5- Resposta: D
6- Resposta: C
7- Resposta: D
8- Resposta: FVFVV
9- Resposta: C
10- Resposta: C
11- Resposta: E
12- Resposta: C
13- Resposta: A
14- Resposta: A

15- Resposta: E
16- Resposta: 75
17- Resposta: A
18- Resposta: A
19- RNA mensageiro: contm a informao do DNA para a sntese de
protenas especficas nos ribossomos.
RNA transportador: transporta os aminocidos do citoplasma at os
ribossomos.
RNA ribossmico: entra na formao dos ribossomos.

LISTO DE EXERCICIOS - GENETICA MOLECULAR


CURSO DE BIOLOGIA - EDILSON SOARES
TEXTO PARA A PRXIMA QUESTO
(Ufpe 96) Na(s) questo(es) a seguir escreva nos parnteses a letra (V) se a afirmativa for
verdadeira ou (F) se for falsa.

1. As proposies a seguir so relativas ao processo de sntese de protenas nas clulas vivas.


( ) A molcula de DNA transcreve no ncleo uma molcula de RNA mensageiro (RNAm) com
vrias seqncias de trs bases - os cdons.
( ) Cada cdon do RNA mensageiro determinar a colocao de um aminocido especfico na
cadeia polipeptdica.
( ) No local onde houver um ribossomo, pequenas molculas de RNA transportador (RNAt),
ligadas a aminocidos, unem-se ao RNAm por uma seqncia de trs bases - o anticdon.
( ) O processo de sntese de protenas ao nvel do citoplasma tambm conhecido como
transcrio gentica.
( ) Os diversos aminocidos unem-se atravs de ligaes do tipo ster, dando formao, ao
final da leitura do RNAm, a uma protena funcional.

TEXTO PARA A PRXIMA QUESTO


(Ufrn 2002) Professor Astrogildo combinou com seus alunos visitar uma regio onde ocorria
extrao de minrio a cu aberto, com a inteno de mostrar os efeitos ambientais produzidos
por aquela atividade. Durante o trajeto, professor Astrogildo ia propondo desafios a partir das
situaes do dia-a-dia vivenciadas ao longo do passeio. Algumas das questes propostas por
professor Astrogildo esto apresentadas a seguir para que voc responda.

2. Aproveitando a pergunta de Zeca, o professor esquematizou o processo de sntese protica,


em que os nmeros I, II, III e IV representam molculas de cidos nuclicos.

A partir do esquema, correto afirmar quea) I corresponde ao RNA que contm o cdigo
gentico determinando a seqncia de aminocidos da protena.b) II corresponde ao RNA que
catalisa a unio do I com o III, durante o processo de transcrio.c) III corresponde ao RNA que
contm o anticdon complementar ao cdon existente em I.d) IV corresponde ao RNA que
catalisa a ligao dos nucleotdeos com a desoxirribose.

3. (Unicamp 96) Um certo tipo de macromolcula destinada membrana plasmtica celular,


depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os
percursos esquematizados a seguir:

a) Por que essas etapas comeam no ncleo?


b) Qual a composio da macromolcula ao final do percurso I? E do percurso II? Esclarea a
diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada
percurso.

4. (Ufpi 2003)

Analisando o desenho esquemtico que representa o ncleo de uma clula animal qualquer,
podemos identificar que o componente responsvel pela sntese de RNA que forma o
ribossomo assinalado pelo nmero:a) 1b) 2c) 3d) 4e) 5

5. (Puccamp 93) "Captura aminocidos que se encontram dissolvidos no citoplasma e carregaos ao local da sntese de protenas".Essa funo desempenhada peloa) RNA mensageiro.b)
RNA transportador.c) RNA ribossmico.d) ribossomo.e) DNA.

6. (Puccamp 99) Clulas vegetais, depois de mantidas em meio de cultura contendo uracila
marcada, foram fixadas e submetidas autoradiografia, para comprovar os locais que
possuam esse material. correto prever que, no citoplasma, encontre-se uracila radioativa
SOMENTE nosa) nuclolos.b) ribossomos.c) nuclolos e nas mitocndrias.d) ribossomos e nos
cloroplastos.e) ribossomos, nos cloroplastos e nas mitocndrias.

7. (Ufpr 2004) Analisando a figura adiante, que representa um caritipo humano, correto
afirmar que se trata do caritipo de um indivduo:

(01) Do sexo masculino.


(02) Do sexo feminino.
(04) Com Sndrome de Down.
(08) Com Sndrome de Patau.
(16) Ccom Sndrome de Edwards.
(32) Com caritipo normal.
(64) Com uma anomalia numrica de autossomos.

Soma (

8. (G2) As evidncias de que o DNA a substncia hereditria que determina as caractersticas


dos seres vivos foram primeiramente observadas ema) vrus.b) protozorios.c) caros.d)
liquens.e) bactrias.

9. (Unicamp 97) Em 1952, Hershey e Chase cultivaram bactrias em meio de cultura contendo
fsforo radioativo (P) e colocaram bacterifagos (vrus) para infectar essas clulas. Os novos
bacterifagos formados estavam marcados radioativamente.

Estes bacterifagos marcados foram utilizados para infectar outras clulas bacterianas
cultivadas sem a presena de fsforo radioativo.

A marcao radioativa foi detectada dentro destas bactrias.

a) Como se explica que o fsforo radioativo tenha passado para o bacterifago?


b) Como se explica que as bactrias cultivadas sem a presena de fsforo radioativo tenham
sido marcadas?
c) Se, em vez de fsforo, tivesse sido usado enxofre radioativo (S) para marcao de
protenas, os resultados seriam os mesmos? Justifique.

10. (Puccamp 98) O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacterifagos.

De acordo com o esquema, verifica-se quea) ocorre lise da bactria no fim do ciclo.b) o DNA
viral se incorpora ao cromossomo bacteriano.c) o DNA viral destrudo pela bactria.d) as
bactrias perdem a capacidade de se dividir.e) h grande multiplicao do DNA viral no interior
da bactria.

11. (G2) Comparando as estruturas dos cidos nuclicos desoxirribonuclico (DNA) e


ribonuclico (RNA) pode-se afirmar quea) timina uma base nitrogenada exclusiva do RNA.b)
uracila uma base nitrogenada exclusiva do DNA.c) ribose um acar que entra na
composio qumica do RNA.d) cido fosfrico s entra na composio qumica do DNA.e)
timina pareia com adenina no RNA.

12. (G2) Mencione duas diferenas de natureza molecular entre o DNA e o RNA.

13. (G2) Quais so as diferenas observadas nos nucleotdeos que entram na composio do
DNA em relao aos que entram na composio do RNA?

14. (G2) O DNA e o RNA quanto sua estrutura qumica, so classificados comoa)
polipeptdeos.b) nucleoprotenas.c) polissacardeos.d) fosfatdeos.e) polinucleotdeos.

15. (G2) Os cidos nuclicos so macromolculas definidas como polinucleotdeos.


a) Represente um nucleotdeo apontando seus trs constituintes moleculares.
b) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em
relao aos que entram na composio do RNA?

16. (G2) Comparando as estruturas dos cidos nuclicos desoxirribonuclico (DNA) e


ribonuclico (RNA) NO se pode afirmar quea) timina uma base nitrogenada exclusiva do
DNA.b) uracila uma base nitrogenada exclusiva do DNA.c) ribose um acar que entra na
composio qumica do RNA.d) cido fosfrico entra na composio qumica do DNA e do
RNA.e) timina pareia com adenina no DNA.

17. (Uel 94) Com relao composio qumica, as molculas de DNA e RNA diferem entre si
quanto ao tipo dea) acar, apenas.b) base nitrogenada, apenas.c) base nitrogenada e de
acar, apenas.d) base nitrogenada e de fosfato, apenas.e) base nitrogenada, de acar e de
fosfato.

18. (Fuvest-gv 92) Um pesquisador que pretende estudar comparativamente a sntese de DNA
e RNA em uma clula deve usar nucleotdios radiativos contendoa) timina e uracila.b) guanina
e timina.c) citosina e guanina.d) adenina e timina.e) citosina e uracila.

19. (Uerj 99) Em clulas eucariotas mantidas em cultura, adicionou-se o nucleosdeo uridina
marcado radioativamente com H ao meio de cultura. Aps algum tempo, as clulas foram
transferidas para um novo meio que no continha o istopo. Amostras destas clulas foram
retiradas 3, 15 e 90 minutos aps a transferncia, sendo, ento, colocadas em lmina de vidro,
fixadas e submetidas a auto-radiografia. Esse processo marca a posio aproximada do istopo
dentro da clula, como representado no esquema a seguir.

a) Cite o tipo de molcula qual a uridina se incorporou. Justifique sua resposta.

b) Nomeie o compartimento celular que seria marcado, se o nucleosdeo radioativo usado


fosse a timidina e justifique sua resposta.

20. (Ufsm 2000) Numere a 2 coluna de acordo com a 1COLUNA 11- DNA
2RNA
COLUNA 2( ) dupla hlice( ) ribose( ) fita nica ou simples( ) desoxirribose(
bases nitrogenadas: adenina, guanina, citosina, timina.( ) bases nitrogenadas: adenina,

guanina, citosina, uracilaA seqncia correta a) 1 - 2 - 1 - 2 - 2 - 1.b) 2 - 1 - 1 - 2 - 2 - 2.c) 1 - 2 2 - 1 - 1 - 2.d) 2 - 1 - 2 - 1 - 1 - 2.e) 1 - 1 - 2 - 2 - 2 - 1.

21. (G2) Dada a seqncia de bases nitrogenadas de um segmento de DNA a seguir, responda
aos itens adiante.

TTT AAT GGG CAT

a) Qual a seqncia de bases da hlice complementar a esse segmento?


b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento?

22. (G2) Para funcionar como material gentico o DNA apresenta duas propriedades
fundamentais. So elas:

I - AUTODUPLICAO

II - TRANSCRIO

Explique essas duas propriedades

23. (G2) Considere um segmento de DNA com a seguinte seqncia de bases nitrogenadas:

ATT CTA CGC AAA GGC

a) Quais so as bases da cadeia complementar a esse segmento?


b) Se o segmento dado servir de molde para a produo de RNA, qual ser a seqncia de
bases desse RNA?

24. (G2) Considere a seqncia de bases nitrogenadas de um segmento de DNA:

AAA GGC ATT,

responda:
a) Qual a seqncia de bases da hlice complementar a esse segmento?
b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento?

25. (Uel 99) Em um segmento de cadeia ativa de DNA h 20 adeninas e 15 guaninas; no


segmento correspondente da cadeia complementar h 10 adeninas e 30 guaninas. Com base
nesses dados, conclui-se que nos segmentos de RNA originrios desse DNA havera) 30
citosinas.b) 20 timinas.c) 15 guaninas.d) 10 uracilas.e) 10 adeninas.

26. (Ufrj 2001) No ADN, a transcrio dos genes no est restrita a somente uma das suas
cadeias. Para alguns genes, a seqncia de nucleotdeos transcrita pode estar em uma cadeia,
ao passo que a seqncia do outro gene pode estar localizada na cadeia oposta. No entanto,
sabe-se que no mesmo trecho nunca ocorre a transcrio simultnea das duas cadeias de uma
molcula de ADN. Tal evento inibiria o processo da traduo.

Explique por que ocorreria a inibio da traduo se a transcrio de uma cadeia do ADN
ocorresse ao mesmo tempo que a transcrio da sua cadeia complementar, no mesmo trecho.

27. (G2) Que papis desempenham o RNA mensageiro e do RNA transportador no processo de
sntese das protenas?

28. (G2) Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases
nitrogenadas:
UUU GUG CCC AACAssinale a alternativa que contm a seqncia de
bases do segmento da molcula de DNA que deu origem a esse RNA.a) AAA CAC GGG TTGb)
TTT CAC GGG UUGc) AAA CTC GGG TTGd) TTT GAG GGG TTGe) AAA CAC CCC UUG

29. (G2) Na figura a seguir que representa o modelo da molcula de RNA os nmeros 1, 2 e 3
indicam, respectivamentea) desoxirribose, cido fosfrico e base nitrogenada.b) cido
fosfrico, desoxirribose e base nitrogenada.c) ribose, cido fosfrico e base nitrogenada.d)
cido fosfrico, ribose e base nitrogenada.e) cido fosfrico, base nitrogenada e desoxirribose.

30. (G2) Observe o esquema adiante e responda:

a) Quais so as molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se


que trata-se da unidade estrutural do cido ribonuclico (RNA).
b) Qual o nome dessa unidade estrutural?

31. (G2) Sobre o RNA, INCORRETO afirmar quea) possui a base nitrogenada uracila.b)
participa da estrutura dos ribossomos.c) reproduz-se de modo semiconservativo.d) traduzido
em protenas nos ribossomos.e) formado de simples cadeia com formato helicoidal.

32. (G2) Qual das seguintes bases nitrogenadas NO entra na composio qumica do RNA?a)
Timina.b) Citosina.c) Adenina.d) Uracila.e) Guanina.

33. (G2) Qual das seguintes molculas NO entra na composio qumica do RNA?a) Ribose.b)
Desoxirribose.c) cido fosfrico.d) Adenina.e) Guanina.

34. (G2) Uma cadeia de RNA tem 200 nucleotdeos. Quantos nucleotdeos tinha o DNA que
originou esse RNA?

35. (G2) Um segmento de RNA mensageiro apresenta a seqncia de bases nitrogenadas a


seguir:

AAA UUC GGG GAU.

a) Quais so as bases do segmento de DNA que deu origem a esse RNA?


b) Quantos nucleotdeos existem no DNA que deu origem a essa molcula de RNA
mensageiro?

36. (G2) No modelo molecular do cido ribonuclico (RNA) representado adiante, os nmeros
1, 2 e 3 indicam, respectivamente,a) desoxirribose, cido fosfrico e base nitrogenada.b) cido
fosfrico, desoxirribose e base nitrogenada.c) ribose, cido fosfrico e base nitrogenada.d)
cido fosfrico, ribose e base nitrogenada.e) cido fosfrico, base nitrogenada e desoxirribose.

37. (G2) Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases
nitrogenadas:
UUU GUG CCC AAU.Assinale a alternativa que contm a seqncia de
bases do segmento da molcula de DNA que deu origem a esse RNA.a) AAA CAC GGG TTAb)
TTT CAC GGG UUTc) AAA CTC GGG TTTd) TTT GAG GGG TTAe) AAA CAC CCC UUA

38. (G2) caracterstica do RNA:a) acar com quatro tomos de carbono.b) presena das
bases nitrogenadas uracila, guanina, citosina e adenina.c) ausncia de cido fosfrico.d)
polipeptdeo.e) ocorre nos lisossomos.

39. (Fei 94) O estudo do mecanismo da sntese de protenas no interior das clulas, confirma
que:a) a transcrio gnica caracteriza-se pela autoduplicao do DNAb) trs tipos de RNA
participam do processoc) os anticdons localizam-se no RNA-md) os cdons so trincas de
bases nitrogenadas do RNA-te) no h evidncias que permitam aceitar que o cdigo gentico
seja considerado degenerado

40. (Puccamp 98) Os itens a seguir referem-se estrutura, composio e funo dos cidos
nuclicos.- Estrutura:I. dupla hliceII. cadeia simples- Composio:1. presena de uracila2.
presena de timina- Funo:a. sntese de protenasb. transcrio gnicaSo caractersticas do
cido ribonuclicoa) I - 1 - ab) I - 2 - bc) II - 1 - ad) II - 1 - be) II - 2 - b

41. (Ufpe 2001) Nos ltimos anos, a biologia molecular tem fornecido ferramentas teis para a
produo de plantas e animais transgnicos. As informaes armazenadas nas molculas de
DNA so traduzidas em protenas por meio de molculas intermedirias denominadas:a)
Proteases.b) Plasmdios.c) rRNA.d) tRNA.e) mRNA.

42. (Ufscar 2001) Um pesquisador, interessado em produzir em tubo de ensaio uma protena,
nas mesmas condies em que essa sntese ocorre nas clulas, utilizou ribossomos de clulas
de rato, RNA mensageiro de clulas de macaco, RNA transportador de clulas de coelho e
aminocidos ativos de clulas de sapo. A protena produzida teria uma seqncia de
aminocidos idntica doa) rato.b) sapo.c) coelho.d) macaco.e) macaco e do rato.

43. (Uerj 2004) A enzima poligalacturonase, que digere a parede celular de clulas vegetais,
a principal responsvel pela maturao de frutos como o tomate. Para retardar o
amadurecimento e evitar as perdas durante o armazenamento, utilizou-se uma tcnica na qual
o gene que codifica a enzima citada foi inserido, de maneira invertida, no genoma de um
tomateiro.
O esquema adiante mostra os produtos da transcrio do gene normal da enzima e do gene
inserido, ambos ativos nesse tomate geneticamente modificado.

a) Descreva a interao que ocorre entre os produtos da transcrio dos genes normal e
inserido no tomate geneticamente modificado e indique a caracterstica dessas molculas que
permite a interao.
b) Explique por que haver um aumento no tempo de amadurecimento desse tomate
geneticamente modificado.

44. (Fuvest 94) Um gene de bactria com 600 pares de bases nitrogenadas produzir uma
cadeia polipeptdica com nmero de aminocidos aproximadamente igual aa) 200b) 300c)
600d) 1200e) 1800

45. (Fuvest 95) Considere a seguinte tabela que indica seqncias de bases do RNA
mensageiro e os aminocidos por elas codificados.Com base na tabela fornecida e
considerando um segmento hipottico de DNA, cuja seqncia de bases AAGTTTGGT, qual
seria a seqncia de aminocidos codificada?a) Aspargina, leucina, valina.b) Aspargina, lisina,
prolina.c) Fenilalanina, lisina, prolina.d) Fenilalanina, valina, lisina.e) Valina, lisina, prolina.

46. (Fuvest 92) De que maneira o DNA determina a seqncia de aminocidos das molculas
de protenas?

47. (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminocidos
correspondentes.

Assinale a alternativa que apresenta a possvel seqncia de cdons para a formao do


seguinte tetrapeptdeo:
GLU - GLI - FEN - LEUa) GUU - GGU - UUU - CUC;b) GAA
- GGC - TTT - CTC;c) CTT - CCG - AAA - AAC;d) GAA - GGA - UUU - CUC;e) GUU - GGC - UUU UUG.

48. (Puccamp 95) O quadro a seguir contm um segmento de DNA, os cdons e os anticdons
correspondentes.

Para preench-lo corretamente, os algarismos I, II, III e IV devem ser substitudos,


respectivamente, pora) GAC, TAA, AGT e CTGb) GTC, AUU, UCA e GUCc) GTC, ATT, TCA e
GUCd) CTG, ATT, TCA e CUGe) CTG, AUU, UCA e CUG

49. (Fuvest 96) Uma doena gentica de herana dominante causada por mutaes em um
gene localizado em um autossomo. Os indivduos A, B e C tm mutaes em um segmento de
DNA desse gene, cuja seqncia normal est representada a seguir.
Usando a tabela que relaciona alguns codons aos respectivos aminocidos e considerando que
a fita molde a ser transcrita aquela assinalada com a letra m, responda:
a) Quais sero os segmentos de protenas produzidos, respectivamente, pelos indivduos A, B e
C?
b) Como ser o fentipo (normal ou afetado dos indivduos A, B e C? Por qu?

Seqncia normal
CAA AAC TGA GGA ATG CAT TTC (m)
GTT TTG ACT CCT TAC GTA AAG

Indivduo A
CAA AAC TGA GGA ATT CAT TTC (m)
GTT TTG ACT CCT TAA GTA AAG

Indivduo B
CAT AAC TGA GGA ATG CAT TTC (m)
GTA TTG ACT CCT TAC GTA AAG

Indivduo C
CAA TAC TGA GGA ATG CAT TTC (m)
GTT ATG ACT CCT TAC GTA AAG

50. (Ufpe 96) OBSERVE:1. O cdigo gentico descreve a relao entre a seqncia de bases
nitrogenadas e a seqncia de aminocidos, na protena que ele especifica.2. A seqncia de
aminocidos que forma uma cadeia polipeptdica compreende a estrutura secundria de uma

protena.3. Trs bases nitrogenadas adjacentes codificam um aminocido e formam um


cdon.Est(o) correta(s):a) 1, apenasb) 1 e 3, apenasc) 3, apenasd) 1, 2 e 3e) 2, apenas

51. (Cesgranrio 92) A tabela a seguir mostra alguns aminocidos e as trincas de bases no DNA
que os identificam:

Se um RNA mensageiro apresenta a seqncia de bases AUU AGA UGU GUU UUA, a seqncia
de aminocidos no polipeptdeo correspondente ser, de acordo com a tabela anterior:a) Cis Val - Leu - Arg - Ileb) Leu - Val - Cis - Arg - Ilec) Arg - Ile - Val - Leu - Cisd) Ile - Arg - Cis - Val Leue) Val - Cis - Arg - Ile - Leu

52. (Puccamp 94) O esquema a seguir representa a seqncia de aminocidos de um trecho


de uma protena e os respectivos anticdons dos RNA transportadores.

Assinale a alternativa que contm a seqncia de cdons do RNA mensageiro que participou
dessa traduo.a) UUU CGT TTG UGC GUCb) UUU CGA AAG UGC GUCc) TTT CGT TTC TGC
GTCd) TTT CGA AAG TGC GTCe) CCC TAC CCA CAT ACT

53. (Puccamp 97) Com relao ao cdigo gentico, foram feitas as seguintes afirmaes:I.
Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminocido.II. O
RNA ribossmico contm as informaes para as protenas que devem ser sintetizadas.III. O
RNA mensageiro, de acordo com o anticdon que possui, liga-se a um aminocido
especfico.IV. Diversos aminocidos so codificados por mais de uma trinca de nucleotdios.So
verdadeiras APENAS as afirmaesa) I e IIb) I e IVc) II e IIId) II e IVe) I, III e IV

54. (Cesgranrio 98) Sobre o cdigo gentico so feitas as seguintes afirmaes:I - pode existir
mais de um cdon para determinar um mesmo aminocido;II - em todos os seres vivos os
cdons que codificam um respectivo aminocido so os mesmos;III - a traduo da seqncia
de bases do RNA para a protena feita, a nvel citoplasmtico, nos ribossomos.Est(o)
correta(s) afirmativa(s):a) II apenas.b) III apenas.c) I e II apenas.d) I, II e III.e) I e III apenas.

55. (Uel 98) Considere os seguintes cdons do RNA mensageiro e os aminocidos por eles
especificados:

ACA = treonina
GUU = valina

Assinale a alternativa da tabela a seguir que indica corretamente os anticdons do RNAt e os


cdons do DNA relacionados com esses aminocidos.

56. (Ufrj 97) O ADN um polmero constitudo por vrios nucleotdeos e as protenas so
polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de
nucleotdeos que codifica uma protena constituda por P aminocidos.
Por que sempre encontramos N > P ?

57. (Unb 98) Um trecho de fita de DNA com a sequncia... TACACCTCTCGT... responsvel
pela incorporao respectiva dos seguintes aminocidos: metionina, triptofano, arginina e
alanina. Considerando as informaes apresentadas, julgue os itens que se seguem.

(1) Os cdons do mRNA, para os aminocidos mencionados, so, respectivamente, UAC ACC
UCU CGU.
(2) A molcula de DNA referente ao trecho apresentado tem 20% de adenina.
(3) A perda de um nucleotdeo do DNA implicar a alterao dos aminocidos da cadeia
polipeptdica.
(4) A fumaa do cigarro, os raios X e a luz ultravioleta podem produzir mutaes na molcula
de DNA.

58. (Ufrj 99) Com o auxlio da tabela do cdigo gentico representada a seguir, sempre
possvel deduzir-se a seqncia de aminocidos de uma protena a partir da seqncia de
nucleotdeos do seu gene, ou do RNA-m correspondentes.

Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma


protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu.

59. (Puccamp 99) Considere o seguinte segmento de uma cadeia de DNA e o polipeptdio
sintetizado a partir dele:
ATA - GCA - GTG - ACA - CCTTIROSINA - ARGININA HISTIDINA - CISTENA - GLICINAAps a substituio de uma nica base nitrogenada no
segmento de DNA, o polipeptdio sintetizado passou a apresentar duas argininas.A seqncia
de trincas no RNA mensageiro que pode ter codificado esse polipeptdio alterado a) CUC TGC - TGC - CGC - GGUb) TUT - CGT - CGT - TGT - GGUc) CGT - CGT - CAC - TGT - GGAd) UAU CTU - CAC - CTU - TTAe) UAU - CGU - CAC - CGU - GGA

60. (Ufsm 99) A tabela apresenta o cdigo gentico, com os cdons e os aminocidos
correspondentes.

phe = FENILALANINA; leu = LEUCINA; ileu = ISOLEUCINA; met = METIONINA; val = VALINA; ser =
SERINA; pro = PROLINA; thr = TREONINA; ala = ALANINA; tyr = TIROSINA; his = HISTIDINA;glu =
GLUTAMINA; asn = ASPARAGINA; lys = LISINA; asp = ASPARTATO; cys = CISTENA; trp =
TRIPTOFANO;arg = ARGININA; gly = GLICINA LOPES, Snia. Bio Volume nico. So Paulo:
Saraiva, 1996.Utilizando a tabela, determine a seqncia de aminocidos que corresponde
seqncia de DNA
TAC TGA TTG CTAa) metionina - treonina - asparagina -

aspartatob) metionina - glutamina - histidina - glicinac) glutamina - treonina - aspartato argininad) glutamina - histidina - glicina - argininae) glicina - cistena - glutamina - treonina

61. (Mackenzie 99) Os cdons UGC, UAU, GCC e AGC codificam, respectivamente os
aminocidos cistena, tirosina, alanina e serina; o cdon UAG terminal, ou seja, indica a
interrupo da traduo. Um fragmento de DNA, que codifica a seqncia serina - cistena tirosina - alanina, sofreu a perda da 9 base nitrogenada. Assinale a alternativa que descreve o
que acontecer com a seqncia de aminocidos.a) O aminocido tirosina ser substitudo por
outro aminocido.b) O aminocido tirosina no ser traduzido, resultando numa molcula com
3 aminocidos.c) A seqncia no ser traduzida, pois essa molcula de DNA alterada no
capaz de comandar esse processo.d) A traduo ser interrompida no 2 aminocido.e) A
seqncia no sofrer prejuzo, pois qualquer modificao na fita de DNA imediatamente
corrigida.

62. (Ufu 99) O aminocido leucina pode ser codificado por mais de uma trinca de nucleotdios
do DNA (AAT, GAA e outras). Assim sendo, podemos dizer queI - o cdigo gentico
degenerado, o que significa que um aminocido pode ser codificado por mais de uma trinca.II um aminocido pode ser codificado por apenas uma trinca de nucleotdios de DNA.III - assim
como a leucina pode ser codificada por diferentes trincas, uma determinada trinca tambm
pode codificar diferentes aminocidos.Esto corretas afirmativas:a) apenas III.b) apenas II.c)
apenas I.d) I e III.e) nenhuma delas.

63. (Ufv 2000) Considere a tabela abaixo, contendo cdigos de trincas de bases do DNA com
os aminocidos correspondentes, para resolver os itens seguintes:

a) Determine a seqncia de bases do RNAm que foi utilizado para sintetizar o polipeptdeo
esquematizado abaixo da tabela.

b) Se ocorresse uma substituio, por uma purina, na 3 base do cdigo correspondente ao 6


aminocido do polipeptdeo, qual seria o aminocido da tabela a ser incorporado?

c) Qual anticdon correspondente ao novo aminocido incorporado?

64. (Uerj 2001) Uma molcula de RNAm, composta pelas bases adenina-A e citosina-C, foi
sintetizada experimentalmente.Sua estrutura est representada no esquema abaixo:C-A-C-AC-A-C-A-C-A-C-A-C-A-C-A-C-ASuponha que a sntese de um peptdeo possa ser iniciada a partir
de qualquer um dos extremos dessa estrutura de RNAm, sem necessidade de cdigo de
iniciao ou de terminao. Nestas condies, o nmero de diferentes tipos de aminocidos
encontrados nos peptdeos formados ser:a) 4b) 3c) 2d) 1

65. (Uff 2001) A determinao da seqncia de aminocidos de todas as protenas da espcie


humana e de outros seres vivos de extrema importncia.A partir da seqncia de
aminocidos de uma protena, podem-se identificar as possveis seqncias de DNA que a
originaram.Considere o quadro:

Com base no quadro apresentado, assinale a opo que indica a seqncia do DNA
responsvel pela sntese do peptdeo mostrado a seguir:
Met - Asn - Glu - Cys - Tyr Phea) ATG - AAT - GAA - TGT - TAC - TTTb) ATG - AAC - GAA - TTC - TAC - TTTc) ATC - AAT - GAA
- TGT - TAC - TTTd) ATG - AAT - GCC - TGT - TAC - TTCe) ATC - AAT - GAA - TGT - TAC - TTC

66. (Puc-rio 2001) Em 1987, foi oficialmente fundado o Projeto Genoma, que visa decifrar e
mapear o cdigo gentico humano. Indique a alternativa ERRADA relativa ao cdigo gentico e
sntese de protenas:a) Os genes so formados por cido desoxirribonucleico e controlam a
produo de protenas da clula, determinando as caractersticas de um ser vivo.b) Todas as
clulas do corpo tm a mesma coleo de genes, mas, apesar disto, encontramos clulas com
formas e funes diferentes.c) A mutao uma alterao do cdigo gentico de um
organismo e pode ser provocada por radiaes ou substncias qumicas.d) As mudanas na
programao gentica de um organismo no alteram a produo de protenas, nem as suas
caractersticas.e) A Engenharia Gentica, que uma tcnica de manipulao dos genes, pode
corrigir defeitos no cdigo gentico de um organismo.

67. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya constitudo pelos mesmos 4
tipos de bases dos seres vivos terrestres. J o cdigo gentico desses organismos
determinado por cdons de 2 bases.

a) As protenas A, B e C, encontradas nos organismos da Terra, apresentam, respectivamente,


13, 16 e 19 tipos diferentes de aminocidos. Explique a possibilidade da ocorrncia dessas trs
protenas nos seres de Zbohrnya.

b) Sabendo que a vida em Zbohrnya e na Terra existe h 3,5 bilhes de anos, faa uma
comparao entre a diversidade dos organismos encontrados nesses dois planetas.

c) Se o gene de uma protena respiratria de um organismo zbohrniano for introduzido numa


bactria terrestre, a protena produzida pela expresso desse gene ser idntica da espcie
zbohrniana? Justifique sua resposta.

68. (Ufrn 2000) Observe as seqncias de nucleotdeos de um vrus de RNA:5' GCA UCA CAC
CUC AUU GCG UAG 3'Considerando que esse segmento de RNA codifica um determinado
peptdeo, correto afirmar:a) Os cdons dessa seqncia sinalizam os mesmos aminocidos

em seres humanos.b) A insero de um nucleotdeo entre a 4 e a 5 base no altera o cdigo


gentico.c) Os cdons GCA e GCG so degenerados porque codificam aminocidos
diferentes.d) Os anticdons do 1 do 2 cdon dessa seqncia so, respectivamente, GCA e
UGA.

69. (Ufpi 2000) Se uma protena possui 100 aminocidos, quantos cdons, que especificam
esses aminocidos, devem estar presentes no seu mRNA?a) 100b) 33c) 99d) 300e) 500

70. (Puc-rio 2000) Com relao ao cdigo gentico e sntese de protenas, assinale a
afirmativa FALSA.a) Na molcula de DNA, encontramos sempre desoxirribose e cinco tipos de
bases: adenina, guanina, citosina, timina e uracil.b) Os cidos nuclicos podem aparecer livres
na clula ou podem estar associados a protenas, compondo os cromossomos e ribossomos na
forma de molculas complexas de nucleoprotenas.c) Duas grandes etapas esto envolvidas na
sntese das protenas: a transcrio, que compreende a passagem do cdigo gentico do DNA
para o RNA, e a traduo, que compreende o trabalho do RNA de organizao dos aminocidos
na seqncia determinada pelo cdigo gentico.d) A mutao constitui uma alterao na
seqncia de bases nitrogenadas de um segmento de DNA e pode ser provocada por
radiaes, por raios csmicos, por raios-X, ou mesmo por exposio aos raios ultravioleta do
sol.e) Todas as clulas do corpo tm a mesma coleo de genes, mas, apesar disso,
encontramos clulas com formas e funes diferentes. Este processo chama-se diferenciao
celular.

71. (Pucsp 2004) Organismos so ditos transgnicos quando, por tcnica de engenharia
gentica, recebem e incorporam genes de outra espcie, os quais podem ser transmitidos aos
seus descendentes. Exemplos desses organismos so as plantas transgnicas, receptoras de
um gene de outro organismo (doador) que lhes confere resistncia a certos herbicidas. Para
que ocorra a sntese da protena codificada pelo gene inserido no genoma da espcie
receptora, diversas condies devem ser observadas. Entretanto, fundamentalmente, essa
tcnica possvel porquea) cada organismo apresenta seu prprio cdigo gentico.b) o cdigo
gentico comum a todos os seres vivos.c) o cdigo gentico degenerado.d) a tcnica
permite trocar o cdigo gentico do organismo doador do gene.e) a tcnica permite trocar o
cdigo gentico do organismo receptor do gene.

72. (Uff 2004) O fumo est relacionado ao aumento de risco para o cncer de pulmo. O
hbito de fumar expe os fumantes a substncias com atividade carcinognica. O
Benzo[a]pireno, um dos principais agentes carcinognicos presentes na fumaa do cigarro, tem
a capacidade de promover mutaes no DNA levando a mudana da base Guanina para
Timina. Suponha que um trecho da fita molde de DNA do gene X, representado a seguir, possa
ser alterado em presena do Benzo[a]pireno, em um dos dois stios indicados na figura 1.
Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da
figura 1 a seguir.
Indique as alteraes que ocorrero na sntese da protena X quando a mutao for localizada
nos diferentes stios, justificando cada resposta com a utilizao do cdigo gentico da figura
2:

73. (Ufrrj 2004) As unidades hereditrias que contm a informao para especificar um
aminocido so denominadasa) ADN.b) cdons.c) nuclolos.d) acrossomos.e) ribossomos.

74. (Ufv 2004) A tabela adiante representa uma verso fictcia do cdigo gentico. Entretanto,
esse cdigo segue o padro do cdigo gentico universal, no qual trs bases codificam um
aminocido.

Analise a tabela e faa o que se pede:


a) Cite o nome da enzima que catalisa a sntese de RNA mensageiro.
b) Cite a seqncia do anticdon correspondente ao cdon de iniciao.
c) Qual a seqncia de aminocidos que resultar da traduo da molcula de RNA
mensageiro? Ver figura anterior.
d) Qual a seqncia de aminocidos que resultar da traduo da mesma molcula de mRNA,
aps uma deleo do TERCEIRO nucleotdeo?

75. (Uerj 2005) A mutao em um gene, por conseqncia da substituio de uma nica base
na estrutura do DNA, pode acarretar modificaes importantes na atividade biolgica da
protena codificada por esse gene.Considere que a estrutura normal de um RNA mensageiro
de um peptdio e sua estrutura alterada em virtude da troca de uma nica base no gene
correspondente so:5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal)5'
AUGUGGUUUGAACACAAAUGAUAA 3' (alterada)A tabela a seguir identifica alguns codons.

Observe que:- o codon da metionina tambm o do incio da traduo;- os codons de trmino


da traduo so UAA, UAG e UGA.O aminocido encontrado no peptdio normal e aquele que

o substituiu no peptdio mutante so, respectivamente:a) lisina e cistenab) treonina e


triptofanoc) alanina e cido glutmicod) fenil alanina e cido asprtico

76. (Unifesp 2003) O jornal "Folha de S.Paulo" (23.09.2002) noticiou que um cientista
espanhol afirmou ter encontrado protenas no ovo fssil de um dinossauro que poderiam
ajud-lo a reconstituir o DNA desses animais.

a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de
uma seqncia de DNA, obtm-se uma protena.
b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de
DNA que a gerou? Justifique.

77. (Fuvest 2005) A seguir est representada a seqncia dos 13 primeiros pares de
nucleotdios da regio codificadora de um gene.

--- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C ---

A primeira trinca de pares de bases nitrogenadas esquerda, corresponde ao aminocido


metionina.
A tabela a seguir mostra alguns cdons do RNA mensageiro e os aminocidos codificados por
cada um deles.

a) Escreva a seqncia de bases nitrogenadas do RNA mensageiro, transcrito a partir desse


segmento de DNA.
b) Utilizando a tabela de cdigo gentico fornecida, indique a seqncia dos trs aminocidos
seguintes metionina, no polipeptdio codificado por esse gene.
c) Qual seria a seqncia dos trs primeiros aminocidos de um polipeptdio codificado por um
alelo mutante desse gene, originado pela perda do sexto par de nucleotdios (ou seja, a
deleo do par de bases T = A)?

78. (Unicamp 94) Considere um fragmento de DNA com a seguinte seqncia de bases:

GTA GCC TAG

e responda:
a) Qual ser a seqncia do RNAm transcrito a partir deste DNA?
b) O mesmo peptdio ser obtido a partir deste RNAm e do RNAm da fita complementar?
Explique.

79. (G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de


transcrever e que apresenta a seqncia de bases

TAC TCC GCT TAG

e, em sua cadeia complementar, a seqncia

ATG AGG CGA ATC,

quais so as seqncias de bases de RNAm por ele produzido?

80. (G2) Dado um segmento de RNA mensageiro com a seguinte seqncia de bases:

AAU GUA GGC

pergunta-se:
a) Qual a seqncia de bases do DNA que deu origem a esse RNA?
b) Quantos aminocidos ter o polipeptdeo traduzido, no ribossomo, a partir desse RNA?

81. (G2) Ribossomos so formados por RNA e protenas, sintetizados pelos processos de
transcrio e traduo, respectivamente.
a) Onde esses processos ocorrem na clula eucaritica?
b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma destruio
do(s) nuclolo(s) de uma clula?.

82. (G2) Dado um segmento de RNA com a seguinte seqncia de bases nitrogenadas:
UUA UUU GGC UCC,pode-se dizer que o segmento de DNA que deu origem a esse RNA
eraa) TTA AAA CCG AGG.b) AAT AAA GGC UCC.c) AAT AAA CCG AGG.d) TTA TTT CCG AGG.e)
AAU AAA CCG AGG.

83. (G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de


transcrever e que apresenta uma seqncia de bases

ACTCCGCTT / TGAGGCGAA,

quais poderiam ser as seqncias de bases do RNA por ele produzido?

84. (G2) Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases
nitrogenadas:
UUU GUG CCC AAA. Assinale a alternativa que contm a seqncia de
bases do segmento da molcula de DNA que deu origem a esse RNA.a) AAA CAC GGG TTTb)
TTT CAC GGG UUUc) AAA CTC GGG TTTd) TTT GAG GGG TTTe) AAA CAC CCC UUT

85. (Uel 96) O segmento CGATAGACT de uma fita de DNA, aps o processo de transcrio,
origina a cadeiaa) GUTATUTGAb) GCUAUCUGAc) GCTUTCTGUd) UCTATCTUAe) GCTATCTGA

86. (Uel 95) Os processos de transcrio e traduo gnicas resultam na sntese,


respectivamente, dea) protenas e de RNA.b) RNA e de protenas.c) DNA e de protenas.d) RNA
e de DNA.e) DNA e de RNA.

87. (Fatec 93) Uma cadeia de DNA apresenta a seguinte seqncia de bases numa certa regio
de sua hlice: ATA CCG TAT; sua cadeia complementar e o tipo de RNAm que poder ser
formado a partir das bases da hlice original so, respectivamente:a) TAT GGC ATA; UAU GGC
AUA.b) UAU GGC UAU; TAT GGC ATA.c) TAT GGC ATA; TUT GGC UTU.d) ATA GGC TAT; UTU
GGC UTU.e) TAT GGC UTU; TAT GGC ATA.

88. (Mackenzie 97) O esquema a seguir representa dois processos observados numa clula
eucaritica.

Assinale a alternativa correta.a) O processo 1 somente observado no ncleo da clula, sendo


inexistente em todas as outras organelas.b) Para interromper o processo 2, necessrio
bloquear o funcionamento de todo o retculo endoplasmtico dessa clula.c) O processo 2
ocorre principalmente no perodo S da intrfase.d) Um dos mais importantes locais de
ocorrncia do processo 1 o nuclolo.e) As molculas produzidas no processo 2 podero ser
utilizadas como catalisadoras, mas nunca sero constituintes de outras organelas.

89. (Faap 97) Um fragmento de DNA de uma espcie de organismo procarionte apresenta a
seguinte seqncia de bases:
AAT ATT CGA GTC TAA AGA.Indique qual a seqncia

de mRNA transcrito a partir deste segmento DNA::a) TTA TAA GCT CAG ATT TCTb) TTA TTA
GCT CAG ATT TCTc) UUA UUU GGU CAG AUU UGUd) UUA UAA GCU CAG AUU UCUe) AAT ATT
CGA GTC TAA AGA

90. (Ufrs 96) Considere as seguintes etapas da sntese de protenas.I - Transcrio do cdigo
gentico do DNA em cdons do RNA mensageiro.II - Ligao dos cdons de RNA mensageiro
aos anticdons correspondentes dos RNAs transportadores.III - Fixao do RNA mensageiro
aos ribossomos.Qual a seqncia correta dessas etapas durante o processo?a) I - II - III.b) I - III
- II.c) II - III - I.d) III - II - Ie) III - I - II.

91. (Ufrj 97) Em um organismo pluricelular com vrios tecidos, como no caso dos seres
humanos, todas as clulas possuem um genoma idntico.
Analogamente, correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos so
todos idnticos? Justifique sua resposta

92. (Fuvest 99) Existe um nmero muito grande de substncias com funes antibiticas.
Essas substncias diferem quanto maneira pela qual interferem no metabolismo celular.
Assim, a TETRACICLINA liga-se aos ribossomos e impede a ligao do RNA transportador; a
MITOMICINA inibe a ao da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura
dos cdons do RNA mensageiro. Essas informaes permitem afirmar queI - a TETRACICLINA
impede a transcrio e leva a clula bacteriana morte por falta de RNA mensageiro.II - a
MITOMICINA, por inibir a duplicao do DNA, impede a multiplicao da clula bacteriana.III a ESTREPTOMICINA interfere na traduo e leva a clula bacteriana a produzir protenas
defeituosas.Assinale a alternativa que rene as afirmaes corretas.a) apenas I correta.b)
apenas I e II so corretas.c) apenas II e III so corretas.d) apenas I e III so corretas.e) I, II e III
so corretas.

93. (Unesp 99) O esquema resume parcialmente as relaes funcionais dos cidos nucleicos
que ocorrem na maioria das clulas vivas.

Considerando-se apenas clulas eucariontes, as etapas que representam, respectivamente,


transcrio, duplicao e traduo so:a) I, II e III.b) I, III e II.c) II, I e III.d) III, I e II.e) II, III e I.

94. (Ufrj 98) Suponha um gene de um eucarioto responsvel pela sntese de uma protena.
Nesse gene existem ntrons, ou seja, regies do ADN cujas informaes no esto presentes na
protena em questo.
As regies do ARN transcrito correspondentes aos ntrons so eliminadas aps o processo de
transcrio.
A figura a seguir representa o resultado de uma experincia de hibridao do ARN mensageiro
com a cadeia de ADN que lhe deu origem.

A figura mostra cinco regies, identificadas por nmeros de 1 a 5.


Quais dessas regies correspondem aos ntrons?
Justifique sua resposta.

95. (Mackenzie 2002) O esquema a seguir representa fragmentos de cidos nuclicos no


ncleo de uma clula.

Observando o esquema, INCORRETO afirmar que:a) 1 uma molcula de uracila.b) 2


representa nucleotdeos de DNA.c) 3 representa nucleotdeos de RNA.d) a clula encontra-se
em metfase.e) trata-se do processo de transcrio.

96. (Uel 2001) Abaixo est representado o filamento I de uma molcula de cido nuclico
presente no interior do ncleo de uma clula vegetal. Qual seria a seqncia correta
encontrada na molcula de RNA mensageiro, transcrita a partir dofilamento II?a) G - A - A - G C - Ub) G - U - U - G - C - Ac) G - U - U - G - C - Ud) C - U - U - C - G - Ae) C - A - A - C - G - U

97. (Pucrs 99) A molcula de RNA sintetizada ___________ fita de DNA que lhe deu origem
e ___________ outra fita de DNA, sendo as _______________ substitudas pelas uracilas.a)
idntica - complementar - adeninasb) complementar - complementar - guaninasc) idntica idntica - citosinasd) complementar - complementar - adeninase) complementar - idntica timinas

98. (Ufsm 2002) Analise as afirmativas a seguir.I. Nas clulas eucariontes, a informao
gentica transmitida do citoplasma, onde est o DNA, para o ncleo, onde sero produzidas
as protenas.II. Nas bactrias, transcrio e traduo ocorrem no mesmo local porque as
clulas procariontes no possuem sistema de endomembranas.III. Durante a transcrio, uma
fita de DNA serve como molde para a produo do RNA que ter uma seqncia de
nucleotdeos complementar fita-molde.Est(o) correta(s)a) apenas I.b) apenas II.c) apenas
III.d) apenas I e III.e) apenas II e III.

99. (Unirio 2002) Atualmente os genes podem ser desmembrados em trs classes diferentes:
os genes que expressam mRNA que codificam polipeptdios diversos; os genes reguladores que
codificam protenas que regulam outros genes; e uma terceira classe de genes que no
codificam polipeptdios.
Qual o produto final da classe de genes que no codificam polipeptdios?

100. (Uerj 2004) Analisando o genoma de alguns tipos de vrus formados por fita simples de
RNA, encontramos aqueles que so RNA (-), como o do resfriado comum, e os que so RNA (+),
como o da poliomielite.
Observe que:
- nos vrus RNA (-), apenas o RNA complementar a seu genoma capaz de funcionar como
mensageiro na clula infectada;
- nos vrus RNA (+), o genoma viral funciona diretamente como mensageiro;
- ambos os vrus necessitam, para sua replicao, da enzima RNA replicase, que sintetiza um
RNA complementar a um molde de RNA;
- o gene da enzima RNA replicase est presente no genoma dos dois tipos de vrus, mas a
enzima s encontrada nas partculas virais RNA (-).
a) Explique por que necessrio, para sua replicao, que os vrus RNA (-) j contenham a
enzima RNA replicase, enquanto os RNA (+) no precisam armazenar esta enzima.
b) Apresente um argumento contrrio hiptese de que os vrus, devido simplicidade de sua
estrutura, foram precursores das primeiras clulas.

101. (Unesp 2006) Algumas clulas de cultura de tecido foram deixadas em um meio
contendo um precursor radioativo de RNA. Posteriormente, essas clulas foram transferidas
para um meio sem essa substncia. Aps 3 minutos, algumas clulas foram fixadas e
radioautografadas. Esse procedimento se repetiu aps 15 e aps 90 minutos. Os esquemas
representam as clulas radioautografadas nos trs momentos, revelando a distribuio do
precursor radioativo nas mesmas.

Esses resultados ocorrem porque


a) o RNA transportador leva o istopo at o nuclolo e posteriormente ao ncleo e citoplasma
celular.
b) a substncia, ao ser deixada em situao de desequilbrio osmtico em relao cultura
sem istopo, dirige-se gradativamente para o citoplasma celular, buscando a situao de
equilbrio.
c) a sntese de RNA, que se intensifica aos 90 minutos, esgota toda a substncia presente no
ncleo, restando apenas no citoplasma.
d) a produo de RNA, que ocorre inicialmente no ncleo celular, prossegue posteriormente
no citoplasma da clula.
e) a sntese de RNA ocorre no ncleo, sendo que posteriormente o RNA a produzido migra
para o citoplasma celular.

102. (G2) Os cdons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os
aminocidos arginina, leucina e treonina. Escreva esses aminocidos na ordem correspondente
seqncia TGA - TCT - GAC de um segmento de DNA.

103. (G2) A seqncia de aminocidos de uma protena determinada pela seqncia dea)
pentoses da molcula de DNA.b) pentoses da molcula de RNA - mensageiro.c) bases da
molcula de DNA.d) bases da molcula de RNA - transportador.e) bases da molcula de RNA ribossmico

104. (Unicamp 2002) O esquema a seguir representa a seqncia de reaes que levam
formao do pigmento da pelagem de uma espcie animal. Os genes autossmicos A, B e C so
responsveis pela produo das enzimas A, B e C que atuam nesse processo metablico.
Mutaes nos genes A, B e C produzem respectivamente os alelos recessivos a, b e c.

a) Do ponto de vista gentico, quantos tipos de albinismo podem ocorrer nessa espcie? Por
qu?

b) Demonstre o fentipo esperado de um cruzamento entre animais de linhagens puras com


dois tipos diferentes de albinismo.

c) possvel ocorrer uma mutao em um gene sem que se altere a enzima correspondente?
Justifique.

105. (Fuvest 93) O que so cidos nuclicos? Como atuam na sntese de protenas?

106. (G2) Griffth em 1928 descobriu que pneumococos sem cpsula, no patognicos,
misturados com um extrato de pneumococos capsulados patognicos mortos causavam a
morte de cobaias. Nesse extrato o agente transformante eraa) o cido ribonuclico.b) o cido
indolilactico.c) o cido desoxirribonuclico.d) uma enzima.e) uma protena.

107. (G2) Em 1928 Griffth descobriu que pneumococos (bactrias) sem cpsula, no
patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos
causavam a morte de cobaias. Nesse extrato o agente capaz de transformar bactrias no
patognicas em patognicas eraa) o cido ribonuclico.b) o cido indolilactico.c) o cido
desoxirribonuclico.d) uma enzima.e) uma protena.

108. (G2) Griffth em 1928 descobriu que bactrias pneumococos sem cpsula, no
patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos
causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluram que o agente
capaz de transformar as bactrias eraa) o RNA.b) o AIA.c) o DNA.d) uma enzima.e) uma
protena.

109. (G2) A experincia do "liquidificador" realizada por Hersey e Chase demonstrou que a
substncia que determinava a destruio de bactrias parasitadas pelos vrus bacterifagos
eraa) uma protena viral.b) uma enzima viral.c) o RNA viral.d) o DNA viral.e) um lpide viral.

110. (G2) O experimento do "liquidificador" serviu para demonstrar que o DNA de certos
organismos era capaz de causar a destruio de bactrias. Os organismos que podem infectar
bactrias soa) fungos.b) vrus.c) algas.d) caros.e) protozorios.

111. (G2) Bacterifagos soa) protozorios de vida livre.b) lquenes parasitas.c) vermes
parasitas.d) vrus.e) vermes de vida livre.

112. (G2) A experincia do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou
quea) o material gentico formado por protenas.b) o material gentico formado de RNA.c)
o material gentico formado de lipdios.d) o material gentico formado por acares.e) o
material gentico formado de DNA.

113. (G2) Descreva os principais passos seguidos por Griffth em 1928 no experimento que
demonstra a "transformao" de bactrias pneumococos sem cpsula, no patognicas, em
pneumococos com cpsula patognicas.

114. (G2) Como que os cientistas O. Avery, M. Mac Leod e M. Mac Carthy chegaram
concluso em 1944 que o "agente transformante" capaz de permitir o desenvolvimento da
cpsula em pneumococos no capsulados era o cido desoxirribonuclico?

115. (G2) O que so bacterifagos? Qual sua importncia na identificao do DNA como
material gentico?

116. (G2) Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como
"experincia do liquidificador" na qual utilizaram istopos radioativos de enxofre (S) e de
fsforo (P) para 'marcar' vrus parasitas de bactrias, bem como suas concluses a partir
deste trabalho.

117. (G2) A bactria 'Pneumococo pneumoniae' pode possuir uma cpsula que lhe permitea)
sofrer mutaes.b) desenvolver flagelos.c) resistir s defesas dos hospedeiros.d) ficar imune s
defesas dos hospedeiros.e) sobreviver em ambientes sem gua.

118. (Ufrs 98) Sabendo que o DNA dos vrus bacterifagos contm fsforo e que a cpsula
protica contm enxofre, Hersey e Chase, em 1952, cultivaram vrus em meio contendo
istopos de fsforo (P) e de enxofre (S). Esses pesquisadores observaram, ao introduzir os
vrus marcados em meio contendo bactrias, que os istopos de fsforo (P) apareciam no
interior das bactrias e que os istopos de enxofre (S) permaneciam fora das clulas.
Observaram tambm que, aps lavarem a superfcie das bactrias, retirando o enxofre (S),
continuava ocorrendo a replicao dos vrus. Com esse experimento, eles puderam concluir
quea) a informao gentica necessria para a sntese de novos vrus est contida no DNA
viral.b) as capas proticas dos vrus contm parte importante da informao gentica
necessria sntese de novos vrus.c) o DNA viral precisa estar associado integralmente s
capas proticas para poder se replicar no interior das bactrias.d) a capa protica protege o

DNA viral da ao de endonucleases no interior do organismo hospedeiro.e) os vrus


bacterifagos contm DNA como material gentico, e essa molcula muito rica em enxofre.

119. (Pucsp 2000) "O sculo XX proporcionou uma srie de pesquisas na rea gentica.Em
1928, Griffith realizou um importante experimento que envolvia transformaes em bactrias.
Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta
da molcula formadora do material gentico.Nos anos 50, Watson e Crick apresentaram o
modela da dupla-hlice dessa molcula, abrindo caminho para que, na dcada seguinte, se
demonstrasse como o gene, atravs de sua seqncia de bases nitrogenadas, controla a
produo de protenas.Nas duas ltimas dcadas, o avano biotecnolgico permitiu aos
cientistas a manipulao do material gentico e a transferncia de um gene de uma espcie
para outra."Considere os itens abaixo:I. estrutura da molcula do DNA;II. descoberta do cdigo
gentico;III. DNA como molcula constituinte do gene;IV. obteno de organismos
transgnicos.O texto faz refernciaa) apenas aos itens I, II e III.b) apenas aos itens I, II e IV.c)
apenas aos itens I, III e IV.d) apenas aos itens II, III e IV.e) a todos os itens considerados.

120. (Ufrs 2004) No incio da dcada de 1950, foi desenvolvido um experimento onde um dos
componentes de um tipo de bacterifago foi marcado radiativamente com enxofre e outro,
com fsforo. Esses bacterifagos foram utilizados para infectar uma cultura de 'Escherichia
coli'. Um dos componentes entrou na bactria, e o outro foi retirado da parede da mesma, por
agitao. A cultura foi, ento, imediatamente, centrifugada. O resultado obtido encontra-se
ilustrado no esquema a seguir.

Sobre o resultado do experimento, correto afirmar quea) o DNA do bacterifago marcado


com fsforo encontra-se no depsito bacteriano.b) as protenas do bacterifago marcadas
com enxofre encontram-se no depsito bacteriano.c) o DNA do bacterifago marcado com
enxofre encontra-se em suspenso.d) as protenas do bacterifago marcadas com fsforo
encontram-se em suspenso.e) o DNA do bacterifago marcado com enxofre encontra-se no
depsito bacteriano.

121. (Ufrj 2004) Aps tratar culturas de bactrias com doses de um agente mutagnico capaz
de induzir uma nica mutao pontual (que afeta apenas um nucleotdeo por clula), analisouse a seqncia de aminocidos de uma determinada protena em diversos mutantes gerados.
Verificou-se que um desses mutantes produzia uma dada protena que diferia da original pela
ausncia de 35 aminocidos em uma das extremidades da cadeia peptdica.

Explique como essa nica mutao pontual pode fazer com que a sntese da protena seja
interrompida prematuramente.

122. (G2) A estrutura qumica de uma protena poder ser modificada sea) durante sua sntese
houver variao dos tipos de aminocidos disponveis no citoplasma celular.b) durante sua
sntese houver variao dos tipos de RNA transportadores.c) sua sntese ocorrer no complexo

de Golgi e no no retculo endoplasmtico rugoso.d) uma base prica substituir uma pirimdica
no RNA mensageiro que a codifica.e) o DNA no se duplicar durante a intrfase.

TEXTO PARA A PRXIMA QUESTO


(Uerj 2001) A enzima transcriptase reversa encontrada em retrovrus.
Muitos pesquisadores, atualmente, procuram descobrir novas substncias que sejam
inibidoras especficas dessa enzima.

123. Descreva a funo da transcriptase reversa no mecanismo de replicao do vrus da Aids.

124. (Unesp 2003) Criadores e sitiantes sabem que a mula (exemplar fmea) e o burro
(exemplar macho) so hbridos estreis que apresentam grande fora e resistncia. So o
produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a gua
('Equus caballus', 2n = 64 cromossomos).
a) Quantos cromossomos tm o burro ou a mula? Justifique sua resposta.

b) Considerando os eventos da meiose I para a produo de gametas, explique por que o burro
e a mula so estreis.

125. (Fuvest 2004) Bactrias (Escherichia coli) foram cultivadas durante vrias geraes em
um meio de cultura na qual toda a fonte de nitrognio era o istopo pesado N.
De uma amostra dessas bactrias (amostra A), extraiu-se o DNA que foi submetido a uma
tcnica de centrifugao que permite separar molculas de DNA de acordo com sua
densidade. O restante das bactrias foi transferido para um meio de cultura em que todo o
nitrognio disponvel era o istopo normal N. Retirou-se uma segunda amostra (amostra B),
quando as bactrias completaram uma diviso celular nesse novo meio e uma terceira amostra
(amostra C), quando as bactrias completaram duas divises celulares. O DNA das bactrias
das amostras B e C foi tambm extrado e centrifugado.

A figura mostra o resultado da centrifugao do DNA das trs amostras de bactrias.


a) Por que, na amostra B, todo o DNA tem uma densidade intermediria entre o que
constitudo apenas por N e o que contm apenas N?
b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior X, que
quantidade de DNA h na faixa superior?

126. (G2) Quais so as duas propriedades fundamentais do DNA que permitem a essa
substncia desempenhar o papel de material gentico?

127. (G2) Porque o processo de replicao do DNA chamada semiconservativa?

128. (G2) Dada a seqncia de bases nitrogenadas de um segmento de DNA:

AAT GGC ATC

responda:
a) Qual a seqncia de bases da hlice complementar a esse segmento?
b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento?

129. (Ufrj 2004) Estudos recentes compararam as seqncias completas de DNA mitocondrial
de indivduos de vrias regies geogrficas do planeta.

Os resultados revelaram que a variabilidade gentica no DNA mitocondrial de indivduos


africanos era quase o dobro da observada no DNA mitocondrial de no-africanos. Esses
resultados foram importantes para corroborar a idia de que o ancestral comum mais recente
do 'Homo sapiens' viveu na frica h cerca de 200.000 anos.

Explique por que a maior diversidade do DNA mitocondrial apia a idia da origem africana do
'Homo sapiens'.

130. (Ufrj 2005) A soma das porcentagens de guanina e citosina em uma certa molcula de
ADN igual a 58% do total de bases presentes.

a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T),
nessa molcula.
b) Explique por que impossvel prever a proporo de citosina presente no ARN mensageiro
codificado por esse trecho de ADN.

131. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma nica pgina na revista
inglesa Nature intitulado "A estrutura molecular dos cidos nuclicos", quase ignorado de
incio, revolucionou para sempre todas as cincias da vida sejam elas do homem, rato, planta
ou bactria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu
posteriormente decifrar o cdigo gentico determinante para a sntese protica.

a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada


retorcida. Explique a que correspondem os "corrimos" e os "degraus" dessa escada.
b) Que relao existe entre DNA, RNA e sntese protica?
c) Como podemos diferenciar duas protenas?

132. (Unesp 2003) Em um segmento da cadeia ativa de DNA, que servir de molde para a fita
de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da fita
complementar do DNA h 12 timinas e 10 guaninas. Levando-se em considerao essas
informaes, responda.

a) Quantas uracilas e quantas guaninas comporo a fita do RNA mensageiro transcrito do DNA
ativado?
b) Quantos aminocidos devero compor a cadeia de polipepitdeos que ser formada?
Justifique sua resposta.

133. (Uerj 2006) Para investigar possveis efeitos de uma determinada droga, utilizou-se uma
cultura de clulas, qual foram adicionadas quantidades adequadas das seguintes substncias,
marcadas com istopos: uridina C, timidina H e leucina N.
Aps algum tempo, a droga foi tambm introduzida no meio de cultura. Ao longo do
experimento, amostras das clulas foram coletadas a intervalos regulares. A incorporao dos
istopos foi medida em uma preparao que contm os cidos nuclicos e as protenas da
clula. Os resultados do experimento esto mostrados no grfico a seguir.

a) Considere as etapas de replicao, transcrio e traduo nas clulas analisadas.


Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas.
b) As protenas, aps sintetizadas, adquirem uma conformao tridimensional.
Cite duas ligaes ou interaes que atuam na manuteno da estrutura enovelada das
protenas.

134. (Ufscar 2005) Nos anos 50 e 60, quando se iniciavam as pesquisas sobre como o DNA
codificava os aminocidos de uma protena, um grupo de pesquisadores desenvolveu o
seguinte experimento:

- Sintetizaram uma cadeia de DNA com trs nucleotdeos repetidos muitas vezes em uma
seqncia conhecida:
...AGCAGCAGCAGCAGCAGCAGCAGC...
- Essa cadeia de DNA foi usada em um sistema livre de clulas, porm no qual haviam todos os
componentes necessrios sntese protica, incluindo os diferentes aminocidos.
- Nesse sistema, essa cadeia de DNA sempre produzia uma protena com um nico tipo de
aminocido. Diferentes repeties do experimento demonstraram que at trs protenas
diferentes poderiam ser produzidas, cada uma delas com um nico tipo de aminocido: serina
ou alanina ou glutamina.

a) Por que as protenas obtidas possuam apenas um tipo de aminocido?


b) Por que foram obtidos 3 tipos de protenas?

135. (Unifesp 2006) Uma fita de DNA tem a seguinte seqncia de bases 5'ATGCGT3'.
a) Considerando que tenha ocorrido a ao da DNA-polimerase, qual ser a seqncia de bases
da fita complementar?
b) Se a fita complementar for usada durante a transcrio, qual ser a seqncia de bases do
RNA resultante e que nome recebe esse RNA se ele traduzir para sntese de protenas?

136. (G2) Qualquer alterao no DNA pode modificar o funcionamento de uma clula?
Justifique.

TEXTO PARA A PRXIMA QUESTO


(Ufsm 2003) Notcia de algum jornal do futuro...

INICIA A CAMPANHA NACIONAL DE VACINAO CONTRA SARAMPO E TUBERCULOSE.

O destaque da campanha de vacinao, neste ano, a utilizao de cerejas coloridas, sem


sementes. Segundo a biloga Josefa da Silva, responsvel pela equipe que desenvolveu os
novos frutos, tcnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras
transgnicas, resultando na obteno de plantas triplides (3n = 72), incapazes de produzir
sementes. Apesar de passar por todas as etapas do ciclo reprodutivo, no h a formao de
endosperma, e o processo cessa nas primeiras divises celulares do zigoto. As novas cores
(amarela, verde, roxa e branca) haviam sido obtidas, anteriormente, por mutao no gene
responsvel pela produo de pigmento na casca do fruto. As formas mutantes para esse loco,
diz a pesquisadora, no interferem na eficincia das plantas transgnicas como produtoras de
vacinas. Elas continuam apresentando, nos frutos, as substncias que, depois de liberadas pela
digesto, ligam-se membrana plasmtica dos linfcitos e sofrem endocitose, determinando o
desenvolvimento da resposta imunolgica.
Outra inovao dessas cerejas a resistncia s moscas Anastrepha fraterculus que, nos
ltimos anos, estabeleceram-se como pragas importantes do cultivo de cerejas-vacina. Da
mesma forma, as plantas apresentam resistncia aos nematides que atacavam a raiz principal
do sistema axial desses vegetais. Com o cultivo das novas variedades de cerejas resistentes,
espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas, por algum
tempo.

137. Se as cerejeiras referidas no texto so transgnicas, ento no .......... das clulas dessas
plantas, em algum cromossomo, existe uma .......... que foi introduzida para ser transcrita e
originar um .......... que, ao ser traduzido, resulta em produto que determinara o
desenvolvimento da resposta imunolgica.Assinale a alternativa que completa as lacunas de
modo correto.a) ncleo - protena - RNA mensageirob) citoplasma - seqncia de aminocidos
- RNA transportadorc) ncleo - seqncia de aminocidos - RNA mensageirod) ncleo seqncia de nucleotdeos - RNA mensageiroe) citoplasma - protena - RNA transportador

TEXTO PARA A PRXIMA QUESTO


(Fgv 2005) O tipo selvagem do fungo Neurospora capaz de crescer em um meio de cultura
simples, constitudo de gua, sais minerais, acar e uma vitamina. O fungo utiliza esses
elementos como precursores para a sntese de vrios compostos, tal como na via biossinttica
representada na figura 1.
Os compostos X, Y e Z correspondem citrulina, arginina e ornitina, no necessariamente
nessa ordem.
Um pesquisador obteve trs diferentes linhagens desse fungo, cada uma delas deficiente em
uma das enzimas participantes dessa via biossinttica.
O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens
foram colocadas para crescer em diferentes meios de cultura. O sinal + indica que houve

crescimento do fungo, o sinal - indica que no houve crescimento. A linhagem D o tipo


selvagem, no deficiente em qualquer uma das enzimas.

138.

As letras X, Y e Z correspondem, respectivamente, aos compostos


a) ornitina, arginina e citrulina.
b) ornitina, citrulina e arginina.
c) citrulina, ornitina e arginina.
d) citrulina, arginina e ornitina.
e) arginina, citrulina e ornitina.

139. (Fuvest 2003) Qual das alternativas se refere a um cromossomo?a) Um conjunto de


molculas de DNA com todas as informaes genticas da espcie.b) Uma nica molcula de
DNA com informao gentica para algumas protenas.c) Um segmento de molcula de DNA
com informao para uma cadeia polipeptdica.d) Uma nica molcula de RNA com
informao para uma cadeia polipeptdica.e) Uma seqncia de trs bases nitrogenadas do
RNA mensageiro correspondente a um aminocido na cadeia polipeptdica.

140. (Puc-mg 2006) Analise o esquema a seguir, o qual mostra o mecanismo de ao de


algumas drogas antimitticas que inibem a progresso a partir dos pontos indicados.

Assinale a afirmativa INCORRETA.


a) A puromicina no tem qualquer efeito sobre o crescimento ou multiplicao celular.
b) A mitomicina no permite a ocorrncia da fase 5 do ciclo celular.
c) Pelo menos duas das drogas interferem diretamente na sntese protica.
d) Nem todos os tipos de nucleotdeos sofrem ao da droga arabinosilcitosdeo.

141. (Fatec 2006) O metabolismo celular depende de uma srie de reaes qumicas
controladas por enzimas, isto , protenas que atuam como catalisadores e que podem sofrer
mutaes genticas sendo modificadas ou eliminadas.
Assinale a alternativa correta, levando em conta os cidos nuclicos, a ocorrncia de mutaes
e as conseqentes mudanas do ciclo de vida da clula.
a) O DNA constitudo por cdons, que determinam a seqncia de bases do RNA mensageiro,
necessria formao dos anticdons, responsveis pela produo das protenas.
b) No caso de uma mutao acarretar a transformao de um cdon em outro relacionado ao
mesmo aminocido, no haver alterao na molcula protica formada, nem no metabolismo
celular.
c) A mutao altera a seqncia de aminocidos do DNA, acarretando alteraes na seqncia
de bases do RNA mensageiro e, conseqentemente, na produo das protenas.
d) As mutaes atuam diretamente sobre as protenas, provocando a desnaturao dessas
molculas e, conseqentemente, a inativao delas.
e) Quando algumas protenas so alteradas por mutaes, suas funes no metabolismo
celular passam a ser realizadas pelos aminocidos.

142. (Puccamp 2005)

A clula muscular cardaca e a esqueltica tm a mesma origem porm so diferentes, tanto


do ponto de vista estrutural como funcional. Ao longo do processo de diferenciao das clulas
do mesmo organismo ocorre
a) duplicao de alguns genes.
b) perda dos genes no expressos.
c) expresso diferencial dos genes.
d) induo de mutaes especficas.
e) recombinao entre genes ativados.

143. (Pucrs 2005) A seqncia de nucleotdeos ATGCACCT forma um segmento de DNA dupla
hlice ao se ligar fita complementar
a) AUGCACCU.
b) UACGUGGA.
c) TACGTGGA.
d) TCCACGTA.
e) ATGCACCT.

144. (Uerj 2004) como se em cada quarto de um imenso prdio existisse uma estante
contendo os planos do arquiteto para todo o prdio. (...) No homem, os planos do arquiteto
montam 46 volumes.Nessa analogia, proposta por Richard Dawkins no livro "O gene egosta",
cada pgina de cada volume contm um texto formado por uma seqncia de:a) fentiposb)
aminocidosc) cromossomosd) bases nitrogenadas

145. (Ufc 2004) Analise as afirmativas a seguir, acerca dos elementos constituintes do ncleo
celular eucaritico.I. Cada cromossomo possui uma nica molcula de DNA.II. Histonas so
protenas relativamente pequenas que se ligam fortemente ao RNA.III. Os nuclolos podem
atuar na sntese de carboidratos que migram do ncleo para o citoplasma.Pode-se afirmar, de
modo correto, que:a) somente I verdadeira.b) somente II verdadeira.c) somente I e II so
verdadeiras.d) somente I e III so verdadeiras.e) somente II e III so verdadeiras.

146. (Ufsc 2004) Neste ano de 2003, so comemorados os 50 anos da "descoberta" da


estrutura tridimensional do DNA.

Com relao s caractersticas dessa molcula, ao papel que ela desempenha nos seres vivos e
aos processos em que se encontra envolvida CORRETO afirmar que:

(01) formada por duas fileiras de nucleotdeos torcidas juntas em forma de hlice.
(02) Em sua composio possvel encontrar quatro bases nitrogenadas diferentes: a adenina,
a citosina, o aminocido e a protena.
(04) Ela tem a capacidade de se autoduplicar.
(08) Nela est contida a informao gentica necessria para a formao de um organismo.
(16) A mensagem nela contida pode ser transcrita para uma outra molcula denominada RNA.
(32) Nos organismos procariontes, ela fica estocada dentro do ncleo das clulas.
(64) Em alguns organismos primitivos, ela apresenta apenas uma fileira de nucleotdeos.

147. (Ufv 2004) Este ano comemorou-se 50 anos da publicao do trabalho de Francis Crick e
James Watson, que estabeleceu o modelo da estrutura da molcula de cido
desoxirribonuclico (DNA). Dentre as afirmativas abaixo, assinale a alternativa CORRETA:a)
Uma cadeia simples de DNA constituda de nucleotdeos, compostos por uma desoxirribose
ligada a um fosfato e a um aminocido.b) A polimerizao de uma fita simples de DNA dita
semiconservativa, pois independe da existncia de uma fita molde.c) Os nucleotdeos so
polimerizados por meio de ligaes fosfodister entre o fosfato e a base nitrogenada.d) Duas
cadeias simples de DNA formam uma dupla-hlice, por meio da formao de pontes de
hidrognio entre as bases nitrogenadas.e) As duas cadeias de uma dupla-hlice possuem a
mesma orientao, e suas seqncias de bases so complementares.

148. (Unesp 2004) Erros podem ocorrer, embora em baixa freqncia, durante os processos
de replicao, transcrio e traduo do DNA. Entretanto, as conseqncias desses erros
podem ser mais graves, por serem herdveis, quando ocorrema) na transcrio, apenas.b) na
replicao, apenas.c) na replicao e na transcrio, apenas.d) na transcrio e na traduo,
apenas.e) em qualquer um dos trs processos.

149. (Enem 2004) A identificao da estrutura do DNA foi fundamental para compreender seu
papel na continuidade da vida. Na dcada de 1950, um estudo pioneiro determinou a
proporo das bases nitrogenadas que compem molculas de DNA de vrias espcies.

A comparao das propores permitiu concluir que ocorre emparelhamento entre as bases
nitrogenadas e que elas formama) pares de mesmo tipo em todas as espcies, evidenciando a
universalidade da estrutura do DNA.b) pares diferentes de acordo com a espcie considerada,
o que garante a diversidade da vida.c) pares diferentes em diferentes clulas de uma espcie,
como resultado da diferenciao celular.d) pares especficos apenas nos gametas, pois essas
clulas so responsveis pela perpetuao das espcies.e) pares especficos somente nas
bactrias, pois esses organismos so formados por uma nica clula.

150. (Pucpr 2003) Os itens abaixo se referem aos cidos nuclicos:Estrutura I. Cadeia simples
II. Dupla hliceComposio 1. Com Timina 2. Com Uracila Funoa. Transcriob. Sntese
proticaSo caractersticas do cido desoxirribonuclico (DNA):a) II - 1 - bb) I - 1 - ac) II - 1 - ad)
II - 2 - ae) I - 2 - b

151. (Pucrs 2003) Supondo que ocorra um evento gentico raro em que dois cromossomos
no-homlogos, de uma mesma clula, quebram-se e voltam a se soldar, porm com os
segmentos trocados, estaramos verificando a ocorrncia dea) crossing-over.b) duplicao.c)
translocao.d) inverso.e) deleo.

152. (Uel 2006) Considere que um cientista esteja, em um laboratrio, tentando reproduzir "in
vitro" a sntese de molculas de DNA. Com base nos conhecimentos sobre o tema, assinale a
alternativa que indica, corretamente, as molculas imprescindveis que ele deve utilizar para
que possa atingir o seu objetivo.
a) Quatro diferentes tipos de nucleotdeos, contendo as bases nitrogenadas adenina, timina,
citosina e guanina; a enzima DNA polimerase e DNA.
b) Os nucleotdeos contendo as bases nitrogenadas timina, guanina, adenina e citosina; a
enzima RNA polimerase; RNA mensageiro e DNA.
c) As enzimas RNA e DNA polimerase; os trs tipos de RNA (mensageiro, transportador e
ribossmico) e DNA.
d) A enzima DNA polimerase; os vinte tipos diferentes de aminocidos, DNA e RNA.
e) As enzimas RNA e DNA polimerase; vinte tipos diferentes de aminocidos; DNA e RNA.

153. (Ufpe 2003) Considerando que na figura a seguir tem-se uma representao plana de um
segmento da molcula de DNA, analise as proposies a seguir.

1) Um nucleotdeo formado por um grupo fosfato (I), uma molcula do acar desoxirribose
(II) e uma molcula de base nitrogenada.2) Um nucleotdeo com Timina (T) em uma cadeia
pareia com um nucleotdeo com Adenina (A) em outra cadeia.3) Um nucleotdeo com Guanina
(G) em uma cadeia pareia com um nucleotdeo com Citosina (C) em outra cadeia. 4) Pontes de
hidrognio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e
G. Est(o) correta(s).a) 1 apenasb) 2 e 3 apenasc) 1, 2 e 3 apenasd) 2, 3 e 4 apenase) 1, 2, 3 e
4

154. (Ufrs 2004) Leia o texto abaixo.A entrada na era da genmica possibilitou ao norteamericano Eugene V. Koonin investigar qual seria o nmero mnimo de genes capazes de
sustentar o funcionamento de uma clula. Para isso, ele comparou 21 genomas completos de
representantes das trs linhagens primrias da vida: as eubactrias, as arqueobactrias e os
eucariontes. O resultado da pesquisa mostrou que o nmero de genes deve situar-se em torno
de 150. Esse enfoque interessante, pois permite imaginar os primeiros sistemas genticos
surgidos por ocasio da origem da vida.Adaptado de SALZANO, F.M. "Cincia Hoje", v. 29, n.
173, jul. 2001.Considere as seguintes afirmaes.I - No cdigo gentico, a cada cdon deve
corresponder mais de um aminocido.II - Os genes compartilhados pelos genomas dos
diferentes grupos devem ser essenciais.III - Os genes envolvidos na replicao, transcrio e
traduo do material gentico devem fazer parte do conjunto mnimo de genes.Quais delas
poderiam ter embasado o raciocnio de Koonin?a) Apenas I.b) Apenas II.c) Apenas III.d) Apenas
II e III.e) I, II e III.

155. (Unesp 2003) A partir dos anos 1900, uma srie de observaes e experimentos
indicaram uma correlao entre o comportamento dos cromossomos na clula em diviso e as
leis mendelianas.Analise cada uma das afirmaes seguintes.I. Na meiose I, a segregao dos
homlogos de um par cromossmico corresponde, em efeito, 1 lei de Mendel.II. Na meiose

I, a segregao dos homlogos dos diferentes pares cromossmicos correspondem, em efeito,


2 lei de Mendel.III. Na meiose I, a segregao de cromossomos homlogos que apresentam
os mesmos alelos resulta nas propores da gerao F2 dos experimentos de Mendel.IV. Na
meiose II, a segregao das cromtides dos diferentes pares cromossmicos corresponde, em
efeito, 2 lei de Mendel.V. Genes localizados em regies prximas de um mesmo
cromossomo implicam em distores das propores mendelianas.So afirmaes corretas:a)
I, II, III, IV e V.b) I, II, III e V, apenas.c) I, II, IV e V, apenas.d) I, II e IV, apenas.e) II e V, apenas.

156. (Ufsc 2006) H na mdia uma grande quantidade de notcias envolvendo o DNA: testes de
paternidade, engenharia gentica, transgnicos, clonagem teraputica e reprodutiva, terapia
gnica, farmacogenmica etc. Para compreender essas notcias, necessrio conhecer a
estrutura da molcula de DNA e entender seu funcionamento.
Analise os dados dos quadros a seguir, e assinale a(s) proposio(es) CORRETA(S).

(01) Em I, observa-se que o pareamento das bases nitrogenadas do DNA aleatrio.


(02) O quadro I mostra uma molcula de DNA cuja duplicao ocorre de forma
semiconservativa, pois cada uma das fitas originais em I serve de molde para uma nova fita,
gerando duas novas duplas hlices.
(04) Em II, est indicado o processo de transcrio, atravs do qual formam-se molculas que
contm as mesmas bases nitrogenadas presentes no DNA.
(08) Em III, est indicado o processo de traduo, que resulta na formao de polipeptdios,
cuja seqncia de aminocidos est codificada numa molcula de cido nuclico.
(16) A deleo de um dos pares de bases na seqncia mostrada em I no alteraria
significativamente a seqncia de aminocidos em III.

157. (Fatec 2003) O esquema a seguir representa a seqncia das etapas da sntese de um
trecho de uma protena a partir da molcula de DNA, num certo organismo.

Sobre essa sntese foram feitas as afirmaes abaixo:I. No esquema, os nmeros 1 e 2


correspondem, respectivamente aos processos de traduo e transcrio, que ocorrem no
ncleo das clulas eucariticas.II. A seqncia correta de bases nitrogenadas encontradas na
molcula de RNA mensageiro, complementar ao segmento da hlice de DNA apresentada
UGGUUUGGCUCA.III. Para codificar a seqncia dos aminocidos do trecho da protena
apresentada no esquema so necessrios 24 nucleotdeos no RNA mensageiro.Deve-se
concluir quea) apenas II est correta.b) apenas I e II esto corretas.c) apenas II e III esto
corretas.d) apenas I e III esto corretas.e) todas esto corretas.

158. (Uel 2006) "Desenvolvimento significa, em grande parte, clulas tornando-se diferentes
de maneira ordenada [...]. Muitos animais desenvolvem-se ao longo de eixos cartesianos,
sendo os padres especificados independentemente ao longo de cada um. Uma maneira de
produzir padres dar s clulas informao posicional, como em um sistema coordenado, e
as clulas ento interpretam esses valores de maneiras diferentes. A importante implicao
disto que no existe relao entre o padro inicial e o observado. Uma outra caracterstica
comum parece ser a gerao de estruturas peridicas como segmentos, vrtebras, penas e
dentes, que so construdas segundo o modelo bsico modificado pela informao posicional.
Todas as interaes ocorrem a curta distncia - raramente ultrapassam mais que 30 dimetros
de clula - e a maior parte da formao de padres acontece localmente, de forma que os
embries so logo divididos em regies que essencialmente se dividem de maneira
independente".
(WOLPERT, Lewis. In: MURPHY, M. P; O'NEILL, L.A.J. "O Que vida? 50 anos depois".
So Paulo: UNESP, 1997. p. 74.)

Com base no texto e nos conhecimentos sobre o tema, correto afirmar:


a) As clulas diferenciam-se de acordo com um padro intrnseco, contido no material
gentico, que induzido a se expressar em resposta a fatores extrnsecos.
b) O desenvolvimento envolve a expresso diferencial do material gentico e independe do
micro-ambiente em que a clula est localizada.
c) O desenvolvimento das diferentes regies de um organismo deve-se propriedade de
interao clula-clula e da quantidade de informaes que a clula capaz de processar.
d) A diferenciao caracteriza-se pela manuteno do padro morfolgico e pela alterao do
padro funcional do tecido.
e) O desenvolvimento ocorre como um domin, em que a diferenciao de um tipo celular
induz outro tipo a se diferenciar.

159. (Ufmg 2004) Analise este grfico, em que est representada a produo de diferentes
tipos de cadeias polipeptdicas - , , e - determinadas pela ao de diferentes genes e que
vo compor as hemoglobinas em vrias fases do desenvolvimento humano:

Com base nas informaes contidas nesse grfico e em outros conhecimentos sobre o assunto,
INCORRETO afirmar quea) a ativao do gene responsvel pela sntese da cadeia
polipeptdica ocorre dias antes do nascimento.b) a sntese da cadeia polipeptdica
permanece constante durante a mudana de produo das cadeias e .c) o gene responsvel
pela sntese da cadeia polipeptdica aumenta sua atividade a partir do terceiro ms da
concepo.d) os quatro tipos de cadeias polipeptdicas - , , e - estaro presentes no
indivduo adulto.

160. (Unesp 2003) Considere o diagrama, que resume as principais etapas da sntese protica
que ocorre numa clula eucarionte.

Os processos assinalados como 1 e 2 e a organela representados no diagrama referem-se,


respectivamente, aa) transcrio, traduo e ribossomo.b) traduo, transcrio e lisossomo.c)
duplicao, transcrio e ribossomo.d) transcrio, duplicao e lisossomo.e) traduo,
duplicao e retculo endoplasmtico.

GABARITO
1. V V V F F

2. [A]

3. a) O ncleo contm DNA que comanda a produo das protenas atravs da sntese de RNA.
b) Protenas e Glicoprotenas porque os ribossomos produzem as protenas que so associadas
aos acares no Complexo de Golgi.

4. [C]

5. [B]

6. [E]

7. 01 + 04 + 64 = 69

8. [E]

9. a) Os bacterifagos utilizam nucleotdeos que contm P da bactria para construir seu


material gentico (DNA).

b) Os bacterifagos injetam seu DNA com P no interior da bactria hospedeira, deixando-a


marcada com radioatividade.

c) No. Os vrus no injetam sua capa protica na clula bacteriana. O S radioativo entra na
composio de protenas e no no DNA introduzido pelo vrus.

10. [B]

11. [C]

12. O DNA um polinucleotdeo formado por uma dupla hlice, contm a pentose
desoxirribose e Timina como base pirimidica exclusiva. No RNA observa-se uma hlice simples
contendo nucleotdeos com ribose e como base pirimidica exclusiva encontramos a Uracila.

13. DNA - Desoxirribose (pentose) e Timina (base nitrogenada exclusiva)


RNA - Ribose (pentose) e Uracil (base nitrogenada exclusiva)

14. [E]

15. a) Observe a figura a seguir:

b) DNA - desoxirribose e timina


RNA - ribose e uracila

16. [B]

17. [C]

18. [A]

19. a) Tipo de molcula: cido ribonuclico (RNA)


Justificativa: a uridina se incorpora ao cido ribonuclico. Este cido principalmente
sintetizado no nuclolo, deslocando-se posteriormente para o citoplasma.

b) Compartimento: ncleo
Justificativa: a timidina exclusiva do DNA, encontrado principalmente no ncleo.

20. [C]

21. a) AAATTACCCGTA
b) AAAUUACCCGUA

22. A autoduplicao permite que o DNA produza cpias e possa ser transmitido
descendncia. Transcrio a capacidade do DNA produzir o RNA que ser traduzido em
protena especfica nos ribossomos das clulas.

23. a) TAA GAT GCG TTT CCG


b) UAA GAU GCG UUU CCG

24. a) TTT CCG TAA


b) UUU CCG UAA

25. [E]

26. Se houvesse a transcrio simultnea das cadeias complementares dos genes, as molculas
de ARN sintetizadas tambm teriam seqncias complementares. Tal situao provocaria
ento a formao de molculas de ARN de cadeia dupla, que no poderiam ser traduzidas nos
ribossomas.

27. RNA mensageiro - determina a ordem dos aminocidos na cadeia polipeptdica

RNA transportador - ativao e transporte de aminocidos para os ribossomos no processo de


sntese protica

28. [A]

29. [C]

30. a) (1) = cido fosfrico, (2) = ribose, (3) = base nitrogenada


b) nucleotdeo

31. [C]

32. [A]

33. [B]

34. 400 nucleotdeos porque o DNA constitudo por duas cadeias complementares e apenas
uma cadeia com 200 nucleotdeos serviu de molde para a produo de RNA.

35. a) TTT AAG CCC CTA


b) 12 nucleotdeos.

36. [C]

37. [A]

38. [B]

39. [B]

40. [C]

41. [E]

42. [D]

43. a) Os RNA mensageiros transcritos do gene normal e do gene inserido formam um RNA de
dupla hlice ou hbrido.
A disposio das bases destes dois RNA mensageiros so exatamente complementares.

b) Havendo a interao entre os RNA mensageiros transcritos a partir destes dois genes,
restaro menos mensageiros normais (fita simples) capazes de serem traduzidos em enzima,
ao nvel ribossomal. Em conseqncia, a concentrao da enzima diminuir nas clulas, o que
retardar o processo de maturao.

44. [A]

45. [C]

46. O DNA um polinucleotdeo capaz de produzir o RNA mensageiro. Cada trs nucleotdeos
(cdon) do RNAm ser traduzido por um aminocido ao nvel dos ribossomos.

47. [D]

48. [E]

49. a)
Protena normal:
Val - Leu - Tre - Pro - Tir - Val - Lis

Indivduo A: Val - Leu - Tre - Pro


Indivduo B: Val - Leu - Tre - Pro - Tir - Val - Lis
Indivduo C: Val - Met - Tre - Pro - Tir - Val - Lis

b)
A afetado porque produz uma protena menor.
B normal, apesar da substituio de uma base nitrogenada no seu DNA, porque o cdigo
gentico degenerado.
C afetado porque possui um aminocido diferente em sua protena.

50. [B]

51. [D]

52. [B]

53. [B]

54. [D]

55. [C]

56. Com a descoberta do cdigo gentico sabe-se que um aminocido sempre codificado por
trs nucleotdeos, logo o gene que codifica uma protena tem sempre maior nmero de
nucleotdeos que de aminocidos. Sabe-se ainda que existem vrios nucleotdeos do gene que
servem para a funo de regulao e no so transcritos.

57. F F V V

58. Porque o cdigo gentico degenerado, isto , para um mesmo aminocido existem vrios
cdons diferentes.

59. [E]

60. [A]

61. [D]

62. [C]

63. a) RNAm: UCC GUU AAU UCC GGC AAG

b) O cdon mutado, TTA, especificaria o terceiro aminocido da tabela.

c) UUA

64. [C]

65. [A]

66. [D]

67. a) As protenas produzidas pelos extraterrestres em questo, poderiam ter, no mximo, 16


tipos diferentes de aminocidos. Seu cdigo gentico, formado por pares de bases, permite a
formao de apenas 16 cdons diferentes. Isso sem considerar a possibilidade da existncia de
um, ou mais, cdons de finalizao. Neste caso, no seria possvel a produo das protenas B
e C com, respectivamente, 16 e 19 aminocidos.

b) A diversidade no planeta Terra seria maior, pois o cdigo gentico dos terrqueos
formado por 64 cdons, sendo 3 cdons de finalizao. Assim o nmero de tipos distintos de
aminocidos presentes nos polipeptdeos seria, obviamente, maior.

c) A protena produzida pela bactria terrestre "transgnica" no ser idntica ao polipeptdeo


aliengena, uma vez que o equipamento ribossmico da bactria que incorporou o gene, est
capacitado para traduzir cdons constitudos por 3 bases nitrogenadas consecutivas.

68. [A]

69. [A]

70. [A]

71. [B]

72. Quando a mutao for localizada:

a) no stio 1
A seqncia do DNA ser modificada pelo benzo[a]pireno de ATG para ATT levando, na
transcrio, a formao de um RNAm com a seqncia UAA ao invs de UAC. UAA um cdon
de terminao, portanto, a mutao provocar a produo de uma protena menor.

b) no stio 2
A seqncia do DNA de CCG ser modificada para CCT levando na transcrio, a formao de
um RNAm com a seqncia GGA ao invs de GGC. Nessa situao, a modificao de GGC para
GGA no provocar alterao na protena; os dois cdons na traduo produzem uma protena
com o aminocido glicina, nesta posio.

73. [B]

74. a) RNA-polimerase.

b) UAC.

c) W - A - T - S - O - N - E - C - R - I - C - K.

d) A protena no ser formada, pois foi alterado o cdon de iniciao.

75. [C]

76. a) Observe a figura a seguir:

b) No. Sendo o cdigo gentico degenerado, diferentes trincas de nucleotdeos especificam o


mesmo aminocido.

77. a) AUG AGU UGG CCU G

b) Serina - triptofano - Prolina

c) Metionina - Serina - Glicina

78. a) CAU CGG AUC

b) Somente se formar o mesmo peptdeo se os cdons transcritos partir da fita


complementar especificarem os mesmos aminocidos, devido degenerao do cdigo
gentico.

79. AUG AGG CGA AUC e UAC UCC GCU UAG

80. a) TTA CAT CCG


b) trs

81. a) ncleo e ribossomos.


b) cessa o processo de traduo.

82. [C]

83. UGA GGC GAA e ACU CCG CUU

84. [A]

85. [B]

86. [B]

87. [A]

88. [D]

89. [D]

90. [B]

91. No. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes protenas que
contm. Assim, a diferenciao dos tecidos resulta principalmente da transcrio de genes
diferentes, o que naturalmente produz uma composio de RNAm qualitativamente diferente
de tecido para tecido.

92. [C]

93. [A]

94. As regies 2 e 4. Essas regies formam alas justamente por no possurem as seqncias
de nucleotdeos complementares, que foram eliminadas aps o processo de transcrio.

95. [D]

96. [D]

97. [E]

98. [E]

99. Os genes que no codificam polipeptdeos transcrevem para produzir RNA ribossmico e
RNA transportador.

100. a) Para que o genoma RNA (-) seja expresso em protenas na clula infectada, primeiro
necessrio que seja transcrito em RNA complementar, o que feito, apenas, pela RNA
replicase, que no existe na clula. Desta forma, o prprio vrus ter de j possuir a enzima em
sua estrutura.
Os vrus RNA (+) j funcionam como mensageiros na clula infectada, sendo diretamente
traduzidos em protenas virais, inclusive a RNA replicase.

b) Os vrus s existem em virtude de sua habilidade de utilizar a maquinaria metablica das


clulas hospedeiras, direcionando-a para a formao de novas partculas virais. Portanto, os
vrus s devem ter surgido aps o aparecimento das primeiras clulas.

101. [E]

102. Treonina - Arginina - Leucina

103. [C]

104. a) Do ponto de vista gentico, poderiam ocorrer trs tipos de albinismo, pois esto
envolvidos trs pares de genes para a produo do pigmento no animal. Defeitos no gene A,
impedem a formao do composto 1, interrompendo toda a cadeia de reaes que levam ao
desenvolvimento da cor. Alteraes no gene B, acarretam a no formao do composto 2,
resultando tambm na no formao da pigmentao. Mutaes no gene C, impedindo a
sntese do composto 3, tambm causariam albinismo.

b) Pais genotipicamente puros portadores de dois tipos distintos de albinismo:

AAbbCC x AABBcc

Gerao:

AABbCc - 100% pigmentados

c) Devido degenerao do cdigo gentico, um aminocido pode ser determinado por


diferentes cdons. Assim, uma mutao em um gene, pode no causar qualquer alterao na
protena codificada.

105. So molculas (DNA e RNA) que comandam, atravs da sntese de enzimas, todo o
metabolismo celular. Segmentos de DNA (genes) transcrevem o RNAm que, nos ribossomos,
associados ao RNAt realizam a traduo do cdigo gentico em uma protena.

106. [C]

107. [C]

108. [C]

109. [D]

110. [B]

111. [D]

112. [E]

113. Experimento realizado com bactrias 'Pneumococo pneumoniae' sem cpsula (no
patognicas) e com cpsula (patognicas).

1) bactrias pneumococo sem cpsula ratos = ratos vivos.

2) bactrias pneumococo com cpsula ratos = ratos mortos.

3) bactrias pneumococo sem cpsula + bactrias capsuladas mortas pelo calor ratos =
ratos vivos.

4) bactrias sem cpsula + extrato de bactrias capsuladas mortas pelo calor ratos = ratos
mortos.

Concluso: Existe algum agente transformante no extrato de bactrias capsuladas mortas pelo
calor que capaz de modificar as no capsuladas. Esse agente seria o cido
Desoxirribonuclico (DNA).

114. Trataram o extrato de bactrias pneumococo capsuladas mortas pelo calor com a enzima
desoxirribonuclease. Esta enzima hidrolisa o DNA, destruindo, portanto, o agente
transformante capaz de modificar as bactrias sem cpsula no patognicas em capsuladas
patognicas e letais para os ratos utilizados nos experimentos.

115. Vrus utilizados nos experimentos que serviram para demonstrar que o DNA de fato o
material gentico.

116. 1) bactrias 'Escherichia coli' cultivadas em meio contendo P e S bactrias


marcadas com os elementos radioativos.

2) Vrus bacteriofagos parasitam as bactrias marcadas e ficam tambm marcados com P


no DNA e S na cpsula protica.

3) Vrus marcados parasitam bactrias no marcadas.

4) Antes da lise bacteriana o preparado levado ao liquidificador e centrifugado.

5) O sobrenadadante apresenta as cpsulas proticas marcadas com S e no precipitado h


bactrias contendo DNA marcado com P.

Concluso: O DNA viral a substncia capaz de TRANSFORMAR as bactrias em "fbricas" de


novos vrus bacteriofagos. Assim o DNA foi definitivamente identificado como sendo a
substncia que controla a hereditariedade.

117. [C]

118. [A]

119. [E]

120. [A]

121. A mutao deve ter alterado um cdon que codificava um aminocido transformando-o
em um cdon de parada, que interrompe a leitura do ARNm pelo ribossoma.

122. [D]

123. O vrus da AIDS um retrovrus que, para multiplicar-se em clulas humanas, precisa
transcrever o cdigo gentico contido em sua molcula de RNA, sintetizando um DNA que ser
incorporado ao genoma da clula infectada. Para isso, emprega a transcriptase reversa contida
no prprio vrus.

124. a) Os animais tm 2n = 63 cromossomos, porque


so resultantes da unio de espermatozide, com n = 31 cromossomos, e vulo, com n = 32
cromossomos.
b) Os cromossomos so de 2 espcies diferentes e, portanto, no ocorre pareamento dos
chamados cromossomos homlogos, impossibilitando a meiose e a gametognese.

125. a) no tubo B a densidade intermediria devido a presena do istopo normal e do


istopo pesado, dada a caracterstica do DNA ser semiconservativo.
b) na faixa superior, h X de DNA, com densidade menor(istopo normal)

126. REPLICAO para que possa ser transmitido descendncia e TRANSCRIO, ou


produo do RNA, para controlar as atividades celulares atravs da sntese de protenas.

127. A replicao do DNA sempre CONSERVA, nas molculas-filhas, metade da molcula-me.

128. a) TTACCGTAG
b) UUACCGUAG

129. As mutaes ocorrem aleatoriamente, com uma taxa mdia constante. Logo, a
variabilidade gentica diretamente proporcional antiguidade, o que confirma que nosso
ancestral comum mais recente viveu na frica.

130. a) C = G = 29% e A = T = 21%.

b) Porque a proporo de bases apresentada refere-se s duas cadeias da molcula de DNA,


no sendo possvel determinar a proporo de citosina na cadeia que ser transcrita.

131. a) Os 'corrimos' correspondem a uma sucesso alternada de fosfato e desoxirribose


(acar). Os 'degraus' so constitudos por pares de bases nitrogenadas, unidas por pontes de
hidrognio, onde adenina pareia com timina, e citosina com guanina.

b) O DNA realiza a transcrio, isto , produz o RNA mensageiro, que conduz os cdons para a
sntese da protena nos ribossomos.

c) As protenas podem ser diferenciadas pelo nmero, tipos e seqncias de seus aminocidos.

132. a) DNA
cadeia complementar: 30A-20C-12T-10G

cadeia ativa: 30T-20G-12A-10C

RNA-mensageiro: 30A-20C-12U-10G

Portador, o RNA-m ter 12 uracilas e 10 guaninas.

b) A cadeia ativa apresenta 72 bases. Cada aminocido codificado por um cdon constitudo
por 3 bases. Da conclumos que 72 bases formam 24 cdons que produziro uma cadeia
polipeptdica com 24 aminocidos.

133. a) Replicao: no interfere; no h alteraes na incorporao de timidina marcada no


DNA.
Transcrio: no interfere; no h alterao na incorporao de uridina marcada no RNA.
Traduo: interfere; esta etapa bloqueada porque h uma queda acentuada na
incorporao de aminocido marcado na protena.

b) Duas dentre as ligaes ou interaes:


- ponte dissulfeto
- ponte de hidrognio
- foras de van der Walls
- interaes hidrofbicas
- interaes eletrostticas

134. a) As protenas obtidas possuam apenas um tipo de aminocido porque o DNA utilizado
apresentava um nico tipo de cdon (AGC).

b) O tipo de aminocido utilizado na produo da protena poder variar dependendo do local


onde os ribossomos iniciam a traduo do cdigo gentico. O aminocido utilizado a serina
quando a leitura comea no A, do cdon AGC. O aminocido a alanina quando a leitura
comea no G, do cdon GCA. O aminocido utilizado a glutamina, quando a leitura comea
no C, do cdon CAG.

135. a) 3'TACGCA5'.

b) 5'AUGCGU3'. O RNA que ser utilizado na traduo o RNAm (RNA mensageiro).

136. No necessariamente, pois a substituio de bases nitrogenadas na cadeia do DNA


poder determinar os mesmos aminocidos, na mesma ordem, em uma protena, j que o
cdigo gentico degenerado.

137. [D]

138. [B]

139. [B]

140. [A]

141. [B]

142. [C]

143. [C]

144. [D]

145. [A]

146. 01+04+08+16=29

147. [D]

148. [B]

149. [A]

150. [C]

151. [C]

152. [A]

153. [E]

154. [D]

155. [C]

156. 02 + 08 = 10

157. [A]

158. [A]

159. [D]

160. [A]