Arch Virol

DOI 10.1007/s00705-013-1973-3

ORIGINAL ARTICLE

Detection of antibodies specific for foot-and-mouth disease virus

infection using indirect ELISA based on recombinant
nonstructural protein 2B
Jitendra K. Biswal Sarita Jena Jajati K. Mohapatra
Punam Bisht Bramhadev Pattnaik

Received: 7 October 2013 / Accepted: 29 December 2013

Springer-Verlag Wien 2014

Abstract Foot-and-mouth disease (FMD) is a highly

contagious viral disease of transboundary importance. In
India, since the launch of the FMD control programme,
there has been a substantial increase in the vaccinated
bovine population. In this scenario, there is a need for
additional locally developed non-structural protein (NSP)based immnoassays for efficient identification of FMD virus
(FMDV)-infected animals in the vaccinated population. The
2B NSP of FMDV, lacking the transmembrane domain
(D2B), was expressed successfully in a prokaryotic system,
and an indirect ELISA (I-ELISA) was developed and validated in this study. The diagnostic sensitivity and specificity
of the D2B I-ELISA were found to be 95.3 % and 94.6 %,
respectively. In experimentally infected cattle, the assay
could consistently detect D2B-NSP-specific antibodies
from 10 to approximately 400 days postinfection. The assay
was further validated with bovine serum samples collected
randomly from different parts of the country. The performance of the D2B I-ELISA was compared with the in-house
r3AB3 I-ELISA, and the overall concordance in test results
was found to be 86.49 %. The D2B I-ELISA could be useful
as a screening or confirmatory assay in the surveillance of
FMD irrespective of vaccination.

Introduction
Foot-and-mouth disease is a highly contagious viral disease
of both domesticated and wild ruminants as well as pigs.

J. K. Biswal
S. Jena
J. K. Mohapatra
P. Bisht

B. Pattnaik (&)
Project Directorate on Foot-and-Mouth Disease (ICAR),
Mukteswar, Nainital 263138, Uttarakhand, India
e-mail: pattnaikb@gmail.com

Owing to its contagiousness and potential for rapid spread

among susceptible animals, the disease poses a serious
threat to the international trade of animals and animal
products. Culling of infected and in-contact animals is the
favoured method of control of FMD in many parts of the
world that are free from FMD. However, prophylactic
biannual vaccination with extensive serosurveillance has
been preferred over culling in India. Nevertheless, the
strategy of vaccination has its own problems, and the most
important one is that vaccinated animals may sometimes be
infected with FMD virus (FMDV) with or without showing
overt clinical signs [12]. Therefore, identification of
FMDV-infected individuals among vaccinated animals is
of utmost importance, especially in ruminants, which may
act as carriers of the virus and can potentially become the
source for new outbreaks. In this respect, it is imperative to
develop highly sensitive and specific discriminatory assays
to detect infection regardless of vaccination status.
Detection of serum antibodies against FMDV nonstructural protein (NSP) in FMD-vaccinated and subsequently infected animals is used as a differential marker of
infection, since vaccination with purified vaccine elicits
antibodies only against the structural protein (SP) of
FMDV [7]. A range of different ELISAs have been
developed to detect antibodies against NSP of FMDV [16],
and these assays have a further advantage over the conventional tests in that they are not serotype specific.
However, the current NSP-based assays are not able to
detect infection reliably in a vaccinated population [5].
During the validation of various NSP ELISAs in an international workshop at Brescia, Italy, it was found that none
of the assays could provide a categorical assurance of
detecting infection [5]. Therefore, it was suggested to use
more than one NSP assay in order to enhance the overall
sensitivity and specificity of determination of infection

123

J. K. Biswal et al.

status. Considering that recommendation, there is a need to

produce a new NSP-based ELISA that can be used either as
the screening or confirmatory method along with existing
NSP tests or one that can be used in a multiple NSP-antigen-based assay [24] to enhance the confidence of detection of infection.
Based on a series of experiments, Berger et al. [4]
suggested to use NSP 2B along with other NSPs (2C, 3AB1
and/or 3C) for identification of FMDV replication in vaccinated cattle. Infection-related linear B-cell epitopes on
the 2B NSP of FMDV have been mapped by analyzing
synthetic peptides in an indirect ELISA [9]. Although the
ELISA based on synthetic 2B peptides had shown some
promising results [21] and was comparable to the Prio
CHECK-NSP assay [10], these peptides were thought to be
too expensive and poorly antigenic for use in ELISA [8].
Therefore, test systems based on recombinant NSP could
be designed as a relatively cost-effective alternative. In this
study, we report the expression in Escherichia coli of
recombinant truncated 2B NSP lacking the transmembrane
domain (D2B) and the development of a differential indirect ELISA (I-ELISA) for serosurveillance of FMD.

Materials and methods

Serum samples
Serum samples used in this study were collected either from
cattle or buffalo, and the term bovine in this manuscript
implies both of them. Serum samples collected from nave,
infected (both experimentally and naturally) and uninfected
vaccinated animals were obtained from the serum repository maintained at Project Directorate on Foot and Mouth
Disease (PDFMD), Mukteswar, India. This study complied
with international standards for animal welfare.
Serum samples from a nave bovine population
A total of 196 serum samples collected from clinically
healthy animals and found negative for anti-FMDV structural protein antibodies in liquid-phase blocking ELISA
were used in this study. These samples included 131 serum
samples derived from an unvaccinated, clinically healthy
bovine population without any history of FMDV infection
for at least 10 years, 60 serum samples collected at day
zero from cattle used in FMD vaccine potency studies,
and five commercial healthy bovine sera.
Serum samples from uninfected, vaccinated bovines
Serum samples (n = 144, from 72 cattle) were collected
from an FMD-free dairy cattle herd that was vaccinated

123

routinely at six-month intervals with a trivalent inactivated

vaccine. These samples were collected at 28 and 180 days
post-vaccination (dpv). Serum samples (n = 312) from
FMD control programme (FMD-CP) areas without any
report of FMD for the last five years were also included in
the study. The majority of the adult bovines in the FMD-CP
areas had received at least 8 rounds of prophylactic biannual vaccination. Samples (n = 60) were also collected at
21 dpv from cattle that were used in FMD vaccine potency
studies. All of these 516 serum samples collected from
vaccinated, uninfected animals along with the serum
samples from nave bovines (n = 196) were used for the
determination of the cutoff value and diagnostic specificity
of D2B I-ELISA.
Serum samples from infected bovines
A total of 178 serum samples that were collected sequentially between 10 and 1000 days postinfection (dpi) from
four unvaccinated bull calves were obtained from the
serum repository of PDFMD. Two of them were inoculated
intradermolingually with either FMDV A IND 40/2000 or
Asia 1 IND 63/1972, while the other two calves were
contact infected after being co-housed separately with each
of the inoculated animals [19]. 120 out of these 178 serum
samples (from 10-400 dpi) were used for the estimation of
the cutoff value and diagnostic sensitivity of the D2B
I-ELISA. Bovine serum samples (n = 1259) from clinical
cases of FMD field outbreaks were also included in this
study. These samples were collected at different time
points during the outbreaks, ranging from the acute phase
to nearly one year post-outbreak.
Bovine serum samples collected at random
Serum samples (n = 3500) that had been collected at
random from different parts of the country were also analysed in D2B I-ELISA in order to determine the prevalence
of 2B antibodies in bovines.
Molecular cloning, expression and purification
of recombinant 2B non-structural protein
Construction of recombinant 2B gene expression vectors
Total RNA was extracted using a QIAamp Viral RNA Mini
Kit (QIAGEN, Hilden, Germany) from baby hamster kidney cells (BHK-21) infected with FMDV isolate O IND
R2/1975. The extracted RNA was reverse transcribed using
oligo (dT)20 primer (Invitrogen, USA) and ThermoScriptTM reverse transcriptase enzyme (Invitrogen, USA).
The full-length coding sequence of 2B NSP was amplified
by PCR using upstream primer 2BF (GATCGGATCC

ELISA for detection of antibodies against FMDV 2B protein

CCCTTCTTCTTC), which has a BamHI site (bold

and underlined), and downstream primer 2BR
(GATCAAGCTTCTGTTTTTCTG), which has a HindIII
site (bold and underlined).
The 2B NSP gene without the sequence encoding the
transmembrane region (D2B) was amplified by an overlap
extension PCR (OEP) in which two rounds of PCR were
carried out to amplify two DNA fragments, F1 and F2 (F1,
nucleotides 1-339; F2, nucleotides 412 to 462), of the 2B
NSP gene with an overlap of 15 nucleotides. These fragments were combined in a subsequent fusion reaction in
which the overlapping ends served as primers for the
extension of complementary strands. The entire experiment
was carried out as per the protocol developed by Urban
et al. [27]. All of the PCRs were carried out using a KOD
Hot Start DNA polymerase kit (Novagen, Germany).
Subsequently the agarose gel purified 2B and D2B
amplicons were ligated into the Bam HI and Hind III sites
of bacterial expression vector pMAL-c5X (NEB, USA) to
generate the recombinant plasmids pMAL-2B and pMALD2B. In these plasmids, the 2B and D2B genes were ligated
in frame with the malE gene, which encodes the maltose
binding protein (MBP). The ligated products were used to
transform chemically competent E. coli JM109 cells
(Promega, Madison, USA). The resultant recombinant
clones were selected on ampicillin plates and screened by
restriction enzyme digestion analysis. The nucleotide
sequences of the inserts were confirmed using gene-specific
primers in an ABI 3130 DNA automated sequencer
(Applied Biosystems, CA, USA). Positive clones were
subsequently subjected to protein expression screening.
Purification and immunological characterisation
of recombinant D2B NSP
Expression and affinity purification of the recombinant
MBP-D2B fusion protein was performed according to the
manufacturers instructions (NEB, USA). Briefly, 25 ml of
an overnight culture of a JM109 clone harbouring the
MBP-D2B construct was inoculated into 250 ml of LB
medium and grown at 37 C until the optical density (O.D.)
at 600 nm reached 0.6-0.7. Following addition of IPTG to a
final concentration of 0.5 mM, the bacterial culture was
incubated further at 28 C for 5 hours. Bacterial cells were
harvested by centrifugation at 4000 g for 20 minutes and
then resuspended in 20 ml of column buffer (20 mM TrisCl [pH 7.4], 200 mM NaCl, 1 mM EDTA, and 1 mM
dithiothreitol). The bacterial suspension was subjected to
one freeze-thaw cycle and sonicated. The clarified supernatant was loaded onto a column containing amylase resin.
The resin was washed four times with column buffer, and
the fusion protein was eluted with column buffer containing 10 mM maltose. Fractions were collected, pooled, and

dialyzed against PBS. The purity of recombinant D2B NSP

was assessed by SDS-PAGE [14]. The immunoreactivity of
recombinant D2B protein was analysed by western blot
using anti-MBP monoclonal antibody and rabbit antimouse HRP-conjugated secondary antibody. Differential
reactivity of the recombinant NSP protein was also verified
by western blot using FMDV-infected bovine serum (28
dpi) and nave serum diluted 1:100 in blocking buffer.
Development of recombinant D2B I-ELISA
During the development of the D2B I-ELISA, the concentrations of various components of the assay were optimised by the checkerboard titration method. Briefly,
96-well, flat-bottom polystyrene plates (Nunc, Roskilde,
Denmark) were coated with recombinant purified MBPD2B protein diluted in carbonate-bicarbonate buffer and
incubated at 4 C overnight. The coated plates were
washed four times with PBS and blocked with a buffer
containing 10 g of fraction V bovine serum albumin, 15 g
of glycine, and 40 g of sucrose in one litre of PBS. Serum
samples were diluted (1:15 dilution) and pre-absorbed for
one hour with purified MBP in a serum dilution buffer
containing 10 g of BSA per litre of PBS. The D2B-NSPcoated ELISA plates were washed three times with PBS,
and diluted serum (100 ll/well) was transferred to duplicate wells of the ELISA plate and incubated at 37 C for
one hour. The positive and negative sera were included as
internal controls, while serum dilution buffer without any
serum was included as conjugate control to determine any
background activity. Subsequently, after washing, rabbit
anti-cow immunoglobulin/HRP conjugate (DAKO, Denmark) diluted 1:2000 in dilution buffer was added and
incubated for 1 hour. Finally, substrate solution containing
o-phenylenediamine dihydrochloride (OPD)/H2O2 was
added, and the reaction was stopped after 12 minutes of
incubation by adding 1 M H2SO4. The optical density (OD)
values were measured at 492 nm.
The corrected mean OD values of the positive control
(mODPOS), the negative control (mODNEG), and the test
samples (mODsample) were determined after subtracting
the mean OD value of the background control wells
(mODBG). The OD for each test serum sample was
expressed as a percentage of the positive control using the
following formula:
Percent of positive control (PP) = [mODsample] 9 100
/ [mODPOS]
Determination of the precision of D2B I-ELISA
For the precision analysis, coefficients of variation (CVs)
were calculated based on the PP values from intra-plate
replicates (four replicates per sample), inter-plate replicates

123

J. K. Biswal et al.
2

Table 1 Estimate of the precision of the D2B I-ELISA based on a set

of five serum samples

Mean PP

134.63

168.82

72.95

34.8

21.83

Intra-plate CV

2.87

3.91

12.12

6.29

11.11

Inter-plate CV
Inter-day CV

2.4
2.07

5.07
2.06

4.71
1.529

7.97
11.17

8.4
7.727

Global CV

5.34

3.61

4.526

11.78

11.46

O.D at 600 nm

Serum sample*

1.8

WT 2B - IPTG

1.6

WT 2B + IPTG

1.4

2B + IPTG

1.2
1
0.8
0.6
0.4
0.2
0

* 1 51 dpi serum sample from A IND 40/2000 intradermolingually

infected calf; 2 serum sample collected from a FMDV infected bull at
approximately two months post infection, 3 135 dpi serum sample
from A IND 40/2000 contact infected calf; 4 serum sample from a
calf at 21 dpv with a single dose of FMD monovalent vaccine, 5
serum sample from a nave calf used in a vaccine potency experiment
CV: coefficient of variation

(three plates per day), and inter-day replicates (between

five different days) of five selected serum samples
(Table 1) in D2B I-ELISA. The precision estimation of the
D2B I-ELISA was carried out as described by Jaworski
et al. [11].
r3AB3 I-ELISA
In order to determine the concordance between D2B
I-ELISA and the in-house r3AB3 I-ELISA, a selected set of
serum samples (n = 2500) were also tested by r3AB3
I-ELISA as described earlier [19].
Bioinformatics and statistical analysis
The prediction of transmembrane helices of FMDV 2B
protein was carried out using various methods, including
DAS
(http://www.sbc.su.se/*miklos/DAS),
PHDtm
(http://www.predictprotein.org/), TMHMM (http://www.
cbs.dtu.dk/services/TMHMM), and TMpred (http://www.
ch.embnet.org/software/TMPRED_form.htm).
Estimation of the cutoff value and other assay parameters were performed by receiver operating characteristic
(ROC) curve analysis using XLstat software (Addinsoft,
http://www.xlstat.com/en/home/).

Results
Cloning, expression, purification and immunoreactivity of
MBP-D2B protein
Even after cloning the full-length 2B gene in various
expression vectors (pMAL-c5X, pQE30Xa, pET-45, pET28) and transformation of different E. coli host cells, it

123

30

60

90

120

150

180

210

Minutes post induction

Fig. 1 Cytotoxic activity of FMDV 2B protein in E. coli. The optical

density at 600 nm of uninduced (diamonds), full-length 2B (squares)
and D2B-expressing cultures (triangles) was determined at 30-minute
intervals for 3.5 hours. The optical density of E. coli culture medium
containing the full-length 2B protein was found to decrease significantly after induction

was not possible to express the recombinant 2B NSP (data

not shown). Interestingly, the O.D of E. coli culture
medium containing the expression vector (pMAL-2B) was
found to drop significantly after induction (Fig. 1). However, D2B protein lacking its transmembrane domain
(amino acid residues 114-137) could be cloned and
expressed successfully, mostly in soluble form. SDSPAGE analysis revealed a protein band of approximately
60 kDa (Fig. 2), which corresponds to the calculated
molecular weight of MBP-D2B NSP. The immunoreactivity of recombinant MBP-D2B was confirmed by western blotting with an MBP-tag-specific monoclonal
antibody (Fig. 3a). Further, D2B protein readily reacted
with 28 dpi bovine serum in western blot, whereas no
visible reactivity was observed with nave serum (Fig. 3b
and c). The purified recombinant D2B protein also showed
differential immunoreactivity in I-ELISA with serum
samples (n = 5) collected from experimentally infected
calves and serum samples (n = 5) collected from nave
calves, confirming the suitability of recombinant D2B
protein as an ELISA antigen.
Development of recombinant D2B I-ELISA
For the standardisation of the I-ELISA protocol, the optimum concentration of recombinant antigen and test serum
dilutions were fixed after conducting a checkerboard
titration. The serum dilution was selected to attain an
acceptable signal-to-noise ratio at the minimum concentration of recombinant antigen. The optimal coating antigen concentration and serum dilution were finalized at
0.350 lg per well of the ELISA plate and 1:15,

ELISA for detection of antibodies against FMDV 2B protein

Fig. 2 SDS-PAGE profile of
expressed D2B protein. Lane M,
protein marker (NEB); lane 1,
uninduced JM109 E. coli lysate;
lane 2, IPTG-induced purified
D2B protein; lane 3, IPTGinduced purified MBP

76 kDa

Induced 2B protein (~60 kDa)

52 kDa

38 kDa

31 kDa

24 kDa

c
3

76kDa

55kDa

76kDa

55kDa
38kDa
38kDa
31kDa

31kDa

24kDa
24kDa
17kDa
17kDa
12kDa

Fig. 3 Western blot analysis of expressed D2B protein to determine its reactivity with (a) anti-MBP monoclonal antibody, (b) FMD-infected
serum and (c) nave serum. Lane M, protein marker; lane 1, uninduced E. coli lysate; lane 2, purified MBP; lane 3, purified D2B protein

respectively (Fig. 4). To ensure the validity of the assay,

the following criteria were chosen:
(i) The corrected mean absorbance of the positive control should be between 1.0 to 1.4.
(ii) The PP values of the negative and conjugate control
should not exceed 20 % and 10 %, respectively

Determination of the cutoff value, diagnostic

specificity, and sensitivity of recombinant D2B
I-ELISA
Normalised PP values of serum samples (n = 2091), consisting of samples from known nave (n = 196), uninfected

123

J. K. Biswal et al.

serum samples collected at random from FMD-CP areas

with no history of an FMD outbreak for the last five years
where animals underwent intensive biannual vaccination,
the 2B antibody seroconversion rate was 6.08 % (19 out of
312 animals). In addition, in serum samples collected from
various vaccine potency experiments at 21 dpv, only 2 out
of the 60 primo-vaccinated animals (3.34 %) were found
positive in D2B I-ELISA.

4
3.5

Optimal 2B antigen
concentration and serum dilution

O.D. @492nm

3
2.5

P 1:5

P1:10
P1:15

1.5

P1:20

P1:30

Postinfection kinetics of 2B antibody response

0.5
0
22.4

11.2

5.6

2.8

1.4

0.7

0.35 0.175 0.087

Recombinant 2B antigen in g/well

Fig. 4 Checkerboard titration to optimise D2B protein concentration

and serum dilution. Twofold dilutions of positive control serum
indicated by different markers are shown at one side of the plot

vaccinated (n = 516), and infected (n = 1379) animals,

were used for the determination of the cutoff value of D2B
I-ELISA by ROC and TG-ROC analysis (Fig. 5a and b). At
a cutoff value of 50 PP, a diagnostic specificity of 94.6 %
(95 % confidence interval, 93.496.6) and a diagnostic
sensitivity of 95.3 % (95 % confidence interval, 90.996.9)
were achieved. A detailed analysis of assay parameters at
different cutoff values is shown in Table 2.
Antibody response to 2B protein in vaccinated animals
In an FMD-free dairy cattle herd that had undergone regular biannual vaccination, an antibody response to the 2B
protein was detected in 15 out of 72 serum samples
(20.83 %) at 28 dpv. However, this antibody response was
of low titre and waned to 5.5 % (4 out of 72) at 180 dpv. In

AUC=0.973

Performance of D2B I-ELISA as compared to 3AB3

I-ELISA
The in-house r3AB3 I-ELISA has been used extensively
throughout the country for differentiation of the FMDVinfected from the vaccinated bovine population for the last
four years [3]. Therefore, it was necessary to compare the
newly developed D2B I-ELISA with that of the r3AB3
I-ELISA. For making this comparison, serum samples were
selected arbitrarily, representing various epidemiological
situations. The highest level of concordance was observed

0.9

0.9

0.8

0.8

Sensitivity / Specificity

True positive rate (Sensitivity)

The postinfection kinetics of the 2B antibody response was

studied using four sets of serum samples collected
sequentially from four bull calves following experimental
infection. By 10 dpi, all four calves had seroconverted
against D2B NSP (Fig. 6). However, the duration of persistence of the 2B antibody response varied widely among
the infected calves. Consistent positivity was observed
until 306 to 900 dpi in the individual calves, followed by a
pattern of intermittent positivity varying from 530 to 1000
dpi (Fig. 6).

0.7
0.6
0.5
0.4
0.3
0.2

Sensitivity

Specificity

0.7
0.6
0.5
0.4
0.3
0.2
0.1

0.1

0
0

0.2

0.4

0.6

0.8

False negative rate (1 - Specificity)

Fig. 5 ROC and TG-ROC analysis for determination of the cutoff

value of the D2B I-ELISA. (a) Sensitivity over 1 and specificity at
different cutoff values. Each point on the ROC plot represents a pair

123

100

200

300

400

500

PP values

of sensitivity and specificity values for a particular cutoff value.

(b) Curves of the relative sensitivity and specificity of D2B I-ELISA
produced by TG-ROC analysis

ELISA for detection of antibodies against FMDV 2B protein

Table 2 Diagnostic sensitivity and diagnostic specificity of the recombinant D2B I-ELISA at different cutoff points as determined by ROC
analysis. The cutoff points are given as percentage of positivity. The selected cutoff point (50 PP) is highlighted
Cutoff values

Sensitivity

95 % confidence interval

Specificity

Lower limit

Upper limit

95 % confidence interval
Lower limit

Upper limit

LR?

LR-

10.0

1.000

0.993

1.000

0.054

0.031

0.091

1.057

0.000

20.0

0.999

0.991

1.000

0.286

0.233

0.347

1.399

0.005

30.0
40.1

0.997
0.983

0.989
0.970

1.000
0.991

0.564
0.788

0.501
0.732

0.625
0.835

2.289
4.646

0.005
0.021

50.0

0.953

0.934

0.966

0.946

0.909

0.969

17.658

0.050

60.0

0.771

0.739

0.800

0.967

0.934

0.984

23.225

0.237

70.1

0.589

0.553

0.625

0.975

0.945

0.990

23.674

0.421

80.2

0.453

0.416

0.489

0.988

0.962

0.997

36.352

0.554

90.1

0.370

0.336

0.406

0.992

0.968

1.000

44.598

0.635

100.2

0.306

0.273

0.341

0.992

0.968

1.000

36.857

0.700

LR? Likelihood-ratio for a positive test result; LR- Likelihood-ratio for a negative test result

Fig. 6 Postinfection kinetics of

the anti-2B antibody response in
experimentally infected calves.
The infection status of each calf
is indicated

160
Type A intradermolingual infection
140

Type A contact infection

Type Asia 1 intradermolingual infection

120

Type Asia 1 contact infection

PP value

100

80

60

40

20

0
12

28

37

51

64

78

94 106 121 135 149 163 171 191 219 304 389 451 524 555 604 755 816 878 939 998

Days post infection

for nave serum samples (98.4 %), while the lowest level of
concordance was observed for serum samples collected at
random (84.48 %). The overall concordance between these
two I-ELISAs was found to be 86.49 % (Table 3).

Discussion
NSP ELISAs have become an essential part of the vaccination-based control and serosurveillance policy in many
FMD-endemic countries. Furthermore, non-endemic
countries are seriously debating in favour of vaccinating
animals in order to obviate the need for stamping out
susceptible in-contact animals under a vaccinate-to-live
policy [2]. In India, vaccination-based FMD-CP was
launched in 2003-04 with the aim of creating disease-free

zones. In this context, it is imperative to have information

on the level of FMDV exposure in domesticated large
ruminants irrespective of vaccination status. For this purpose, national FMD serosurveillance is being carried out in
India by determining seroconversion against 3AB3 NSP
using an in-house r3AB3 I-ELISA [19]. However, as per
the suggestions made at an international NSP test validation workshop at Brescia, Italy, there is a need to use more
than one NSP assay to increase the efficiency of detection
[22]. Further, when the epidemiological picture does not
correlate with the screening test results, in particular
because of vaccinal NSP response, it is important to
establish the reliability of the screening test results through
the profiling of multiple NSP antibodies in the serum
samples [20]. Therefore, the availability of a locally produced efficient diagnostic assay making use of an NSP

123

J. K. Biswal et al.
Table 3 Comparison of the performance of 2B I-ELISA with that of r3AB3 I-ELISA
Sera

Total number tested

r2BL ELISA

3AB3 ELISA (no. concordance)

Positive

Positive

Negative

Concordance rate

Negative

Unvaccinated nave samples

130

128

130 (128)

98.4 % (128/130)

Vaccinated uninfected samples

240

18

222

15 (12)

225 (213)

93.75 % (225/240)

Samples from field outbreak

500

465

35

482 (440)

18 (10)

90.0 % (450/500)

2500

730

1770

605 (515)

1895 (1597)

84.48 % (2112/2500)

Random samples

other than 3AB3 could be a suitable alternative to the

expensive kits available commercially.
In that respect, an attempt was initially made to express
the full-length 2B protein in prokaryotic cells. However, it
was not possible to express the full-length 2B NSP. Interestingly, the optical density of the E. coli cells containing
the prokaryotic expression vector pMAL-2B started to
decline following induction with IPTG, which might be
attributed to the cytotoxicity of the heterologous recombinant protein to E. coli. Similar observations have been
reported for the expression of the 2B protein of poliovirus
in prokaryotic cells [15], which were attributed to viroporin-mediated permeabilization of the cell membrane [1,
17]. Owing to the cytotoxic nature of the FMDV 2B protein
to E. coli cells, the 2B NSP of FMD virus may be considered as a putative viroporin. However, further experimental analysis needs to be conducted in order to confirm
the viroporin activity of FMDV 2B. A typical feature
exhibited by viroporins is the presence of at least one
transmembrane sequence. In the present study, a transmembrane domain was predicted between amino acid
residues 114 and 137. It was decided to express the 2B
region lacking the transmembrane domain. D2B could be
expressed successfully as a recombinant MBP-tagged
protein of *60 kDa (43 kDa from MBP and 16 kDa from
2B) in soluble form. In a western blot assay, the recombinant D2B demonstrated differential reactivity with FMD
convalescent and nave serum.
While developing and validating the MBP tagged
recombinant D2B I-ELISA, attention was paid to reducing
the nonspecific reactivity of the serum antibodies with the
large MBP tag by pre-adsorbing the serum samples with
the purified MBP protein, as described by others [13, 26].
However, the possibility of residual anti-MBP antibodies
leading to some nonspecific reaction, as evidenced by the
false-positive reactions with nave and vaccinated uninfected serum samples, cannot be ruled out completely. In
serum samples from multiply vaccinated, uninfected animals, the 2B-antibody response declined from 20.83 % (at
28 dpv) to 5.5 % (at 180 dpv). Further, 6.08 % false positivity was observed in serum samples collected from
FMDCP areas where there had been no reported outbreaks
or cases for five years. This response could be explained

123

either by nonspecific binding or by the residual anti-NSP

response from unreported past infections.
At the fixed cutoff value of 50 PP, a sensitivity of
95.3 % and specificity of 94.3 % were determined for the
D2B I-ELISA. Also, preliminary precision studies based on
PP values from intra-plate, inter-plate and inter-day replicates showed the CV values to be within the acceptable
limits, in support of the repeatability of the optimised assay
(Table 1). The diagnostic sensitivity and diagnostic specificity of indirect r3AB3 I-ELISA for bovines were found to
be 96 % and 96.4 %, respectively [19]. As the performance
of the recently developed recombinant D2B I-ELISA is
comparable to that of the r3AB3 I-ELISA, the D2B assay
has the potential to be used as either a screening or confirmatory assay in conjunction with the r3AB3 I-ELISA.
Further, it is also preferable to have the second test, which
uses a different NSP, than the first test to confirm the
presence of infection. This was shown in a study [23] in
which, to confirm the FMD infection in sheep, a 2B-peptide-based indirect ELISA was used to confirm the result of
the PrioCHECK-NSP assay. During the current analysis, a
good overall concordance was observed between the 3AB3
and D2B I-ELISAs. Considering that there are no assays
with absolute sensitivity and specificity, no surveillance
plan can provide an absolute guarantee of freedom from
infection. Therefore, serosurveillance should be seen as a
part of a package of risk-mitigation measures that will
include movement restriction, epidemiological tracing, and
clinical surveillance [22].
The earliest possible detection of FMD post-exposure by
anti-NSP antibody assay is of paramount importance for
adopting control measures. However, there has been variation in the time at which early detection of antibodies
against various NSPs is possible [25]. Although the precise
time of onset of 2B antibodies could not be deduced in this
study, seroconversion to 2B protein was evident at 10 dpi
in the serum samples collected from four experimentally
infected calves. While studying the post-infection kinetics
of 2B antibodies in serum samples collected from four
experimentally infected calves, a variation in the persistence of 2B antibodies was observed. This variation in
antibody response could be attributed to a difference in the
route of infection or load of virus challenge. Although the

ELISA for detection of antibodies against FMDV 2B protein

relationship between the persistence of 2B antibody and

identification of known FMD carrier animals was not
determined in the current study, from earlier findings of
others [10, 21] it can be proposed that recombinant-D2BNSP-based I-ELISA could be used for the identification of
persistently infected animals.
Testing of random bovine serum samples collected from
different parts of the country in D2B I-ELISA suggested an
overall seroconversion rate of 29.2 %. The apparent prevalence of 2B NSP antibody estimated in the current work is
similar to that against 3AB3 NSP (26.41 %), which was
determined under the national FMD serosurveillance programme [3]. As the amino acid sequence of the 2B NSP
region is known to be highly conserved among the different
serotypes of FMDV [6], the recombinant 2B protein assay
is expected to detect infection-specific antibodies against
all seven serotypes of FMDV. At the same time, it should
be emphasised that there is a significant difference between
the 2B protein sequences of members of various genera of
the family Picornaviridae [18]. Therefore, it could be
presumed that there may be less chance of cross-reaction of
FMDV 2B protein with antibodies against other related
picornaviruses that cause clinically indistinguishable
vesicular diseases in cattle. Although analytical specificity
is an important parameter for any newly developed assay
system, it could not be determined for D2B I-ELISA due to
the unavailability of known serum samples derived from
other clinically similar diseases because most of these
diseases are exotic to India at present.
In conclusion, an I-ELISA based on recombinant D2B
NSP, which has been developed for the first time, could be
used for the serological detection of FMDV circulation. A
situation of controlled FMD incidence due to extensive
vaccination is expected in India after a few years of successful FMD-CP. In that case, the use of more than one NSP
ELISA would be helpful in increasing the efficiency of
detection of infection. It would also be useful to evaluate the
D2B NSP I-ELISA using serum samples from FMD-vaccinated and/or infected small ruminants and pigs in the future.
Acknowledgement This work was supported by Indian Council of
Agricultural Research under the project IXX08487. The assistance of
Mr. N. S. Singh in sorting the serum samples is appreciated.

References
1. Agirre A, Barco A, Carrasco L, Nieva JL (2002) Viroporinmediated membrane permeabilization. Pore formation by nonstructural poliovirus 2B protein. J Biol Chem 277:4043440441
2. Anonymous (2003) Council Directive 2003/85/EC on Community measures for the control of foot-and-mouth disease repealing
Directive 85/511/EEC and Decisions 89/531/EEC and 96/665/
EEC and amending Directive 92/46/EEC. Off J Eur Union L
306:46

3. Anonymous (2012) PD-FMD annual report, 201112. In: Project

Directorate on foot and mouth disease, Mukteswar
4. Berger HG, Straub OC, Ahl R, Tesar M, Marquardt O (1990)
Identification of foot-and-mouth disease virus replication in
vaccinated cattle by antibodies to non-structural virus proteins.
Vaccine 8:213216
5. Brocchi E, Bergmann IE, Dekker A, Paton DJ, Sammin DJ,
Greiner M, Grazioli S, De Simone F, Yadin H, Haas B, Bulut N,
Malirat V, Neitzert E, Goris N, Parida S, Sorensen K, De Clercq
K (2006) Comparative evaluation of six ELISAs for the detection
of antibodies to the non-structural proteins of foot-and-mouth
disease virus. Vaccine 24:69666979
6. Carrillo C, Tulman ER, Delhon G, Lu Z, Carreno A, Vagnozzi A,
Kutish GF, Rock DL (2005) Comparative genomics of foot-andmouth disease virus. J Virol 79:64876504
7. Clavijo A, Wright P, Kitching P (2004) Developments in diagnostic techniques for differentiating infection from vaccination in
foot-and-mouth disease. Vet J 167:922
8. Hema M, Nagendrakumar SB, Yamini R, Chandran D, Rajendra
L, Thiagarajan D, Parida S, Paton DJ, Srinivasan VA (2007)
Chimeric tymovirus-like particles displaying foot-and-mouth
disease virus non-structural protein epitopes and its use for
detection of FMDV-NSP antibodies. Vaccine 25:47844794
9. Hohlich BJ, Wiesmuller KH, Schlapp T, Haas B, Pfaff E, Saalmuller A (2003) Identification of foot-and-mouth disease virusspecific linear B-cell epitopes to differentiate between infected
and vaccinated cattle. J Virol 77:86338639
10. Inoue T, Parida S, Paton DJ, Linchongsubongkoch W, Mackay D,
Oh Y, Aunpomma D, Gubbins S, Saeki T (2006) Development
and evaluation of an indirect enzyme-linked immunosorbent
assay for detection of foot-and-mouth disease virus nonstructural
protein antibody using a chemically synthesized 2B peptide as
antigen. J Vet Diagn Investig Off Publ Am Assoc Vet Lab Diagn
Inc 18:545552
11. Jaworski JP, Compaired D, Trotta M, Perez M, Trono K, Fondevila N (2011) Validation of an r3AB1-FMDV-NSP ELISA to
distinguish between cattle infected and vaccinated with foot-andmouth disease virus. J Virol Methods 178:191200
12. Kitching RP (2002) Identification of foot and mouth disease virus
carrier and subclinically infected animals and differentiation from
vaccinated animals. Revue Scientifique et Technique 21:531538
13. Knowles D, Torioni de Echaide S, Palmer G, McGuire T, Stiller
D, McElwain T (1996) Antibody against an anaplasma marginale
MSP5 epitope common to tick and erythrocyte stages identifies
persistently infected cattle. J Clin Microbiol 34:22252230
14. Laemmli UK (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227:680685
15. Lama J, Carrasco L (1992) Expression of poliovirus nonstructural
proteins in Escherichia coli cells. Modification of membrane
permeability induced by 2B and 3A. J Biol Chem 267:
1593215937
16. Ma LN, Zhang J, Chen HT, Zhou JH, Ding YZ, Liu YS (2011)
An overview on ELISA techniques for FMD. Virol J 8:419
17. Madan V, Sanchez-Martinez S, Vedovato N, Rispoli G, Carrasco
L, Nieva JL (2007) Plasma membrane-porating domain in
poliovirus 2B protein. A short peptide mimics viroporin activity.
J Mol Biol 374:951964
18. Moffat K, Howell G, Knox C, Belsham GJ, Monaghan P, Ryan
MD, Wileman T (2005) Effects of foot-and-mouth disease virus
nonstructural proteins on the structure and function of the early
secretory pathway: 2BC but not 3A blocks endoplasmic reticulum-to-Golgi transport. J Virol 79:43824395
19. Mohapatra JK, Pandey LK, Sanyal A, Pattnaik B (2011)
Recombinant non-structural polyprotein 3AB-based serodiagnostic strategy for FMD surveillance in bovines irrespective of
vaccination. J Virol Methods 177:184192

123

J. K. Biswal et al.
20. OIE (2004) Foot and mouth disease. In: OIE Standards Commission (ed). Manual of standards for diagnostic tests and vaccines, Office International des Epizooties (chapter 2.1.1), 5th edn.
Paris, France
21. Parida S, Cox SJ, Reid SM, Hamblin P, Barnett PV, Inoue T,
Anderson J, Paton DJ (2005) The application of new techniques
to the improved detection of persistently infected cattle after
vaccination and contact exposure to foot-and-mouth disease.
Vaccine 23:51865195
22. Paton DJ, de Clercq K, Greiner M, Dekker A, Brocchi E, Bergmann I, Sammin DJ, Gubbins S, Parida S (2006) Application of
non-structural protein antibody tests in substantiating freedom
from foot-and-mouth disease virus infection after emergency
vaccination of cattle. Vaccine 24:65036512
23. Paton DJ, Ferris NP, Hutchings GH, Li Y, Swabey K, Keel P,
Hamblin P, King DP, Reid SM, Ebert K, Parida S, Savva S,
Georgiou K, Kakoyiannis C (2009) Investigations into the cause
of foot-and-mouth disease virus seropositive small ruminants in
Cyprus during 2007. Transboundary Emerg Dis 56:321328

123

24. Perkins J, Clavijo A, Hindson BJ, Lenhoff RJ, McBride MT

(2006) Multiplexed detection of antibodies to nonstructural proteins of foot-and-mouth disease virus. Anal Chem 78:54625468
25. Sorensen KJ, Madsen KG, Madsen ES, Salt JS, Nqindi J, Mackay
DK (1998) Differentiation of infection from vaccination in footand-mouth disease by the detection of antibodies to the nonstructural proteins 3D, 3AB and 3ABC in ELISA using antigens
expressed in baculovirus. Arch Virol 143:14611476
26. Torioni de Echaide S, Knowles DP, McGuire TC, Palmer GH,
Suarez CE, McElwain TF (1998) Detection of cattle naturally
infected with Anaplasma marginale in a region of endemicity by
nested PCR and a competitive enzyme-linked immunosorbent
assay using recombinant major surface protein 5. J Clin Microbiol 36:777782
27. Urban A, Neukirchen S, Jaeger KE (1997) A rapid and efficient
method for site-directed mutagenesis using one-step overlap
extension PCR. Nucl Acids Res 25:22272228