Você está na página 1de 136

UNIVERSIDADE FEDERAL FLUMINENSE

CENTRO DE CINCIAS MDICAS


FACULDADE DE VETERINRIA
PS-GRADUAO EM MEDICINA VETERINRIA CLNICA E REPRODUO
ANIMAL

CARACTERIZAO MOLECULAR DOS PARVOVRUS ASSOCIADOS AOS


CASOS DE GASTRENTERITE EM FILHOTES DE CES E GATOS NO ESTADO
DO RIO DE JANEIRO

TATIANA XAVIER DE CASTRO

Orientadoras:
Norma Vollmer Labarthe
Rita de Cssia N.C.Garcia

Niteri
2010

TATIANA XAVIER DE CASTRO

CARACTERIZAO MOLECULAR DOS PARVOVRUS ASSOCIADOS AOS


CASOS DE GASTRENTERITE EM FILHOTES DE CES E GATOS NO ESTADO
DO RIO DE JANEIRO

Tese apresentada ao Curso de PsGraduao em Medicina Veterinria da


Universidade Federal Fluminense, como
requisito para a obteno do Grau de Doutor.
rea de Concentrao: Cirurgia e Clnica
Mdica Veterinria, Sub- rea: Clnica
Veterinria.

Orientadoras:
Norma Vollmer Labarthe
Rita de Cssia N.C.Garcia

Niteri
2010
III

TATIANA XAVIER DE CASTRO


CARACTERIZAO MOLECULAR DOS PARVOVRUS ASSOCIADOS AOS CASOS DE
GASTRENTERITE EM FILHOTES DE CES E GATOS NO ESTADO DO RIO DE JANEIRO
Tese apresentada ao Curso de Ps-Graduao
em Medicina Veterinria da Universidade
Federal Fluminense, como requisito para a
obteno do Grau de Doutor. rea de
Concentrao: Cirurgia e Clnica Mdica
Veterinria, Sub- rea: Clnica Veterinria.

BANCA EXAMINADORA

Dr Norma Vollmer Labarthe (UFF) Orientadora

Dra Rita de Cssia Nasser Cubel Garcia (UFF) Orientadora

Dr. Aloysio de Mello F. Cerqueira (UFF)

Dr. Marcelo de Lima (UFF)

Dr. Jos Paulo Gagliardi Leite (FIOCRUZ)

Dr. Jonimar Pereira Paiva (Universidade Castelo Branco)

Dra Flavya Mendes-de-Almeida (UFF - Suplente Interna)

Dr. Eduardo de Mello Voloto (FIOCRUZ - Suplente Externo)

Niteri
2010

UNIVERSIDADE FEDERAL FLUMINENSE


PR-REITORIA DE PESQUISA E PS-GRADUAO PROPP

Este trabalho foi realizado no Departamento de Microbiologia e Parasitologia do Instituto Biomdico


UFF, em cooperao com o Laboratrio de Virologia Comparada e Ambiental, Instituto Oswaldo Cruz
(IOC) por Tatiana Xavier de Castro, sob orientao da Dra. Norma Vollmer Labarthe e Dra.Rita de
Cssia Nasser Cubel Garcia.

C355

Castro, Tatiana Xavier de


Caracterizao molecular dos parvovrus
associados aos casos de gastrenterite em
filhotes de ces e gatos no Estado do Rio de
Janeiro/ Tatiana Xavier de Castro; orientadora
Norma Vollmer Labarthe. 2010.

124 f.
Dissertao (Mestrado em Cirurgia e Clnica
Mdica
Veterinria)Universidade
Federal
Fluminense,2010.
Orientadora: Norma Vollmer Labarthe
1.Parvovrus
canino.
2.Gastroenterite
3.Diagnstico. 4. Vrus da panleucopenia felina.
I. Ttulo.

CDD 636.08960194

Aos meus pais e irm, pelo apoio incondicional


durante esta etapa da minha vida.

VI

AGRADECIMENTOS
A Deus pela fora de superar todos os obstculos e continuar sempre buscando
meus objetivos.
minha famlia por todo o amor, carinho e compreenso ao longo desta etapa da
minha vida.
Profa Dra Rita de Cssia Nasser Cubel Garcia pelo apoio e presena marcante
nestes 11 anos de convivncia.
Dra Norma Labarthe pelo apoio e orientao no somente neste projeto, mas ao
longo de todo o meu desenvolvimento profissional.
Ao Dr. Jos Paulo Gagliardi Leite pela oportunidade oferecida de desenvolver a
etapa determinante deste projeto no Instituto Oswaldo Cruz.
Aos colegas do laboratrio de Virologia da Universidade Federal Fluminense por
todos os bons momentos compartilhados no laboratrio.
Aos colegas do laboratrio de Virologia Comparada e Ambiental do Instituto Oswaldo
Cruz pela pacincia e boa vontade em transmitir os ensinamentos que
permitiram a realizao deste projeto.
todos os mdicos veterinrios que gentilmente nos enviaram amostras fecais de
casos de gastrenterite, possibilitando a realizao deste estudo.
Ao Curso de Ps-Graduao em Cirurgia e Clnica Mdica Veterinria da Faculdade
de Medicina Veterinria, por esta oportunidade de crescimento profissional e
pessoal.
Coordenao de Aperfeioamento de Pessoal de Nvel Superior (CAPES), ao
Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq) e
Fundao de Amparo Pesquisa do Estado do Rio de Janeiro (FAPERJ)
pelo auxlio financeiro durante a elaborao do projeto.

VII

Ora Lege Lege Lege Relege Labora et


Invenies".
"Reza, l, l, l, rel, trabalha e
encontrars"
Gaston Bachelard, livro mudo da
alquimia, 1677.

VIII

SUMRIO

DEDICATRIA, f. VI
AGRADECIMENTOS f. VII
EPGRAFE f.VIII
SUMRIO, f. XI
LISTA DE FIGURAS, f. XII
LISTA DE QUADROS, f. XIII
LISTA DE TABELAS, f. XIV
LISTA DE APNDICE, f. XV
LISTA DE ANEXOS, f.XVI
RESUMO, f. XVII
ABSTRACT, f. XIX
1 INTRODUO, f.20
2 HIPTESE, f. 24
3 OBJETIVOS, f.25
3.1- OBJETIVO GERAL, f.25
3.2- OBJETIVOS ESPECFICOS, f.25
4 REVISO DA LITERATURA, f.26
4.1. CLASSIFICAO, f.26
4.2 MORFOLOGIA

DO VRUS, f.26

4.3 REPLICAO DO VRUS, f.28


4.4 EVOLUO DO VRUS E SURGIMENTO DOS TIPOS ANTIGNICOS, f. 30
4.5 ANLISE DE HOMOLOGIA DE NT E AA DOS PARVOVRUS CANINOS(CPV) f.35

IX

4.6 TRANSMISSO, PATOGENIA E MANIFESTAES CLNICAS, f.40


4.7 IMUNIDADE E PROFILAXIA, f. 43
4.8- DIAGNSTICO LABORATORIAL f. 45
5-MATERIAL E MTODOS, f.49
5.1- AMOSTRAS CLNICAS, f.49
5.2- REAGENTES E SOLUES, f.50
5.2.1- TAMPO TRIS-CA++ 0,01M PH 7,2, f.50
5.2.2- TAMPO SALINA-BORATO (BABS) PH 9.0, f.50
5.2.3- TAMPO VAD PH 6.0, f.51
5.2.4- CAOLIM 25%, f.51
5.2.5- TAMPO L2 PH 6,4, f.51
5.2.6- TAMPO TRIS-HCL 0,1 M PH 6,4, f.52
5.2.7- TAMPO NAOH 10N, f.52
5.2.8- SLICA, f.52
5.2.9- ETANOL 70%, f.53
5.2.10- EDTA 0,5M PH 8,8, f.53
5.2.11- TAMPO TRIS-BORO-EDTA (TBE) 10 X PH 8,4, f.53
5.2.12- AGAROSE A 1,5%, f.54
5.2.13- SOLUO DE BROMETO DE ETDIO, f.54
5.2.14- TAMPO CORANTE AZUL DE BROMOFENOL , f.54

5.3- INICIADORES DE CADEIA UTILIZADOS NA PCR PARA CARACTERIZAO GENMICA,


F.55
5.4 - MTODOS, f.56
5.4.1- SUSPENSO FECAL A 10%, f.56

5.4.2 - REAO DE HEMAGLUTINAO E INIBIO DA HEMAGLUTINAO (HA/HI), f.56


5.4.3 - REAO EM CADEIA
CANINO.

PELA POLIMERASE

(PCR) PARA A DETECO DO GENOMA DO PARVOVRUS

f.57
5.4.3.1. - EXTRAO DO CIDO NUCLEICO. f.57
5.4.3.2- REAO EM CADEIA PELA POLIMERASE (PCR). f.58

5.4.4- SEQUENCIAMENTO

PARCIAL DO GENE QUE CODIFICA PARA A PROTENA DE CAPSDEO

VP2

DOS

PARVOVRUS CANINO E FELINO. f.59

5.4.5- ANLISE FILOGENTICA DAS AMOSTRAS DOS PARVOVRUS CANINO E FELINO. f.61
6- RESULTADOS. f.63
6.1- TRIAGEM DE AMOSTRAS CPV POSITIVAS PARA SEQUENCIAMENTO. f.63
6.2- CARACTERIZAO

DOS TIPOS DE

CPV

EM AMOSTRAS FECAIS DE CES NO VACINADOS COM

GASTRENTERITE, f.65

6.3- MONITORAMENTO

DOS TIPOS DE

PARVOVIRUS CANINO (CPV)

EM FILHOTES DE CES VACINADOS

COM GASTRENTERITE NO ESTADO DO RIO DE JANEIRO. f.70

6.4 -CARACTERIZAO

MOLECULAR DOS PARVOVRUS EM AMOSTRAS DE FELINOS DOMSTICOS NO

ESTADO DO RIO DE JANEIRO E COMPARAO COM OS TIPOS


7- DISCUSSO. f.81
8- CONCLUSES. f.89
9- OBRAS CITADAS. f.90
10- APNDICES. f.104
11-ANEXOS. f.108

XI

DE CPV DE AMOSTRAS CANINAS.

f.77

LISTA DE FIGURAS

Figura 1

Fotomicrografia eletrnica de partculas de parvovrus canino (CPV) em amostra fecal de um


co com gastrenterite (WILLI, 1998); B- Modelo da partcula viral; C- Modelo dinmico da
montagem do capsdeo icosadrico do CPV (www. people.brandeis.edu). f.27

Figura 2

Etapas da expresso gnica e replicao dos parvovrus autnomos (MORAES & COSTA,
2007). f.29

Figura 3

Organizao genmica e mapa de transcrio do parvovrus canino (REED; JONES;


MILLER, 1988) f.30

Figura 4

Representao do capsdeo viral com os AA que alteraram durante a evoluo do CPV.


Resduos que variaram entre FPV e CPV esto em azul, resduos que variaram entre CPV-2
e CPV-2a esto em verde e em amarelo os resduos que ainda continuam variando
(PARRISH & KAWAOKA, 2005). f.32

Figura 5

Anlise gentica e os hospedeiros do vrus da panleucopenia felina (FPLV) e parvovirus


canino (CPV) desde a sua origem no final da dcada de 70, at os dias atuais (HOELZER&
PARRISH, 2010). f.34

Figura 6

Relao filogentica entre os parvovrus de carnvoros, baseada no gene que codifica para
a protena de capsdeo VP2. FPLV (vrus da panleucopenia felina); BFPV (parvovrus da
raposa azul); RPV (parvovrus do racoon) (HOELZER& PARRISH, 2010). f.39

Figura 7

Fluxograma da patogenia da infeco pelo parvovrus canino (CPV) (MACARTNEY;


MCCANDLISH; THOMPSON, 1984; POLLOCK; COYNE, 1993; SMITH-CARR et al., 1997).
f.41

Figura 8

Localizao da seqncia dos iniciadores de cadeia utilizados neste estudo f.55

Figura 9

Fluxograma de deteco, caracterizao e anlise de homologia de nt e AA das amostras


de parvovrus canino e felino utilizadas neste estudo. f.43

Figura 10 Comparao entre as sequncias nucleotdicas dos isolados de CPV-2c detectados na


Amrica do Sul. Em destaque as mutaes pontuais detectadas nos diferentes isolados.
f.68
Figura 11 Dendograma construdo a partir da anlise de um fragmento (563 pb) do gene que codifica
para a protena de capsideo VP2 das amostras de CPV de ces no vacinados e amostras
de CPV no GenBank. A barra na parte inferior da figura proporcional distncia gentica.
f.69
Figura 12 Sequncias nucleotdicas da amostra caracterizada como CPV-2b selvagem (RJ901/08) e
amostra CPV-2b vacinal (vacina Duramune Max5) Em destaque a mutao pontual no nt

XII

4494, presente na cepa vacinal. f.74


Figura 13 Dendograma elaborado a partir das anlise de um fragmento (563 pb) do gene que codifica
para a protena de capsideo VP2 de 37 ces vacinados, quatro vacinas para CPV e
amostras padro e recombinantes de CPV obtidas no GenBank. A barra na parte inferior da
Figura proporcional distncia gentica. f. 76
Figura 14 Dendograma elaborado a partir das anlise de um fragmento (1171 pb) do gene que
codifica para a protena de capsideo VP2 das seis amostras felinas deste estudo junto com
as amostras caninas e isolados felinos e caninos obtidos no Genbank. Em destaque as
amostras caninas que apresentaram mutaes de AA importantes na determinao do
espectro de hospedeiro dos parvovirus. A barra na parte inferior da Figura proporcional
distncia gentica. f. 80

XIII

LISTA DE QUADROS

Quadro 1

Principais mutaes descritas no genoma do parvovrus canino (CPV) durante sua


evoluo (TRUYEN et al., 1998; BUONAVOGLIA et al., 2001; MOON et al., 2008;
HOELZER& PARRISH, 2010). f.38

Quadro 2

Descrio dos iniciadores utilizados na reao em cadeia pela polimerase (PCR) neste
estudo, com o tamanho em pares de base (pb) de seus respectivos produtos. f.56

XIV

LISTA DE TABELAS

Tabela 1

Distribuio das 69 amostras fecais caninas positivas por HA/HI e PCR analisadas neste
estudo conforme o sexo, faixa etria, raa, condio vacinal dos ces e tipo de CPV (CPV2a, 2b e 2c) caracterizado na amostra fecal. f.64

Tabela 2 Diferenas de nucleotdeos e aminocidos encontradas no produto amplificado de 563


bp de VP2 nas 32 amostras de parvovirus canino de ces no vacinados apresentando
gastrenterite e isolados obtidos no GenBank. f.66
Tabela 3 Idade e condio vacinal dos ces e tipo de parvovrus canino detectado nas 37
amostras fecais coletadas de ces vacinados no Rio de Janeiro no perodo de 19952009. f.70
Tabela 4 Caracterizao genmica dos parvovirus caninos detectados nas 37 amostras de ces
vacinados e nas quatro amostras de vacinas a partir da anlise da sequncia parcial do
gene que codifica para a protena de capsdeo VP2. f. 72
Tabela 5 Diferenas de nucleotdeos e aminocidos encontradas no fragmento de 1171 pb do
gene que codifica para a protena de capsdeo VP2 em seis amostras felinas e quatro
amostras caninas coletadas em 2004-2005. f. 78

15

LISTA DE APNDICES

Apndice 1

Ficha de identificao do animal. f. 105

Apndice 2

Tabela de aminocidos. f.106

Apndice 3

Aprovao do COMIT DE TICA EM PESQUISA ANIMAL (PR-REITORIA DE


PESQUISA E PS-GRADUAO), f. 107

16

LISTA DE ANEXOS

Anexo 1 Nmero de acesso do GenBank das amostras de parvovrus canino (CPV) e felino
(FPLV) caracterizadas neste estudo. f.109
Anexo 2 Distribuio cronolgica dos tipos de CPV no Brasil de 1980 a 2009. A tabela oi
formulada tendo como base o estudo atual e estudos anteriores (PEREIRA et al., 2007;
STRECK et al., 2009). A linha contnua indica predominncia do tipo. A linha tracejada
indica uma menor circulao do tipo. f.110
Anexo 3 Carta de aceite e trabalho submetido para publicao no peridico Brazilian Journal of
Mirobiology: Partial VP2 sequencing of canine parvovirus (CPV) strains circulating in
the State of Rio de Janeiro, Brazil: detection of the new variant CPV-2c. f.111
Anexo 4 Carta de aceite e trabalho submetido para publicao no peridico Research in
Veterinary Science: Monitoring of canine parvovirus (CPV) strains detected in
vaccinated puppies in Brazil.f. 118
Anexo 5 Carta de submisso e trabalho First Characterization of parvovirus strains from
domestic cats in Brazil. para publicao no peridico Journal of Veterinary Diagnostic
Investigation. f. 124

17

RESUMO

A infeco pelo Parvovrus Canino (CPV) a principal causa de gastrenterite viral


em filhotes de ces e novos tipos antignicos vem sendo descritos substituindo os
tipos antigos destes vrus. A circulao do CPV e do vrus da Panleucopenia
Felina (FPLV) em ces e gatos no Estado do Rio de Janeiro, bem como a
descrio de casos de gastrenterite em felinos associados aos novos tipo de CPV
torna necessria uma avaliao contnua das amostras de parvovrus (FPLV e
CPV) circulantes nestas espcies. Portanto, este trabalho teve como objetivo
realizar a caracterizao molecular dos parvovrus detectados em amostras fecais
de ces e gatos com at um ano de idade com gastrenterite no Estado do Rio de
Janeiro no perodo de 1995-2009. Aps confirmao laboratorial da infeco pelo
parvovrus por hemaglutinao/ inibio da hemaglutinao (HA/HI), 69 amostras
fecais de ces foram submetidas reao em cadeia pela polimerase (PCR) e
sequenciamento parcial do gene que codifica para a protena de capsdeo VP2
para caracterizao dos tipos de CPV. Seis amostras fecais de felinos domsticos,
tambm foram submetidas ao sequenciamento parcial da mesma regio para
caracterizao dos parvovrus associadas infeco nesta espcie. A anlise de
dois aminocidos (AA) 426 e 555 do CPV em 32 amostras fecais de ces no
vacinados coletadas no perodo de 1995-2009 demonstrou uma substituio do
tipo CPV-2a pelo tipo 2b e a primeira descrio do tipo CPV-2c na populao
canina no Rio de Janeiro. Para monitoramento dos tipos de CPV em 37 ces
vacinados, a anlise dos AA 297, 300, 305, 426 e 555 permitiu a caracterizao
dos tipos CPV-2a em 23 amostras e CPV-2b em 14 amostras. Mutaes
sinnimas foram detectadas nos AA 440 e 574. As mutaes detectadas nos tipos
estudados aparentemente no afetaram os AA relacionados a antigenicidade do
vrus e no parecem comprometer a capacidade global das vacinas em proteger
os filhotes contra os tipos em circulao. Os parvovrus detectados em seis
amostras felinas foram caracterizadas com FPLV por sequenciamento, porm a
deteco de mutaes no-sinnimas em resduos importantes para a
determinao do espectro de hospederio em duas amostras felinas e uma canina
indica que os CPV e FPLV esto sujeitos a importantes eventos evolutivos e
enfatizam a importncia do monitoramento contnuo e da caracterizao molecular
desse parvovrus de maneira a permitir a identificao de possveis mudanas
genticas e antignicas que possam interferir na eficcia das vacinas para CPV.
Estes resultados tambm reforam a idia de que somente o sequenciamento
oferece ampla informao sobre a caracterizao e anlise filogentica dos
parvovrus em circulao na populao canina e felina.
Palavraschave: Parvovrus Canino (CPV); Vrus da Panleucopenia felina
(FPLV); Gastrenterite; Caracterizao Molecular; Sinais clnicos.

18

ABSTRACT

Canine Parvovirus (CPV) infection is the major cause of viral enteritis in puppies
and new antigenic types have been described in substitution of the old types of
these viruses. The aim of this study was to realize the genomic analysis of CPV
strains in enteritis puppies in the State of Rio de Janeiro. The circulation of CPV
and FPLV in dogs and cats in Rio de Janeiro, and the description of cases of
enteritis in cats associated with the new types of CPV requires a continuous
evaluation of parvovirus (FPLV and CPV) circulating in these species. Therefore,
the aim of this study was to perform the molecular characterization of parvovirus
detected in fecal samples of dogs and cats up to one year of age with enteritis in
the State of Rio de Janeiro. After laboratory confirmation of CPV infection by
hemagglutination/ hemagglutination inhibition tests (HA/HI), 69 fecal samples from
dogs with one year of age were submitted to polymerase chain reaction (PCR) and
partial sequencing of the gene coding for VP2 capsid protein for characterization of
the types of CPV in clinical samples. Six fecal samples from domestic cats up to
six months old were also subjected to partial sequencing of the same region for
characterization of parvovirus infection associated with this species. The analysis
of two amino acids (AA) 426 and 555 of CPV in 32 fecal samples collected from
unvaccinated puppies collected during 1995-2009 showed a progressive
replacement of CPV type-2a by the 2b type and the first description of CPV-2c in
the canine population in Rio de Janeiro. In order to investigate CPV types in 37
puppies with parvoviral infection despite vaccination, the analysis of residues 297,
300, 305, 426 e 555 allowed the characterization of CPV-2a in 23 samples and
CPV-2b in another 14. Synonymous substitutions in the AA 440 and 574 were
detected. All CPV-2a showed a non-synonymous mutation in residue 297
(SerAla). The mutations detected in CPV strains collected from vaccinated
puppies apparently did not affect the amino acid residues related to antigenicity of
CPV, and did not compromise the overall ability of current vaccines in protect
puppies against the circulating types. The parvovirus strains detected in six cat
samples were confirmed by sequencing as FPLV but the detection of nonsynonymous mutations in feline and canine parvovirus strains indicate that CPV
and FPLV are subject to important evolutionary events and emphasize the
importance of continuous surveillance and genetic characterization of these
parvovirus in order to detect possible genetic and antigenic changes with potential
effect on CPV vaccine effectiveness. These results also reinforce that only
sequence analysis provides full information for characterization and phylogenetic
analysis of parvovirus circulating in dog and cat population.
Key-words: Canine Parvovirus (CPV); Feline Panleukopenia Virus (FPLV);
Enteritis; Molecular Characterization; Clinical Signs.

19

1- INTRODUO

Nos ltimos anos, a emergncia de novos vrus deixou de ser um tema


apenas do meio cientfico e acadmico e passou a ser discutido tambm pela
populao leiga mundial. Um dos mecanismos responsveis pelo aparecimento de
uma virose emergente resulta da capacidade de determinados vrus em ampliar
seu espectro de hospedeiros (transposio da barreira de espcie), adquirindo a
habilidade de se replicar e disseminar eficientemente em outras espcies de
hospedeiro (PARRISH& KAWAOKA, 2005).
Entre os vrus com genoma DNA de fita simples, os parvovrus de
carnvoros constituem-se em importante modelo para explicar como mltiplas
mudanas de aminocidos na protena de capsdeo podem contribuir para a
emergncia de um novo patgeno (PARRISH & KAWAOKA, 2005). O parvovrus
canino (CPV) um exemplo de sucesso na transposio da barreira de
hospedeiro (PARRISH & KAWAOKA, 2005; HOELZER; PARRISH, 2010), j que
considerado uma variante do vrus da panleucopenia felina (FPLV) que adquiriu a
capacidade de replicao em ces aps a passagem em um hospedeiro carnvoro
selvagem (HORIUCHI et al., 1998; TRUYEN et al., 1998; STEINEL et al., 2001;
IKEDA et al., 2002).
Desde 1920, o FPLV j era conhecido como agente de doena em gatos
domsticos (Felis catus) (VERGE; CHRISTOFORI, 1928). Aps o aparecimento
do CPV em 1978, a doena entrica associada a infeco pelo CPV em ces foi
considerada patologicamente semelhante a doena causadas pela vrus da
panleucopenia felina vrus (FPLV) em gatos e anticorpos policlonais e estudos de
in vivo proteo cruzada logo mostrou que o CPV e FPV estavam estreitamente
relacionados antigenicamente (PARRISH, 1999). Neste perodo, PARRISH et al.

20

(1985) observaram que as amostras de CPV que circularam nos Estados Unidos
da Amrica (EUA) entre 1978 a 1980 eram de um nico tipo, atualmente
denominadas de tipo antigo ou CPV-2. Um novo tipo, CPV-2a, rapidamente
substituiu o tipo antigo em circulao e passou a prevalecer na populao canina
logo aps 1980. A partir de 1984 um novo tipo CPV-2b surgiu (PARRISH, 1988;
PARRISH, 1995-a) e estes tipos 2a e 2b co-existiram em vrias populaes no
mundo em diferentes propores no sendo observada vantagem evolutiva de um
tipo em relao ao outro (STEINEL et al., 1998).
Em 2001, um terceiro tipo de CPV (CPV-2c) foi descrito na Itlia
(BUONAVOGLIA et al., 2001) e j existem relatos da circulao deste tipo na
populao canina em diferentes pases, incluindo na Amrica do Sul (DECARO et
al., 2006, 2007; HONG et al., 2007; MEERS et al., 2007; PREZ et al., 2007;
VIEIRA et al., 2008; CALDERON et al., 2009). Na Itlia, o tipo 2c est substituindo
o tipo 2b na populao canina e tal disseminao sugere que esse tipo apresenta
uma vantagem evolutiva, em comparao com os demais (DECARO et al., 2006b, 2007-a).
A manifestao clnica da infeco pelo CPV e a intensidade dos sinais
clnicos podem variar, mas a gravidade do quadro clnico (vmito, anorexia, apatia,
diarria hemorrgica lquida) faz com que o proprietrio do filhote procure o
atendimento de um mdico veterinrio (CASTRO et al., 2007, DESARIO et al.,
2005; MOON et al., 2007).
Os estudos que investigaram o potencial patognico do CPV-2c
apresentaram resultados discordantes. Enquanto os primeiros relatos sugeram
uma baixa patogenicidade, nos casos mais recentes tem-se observado sinais
clnicos mais graves (DECARO et al., 2006; KAPIL et al., 2008; DECARO et al.,
2009). Portanto, a circulao de novos tipos de CPV, bem como a descrio de
uma diversidade de sinais clnicos relacionados infeco pelos diferentes tipos
(CASTRO et al., 2007; MOON et al., 2007; PREZ et al., 2007), torna necessrio
no somente o diagnstico laboratorial da infeco por CPV, mas tambm o
estudo dos sinais clnicos associados a infeco pelos novos tipos.
Desde os primeiros surtos de enterite por CPV, houve uma evoluo gradual
na profilaxia da parvovirose canina, e atualmente vacinas de vrus vivo modificado
21

ou Modified Live Virus (MLV), constitudas de CPV-2 (tipo antigo) ou CPV-2b so


amplamente utilizadas em vrios pases, inclusive no Brasil. A deteco de CPV
em animais vacinados atravs das metodologias usadas na rotina como a reao
de hemaglutinao (HA) e o ensaio imunoenzimtico (EIA) um complicador no
diagnstico, pois

o vrus vacinal eliminado nas fezes de 3 a 9 dias ps

vacinao e pode ser detectado por estas tcnicas, que no distinguem o CPV
vacinal do selvagem (DECARO et al., 2006-a).
Alm disso, com a emergncia do novo tipo 2c em vrios pases, alguns
trabalhos sugerem que as vacinas disponveis no conferiam proteo infeco
por este tipo, uma vez que surtos de enterite em filhotes vacinados foram
associados presena do CPV-2c (DECARO et al., 2006-b, 2008-a). Portanto, o
monitoramento das amostras de CPV circulantes, principalmente naqueles casos
em que os animais apresentam enterite por CPV apesar da vacinao, essencial
para a avaliao da eficcia das vacinas frente ao desafio com os novos tipos do
vrus.
Estudos realizados aps 1996 tm demonstrado que vrios de surtos
panleucopenia felina no no foram associados ao FPLV e sim aos novos tipos de
CPV em circulao (CPV-2a 2b e 2c) (TRUYEN et al., 1996; NAKAMURA;
SAKAMOTO; IKEDA, 2001; GAMOH et al., 2003-b; DECARO et al., 2010). Estes
estudos sugerem que, embora o CPV-2 tenha perdido a capacidade de se replicar
em clulas de origem felina, os novos tipos de CPV voltaram a causar doena em
gatos domsticos, com sinais clnicos semelhantes aos causados pelo FPLV.
Entretanto, o potencial patognico do CPV nestes hospedeiros no est claro
(NAKAMURA; SAKAMOTO; IKEDA, 2001; GAMOH et al., 2003-b).
Em estudos conduzidos por um perodo de 15 anos (1995 a 2009), o CPV
foi associado a 32 a 55% dos casos de diarria em filhotes de ces com at 6
meses de idade no Estado do Rio de Janeiro (CASTRO et al., 2007; SILVA, 2010).
Da mesma forma, um estudo realizado em 2006 com 159 amostras fecais de
felinos domsticos confirmou a circulao do FPLV associado a casos de enterite
nesta mesma regio (MIRANDA, 2006).
A co-circulao do FPLV e CPV na populao canina e felina neste Estado,
bem como a recente descrio de casos graves de enterite em felinos domsticos
22

associados ao tipo novo CPV-2c na Itlia (DECARO et al., 2010) torna necessria
uma avaliao contnua das amostras de parvovrus (FPLV e CPV) circulantes na
populao felina para determinao do padro de evoluo destes parvovrus no
Rio de Janeiro e da sua importncia epidemiolgica.
Neste estudo os parvovrus detectados em amostras fecais coletadas de
filhotes de ces com enterite no perodo de 15 anos (1995-2009) e de gatos
domsticos foram caracterizados atravs do sequenciamento parcial da protena
de capsdeo VP2 evidenciando a circulao dos novos tipos CPV-2a e 2b e a
primeira descrio do novo tipo 2c na populao canina do Estado do Rio de
Janeiro.
As amostras obtidas de ces que apresentaram enterite por CPV apesar da
vacinao tambm foram caracterizadas em busca de alteraes no gene que
codifica para a protena VP2 que pudessem resultar em alteraes antignicas
capazes de interferir na eficcia das vacinas constitudas pelos tipo antigo (CPV2). Os tipos de CPV caracterizados nas amostras fecais de ces vacinados e no
vacinados foram relacionados aos sinais clnicos apresentados pelos ces,
buscando a associao entre o tipo de CPV e a gravidade do quadro clnico.
Seis amostras felinas coletadas em 2004 foram estudadas juntamente com
quatro amostras caninas coletadas no mesmo ano em busca de CPV associado a
infeco em gatos, bem como possveis mutaes nos parvovrus detectados em
felinos.

23

2- HIPTESE

As mudanas de nucleotdeos (nt) e aminocidos (AA) observadas na


protena de capsdeo VP2 do parvovrus canino (CPV) favorecem o surgimento de
novos tipos de CPV no Estado do Rio de Janeiro.
A ocorrncia de mutaes em AA importantes na deteminao do espectro
de hospedeiro no CPV faz com que o CPV readquira a capacidade de se replicar
em felinos.

24

3- OBJETIVOS

3.1- Objetivo Geral:


Realizar a caracterizao molecular dos parvovrus detectados em
amostras fecais de filhotes de ces e gatos (at um ano de idade)
portadores de gastrenterite no Estado do Rio de Janeiro.
3.2- Objetivos especficos:
Realizar o diagnstico laboratorial dos casos de gastrenterite associados ao
parvovrus canino.
Caracterizar atravs do sequenciamento parcial da protena de capsdeo
VP2, os tipos de parvovrus canino associados a casos de gastrenterite em
amostras fecais de filhotes de ces no Estado do Rio de Janeiro no perodo
de 1995 a 2009.
Caracterizar os tipos de parvovrus canino detectados em amostras fecais
de filhotes de ces vacinados apresentando sinais clnicos de gastrenterite
no Estado do Rio de Janeiro no mesmo perodo.
Realizar a caracterizao molecular das amostras de parvovrus detectadas
em felinos domsticos no Estado do Rio de Janeiro.

25

4- REVISO DA LITERATURA

4.1 Classificao
Os parvovrus patognicos de animais esto classificados na famlia
Parvoviridae, sub-famlia Parvovirinae, gnero Parvovirus, sendo que o vrus da
panleucopenia felina (FPLV), vrus da enterite do mink (MEV) e parvovrus canino
(CPV), juntamente com o parvovrus da raposa azul (blue fox parvovirus-BFPLV),
raccoon parvovirus (RPV) e raccoon dog parvovirus (RDPV) formam o Subgrupo
dos Parvovrus Felinos (VAN REGENMORTEL et al., 2000; MORAES & COSTA,
2007).
4.2 Morfologia do vrus
As partculas de CPV quando visualizadas pela microscopia eletrnica
(ME) so esfricas, no envelopadas, com dimetro variando de 18 a 26 nm e
capsdeo de simetria icosadrica (Figura 1). A massa molecular da partcula viral
completa de 5,0 a 6,2 X 10 6 daltons e a densidade do vrion em gradiente de
cloreto de csio de 1,39 a 1,42 g/cm3 (SIEGL , 1984).
O capsdeo constitudo pelas protenas VP1 (84 kDa) e VP2 (67 kDa),
sendo 5-6 cpias de VP1 e 5455 cpias de VP2. A VP1 muito semelhante
VP2, com a adio de 154 aminocidos na regio amino terminal. Nas partculas
infecciosas de CPV, a clivagem de 15-20 aminocidos na regio amino terminal de
VP2 gera a protena VP3 de 63 kDa (PARADISE; RHODE; SINGER, 1982; TSAO;
CHAPMAN;

AGBANDJE,

1991).

Esta

clivagem parece ser essencial

infectividade do vrus porque expe sequncias ricas em Glicina, importantes na


interao com a membrana celular (WU & ROSSMAN, 1993). A protena VP2
alm de ser o stio de ligao ao receptor, confere ao vrus a propriedade
26

hemaglutinante e contm os eptopos responsveis pela induo de anticorpos


neutralizantes (LOPEZ DE TURIZO et al., 1991).
O

genoma

viral

consiste

de

um

nico

filamento

de

cido

desoxiribonucleico (DNA), linear e de aproximadamente 5.150 nucleotdeos (nt),


contendo nas extremidades 3 e 5 sequncias palindrmicas de aproximadamente
150 nt (REED; JONES; MILLER,1988).

Figura 1. Fotomicrografia eletrnica de partculas de parvovrus canino


(CPV) em amostra fecal de um co com gastrenterite (WILLI, 1998); BModelo da partcula viral; C- Modelo dinmico da montagem do capsdeo
icosadrico do CPV (www. people.brandeis.edu).

Como consequncia de sua estrutura simples, os parvovrus so resistentes


inativao, sendo estveis a variaes de pH (3,0-9,0), a temperatura de 56oC/
60 minutos e ao tratamento com solventes orgnicos (SIEGL, 1984). GORDON &
ANGRICK (1986) demonstraram que o CPV pode manter-se infeccioso por at
cinco meses no ambiente. Os parvovrus so sensveis formalina (0,2%),
hipoclorito de sdio (1:30) e radiao ultravioleta (SIEGL, 1984).

27

4.3 Replicao viral

A infeco pelos CPV e FPLV est associada habilidade do capsdeo viral


adsorver-se ao receptor de transferrina (Tf), uma glicoprotena de superfcie
celular expressa na maioria das clulas do organismo, responsvel pelo transporte
de ferro para o interior da clula (HUEFFER& PARRISH, 2003; PARRISH &
KAWAOKA, 2005).
Em clulas com intensa atividade mittica tais como da cripta do epitlio
intestinal e do tecido hematopotico, estes receptores podem ser encontrados em
nveis elevados, representando os principais alvos do CPV e FPLV nos animais.
Aps a ligao destes vrus ao receptor de Tf ocorre a formao de um complexo
(vrus-receptor) que rapidamente transportado para um sistema endossomal no
interior da clula. Os tipos novos de CPV so capazes de se ligarem tanto ao
receptor de Tf canino como felino, enquanto o FPLV liga-se apenas a receptores
de Tf felinos. Por essa razo o FPLV no capaz de infectar ces e de se replicar
em cultura de clulas caninas (HUEFFER& PARRISH, 2003; PARRISH&
KAWAOKA, 2005).
O genoma dos parvovrus no codifica a enzima necessria para a etapa
inicial da replicao do DNA, a DNA polimerase, que responsvel pela sntese
da fita de DNA complementar ao DNA viral fita simples. Como a DNA polimerase
celular somente expressa durante a mitose, a primeira e crucial etapa da
replicao viral, portanto, requer a diviso celular (fase S tardia ou G2 do ciclo
mittico). Em animais jovens o tecido linfide e particularmente o epitlio do
intestino delgado apresentam intensa proliferao celular (STEINEL et al., 2001).
A replicao do genoma dos parvovrus ocorre no ncleo da clula
infectada, onde as sequncias palindrmicas terminais dobram sobre si mesmas,
formando uma estrutura semelhante a um grampo (hairpin), que atuam como
iniciadores para a DNA polimerase celular. Nestas regies de DNA de fita dupla
tem incio a replicao com a formao de uma fita complementar. A replicao
continua com a formao de intermedirios de dupla fita que, posteriormente, so
enzimaticamente clivados gerando DNA de fita simples. A fita negativa por

28

conveno, d origem a duas fitas positivas e duas fitas negativas (YOUNG, 1988)
(Figura 2).

Figura 2. Etapas da expresso gnica e replicao dos parvovrus


autnomos (MORAES; COSTA, 2007).

O genoma dos parvovrus canino e felino contm dois promotores (P4 e


P38), que dirigem a sntese das protenas no estruturais (NS1 e NS2) e
estruturais (VP1 e VP2), respectivamente (REED; JONES; MILLER, 1988). Dois
cidos ribonucleicos (RNAm) transcritos a partir da extremidade 3` do genoma
codificam a sntese das protenas NS1 e NS2, importantes para a replicao do
DNA viral. Dois outros RNAm transcritos a partir da extremidade 5 do genoma
dirigem a sntese das protenas estruturais. Estas protenas so codificadas por
sequncias de leitura aberta (ORF) que se sobrepem: nucleotdeo (nt) 2285-4786
para VP1 e nt 2786-4786 para VP2 (REED; JONES; MILLER, 1988; AGBANDJE;
PARRISH; ROSSMANN, 1995) (Figura 3).

29

P4
0

10

VP1 VP2

P38
20

30

40

50

60

70

80

90

100

5
mRNA

4.9Kb

NS-1
NS-2

3.3Kb

VP-1

3.0Kb

VP-2

3.0Kb

Figura 3. Organizao genmica e mapa de transcrio do parvovrus canino


(REED; JONES; MILLER, 1988)

A sntese das protenas estruturais ocorre no citoplasma da clula, porm


a montagem de novas partculas virais acontece no ncleo e a liberao por lise
celular. A replicao viral em cultura de clulas pode ser observada pela presena
de corpsculos de incluso intranucleares corados pelo mtodo de May Grunwald
Giemsa (APPEL; SCOTT; CARMICHAEL,1979).
Alguns aspectos do processo de replicao do vrus, incluindo a ausncia
de algumas subunidades da DNA polimerase da clula hospedeira, a rpida
replicao do genoma e a natureza fita simples do genoma viral resultam em
uma baixa fidelidade de replicao dos parvovrus caninos, facilitando o
aparecimento de mutaes (HOELZER; SHACKELTON; PARRISH, 2008;
HOELZER & PARRISH, 2010).

4.4- Evoluo do vrus e surgimento dos tipos antignicos

O CPV um exemplo de sucesso na transposio da barreira de hospedeiro


(PARRISH & KAWAOKA, 2005), j que considerado uma variante do FPLV
30

(HORIUCHI et al., 1998; TRUYEN et al., 1998; STEINEL et al., 2001; IKEDA et al.,
2002). O CPV e FPLV so geneticamente idnticos em 98% do seu genoma e
diferem em cerca de 8-10 aminocidos (PARRISH, 1988; 1990; 1995).
Durante os anos de 1978 e 1979, surtos de uma doena fatal em ces,
caracterizada por causar miocardite em animais entre 3 e 16 semanas de idade ou
gastrenterite hemorrgica em animais mais velhos, foram descritos na Amrica do
Norte, Europa e Austrlia. Os vrus isolados dos casos de miocardite neonatal
causaram gastrenterite em ces aps infeces experimentais, indicando que as
duas sndromes eram causadas pelo mesmo tipo de vrus (ROBINSON; WILCOX;
FLOWER,1980; PARRISH et al.,1995).

Em 1980, esta doena j tinha uma

distribuio mundial (SIEGL, 1984; APPEL & PARRISH, 1987).


Os sinais clnicos e patolgicos da gastrenterite em ces eram similares
aos observados na infeco pelo FPLV em gatos e do vrus da enterite do Vison
(Mink enteritis vrus ou MEV). Poucos meses aps a descrio da doena,
partculas semelhante aos parvovrus foram observadas por ME em amostras
fecais de ces com as formas miocrdica e entrica da doena, respectivamente.
Naquela poca, o novo vrus foi denominado parvovrus canino tipo 2 (CPV-2) a
fim de diferenci-lo do vrus mnimo do co (CPV-1), descrito anteriormente (BINN
et al., 1970).
A hiptese mais aceita que o CPV tenha surgido de uma mutao do
FPLV ou de outro parvovrus estritamente relacionado aps a passagem em um
hospedeiro carnvoro, tal como sub-espcies de Neovison vison (Schreber,1777),
(visons e doninhas), Alopex lagopus (Linnaeus, 1758) (raposas do rtico) ou
Vulpes lagopus (Huxley,1880) (raposas vermelha) (HORIUCHI et al., 1998;
TRUYEN et al., 1998; IKEDA et al., 2002).
No Brasil, os primeiros casos de gastrenterite hemorrgica foram
observados em So Paulo em 1979, mas a disseminao do vrus na populao
canina ocorreu a partir de 1980 (ANGELO et al., 1980; HAGIWARA et al., 1980).
Quanto as mudanas no espectro de hospedeiro de felinos para caninos,
mudanas nos AA nas posies 80 (LysArg), 93 (LysAsn), 103 (ValAla),
323 (AspAsn), 564 (AsnSer) e 568 (AlaGly) de VP2 conferiram ao CPV a
capacidade de se ligar ao receptor de Tf canino e com isso replicar e infectar
31

clulas caninas, mas o vrus perdeu a capacidade de infectar clulas felinas


(PARRISH et al., 1991; TRUYEN; PARRISH, 1992; CHANG; SGRO; PARRISH,
1992; AGBANDJE; PARRISH; ROSSMANN, 1995; HUEFFER; PARRISH, 2003;
PARRISH; KAWAOKA, 2005) (Figura 4).
Logo aps o aparecimento do CPV em 1978, PARRISH et al. (1985)
observaram que as amostras que circularam nos Estados Unidos da Amrica
(EUA) entre 1978 e 1980 eram de um nico tipo (denominadas de tipo antigo ou
CPV-2). Entretanto, as amostras obtidas aps 1980 podiam ser distinguidas das
anteriores pela reatividade com anticorpos monoclonais e diferenas no perfil
genmico aps digeridas com endonucleases de restrio. Este novo tipo (CPV2a) rapidamente substituiu o tipo antigo em circulao e passou a prevalecer na
populao canina (Figura 4).

Figura 4. Representao do capsdeo viral com os aminocidos (AA) que


alteraram durante a evoluo do do parvovrus canino (CPV). AA que
variaram entre o vrus da panleucopenia felina (FPLV) e CPV esto em azul,
AA que variaram entre CPV-2 e CPV-2a esto em verde e em amarelo os AA
que continuam variando (PARRISH& KAWAOKA, 2005)

32

A partir de 1984 um novo tipo surgiu (CPV-2b) (PARRISH, 1988; 1995).


Substituies nos AA 87 (MetLeu), 300 (GlyAla), 305 (TyrAsp) e 555
(ValIle) ocorreram na evoluo do parvovrus canino tipo antigo (CPV-2) para o
tipo novo (CPV-2a), e 426 (AsnAsp) e 555 (Ile Val) na emergncia do tipo 2b
a partir do 2a (TRUYEN, 1999).
Estes novos tipos (CPV-2a e CPV-2b) tem sido detectados em vrios
pases (PARRISH et al., 1995). A co-existncia destes tipos em vrias populaes
no mundo em diferentes propores mostra que no houve uma vantagem
evolutiva de um tipo em relao ao outro (STEINEL et al., 1998). Alm disso, estes
novos tipos extenderam o espectro de hospedeiro do CPV que adquiriu tambm a
capacidade de infectar a espcie felina (PARKER & PARRISH, 1997) (Figura 5).
Desde o final da dcada de 1980, os tipos novos de CPV (2a e 2b) tm sido
isolados de felinos domsticos e selvagens no Japo, Alemanha, EUA, Taiwan,
Vietn e Itlia, demonstrando que estes tm a capacidade de se replicar em
tecidos felinos, ao contrrio do tipo antigo que no era capaz de se replicar nestes
tecidos (MOCHIZUKI et al.,1993; MOCHIZUKI et al., 1996; TRUYEN et al., 1996-a;
TRUYEN; PLATZER; PARRISH, 1996; IKEDA et al., 1999; IKEDA et al., 2000;
STEINEL et al., 2000; GAMOH et al., 2003; BATINALLI et al., 2006; DECARO et
al., 2010).
A primeira descrio de um parvovrus canino infectando gatos ocorreu em
1996 (TRUYEN et al., 1996-b) e atualmente 5% dos parvovrus isolados de gatos
com gastrenterite detectados na Alemanha e EUA e 3% dos isolados no Japo
foram form caracterizados como tipos 2a ou 2b (TRUYEN et al., 1996-b; TRUYEN;
PLATZER; PARRISH,1996; GAMOH et al., 2003).
Em 2001, mais um tipo de CPV (CPV-2c) foi relatado na Itlia e j existem
trabalhos descrevendo sua circulao na populao canina da Espanha, Reino
Unido, Vietn, Austrlia, Tunsia, ndia e Amrica do Sul. (MARTELLA et al., 2004;
DECARO et al., 2006-b; MEERS et al., 2007; PERES et al., 2007; TOUIHRI et al.,
2009; CALDERON et al., 2009; NANDI et al., 2010).
O CPV-2c apresenta uma mudana de AA na posio 426 (AspGlu) da
protena de capsdeo VP2, regio importante para o estabelecimento das
33

propriedades antignicas do CPV (BUONAVOGLIA et al., 2001). Na Itlia, o tipo


2c est substituindo o tipo 2b na populao canina e tal disseminao sugere que
a mudana de AA na posio 426 tenha dado ao vrus uma maior adaptao ao
hospedeiro canino, em comparao com as outros tipos (DECARO et al., 2006-b,
2007-a; DECARO et al., 2009-a). Este tipo 2c tambm j foi associado infeco
em felinos, que desenvolveram quadro clnico grave de gastrenterite e
panleucopenia (DECARO et al., 2010) (Figura 5).

Figura 5. Anlise gentica e hospedeiros do vrus da panleucopenia felina


(FPLV) e parvovirus canino (CPV) desde a sua origem no final da dcada de
70, at os dias atuais (HOELZER& PARRISH, 2010).

34

A infeco por CPV-2c j foi descrita na Argentina (CALDERON et al.,


2009) e no Uruguai (PREZ et al., 2007) em ces com gastrenterite hemorrgica
e foi detectada em casos de gastrenterite em filhotes de ces no Rio Grande do
Sul, (STRECK et al., 2009). At o momento, infeces relacionadas ao tipo CPV2c ainda no foram descritas no Estado do Rio de Janeiro.
Vrias mudanas continuam ocorrendo nas amostras de CPV-2a e 2b que
circulam na populao canina em todo o mundo desde a dcada de 1980, embora
nem todas estejam associadas variaes antignicas (TRUYEN et al., 2000;
BATILLANI et al., 2001; MARTELLA et al., 2004; PARRISH & KAWAOKA, 2005;
WANG et al., 2005; BUONAVOGLIA, C. 2006; DECARO et al., 2007).
Casos de co-infeco por diferentes tipos de parvovrus em um mesmo
hospedeiro tambm foram anteriormente descritos. URL et al. (2003) detectatam
pela PCR o tipo antigo CPV-2 e FPLV simultaneamente em uma amostra de
tecido nervoso de um felino apresentando hipoplasia cerebelar e panleucopenia.
Em 2006, em Portugal, os tipos novos CPV-2b e 2c foram detectados em uma
amostra fecal de um co com gastrenterite no vacinado (VIEIRA et al., 2008-b) e
na Itlia, BATINALLI et al. (2007) detectaram em duas amostras fecais de filhotes
(um co e um gato) com sinais clnicos de gastrenterite a presena simultnea dos
tipos CPV-2a e 2c.
4.5 - Anlise de homologia de nt e AA dos parvovrus caninos (CPV).

Por tcnicas de mapeamento de nucleotdeo e sequnciamento, o acmulo


de mutaes pontuais tem sido observado em isolados de CPV desde a dcada
de 1980. Algumas destas mutaes podem ser silenciosas, no provocando
mudana na sequncia de AA (mutaes sinnimas) ou podem levar a alterao
do AA (mutaes no-sinnimas) (PARRISH et al.,1991; BATINALLI et al., 2002).
Aps 1990, os novos tipos em circulao (CPV-2a e 2b) passaram a
apresentar uma mutao no gene que codifica para a protena de capsdeo VP2
(AA 297 SerAla). Esta mutao representou uma vantagem evolutiva, e se fez
presente em mais de 90% dos isolados de CPV at o ano de 2000 (TRUYEN,
1999; HOELZER; PARRISH, 2010). Estas variantes (297 SerAla) foram
35

inicialmente denominadas de Novo CPV-2a e Novo CPV-2b , entretanto esta


nova nomenclatura no adotada por todos os autores.
Uma outra variante de CPV-2a, apresentando uma alterao no gene que
codifica para a protena de capsdeo VP2 na posio 4449 (AA 555 IleVal) foi
descrita em 2001 (BUONAVOGLIA et al., 2001; DESARIO et al., 2005; MEERS et
al., 2007), e tambm substituiu o tipo anterior CPV-2a (AA 555 Ile) em circulao
(DECARO et al., 2009-a). O resduo 555 se localiza em um stio antignico da
protena de capsdeo VP2, e esta mudana IleVal 555 representa uma reverso
sequncia original do vrus (CPV-2) (Quadro 1). (BUONAVOGLIA et al., 2001;
MARTELLA et al., 2005-a).
As diferentes mutaes que ocorreram no genoma do CPV de 1978 at
hoje esto descritas no Quadro 1.
O acmulo de mutaes tambm permite o agrupamento das amostras em
diferentes grupos. Os isolados de CPV so normalmente divididos em dois grupos
maiores, sendo o primeiro composto pelo tipo CPV-2 e o segundo, claramente
distinto, contendo outros isolados CPV-like que se originaram de um ancestral
comum CPV-2a (HOELZER;PARRISH, 2010) (Figura 6).
Algumas caractersticas do genoma viral dos parvovrus como tamanho e
tipo do genoma viral (nico filamento de DNA), ocorrncia de metilao em
algumas regies do genoma (DUFFY; SHACKLETON; HOLMES, 2008; HOELZER;
SHACKELTON; PARRISH, 2008), a co-circulao de diferentes tipos de parvovrus
em uma mesma populao canina e felina (STEINEL et al., 1998; HOELZER;
PARRISH, 2010) e a co-infeco de diferentes tipos em um mesmo indivduo
(BATINALLI et al., 2007; VIEIRA et al., 2008-b) so fatores que podem favorecer o
aparecimento de mutaes.
Estudos demostram que o CPV apresenta taxas de mutao dos genes que
codificam para as protenas de capsdeo VP1/ VP2 de 2x 10 -4 e 8x10-5
substituies/ stio/ ano respectivamente (HOELZER; PARRISH, 2010), valores
comparveis aos observados em vrus de genoma RNA e valores superiores ao
FPLV (PARRISH; KAWAOKA, 2005; DUFFY,S.; SHACKLETON, A.; HOLMES,E.
2008).

36

Um estudo realizado com isolados brasileiros de CPV-2a e 2b apresentou


valores ainda maiores, de 2,4x 10 4 substituies/ stio/ ano para os genes que
codificam para as protenas de capsdeo VP1 e VP2 (PEREIRA; LEAL; DURIGON,
2007).
Para outras protenas no estruturais (NS1 e NS2) as taxas de mutaes do
CPV e FPLV so idnticas (7,9 x 10-5 substituies/ stio/ ano), sugerindo que os
genes que codificam para estas protenas esto sujeitos a uma menor presso
seletiva (SHACKELTON et al., 2005).

37

Quadro 1. Principais mutaes descritas no genoma do parvovrus canino


(CPV) durante sua evoluo (TRUYEN et al., 1998; BUONAVOGLIA et al.,
2001; MOON et al., 2008; HOELZER; PARRISH, 2010).
Aminocido e tipo

Nome do vrus mutante

de substituio

Ano da

Importncia e prevalncia

primeira

relativa na populao

descrio
80

Arg Lys

93

LysAsn

103

Val Ala

323

Asp Asn

564

AsnSer

568

Ala Gly

87

Met Leu

101

Ile Thr

300

Ala Gly

305

Asp Tyr

426

FPLV para CPV-2

1978

Mudana de espectro de
hospedeiro de felinos para
caninos.
Habilidade de se replicar
somente em ces.
Alteraes na ligao com o
receptor celular de transferrina
(TRUYEN et al., 1998;
HOELZER; PARRISH, 2010)

CPV-2 para CPV-2a

1979

100% a partir de 1980.


Novo tipo antignico
Habilidade de se replicar em
felinos (TRUYEN et al., 1998;
HOELZER; PARRISH, 2010)

Asn Asp

CPV-2a para CPV-2b

1984

30 a 80% entre 1984 e 2005


Novo tipo antignico
Habilidade de se replicar em
felinos. (TRUYEN et al., 1998;
HOELZER; PARRISH, 2010)

297

Ser Ala

CPV-2a e 2b

1990

Superior a 90% at 2000


(TRUYEN et al., 1998;
HOELZER; PARRISH, 2010)

555

Ile Val

CPV-2a e 2b

2001

Reverso sequncia original do


vrus (CPV-2)
Prevalncia no estimada
(BUONAVOGLIA et al., 2001;
HOELZER; PARRISH, 2010)

426

Asp Glu

CPV-2c

2001

Prevalncia no estimada
Novo tipo antignico.
Habilidade de se replicar em
felinos. (BUONAVOGLIA et al.,
2001; HOELZER; PARRISH,
2010)

440

ThrAla

CPV-2a

2008

Associado sinais clnicos mais


graves.Prevalncia no estimada
(MOON et al., 2008)

38

Figura 6. Relao filogentica entre os parvovrus de carnvoros, baseada no


gene que codifica para a protena de capsdeo VP2. FPLV (vrus da
panleucopenia felina); BFPLV (parvovrus da raposa azul); RPV (parvovrus
do racoon) (HOELZER; PARRISH, 2010).

39

4.6 Transmisso, patogenia e manifestaes clnicas

Estudos de infeco experimental em filhotes de ces demostraram que a


infeco natural ocorre pela via oral, com replicao inicial do vrus nos tecidos
linfides da orofaringe dois dias aps a infeco (PI). A seguir, uma intensa
viremia observada 3-5 dias PI, disseminando o vrus para outros tecidos: medula
ssea, tecido linfide e intestino delgado (MACARTNEY; MCCANDLISH;
THOMPSON, 1984). Embora geralmente se manifeste como uma doena entrica,
a infeco pelo CPV uma enfermidade com disseminao sistmica, com as
manifestaes clnicas surgindo 5 dias PI (POLLOCK; CARMICHAEL, 1990;
POLLOCK; COYNE, 1993).
No trato intestinal, a replicao viral nas clulas do epitlio germinativo das
criptas do intestino delgado resulta em morte celular, levando destruio do
epitlio e, consequentemente, achatamento das vilosidades intestinais. Quando
ocorre a atrofia das vilosidades, o intestino delgado perde a capacidade de
absoro, pois o epitlio germinativo responsvel por substituir o epitlio maduro
foi destrudo. Devido reposio celular, que ocorre de 1-3 dias, esta perda
normalmente limitada (POLLOCK; COYNE, 1993) (Figura 7).

40

Transmisso oral

Replicao viral em ndulos linfticos


(orofaringe) 1-2 dias ps infeco (PI)

Viremia
3-5 dias PI

6-10 dias
PI

Linfonodos e
Medula ssea

Intestino

Necrose de Clulas Linfides


e Linfopenia

Necrose do epitlio germinativo


e diarria

Infeco secundria, septicemia e morte

Recuperao

Figura 7. Fluxograma da patogenia da infeco pelo parvovrus canino (CPV)


(MACARTNEY; MCCANDLISH; THOMPSON, 1984; POLLOCK; COYNE, 1993;
SMITH-CARR et al., 1997).

O vrus pode ser detectado nas fezes a partir do 3 o e 4o dias ps infeco


(PI), antes do aparecimento dos sinais clnicos. A maior concentrao do vrus nas
fezes observada entre o 4o e 6o dias PI (APPEL; PARRISH, 1987; POLLOCK;
COYNE, 1993). A transmisso fecal-oral ocorre quando animais infectados liberam
partculas virais nas fezes que permanecem no ambiente por longos perodos e
que contaminam animais saudveis pela ingesto de gua ou alimentos
contaminados (MURPHY et al., 1999).
Pela necessidade de clulas em atividade mittica para a replicao, o CPV
apresenta tropismo por tecidos de animais jovens ou recm-nascidos, ou tecidos
de animais adultos com intensa proliferao (TSAO; CHAPMAN;

AGBANDJE,

1991). Os tipos de CPV-2a, 2b e 2c apresentam patogenia e distribuio tecidual


semelhante, sugerindo um mesmo comportamento biolgico desses tipos no
hospedeiro (DECARO et al., 2007).
Os filhotes de ces entre seis semanas e seis meses de vida so os mais

41

suscetveis e a forma clnica predominante da infeco pelo CPV a gastrenterite,


que se caracteriza pela eliminao de fezes de consistncia diminuda com ou
sem melena. A diarria hemorrgica em filhotes de ces pode ser considerada um
indicativo da infeco por CPV (CARMICHAEL; BINN, 1981; PARRISH, 1995-b;
GUILFORD; STROMBECK, 1996; McCAW; HOSKINS, 1998). Em estudo anterior
realizado em nosso laboratrio, foram observados os sinais clssicos em 70% dos
animais infectados por CPV. Os demais animais apresentaram sinais entricos de
gravidade variada (CASTRO et al., 2007).
Os primeiros sinais clnicos geralmente so inespecficos, observados entre
o 4 e 5 dias PI e incluem anorexia, apatia e febre (MCARTNEY et al., 1984;
MARTIN et al., 2002; PRITTIE, 2004). Vmito e diarria ocorrem aps 24 a 48
horas e levam a desidratao rapidamente, alm de serem associados com a
rpida destruio de clulas em mitose do intestino e medula ssea (SHERDING,
1989; POLLOCK; COYNE, 1993).
A leucopenia, que ocorre comumente nas infeces pelo CPV tem sua
intensidade associada gravidade dos sintomas clnicos, o que costuma ocorrer
entre o 5 e o 8 dias da infeco. Observa-se uma reduo de moderada a
acentuada nesses tipos celulares em decorrncia da destruio das clulas
precurssoras na medula ssea e em outros rgos e tecidos com funo
linfoproliferativa como timo, linfonodos e bao (GODDARD et al., 2008).
Quando a infeco pelo CPV evolui favoravelmente, a recuperao
hematolgica ocorre entre 1 a 6 dias aps o incio do tratamento quando observase frequentemente leucocitose reativa (LATIMER, 1995). Aps o perodo das
manifestaes clnicas, que geralmente dura de seis a sete dias, o animal
recupera o seu estado geral.
Os sinais clnicos observados aps a infeco pelo FPLV esto associados
a duas sndromes tpicas. Quando o FPLV infectava fetos ou felinos recm-natos
ocorria hipoplasia cerebelar, com manifestao clnica de ataxia (JOHNSON;
MARGOLIS; KILHAM, 1967; KILHAM; MARGOLIS; COLBY,1971). Contudo,
quando a infeco ocorria em filhotes com mais de 15 dias de idade, a doena

42

caracterizava-se por anorexia, febre, vmito, diarria hemorrgica e leucopenia


(JOHNSON; MARGOLIS; KILHAM,1967; CARPENTER, 1971).
Apesar dos tipos CPV-2a e CPV-2b terem sido isolados de gatos com
sintomatologia clnica compatvel com parvovirose, a patogenicidade destes vrus
em felinos domsticos ainda discutida (MOCHIZUKI et al., 1993; MOCHIZUKI et
al., 1996). Enquanto alguns estudos de infeco experimental demonstraram que
CPV-2a e 2b eram capazes de infectar felinos mas no causavam manifestaes
clnicas claras, apenas uma leucopenia transitria (CHALMERS et al. 1999;
SAKAMOTO; ISHIGURO; MOCHIZUKI, 1999); outros observaram bito em 2/3
animais inoculados com uma amostra de CPV-2b isolada de um gato com
infeco pelo parvovrus (GAMOH et al., 2003).
Da mesma forma, DECARO et al. (2010) foram capazes de detectar CPV2c em uma amostra fecal de um filhote de gato que veio a bito aps um quadro
grave de gastrenterite hemorrgica. Por esta razo, a circulao dos novos tipos
de CPV em felinos domsticos, principalmente associada a doena clnica deve
ser monitorada.

4.7 Imunidade e profilaxia

Vacinas contra FPLV esto disponveis no mercado desde a dcada de


1950 e devido a similaridade antignica entre o CPV-2 e o FPLV, vacinas com
FPLV inativado chegaram a ser utilizadas em ces no incio da dcada de 80. A
primeira vacina contra CPV (CPV-2) foi disponibilizada no mercado em 1979,
aproximadamente um ano aps a emergncia deste agente na populao canina
(HOELZER; PARRISH, 2010) e ficou comprovado que a vacina inativada
constituda por CPV apresentou melhores resultados que a vacina produzida com
FPLV (MOORE, 1983; BURTONBOY et al., 1991).
No fim da dcada de 1980, uma vacina atenuada foi desenvolvida com o
tipo CPV-2a e permaneceu no mercado por 10 anos, Durante este perodo,
nenhuma vantagem imunolgica foi observada com o uso da vacina constituda

43

por este tipo em relao a vacina constituda pelo tipo antigo (CPV-2) (LARSON;
SHULTZ, 2008).
A presena de anticorpos maternos considerada a causa mais comum de
falha vacinal em filhotes de ces e gatos (SCHULTZ, 2009). Vrios estudos
mostraram que ttulos de anticorpos sricos > 80 pela reao de inibio da
hemaglutinao (HI) so considerados protetores e ttulos > 10 j interferem na
imunizao com vacinas inativadas para CPV-2 (POLLOCK; COYNE, 1993). Os
filhotes que nascem de cadelas com baixos ttulos de anticorpos podem tornar-se
suscetveis ao vrus selvagem aps quatro a seis semanas de vida, enquanto
filhotes de cadelas com altos ttulos de anticorpos podem permanecer imunes
infeco por at 12-20 semanas aps o nascimento (MURPHY et al., 1999). Este
intervalo pode durar algumas semanas, durante as quais os ces no respondem
a imunizao ativa

mas esto vulnerveis a infeco (BUONAVOGLIA et al.,

1992; LARSON; SHULTZ,1997).


Na tentativa de reduzir este perodo de suscetibilidade, quatro anos aps o
surgimento do CPV-2, vacinas constitudas pelo vrus atenuado (MLV ou Modified
Live Virus) foram elaboradas a partir de amostras isoladas no incio da dcada de
80. Na dcada de 1990, vacinas constitudas por vrus modificado e com alto
ttulo (107 TCID50/dose) e baixa passagem (HTLP) foram desenvolvidas com o
mesmo objetivo (BURTONBOY et al., 1991; BUONOVOGLIA et al., 1992).
A primeira vacina constituda pelo tipo CPV-2b foi desenvolvida no final da
dcada de 90. Sabe-se que os CPV-2a e 2b podem ser eliminados nas fezes a
ttulos muito superiores que o CPV-2 (CARMICHAEL, 1994), provavelmente como
uma conseqncia da adaptao dos tipos de CPV ao hospedeiro canino o que
explicaria porque a tipo 2b foi mais eficiente em superar o bloqueio dos anticorpos
maternos (DECARO et al., 2005-a).
Atualmente, vacinas constitudas pelo tipo antigo do vrus (CPV-2) ou pelo
tipo CPV-2b esto disponveis no mercado para a preveno da parvovirose
canina. No existem at o momento vacinas licenciadas constitudas pelos tipos
2a ou 2c (LARSON; SHULTZ, 2008).

44

Em 2006, um surto de gastrenterite em filhotes nascidos de cadelas


imunizadas com o tipo CPV-2 foi associado presena do CPV-2c (DECARO et
al., 2006-b). Em 2007, um novo surto por CPV-2c com alta mortalidade foi relatado
por DECARO et al. (2008-a) desta vez acometendo adultos jovens (com idade de
seis meses a dois anos), que haviam recebido mltiplas doses de vacina MLV
constituda pelo tipo antigo CPV-2. Na mesma poca, estudos baseados em
infeco experimental demostraram que as vacinas constitudas por CPV-2 e 2b
protegeram os filhotes frente ao desafio com o tipo 2c (LARSON; SHULTZ, 2008;
SPILBEY et al., 2008). Um estudo realizado por SCHULTZ et al. (2010) tambm
demonstrou que a vacinao com os tipos CPV-2 e 2b conferem proteo contra
os tipos novos circulantes (CPV-2a, 2b e 2c).

4.8 Diagnstico Laboratorial

De modo a confirmar o diagnstico clnico destes animais e acompanhar a


circulao dos tipos de CPV, faz-se necessrio a realizao do diagnstico
laboratorial. Este consiste principalmente na deteco direta do vrus a partir de
amostras fecais coletadas dos casos agudos da infeco, pois nesta fase, a
quantidade de vrus eliminada pelo animal doente pode alcanar at 10 9 TCID50/g
de fezes (POLLOCK; COYNE, 1993).
Os mtodos utilizados para o diagnstico so: a) observao das partculas
virais pela ME, b) reao de HA seguida pela reao de HI c) ensaios
imunoenzimticos (EIE), d) isolamento em cultura de clulas e e)PCR
(TERRAMOTO et al., 1984; APPEL; PARRISH, 1987; DURIGON et al., 1987;
MOCHIZUKI; HASHIMOTO; ISHIDA, 1993; MOCHIZUKI, 2006; DECARO et. al.,
2009-b; SCHIMITZ et al., 2009).
Devido a propriedade de aglutinar hemcias de sunos e macaco Rhesus
(Macaca mulatta), o teste de HA um dos mais utilizados rotineiramente para o
diagnstico rpido da parvovirose canina. Entretanto o resultado positivo pelo HA
deve ser confirmado pelo HI, com um soro imune especfico. Ainda, a reao de

45

HI com anticorpos monoclonais permite a diferenciao antignica das amostras


de CPV (CARMICHAEL; JOUBERT; POLLOCK, 1980; DURIGON et al., 1987).
O diagnstico tambm pode ser realizado atravs do isolamento viral em
cultura de clulas, tanto de origem canina (Madin-Darby canine kidney - MDCK)
quanto felina (Crandell feline kidney CRFK) (CARMICHAEL; JOUBERT;
POLLOCK, 1980; MOCHIZUKI et al., 1984; DURIGON et al., 1987). Atualmente,
testes comerciais baseados em EIE e imunocromatogrficos esto disponveis no
mercado para a rpida deteco do CPV nas fezes, o que facilita o diagnstico em
clnicas e hospitais veterinrios (DESARIO et al., 2005; DECARO et al.,2009-b;
SCHIMITZ et al., 2009).
Tcnicas baseadas na amplificao do genoma viral mostraram ser
altamente sensveis e a PCR alm de permitir a deteco do genoma do CPV em
amostras de fezes, possibilita a distino entre o tipo antigo (CPV-2) presente em
algumas vacinas e os novos tipos (CPV-2a, 2b e 2c) em circulao (SENDA et al.,
1995; PEREIRA et al., 2000; BUONAVOGLIA et al., 2001; COSTA et al., 2005;
DESARIO et al., 2005; PEREIRA; LEAL; DURIGON, 2007). Metodologias de PCR
quantitativa tambm tem sido utilizada no diagnstico, para a deteco, tipagem e
quantificao de DNA do CPV em fezes de ces com diarria. Estas metodologias
possibiltam determinar o nmero de cpias do genoma viral durante o perodo de
eliminao do vrus nas fezes, o que importante para a avaliao da eficcia de
vacinas (DECARO et al., 2006-a; 2007-a).
Os primeiros estudos realizados para diferenciao dos tipos de CPV
circulantes em CPV-2, CPV-2a e CPV-2b, utilizavam anticorpos monoclonais e
mapeamento com enzimas de restrio (PARRISH et al., 1985; 1988). A anlise
das mudanas de nucleotdeos responsveis pelas substituies de aminocidos
na protena VP2 do capsdeo viral (PARRISH et al.,1988) permitiu a elaborao de
pares de iniciadores especficos para tipagem das amostras de CPV atravs da
PCR (P2For/P2Rev e P2abFor/P2abRev) que foram ento utilizados para a
distino entre o tipo antigo (CPV-2) e novos de CPV (2a e 2b) (MOCHIZUKI et
al., 1993; SENDA et al., 1995; COSTA et al., 2005).

46

Posteriormente, PEREIRA et al. (2000) desenharam um novo par de


iniciadores para a tipagem do CPV-2b, baseado nas duas mudanas pontuais do
genoma viral que correspondem aos AA 426 e 555 e que permitem a
diferenciao dos tipos 2a e 2b.

A PCR com estes pares de iniciadores

(P2abFor/P2abRev e P2bFor/P2bRev) foi amplamente utilizada no laboratrio de


virologia (Universidade Federal Fluminense) e por outros grupos de pesquisa para
tipagem molecular das amostras de CPV em circulao at a implementao do
sequenciamento genmico (BUONAVOGLIA et al 2001; COSTA et al., 2005;
PREZ et al.,2007; CALDERON et al., 2009).
BUONAVOGLIA et al. (2001) detectaram por sequenciamento uma
mutao no AA426 (Asp-Glu) em duas amostras fecais de ces com gastrenterite
por CPV. Estas amostras foram inicialmente tipadas como 2b pela reao com
anticorpos monoclonais e PCR, mas apresentavam um perfil atpico aps digesto
do produto de PCR com enzimas de restrio. Este mutante, detectado na Itlia,
foi denominado de CPV-2c (426-Glu) e j se disseminou na populao canina em
vrios pases (MARTELLA et al., 2004; DECARO et al., 2006-b; MEERS et al.,
2007; PRES et al., 2007; TOUIHRI et al., 2009; CALDERON et al., 2009; NANDI
et al., 2010).
A caracterizao molecular dos CPV por de tcnicas de sequenciamento foi
ento difundida e estudos que compararam a tipagem pela PCR convencional e a
caracterizao por sequenciamento demonstraram que a PCR no foi capaz de
identificar a mutao no resduo 426 que caracteriza o novo tipo 2c
(BUONAVOGLIA et al., 2001) e as amostras 2c foram erroneamente tipadas como
CPV-2b por esta metodologia (DESARIO et al., 2005; MEERS et al., 2007).
Atravs do sequenciamento, BUONAVOGLIA et al. (2001) detectaram pela
primeira vez uma variante do tipo CPV-2a (555 IleVal). Estudos retrospectivos
em diferentes pases evidenciaram que esta variante CPV-2a (555 -Val) j
circulava na populao canina desde o incio da dcada de 1990 (TRUYEN, 1999;
DESARIO et al., 2005; MEERS et al., 2007; HOELZER; PARRISH, 2010) e que
esta variante tambm era amplificada pelo par de iniciadores P2b, o qual se
pensava ser especfico para o CPV-2b.

47

Com a descrio do CPV-2c e da variante CPV-2a (555 Val) ficou claro que
somente o sequenciamento do gene que codifica para a protena de capsdeo VP2
permitiria a identificao dos tipos de CPV em circulao (DESARIO et al., 2005;
MEERS et al., 2007).
O sequnciamento genmico considerado o mtodo mais fidedigno para a
caracterizao das amostras de parvovrus canino e felino e se baseia na
determinao da seqncia de nucleotdeos do gene que codifica para as
protenas de capsdeo VP2 permitindo definir com preciso o tipo de parvovrus
presente na amostra e a anlise da relao de homologia de nt e AA do recente
isolado com as amostras de parvovrus disponveis em bancos de dados
(GenBank) (IKEDA et al., 2000; STEINEL et al., 2000; BATTILANI et al., 2002;
NAKAMURA et al., 2004; SHACKELTON et al., 2005; WANG et al., 2005;
DECARO et al., 2008-b; DECARO et al., 2009-a; DECARO et al., 2010)
Para a diferenciao dos tipos novos de CPV (2a, 2b e 2c), a anlise da
regio do genoma que codifica para a protena de capsdeo VP2, contendo os AA
426 e 555 vem sendo amplamente utilizada (BUONAVOGLIA et al., 2001; PRES
et al., 2007; VIEIRA et al., 2008-a; CALDERON et al., 2009). Uma vez que o tipo
antigo do vrus (CPV-2) ainda amplamente utilizado na preparao de vacinas
atenuadas, a anlise de outros AA informativos (297, 300 e 305) da protena VP2
pode ser necessria para a determinao do tipo do vrus.

48

5- MATERIAL E MTODOS

5.1- Amostras clnicas:


Para a realizao deste estudo, foram incluidas 51 amostras fecais diarricas
de ces com at um ano de idade pertencentes a coleo do Laboratrio de
Virologia, Depatamento de Microbiologia e Parasitologa, Universidade Federal
Fluminense, obtidas de 1995 a 2007 cujas fichas apresentavam dados clnicos
completos e que foram consideradas positivas para CPV por HA/HI (ttulo de HA >
512).
Alm destas, foram includas amostras de fezes diarricas obtidas de ces
com at um ano de idade obtidas durante a realizao deste estudo ( 2008-2009).
As amostras foram coletadas de diferentes clnicas e Hospitais veterinrios das
cidades de Niteri, Rio de Janeiro e municpio de Duque de Caxias. As amostras
foram coletadas aps defecao espontnea e mantidas a 20C at o envio ao
laboratrio onde ficavam estocadas nas mesmas condies at o processamento.
Cada amostra foi acompanhada de uma ficha preenchida pelo responsvel pela
coleta, contendo dados de identificao do animal, data de coleta da amostras,
sinais clnicos e histrico das vacinas que recebeu (Anexo 1).

49

Seis amostras de gatos domsticos (cinco com gastrenterite e um


assintomtico) com at seis meses de idade coletadas no ano de 2004 de um
abrigo para felinos na cidade do Rio de Janeiro e previamente confirmadas como
positivas para parvovrus por HA/HI e PCR (MIRANDA, 2006) tambm foram
incluidas neste estudo.
Este projeto obteve a aprovao do COMIT DE TICA EM PESQUISA
ANIMAL (PR-REITORIA DE PESQUISA E PS-GRADUAO) sob o nmero
0081/09 (Apndice 2).

5.2- Reagentes e Solues


5.2.1- Tampo Tris-Ca++ 0,01M pH 7,2
Tris-base (Invitrogen)..............................................................................

1,21 g

Cloreto de Clcio (Vetec) 0,0015M.........................................................

0,02 g

gua Milli-Q q.s.p....................................................................................... 1000,00 mL


Em um bquer de 2000mL os reagentes foram adicionados e homogeneizados com
agitador magntico. O pH 7,2 foi ajustado com cido clordrico P.A. (Merck) antes de
completar o volume final em proveta de 1000mL. A soluo foi transferida para frasco
com vedao, autoclavada a 121C por 20 min e foi estocada em geladeira a 4C.

5.2.2- Tampo salina-borato (BABS) pH 9.0


Cloreto de sdio (Vetec)1,5M..............................................................

80,0 mL

cido brico (Merck) 0,5 M...................................................................

100,0 mL

Hidrxido de Sdio (Merck) 1,0 M.......................................................

24,0 mL

Soroalbumina bovina (BSA) (Sigma)....................................................

2,0 g

H2O destilada q.s.p. ............................................................................... 1000,0 mL


As trs solues foram preparadas separadamente. Antes de adicionar a

50

soroalbumina bovina, esta foi dissolvida em banho-maria a 37C. A soluo foi


estocada a 4C.

5.2.3-Tampo VAD pH 6.0


Soluo A:
Cloreto de sdio (Vetec)......................................................................

8,77 g

Fosfato de sdio dibsico P.A. (Vetec).................................................

80,40 g

H2O destilada q.s.p................................................................................. 1000,00mL


Soluo B:
Cloreto de sdio (Vetec)......................................................................

8,77 g

Fosfato de sdio monobsico P.A. (Vetec) .........................................

41,40 g

H2O destilada q.s.p ................................................................................ 1000,00mL


As solues foram preparadas separadamente e estocadas a 4oC. Para pH 6,0,
125 mL da soluo A foi misturado a 875 mL da soluo B.

5.2.4- Caolim 25%


Caolim P.A (Vetec)................................................................................

2,5 g

gua destilada q.s.p................................................................................ 10,0 ml


Os reagentes foram homogeneizados e acondicionado em tubo Falcon em
geladeira a 4C at sua utilizao.

5.2.5- Tampo L2 pH 6,4


Isotiocianato de guanidina (Invitrogen) ............................................... 120,0 g
Tris-HCl 0,1 M pH 6,4................................................ 100,0 mL
Em um bquer de 250 ml foram adicionados os reagentes e homogeneizados em

51

agitador magntico. O contedo foi transferido para proveta de 250 ml e o volume


final completado com Tris-HCl 0,1 M pH 6,4. O tampo foi acondicionado em
frasco mbar e conservado em tempeatua ambiente. Esta soluo estvel por 1
semana.

5.2.6- Tampo Tris-HCl 0,1 M pH 6,4


Tris-base (Invitrogen)...............................................................................

12,11g

gua destilada q.s.p................................................................................... 1000,00mL


Em um bquer de 1000 mL, foram dicionados os reagentes e homogeinezados em
agitador magntico. O contedo foi transferido para proveta de 2000mL e o volume
final completado. O pH foi ajustado a pH 6,4 com cido clordrico P.A. (Merck ),
antes de completar o volume final. A soluo foi autoclavada a 121C por 20 min e
estocada a 4o C.

5.2.7- NaOH 10N


Hidrxido de Sdio (Merck)..................................

10,0 g

gua destilada q.s.p................................................................................ 200,0 mL

5.2.8- Slica
Dixido de Slica......................................................................................

60,0 g

gua destilada q.s.p. .............................................................................. 500,0 mL


O reagente foi homogeneizado e mantido em repouso para sedmentao por 24 h.
Aps este perodo, 430 mL da soluo foram aspirados por suco e
desprezados. O volume foi completado para 500 mL com gua destilada,
homogeneizado e mantido em repouso para sedmentao por 5 h. 440 mL da
soluo foram aspirados por suco e desprezados. O sedmento foi ajustado a pH
2,0 pela adio de 600 L de cido clordrico 37% (Merck) e aliquotado 10 mL da

52

soluo em frascos de cor mbar. Os frascos foram autoclavados e estocados


temperatura ambiente.

5.2.9- Etanol 70%


Etanol P.A. (Merck) ............................. ................................................ 70,0 mL
gua destilada q.s.p. .............................................................................. 30,0 mL
Os regentes foram homogeneizados em bquer de 250mL. O volume final foi
ajustado em proveta de 250 mL. A soluo foi mantida a -20C.

5.2.10- EDTA 0,5M pH 8,8


cido etilenodiamino tetra-actico (Sigma) .........................................

146,1g

gua destilada q.s.p. ............................................................................. 1000,0mL


Em um bquer de 1000 ml foram adicionados EDTA e 300 mL de gua destilada.
O pH 8,8 foi ajustado com hidrxido de Sdio (Merck) e a soluo foi
homogeneizada com agitador magntico. A soluo foi transferida para proveta de
1000 mL e o volume final ajustado. A soluo foi aliquotada em frascos com tampa
e autoclavado a 121C por 20 min. Os frascos foram mantidos em geladeira a 4C.

5.2.11- Tampo Tris-Boro-EDTA (TBE) 10 X pH 8,4


Tris-base (Invitrogen) ..........................................................................

108,0 g

cido Brico (Merck)..........................................................................

5,5 g

EDTA 0,5M pH 8,8 (Sigma) .................................................

40,0 mL

H2O destilada q.s.p............................................................................... 1000,0 mL


Em um bquer de 2000 mL foram adicionados os reagentes e homogeneizados
com agitador magntico. O contedo foi transferido para uma proveta de 1000 mL,
completado o volume final e transferido para frasco com vedao. A soluo final

53

foi conservada a 4C e diluda para 0,5 X no momento do uso.

5.2.12- Agarose a 1,5%


Agarose ...................................................................................................

1,5 g

Tampo TBE 0,5 X pH 8,4 ..................................................................... 100,0 mL


A agarose foi pesada, colocada em erlenmeyer. Foram adicionados 100 mL de
tampo TBE 0,5X. O erlenmeyer foi levado ao forno de microondas. A mistura foi
resfriada a 50C e colocada na cuba de eletroforese, evitando a formao de
bolhas.

5.2.13- Soluo de brometo de etdio


Brometo de etdio 10 mg/mL (Invitrogen)..............................................

15,0 L

gua destilada q.s.p................................................................................ 300,0 mL

5.2.14- Tampo corante azul de Bromofenol


Azul de Bromofenol (Shandom So).........................................................

0,1 g

Xylene Cyanol FF (Sigma)....................................................................

0,1 g

EDTA 0,2 M pH 8 (Sigma)....................................................................

10,0 mL

Glicerol P.A. (Sigma).............................................................................

50,0 mL

gua destilada q.s.p. ............................................................................. 100,0 mL


Os reagentes foram gentilmente homogeneizados em um bquer de 250 mL at a
completa dissoluo. Alquotas de 10 ml foram acondicionadas em frascos mbar
e mantidas em temperatura ambiente.

54

5.3 Iniciadores de cadeia utilizados na reao de PCR para caracterizao


genmica
Para a caracterizao genmica das amostras de CPV e FPLV foram
selecionados quatro pares de iniciadores, descritos na Figura 8 e Quadro 2.
Para a distino entre os tipos antigo e novos de CPV foram usados os
seguintes iniciadores especficos: P2: tipo antigo (CPV-2); P2ab: tipos novos (2a,
2b e 2c) (SENDA et al., 1995) (Figura 8 e Quadro 2).
Para sequenciamento, foram escolhidos pares de iniciadores j descritos
em literatura (BUONAVOGLIA et al., 2001), que amplificam dois fragmentos do
gene que codifica para a protena de capsdeo VP2. O par de iniciadores
555For/555Rev amplifica uma regio do gene que codifica dois resduos
importantes para a caracterizao dos novos tipos do CPV (AA 426 e AA 555). O
par de iniciadores HFor/HRev, amplifica uma outra regio do genoma que codifica
para trs resduos importantes (AA297, AA300 e AA305) (BUONAVOGLIA et al.,
2001).
5
0

3
1000

2000

3025

3025

3000

P2For/ P2Rev
P2abFor/P2abRev
3556

4000

5000

3706
3706

HFor/HRev
4003

4166

555For/555Rev

4561

Figura 8. Localizao da sequncia dos iniciadores de cadeia utilizados


neste estudo.

55

Quadro 2. Descrio dos iniciadores utilizados na reao de PCR utilizados


neste estudo, com o tamanho em pares de base (pb) de seus respectivos
produtos.
Sequencia

Posio

Tamanho do
amplicon

Especificidade

GAAGAGTGGTTGTAAATAATA
CCTATATCACCAAAGTTAGTAG

(3025-3045)

681 pb

FPLV

GAAGAGTGGTTGTAAATAATT
CCTATATAACCAAAGTTAGTAC

(3025-3045)

H For **

CAGGTGATGAATTTGCTACA

3556-3575

H Rev

CATTTGGATAAACTG GTGGT

4183-4166

555 For **

CAGGAAGATATCCAGAAGGA

4003-4022

GTGCTAGTTGATATGTAATAAACA

4585-4561

Iniciador
P2For *
P2Rev
P2abFor *
P2abRev

555 Rev

* SENDA et al., 1995,

(3685-3706)

CPV-2
681 pb

(3685-3706)

CPV-2a, CPV-2b
CPV-2c

608 pb

563 pb

* * BUONAVOGLIA et al., 2001

5.4 Mtodos
5.4.1- Suspenso fecal a 10%:
Inicialmente foi preparada uma suspenso a 10% de cada amostra fecal em
soluo Tris-Ca++ 0,01M pH 7,2. A seguir adicionou-se igual volume de
clorofrmio e aps agitao em vortex por 1 minuto, as suspenses foram
centrifigadas a 1000 rpm por 15 minutos, e os sobrenadantes acondicionados em
tubo plstico de 1,5 ml1 at o momento da anlise (CARMICHAEL; JOUBERT;
POLLOCK, 1980).

5.4.2 - Reao de Hemaglutinao e Inibio da Hemaglutinao:


Para triagem das 100 amostras coletadas no decorrer do estudo (20082009), o teste de hemaglutinao (HA) foi utilizado para a deteco direta de
parvovrus canino nas suspenses fecais, de acordo com o descrito em SANTOS
et al. (1997). As suspenses fecais foram diludas em microplacas de 96
1

Eppendorf
56

cavidades, utilizando-se diluies seriadas em tampo BABS pH 9,0. Aps as


diluies, adicionou-se 50 l de suspenso de hemcias de sunos a 0,5% em
tampo VAD (pH 6,0). A mistura foi incubada por 18 horas a 4C e o ttulo da
reao foi determinado como sendo o inverso da maior diluio da suspenso
fecal capaz de causar a aglutinao total das hemcias. Amostras com ttulos
menores ou iguais a oito foram consideradas negativas, enquanto amostras com
ttulos maiores ou iguais a 16 foram analisadas pelo HI para confirmao

do

diagnstico.
O teste de (HI) foi utilizado para confirmar as amostras positivas por HA. O
soro imune de coelho ou cobaio foi previamente inativado a 56C por 30 minutos,
tratado com suspenso de caolim a 25% em BABS e suspenso de hemcias a
50% em VAD (SANTOS et al., 1997). A seguir foram feitas diluies seriadas do
soro de cobaio (25l) em BABS (pH 9,0) na microplaca de 96 cavidades.
Adicionou-se igual volume de suspenso fecal

diluda para conter 8

UHA/ 50l do vrus. Aps incubao a 37C por duas horas, adicionou-se em
todas as cavidades da microplaca 50l de suspenso de hemcias a 0,5%. As
placas foram incubadas a 4C por 18 horas para posterior leitura. Cada microplaca
continha controles de soro, vrus e hemcia.

5.4.3 - Reao em cadeia pela polimerase para a deteco do


genoma do parvovrus canino:
A fim de confirmar os resultados positivos no HA/HI de todas as amostras
fecais de ces incluidas, a PCR foi realizada com dois pares de iniciadores para
distinguir

entre

tipo

antigo

(P2For/P2Rev)

tipos

novos

de

CPV

(P2abFor/P2abRev).

5.4.3.1. - Extrao do cido nucleico:


Aps o preparo da suspenso fecal a 10%, procedeu-se a extrao do
genoma viral atravs do mtodo de Boom que utiliza isotiocianato de guanidina e

57

slica (BOOM; SOL; SALIMANS, 1990) com algumas modificaes (COSTA et al.,
2005).
Em tubo plstico de 1,5 mL2, a 200 L da suspenso fecal a 10% foi
adicionado 200 L de fenol/clorofrmio3, seguido de homogeneizao em vrtex.
Aps centrifugao por 2 minutos, transferiu-se o sobrenadante para um outro
tubo e em seguida foram adicionados 15 L de slica e 1 mL de tampo L2 pH 6,4.
Os reagentes foram homogeneizados em vrtex e mantidos temperatura
ambiente por 30 minutos com agitao constante.
A seguir, as amostras foram centrifugadas a 14.000 x g/ 20 segundos e os
sobrenadantes decantados. As amostras foram sucessivamente lavadas em
500L de etanol 70% (2x) e acetona P.A. (1x) mantidos a 20C. Os tubos foram
incubados a 56C/15 minutos para a secagem completa dos sedimentos e, ento,
adicionou-se a cada tubo 50L de gua estril4.

Aps nova centrifugao

14.000 x g/3 minutos, os eluatos foram coletados em tubos plsticos tipo


Eppendorf e estocados a -20C para posterior uso na PCR.
Cada reao de extrao de DNA foi realizada com um controle positivo
(vacina CPV-2b disponvel comercialmente no Brasil 5) e um negativo (gua
estril6).

5.4.3.2- Reao em cadeia pela polimerase


Aps extrao do genoma a reao de PCR foi realizada em termociclador
automtico7. Inicialmente, 10L do extrato foi incubado com 1L de cada par de
iniciador (20 picomol) a 94C/2 minutos, seguido de rpido resfriamento a 4C por
2 minutos. A reao de amplificao foi realizada em um volume final de 50L

Eppendorf
3
Invitrogen
4
Milli-Q
5
Duramune Max5 FortDodge
6
Milli-Q
7
Perkin Elmer
2

58

contendo 50 mM KCl2, 10mM Tris-HCl pH 8,3, 1,5mM MgCl2 8, 200M de cada


dNTP 9 e 0,5U de Taq DNA Polimerase Platinum II 10. A PCR consistiu de 30 ciclos
de incubao a 94C por 30 segundos, 55C por 2 minutos e 72C por 2 minutos e
extenso final de 10 minutos a 72C. Cada reao de PCR foi realizada com um
controle positivo (vacina CPV-2b disponvel comercialmente no Brasil11) e um
negativo (gua estril12).
A cada produto da reao de PCR (amplicon) foi adicionado 1L de corante
azul de bromofenol e os mesmos foram submetidos a eletroforese em gel de
agarose a 1,5% em tampo TBE 0,5 % por 50 minutos a 84 volts. Utilizou-se como
padro de corrida o DNA Ladder de 100 pb13. O gel foi corado em soluo de
brometo de etdio a 0,5 g/mL, os produtos amplificados visualizados em
transiluminador (UV)14.

5.4.4- Sequenciamento parcial do gene que codifica para a


protena de capsdeo VP2 dos parvovrus canino e felino:
Todas as amostras de 1995-2007 cujos resultados foram confirmados pela
PCR; as seis amostras felinas coletadas em 2004; e as amostras fecais obtidas no
perodo de 2008-2009 (HA>512; HI> 40 e confirmadas pela PCR) com dados
clnicos completos foram submetidas ao sequenciamento parcial do gene que
codifica para a protena de capsdeo VP2.
A reao de amplificao com os iniciadores 555For/555Rev foi realizada
em um volume final de 50L, com a mistura de reagentes15: PCR buffer 1x (50 mM
KCl2, 10mM Tris-HCl pH 8,3), 1,5mM MgCl2 , 200M de cada dNTP16, 1L de cada
Invitrogen
9
Invitrogen
10
Invitrogen
11
Duramune Max5 FortDodge
12
Milli-Q
13
Invitrogen
14
Labnet
15
Invitrogen
16
Invitrogen
8

59

par de iniciador (20 picomol) e 0,5U de Taq DNA Polimerase Platinum II 17. A PCR
foi realizada em termociclador automtico e consistiu de uma etapa inicial de
incubao a 94C por 10 minutos, 40 ciclos de a 94C por 30 segundos, 50C por
1 minuto e 72C por 1 minuto seguido por extenso final de 10 minutos a 72C.
A reao de amplificao com os iniciadores HFor/HRev foi realizada em
um volume final de 50L, com a mistura de reagentes18: PCR buffer 1x (50mM
KCl2, 10mM Tris-HCl pH 8,3), 1,5mM MgCl 2, 200M de cada dNTP, 1L de cada
par de iniciador (20 picomol) e 0,5U de Taq DNA Polimerase Platinum II. A PCR
foi realizada em termociclador automtico e consistiu de uma etapa inicial de
incubao a 94C por 10 minutos, 40 ciclos de a 94C por 30 segundos, 52oC por
1 minuto e 72oC por 1 minutos seguido por extenso final de 10 minutos a 72 oC.
Para anlise dos produto amplificado nas reaes com os iniciadores
555For/555Rev e HFor/HRev, 1L de corante azul de bromofenol foi adicionado a
10 L de cada amostra e as mesmas foram submetidas a eletroforese em gel de
agarose a 1,5% em tampo TBE 0,5 % por 50 minutos a 84 volts. Os produtos
amplificados foram visualizados em transiluminador UV

19

e a quantificao do

DNA nas amostras foi realizada utilizando Low DNA Mass20.


Para a purificao do produto amplificado pela tcnica de PCR, foi utilizado o
Kit comercial QIAQuick PCR purification kit

21

. Para o sequenciamento direto dos

produtos amplificados e purificados foi utilizado o kit comercial Big Dye


Terminator v3.1 Cycle Sequencing Kit22 conforme orientao do fabricante. Foram
usados os mesmos iniciadores de cadeia utilizados na reao de PCR. Os
produtos da reao de sequncia foram purificados com as colunas CENTRI-SEP
23

conforme orientao do fabricante.

Invitrogen
Invitrogen
19
Labnet
20
Invitrogen
21
QIAGEN
22
Applied Biosystems, CA, USA
23
Princeton Separations, CA, USA
17
18

60

Os cromatogramas das sequncias foram obtidos a partir do sequenciador


automtico de 48 capilares ABI Prism 3730 Genetic Analyzer

24

do servio da

Plataforma de Sequenciamento de DNA PDTIS/FIOCRUZ conforme OTTO et al.,


(2008).
Todas as amostras foram sequenciadas nas duas direes (5 3e 3 5).
Aps o alinhamento com as sequncias padres, as regies correspondentes aos
iniciadores foram retiradas.
Todas as sequncias obtidas neste trabalho foram depositadas no
GenBank (www.ncbi.nlm.nih.gov/GenBank) e cada amostra sequenciada foi
identificada com a sigla do Estado de origem (RJ), seguido pelo nmero da
amostra no laboratrio e pelo ano de coleta.

5.4.5-Anlise da homologia de nt e AA entre as amostras dos parvovrus


canino e felino:
As sequncias nucleotdicas (e as aminoacdicas deduzidas a partir das
mesmas) foram alinhadas utilizando o mtodo CLUSTAL W, contido no programa
Bio Edit (HALL et al., 1999). As sequncias prottipos representantes dos
diferentes tipos de CPV e FPLV, descritas em diferentes pases, foram resgatadas
no

site

do

NCBI

(National

Center

for

Biotechnology

Information)

(http://www.ncbi.nlm.nih.gov) atravs dos seus nmeros de acesso ou mediante a


utilizao da ferramenta BLAST (Basic Local Aligment Search Tool), disponvel no
GenBank.
As relaes de homologia de nt e AAs entre as diferentes sequncias foram
determinadas mediante a utilizao do programa MEGA v.4.0 (TAMURA et al.,
2007) atravs do mtodo de reconstruo filogentica Neighbor-Joining. A
distncia gentica entre as diferentes amostras foi calculada mediante o modelo
Kimura-dois-parmetros como modelo de substituio nucleotdica. A significncia
estatstica das diferentes filogenias obtidas foi estimada atravs de 2.000 rplicas
de bootstrap.
24

Applied Biosystems, Foster City, CA, USA


61

Todas as etapas de deteco, caracterizao e anlise de homologia de nt e


AA das amostras de CPV e FPLV utilizadas neste estudo esto demostradas na
Figura 9.

Amostras fecais caninas


(2008-2009)

51 amostras caninas
1995-2007
HA>512
HI> 40

6 amostras felinas
2004
HA>512
HI> 40

Suspenso fecal 10%


(-20C)

Extrao do Genoma
Isotiocianato de Guanidina e Slica

HA

<8

> 16

PCR com pares de iniciadores P2For/P2Rev e


P2abFor/P2abRev

HI

NEGATIVO

HI< 20

HI>40

POSITIVO

PCR para Sequenciamento com pares de iniciadores


555For/555Rev e HFor/HRev

Sequenciamento (Plataforma de Sequenciamento de


DNA PDTIS/ FIOCRUZ)

Anlise de homologia de nt e AA

Figura 9. Fluxograma de deteco, caracterizao e anlise de homologia de


nt e AA das amostras de parvovrus canino e felino utilizadas neste estudo.

62

6- RESULTADOS

6.1- Triagem de amostras CPV positivas para sequenciamento


Das 100 amostras fecais de ces coletadas no perodo de 2008-2009, 43
foram positivas por HA/HI e PCR e destas, 18 amostras foram incluidas para
caracterizao por sequenciamento (HA > 512 e dados clnicos completos).
Portanto, um total de 69 amostras fecais de ces foram analisadas: 51
coletadas entre 1995-2007 e 18 de 2008-2009. A distribuio das 69 amostras
caracterizadas neste estudo de acordo com o sexo, faixa etria e histrico de
vacinao est demonstrada na Tabela 1.
Todas as 69 amostras apresentaram amplificao somente com o par de
iniciador P2ab, especfico para os tipos novos de CPV.

63

Tabela 1. Distribuio das 69 amostras fecais caninas, positivas por HA/HI e


PCR analisadas neste estudo conforme o sexo, faixa etria, raa, condio
vacinal dos ces e tipo de CPV (CPV-2a, 2b ou 2c) caracterizado na amostra
fecal.

Amostras fecais caninas

CPV-2a

CPV-2b

CPV-2c

Total (%)

Macho

15

21 (30%)

Fmea

26

21

48 (60%)

<2

12

18 (26%)

>2 - <4

21

15

37 (54%)

>4

14 (20%)

SRD

12

20 (29%)

Labrador Retriever

8 (12%)

Poodle

8 (12%)

Cocker Spaniel

6 (8%)

Rottweiler

6 (8%)

Pastor Alemo

5 (8%)

Outras raas

16 (23%)

Sim

22

15

37 (54%)

No

19

12

32 (46%)

Sexo

Faixa etria (meses)

Raa

Vacinao

SRD: Sem Raa Definida


Outras Raas: Fila Brasileiro (2); Golden Retriever de Labrador (2); Pit Bull (2); Teckel (2);
Yorkshire Terrier (2) Bull Terrier (2); Bulldog Francs (2); Dlmata (1); Shit-zu (1).

64

6.2- Caracterizao dos tipos de parvovrus canino (CPV) em amostras fecais


de ces no vacinados apresentando gastrenterite.
Um total de 32 amostras fecais de filhotes de ces no vacinados
apresentando quadro clnico de gastrenterite (16 machos e 16 fmeas), coletadas
no perodo de 1995 a 2009, foram amplificadas pela PCR com os iniciadores
555For/ 555Rev para realizao do sequnciamento parcial do gene que codifica
para a protena de capsdeo VP2.
As sequncias obtidas de amostras de ces no vacinados foram
depositadas

no

GenBank

(nmero

de

acesso:

FJ977046-FJ977077)

comparadas com amostras prottipos de CPV: CPV-2, 1978 (M38245), CPV-2a,


1983 (M24000), CPV-2a, 2007, BR (DQ340434), CPV-2b, 2008, BR (FJ236068),
CPV-2c, 2007, URU (EF375482), CPV-2c, 2008, ARG (FJ349322), CPV-2c, 2008,
BR (EU797727).
As principais diferenas observadas entre as sequncias parciais do gene
que codifica para a protena de capsdeo VP2 geradas neste estudo e as
sequncias obtidas a partir das amostras prottipos de diferentes locais, esto
descritas na Tabela 2.
A anlise por sequnciamento do fragmento de 563 pb do gene que codifica
para a protena VP2, que abrange as regies 426 e 555, permitiu a caracterizao
dos novos tipos de CPV nas 32 amostras estudadas. Todas as 12 amostras
coletadas de 1995 a 2003 foram caracterizadas como CPV-2a. De 2004 a 2006,
tanto CPV-2a (4) quanto CPV- 2b (4) foram detectados. A partir de 2006, nove das
12 amostras foram caracterizadas como CPV-2b (Tabela 2).
Todas as amostras caracterizadas como CPV-2a apresentaram mutao
Guanina (G) no nucleotdeo 4449 do gene que codifica para VP2, o que resulta em
uma alterao no sinnima no resduo 555 (IleVal) (Tabela 2).
Aproximadamente 59% das amostras estudadas (19/32) apresentaram uma
substituio sinnima de adenosina (A) por guanina (G) no nt 4508, resduo 574.
Outras 12 amostras (nove CPV-2b, duas CPV-2a e uma CPV-2c) apresentaram
65

outra mutao sinnima, uma insero de adenosina (A) no nt 4104 resduo


440. (Tabela 2).
Tabela 2. Diferenas de nucleotdeos e aminocidos encontradas no produto
amplificado de 563 bp do gene que codifica para VP2 nas 32 amostras de
parvovirus canino de ces no vacinados apresentando gastrenterite e
isolados obtidos no GenBank.
Sequencias GenBank

tipo

(Prottipo)

AA 426

AA 440

AA 555

AA 574

(nt 4062)

(nt4104)

(nt 4449)

(nt4508)

M38245 (EUA)

1978

CPV-2

AAT (Asn)

GTA (Val)

M24000 (EUA)

1983

CPV-2a

AAT (Asn)

ATA (Ile)

DQ340434 (BR) 2007

CPV-2a

AAT (Asn)

GTA (Val)

FJ236068 (BR)

2008

CPV-2b

GAT(Asp)

GTA (Val)

EF375482 (URU) 2007

CPV-2c

GAA (Glu)

GTA (Val)

EU797727 (BR) 2008

CPV-2c

GAA (Glu)

GTA (Val)

FJ349322 (ARG) 2008

CPV-2c

GAA (Glu)

GTA (Val)

Amostra

tipo

426

440

555

574

(nt 4062)

(nt4104)

(nt 4449)

(nt4508)

RJ004/95

CPV-2a

AAT (Asn)

GTA (Val)

RJ083/96

CPV-2a

AAT (Asn)

GTA (Val)

RJ126/97

CPV-2a

AAT (Asn)

GTA (Val)

RJ129/97

CPV-2a

AAT (Asn)

GTA (Val)

RJ164/98

CPV-2a

AAT (Asn)

GTA (Val)

RJ167/98

CPV-2a

AAT (Asn)

GTA (Val)

RJ183/99

CPV-2a

AAT (Asn)

GTA (Val)

RJ223/99

CPV-2a

AAT (Asn)

GTA (Val)

RJ251/00

CPV-2a

AAT (Asn)

GTA (Val)

RJ305/01

CPV-2a

AAT (Asn)

GTA (Val)

RJ369/02

CPV-2a

AAT (Asn)

GTA (Val)

RJ426/03

CPV-2a

AAT (Asn)

GTA (Val)

RJ542/04

CPV-2b

GAT (Asp)

GTA (Val)

RJ596/04

CPV-2b

GAT (Asp)

GTA (Val)

RJ630/05

CPV-2b

GAT (Asp)

GTA (Val)

RJ708/06

CPV-2a

AAT (Asn)

GTA (Val)

RJ736/06

CPV-2a

AAT (Asn)

GTA (Val)

RJ738/06

CPV-2a

AAT (Asn)

GTA (Val)

RJ803/06

CPV-2a

AAT (Asn)

GTA (Val)

RJ814/06

CPV-2b

GAT (Asp)

GTA (Val)

RJ815/07

CPV-2b

GAT (Asp)

GTA (Val)

66

RJ818/07

CPV-2b

GAT (Asp)

GTA (Val)

RJ825/07

CPV-2b

GAT (Asp)

GTA (Val)

RJ868/08

CPV-2a

AAT (Asn)

GTA (Val)

RJ893/08

CPV-2a

AAT (Asn)

GTA (Val)

RJ898/08

CPV-2b

GAT (Asp)

GTA (Val)

RJ913/08

CPV-2b

GAT (Asp)

GTA (Val)

RJ925/08

CPV-2b

GAT (Asp)

GTA (Val)

RJ926/08

CPV-2b

GAT (Asp)

GTA (Val)

RJ933/08

CPV-2b

GAT (Asp)

GTA (Val)

RJ934/08

CPV-2c

GAA (Glu)

GTA (Val)

RJ944/09

CPV-2b

GAT (Asp)

GTA (Val)

Uma amostra coletada no fim de 2008 (RJ934/08) apresentou o cdon GAA


no AA 426 da protena de capsdeo VP2. A presena do cdon para cido
Glutmico caracterizou a amostra como CPV-2c (Glu-426). A comparao desta
amostra 2c (RJ934/08) com os demais tipos de CPV-2c descritos na Amrica do
Sul demonstrou 100% de similaridade em aminocidos na regio sequenciada
(Figura 10).
A anlise de homologia de nt e AA realizada a partir das sequncias
parciais de VP2, das amostra de ces no vacinados (Figura 11) demonstrou que
a amostra 2c deste estudo (RJ934/08) e os demais isolados CPV-2c da Amrica
do Sul se agruparam.

Estas amostras se inseriram em um grupo maior com

outras dez amostras CPV-2b deste estudo (coletadas de 2004 a 2008), uma
amostra CPV-2b de 2007 do Rio Grande do Sul (FJ23608) e o isolado CPV-2
(M38245).
Das 18 amostras caracterizadas como CPV-2a neste estudo (Tabela 2), 13
agruparam-se

com

demais

isolados

de

CPV-2a

(M240000,

DQ340434,

DQ340408) (Figura 11). A nica amostra de co no vacinado coletada em 2009


(RJ944/09) permaneceu isolada filogeneticamente das demais (Figura 11).

67

Figura 10. Comparao entre as sequncias nucleotdicas dos isolados de


parvovrus canino tipo 2c detectados na Amrica do Sul. Em destaque em
vermelho as mutaes pontuais detectadas nos diferentes isolados.

68

7 RJ004/95

RJ369/02
RJ164/98
RJ736/06
CPV-2A (DQ340408)
RJ305/01
RJ223/99
RJ251/00
25

RJ183/99
RJ893/08
RJ129/97
CPV-2A (M24000)
RJ083/96
RJ167/98
CPV-2 (EU659116)
CPV-2A (DQ340434)

17

RJ126/97
CPV-2 (M38245)
RJ818/07
RJ926/08
RJ815/07
CPV-2C (EU797727)
40

CPV-2C (EF375482)

64

RJ934/08
CPV-2C (FJ349322)

51

44

RJ814/06
CPV-2B (FJ236068)
RJ825/07
RJ596/04
RJ925/08
RJ630/05

61

RJ542/04
RJ898/08

RJ426/03
RJ708/06

35

RJ933/08

82

RJ913/08
RJ738/06
27

RJ803/06
RJ868/08
RJ944/09

0.005

Figura 11. Dendograma construdo a partir das anlise de um fragmento (563


pb) do gene que codifica para a protena de capsideo VP2 das amostras de
parvovrus canino de ces no vacinados e amostras de CPV no GenBank. A
barra na parte inferior da figura proporcional distncia gentica.

69

6.3 - Monitoramento dos tipos de Parvovirus Canino (CPV) em filhotes de


ces vacinados apresentando gastrenterite no Estado do Rio de Janeiro
Para a realizao deste estudo, 37 amostras de ces vacinados
consideradas positivas para CPV pelas tcnicas de HA/HI e PCR foram
analisadas.
As amostras foram coletadas de filhotes com idade entre dois e 10 meses
que haviam recebido uma (20), duas (12) ou trs (5) doses de vacina. Dos cinco
filhotes que receberam trs doses de vacina, trs apresentavam idade inferior a
quatro meses no momento da ltima dose, um apresentava mais de quatro meses
e para o ltimo, este dado no estava disponvel (Tabela 3).
Em relao ao tipo de CPV utilizado na preparao da vacina, verificou-se
que 20 filhotes receberam vacina mono ou polivalente constituda com CPV-2.
Outros trs receberam vacina constituda pelo tipo CPV-2b. Para 14 filhotes, este
dado no estava disponvel (Tabela 3).
Dos 27 filhotes cuja data da ltima vacinao era conhecida, para cinco o
intervalo entre a vacinao e o aparecimento dos sinais clnicos foi de trs a nove
dias. Para outros 22 animais este intervalo foi superior a 10 dias (Tabela 3).
Tabela 3. Idade e condio vacinal dos ces e tipo de parvovrus canino
detectado nas 37 amostras fecais coletadas de ces vacinados no Rio de
Janeiro no perodo de 1995-2009.
Amostra

Idade
(Meses)

Tipo de CPV
da vacina

Nmero de
doses de
vacina

Intervalo entre
vacinao e
aparecimento dos
sintomas

Tipo de CPV
detectado

RJ304/01

CPV-2b

3- 9 dias

CPV-2a

RJ006/95

CPV-2

> 9 dias

CPV-2a

RJ353/01

CPV-2

> 9 dias

CPV-2a

RJ735/06

ND*

> 9 dias

CPV-2b

RJ833/07

CPV-2

> 9 dias

CPV-2b

RJ834/07

CPV-2

> 9 dias

CPV-2a

RJ936/08

ND

> 9 dias

CPV-2b

70

RJ905/08

ND

ND

CPV-2a

RJ302/01

CPV-2

> 9 dias

CPV-2a

RJ688/06

CPV-2

3- 9 dias

CPV-2b

RJ089/96

CPV-2

> 9 dias

CPV-2a

RJ705/06

CPV-2

> 9 dias

CPV-2b

RJ840/07

ND

> 9 dias

CPV-2b

RJ914/08

ND

> 9 dias

CPV-2b

RJ948/09

CPV-2

> 9 dias

CPV-2b

RJ242/00

CPV-2

ND

CPV-2a

RJ741/06

ND

ND

CPV-2a

RJ349/01

ND

3- 9 dias

CPV-2a

RJ835/07

CPV-2

3- 9 dias

CPV-2b

RJ107/97

CPV-2

> 9 dias

CPV-2a

RJ928/08

ND

ND

CPV-2b

RJ001/95

CPV-2

> 9 dias

CPV-2a

RJ159/98

ND

> 9 dias

CPV-2a

RJ339/01

ND

> 9 dias

CPV-2a

RJ371/02

ND

ND

CPV-2a

RJ951/09

CPV-2b

ND

CPV-2a

RJ209/99

CPV-2

3- 9 dias

CPV-2a

RJ014/95

CPV-2

> 9 dias

CPV-2a

RJ892/08

ND

ND

CPV-2a

RJ83/07

CPV-2

> 9 dias

CPV-2b

RJ355/02

CPV-2

> 9 dias

CPV-2a

RJ706/06

CPV-2

> 9 dias

CPV-2b

RJ931/08

CPV-2

> 9 dias

CPV-2b

RJ336/01

ND

ND

CPV-2a

RJ446/04

ND

ND

CPV-2a

RJ901/08

CPV-2b

ND

CPV-2b

RJ422/03

10

CPV-2

> 9 dias

CPV-2a

*ND- Informao no disponvel

Inicialmente, para a caracterizao dos novos tipos de CPV nas amostras, as


diferenas nos AA 426 e 555 foram analisadas aps PCR e sequenciamento com
o par de iniciadores 555For/555Rev para o gene que codifica para VP2.
As sequncias obtidas a partir de amostras de ces vacinados foram
depositadas no GenBank (nmero de acesso:FJ998133-FJ998169). Quatro

71

vacinas constitudas de duas diferentes cepas de CPV e utilizadas no Brasil foram


tambm submetidas a amplificao com o par de iniciadores 555For/555Rev e
sequenciadas: Octa-Cino-Vacin, Biovet (CPV-2); Recombitec, Merial (CPV-2);
Vanguard, Pfizer (CPV-2) and Duramune Max5 FortDodge (CPV-2b) (Tabela 4).
As principais alteraes nucleotdicas observadas entre as sequncias
parciais de VP2 geradas neste estudo a partir das 37 amostras clnicas, quatro
amostras vacinais e os isolados obtidos no GenBank, esto descritas na Tabela 4.
Tabela 4. Caracterizao genmica dos parvovrus caninos detectados nas
37 amostras de ces vacinados e nas quatro amostras de vacinas a partir da
anlise da sequncia parcial do gene que codifica para a protena de
capsdeo VP2 .
Sequncias de CPV
obtidas do
GenBank

Tipo

AA 297

AA 300

AA 305

AA 426

AA 555

AA 574

nt 3675

nt 3685

nt 3699

nt 4062

nt 4449

nt 4458

M38245

CPV-2

T (Ser)

C (Ala)

G (Asp)

AAT(Asn)

GTA(Val)

M24000

CPV-2a

T (Ser)

G (Gly)

T (Tyr)

AAT(Asn)

ATA (Ile)

DQ340434

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT Asn)

GTA(Val)

DQ340409

CPV-2b

G (Ala)

G (Gly)

T (Tyr)

GAT(Asp)

GTA(Val)

Ab437433
(Recombinante)

CPV-2/CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT Asn)

GTA(Val)

Ab437434
(Recombinante)

CPV-2/CPV-2b

G (Ala)

G (Gly)

T (Tyr)

GAT(Asp)

GTA(Val)

Octa-Cino-Vacin,
Biovet

CPV-2

NR**

NR

NR

AAT(Asn)

GTA(Val)

Recombitec ,
Merial

CPV-2

NR

NR

NR

AAT(Asn)

GTA(Val)

Vanguard,
Pfizer

CPV-2

NR

NR

NR

AAT(Asn)

GTA(Val)

Duramune Max5
FortDodge

CPV-2b*

G (Ala)

G (Gly)

T (Tyr)

GAT(Asp)

GTA(Val)

Amostras

Tipo detectado

297

300

305

426

555

574

nt 3675

nt 3685

nt 3699

nt 4062

nt 4449

nt 4508

RJ001/95

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ006/95

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ014/95

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ089/96

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ107/97

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ159/98

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

72

RJ209/99

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ242/00

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ302/01

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ304/01

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ336/01

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ339/01

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ349/01

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ353/01

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ355/02

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ371/02

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ422/03

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ446/04

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ688/06

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ705/06

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ706/06

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ735/06

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ741/06

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ833/07

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ834/07

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ835/07

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ837/07

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ840/07

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ892/08

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ901/08

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ905/08

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

RJ914/08

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ928/08

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ931/08

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ936/08

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ948/09

CPV-2b

NR

NR

NR

GAT (Asp)

GTA(Val)

RJ951/09

CPV-2a

G (Ala)

G (Gly)

T (Tyr)

AAT (Asn)

GTA(Val)

* Substituio AG no nucleotdeo 4494 (AA570)


** NR = no realizado

Dos 20 ces que receberam vacina constituda por CPV-2, oito apresentaram
Asp-426 e Val-555 e foram caracterizadas como CPV-2b. Doze amostras
apresentaram Asn-426 e Val-555 e a anlise destes dois resduos no foi

73

suficiente para a caracterizao do tipo de CPV na amostra. Para as trs amostras


de animais que receberam vacina constituda de CPV-2b, duas foram
caracterizadas como CPV-2a. Para o outro filhote que recebeu vacina constituda
por CPV-2b, a infeco pelo 2b selvagem foi confirmada atravs da anlise do
resduo 570 (nt 4494), j que o tipo 2b utilizado nesta vacina (Duramune CPV-2b)
possui uma mutao caracterstica neste AA (nt 4494 A-G) (Figura 12).

Figura 12. Sequncias nucleotdicas da amostra caracterizada como


parvovrus canino 2b selvagem (RJ901/08) e amostra CPV-2b vacinal (vacina
Duramune Max5) Em destaque a mutao pontual no nt 4494, presente na
amostra vacinal.
Para os 14 filhotes cuja informao sobre o tipo da vacina no estava
disponvel, cinco foram caracterizados como CPV-2b selvagem pela anlise do
resduo 570 (nt 4494). Nove amostras apresentaram Asn-426 e Val-555 e tambm
no puderam ser caracterizadas pela anlise dos resduos 426 e 555.

74

Portanto, para 21 amostras (12 de animais vacinados com o tipo CPV-2 e


nove de filhotes sem informao sobre o tipo da vacina) uma segunda regio do
genoma da VP2 foi sequenciada a partir dos iniciadores HFor/Hrev. Pela anlise
desta regio todas as amostras foram caracterizadas como CPV-2a (Tabela 4).
Nas 18 amostras coletadas de 1995 a 2004, somente o tipo CPV-2a foi
detectado. De 2006 a 2009, ambos CPV-2a (5) e CPV-2b (14) foram detectados,
sendo o tipo 2b predominante.
Todas as amostras caracterizadas como CPV-2a em filhotes vacinados
apresentaram uma mutao no sinnima no resduo 297 (SerAla) e no residuo
555 (IleVal) (Tabela 4).
Uma mutao sinnima no nt 5408 (AG), resduo 574

tambm foi

observada em 15/37 amostras (14 CPV-2a e uma CPV-2b) (Tabela 4).


O dendograma das sequncias parciais de VP2 em 37 amostras de ces
vacinados, quatro vacinas para CPV e isolados obtido no GenBank demonstrou
que todas as amostras CPV-2b agruparam-se junto com a vacina CPV-2b

25

outras amostras CPV-2b e CPV-2c da Amrica do Sul. As vacinas constitudas


por CPV-2

26

se mantiveram distantes filogeneticamente das demais amostras

clnicas e prottipos de CPV (Figura 13).


As amostras de CPV-2b e CPV-2c, coletadas aps 2006, agruparam
juntamente com variantes recombinantes descritas recentemente em animais
vacinados (CPV-2/CPV-2a e CPV-2/2b) (MOCHIZUCK et al., 2008) (Figura 13).

DuramuneMax
26
Vanguard Octa-cino-vac e Recombitec
25

75

CPV-2C (EF375482)

41
64

CPV-2C (FJ349322)
CPV-2C (EU797727)

RJ835/07
RJ706/06
RJ936/08
RJ833/07

3
65

RJ840/07
Duramune Max5 FortDodge
CPV-2B (FJ236068)

CPV-2 (M38245)
64

RJ735/06
RJ837/07
CPV recombinante AB437433
65

CPV recombinante AB437434

RJ688/06
RJ928/08
RJ901/08
RJ948/09
RJ914/08
RJ931/08
RJ705/06
RJ339/01
CPV-2 (EU659116)
RJ107/97
RJ355/02
RJ446/04
RJ905/08

64

RJ741/06
2

RJ001/95
RJ242/00
RJ892/07
RJ834/07
64

RJ951/09
RJ422/03

CPV-2A (M24000)
RJ336/01
CPV-2A (DQ340434)
64

RJ014/95
RJ371/02
RJ302/01
RJ353/01
RJ089/06
RJ304/01

RJ159/98
CPV-2A (DQ340408)
RJ349/01
RJ209/99
RJ006/05
Vanguard Pfizer
86

Octa-Cino-Vacin Biovet
Recombitec Merial

0.005

Figura 13. Dendograma elaborado a partir das anlise de um


fragmento (563 pb) do gene que codifica para a protena de capsideo VP2 de
37 ces vacinados, quatro vacinas para parvovrus canino e amostras
padro e recombinantes de CPV obtidas no GenBank. A barra na parte
inferior da figura proporcional distncia gentica.

76

6.4 Caracterizao molecular dos parvovrus em amostras de gatos


domsticos no Estado do Rio de Janeiro e comparao com os tipos de
parvovrus encontrados em amostras caninas.
As sequncias obtidas a partir das seis amostras fecais de felinos domsticos
(cinco com sinais clnicos de gastrenterite e um assintomtico) coletadas em 2004
na cidade do Rio de Janeiro foram comparadas com outras amostras de CPV
obtidas de ces no ano de 2004-2005 e com isolados felinos e caninos obtidos no
GenBank de diferentes pases: FPLV EUA (M38246), FPLV Japo (AB000064),
FPLV Argentina (EU018145), FPLV Frana (AY606131), FPLV Itlia (EU498693),
FPLV Alemanha (AY742937), CPV-2 M38245, CPV-2A M24000, CPV-2a
(F306449), CPV-2b (FJ236068), CPV-2c (EU797727).
As sequncias foram comparadas tambm com isolados recombinantes
recentemente descritos em felinos (OHSHIMA; MOCHIZUKI, 2008) (EF988660) e
primatas (FJ231389) (YANG, 2009) (Tabela 5).
As amostras felinas foram caracterizadas FPLV atravs da anlise das
regies 300, 305, 323, 564 e 568. Entretanto, duas amostras apresentaram
mutaes no-sinnimas em resduos importantes para a caracterizao dos tipos
de parvovrus caninos: a amostra felina RJ620/04 apresentou uma substituio de
nt (3909 GA) que gerou uma mudana na regio 375 (Asp Asn), semelhante
s amostras de CPV-2; a amostra RJ606/04 apresentou uma substituio de nt
(4062 AG) que gerou uma mudana na regio 426 (AsnAsp), semelhante ao
tipo CPV-2b.
As quatro amostras caninas foram caracterizadas pela anlise dos resduos
426 e 555 como CPV-2a (1) e CPV-2b (3). Duas amostras caninas apresentaram
uma mutao no-sinnima no resduo 297 (SerAsn). A amostra canina
RJ596/04 apresentou tambm duas mutaes no-sinnimas em AA importantes
para definio do espectro de hospedeiro entre FPLV e CPV: resduos 564
(SerAsn) e 568 (GlyAla), normalmente observados nos FPLV.

77

Tabela 5. Diferenas de nucleotdeos e aminocidos encontradas no


fragmento de 1171 pb do gene que codifica para a protena de capsdeo VP2
dos parvovrus detectados em seis amostras felinas e quatro amostras
caninas coletadas em 2004-2005.

Nmero de
Acesso
GenBank

nt

297

300

305

323

375

426

555

564

568

3675

3685

3699

3753

3909

4062-64

4449

4477

4489

A-Asn
G-Ser

C-Ala
G-Gly
Ala
Ala

T-Ser
A-Asn

C-Ala G-Asp G-Asp G-Asp AAT-Asn G-Val


G-Gly T-Tyr A-Asn A-Asn GAT-Asp
GAA-Glu

FPLV M38246 EUA

Ser

Ala

Asp

Asp

Asp

Asn

Val

FPLV AB000064 JAP

Ser

Ala

Asp

Asp

Asp

Asn

Val

Asn
Asn

FPLV EU018145 ARG

Ser

Ala

Asp

Asp

Asp

Asn

Val

Asn

Ala

FPLV AY606131 FRA

Ser

Ala

Asp

Asp

Asp

Asn

Val

Asn

Ala

FPLV EU498693 ITA

Ser

Asp

Asp

Asp

Asn

Val

Asn

Ala

FPLV AY742937 GER

Ser

Ala
Ala

Asp

Asp

Asp

Asn

Val

Asn

Ala

FPLV FJ231389
Recombinante Primata

Ser

Ala

Asp

Asn

Asp

Asn

Val

Ser

Ala

FPLV EF988660
Recombinante Felino

Ser

Ala

Asp

Asp

Asp

Asn

Val

Asn

Ala

CPV-2 M38245

Ser

Ser

Asp

Asn

Asn

Asn

Val

Ser

Gly

Ser

Gly

Tyr

Asn

Asp

Asn

Ile

Ser

Gly

CPV-2a F306449

Ser

Gly

Tyr

Asn

Asp

Asn

Val

Ser

Gly

CPV-2b FJ236068

Ser

Gly

Tyr

Asn

Asp

Asp

Val

Ser

Gly

CPV-2c EU797727

Ser

Gly

Tyr

Asn

Asp

Glu

Val

Ser

Gly

Amostra

297

300

305

323

375

426

555

564

568

Tipo

RJ606/04

Ser

Ala

Asp

Asp

Asp

Asp

Val

Asn

Ala

FPLV

RJ616/04

Ser

Ala

Asp

Asp

Asp

Asn

Val

Asn

Ala

FPLV

RJ617/04

Ser

Ala

Asp

Asp

Asp

Asn

Val

Asn

Ala

FPLV

RJ618/04

Ser

Ala

Asp

Asp

Asp

Asn

Val

Asn

Ala

FPLV

RJ620/04

Ser

Ala

Asp

Asp

Asn

Asn

Val

Asn

Ala

FPLV

RJ628/04

Ser

Ala

Asp

Asp

Asp

Asn

Val

Asn

Ala

FPLV

RJ446/04

Ser

Gly

Tyr

Asn

Asp

Asn

Val

Ser

Gly

CPV-2a

RJ542/04

Asn

Gly

Tyr

Asn

Asp

Asp

Val

Ser

Gly

CPV-2b

RJ596/04

Asn

Gly

Tyr

Asn

Asp

Asp

Val

Asn

Ala

CPV-2b

RJ630/05

Ser

Gly

Tyr

Asn

Asp

Asp

Val

Ser

Gly

CPV-2b

CPV-2a M24000

78

A anlise de homologia de nt e AA foi realizada a partir do gene que


codifica para VP2 com as amostras felinas, caninas e isolados felinos e caninos de
outros pases obtidos no GenBank. Todas as seis amostras felinas sequenciadas
formaram juntas um grupo distante dos demais isolados felinos de outros pases e
dos tipos caninos. As amostras RJC542, que apresentou uma mutao no
sinnima no AA 297 e a RJC596/04 que apresentou trs mutaes no sinnimas
(AAs 297, 564 e 568), permaneceram distantes das demais amostras e isolados
de CPV e FPLV. O dendograma das sequncias parciais de VP2 de felinos
descrito na Figura 14.

79

88 RJF616/04
53

RJF617/04

40

RJF618/04
RJF620/04

80

RJF606/04
47

96

RJF628/04

FPV EU018145 ARG


FPV M38246

56

34

63 FPV M38246 USA

FPV AB000064 JAP

37

FPV EU498693 ITA


FPV REC EF988660

83

FPV AY606131 FRA

69

FPV AY742937 GER


RJC542/04

49

RJC596/04
59 RJc446/04

FPV REC MONKEY FJ231389

92

32 RJC630/05
49

48

CPV-2c EF599098
CPV-2a M24000
cpv-2 M38245

40

CPV-2b DQ340409
61

CPV REC AB437433


64 CPV REC AB437434

0.002

Figura 14. Dendograma elaborado a partir das anlise de um


fragmento (1171 pb) do gene que codifica para a protena de capsideo VP2
das seis amostras felinas e quatro amostras caninas deste estudo e isolados
felinos e caninos obtidos no GenBank. Em destaque as amostras caninas
que apresentaram mutaes em AA importantes na determinao do
espectro de hospedeiro dos parvovrus. A barra na parte inferior da figura
proporcional distncia gentica.

80

7- DISCUSSO

Desde que emergiu em 1978 como um novo patgeno de ces, o CPV


apresenta um modelo contnuo de evoluo, com o aparecimento e circulao de
novos tipos e variantes na populao canina (TRUYEN, 1999; HOELZER;
PARRISH, 2010).
Neste estudo, ao comparar os resultados obtidos na PCR com os pares de
iniciadores P2For/P2Rev e P2abFor/P2abRev com a caracterizao dos tipos
atravs do sequenciamento neste estudo observou-se que a PCR foi capaz de
diferenciar com sucesso os tipos antigo (CPV-2) e novos (CPV-2a, 2b e 2c) do
vrus, o que importante para a confirmao do diagnstico da infeco por CPV
em animais que receberam vacinas constitudas pelo tipo antigo. Entretanto,
somente o sequenciamento parcial do gene que codifica para VP2 permitiu a
observao

de

mutaes

sinnimas

no-sinnimas,

essenciais

para

caracterizao dos tipos novos e para o estudo filogentico das amostras.


Este o primeiro estudo de caracterizao molecular dos tipos e variantes
de parvovrus em circulao no Estado do Rio de Janeiro por sequenciamento e
atravs da anlise do fragmento do gene que codifica para a protena VP2, foi
possvel detectar os trs tipos de CPV (2a, 2b e 2c), alm da variante CPV-2a
(555-Val).
Neste trabalho, a caracterizao de amostras de CPV coletadas no perodo
de 1995 a 2009 evidenciou o ressurgimento do tipo 2b na populao canina aps
81

2004, sua co-circulao com o tipo 2a at 2008 e a descrio do tipo 2c em 2008.


Sabe-se que o tipo 2b foi descrito no perodo de 1980 a 2000 em co-circulao
com o tipo 2a no Brasil at 1986. Aps este perodo ocorreu uma substituio
gradual do tipo 2b pelo 2a, at que em 1990 o tipo 2b no foi mais detectado
(PEREIRA; LEAL; DURIGON, 2007). (Anexo 2).
Em vrios aspectos, a histria epidemiolgica do CPV no Brasil se
assemelha ao de outros pases, evidenciando um processo de substituio de
variantes por outras mais adaptadas e evoluo de novos tipos. A razo desta
substituio est relacionada vantagens replicativas adquiridas por estas
mutaes e uma disseminao mais eficiente do vrus no ambiente (PEREIRA;
LEAL; DURIGON, 2007; OHSHIMA et al., 2008).
Os resultados deste trabalho tambm representam a primeira descrio do
tipo CPV-2c no Estado do Rio de Janeiro. Este tipo foi detectado pela primeira vez
na Argentina em 2003 (CALDERON et al., 2009), Uruguai em 2007 (PRES et al.,
2007) e no Rio Grande do Sul no incio de 2008 (STRECK et al., 2008).

proximidade geogrfica destas regies e a observao deste novo tipo no Rio de


Janeiro no final de 2008 evidencia a expanso do CPV-2c pelo pas e sua
circulao com os demais novos tipos antignicos 2a e 2b.
Alm das mutaes j descritas e utilizadas na caracterizao dos tipos,
duas mutaes sinnimas foram observadas nas amostras estudadas (resduos
440 e 574). O resduo 440 se localiza na regio de loop GH da protena VP2, que
apresenta maior variabilidade entre os parvovrus de carnvoros (BATTILANI et al.,
2002). Estas mutaes no foram correlacionadas ao tipo do CPV detectado (2a,
2b ou 2c) e a consequncia fenotpica destas mutaes ainda no est clara, mas
sua permanncia na populao canina estudada pode representar uma adaptao
local destas variantes.
Ao realizar a anlise de homologia de nt e AA das amostras de ces no
vacinados, o tipo CPV-2c detectado no Rio de Janeiro formou com os demais 2c
da Amrica do Sul um grupo independente, que pode ser explicado pelas poucas
diferenas de nucleotdeos observadas entre esses isolados. Este grupo se inseriu
em um grupo maior de amostras 2b. As mutaes pontuais, mesmo as sinnimas

82

(AA 440 e 574), so provavelmente responsveis pela formao do grupo maior


que agregou as variantes de CPV-2b mais recentes.
A ocorrncia de mutaes aleatrias, selecionadas pela presso
imunolgica parece ser o principal mecanismo de evoluo dos parvovrus
(SHACKELTON et al., 2005; HOELTZER; PARRISH, 2010).
Em um ambiente com alta taxa de mutao e condies termodinmicas
instveis, a entidade auto-replicante chega a um mximo de aptido replicativa.
Esta entidade auto-replicante no representada por uma nica partcula viral
mas por um conjunto de varias partculas virais que iro se destacar de acordo
com as vantagens adaptativas que o seu fentipo traga em relao ao ambiente
ou com a sua capacidade de produzir prognies (MAS et al., 2010).
A diversidade gentica viral que surge a partir destas mutaes
importante para a sobrevivncia da populao viral como um todo. A presena de
presses seletivas, como a presso imunolgica favorecem o aparecimento de
mutaes com benefcios em seus fentipos. Esses mutantes so esperados para
sobreviver e agir como os fundadores para a prxima gerao (MAS et al., 2010).
Antes da descrio de variantes recombinantes de CPV na natureza,
somente a alta taxa de mutao do genoma DNA e a seleo positiva das
mutaes foram os mecanismos associados ao surgimento e evoluo da CPV
(SHACKELTON et al., 2005)
Em 2008 foi descrito pela primeira vez a ocorrncia de amostras
recombinantes de CPV (CPV-2/2a e CPV-2/2b) provenientes de amostras clinicas
de ces diarricos que haviam recebido vacinas atenuadas constitudas por CPV2 (MOCHIZUKI et al., 2008). Para que ocorra o evento de recombinao
fundamental que a clula intestinal seja co-infectada pelos tipos selvagens e pelo
tipo vacinal e a administrao da vacina provavelmente ocorreu durante o perodo
de incubao da infeco (MOCHIZUKI et al., 2008) e este um risco potencial
geral do uso de vacinas atenuadas que no se limita ao CPV.
Com a co-circulao dos novos tipos (2a, 2b e 2c) no Brasil, existe a
discusso se as possveis mudanas antignicas decorrentes de mutaes
genticas que levaram ao aparecimento destes tipos poderiam ou no alterar de
forma significativa as propriedades antignicas dos vrus interferindo na eficcia
83

das vacinas constitudas pelo tipo antigo (CPV-2) (DECARO et al., 2006-a; 2008;
MEERS et al., 2007; PRES et al., 2007; LARSON; SCHULTZ, 2008;
CALDERON et al., 2009; SCHULTZ et al., 2010). Alm disso, no se sabe se as
vacinas atualmente disponveis poderiam proteger os ces contra a infeco por
variantes recombinantes, o que torna ainda mais importante o monitoramento
genmico dos tipos de CPV em ces vacinados (MOCHIZUKI et al., 2008).
Os tipos vacinais no foram detectados em nenhuma das amostras
estudadas, mesmo naquelas cinco coletadas de trs a nove dias aps a
vacinao, perodo no qual possvel se detectar o vrus vacinal nas fezes por HA
(CARMICHAEL; JOUBERT; POLLOCK, 1981) no evidenciando a ocorrncia de
reverso virulncia nos casos de enterite ps vacinao nesse estudo.
Resultados similares foram descritos por

DECARO et al. (2006), que

demonstraram a alta estabilidade e baixo risco de reverso virulncia das


vacinas atenuadas atualmente disponveis.
A mutao no AA 297 (297 SerAla), observada em todas as amostras de
CPV-2a nos ces vacinados vem sido descrita desde 1990 e se tornou
predominante nos tipos 2a e 2b em diferentes pases (BATINALLI et al., 2002;
MARTELLA et al., 2005-a), incluindo Brasil (PEREIRA; LEAL; DURIGON, 2007).
Apesar da observao de mutaes pontuais ao longo do fragmento
genmico sequenciado, estas alteraes aparentemente no afetaram os AA
importantes relacionados antigenicidade do vrus e no parecem comprometer
a capacidade das vacinas em proteger os filhotes contra os tipos de CPV em
circulao.
Entretanto, a anlise de homologia de nt e AA das amostras fecais de ces
vacinados e das vacinas demonstrou que a vacina constituda com o tipo novo do
vrus (CPV-2b) se localizou filogeneticamente mais prxima dos tipos de CPV em
circulao do que as vacinas constitudas pelo tipo antigo do vrus (CPV-2). As
vacinas constitudas pelo CPV tipo antigo so produzidas com cepas isoladas no
incio da dcada de 80, o que explica a distncia de homologia de nt e AA
observada.

84

Analisando os dados clnicos dos animais, foi possvel observar que a


maioria das amostras (37 amostras ou 54%) foi coletada de filhotes com dois a
quatro meses de idade. Nesta faixa etria, muitos animais ainda no completaram
o protocolo de vacinao sugerido de trs doses com intervalos de 21 a 30 dias
(MOORE, 1983; DAVIS-WURZLER, 2006).
Alm disso, durante o perodo de suscetibilidade os anticorpos maternos
adquiridos via colostro nos primeiros dias de vida do filhote so capazes de
bloquear o vrus vacinal mas no so capazes de proteger o co da infeco pelo
vrus selvagem (MOORE, 1983; DAVIS-WURZLER, 2006). Estes anticorpos
permanecem em circulao no co at no mximo os quatro meses de vida,
quando decrescem nveis indetectveis. Portanto nesta idade (quatro meses) os
casos de falha vacinal podem ocorrer a despeito do protocolo de vacinao
adotado pelo clnico (CHAPPUIS, 1998). Por esta razo, os filhotes devem
receber mltiplas doses de vacina para CPV, iniciando com dois meses de idade
e, uma vez que os anticorpos maternos podem persistir at o 4 ms de vida, o
protocolo vacinal no deve ser interrompido antes desta idade (MOORE, 1983;
DAVIS-WURZLER, 2006).
De fato, dos cinco ces que receberam trs doses de vacina para CPV,
somente um possua idade superior a quatro meses no momento da terceira
dose. Uma vez que este co era um filhote da raa Rottweiller, esta aparente
falha vacinal pode estar relacionada a uma maior suscetibilidade em ces desta
raa, que parecem ser refratrios imunizao, apesar da adoo do protocolo
vacinal recomendado (MOORE, 1983; DAVIS-WURZLER, 2006).
Os ces vacinados podem eliminar vrus vacinal nas fezes, acompanhado
ou no de uma variante selvagem (DECARO et al., 2006-a). A maioria dos testes
utilizados rotineiramente no diagnstico da infeco pelo CPV (HA/HI, EIE e
testes imunocromatogrficos) no so capazes de distinguir o tipo vacinal do
selvagem e casos de gastrenterite logo aps a vacinao podem ser
diagnosticados

erroneamente

como

infeco

pelo

JOUBERT; POLLOCK, 1980; DECARO et al., 2006-a).

85

CPV

(CARMICHAEL;

Conforme observado, somente o sequenciamento parcial do gene que


codifica para a protena de capsdeo VP2 permitiu realizar a distino entre o
CPV-2b selvagem e vacinal (DESARIO et al., 2005, MEERS et al., 2007).
Os casos de infeco por CPV nos animais vacinados neste estudo no
foram relacionados a mutaes nos tipos dos vrus em circulao, mas podem ser
atribudos a um protocolo vacinal incompleto, com a administrao da ltima dose
antes do 4 ms de vida do filhote.
Devido a alta resistncia do vrus no ambiente, principalmente em abrigos e
canis (SIELG, 1984) essencial que os proprietrios minimizem a exposio dos
filhotes a locais contaminados, principalmente filhotes da raa Rottweiller
(MOORE,1983; DAVIS-WURZLER,2006), at o trmino do esquema de vacinao
e a infeco pelo CPV em animais vacinados deve ser continuamente monitorada
a fim de acompanhar o potencial efeito das possveis mudanas antignicas
decorrentes de mutaes genticas sobre a eficcia das vacinas.
Embora os FPLV e CPV sejam altamente relacionados a nvel gentico,
apresentam um padro de evoluo completamente diferente. Enquanto o FPLV,
desde a sua primeira identificao em 1920 no sofreu mudanas significativas
nas propriedades antignicas e biolgicas e evolui mantendo sua especificidade
de hospedeiro, o CPV, desde o seu aparecimento no final de 1970, tem vindo
evoludo progressivamente sob presso seletiva, dando origem a variantes
antignicas que substituiram o CPV-2 original e readquiriram a capacidade de se
replicar em felinos (DECARO et al., 2008).
Um estudo anterior realizado com 159 amostras fecais de felinos
domsticos confirmou por HA/HI e PCR, a presena de parvovrus associados a
casos de gastrenterite no Rio de Janeiro em

seis amostras fecais de gatos

domsticos (MIRANDA et al., 2006).


Apesar da recente descrio de casos graves de gastrenterite em felinos
domsticos associados ao CPV-2c (DECARO et al., 2010), neste estudo no foi
evidenciada a infeco por CPV em gatos e todas as seis amostras felinas foram
caracterizadas como FPLV.

86

Entetanto em trs amostras fecais foram caracterizados tipos de CPV e


FPLV com mudanas em AA importantes inesperadas: duas amostras felinas
apresentaram alteraes em regies importantes para a determinao do espectro
de hospedeiro (375 e 426), observadas somente nos CPV-2 e CPV-2b
respectivamente. Da mesma forma, uma amostra canina coletada em 2004
(RJC596/04) tambm apresentou duas mutaes, nos resduos 564 e 568,
esperadas somente em amostras de FPLV, e a anlise de homologia de nt e AA
mostrou que esta amostra se localizou mais prxima dos isolados felinos que as
demais amostras caninas.
Como o FPLV e CPV circulam na populao canina e felina no Rio de
Janeiro (MIRANDA, 2006; CASTRO et al., 2007; SILVA, 2010), uma das
explicaes para o

aparecimento destas mutaes a ocorrncia de

recombinao entre os parvovrus.


O surgimento de variantes recombinantes de CPV em amostras selvagens
foi observado pela primeira vez em 2008 por Mochizuki et al. em ces vacinados
com CPV-2 e os tipos detectados foram caracterizados como recombinantes CPV2/2a e CPV-2/2b.
Posteriormente foi descrito a partir de uma amostra diarrica de um felino
domstico, o primeiro recombinante FPLV/CPV constitudo por uma combinao
do gene que codifica para NS1/NS2 do CPV-2b e do gene que codifica para VP2
do FPLV (OSHIMA; MOCHIZUKI, 2008).
Em 2009, foi um parvovrus felino recombinante (FPLV) foi associado a um
surto de enterite hemorrgica em primatas jovens e as mutaes observadas em
AA importantes para determinao de espectro de hospedeiro nestes isolados
provavelmente permitiram que esta variante recombinante cruzasse a barreira
inter-espcie causando surto de doena grave em primatas (YANG et al., 2009).
A frequncia com que foram observadas mutaes nas amostras felinas
deste estudo (2/6) reforam a idia de que os FPLV da mesma forma que os CPV
tambm esto sujeitos a importantes eventos evolutivos.

87

A importncia dessas mutaes deve ser evidenciada atravs de futuras


anlises moleculares de outras regies do genoma, assim como pelo estudo de
infectividade destes vrus em cultivo celular de origem canina e felina.
Portanto, o contnuo monitoramento e caracterizao molecular das
amostras de CPV e FPLV so necessrios no somente para a identificao de
possveis mudanas genticas e antignicas que possam interferir na eficcia das
vacinas, mas tambm para trazer uma melhor compreenso sobre os mecanismos
que impulsionam a evoluo dos parvovrus no Brasil.

88

8-CONCLUSES

A infeco pelo CPV foi confirmada pelas tcnicas de HA/HI e PCR em 43%
(43/100) das amostras fecais diarreicas analisadas entre 2008-2009.

Pela PCR foi possvel diferenciar os tipos antigo (CPV-2) e novos (CPV-2a, 2b
e 2c), porm somente o sequenciamento parcial do gene que codifica para a
protena VP2 permitiu a caracterizao dos novos tipos de CPV e a deteco
de mutaes sinnimas e no-sinnimas nas amostras.

Foi evidenciada a co-circulao dos tipos 2a e 2b e descrito pela primeira vez


o tipo CPV-2c na populao canina do Estado do Rio de Janeiro.

As mutaes observadas nos parvovrus (CPV) detectados nas amostras


fecais de ces vacinados no afetaram os AA relacionados antigenicidade
do vrus e no comprometeram a capacidade global das vacinas em proteger
os filhotes contra os tipos em circulao.

Todas as amostras fecais de gatos domsticos deste estudo foram


caracterizadas como FPLV.

Duas amostras caracterizadas como FPLV e uma amostra canina coletadas no


mesmo perodo das felinas (2004) apresentaram mutaes no-sinnimas em
resduos importantes para a determinao do espectro de hospedeiro.

89

9- OBRAS CITADAS

AGBANDJE, M.; PARRISH, C.R.; ROSSMANN, M.G. The estructure of parvovirus.


Virology, v. 6, p.299-309, 1995.
ANGELO, M.; HAGIWARA, M.; JULY, J.; CARVALHO, R.; BACCARO, M.
Isolamento de parvovrus canino no Brasil.

Rev. Fac. Vet. Zootec. Univ. So

Paulo. v. 25, p.123-134, 1980.


APPEL, M.; SCOTT, F.; CARMICHAEL, L. Isolation and immunization studies of a
canine parvo-like virus from dogs with haemorrhagic enteritis. Vet. Rec. v.105,
p.156-159, 1979.
APPEL,

M.; PARRISH C. Canine parvovirus type 2.

In: APPEL, M.S. Virus

infections of carnivores. Elsevier Science Publishers, Amsterdam, 69-92, 1987.


BATTILANI, M.; SCAGLIARINI, A.; TISATO, E.; TURILLI, C.; JACOBONI, I.;
CASADIO, R.; PROSPERI, S. Analysis of canine parvovrus sequences from
wolves and dogs isolates in Italy. J. Gen. Virol. v.82, p.1555-60, 2001.
BATTILANI, M.; CIULLI, S.; TISATO, E.; PROSPERI, S. Genetic analysis of canine
parvovrus isolates (CPV-2) from dogs in Italy. Virus Res. v.83, p.149-157, 2002.
BATTILANI, M.; BASSANI, M.; FORTI, D.; MORGANTI, L. Analysis of the evolution
of feline parvovirus (FPLV). Vet. Res. Comm. v.30, p. 223-226, 2006.
BATTILANI, M.; GALLINA, L.; VACCARI, F.; MORGANTI, L. Co-infection with
multiple variants of canine parvovirus type 2 (CPV-2). Vet. Res. Comm. v. 31,
p.209-211, 2007.

90

BINN, L.; LAZAR, E.; EDDY, G.; KAJIMA, A. Recovery and characterization of a
minute virus of canides. Infect. Immunol. v.1, p. 503-508, 1970.
BOOM, R.; SOL, C.; SALIMANS, M. Rapid and simple method for purification of
nucleic acids. J. Clin. Microbiol. v.28, p.495-503, 1990.
BUONAVOGLIA, C.; TOLLIS, M.; BUONAVOGLIA, D.; PUCCINI, A. Response of
pups with maternal derived antibodies to midified-live canine parvovirus vaccine.
Comp. Immun. Microbio. Infect. Dis. v.15, n.4, p. 281-283, 1992.
BUONAVOGLIA, C.; MARTELLA, V.; PRATELLI, A.; TEMPESTA, M.; CAVALLI,
A.; GRECO, G.; BUONAVOGLIA, D. Evidence for evolution of canine parvovirus
type 2 in ITALY. J. Gen. Virol. v.82 p.3021-3025, 2001.
BURTONBOY, S.; CHARLIER, P.; HERTOGHS, J.; LOBMANN, M.; WISEMAN, A.;
WOODS, S. Performance of hight titre attenuated canine parvovirus vaccine in
pups with maternally derived antibody. Vet. Rec. v. 128, p. 377-381, 1991.
CALDERON, M.; MATTION, N.; BUCAFUSCO, D.; FOGEL, F.; REMORINI, P.; LA
TORRE, J. Molecular characterization of canine parvovirus strains in Argentina:
Detection of pathogenic variant CPV-2c in vaccinated dogs. J. Virol. Meth. v.159,
n.2, p.141-145, 2009.
CARMICHAEL, L.; JOUBERT, J.; POLLOCK, R. Hemagglutination by canine
parvovirus: serologic studies and diagnostic applications. Am. J. Vet. Res. v.41,
p.784-791, 1980.
CARMICHAEL, L. Canine parvovirus type-2. An evolving pathogen of dogs. Ann.
Vet. Med. v.135, p. 459464, 1994.
CARMICHAEL, L. E.; BINN, L. N. New enteric viruses in the dog. Adv. Vet. Sci.
Comp. Med. v.25, p.1-37, 1981.
CASTRO, T; MIRANDA, S.; LABARTHE, N.; SILVA, L.; CUBEL GARCIA, R.
Clinical and epidemiologocal aspects of canine parvovirus (CPV) enteritis in the
State of Rio de Janeiro: 1995- 2004. Arq. Bras. Med. Vet. Zootec. v.59, n.2, p.333339, 2007.
CHALMERS, W.; TRUYEN, U.; GREENWOOD, N.; BAXENDALE, W. Efficacy of
feline panleukopenia vaccine to prevent infection with an isolate of CPV2b
obtained from a cat. Vet. Microbiol. v. 69, p. 41-45, 1999.

91

CHAPPUIS, G. Neonatal immunity and immunisation in early age: lessons from


veterinary medicine. Vaccine v.16, n.13, p.1468-1472, 1998.
COSTA, A.; LEITE, J.; LABARTHE, N.; CUBEL GARCIA, R. Genomic typing of
canine parvovirus circulating in the State of Rio de Janeiro, Brazil from 1995 to
2001 using polymerase chain reaction assay. Vet. Res. Commun. v.29, n.8, p.735743, 2005.
CUBEL GARCIA, R.; PINTO, A.; COSTA, A.; MACIEL, B.; OLIVEIRA, L.;
NASCIMENTO, J.; SANTOS, A.; CASTRO, M.; WILLI, L.; LABARTHE, N. Canine
parvovirus infection in puppies with gastroenteritis in Niteri, Rio de Janeiro, from
1995 to 1997. Braz. J. Vet. Res. An. Sci., [Periodico on line]. v.37, n.2, p.132-135,
2000.
CUBEL GARCIA, R.; LEITE, J.; XAVIER, M.; WILLI, L.; LEMOS, M.; CASTRO, T.;
MERTENS, R.; LABARTHE, N. Infeco pelo parvovrus canino no Rio de Janeiro:
Um Estudo de 5 anos. Rev.Bras.Ci.Vet. v.9, n.1, p.42-46, 2002.
DAVIS-WURZLER, G, M. Current vaccination strategies in puppies and kittens.
Vet. Clin. Small. v.36, p.607-640, 2006.
DECARO, N.; CAMPOLO, M.; DESARIO, C.; ELIA, G.; MARTELLA, V.;
LORUSSO, E.; BUONAVOGLIA, C. Maternally-derived antibodies in pups and
protection from canine parvovirus infection. Biolog. v.33, p.261-267, 2005-a.
DECARO, N.; DESARIO, C.; CAMPOLO, M.; ELIA, G.; MARTELLA, V.; RICCI, D.;
LORUSSO, E.; BUONAVOGLIA, C. Clinical and virological findings in pups
naturally infected by canine parvovirus type 2 Glu-426 mutant. J. Vet. Diagn.
Invest. v.17, p.133138, 2005-b.
DECARO, N.; DESARIO, C.; ELIA, G.; CAMPOLO, M.; LORUSSO, A.; MARI, V.;
MARTELLA, V.; BUONAVOGLIA, C. Occurrence of severe gastroenteritis in pups
after canine parvovirus vaccine administration: A clinical and laboratory diagnostic
dilemma. Vaccine v.25, p.1161-1166, 2006-a.
DECARO, N; MARTELLA, V.; DESARIO, C.; BELLACICCO, A. L.; CAMERO, M.;
MANNA, L.; DALOJA, D.; BUONAVOGLIA, C. First detection of canine parvovirus
type C in pups with haemorragica enteritis in Spain. J.V.Med. v.53, p.468-472,
2006-b.

92

DECARO,N.; MARTELLA, V.; ELIA, G.; DESARIO, C.; CAMPOLO,M.; LORUSSO,


E.; COLAIANNI, M.L.; LORUSSO, A; BUONAVOGLIA, C. Tissue distribution of the
antigenic variants of canine parvovirus type C in dogs. Vet. Microb. v.121, p.39-44,
2007.
DECARO, N.; DESARIO,C.; ELIA, G.; MARTELLA, V.; MARI, V.; LAVAZZA, A.;
NARDI, M.; BUONAVOGLIA,C. Evidence for immunization failue in vaccinated
adult dogs infected with canine parvovirus type 2c. New Microbio, v.31, p.125-130,
2008-a.
DECARO, N.; DESARIO, C.; MICCOLUPO, A.; CAMPOLO, M.; PARISI, A.;
MARTELLA, V.; AMORISCO, F.; LUCENTE, M.; LAVAZZA, A.; BUONAVOGLIA,
C. Genetic analysis of feline panleokopenia viruses from cats with gastroenteritis.
J. Gen. Virol. v. 89, p. 2290-2298, 2008-b.
DECARO, N.; DESARIO, C.; PARISI, A.; MARTELLA, V.; LORUSSO, A.;
MICOPULLO, A.; MARI, V.; COLAIANNI, M. L.; CAVALLI, A.; DI TRANI, L.;
BUONAVOGLIA, C. Genetic analysis of canine parvovirus type 2c. Virology. v.
385, p.5-10, 2009-a.
DECARO, N.; DESARIO,C.; BEALL,M.J.; CAVALLI, A.; CAMPOLO,M.; DIMARCO,
A.A.; AMORISCO,F.; COLAIANNI, M.L.; BUONAVOGLIA, C. Detection fo canine
parvovirus type 2c by a commercially available in-house rapid test. Vet. J. v.184,
n.3, p.373-375, 2009-b.
DECARO, N.; BUONAVOGLIA, D.; DESARIO, C.; AMORISCO, F.; COLAIANNI,
M.; PARISI, A.; TERIO, V.; ELIA, G.; LUCENTE, M.; CAVALLI, A.; MARTELLA, V.;
BUONAVOGLIA, C. Characterization of canine parvovirus strains isolated from
cats with feline panleukopenia. Res Vet. Sci. (2010), doi 10.1016/j.rvs.
2010.03.001. 2010.
DESARIO, C.; DECARO, N.; CAMPOLO, M.; CAVALLI, A; CIRONE, F.; ELIA, G.;
MARTELLA, V.; LORUSSO, E.; CAMERO, M.; BUONAVOGLIA, C. Canine
Parvovirus infection: Wich diagnostic test for vrus? J.Virol. Met. v.126 p.179-185,
2005.
DUFFY, S.; SHACKELTON, L., HOLMES, E. Rates of evolutionary change in
viruses: patterns and determinants. Nature v. 9, p.267-276, 2008.

93

DURIGON, E.; ANGELO,

M.; JEREZ, J. Comparao entre as reaes de

hemaglutinao (HA), isolamento do vrus em cultura de clulas (CC),


imunoeletrosmoforese (IEOF) e imunomicroscopia eletrnica (IME), para o
diagnstico etiolgico da parvovirose canina. Rev. Microb. v.18, p.205-210, 1987.
GAMOH, K.; SHIMAZAKI, Y.; MAKIE, H.; SENDA, M.; ITOH, O.; INOUE, Y. The
pathogenicity of Canine Parvovirus Type-2b, FP84 strain isolated from a domestic
cat, in domestics cats. J. Vet. Med. Sci. v.65, n.9, p.1027-1029, 2003.
GUILFORD, W. G.; STROMBECK, D. R. Gastrointestinal tract infections,
parasites, and toxicoses. In: GUILFORD, W.G.; CENTER, S.A.; STROMBECK,
D.R.; WILLIANS, D.A.; MEYER, D.J. Strombecks Small Animal Gastroenterology.
3 ed. Philadelphia: W.B.Saunders Company, 1996. Cap.21, p.411-432.
GODDARD, A.; LEISEWITZ, A.; CHRISTOPHER, N.; DUNCAN, N.; BECKER,P.
Prognostic usefulness o blood leukocyte changes in canine parvoviral enteritis. J.
Vet. Intern .Med. v.22, p.309-316. 2008.
GORDON, J.; ANGRICK, E. Canine parvovirus: environmental effects on
infectivity. Am. J. Vet. Res. v.47, n.7, p.1464-1467, 1986.
HAGIWARA,

M.; JULY, J.; BACCARO, M.; ANGELO, M. Enterite hemorrgica

em ces associada infeco por um parvovrus. Arq. Inst. Biol. v. 47, p.47-49,
1980.
HALL, T. BioEdit: A user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series v.41, p.95-98,
1999.
HOELZER, K; SHACKELTON, L.; PARRISH,C. Presence an role of cytosine
methylation in DNA viruses of animals. Nuc.Ac.Res. v.36, n.9, p.2825-2837, 2008.
HOELZER, K. ; PARRISH, C. The emergence of parvoviruses of carnivores. Vet.
Res. DOI: 10.1051/vetres/2010011, 2010.
HORIUCHI, M.; YAMAGUCHI, Y.; GOJOBOTI, T.; MOCHIZUK, M.; NAGAZAWA,
H.; TOYODA, Y.; ISHIGURO, N.; SHINAGAWA, M. Differences in the evolucionary
pattern of feline panleukopenia virus and canine parvovirus. Virology. v. 249, p.
440-452, 1998.

94

HOMEM, V., MENDES ,Y., LINHARES, A. Gastroenterite canina - Agentes virais


nas fezes de ces diarreicos e no diarreicos. Arq.Bras.Med.Vet. Zootec. v.51, n.6,
p.531- 536, 1999.
HORIUCHI, M.; YAMAGUCHI, Y.; GOJOBOTI, T.; MOCHIZUK, M.; NAGAZAWA,
H.; TOYODA, Y.; ISHIGURO, N.; SHINAGAWA, M.

Differences in the

evolucionary pattern of feline panleukopenia virus and canine parvovirus. Virology.


v.249, p.440-452, 1998.
HUEFFER, K.; PARRISH, C. K. Parvovirus host range, cell tropism and evolution.
Curr. Opin. Microbiol. v. 6, n.4, p.392-398, 2003.
IKEDA, Y.; MIYAZAWA, T, NAKAMURA, K.; NAITO, R.; INOHSHIMA, Y.; TUNG,
K.C.; LEE, W.M.; CHEN, M.C.; KUO, T.F.; LIN, J.A.; MIKAMI, T. Serosurvey for
selected virus infections of wild carnivores in Taiwan and Vietnam. J. Wildl. Dis.
v.35, n.3, p.578581, 1999.
IKEDA, Y.; MOCHIZUKI, M.; NAITO, R.; NAKAMURA, K.; MIYAZAWA, T.;
MIKAMI, T.; TAKAHASHI, E. Predominance of canine parvovirus in unvaccinated
cat populations and emergence of new antigenic types of CPV in cats. Virology.
v.278 p.13-19, 2000.
IKEDA, Y.; NAKAMURA, K.; MIYAZAWA, T.; TOHYA, Y; TAKAHASHI, E.;
MOCHIZUKI, M. Feline host range of canine parvovrus recent emergence of new
antigenic types in cats. Emerg. Infect. Dis. v.8, n.4, p.341-346, 2002.
JOHNSON, R.; MARGOLIS, G.; KILHAM, L. Identity of feline ataxia virus with
feline panleucopenia virus. Nature. v.214, p.175-177, 1967.
KILHAM, L.; MARGOLIS, G.; COLBY, E.D. Cerebellar ataxia and its congenital
transmission in cats by feline panleukopenia virus. J. Am. Vet. Med. Assoc. v. 158,
p. 888, 1971.
KAPIL, S. ; COOPER, E. ; LAMM, C. ; MURRAY, B. ; REZABEK, G. ; JOHNSTON
III, L. ;CAMPBELL, G.; JOHNSON, B., Canine parvovirus types 2b and 2c
circulating in North American dogs in 2006 and 2007. J. Clin. Microbio. v.45, n.12,
p.4044-4047, 2007.
LARSON,L.; SCHULTZ, R. Comparasion of selected canine vaccines for their
ability to induce protective immunity against canine parvovirus infection.
Am.J.Vet.Res. v. 58, n. 4, p.360-363, 1997.
95

LARSON, L.; SCHULTZ, R. Do two current canine parvovirus type 2 and 2b


vaccines provide protection against the new type 2c variant? Vet.Ther. v.9, n.2,
p.94-101, 2008.
LATIMER; K. Leukocytes in health and disease. In: S.J.Ettinger & E.C.Feldman,
Textbook of Veterinary Internal Medicine, 5th ed., p. 1892-1929, 1995.
Philapdelphia, U.S.A.: W.B. Saunders Company.
LOPEZ DE TURISO, J.; CORTES, E.; RANZ, A.; GARCIA, J.; SANZ, A.; VELA, C.;
CASAL, J.I.. Fine mapping of canine parvovirus B cell epitopes. J Gen Virol. v. 72,
p. 2445-2456, 1991.
MACARTNEY,L.; MCCANDLISH, I. A.; THOMPSON, H.P. Canine parvovirus
enteritis 1: Clinical, haematological and pathological features of experimental
infection. Vet. Rec. v.115, p.201-210, 1984.
MACARTNEY, L.; MCCANDLISH, I.; THOMPSON, H. Canine parvovirus enteritis 2:
Pathogenesis. Vet. Rec., v.115, p.453-460, 1984. McCAW, D.L.; HOSKINS, J.D.
Canine viral enteritis. In: GREENE, C. E. 2 ed. Infectious Diseases Of The Dog
And Cat. WB Saunders Company, 1998, Athens, Georgia (USA), cap.8, p.63-70,
1998.
MARTELLA, V.; CAVALLI, A.; PRATELLI, A.; BOZZO, G.; CAMERO, M.;
BUONAVOGLIA, D.; NARCISI, D.; TEMPESTA, M.; BUONAVOGLIA, C. A canine
parvovirus mutant is spreading in Italy. J. Cli. Micobiol. v. 42, n.3, p.1333-1336,
2004.
MARTELLA,V. ; DECARO,N. ; ELIA,G. ; BUONAVOGLIA, C. Surveillance activity
for canine parvovirus in Italy. J. Vet. Med. v.52, p.312-315, 2005-a.
MARTELLA,V.; CAVALLI, A.; DECARO, N.; ELIA, G.; DESARIO, C.; CAMPOLO,
M.; BOZZO, G.; TARSITANO, E.; BUONAVOGILA,C. Immunogenicity of an
intranasally administered modified live canine parvovirus type 2b in pups with
maternally derived antibodies. Clin. Diag. Lab. Immun., v.12, n.10, p.1243-1245,
2005-b.
MARTELLA, V.; DECARO, N.; BUONAVOGLIA, C. Evolution of CPV-2 and
implicance for antigenic/genetic characterization. Virus Genes, v.33, p.11-13, 2006.

96

MARTIN, V.; NAJBAR, W., GUEGUEN, S. Treatment of canine parvoviral enteritis


with interferon-omega in a placebo controlled trial. Vet. Microbiol., v.89, p.115-127,
2002.
MS, A.; LPEZ-GALNDEZ, C.; CACHO, I; GMEZ, J.; MARTINZ, M.A.
Unfinished stories on viral quasispecies and Darwinian views of evolution.
J.Mol.Biol. v.397, p. 865-877, 2010.
MEERS, J.; KYAW-TANNER, M.; BENZINK, Z.; ZWIJNENBERG, R. Genetic
analysis of canine parvovirus from dogs in Australia. Austr. Vet. J. v.85, n.10,
p.392-396, 2007.
MEHNERT, D.; MONEZI, T.; PRADO, M.; HRSI, C.; CAVALIERO, M.; QUEIROZ,
A.; MLLER, N.; ANGELO, M. Canine gastroenteritis in Brazil: Preliminary results
of a viral etiological study. In: Encontro Nacional de Virologia, 8., So Loureno,
1996. Anais. So Loureno : Sociedade Brasileira de Virologia, p.43,1996.
MIRANDA, S. Caracterizao de amostras de Parvovrus detectadas em gatos e
ces nas cidades de Niteri e Rio de Janeiro em 2004-2005. Niteri, 2006, 97f.
Tese Mestrado Faculdade de Medicina Veterinria, Universidade Federal
Fluminense, Niteri, 2006.
MOCHIZUKI,

M.; HIDA, S.;

HSUAN, S. ; SATO, H. Fecal examinations for

diagnosis of canine parvovirus infection. Jpn. J. Vet. Sci. v. 46, p. 588-592, 1984.
MOCHIZUKI, M.; SAN GABRIEL, M.C.; NAKATANI, H.; YOSHIDA, M. Comparison
of polymerase chain reaction with virus isolation and haemagglutination assays for
the detection of canine parvoviruses in faecal specimens. Res. Vet. Sci. v.55,
p.60-63, 1993.
MOCHIZUKI, M.; HORIUCHI, M.; HIRAGI, H; SAN GABRIEL M.C.; YASUDA, N.;
UNO, T. Isolation of canine parvovirus from a cat manifesting clinical signs of feline
panleukopenia. J. Clin. Microb. v.34, p. 2101-2105, 1996.
MOCHIUKI, M. Growth characteristics of canine pathogenic viruses in MDCK cells
cultured in RPMI 1640 medium without animal protein. Vaccine. v.24, p.1744-1748,
2006.
MOCHIZUKI, M.; OHSHIMA, T.; UNE, Y.; YACHI, A. Recombination between
vaccine and field strains of canine parvovirus is revealed by isolation of virus in
canine and feline cell cultures. J. Vet. Med. Sci. v.70, n.12, p.1305-1314, 2008.
97

MOON, H-S. ; LEE, S-G. ; CHOI, R.; JEOUNG, S-Y.; KIM, D.; HYUN, C.
Comparison of the pathogenicity in three different Korean canine parvovirus 2
(CPV-2) isolates. Vet. Microbiol. v.131,n.1-2, p.47-56. 2008.
MOORE, D. Canine parvovirus immunoprophylaxis: a review. J South African Vet.
Assoc. v.83, n.4, p.258-264, 1983.
MORAES, M.; COSTA, P. Parvoviridae. In: Flores, E. F. 1ed. Virologia veterinria.
Ed. da UFSM, 2007, Santa Maria, RS, cap. 14, p. 382, 2007.
MURPHY, F.; GIBBS, E.; HORZINEK, M.; STUDDERT, M.J. Veterinary Virology.
3rd ed. Academic Press, New York, USA. 1999. 629 p.
NAKAMURA, K.;

SAKAMOTO, M.; IKEDA, Y. Pathogenic potential of canine

parvovirus types 2a and 2c in domestic cats. Clin. Diag. Lab. Immun. v. 8, n. 3, p.


663-668, 2001.
NAKAMURA, M.; TOHYA, Y.; MIYAZAWA, T.; MOCHIZUKI, M.; PHUNG, H.T.T.;
NGUYEN, N.H.; HUYNH, L.M.T.; NGUYEN, L.T.; NGUYEN, P.N.; NGUYEN, P.V.;
NGUYEN, N.P.T.; AKASHI, H. A novel antigenic variant of Canine parvovrus from
a Vietnanmese dog. Arch. Virol. v.149, p.2261-2269, 2004.
NANDI, S.; CHIDRI, S.; KUMAR, M.; CHAUHAN, R. Occurrence of canine
parvovirus type 2c in the dogs with haemorragic enteritis in India. Res. Vet. Sci.
v.88, p.169-17, 2010.
OHSHIMA, T; MOCHIZUKI, M. Evidence for recombination between feline
panleukopenia virus and canine parvovirus type 2. J. Vet. Med. Sci. v.71, n.4,
p.403-408, 2008.
OHSHIMA, T. ; HISAKA, M. ; KAWAKAMI, K. ; KISHI, M.; TOHYA, Y.;
MOCHIZUKI, M. Chronological analysis of canine parvovirus type 2 isolates in
Japan.J. Vet. Med. Sci. v. 70, n.8, p.769-775, 2008.
OTTO, T.; VASCONCELLOS, E.; GOMES, L..; MOREIRA, A.; DEGRAVE, W.;
MENDONA-LIMA, L. AND ALVES-FERREIRA, M. CHROMAPIPE: a pipeline for
analysis, quality control and management for a DNA sequencing facility. Genet.
Mol. Res. v. 7, n.3, p.861-871, 2008.
PARADISE, P.; RHODE, S.; SINGER, I. Canine Parvovirus: a Biochemical and
ultra structural characterization. J. Gen. Virol. v. 62, p. 113-125, 1982.

98

PARKER, J.; PARRISH, C. Canine parvovirus host range is determined by the


specific conformation of an additional region of the capsid. J. Virol. v.71, p.92149222, 1997.
PARRISH, C.; EVERMANN, J.; CARMICHAEL, L. Nature variation of canine
parvovirus. Science. v. 230, p.1046-1048, 1985.
PARRISH, C.; HAVE, P.; FOREYT, W.; EVERMANN, J.; SENDA, M.;
CARMICHAEL, L. The global spread and replacement of canine parvovirus strains.
J. Gen. Virol. v.69, p. 111-116, 1988.
PARRISH, C. Emergence, natural history, and variation of canine, mink, and feline
parvoviruses. Adv. Virus Res. v.38, p. 403-449, 1990.
PARRISH, C. Mapping specific functions in the capsid structure of canine
parvovirus and feline panleukopenia virus using infectious plasmid clones.
Virology. v. 183, p. 195-205, 1991.
PARRISH, C. R. Pathogenesis of feline panleukopenia vrus and canine
parvovirus. Baillires Clinical Haematology, v.8, p.1, 1995 (a).
PARRISH, C. R. Molecular epidemiology of parvoviruses. Semin. Virol. v.6, p.415
418, 1995 (b).

PARRISH, C.R. Host range relationships and the evolution of canine parvovirus.
Vet. Microbiol. v.69 p.29-40, 1999.
PARRISH, C.; KAWAOKA, Y. THE ORIGINS OF NEW PANDEMIC VIRUSES: The
Acquisition Of New Host Ranges By Canine Parvovirus And Influenza A Viruses.
Annu. Rev. Microbiol. v.59, p.553-586, 2005.
PEREIRA, C.A.; MONEZI, T.A.; MEHNERT, D.U.; DANGELO,M.; DURIGON, E.L.
Molecular characterization of canine parvovirus in Brazil by polymerase chain
reaction assay. Vet. Microb. v.75, p.127-133, 2000.
PEREIRA, C.; LEAL, E.; DURIGON, E. Selective regimen shift and demographic
growth increase associated with the emergence of hight-fitness variants of canine
parvovirus. Infec. Genet. Evol. v.7, p.399-409, 2007.
PREZ, R.; FRANCIA, L.; ROMERO, V.; MAYA, L.; LPEZ, I.; HERNNDEZ, M.
First detection of canine parvovirus type C in South Amrica. Vet. Micro. v.124,
p.147-152, 2007.

99

POLLOCK, R.; CARMICHAEL, L. Canine viral enteritis. In: GREENE, C.E.


Infections diseases of the dog and cat. WB Saunders Company. 268-287, 1990.
POLLOCK, R.; COYNE, M. Canine Parvovirus. Vet.Clin. North. Am.: Small Anim.
Pract. v.23, n.3, p.555-569, 1993.
PRITTIE, J. Canine parvoviral enteritis: a review of diagnosis, management, and
prevention. Journal of Veterinary Emergency and Critical Care, v.14, n.3, p.167176, 2004.
REED, A.; JONES, E.; MILLER, T. Nucleotide sequence and genome organization
of canine parvovirus. J. Virol. v. 62, p.266-276, 1988.
ROBINSON, W.; WILCOX, G.; FLOWER, R.; SMITH JR. Evidence for a parovirus
as the aetiologic agent in the myocarditis of puppies. Aust. Vet. J. v. 55, p.294-295,
1979.
SAKAMOTO, M.; ISHIGURO, S.; MOCHIZUKI, M. Experimental infection of canine
parvovrus in cats. J. Jpn. Vet. Med. Assoc. v. 52, p. 305-309, 1999.
SANTOS, P.; PINTO, A.; CUBEL GARCIA, R. Padronizao de reagentes e
mtodos utilizados na tcnica de hemaglutinao para o diagnstico laboratorial
da parvovirose canina. Rev. Bras. Cin. Vet. v.4, n.3, p.101-115, 1997.
SCHIMITZ, S.; COENEN, C. ; KONIG, M. ; THIEL, H. ; NEIGER, R. Comparison of
three rapid commercial canine parvovirus antigen detection tests with electron
microscopy and polimerase chain reaction. J.Vet. Diagn. Invest. v.21, p.344-345,
2009.
SCHULTZ, R.; THIEL, B.; MUKHTAR,E.; SHARP, P.; LARSON, L. Age ans Longterm protective immunity in dogs and cats. J. Comp. Path. v.142, p.102-108, 2010.
SENDA, M.; PARRISH, C.; HIRASAWA, R. Detection by PCR of wild-type canine
parvovirus which contaminates dog vaccines. J. Clin. Microb. v.33, n.1, p. 110-113,
1995.
SHACKELTON, L.; PARRISH, C.; TRUYEN, U.; HOLMES, E. High rate of viral
evolution associated with the emergence of carnivore parvovirus. Proc. Natl. Acad.
Sci. U S A. v.102, n.2, p.379-384, 2005.
SHERDING R. Small bowel disease. In: ETTINGER S.J. 3 ed. Textbook of
veterinary medicine. WB Saunders Company, 1989, Philadelphia. v.2, p.13511353, 1989.
100

SIEGL, G. Canine Parvovirus: Origin and Significance of a New Pathogen.


In: BERNS, K.I. The Parvoviruses. New York, Plenum Publishing Corp. p. 363388, 1984.
SILVA, M.M.O. Avaliao de mtodos rpidos para o diagnstico laboratorial da
parvovirose e fatores relacionados infeco em ces da zona sul da cidade do
Rio de Janeiro e municpio de Duqie de Caxias. Niteri, 2010, 74f. Tese Mestrado
Faculdade de Medicina Veterinria, Universidade Federal Fluminense, Niteri,
2010.
SMITH-CARR, S.; MACINTIRE, D.; SWANGO, L. Canine parvovirus: part 1.
Pathogenesis and vaccination. Compend. Cont. Educ. Pract. Vet., v.19, p.125-133,
1997.
SPIBEY, N.; GREENWOOD, N.M.; SUTTON, D.; CHALMERS W.; TARPEY, I.
Canine parvovirus type 2 vaccine protects against virulent challenge with type C
virus. Vet. Microbio. v.128, p.48-55, 2008.
STEINEL, A.; VENTER, E.H.; VAN VUUREN, M.; PARRISH, C.R.; TRUYEN, U.
Antigenic and genetic analysis of canine parvoviruses in southern Africa. J. Vet.
Res. v. 65, p.239-242, 1998.
STEINEL, A.; MUNSON, L.; VAN VUUREN, M.; TRUYEN, U. Genetic
characterization of feline parvovrus sequences from various carnivores. J. Gen.
Virol. v. 81, p.345-350, 2000.
STEINEL, A.; PARRISH, C.R.; BLOOM, M.E.; TRUYEN, U. Parvovirus infections in
wild carnivores. J. Wildl. Dis. v.37, n.3, p.594-607, 2001.
STRECK, A.; SOUZA,C.;GONALVES, K.;ZANG, L.; PINTO, L.;CANAL, C. First
detection of canine parvovirus 2c in Brazil. Braz J. Microbio. v.40, p.465-469, 2009.
TAMURA, K.; DUDLEY, J.; NEI, M.; KUMAR, S. MEGA 4: Molecular Evolutionary
Genetics Analysis (MEGA) Software Version 4.0. Molec. Biolog. Evol. v.24, n.8,
p.1596-1599, 2007.
TERAMOTO, Y.; MILDBRAND, M.; CARLSON J.; COLLINS, J.; WINSTON, S.
Comparison

of

enzyme-linked

immunosorbent

assay,

DNA

hybridiization,

hemagglutination, and electron microscopy for detection of canine parvovirus


infections. J. Clin. Microbiol. v. 20, p.373-378, 1984.

101

TOUIHRI, L.; BOUZID, I.; DAOUD, R.; DSARIO, C. ; GOULLI, A.; DECARO, N.;
GHORBEL, A.; BUONAVOGLIA, C.; BAHLOUL,C. Molecular characterization of
canine parvovirus-2 variants circulating in Tunisia. Virus Gen. v.38, n.2, p.249-258,
2009.
TRUYEN, U.; EVERMANN, J.F.; VIELER, E.; PARRISH, C.R.; Evolution of canine
parvovrus involved loss and gain of feline host range. Virology. v. 215, p.186-189,
1996-a.
TRUYEN, U.; PLATZER, G.; PARRISH, C.R. Antigenic type distribution among
canine parvoviruses in dogs and cats in Germany. Vet Rec. v.138, p.365-366,
1996-b.
TRUYEN, U.; MULLER, T.; HEIDRICH, R.; TACKMANN, K.; CARMICHAEL, L.E.
Survey on viral pathogens in wild red foxes (Vulpes vulpes) in Germany with
emphasis on parvoviruses and analysis of a DNA sequence from a red fox
parvovirus. Epidemiol Infect. v.121, p. 433-440, 1998.
TRUYEN, U. Emergence and recent evolution of canine parvovirus. Vet. Microbiol.,
v. 69, p. 47-50, 1999.
TRUYEN, U.; STEINEL, A.; BRUCKNER, L.; LUTZ, H.; MOSTL, K. Distribution of
antigen types of canine parvovirus in Switzerland, Austria and Germany. Schweiz.
Arch. Tierheilkd. v.142, n.3, p.115-119, 2000.
TSAO, J.; CHAPMAN, M.; AGBANDJE, M. The three dimensional structure of
canine parvovirus and its functional implications. Science. v.251, p.1456-1464,
1991.
URL, A.; TRUYEN, U.; REBEL-BAUDER, B.; WEISSENBOCK,H.; SCHIMIDT, P.
Evidence of Parvovirus replication in cerebral neurons of cats. J.Cli. Microbio. v.41,
n.8, p. 3801-3805, 2003.
VAN REGENMORTEL, M.; FAUQUET, C.; BISHOP, D.; CARSTENS, E.; ESTES,
M.; LEMON, S.; MANILOFF, J.; MAYO, M.; McGEOCH, D.; PRINGLE, C. Virus
Taxonomy. San Diego, Academic Press, p. 1167, 2000.
VERGE, J.; CHRISTOFORI, N. La gatroenterite infectieuse des chats; est-elle due
un virus filterable? Comptes Rendus des Ssnces de la Socit de Biologie et de
ses filiales v. 99, p. 312, 1928.

102

VIEIRA, M. ; SILVA, E.; OLIVEIRA, J.; VIEIRA, A .; DECARO, N.; DESARIO, C.;
MULLER, A.; CARVALHEIRA, J.; BUONAVOGLIA,C.; THOMPSON, G. Canine
parvovirus 2c infection in central Portugal. J. Vet. Diag. Invest. v.20, p.488-491,
2008-a.
VIEIRA, M.; SILVA, E.; DESARIO, C.; DECARO, N.; CAVALHEIRA, J.;
BUONAVOGLIA, C.; THOMPSON, G. Natural co-infection with 2 parvovirus
variants in dog. Emer. Infec. Dis. v.14, n.4, p.678-679, 2008-b.
WANG, H.; CHEN, W.; LIN, S.; CHAN, J.; WONG, M. Phylogenetic Analysis of
Canine Parvovirus VP2 Gene in Taiwan. Virus Gen. v.31, n.2, p.171-174, 2005.
WILLI, L. Estudo de eliminao de Parvovrus vacinal nas fezes de ces (Canis
Familiaris) primovacinados. Tese (Mestrado)- Niteri, 1998 Faculdade de
Medicina Veterinria, Universidade Federal Fluminense Niteri, 1998.
WU, H.; ROSSMAN, M. The Canine Parvovirus empty capsid structure. J. Mol.
Biol. v. 223, p. 231-244, 1993.
YANG, S.; WANG, S. ; FENG, H.; ZENG, H.; XIA, Z.; ZHANG, R. ; ZOU, X. ;
WNG, Q.; XIA, X. Isolation and characterization of feline panleukopenia virus from
a diarrheic monkey. Vet Micro. DOI 10.1016/j.veimic.2009.11.023, 2009.
YOUNG, N. Hematologic and hematopoietic consequences of B19 parvovirus
infection. Semin. Hematol. v. 25, p. 159-172, 1988.

103

10- APNDICES

104

APNDICE 1 - Ficha de identificao do animal


UNIVERSIDADE FEDERAL FLUMINENSE
INSTITUTO BIOMDICO
DEPARTAMENTO DE MICROBIOLOGIA E PARASITOLOGIA
Registro

Data de coleta

PROTOCOLO DE PARVOVIROSE CANINA


/

1 CLNICA
Nome: ______________________________________ Local: ______________________
2 PROPRIETRIO DO ANIMAL
Nome: __________________________________________________________________
Endereo: _________________________________________ Bairro: ______________
Cidade: _______________________ Estado: _____ Telefone: ___________________
3 ANIMAL
Nome: _________________ Idade (meses): ______ Sexo: ____ Raa_____________
Moradia: ( ) casa ( )apto
Finalidade do co: ( ) guarda ( ) companhia ( ) outros
Local predominante de passeio do co: ( )rua ( )praia ( )praa ( )outros ( )No passeia
4 VACINAO
Nome da vacina
/
/
/
/

Data
/
/
/
/

Nome da vacina
/
/
/
/

5 SINAIS CLNICOS
OCORRNCIA EM DIAS:
VMITO
ANOREXIA
( ) sim ( ) no
( ) sim (
DIARRIA
( ) Ausente ( ) Hemorrgica ( ) Outra

O
TEMPERATURA:
C
APATIA
) no
( ) sim ( ) no
CONSISTNCIA DAS FEZES
( ) Lquida
( ) Pastosa

6 RESULTADO
Data:

) negativo

) positivo

7 OBSERVAES

105

Ttulo de HA:

Data
/
/
/
/

APNDICE 2 Tabela de aminocidos

Aminocido

abreviao

Valina

Val

Leucina

Leu

Triptofano

Trp

Prolina

Pro

Isoleocina

Leu

Metionina

Met

Fenilalanina

Fen

Alanina

Ala

Treonina

Ter

Glicina

Gli

Asparagina

Asn

Glutamina

Gln

Cistena

Cis

Serina

Ser

Tirosina

Tir

Arginina

Arg

Histidina

His

Lisina

Lis

cido Glutmico

Glu

cido Asprtico

Asp

106

APNDICE 3 Aprovao do COMIT DE TICA EM PESQUISA ANIMAL


(PR-REITORIA DE PESQUISA E PS-GRADUAO)

107

11- ANEXOS

108

ANEXO 1- Nmero de acesso do GenBank das amostras de parvovrus


canino (CPV) e felino (FPLV) caracterizadas nesse estudo.
Amostra

Acesso
GenBank

Amostra

Acesso
GenBank

Amostra

Acesso
GenBank

RJ001/95

(FJ998133)

RJ596/04

(FJ977059)

RJ892/07

(FJ998161)

RJ004/95

(FJ977046)

RJ606/04

RJ893/08

(FJ977070)

RJ006/95

(FJ998134)

(DQ658146,
GQ415003)

RJ898/08

(FJ977071)

RJ014/95

(FJ998135)

RJ616/04

(DQ658147,
GQ415004)

RJ901/08

(FJ998162)

RJ083/96

(FJ977047)

RJ617/04

RJ905/08

(FJ998163)

RJ089/96

(FJ998136)

(DQ658151,
GQ415008)

RJ913/08

(FJ977072)

RJ107/97

(FJ998137)

RJ126/97

(FJ977048)

RJ129/97

(FJ977049)

RJ159/98

(FJ998138)

RJ164/98

(FJ977050)

RJ167/98

(FJ977051)

RJ630/05

RJ183/99

(FJ977052)

RJ209/99

RJ618/04

(DQ658148,
GQ415005)

RJ914/08

(FJ998164)

RJ925/08

(FJ977073)

RJ620/04

(DQ658149,
GQ415006)

RJ926/08

(FJ977074)

RJ628/04

(DQ658150,
GQ415007)

RJ928/08

(FJ998165)

RJ931/08

(FJ998166)

(FJ977060)

RJ933/08

(FJ977075)

RJ688/06

(FJ998151)

RJ934/08

(FJ977076)

(FJ998139)

RJ705/06

(FJ998152)

RJ936/08

(FJ998167)

RJ223/99

(FJ977053)

RJ706/06

(FJ998153)

RJ944/09

(FJ977077)

RJ242/00

(FJ998140)

RJ708/06

(FJ977061)

RJ948/09

(FJ998168)

RJ251/00

(FJ977054)

RJ735/06

(FJ998154)

RJ951/09

(FJ998169)

RJ302/01

(FJ998141)

RJ736/06

(FJ977062)

RJ304/01

(FJ998142)

RJ738/06

(FJ977063)

RJ305/01

(FJ977055)

RJ741/06

(FJ998155)

RJ336/01

(FJ998143)

RJ803/06

(FJ977064)

RJ339/01

(FJ998144)

RJ814/06

(FJ977065)

RJ349/01

(FJ998145)

RJ815/07

(FJ977066)

RJ353/01

(FJ998146)

RJ818/07

(FJ977067)

RJ355/02

(FJ998147)

RJ825/07

(FJ977068)

RJ369/02

(FJ977056)

RJ833/07

(FJ998156)

RJ371/02

(FJ998148)

RJ834/07

(FJ998157)

RJ422/03

(FJ998149)

RJ835/07

(FJ998158)

RJ426/03

(FJ977057)

RJ837/07

(FJ998159)

RJ446/04

(FJ998150)

RJ840/07

(FJ998160)

RJ542/04

(FJ977058)

RJ868/08

(FJ977069)

109

ANEXO 2- Distribuio cronolgica dos tipos de CPV no Brasil de 1980 a 2009. A tabela foi formulada tendo como
base o estudo atual e estudos anteriores (PEREIRA et al., 2007; STRECK et al., 2009). A linha contnua indica
predominncia do tipo. A linha tracejada indica uma menor circulao do tipo.

Perodo estudado em anos


Tipo de
CPV

1
9
8
0

1
9
8
1

1
9
8
2

1
9
8
3

1
9
8
4

1
9
8
5

1
9
8
6

1
9
8
7

1
9
8
8

1
9
8
9

1
9
9
0

1
9
9
1

1
9
9
2

1
9
9
3

1
9
9
4

1
9
9
5

1
9
9
6

1
9
9
7

1
9
9
8

1
9
9
9

2
0
0
0

2
0
0
1

2
0
0
2

2
0
0
3

2
0
0
4

2
0
0
5

2
0
0
6

2
0
0
7

2
0
0
8

CPV- 2
CPV-2a
CPV-2a
Val-555
CPV-2b
CPV-2c

110

2
0
0
9

ANEXO 3 - Carta de aceite e trabalho: Partial VP2 sequencing of canine


parvovirus (CPV) strains circulating in the State of Rio de Janeiro, Brazil:
detection of the new variant CPV-2c.

[BJM] Editorial Review of Article - Accept


Quinta-feira, 4 de Fevereiro de 2010 9:52
De:
"Silvio Arruda Vasconcellos" <savasco@usp.br>
Para:
"Tatiana Xavier de Castro" txcastro@yahoo.com.br

Tatiana:
We have now completed the review of your submission "BJM-1001 PARTIAL VP2
SEQUENCING OF CANINE PARVOVIRUS (CPV) STRAINS CIRCULATING IN THE
STATE OF RIO DE JANEIRO: DETECTION OF THE NEW VARIANT CPV-2c."
Our decision is to accept.
Additional comments on the paper, based on the editorial and peer review, are found by
logging in to the journal web site:

Submission URL:
http://submission.scielo.br/index.php/bjm/author/submission/20989

Brazilian Journal of Microbiology

111

112

113

114

115

116

117

ANEXO 4 - Carta de aceite e trabalho submetido para publicao no


peridico Research in Veterinary Science: Monitoring of canine parvovirus
(CPV) strains detected in vaccinated puppies in Brazil.
RVSC-09-544R1 Decision
Sexta-feira, 4 de Junho de 2010 6:59

De: "Research in Veterinary Science" resvetsci@elsevier.com


Para: txcastro@yahoo.com.br

Research in Veterinary Science


Ms. No. RVSC-09-544R1, "MONITORING OF CANINE PARVOVIRUS (CPV)
STRAINS DETECTED IN VACCINATED PUPPIES IN BRAZIL"
Dear Ms Castro,
I am pleased to be able to inform you that your manuscript
has been accepted as Research Paper for publication in
Research in Veterinary Science.
The manuscript will be transferred to our Production
Department. Proofs will be sent to you in due course.
With kind regards,
Carmel Mathew Maria Jude
Journal Manager
Research in Veterinary Science

118

119

120

121

122

ANEXO 6- Carta de submisso do trabalho First Characterization of


123

ANEXO 5- Carta de submisso e artigo cientfico First characterization of


parvovirus strains from domestic cats in Brazil. para publicao no
peridico Journal of Veterinary Diagnostic Investigation.
Journal of Veterinary Diagnostic Investigation - Manuscript ID 10-0214
Segunda-feira, 7 de Junho de 2010 17:35

De: "editorial@jvdi.org" <editorial@jvdi.org>


Para: txcastro@yahoo.com.br

07-Jun-2010
Dear Mrs. Castro:
Your manuscript entitled "FIRST CHARACTERIZATION OF
PARVOVIRUS STRAINS FROM DOMESTIC CATS IN BRAZIL" has been
successfully submitted online and is presently being given
full consideration for publication in the Journal of
Veterinary Diagnostic Investigation in chronological order.
Your manuscript number is 10-0214.
Please mention the above manuscript number in all future
correspondence or when contacting the Editorial Office for
questions. If there are any changes in your street address or
e-mail address, please log in to Manuscript Central at
http://mc.manuscriptcentral.com/jvdi and edit your user
information as appropriate.
You can also view the status of your manuscript at any time
by checking your Author Center after logging in to
http://mc.manuscriptcentral.com/jvdi.
Thank you for submitting your manuscript to the Journal of
Veterinary Diagnostic Investigation.
Sincerely,
Journal of Veterinary Diagnostic Investigation Editorial
Office

124

First Characterization of parvovirus strains from domestic cats in Brazil.

Rita de Cssia Nasser Cubel Garcia1*;


* Corresponding Author
E-mail address: ritamip@vm.uff.br
Running Title: Parvovirus from cats in Brazil
Suzana Carvalho de Miranda1;
Tatiana Xavier de Castro 1;
Glucio Lopes Jnior1;
Norma Vollmer Labarthe3;
Jos Paulo Gagliardi Leite2

Departamento de Microbiologia e Parasitologia, Instituto Biomdico, Universidade

Federal Fluminense, Rua Prof. Ernani Pires de Melo, 101 24210-130 Niteri, Rio de
Janeiro, Brazil. Tel 55 21 2629-2432
3

Programa de Biodiversidade e Sade and

Laboratorio de Virologia Comparada e Ambiental, IOC, Fundao Oswaldo Cruz. Av

Brasil, 4365 - 21040-360, Manguinhos, Rio de Janeiro, Brazil.

ABSTRACT
The aim of this study was to characterize parvovirus strains from domestic cats in
Brazil. Fifty-one kittens fecal samples were initaially submitted to hemagglutination/
hemagglutination-inhibiton (HA/HI) tests. The parvovirus strains detected in 6/51 samples
were then tested by HA in a range of different pH conditions and temperature, submitted to

125

a PCR genotyping by using four sets of primers, and to partial sequencing of capsid protein
VP1/VP2 gene. In addition, the phylogeny carried on a fragment of VP2 protein gene was
analyzed. The pH dependence of HA was observed in only one sample and for all the six
samples the HA titers remained constant at 4oC and 37oC. A PCR typing approach was
unable to distinguish FPLV from CPV as four samples were amplified by all set of primers,
including those considered specific for the new types of CPV. Six samples were confirmed
as FPLV strains by sequencing but two samples showed amino acid changes in residues
which have been described in CPV strains. An additional 11 synonymous and six non
synonymous substitutions were also detected in brazilian FPLV strains. Phylogenetic
analysis based on nucleotide sequences showed that Brazilian feline samples form a cluster
distinct from the other FPLV or CPV isolates in other countries. The detection of
anomalous FPLV strains might indicate a direction in which evolution is leading FPLV.
Our findings also reinforce that only sequence analyses give ample information for FPLV
characterization.

KEYWORDS
Brazil; Characterization; Feline Parvovirus, Phylogenetic analysis.

INTRODUCTION
Feline panleukopenia virus (FPLV) and canine parvovirus (CPV) are responsible for a
highly contagious gastro enteric disease mainly in puppies and kittens. FPLV-induced
disease in cats has been known since before 1920s. CPV, a host-range variant of FPLV,
emerged as a new virus of dogs in the late 1970s. Soon after the appearance, the original

126

CPV-2, was subsequently replaced by new variants, termed CPV-2a and CPV-2b. In the
early 2000s a novel CPV mutant (CPV-2c) emerged in Italy 2,18 .
FPLV and CPV are more than 98% identical in nucleotide and amino acid
sequences18. There are six amino acid changes between FPLV and CPV in the open read
framing encoding structural proteins (residues 80, 93, 103, 323, 564 and 568)

6, 12

. Another

five or six amino acid changes differ the new variants CPV2a/2b/2c (residues 87, 300,305,
426 and 555) from the original CPV-2 18.
FPLV and CPV isolates may also differ in the pH and temperature dependence of the
hemagglutination (HA). FPLV-like isolates hemagglutinate only in buffers with pHs below
6.8 while CPV isolates hemagglutinate at all pH value between 6,0 and 8,0. CPV isolates
are also able to HA at 4oC or 37oC 6, 18, 23.
Although the original CPV had lost the ability to replicate in feline cells, several
reports have demonstrated that these new CPV variants have gained the ability to infect,
replicate and cause disease in domestic cats with clinical signs similar to feline
panleukopenia 1,10, 16, 30.
Natural infections of domestic and wild felines with CPV like viruses have been
described

10, 13, 16, 26

, but FPLV has remained the more prevalent parvovirus casing disease

in cats 11.
Despite of widespread vaccination, CPV is responsible for approximately 46% of
the enteritis cases among young dogs in the state of Rio de Janeiro, Brazil

4,8

. Data

regarding parvovirus infection in feline population has not been reported in Brazil yet. The
purpose of this study was to perform the characterization of parvovirus strains from
domestic cats.

127

MATERIALS AND METHODS


A total of 51 fecal samples from unvaccinated domestic cats up to one year old (46
diarrheic and five asymptomatic) were collected at Rio de Janeiro city during 2004-2005.
The samples were screened for the presence of parvovirus by hemagglutination (HA) test
using borate-buffered saline (BBS) and virus-adjusting-diluent pH6.0 as diluents for
antigen and swine erythrocytes respectively. The positive samples were also tested by HA
at different pHs (6.0 and 7,4) with incubation at 4 oC and 37oC 23.
For genome detection, viral DNA was extracted from 10% fecal suspensions in TrisCa2+ using a combination of phenol/chloroform/isoamyl-alcohol (Invitrogen) and
silica/guanidin thyocianate 7.
A PCR genotyping approach based on four sets of primers was used. Initially, the
primer set VPF/VPR (2285-4530), which amplifies FPLV as also the old and new types of
CPV was used for the first amplification

15

. The amplicon was submitted to a nested-PCR

assay using a differential set of primers in order to distinguish FPLV from the old and new
types of CPV: FMF/FMR (3113-3810), P2 (3025-3706) and P2ab (3025-3706) 16,24. While
the primer set FMF/FMR was used for identifying FPLV, the primer set P2 was used for
CPV-2 and primer set P2ab was used for both CPV-2a and CPV-2b.
For sequencing analysis, two regions of VP1/VP2 protein gene were amplified using three
different sets of primers: M1 (2949-2960) & M2 (3128-3150), M13 (3629-3658) & M14
(4082-4111)26 and 555F (4003-4022) & 555R (4585-4561)2. The PCR products were then
purified using the QIAQuick PCR purification kit (QIAGENTM, Valencia, CA, USA) and
subjected to direct sequencing in both directions by using BigDye terminator v1.1 Cycle
Sequencing kit (Applied Biosystems, CA, USA) 17.

128

A partial consensus sequence of VP2, obtained by the assembling of the nucleotide


sequences of different amplicons was aligned and analyzed by BioEdit Sequence
Alignment Editor 7.0.1 ( bioedit.html). For comparison, sequences of FPLV and CPV
strains were selected from GenBank as listed in Table 1.
The unrooted phylogenetic tree was generated from a 1170 bp fragment of the VP2
gene according to Neighbor-Joining method and subjected to 2000 bootstrap samplings.
The nucleotide sequences generated in this study have been deposited in GenBank
under accession numbers: RJF606/04 (DQ507872, DQ658146, GQ415003), RJF616/04
(DQ507873, DQ658147, GQ415004), RJF617 (DQ507874, DQ658148, GQ415008)
RJF618/04 (DQ507875, DQ658148, GQ415005), RJF620/04 (DQ507876, DQ658149,
GQ415006), RJF628/04 (DQ507877, DQ658150, GQ415007).

RESULTS
Six feline fecal samples (from a total of 51) initially screened by HA were
confirmed as positive by HI test. These positive samples were tested by HA at different pHs
and temperatures. The pH dependence of HA was observed in only one sample, BRF618,
which HA titer decreased 32-fold at pH 7.4 than at pH 6.0.
In order to identify and differentiate the parvovirus strains detected in fecal samples, a
PCR genotyping approach was used. All samples examined were amplified with the
primers set FMF/FMR. While two feline samples (RJF617/04 and RJF628/04) were
amplified with the primers set VPF/VPR and P2, other four samples (RJF606/04,
RJF616/04, RJF618/04 and RJF620/04) were also amplified with the primers set P2ab
which are specifically for detection of the new types of CPV.

129

Sequencing analysys showed that most amino acids residues which allow
differentiation between feline and canine parvovirus were conserved including 80-Val, 93Lys, 103-Val, 323-Asp, 564-Asn and 568-Ala. All these samples were characterized as
FPLV. In addition, only one sample (RJF616/94) had an amino acid change on residue 93
(LysAsn) as described in CPV strains (Table 1).
Considering the nucleotide changes observed in the sequence, two non synonymous
substitutions were found in all FPLV isolates: residues 91 (AlaSer) and 101 (IleThr).
Other two synonymous substitutions at residues 363 (AG) and 368 (AG) were also
observed. An additional 11 synonymous substitutions and seven non synonymous
substitutions were also detected. One sample (RJF620/04) displayed the amino acid change
AspAsn at residue 375, which has been considered typical of CPV strains (Table 1).
The phylogenetic tree based on nucleotide sequence showed that Brazilian feline
samples form a cluster distinct from the other FPLV or CPV isolates (Figure 1).

DISCUSSION
This is the first study on sequence analysis of FPLV strains in Brazil. Since its first
identification in 1920, FPLV has not undergone significant changes in its antigenic and
biological properties

25

. It is known that FPLV strains display a pH and temperature

dependence of the hemagglutination (HA) which allows its distinction from CPV isolates
3,22,23,28

However, in this study we used more recent isolates of FPLV and the pH-

dependence and requirement for low temperature of FPLV HA, as reported by other
authors, were not observed.
These results suggest that differences in HA pattern should not be used as a single
parameter to characterize FPLV strains. Likewise, a PCR typing approach was also unable

130

to distinguish FPLV from CPV. Four samples showed amplification with all set of primers
including those considered specific for detection of the new types of CPV.
To confirm the genomic identity of these FPLV isolates from cats, we performed the
sequencing of two regions of the VP2 genome involved in controlling canine and feline
host range (residues 93 and 323) as also the pH difference of HA (residues 323 and 375)
12,18,20

Non-synonymous substitutions detected in residues 91 (Ala Ser) and 101 (IleThr)


were also reported in FPLV isolates after 2006 from Italy and Argentina 9. This change in
AA 101 is also present in the new CPV variants

5,11,14

. The exact phenotypic consequence

of these mutations is not clear yet, and it may represent a host-adaptation of FPLV strains.
Although CPV infection in puppies is widespread in Brazil

4,21,27

, the sequences

analyzed in this study showed no evidence of CPV infection in kittens. Nevertheless,


changes at residues 93, 101 and 375 could be observed and it is well known that these AA
changes affect parvovirus host range and hemagglutination 19,29,30.
The phylogenetic analysis using reference strains of both FPLV and CPV showed
that all Brazilian strains form a distinct cluster which may reflect their geographic origin.
This study demonstrate that although FPLV showed a certain degree of genetic
stability1, the detection of anomalous strains with mutations at residues that affect
parvovirus host range might indicate a direction in which evolution is leading FPLV. Our
findings also reinforce that only sequence analyses give ample information for FPLV
characterization. The continued epidemiological surveillance of the distribution of these
parvoviruses is may provide new insights into the mechanisms that drive FPLV evolution
in Brazil.

131

ACKNOWLEDGMENTS
This study was supported by the Conselho Nacional de Desenvolvimento
Cientfico e Tecnolgico (CNPq), by the Universidade Federal Fluminense- Pr-Reitoria
de Pesquisa e Ps-Graduao (UFF-PROPP), by the Fundao de Amparo Pesquisa
Carlos Chagas Filho (Faperj), and Instituto Oswaldo Cruz - Fundao Oswaldo Cruz
(IOC-FIOCRUZ). Suzana C. Miranda and Tatiana X. Castro were fellowship recipients of
Coordenao de Aperfeioamento de Pessoal de Nvel Superior (CAPES). We also thank
Dr. Marcelo de Lima for the critical revision and helpful discussion of the manuscript.

REFERENCES
1. Battilani M; Bassani M; Forti D; Morganti L: 2006, Analysis of the evolution of feline
parvovirus (FPLV). Vet Res Commun 30:223-226.
2. Buonavoglia C; Martella V; Pratelli A et al.: 2001, Evidence for evolution of canine
parvovirus type 2 in Italy. J Gen Virol 82:3021-3025.
3. Carmichael L; Joubert J; Pollock R:1980, Hemagglutination by canine parvovirus:
serologic studies and diagnostic applications. Am J Vet Res 41:784-791.
4. Castro T; Miranda C; Larbarthe N et al.: 2007, Clinical and epidemiological aspects of
canine parvovirus (CPV) enteritis in the State of Rio de Janeiro: 1995-2004. Arq Bras
Med Vet Zootec 59 (2):333-339.
5. Castro, T; Costa, E; Leite, J et al.: 2010, Partial VP2 sequencing of canine parvovirus
(CPV) strains circulating in the State of Rio De Janeiro, Brazil: Detection of the new
variant CPV-2c. Bras J Microbiol BJM1001 In Press.

132

6. Chang S; Sgro J; Parrish C: 1992, Multiple amino acids in the capsid structure of
canine parvovirus coordinately determine the canine host range and specific antigenic
and hemagglutination properties. J Virol 66:6858-6867.
7. Costa A; Leite J; Labarthe N; Cubel Garcia R: 2005, Genomic typing of canine
parvovirus circulating in the State of Rio de Janeiro, Brazil from 1995 to 2001 using
polymerase chain reaction assay. Vet Res Commun 29:735-743.
8. Cubel Garcia R; Pinto A.; Costa A et al.: 2000, Canine parvovirus infection in puppies
with gastroenteritis in Niteri, Rio de Janeiro, from 1995 to 1997. Braz J Vet Res An
Sci 37:132-135.
9. Decaro N; Desario C;Micollupo A et al.: 2008, Genetic analysis of feline panleukopenia
viruses from cats with gastroenteritis. J Gen Virol 89:2290-2298.
10. Gamoh K; Shimazaki Y; Makie H et al.: 2003, The pathogenicity of canine parvovirus
type-2b, FP84 strain isolated from a domestic cat, in domestics cats. J Vet Med Sci
65:1027-1029.
11. Hoelzer K; Shackelton, L; Parrish, C; Holmes, E: 2008, Philogenetic analysis reveals
the emergence, evolution and dispersal of carnivore parvoviruses. J Gen Virol 89:22802289.
12. Hueffer K; Parrish C: 2003, Parvovirus host range, cell tropism and evolution. Curr
Opin Microbiol 6:392-398.
13. Ikeda Y; Mochizuki M; Naito R et al: 2000, Predominance of canine parvovirus (CPV)
in unvaccinated cat populations and emergence of new antigenic types of CPVs in cats.
Virology 278:13-19.
14. Martella V; Decaro N; Elia G; Buonavoglia C: 2005, Surveillance activity for canine
parvovirus in Italy. J Vet Med 52: 312315.

133

15. Mochizuki, M.; San Gabriel M; Nakatami H.; Yoshida M:1993, Comparison of
polymerase chain reaction with virus isolation and haemagglutination assays for the
detection of canine parvoviruses in faecal specimens. Res Vet Sci 55:60-63.
16. Mochizuki M; Horiuchi M; Hiragi H et al.: 1996, Isolation of canine parvovirus from a
cat manifesting clinical signs of feline panleukopenia. J Clin Microb 34:2101-2105.
17. Otto T; Vasconcellos E; Gomes L et al.: 2008, ChromaPipe: a pipeline for analysis,
quality control and management for a DNA sequencing facility. Genet Mol Res
7(3):861-871.
18. Parrish C; Aquadro C; Strassheim M et al.: 1991, Rapid antigenic-type replacement and
DNA sequence evolution of canine parvovirus. J Virol 65(12):6544-6552.
19. Parrish C: 1994, The emergence and evolution of canine parvovirus an example of
recent host range mutation. Semin Virol 5:121-132.
20. Parrish C; Kawaoka Y: 2005, The origins of new pandemic viruses: the acquisition of
new host ranges by canine parvovirus and influenza A viruses. Annu Rev Microbiol
59:553-586.
21. Pereira C; Leal E; Durigon E: 2007, Selective regimen shift and demographic growth
increase associated with the emergence of hight-fitness variants of canine parvovirus.
Infect Gen Evol 7:399-409.
22. Senda M; Hirayama N; Yamamoto H; Kurata K: 1986, An improved hemagglutination
test for study of canine parvovirus. Vet Microbiol 12:1-6.
23. Senda M; Hirayama N; Ito O; Yamamoto H: 1988, Canine parvovirus: strain difference
in haemaglutination activity and antigenicity. J Gen Virol 69:349-354.
24. Senda M; Parrish C; Harasawa R; Gamoh K et al.: 1995, Detection by PCR of wildtype canine parvovrus which contaminates dog vaccines. J Clin Micobiol 33:110-113.

134

25. Shackelton, L; Parrish, C; Truyen U; Holmes E: 2005, Hight rate o viral evolution
associated with the emmergence of carnivore parvovirus. Proc Natl Acad Sci U S A
102:379-384.
26. Steinel A; Munson L; Van Vuuren M; Truyen U: 2000, Genetic characterization of
feline parvovrus sequences from various carnivores. J Gen Virol 81:345-350.
27. Streck F; Souza K; Gonalves K et al.: 2009, First Detection of canine parvovirus type
2c in Brazil. Bras J Microbiol 40:465-469.
28. Truyen U; Parrish C: 1992, Canine and feline host ranges of canine parvovirus and
feline panleukopenia virus: distinct host cell tropisms of each virus in vitro and in vivo.
J Virol 66:5399-5408.
29. Truyen U; Gruenberg A; Chang S et al.: 1995, Evolution of the feline-subgroup
parvoviruses and the control of canine host range in vivo. J Virol 69: 4702-4710.
30. Truyen U; Evermann J; Vieler E; Parrish C: 1996, Evolution of canine parvovirus
involved loss and gain of feline host range. Virology 215:186-189.

135

Amostra

Nt
AA

3032
82
GTA
Val

3057
91
GCA
Ala

3065
93
AAA
Lys

3087
101
ATT
Ile

3679
298
GAA
Glu

3705
307
GGA
Gly

3782
332
AGA
Arg

3787
334
GCT
Ala

3827
347
GCG
Ala

3836
350
CAA
Gln

3837
351
GGG
Gly

3875
363
GGA
Gly

3878
364
GCG
Ala

3890
368
GAA
Glu

3909
375
GAT
Asp

3968
395
ACA
Thr

ACT
Thr

ACT
Thr

GCA
Ala

ACT
Thr

GCA
Ala

TCA
Ser

ACT
Thr

GCA
Ala

ACT
Thr

GCA
Ala

AGC Ser

RJF617/04

RJF618/04

GAT
Asp

AGA
Arg

GCA
Ala

RJF620/04
RJF628/04

ACT
Thr
ACT
Thr
ACT
Thr
ACT
Thr
ACT
Thr
ACT
Thr

GTG
Val

TCA
Ser
TCA
Ser
TCA
Ser
TCA
Ser
TCA
Ser
TCA
Ser

RJF616/04

TCC
Ser

GGG
Gly
GGG
Gly
GGG
Gly
GGG
Gly
GGG
Gly
GGG
Gly

GCA
Ala
GCA
Ala
GCA
Ala
GCA
Ala
GCA
Ala

FPLV-b
M38246 (USA,
1967)
FPLV
AB000070
(JAP, 1996)
FPLV
AY606131
(FRA,2004)
FPLV
AY742937
(GER, 2005)
FPLV
EU018145
(ARG, 2008)
FPLV
EU498693
(ITA, 2008)
RJF606/04

2981
65
TCA
Ser

AAC
Asn

AGG
Arg

CCG
Pro
GCT CAG
Ala
Gln

GAG

Glu
GAG

Glu
GAG

Glu
GAG

Glu
GAG AAT
Glu Asn
GAG
Glu

ACC
Thr

Table 1: Synonymus and non- synonymus substitution detected in the partial VP2 sequences of FPLV strains generated in this study and other sequences
obtained from the GenBank database. Accession numbers of reference strains are showed. ( ) indicate identical nucleotide and amino acid.

136

RJ606

96

RJ628

45

RJ616
92

75 RJ617

RJ618
52

RJ620

51

FPV EU018145 ARG


53

FPV M38246 USA


FPV AB000064 JAP

66

FPV AY606131 FRA

63

FPV EU498693 ITA


FPV AY742937 GER
CPV-2a M24000
CPV-2c EF599098

99

CPV-2 M38245

73
63

CPV-2b DQ340409

0.002

Figure 1: Phylogenetic tree constructed from a 1170 bp fragment of the VP2 gene nucleotide sequence of the
Brazilian FPLV strains generated in this study and other sequences obtained from the GenBank database.
Accession numbers of reference strains are indicated. Principal bootstrap values are shown.