Você está na página 1de 70

Elizandra de Matos Cardoso

INFERNCIAS FILOGENTICAS E DIVERSIDADE


MOLECULAR NO GNERO Neacomys THOMAS 1900

R.V. Rossi

(RODENTIA: CRICETIDAE)

Belm PA, 2011

ii

UNIVERSIDADE FEDERAL DO PAR


MUSEU PARAENSE EMLIO GOELDI
PROGRAMA DE PS-GRADUAO EM ZOOLOGIA
CURSO DE MESTRADO EM ZOOLOGIA

Elizandra de Matos Cardoso


INFERNCIAS FILOGENTICAS E DIVERSIDADE MOLECULAR NO
GNERO Neacomys THOMAS 1900 (RODENTIA: CRICETIDAE)

Dissertao apresentada ao Programa de PsGraduao em Zoologia, Curso de Mestrado da


Universidade Federal do Par e Museu Paraense
Emlio Goeldi, como requisito parcial para
obteno do grau de mestre em Zoologia.

Orientador: Dr. Horacio Schneider


Co orientador: Dr. Rogrio Vieira Rossi

Belm PA
2011

iii
UNIVERSIDADE FEDERAL DO PAR
MUSEU PARAENSE EMLIO GOELDI
PROGRAMA DE PS-GRADUAO EM ZOOLOGIA
CURSO DE MESTRADO EM ZOOLOGIA

Elizandra de Matos Cardoso


INFERNCIAS FILOGENTICAS E DIVERSIDADE MOLECULAR NO
GNERO Neacomys THOMAS 1900 (RODENTIA: CRICETIDAE)

Dissertao apresentada ao Programa de PsGraduao em Zoologia, Curso de Mestrado, da


Universidade Federal do Par e Museu Paraense
Emlio Goeldi, como requisito parcial para
obteno do grau de mestre em Zoologia.

Orientador: Dr. Horacio Schneider


Co orientador: Dr. Rogrio Vieira Rossi

Belm PA
2011

iv
EPGRAFE

.... eu acredito que tenha sido assim com a grande rvore da vida, que
preenche com seus ramos mortos e quebrados a crosta da terra,
enquanto cobre a superfcie com seus novos ramos.
(Charles Darwin)

v
DEDICATRIA

Aos meus maiores torcedores nesta vida e para a eternidade, meu


pai Enadir e minha me Sandra. Grandes incentivadores, que
deram todo apoio e amor para que eu conclusse este ciclo.

vi
AGRADECIMENTOS
Ao Programa de Ps Graduao em Zoologia do convnio Museu Paraense
Emlio Goeldi e Universidade Federal do Par, pelo curso de Mestrado em Zoologia.
Fundao de Amparo Pesquisa do Estado do Par - FAPESPA, pela
concesso da bolsa de mestrado, nesses dois anos.
Ao Prof. Dr. Horacio Schneider, grande responsvel pela minha incluso na rea
que, at ento, era inexplorada na minha vida acadmica: o impressionante mundo da
sistemtica molecular.
Ao Prof. Dr. Rogrio Rossi, pelo apoio, pacincia e compreenso. Assim como
na ajuda com contatos e tambm por ceder material coletado sob sua coordenao no
Mato Grosso e Amaznia nos ltimos anos.
Prof. Dr. Iracilda Sampaio e Prof. Dr. Grazielle Gomes por todo suporte e
acesso aos laboratrios, pelas sugestes e pela ajuda nos momentos decisivos. Tambm
agradeo, por todo apoio na etapa final do laboratrio e nas anlises do trabalho. A
vocs a minha gratido eterna!
Ao Laboratrio de Gentica e Biologia Molecular do Instituto de Estudos
Costeiros IECOS, todos os seus membros e estagirios pela pacincia e amizade.
Graas a vocs tive a oportunidade de ter uma outra viso da gentica, a minha gratido
por toda ajuda: Prof. Dr. Simoni Santos, Issakar, Katiscia, Luciana Watanabe, Salene,
Gabriel Iketani, Yrlene, Rosa, Tain, Brulio, Davidson (folha), Jackson, Ana Paula
(Paulinha), Ftima, Glucia, Clo, Divino, Diogo, Natlia, Cssia, Douglas, Lorena,
Josy, Andressa, Jferson, Auricia (Lyca), Eliene e Luis Fernando.
Diviso de Mastozoologia do Museu Paraense Emlio Goeldi, e especialmente
Dr Suely Marques Aguiar, ao Dr. Jos de Souza Silva Jnior (Cazuza) por
permitirem o meu acesso diviso e a sua fascinante coleo de Mamferos, e ao Joo
Alberto Queiroz e Cristina Braga pela ajuda na mesma. Tambm gostaria de agradecer
Dr. Liza Veiga pelo espao cedido de sua sala para uso e acomodao de material.
MSc. Claudia Silva, pela amizade, apoio e incentivo desde a minha
graduao. Tambm agradeo por me ceder tecido e emprstimo dos exemplares de
Neacomys disponveis no Instituto de Pesquisas Cientficas e Tecnolgicas do Estado do

vii
Amap IEPA, e em seu nome agradeo a todos os membros e estagirios da Diviso
de Mastozoologia do mesmo instituto, por toda ajuda concedida.
Sou extremamente grata Dr. Maria de Nazareth F. Silva, por me ceder tecidos
de Neacomys e Oligoryzomys e permitir o meu acesso Coleo de Mamferos do
INPA. Tambm ao James L. Patton, Museum of Vertebrate Zoology, University of
Califrnia, Berkeley, por ceder seqncias de Neacomys para este trabalho.
Ao Dr. Manoel Santos Filho Universidade Estadual do Mato Grosso, por me
ceder tecidos de exemplares de Neacomys coletados no Mato Grosso.
s pessoas que permitiram o meu acesso s colees e deram apoio e/ou
sugestes durante a visita: MNRJ Dr. Joo Oliveira, Sergio Vaz, Stella Franco e Dr.
Marcelo Weksler. MZUSP - Dr. Mario de Vivo e Juliana Barros.
Dorotia e Vanessa, pela ajuda e descontrao nos assuntos burocrticos.
Aos amigos e colegas que me receberam em suas casas durante as visitas aos
museus: Luciano, Clo Ichihara e Eveline, Fabio Rohe e Tina. Muito obrigada por tudo!
Tamara Flores, pela amizade, apoio nos momentos cabeludos do trabalho e
por dividir comigo um pouco de sua experincia com Oecomys. Valeu bicha!
Aos amigos e colegas mastozologos que foram importantes no decorrer do
mestrado: Victor Fonseca, Ana Karolyna Pereira, Cleuton Lima, Silvia Pavan, Michele
Mercs, Alex Ruffeil e Liliane Tavares.
Aos amigos queridos da turma de mestrado: Marclia Basto (bicha), Danilo
Arcoverde, Silvia Tereza (Silvo), Ana Carolina Guimares, Heriberto Figueira, Isabela
Brcko e Ablio Ohana, pelos timos momentos, principalmente os de rir at chorar!
Aos amigos de Macap, por compreenderem a minha ausncia e sempre
torceram por mim: Martinha, Wanu, L, Samara, rica, Janica, Salomo e Rmulo.
Ao Srgio, por tudo que passamos juntos nesses dois anos e por ser minha
segunda conscincia nos meus momentos de delrio.
minha estimada famlia, por ser minha maior riqueza! Que mesmo distncia
sempre esteve presente: minha me Sandra e meu Pai Enadir. Meus irmos Anderson,
Alessandra e Wenderson. Meu cunhado Evngelo e ao meu sobrinho Hugo. Amo vocs!

viii
SUMRIO
pg.
Resumo

ix

Abstract

Introduo

01

Referncias Bibliogrficas

11

Artigo a ser submetido

16

Abstract

17

1. Introduo

18

2. Material e Mtodos

20

2.1 Obteno e Identificao das Amostras

20

2.2 Isolamento do Material Gentico

20

2.3 Inferncias Filogenticas

21

3. Resultados

23

3.1 Caracterizao dos Bancos de Dados

23

3.2 Inferncias Filogenticas

23

3.3 Distncias Genticas

26

4. Discusso

28

4.1 Inferncias Filogenticas

29

4.2 Divergncias

32

4.3 Consideraes sobre Neacomys minutus

34

4.4 Consideraes biogeogrficas

35

4.5 Consideraes gerais

36

Agradecimentos

37

Referncias

37

Apndice A

46

Apndice B

50

Figuras

53

Tabelas e dados suplementares

57

ix
RESUMO
Os camundongos de espinho, pertencentes ao gnero Neacomys Thomas, 1900, so
roedores de hbitos terrestres distribudos nas reas florestais da Amrica Central e Sul,
desde o Panam at a poro central da Bolvia e do Brasil. Nos ltimos anos, autores
apontaram que a diversidade deste gnero est subestimada, mediante dados
moleculares com o gene Citocromo b (Cyt b) que mostraram uma diversidade gentica
at ento desconhecida. Este trabalho tem como objetivos (i) propor uma hiptese
filogentica para as espcies distribudas na Amaznia, com nfase na Amaznia
oriental brasileira (ii) discutir a riqueza de espcies com base no levantamento de
linhagens evolutivas independentes dentro do grupo, e (iii) atualizar o conhecimento
sobre a distribuio geogrfica das espcies reconhecidas, contribuindo para revises
sistemticas e estudos evolutivos mais abrangentes para este grupo no futuro. Doze
linhagens foram observadas, das quais seis correspondem a espcies vlidas: N. dubosti,
N. guianae, N. musseri, N. minutus, N. paracou e N. spinosus; trs j foram
reconhecidos como distintas das espcies vlidas, mas no foram formalmente descritas:
Neacomys sp.2, Neacomys sp.3, Neacomys sp.4; e trs foram reconhecidos neste estudo
como espcies vlidas, dada sua alta divergncia gentica e topologia nos cladogramas
gerados: Neacomys sp.1, Neacomys sp.5 e Neacomys sp.6. Nossos resultados apontam
tambm nveis altos de divergncias nucleotdicas entre as espcies e dentro de uma
espcie em particular: Neacomys minutus, com 9,1% de divergncia intra-especfica.
Estudos futuros so necessrios para inferir se este grupo trata-se de um complexo de
espcies. Padres de distribuio foram verificados para este gnero, no qual os
principais rios amaznicos parecem atuar como barreiras distribuio de vrias
espcies, e ao menos um destes rios (rio Negro) pode ter tipo papel fundamental na
especiao deste grupo por vicarincia.

x
ABSTRACT
The spiny mice, belonging to the genus Neacomys Thomas, 1900 are distributed
terrestrial habits of rodents in the forest areas of Central and South America, from
Panama to the central portion of Bolivia and Brazil. In recent years, the authors showed
that the diversity of this genus is underestimated by molecular data with the Cytochrome
b gene (Cyt b) which showed a genetic diversity previously unknown. This study aims
to (i) to propose a phylogenetic hypothesis for species in the Amazon, with emphasis on
the eastern Brazilian Amazon (ii) discuss the species richness based on survey of
independent evolutionary lineages within the group, and (iii) update knowledge about
the geographic distribution of species recognized by contributing to systematic reviews
of evolutionary studies and more comprehensive for this group in the future. Twelve
strains were observed, six of which correspond to valid species: N. dubosti, N. guianae,
N. musseri, N. minutus, N. paracou and N. spinosus, three have already been recognized
as a valid species distinct from, but have not been formally described: Neacomys sp.2,
Neacomys sp.3, Neacomys sp.4 and three were recognized as valid species in this study,
given its high genetic diversity and topology in the cladograms generated: Neacomys
sp.1, and Neacomys sp.5 Neacomys sp.6. Our results also indicate high levels of
nucleotide differences between species and within a particular species: Neacomys
minutus, with 9.1% intraspecific divergence. Future studies are needed to infer whether
this group it is a species complex. Distribution patterns were observed for this genre, in
which the major Amazonian rivers seem to act as barriers to the distribution of various
species, and at least one of these rivers (Rio Negro) type may have key role in
speciation by vicariance this group.

1
1. INTRODUO GERAL
A ordem Rodentia a maior entre os mamferos viventes, contendo
aproximadamente 42% da diversidade da classe Mammalia (MUSSER & CARLETON,
2005), o que confirma ser um dos grupos com maior sucesso na histria evolutiva dos
mamferos (STEPPAN et al. 2004; VAN VALEN, 2004). Na regio Neotropical, 60%
das novas espcies descritas de mamferos pertencem a esta ordem (PATTERSON,
2000). Tem como principal caracterstica diagnstica a presena de um nico par de
incisivos superiores/inferiores, ausncia de caninos e processo ps glenide ausente.
composta por cinco subordens e 33 famlias (MUSSER & CARLETON, 2005).
Para o Brasil, Rodentia est representada por 11 famlias, das quais se destaca
Cricetidae, a mais diversificada com 681 espcies e 130 gneros (MUSSER &
CARLETON, 2005). Esta famlia caracteriza-se pelo arranjo bisserial das cspides
molares com reteno de uma conexo longitudinal (muro/murdeo) entre elas, e pela
formao de um anterocone/anterocondeo nos primeiros molares (MOOJEN, 1952;
MUSSER & CARLETON, 2005). Est composta por seis subfamlias: Arvicolinae,
Cricetinae, Lophiomyinae, Neotominae, Sigmodontinae e Tylomyinae (MUSSER &
CARLETON, 2005).
A maioria dos roedores da subfamlia Sigmodontinae neotropical. Sua
diversidade e distribuio acusam um marcado endemismo para muitas espcies no
continente sul-americano (REIG, 1980; 1984). Seus membros tm como caracterstica
principal os dentes com forma aproximada letra do alfabeto grego sigma (),
compondo

nove

tribos:

Akodontini,

Ichthyomyini,

Oryzomyini,

Phyllotini,

Reithrodontini, Sigmodontini, Thomasomyini, Wiedomyini e Abotrichini, que somam


cerca de 75 gneros e 378 espcies. Entre os 27 gneros alocados na tribo Oryzomyini,
inclui-se os roedores do gnero Neacomys, cujos representantes so vulgarmente
conhecidos como camundongos-de-espinho e estudos confirmam a sua incluso na tribo
(REIG, 1980, 1984; SMITH & PATTON, 1999; MUSSER & CARLETON, 2005;
DELIA et al., 2007; PERCEQUILLO et al., 2011).

2
O GNERO Neacomys
O grupo conta com oito espcies reconhecidas atualmente (Tabela 1), das quais
cinco ocorrem no Brasil: Neacomys dubosti, Voss, Lunde e Simons, 2001; Neacomys
minutus, Patton, da Silva e Malcolm, 2000; Neacomys musseri Patton, da Silva e
Malcolm, 2000; Neacomys paracou Voss, Lunde e Simons, 2001; e Neacomys spinosus
(Thomas, 1882). As espcies Neacomys pictus Godman, 1912, Neacomys tenuipes
Thomas, 1900 e Neacomys guianae Thomas, 1905 no ocorrem no Pas. Estas espcies
se distribuem no Panam e pores norte e central da Amrica do Sul, incluindo,
Colmbia, Equador, Peru, Bolvia, Venezuela, Brasil e na regio das Guianas
(PATTON et al., 2000; VOSS et al., 2001; MUSSER & CARLETON, 2005;
OLIVEIRA & BONVICINO, 2011; BONVICINO et al. 2008). No Brasil, a ocorrncia
das espcies de Neacomys foi confirmada nos biomas Amaznia e Cerrado (Figura 1),
nos seguintes estados: Acre, Amazonas, Amap, Gois, Mato Grosso, Par, Rondnia e
Roraima (THOMAS, 1903; CABRERA, 1961; PATTON et al., 2000; VOSS et al.,
2001; OLIVEIRA & BONVICINO, 2011).

Figura 1. Distribuio atual das espcies de Neacomys no Brasil (Retirado de BONVICINO et


al., 2008).

3
Os membros do gnero Neacomys (Figura 2) tm em comum as seguintes
caractersticas:

tamanho

pequeno,

semelhantes

aos

gneros

Oligoryzomys

Microryzomys, com cabea e corpo entre 70 a 80 mm, e cauda menor variando entre 65
e 75 mm de comprimento. Possuem plos-guarda cinza claro na base e castanho escuro
na parte distal; sobreplos acinzentados na base e com uma ampla faixa alaranjada na
poro distal. A colorao geral do dorso castanho-alaranjada, brilhante e finamente
tracejada de preto. As partes superiores dos membros, a face e as laterais do corpo, so
um pouco mais claras, bem delimitadas em relao ao ventre por uma faixa amarelada
mais escura, resultante da sobreposio dos sobreplos acinzentados das laterais do
corpo com os sobreplos totalmente sem pigmentao do ventre, que esbranquiado.
A cauda escamosa, pouco pilosa, de cor castanho-clara uniforme. Mos e ps so da
cor da pele, cobertos por pequenos plos esbranquiados e tufos ungueais prateados
cobrindo as garras. Possuem quatro pares de mamas: inguinal, abdominal, ps-axial e
peitoral. Em relao ao crnio, possuem crista supra-orbital bem desenvolvida e palato
longo e largo, circulao cartida padro 1 e 2, molares pequenos e pentalofodontes; o
primeiro molar inferior e superior no possuem razes acessrias (DIECKEMAN &
YATES 1995; ANDERSON, 1997; PATTON et al., 2000; VOSS et al., 2001;

K.C.Castro

BONVICINO et al., 2008).

Figura 2. Exemplar adulto de Neacomys paracou.

4
Estes roedores possuem hbitos terrestres e so predominantemente noturnos.
Em inventrios faunsticos, o nmero de exemplares coletados em armadilhas com isca
baixo, sendo capturados mais eficientemente em armadilhas de queda (pitfall traps). A
utilizao de pitfall-traps responsvel pelo recente aumento do nmero de exemplares
de Neacomys em colees cientficas. So encontrados principalmente em reas de
floresta de terra firme, mas tambm so registrados em reas de vrzea e de campo
cerrado em regies de transio entre Amaznia e Cerrado (PATTON et al., 2000;
VOSS et al., 2001; BONVICINO et al., 2008). Inventrios com longa durao,
realizados em rea de floresta de terra firme registraram atividades reprodutivas de
espcies deste gnero. Fmeas com dois a quatro embries foram capturadas no perodo
de fevereiro a outubro, sugerindo reproduo na maior parte do ano (ANDERSON,
1997; PATTON et al., 2000).
Desde a descrio de Hesperomys (Calomys) spinosus por Thomas (1882), 11
txons nominais do grupo da espcie j foram associados Neacomys (Tabela 1).
Apesar do baixo nmero de txons nominais, a taxonomia do gnero problemtica em
muitos aspectos devido principalmente s breves diagnoses das espcies presentes nas
descries originais e trabalhos compilatrios, dificultando a identificao das espcies
(THOMAS,1882, 1900, 1903, 1905; GODMAN 1912; GYLDENSTOLPE, 1932;
ELLEMAN, 1941; CABRERA, 1961). Ademais no h revises taxonmicas
abrangentes do gnero, mas apenas estudos taxonmicos pontuais (PATTON et al.,
2000; VOSS et al., 2001; CATZEFLIS & TILAK, 2009).

Tabela 1. Txons nominais do grupo da espcie associados a Neacomys e suas respectivas


localidades tipo (Cabrera 1961; Musser & Carleton, 2005). Txons nominais atualmente
reconhecidos como espcies vlidas possuem asterisco (*).
Epteto especfico

Localidade - tipo

dubosti* Voss, Lunde & Simons, 2001

Guiana Francesa, Paracou. 515'N 53W

guianae* Thomas, 1905

Guiana Inglesa, Rio Demerara, 36 m. 6 47' 60 N 58


10' W

5
minutus* Patton, da Silva & Malcolm, Brasil, Amazonas, margem esquerda do rio Juru,
2000

Altamira. 635S, 6854W.

musseri* Patton, da Silva & Malcolm, Peru, Cuzco, Manu Biosphere Reserve, 72 km,
2000

NE Paucartambo, 152 km, 1460 m. 13 18' 56S 71


35' 30W

paracou* Voss, Lunde & Simons, 2001 Guiana Francesa, Paracou. 515'N 53W
pictus* Godman, 1912

Panam, Provncia de Drien, Santa Cruz de Cana, no


alto Tuyra. 549 m. 8.345N

78.0661111W
spinosus* (Thomas, 1882)
amoenus Thomas, 1903

Per, Huambo, 1128 m. 6 22' 0S 77 28' 0W


Brasil, Mato Grosso, Santana da Chapada, 800 m. 1525'
60S 5545'W

carceleni Hershkovitz, 1940

Equador, Isla Llunchi, Rio Napo, Napo-Pastaza, 250 m.


037S 7646W.

tenuipes* Thomas, 1900

Colmbia,

Cundinamarca,

Regio

de

Bogot,

Guaquimay 700 m. 528'00''S -7411'00''W


pusillus, Allen, 1912

Colmbia, San Jos, distrito de Cauca. 2 57' 44N 77


35' 55W

SISTEMTICA MOLECULAR DO GNERO Neacomys


Marcadores moleculares vm sendo aplicados com bastante eficincia para a
compreenso das relaes filogenticas, resolues de questes taxonmicas e descrio
de novas espcies de roedores sigmodontneos (GARDNER & PATTON, 1976; SMITH
& PATTON 1991, 1993, 1999; PATTON et al., 2000; VOSS et al., 2001; WEKSLER,
2003; BORISENKO et al., 2008; CATZEFLIES & TILAK, 2009; PERCEQUILLO et
al., 2011). Nestes estudos, a monofilia da tribo Orizomyini foi confirmada, assim como
a dos gneros que a compem (MIRANDA, 2007). Entretanto, o conhecimento acerca

6
das relaes intra-genricas ainda incipiente (PATTON et al. 2000; WEKSLER, 2003;
WEKSLER, 2006; CATZEFLIES & TILAK, 2009).
Dentre

os

marcadores

comumente

utilizados,

destacam-se

os

genes

mitocondriais. Estes so utilizados tanto para estudos filogenticos quanto estudos


filogeogrficos (BRITO & EDWARDS, 2009). A aplicabilidade do genoma
mitocondrial se deve principalmente por apresentar diferentes taxas mutacionais, e
evoluo mais acelerada em relao ao genoma nuclear, pela facilidade de isolamento e
por apresentar sistema simples de transmisso gentica (em geral herana materna),
permitindo a sua utilizao para diferentes abordagens (AVISE et al. 1987; SACCONE
et al.,2000; MORIN et al., 2004).
Nos estudos de filogenia molecular com sigmodontneos os marcadores mais
utilizados so os genes Citocromo b (Cyt b) e Citocromo Oxidase C, subunidade I
(COI), que tem sido amplamente empregado para identificao de espcies, aplicado
como um cdigo de barras denominado Barcoding de DNA (FOLMER et al., 1994;
IVANOVA et al., 2006; BORISENKO et al., 2008).
No gnero Neacomys ainda no h uma filogenia completa. Os estudos
realizados at o momento incluram apenas algumas espcies e corroboraram o
monofiletismo de Neacomys. Dentre eles, trs utilizaram somente dados moleculares
nas anlises (PATTON et al., 2000; WEKSLER, 2003; CATZEFLIES & TILAK, 2009)
e um utilizou alm dos moleculares, dados morfolgicos (WEKSLER, 2006). Em todos
os estudos supracitados e tambm nos realizados por DIECKMAN & YATES (1995), e
MYERS et al. (1995) e MIRANDA et al. (2009), os gneros Microryzomys e
Oligoryzomys aparecem como grupos irmos de Neacomys (Figura 3), apesar do baixo
suporte estatstico (Bootstrap=74; ndice de Decaimento=2).

Figura 3. rvore filogentica de Mxima Parcimnia (consenso estrito) utilizando dados


moleculares (gene xon IRBP) e morfolgicos combinados. O clado est formado por trs
espcies de Neacomys. Figura modificada de WEKSLER (2006; pgina 65, figura 37).

PATTON et al. (2000) apresentaram a primeira abordagem filogentica


especfica para Neacomys a partir de exemplares procedentes da regio do rio Juru,
estados do Acre e Amazonas, Brasil. Estes autores investigaram a diversificao do
gnero atravs de sequncias de 801pb do gene mitocondrial Cyt b de 53 exemplares
das seguintes espcies: N. spinosus, N. tenuipes, N. guiane (provenientes de outras
localidades da Amaznia), mais duas espcies descritas pelos autores (N. musseri e N.
minutus), alm de espcies no definidas, resultando em sete clados na rvore
filogentica (Figura 4). A divergncia molecular mdia estimada entre as espcies,
atravs da distncia de Kimura, variou entre 11 e 17%. Dentre os clados, est uma
espcie de Neacomys no definida para a Amaznia oriental brasileira, especificamente
no Rio Xingu, PA. Coletivamente esses clados evidenciam o conhecimento inadequado
da taxonomia de Neacomys, cuja diversidade encontra-se amplamente subestimada.

Figura 4. rvore de Mxima Parcimnia (consenso estrito) para as espcies de Neacomys, com
base em 801 pb do Cyt b (PATTON et al., 2000).

Recentemente, CATZEFLIES & TILAK (2009) propuseram uma filogenia para


Neacomys enfatizando as trs espcies do gnero que ocorrem em simpatria na regio
das Guianas: N. guiane, N. paracou e N. dubosti. Em suas anlises moleculares
utilizando 801 pb do gene Cyt b, os autores corroboraram o monofiletismo do gnero,
alm disso, como sugerido em outro estudo na regio (VOSS et al. 2001), os autores
apontaram distncia molecular alta entre as espcies, em contraste com a acentuada
similaridade morfolgica. Foram analisadas as relaes filogenticas entre indivduos
das espcies N. dubosti, N guianae e N. paracou de diferentes localidades da Guiana
Francesa, Suriname e Guiana, como mostra a Figura 5.
A rvore proposta por CATZEFLIES & TILAK (2009) apresenta fortes
implicaes zoogeogrficas, sugerindo que os clados da Guiana no formam grupos

9
monofilticos separados de outras formas no-guianenses. Tal achado pode indicar que
a diversidade dos camundongos-de-espinhos da Guiana no parece ser resultado de
radiao local, mas sim de um passado de intercmbio com outras regies da fauna
amaznica. Este estudo encontrou uma distncia molecular mdia de 13%, entre os
clados da regio das Guianas, variando entre 11,5% a 15,2%, nmeros semelhantes aos
do estudo realizado no rio Juru (PATTON et al. 2000). Os autores incluram outras
seqncias utilizadas por PATTON et al. (2000), entre estas a do clado 7 (figura 4)
proveniente do rio Xingu, Amaznia oriental, e este manteve-se isolado perante outras
formas das Guianas e Amaznia ocidental. Como no era relevante para o estudo, os
autores optaram por no representar esta seqncia no cladograma publicado (figura 5).
Entretanto, o isolamento do clado 7 mostra a necessidade de um estudo direcionado
para outras regies onde este gnero ocorre, como a Amaznia oriental brasileira.

Figura 5. rvore de mxima verossimilhana (modelo de substituio GTR+I+G) para 801 pb do


citocromo b de 21 espcimes de Neacomys, obtida por CATZEFLIES & TILAK (2009), com
valores de bootstrap (acima: MP; abaixo: ML) acima de 70%. Fonte: CATZEFLIES & TILAK
(2009; pgina 241, figura 1).

10
Com base na diversidade subestimada do gnero Neacomys para a regio
amaznica, especificamente para a Amaznia Oriental onde no h informaes
adequadas sobre a distribuio geogrfica e a delimitao das espcies, este trabalho
tem como objetivos (i) propor uma hiptese filogentica para as espcies distribudas na
Amaznia, com nfase na Amaznia oriental brasileira (ii) discutir a riqueza de espcies
com base no levantamento de linhagens evolutivas independentes dentro do grupo, e
(iii) atualizar o conhecimento sobre a distribuio geogrfica das espcies reconhecidas,
contribuindo para revises sistemticas e estudos evolutivos mais abrangentes para este
grupo no futuro.
Os mtodos e os resultados encontrados neste estudo sero apresentados a seguir,
em formato de artigo cientfico a ser submetido revista Molecular Phylogenetics and
Evolution.

11
REFERNCIAS BIBLIOGRFICAS
ALLEN, J.A. 1912. Mammals from western Colombia. Bulletin American Museum
Natural History. Vol. XXXI. p. 71-95.
ANDERSON, S. 1997. Mammals of Bolivia, taxonomy and distribution. Bulletin
American Museum Natural History. 231: 652 p.
AVISE, J.C.; ARNOLD, J.; BALL, R.M.; BERMINGHAM, E.; LAMB. T.; NEIGEL,
J.E.; REEB, C.A.; SAUNDERS, N.C. 1987. Intraspecific phylogeography: The
mitochondrial DNA bridge between population genetics and systematics. Annals
Review Ecology e Systematics. 18, p. 489-522.
BONVINCINO, C.R.; OLIVEIRA, J.A.; DANDREA, P.S. 2008. Guia dos roedores do
Brasil, com chaves para gneros baseadas em caracteres externos. Centro Pan Americano de Febre Aftosa OPAS/OMS, Rio de Janeiro, 120 p.
BORISENKO, A.V.; LIM, B.K.; IVANOVA, N.V.; HANNER, R.H.; HEBERT, P.D.N.
2008. DNA barcoding in surveys of small mammal communities: a Field study in
Suriname. Molecular Ecology Resources, vol. 8, p. 471-479.
BRITO, P.H.; EDWARDS, S.V. 2009. Multilocus phylogeography and phylogenetics
using sequence-based markers. Gentica, (2009) 135, p. 439455
CABRERA, A. 1961. Catalogo de los mamiferos de America del Sur. Revista Del
Museo Argentino de Ciencias Naturales Bernladino Rivadavia, Zoologia, vol. 4, n.
2, p. 309-732.
CATZEFLIS, F.; TILAK, M. 2009. Molecular systematic of Neotropical spiny mice
(Neacomys: Sigmodontinae, Rodentia) from the Guianan Region. Mammalia, vol. 73,
p. 239 - 247.
DICKERMAN, A.W.; YATES, T.L. 1995. Systematics of Oligoryzomys: Protein
electrophoretic analyses. Journal of Mammalogy. 76, p. 172 188.

12
DELIA, G.; PARDIAS, U.F.J.; TETA, P.; PATTON, J.L. 2007. Definition and
diagnosis of a new tribe of sigmodontine rodents (Cricetidae: Sigmodontinae), and a
revised classification of the subfamily. Gayana 71(2), p. 187-194.
ELLERMAN, J.R. 1941. The families and genera of living rodents. Vol. II. Family
Muridae. British Museum (Natural History). London, 690 p.
FOLMER, O.; BLACK, M. HOEH, W.; LUTZ, R.; VRIJENHOEK, R. 1994. DNA primers for
amplification of mitochondrial Cytochrome C Oxidase subunit I from diverse metazoan
invertebrates. Molecular Marine Biology and Biotechnology. 3, p. 294-297.

GARDNER, A.L.; PATTON, J.L. 1976. Karyotypic variation in oryzomyinae rodents


(Cricetinae) with comments on chromosomal evolution in the Neotropical cricetinae
complex.Occasional Papers of the Museum of Zoology, Louisiana State University,
n. 49, p. 1-48.
GODMAN, 1912. E. A. New mammals from eastern Panama. Smithsonian
Miscelaneous Collection 60(2): 18 p.
GYLDENSTOLPE, N. 1932. A manual of Neotropical sigmodont rodents. K. Sven.
Vetenskapsakad. Handl., Ser. 3, Band 11(3): 164 p. 118 pl.
HERSHKOVITZ, P.1940. A new spiny mouse of the genus Neacomys from eastern
Ecuador. Occasional Papers of the Museum of Zoology. 419: p. 1-4.
IVANOVA, N.V.; ZEMLAK, T.S.; HANNER, R.H.; HEBERT, P.D.N. 2007. Universal
primer cocktails for fish DNA barcoding. Molecular Ecology Notes, 7, 544548.
MIRANDA, G.B. 2007. Relaes filogenticas entre as espcies de roedores sulamericanos da tribo Orizomini analizadas pelos genes Citocromo b e IRBP. Tese de
Doutorado. Universidade Federal do Rio Grande do Sul. Porto Alegre, 180 p.
MIRANDA, G.B.; OLIVEIRA, L.F.B.; ANDRADES-MIRANDA, J.; LANGGUTH,
A.; CALLEGARI-JACQUES, S.M.; MANTEVI, M.S. 2009. Phylogenetic and
Phylogeographicn Patterns in Sigmodontine Rodents of the Genus Oligoryzomys.
Journal of Heredity. 100(3):309321.

13
MOOJEN, J. 1952. Os Roedores do Brasil. Ministrio da Educao e Sade:
Instituto Nacional do Livro. Rio de Janeiro, 214 p.
MORIN, P.A.; LUIKART, G.; WAYNE, R. K. & SNP WORKSHOP GROUP. 2004.
SNPs in ecology, evolution and conservation. Trends in Ecology and Evolution. 19
(4), 208-216.
MUSSER, G.G.; CARLETON, M.D. 1993. Family Muridae. In: WILSON, D.E.;
REEDER, D.M. (Eds.). Mammal species of the world, a taxonomic and geographic
reference, 2a Edio, Smithsonian Institution Press, Washington D.C., p. 501-755.
MUSSER, G.G.; CARLETON, M.D. 2005. Superfamily Muroidea. In: WILSON, D.E.;
REEDER, D.M. (EDS.). Mammals species of the World, a taxonomic and geographic
reference. 3a. Edio, Vol. 2. The Johns Hopkins University Press, Baltimore. p.8941531.
MYERS, P.; LUNDRIGAN, B. e TUCKER, P. K. 1995. Molecular Phylogenetics of
Oryzoyine Rodents: The Genus Oligoryzomys. Molecular Phylogenetics and
Evolution 4. n4: p. 372-382
OLIVEIRA, J.A. BONVICINO, C. R. 2011. Ordem Rodentia. In: REIS, N.R.;
PERACCHI, A.L.; PEDRO, W.A.; LIMA, I.P. (eds). Mamferos do Brasil. 2 Edio.
Universidade Estadual de Londrina, Londrina, 437 p.
PATTERSON, B.D. 2000. Patterns and trends in the discovery of New Neotropical
Mammals. Diversity and Distribuitions, 6: p. 145-151.
PATTON, J.L.; DA SILVA, M.N.F; MALCOLM, J.R. 2000. Mammals of the rio Juru
and the evolutionary and ecological diversification of Amazonia. Bulletin of the
American Museum of Natural History, n. 244, p. 1-306.
PERCEQUILLO, A.R.; WEKSLER, M; COSTA, L.P.C. 2011. A new genus and
species of rodent from the Brazilian Atlantic Forest (Rodentia: Cricetidae:
Sigmodontinae: Oryzomyini), with comments on oryzomyine biogeography. Zoological
Journal of the Linnean Society, 161, 357390.

14
REIG, O.A. 1980. A new fossil genus of South American cricetid rodents allied to
Wiedomys, with an assessment of the Sigmodontinae. Journal of Zoology, London, n.
192, p. 257-281.
REIG, O.A. 1984. Distribuio geogrfica e histria evolutiva dos roedores muroideos
sulamericanos (Cricetidae: Sigmodontinae). Revista Brasileira de Gentica, vol. 7, p.
333-365.
SMITH, M.F.; PATTON, J.L. 1991. Variation in mitochondrial cytochrome-b sequence
in

natural

populations

of

South

American

akodontine

rodents

(Muridae:

Sigmodontinae). Molecular Biology and Evolution, v. 8, p. 85-103.


SMITH, M.F.; PATTON, J.L. 1993. The diversification of South American murid
rodents: evidence from mitochondrial DNA sequence data for akodontine tribe.
Biological Journal of Linnean Society, vol. 50, p. 149-177.
SMITH, M.F.; PATTON, J.L. 1999. Phylogenetic relationships and the radiation of
sigmodontine rodents in South America: evidence from Cytochrome b. Journal of
Mammalian Evolution, vol. 6, n. 2, p. 89-128.
STEPPAN, S.J.; ADKINS, R.M.; ANDERSON, J. 2004. Phylogeny and DivergenceDate Estimates of Rapid Radiations in Muroid Rodents Based on Multiple Nuclear
Genes. Systematic Biology. 53(4):533553.
TATE, G.H.H. 1939. Mammals of the Guiana region. Bulletin of the American
Museum of Natural History . 76: 151229.
THOMAS, O. 1882. On a collection of rodents from north Peru. Proceedings of the
Zoological Society of London 1882: p. 98111 1 pl. IV.
THOMAS, O. 1900. New South American mammals. Annals and Magazine of
Natural History 7(5): p. 148153.
THOMAS, O. 1903. On the mammals collected by Mr. A. Robert at Chapada Mato
Grosso (Percy Sladen Expedition to Central Brazil). Proceedings of the Zoological
Society of London, 2: p. 232-244. PI.XXVII.

15
THOMAS, O. 1905. New Neotropical Chrotopterus, Sciurus, Neacomys, Coendou,
Proechimys, and Marmosa. Annals and Magazine of Natural History 7(16): p. 308
314.
VAN VALEN, L. 2004. Chapter 8: Adaptation and the Origin of Rodents. Bulletin of
the American Museum of Natural History. 285 :110-119.
VOSS, R.S; LUNDE, D.P.; SIMMONS, N.B. 2001. The mammal of Paracou, French
Guiana: a Neotropical lowland rainforest fauna part 2. Nonvolant species. Bulletin of
the American Museum of Natural History. n. 263, p. 1-236
WEKSLER, M. 2003. Phylogeny of neotropical oryzomyine rodents (Muridae:
Sigmodontinae) based on the nuclear IRBP exon. Molecular Phylogenetics and
Evolution, vol. 29, p. 331-349.
WEKSLER, M. 2006. Phylogenetic relattioships of oryzomine rodents (Muroidea:
Sigmodontinae): separate and combined analyses of morphological and molecular data.
Bulletin of the American Museum of Natural History, n. 296, 149 pp.
WOODMAN, N., R. M. TIMM, R. ARANA C., V. PACHECO, C. A. SCHMIDT, E.
D. HOOPER; C. PACHECO A. 1991. Annotated checklist of the mammals of Cuzco
Amazonico, Peru. Occasional Papers of the Museum of Natural History University
of Kansas.145: p. 12

16
Molecular Phylogenetics and Evolution

Inferncias Filogenticas e Diversidade Molecular no gnero Neacomys


Thomas 1900 (Rodentia: Cricetidae), com nfase na Amaznia Oriental
brasileira
Elizandra de Matos Cardosoa,b,*, Rogrio Vieira Rossic, Grazielle Evangelista Gomesb,
Iracilda Sampaio b , Horcio Schneiderb.
a

Museu Paraense Emlio Goeldi, Mastozoologia, Coordenao de Zoologia, CP 399. Av.

Perimetral, 1901, Terra Firme, 66077-530 Belm, Par, Brasil.


b

Universidade Federal do Par, Instituto de Estudos Costeiros. Laboratrio de Gentica e

Biologia Molecular. Alameda Leandro Ribeiro Bloco B s/n, Aldeia, 68600-000, Bragana,
Par, Brasil.
c

Universidade Federal de Mato Grosso, Instituto de Biocincias, Departamento de Biologia e

Zoologia. Av. Fernando Corra da Costa, 2367, Boa Esperana, 78060-900, Cuiab, Mato
Grosso, Brasil.
*

Endereo para correspondncia: Email - elz_matos@yahoo.com.br.

17
ABSTRACT

The spiny mice, belonging to the genus Neacomys Thomas, 1900 are distributed
terrestrial habits of rodents in the forest areas of Central and South America, from
Panama to the central portion of Bolivia and Brazil. In recent years, the authors showed
that the diversity of this genus is underestimated by molecular data with the Cytochrome
b gene (Cyt b) which showed a genetic diversity previously unknown. This study aims
to (i) to propose a phylogenetic hypothesis for species in the Amazon, with emphasis on
the eastern Brazilian Amazon (ii) discuss the species richness based on survey of
independent evolutionary lineages within the group, and (iii) update knowledge about
the geographic distribution of species recognized by contributing to systematic reviews
of evolutionary studies and more comprehensive for this group in the future. Twelve
strains were observed, six of which correspond to valid species: N. dubosti, N. guianae,
N. musseri, N. minutus, N. paracou and N. spinosus, three have already been recognized
as a valid species distinct from, but have not been formally described: Neacomys sp.2,
Neacomys sp.3, Neacomys sp.4 and three were recognized as valid species in this study,
given its high genetic diversity and topology in the cladograms generated: Neacomys
sp.1, and Neacomys sp.5 Neacomys sp.6. Our results also indicate high levels of
nucleotide differences between species and within a particular species: Neacomys
minutus, with 9.1% intraspecific divergence. Future studies are needed to infer whether
this group it is a species complex. Distribution patterns were observed for this genre, in
which the major Amazonian rivers seem to act as barriers to the distribution of various
species, and at least one of these rivers (Rio Negro) type may have key role in
speciation by vicariance this group.

18
1. Introduo
Os camundongos de espinho, pertencentes ao gnero Neacomys Thomas,
1900, so roedores de hbitos terrestres distribudos nas reas florestais da Amrica
Central e Sul, desde o Panam at a poro central da Bolvia e do Brasil (Patton et al.,
2000; Voss et al., 2001; Musser & Carleton, 2005; Bonvicino et al., 2008; Oliveira &
Bonvicino, 2011) (Figura 1).
A primeira espcie de Neacomys foi descrita por Thomas (1882) sob o gnero
Hesperomys, baseado em um exemplar proveniente de Huambo, Peru. Segundo este
autor, H. spinosus se destacava das demais do gnero por apresentar crista supraorbital
mais desenvolvida e presena de plos rgidos como espinhos. Porm, em 1900, este
mesmo autor definiu um novo grupo para alocar esta espcie, criando o gnero
Neacomys.
At o presente momento, onze txons nominais do grupo da espcie j foram
associados ao gnero, dos quais oito correspondem a espcies vlidas, dois a sinnimos
de N. spinosus e um a sinnimo de N. tenuipes, segundo Patton et al. (2000), Voss et al.
(2001) e Musser & Carleton (2005) (Tabela 1).
Apesar do baixo nmero de txons nominais do grupo da espcie associados a
Neacomys, taxonomia do gnero problemtica em muitos aspectos, devido
principalmente breves diagnoses de espcies presentes nas descries originais e
trabalhos compilatrios, e da inexistncia de revises taxonmicas amplas para o grupo.
Ademais, quatro espcies foram descritas recentemente (Patton et al., 2000; Voss et al.,
2001), evidenciando um grande desconhecimento sobre a diversidade dentro do gnero.
Por estas razes, diversos autores concordam com a necessidade de uma reviso
necessria para o gnero (Woodman et al., 1991; Musser & Carleton, 2005; Voss et al.,
2001; Catzeflies & Tilak, 2009).
Ainda no h uma filogenia completa para o gnero Neacomys. Os estudos
realizados at o momento incluram apenas algumas espcies deste gnero, e
corroboraram o monofiletismo de Neacomys. Dentre eles, trs utilizaram somente dados
moleculares nas anlises (Patton et al., 2000; Weksler, 2003; Catzeflies & Tilak, 2009)

19
e um utilizou dados moleculares e morfolgicos (Weksler, 2006). Em todos os estudos
supracitados e tambm nos estudos realizados por Dickerman & Yates (1995), e Myers
et al. (1995) e Miranda et al. (2009) com o gnero Oligoryzomys, os gneros
Microryzomys e Oligoryzomys aparecem como grupos irmos de Neacomys.
No estudo de Patton et al. (2000) foi investigada a diversificao do gnero no
rio Juru, estados do Acre e Amazonas, Brasil, atravs de seqncias de 801pb do gene
mitocondrial citocromo b de 53 exemplares regionais e de outras localidades da
Amaznia pertencentes a N. spinosus, N. tenuipes, N. guiane e duas espcies descritas
pelos autores (N. musseri e N. minutus), alm de espcies no definidas. A filogenia
molecular destes autores resultou em sete clados correspondentes a diferentes espcies.
A distncia molecular mdia estimada entre as espcies, atravs da distncia de Kimura,
variou entre 11 e 17%. Dentre os clados, est uma espcie de Neacomys no definida
para a Amaznia oriental brasileira, especificamente no Rio Xingu, PA. Coletivamente,
esses clados evidenciam o conhecimento inadequado da taxonomia de Neacomys, cuja
diversidade encontra-se amplamente subestimada.
Recentemente, Catzeflies & Tilak (2009) realizaram a segunda abordagem
filogentica especfica para Neacomys. Utilizando 801 pb do gene mitocondrial
citocromo b, foram estudadas as relaes filogenticas entre indivduos das espcies N.
dubosti, N guianae e N. paracou de diferentes localidades da Guiana Francesa,
Suriname e Guiana. Os resultados encontrados por esses autores apresentam fortes
implicaes zoogeogrficas, sugerindo que os clados da Guiana no formam grupos
monofilticos separados de outras formas no-guianenses. Tal achado pode indicar que
a diversidade dos camundongos-de-espinhos da Guiana no parece ser resultado de
radiao local, mas sim de um passado de intercmbio com outras regies da fauna
amaznica. Este estudo encontrou uma distncia molecular mdia de 13%, entre os
clados da regio das Guianas, variando entre 11,5% a 15,2%. Os autores incluram
outras seqncias utilizadas por Patton et al. (2000), entre as quais o clado 7
proveniente do rio Xingu, PA, que se manteve isolado perante outras formas das
Guianas e Amaznia ocidental. Por no ser o enfoque do estudo, os autores optaram por
no apresentar esta seqncia no cladograma de seu artigo e no comparar divergncias
com outras linhagens de Neacomys publicadas anteriormente. Entretanto, o isolamento

20
do clado representado por um exemplar do rio Xingu em ambos os estudos supracitados
mostra a necessidade de estudos direcionados para outras regies onde este gnero
ocorre, como a Amaznia oriental brasileira.
Com base na diversidade subestimada do gnero Neacomys para a regio
amaznica, especificamente para a Amaznia Oriental onde no h informaes
adequadas sobre a distribuio geogrfica e a delimitao das espcies, este trabalho
tem como objetivos (i) propor uma hiptese filogentica para as espcies
distribudas na Amaznia, com nfase na Amaznia oriental brasileira (ii) discutir
a riqueza de espcies com base no levantamento de linhagens evolutivas
independentes dentro do grupo, e (iii) atualizar o conhecimento sobre a
distribuio geogrfica das espcies reconhecidas, contribuindo para revises
sistemticas e estudos evolutivos mais abrangentes para este grupo no futuro.
2. Material e Mtodos
2.1 Obteno e identificao de amostras
As amostras obtidas foram provenientes de materiais de projetos da
Mastozoologia do Museu Paraense Emlio Goeldi (MPEG) e do banco de tecidos das
seguintes instituies: Instituto de Pesquisas Cientficas e Tecnolgicas do Estado do
Amap (IEPA), Instituto Nacional de Pesquisas da Amaznia (INPA) e Instituto de
Biocincias da Universidade de So Paulo (IB-USP). As identificaes das amostras
foram verificadas junto aos exemplares depositados nas colees de mamferos das
instituies supracitadas, exceo os exemplares correspondentes s amostras do IBUSP, estes foram verificados na coleo de mamferos do Museu de Zoologia da
Universidade de So Paulo (MZUSP).
2.2 Isolamento do material gentico
Foram utilizadas 106 amostras de Neacomys e uma das espcies empregadas
como grupo externo Oligoryzomys microtis (Apndice B). Destas amostras foram
isolados os fragmentos mitocondriais dos genes citocromo b cytb (83 sequencias de
651 pb), citocromo oxidase, subunidade 1 COI (57 sequencias de 540 pb) e o
fragmento nuclear do ntron 2 do alcohol dehydrogenase - ADH1-I2 (46 sequencias de

21
540 pb). Alm das amostras obtidas supracitadas, foram obtidas treze seqncias do
GenBank (cinco para cytb, quatro para COI e quatro para ADH1-I2; Tabela 2),
incluindo seqncias de uma expcie do grupo externo Oligoryzomys fulvescens.
Tambm foram adicionadas 43 seqncias do gene cytb de amostras de localidades do
Peru, Bolvia, Equador e algumas do rio Juru, cedidas por J.L. Patton (MVZ, Berkeley;
Apndice B). Neste trabalho somente duas espcies do gnero no foram includas nas
amostras: N. tenuipes e N. pictus.
O DNA foi extado a partir de amostras de tecido muscular ou fgado usando trs
tipos de protocolo de extrao: 1) Fenol-clorofrmio e proteinase K-RNAse (Sambrook
et al, 1998), 2) Sal (Aljanabi & Martinez, 1997) e 3) Kit de extrao: DNeasy tissue
extraction Kit (Qiagen).
As regies genmicas utilizadas na presente anlise foram isoladas atravs da
Tcnica de PCR (Reao em Cadeia da Polimerase). Os iniciadores foram: para cytb,
MVZ05

5-CGAAGCTTGATATGAAAAACCATCGTTG-3

MVZ16

3-

AAATAGGAARTATCAYTCTGGTTTRAT-5 (Smith & Patton 1993); para COI,


LCO

1490

3-GGTCAACAAATCATAAAGATATTGG-5

HCO

2198

5-

TAAACTTCAGGGTGACCAAAAAATCA-3 (Folmer et. al.,1994); e para ADH1-I2,


EXON IIF 5GTAATCAAGTGCAAAGCRGCYYTRTGGGAG3 e 2340 II 3TAACCACGTGGTCATCTGAGCG (Amman et al., 2006). As condies de
amplificao foram as seguintes: para Cyt b: desnaturao inicial a 94C por 3 minutos,
seguido de 35 ciclos de 30 segundos de desnaturao a 94C, 1 minuto de anelamento a
49C (Cytb) -, 51C (COI) - 59C (ADH1 I2), e 2 minutos de extenso a 72C, com
uma extenso final a 72C por 7 minutos. Os produtos das PCRs foram seqenciados
utilizando-se o mtodo didesoxiterminal (Sanger et al,. 1977), no seqenciador
automtico de capilar ABI 3500 XL (Applied Biosystems).
2.3 Inferncias filogenticas
As seqncias foram editadas e alinhadas utilizando-se os programas
CLUSTALX (Thompson et al., 1997) e BIOEDIT 7.0.5.2 (Hall, 1999). Foram
construdos quatro bancos de dados, correspondendo a cada marcador molecular
utilizado e incluindo todas as regies para anlise dos dados concatenados. Esta anlise

22
com os dados combinados foi possvel aps a realizao do teste de Homogeneidade de
Partio (THP) (Farris et al. 1995), onde os bancos apresentaram congruncia (p =
0,77).
A saturao dos dados foram realizados no programa DAMBE 5.0.59 (Xia &
Xie 2001), respectivamente. Para a seleo do modelo evolucionrio, considerando cada
marcador, utilizou-se o programa Modeltest 2.3 (Posada, 2008) no PAUP* 4.0. O
modelo de susbtituio nucleotdica selecionado para os genes cytb e COI foi o GTR + I
+ G, com taxa de substituio igual a 6, parmetro de distribuio gamma igual a
1,6199 (cytb) e 1,0953 (COI), e a proporo de stios invariveis de 0,5539 (cytb) e de
0,6152 (COI). Para o gene ADH1-I2 foi HKY + G, com uma taxa de substituio igual
a 2, parmetro de distribuio gamma igual a 0,3228, e a proporo de stios invariveis
igual a zero. Considerando dados concatenados, o modelo selecionado foi GTR + I + G,
com uma taxa de substituio igual a 6, parmetro de distribuio gamma igual a
1,2547, e a proporo de stios invariveis igual a 0,6478.
Para a obteno das rvores filogenticas, utilizaram-se mtodos baseados em
estados de carter: Mxima Verossimilhana (ML), Mxima Parcimnia (MP) e
Inferncia Bayesiana. Na Anlise Bayesiana mediante o MrBayes 3.1 (Ronquist and
Huelsenbeck 2003), foi utilizado o modelo evolutivo encontrado para os quatros bancos
supracitados no JModeltest 0.1.1 (Posada, 2008), foram realizadas quatro cadeias, cada
uma com quatro milhes de geraes (Cyt b) e trs milhes de geraes (Concatenado),
com a freqncia da amostra igual a 100. Anlise de Mxima Verossimilhana (ML)
conduzida no programa PHYML (Guindon & Gascuel 2003), usando o modelo
evolutivo descrito para os quatros bancos, com bootstrap de 1000 rplicas (Felsenstein
1985) para o suporte dos clados. Anlise de Mxima Parcimnia (MP) conduzidas no
PAUP* 4.0., onde a melhor rvore foi encontrada por busca heurstica com 1000
rplicas, rvore inicial obtida via Stepwise addition e arranjo Branch Swapping (TBR=
tree bisection and reconection).
Para comparao com os dados da literatura, a composio de bases e
estimativas de distncias genticas das seqncias de Neacomys nos nveis intrapopulacional, intra-especfico e intra-genrico foram conduzidas no modelo Kimura 2
parmetros no programa MEGA 5.0 (Kimura, 1980; Tamura et al., 2011), considerando

23
diferentes padres de substituies de nucleotdeos entre as linhagens. A variao da
taxa entre os stios foi verificada pela distribuio gama (cytb = 1.6199; COI = 1.095;
ADH = 0.3228; dados concatenados = 1.2547). Todas as posies de cdon foram
includas para comparao, ignorando apenas as lacunas envolvidas na comparao por
pares de sequncias.
3. Resultados
3.1 Caracterizao dos bancos de dados
No fragmento de 651 pb de Cytb a composio nucleotdica consistiu em:
30,53% A; 26,15% C; 13,2% G; e 30,30% T. Foram observados 284 stios variveis dos
quais 263 so informativos para parcimnia. No fragmento de 540 pb analisados nas
seqncias de COI, a composio nucleotdica consistiu em: 29,26% A; 30,97% C;
15,18% G; e 30,97% T. Foram observados 159 stios variveis dos quais 134 so
informativos para parcimnia. Quanto ao gene nuclear ADH1-I2, no fragmento de 540 pb
a composio nucleotdica consistiu em: 32,12% A; 18,77% C; 16, 68% G; e 32,42% T.

Foram observados 69 stios variveis dos quais 44 so informativos para parcimnia.


3.2 Inferncias filogenticas
Neste trabalho foi realizado um total de 11 anlises (Tabela 3). Todas as
topologias resultantes confirmou-se a monofilia do gnero Neacomys e a existncia de
um nmero maior de espcies em relao as oito atualmente reconhecidas. Estas
espcies foram reconhecidas mediante grupos monofilticos distintos, com alto suporte
estatstico e divergncias nucleotdicas compatveis com as encontradas em espcies
amplamente aceitas de sigmodontneos.
O nmero de clados que correspondem a diferentes espcies variou em funo
das seqncias disponveis para cada banco de dados utilizado: 12 espcies para Cyt b
(Figura 2), oito espcies para COI (no apresentado), sete espcies para ADH-I2 (no
apresentado) e 10 espcies para os dados concatenados (Figura 3). A composio destes
grupos foi constante nas 11 anlises realizadas, porm a relao entre eles variou nas
diferentes anlises.

24
Dentre estes clados obtidos, seis j foram reconhecidos e descritos na literatura
como espcies vlidas: N. dubosti, N. guianae, N. musseri, N. minutus, N. paracou e N.
spinosus; e trs j foram reconhecidos como linhagens separadas das outras espcies,
mas no foram formalmente descritas: Neacomys sp.2 (= clado 7 de Patton et al., 2000),
Neacomys sp.3 (= clado 3 de Patton et al., 2000) e Neacomys sp.4 (= clado 6 de Patton
et al., 2000). Outros trs clados com alto grau de divergncia gentica foram
reconhecidos neste estudo: Neacomys sp.1, Neacomys sp.5 e Neacomys sp.6, todos estes
clados apresentando alto suporte de bootstrap e probabilidade posterior (95 a 100%) nas
filogenias construdas com Cyt b e dados combinados (Figuras 2 e 3). As excees so
Neacomys sp.1 (MP 90%, IB 89%, ML 90 % para Cyt b), Neacomys sp.2 (MP 81%, IB
85%, ML 84% para Cyt b), Neacomys sp.6 (MP 61%, IB 84%, ML 64% para Cyt b), N.
musseri (MP <50%, IB 77%, ML 86% para dados concatenados), Neacomys sp.3 (MP
<50%, IB 63%, ML 76% para dados concatenados), Neacomys sp.4, N. guianae (MP
87% para dados concatenados) e N. dubosti (todos os suportes <50% para dados
concatenados).
Na topologia apresentada para Cyt b (Figura 2), dois grandes grupos so
formados: grupo J (MP <50%; IB 55%; ML <50%) composto por N. paracou,
Neacomys sp.5, Neacomys sp.6 e N. spinosus; e grupo G (MP <50%; IB <50%; ML
<50%) composto por N. dubosti, Neacomys sp.1, Neacomys sp.2, N, musseri, Neacomys
sp.3, Neacomys sp.4, N. guianae e N. minutus. Na topologia apresentada para os dados
concatenados (Figura 3) tambm se formam dois grupos iniciais: um somente com os
espcimes de N. paracou (MP 100%; IB 100%; ML 100%) e o outro com as demais
espcies (MP 70%; IB <50%; ML 57%). O padro das topologias de COI e ADH- I2
(no apresentadas) foram similares aos encontrados para os dados concatenados nas
anlises de ML.
Contido no grupo J est o grupo I (Neacomys sp.5, Neacomys sp.6 e N.
spinosus). Este clado apresenta a mesma posio nas trs anlises para Cyt b (MP 95%;
IB 100%; ML 99%), porm nas anlises dos demais bancos de dados este ramo no
consta devido ausncia de seqncias de COI e ADH-I2 para Neacomys sp.5 e
Neacomys sp.6. O mesmo ocorre para o grupo H (Neacomys sp.6 e N. spinosus) contido
no grupo I.

25
O grupo G est formado pelos grupos B e F. O grupo B (N. dubosti, Neacomys
sp.1 e Neacomys sp.2) apresenta a mesma posio nas trs anlises para Cyt b (MP
53%; IB 84%; ML 64%), contudo para os dados concatenados o mesmo agrupamento
formou-se apenas na anlise de ML (<50%). J nas anlises para o gene COI e ADH-I2
este grupo no formado (topologias no apresentadas) e a posio de N. dubosti variou
em relao s topologias das Figuras 2 e 3, surgindo como grupo irmo de N. paracou.
O grupo A (Neacomys sp.1 e Neacomys sp.2) surge em todas as anlises realizadas, com
suporte variando de 89% a 100%.
O grupo F (N. musseri, Neacomys sp.3, Neacomys sp.4, N. guianae e N. minutus)
est presente nas duas filogenias representadas neste trabalho (Figuras 2 e 3). Tanto
para os dados concatenados como para o marcador Cyt b este grupo forma-se apenas
nas anlises de ML (86% e 64% respectivamente) e IB (77% e 97% respectivamente).
Em relao s demais anlises, o mesmo clado surge nas anlises de ML e IB (<50%)
do gene COI (no apresentadas). No houve seqncias do gene ADH-I2 disponveis
para algumas espcies do grupo.
Contido no grupo F est o agrupamento E (Neacomys sp.3, Neacomys sp.4, N.
guianae e N. minutus) que surge na anlise ML (<50%) para Cyt b e nas anlises de ML
(73%) e IB (88%) para os dados concatenados (Figuras 2 e 3). Em relao s anlises
no representadas neste estudo, este ramo surge sem Neacomys sp.3 (para o qual no
houve seqncias disponveis) em todas as anlises com o marcador COI (MP <50%; IB
98%; ML 66%). No houve seqncias do gene ADH-I2 disponveis para mais de uma
das espcies deste grupo.
O ramo D (Neacomys sp.3, Neacomys sp.4 e N. guianae), contido no grupo E,
surge apenas na anlise de ML (<50%) para o marcador Cyt b nas anlises de ML
(76%) e IB ( 63%) para os dados concatenados (Figuras 2 e 3). Em relao s anlises
no representadas neste estudo, no houve seqncias dos genes COI e ADH-I2
disponveis para Neacomys sp.3. A posio de Neacomys sp.3 como espcie mais basal
do grupo D confirmada em todas as anlises.
O grupo C (Neacomys sp.4 e N. guianae), contido no grupo D, forma-se em
todas as anlises realizadas para Cyt b (MP 92%; IB 100%; ML 98%) e para os dados

26
concatenados (MP 87%; IB 100%; ML 97%) (Figuras 2 e 3). Em relao s anlises no
representadas neste estudo, este ramo surge em todas as anlises de COI com suporte
acima de 92%. No houve seqncias do gene ADH-I2 disponveis para estas espcies.
Em todas as anlises onde o grupo C foi obtido, foram observadas estreitas relaes do
mesmo com as seguintes espcies na posio mais basal: Neacomys sp.3 (ML <50%
Cyt b; ML 76%, IB 63% dados concatenados); N. minutus ( ML 66%, MP <50%, IB
98% COI).
3.3 Distncias genticas
Neste estudo as distncias genticas corrigidas verificadas para o gnero foram
comparadas em nvel intra-populacional (distncias entre espcimes da mesma
localidade), intra-especfico (distncias entre espcimes da mesma espcie de
localidades diferentes) e inter-especfico (distncias entre espcimes de espcies
diferentes) (Tabelas 4 e 5).
As divergncias intra-populacionais variaram de 0 a 4,7% para o gene Cytb, e de
0 a 1,4% para os dados concatenados. As divergncias intra-especficas variaram de 0 a
9,1% para o gene Cytb (Tabela 6) e de 0,3 a 4,4%, para os dados concatenados. As
divergncias inter-especficas variaram de 8,9 a 19,9% para Cytb e de 6.3 a 19,4% para
os dados concatenados.
A mdia de distncia dentro dos clados variou de 2,1 % (clado H: Neacomys sp.
6 e N. spinosus) a 13% (clado G: N. dubosti, Neacomys sp. 1, Neacomys sp. 2, N.
musseri, Neacomys sp. 3, Neacomys sp. 4, N. guianae, N. minutus).
Para divergncias nucleotdicas inter-especficas com o gene Cyt b, as espcies
que apresentaram os menores valores foram Neacomys guianae e Neacomys sp. 4,
8.9%. As espcies mais divergentes foram N. minutus e Necomys sp. 5, com 19,9% de
divergncia gentica. Em relao aos dados concatenados o menor valor de divergncia
inter-especfica foi de 6,3% entre Neacomys sp.1 e Neacomys sp.2, enquanto que,as
espcies mais divergentes foram N. paracou e Neacomys sp.3, N. guianae e Neacomys
sp.1 (19,4% de divergncia cada).

27
Os valores de distncias genticas apresentados nos nveis intra-populacionais e
intra-especficos a seguir so referentes ao gene Cyt b, por ser este o marcador com o
maior nmero de pares de base seqenciados, com maior quantidade de localidades por
espcie e o que rene todas as linhagens observadas neste estudo.
Neacomys spinosus apresentou de 0 a 1,9% de variao intra-populacional,
sendo Aripuan, Mato Grosso, a localidade onde foi observada a maior divergncia. J
entre diferentes localidades do Equador, Peru, Bolvia e Brasil, a divergncia variou de
0 a 4%, sendo as mais elevadas entre exemplares provenientes do P. N. Yasuni, Napo,
Equador com os demais (2,4 a 4%).
Neacomys paracou apresentou de 0 a 2,8% de variao intra-populacional,
sendo Laranjal do Jari, Amap, a localidade onde foi observada a maior divergncia. A
divergncia intra-especfica nesta espcie variou de 0,2 a 2,2% entre amostras
provenientes da Guiana e Brasil. As maiores divergncias foram observadas entre um
exemplar proveniente de Baramita, Guiana e os demais exemplares (1,4 a 2,2%).
Em Neacomys guianae e Neacomys dubosti no foi possvel estimar as
divergncias intra-populacionais, devido pouca quantidade das amostras. A
divergncia intra-especfica foi de 0,6%, entre dois hapltipos provenientes do
Suriname. Para N. dubosti a divergncia intra-especfica variou de 0,3 a 0,6%, entre
amostras do Brasil e Suriname.
Neacomys minutus apresentou de 0 a 0,8% de variao intra-populacional, sendo
Penedo, Amazonas, a localidade onde foi observada a maior divergncia. A divergncia
intra-especfica variou de 0,2 a 9,1%, entre amostras do Peru e Brasil. As maiores
divergncias foram observadas entre os exemplares provenientes de Bela Vista e
Abun, Amazonas e tambm de Loreto, Peru, quando comparados aos demais
exemplares da espcie.
Em Neacomys sp. 4 e Neacomys sp. 1 tambm no foi possvel estimar as
divergncias intra-populacionais, pois todos os exemplares desta espcie so
provenientes da mesma localidade (rio Ja, Amazonas e Juruti, Par, respectivamente).

28
Na primeira espcie, a divergncia variou de 0,7 a 4,7%. Sobre a segunda espcie a
divergncia intraespecfica variou de 0,2 a 0,7%.
Neacomys musseri, apresentou de 1 a 1,9% de variao intra-populacional,
sendo Cuzco, Peru, a localidade onde foi observada a maior divergncia. A divergncia
intraespecfica variou de 1,4 a 3,6% entre amostras provenientes do Peru e Brasil. As
maiores divergncias foram observadas entre os exemplares provenientes de Loreto,
Peru com os demais exemplares (3,1 a 3,6%).
Neacomys sp.3 apresentou de 0,2 a 0,5% de variao intra-populacional. A
divergncia intra-especfica variou de 0,5 a 2,3% entre amostras provenientes do
Equador e Peru. As maiores divergncias foram observadas entre os exemplares
provenientes de Huampami, Peru e os demais exemplares (2,2 a 2,3%).
Neacomys sp.2 est constitudo por dois grupos de indivduos, sendo o primeiro
formado por exemplares de Chaves, ilha de Maraj, Par e o segundo por exemplares da
regio de Carajs, Marab, Par. Os exemplares desta espcie apresentaram de 0,2 a
0,9% de variao intra-populacional.

A divergncia intra-especfica nesta espcie

variou de 0 a 4,5%, sendo a maior divergncia observada entre o exemplar do


continente (Altamira, Xing) e os da ilha de Maraj (4,5%).
4. Discusso
Neste estudo o monofiletismo do gnero Neacomys confirmado, corroborando
estudos anteriores (Patton et al., 2000; Weksler 2006; Catzeflis & Tilak, 2009). Apesar
do alto suporte encontrado para o gnero, neste trabalho no foram includas duas
espcies do gnero (N. pictus e N. tenuipes), assim como os gneros Microryzomys e
Oreoryzomys, que juntamente com Oligoryzomys aparecem como possveis grupos
irmos do gnero (Patton et al. 1995; Weksler, 2006). Portanto, estudos futuros com
maior nmero de txons sero importantes para consolidar Neacomys como
monofiltico.
O gnero Neacomys apresenta uma diversidade subestimada segundo Patton et
al. (2000) e Voss et al., (2001), o que pode resultar na deteco de novas linhagens
mediante anlises mais acuradas de amostras existentes ou de amostras de locais

29
anteriormente no inventariados. Seis espcies de Neacomys usualmente reconhecidas
na literatura foram includas neste estudo e todas elas surgiram como linhagens
independentes em nossas anlises. Neste trabalho foram identificadas ainda seis novas
unidades evolutivas independentes e com ampla divergncia molecular que representam
espcies distintas, das quais duas encontram-se na Amaznia oriental brasileira
(Neacomys sp.2 e Neacomys sp.6), duas na Amaznia central (Neacomys sp.1 e
Neacomys sp.4) e duas na Amaznia ocidental (Neacomys sp.3 e Neacomys sp.5)
(Figuras 2 a 4). Dentre as seis novas unidades evolutivas aqui identificadas, trs
(Neacomys sp.2, Neacomys sp.3 e Neacomys sp.4) foram reconhecidas anteriormente na
literatura por Patton et al. (2000). Neste trabalho as espcies Neacomys sp.2, Neacomys
sp.3 e Neacomys sp.4 correspondem respectivamente ao clado 7, Clado 3 e clado 6 de
Patton et al. (2000).
4.1 Inferncias filogenticas
Informaes acerca das relaes filogenticas do gnero Neacomys tm sido
investigadas nas ltimas dcadas, seja na relao deste gnero com outros da subfamlia
Sigmodontinae (Dickeman & Yates; Myers et al., 1995; Patton & da Silva, 1995;
Bonvicino & Moreira, 2001; Weksler 2003, 2006; Miranda, 2007; Turvey et al.,2010;
Percequillo et al., 2011), ou inferncias baseadas nas relaes intra-genricas (Patton et
al, 2000; Catzeflis & Tilak, 2009). Como mencionado anteriormente, a monofilia do
gnero foi confirmada por todos os autores e corroborada no presente trabalho com base
em todas as anlises realizadas neste estudo (Figuras 2 e 3 para anlises com
marcadores Cyt b e dados combinados, respectivamente; demais anlises no
apresentadas).
Quanto s relaes filogenticas intra-genricas, estudos com base em dados
morfolgicos e moleculares (seqncias de citocromo b e xon do IRBP) mostram que
N. spinosus a espcie basal em relao a N. minutus e N. musseri (Bonvicino &
Moreira, 2001; Weksler 2003, 2006; Miranda, 2007, Percequillo et al., 2011). As
relaes filogenticas entre as demais espcies do gnero abordadas por Patton et al.
(2000) e Catzeflies & Tilak (2009) apontaram N. paracou e N. spinosus como os clados
mais basais, porm com baixo suporte, assim como as topologias apresentadas neste
estudo.

30
Na presente anlise observou-se baixo suporte nos ramos mais basais e elevado
apoio nas linhagens terminais. O baixo suporte encontrado na poro basal da filogenia
pode ser um indicativo de um processo de diversificao recente para as espcies deste
grupo. Este padro tambm foi encontrado em roedores murneos (Steppan et al., 2005)
e equimdeos (Lara et al. 1996; Leite & Patton, 2002; Patterson & Velazco, 2006), cuja
irradiao teria ocorrido a partir do Mioceno tardio. Outra tese a ser considerada de
que a irradiao antiga e as homoplasias dificultariam a reconstruo filogentica.
Entretanto, isto seria mais evidente em genes mitocondriais de evoluo rpida, mas no
em segmentos nucleares mais conservados. No caso presente, tanto os genes
mitocondriais (Cyt b e COI) quanto o nuclear (ADH) recuperam topologias similares,
com inter-ns curtos, o que seria sugestivo de diversificao rpida em alguns
momentos da histria evolucionria de Neacomys.
As topologias de ML dos dados de Cyt b e dos dados concatenados (Figuras 2 e
3), apesar do baixo suporte para as relaes entre os grupos basais, so na sua maioria
similares s topologias propostas por Catzeflis & Tilak (2009) com o gene Cytb. O
grupo formado isoladamente que inclui somente a espcie N. paracou como o mais
basal na rvore de dados concatenados (Figura 3) corrobora com os autores
supracitados, assim como tambm no suporte observado. Entretanto, na rvore com
dados de Cyt b (Figura 2), N. paracou est includo no grupo J juntamente com o grupo
I, este ltimo formado por Neacomys sp.5 e Neacomys sp.6. e N. spinosus.
O grupo I, por sua vez, apresenta alto suporte ( 95% em todas as anlises de
Cyt b), indicando que Neacomys sp.5 a espcie basal do agrupamento formado pelas
espcies Neacomys sp.6 e N. spinosus. Estas duas ltimas espcies, por sua vez, surgem
em nossas anlises de Cyt b como irms no grupo H, com suporte estatstico moderado
(61-84%). Anlises filogenticas disponveis na literatura nunca incluram as espcies
Neacomys sp.5 e Neacomys sp.6 (Patton et al., 2000 e Catzeflis & Tilak, 2009), motivo
pelo qual N. spinosus e N. paracou aparecem como espcies irms nas referidas
anlises.
Outros dois grupos que apresentaram alto suporte ( 87% em todas as anlises
de Cyt b e dados concatenados) so o grupo A (Neacomys sp.1 e Neacomys sp.2) e o
clado C (Neacomys sp.4 e N. guianae).

31
Dentro do grupo A, os hapltipos de Neacomys sp.2 procedentes de Chaves
(ilha do Maraj) surgem como basais em relao aos hapltipos continentais desta
espcie. Esta relao apresenta suporte alto ( 81% em todas as anlises de Cyt b e
99% nas anlises de dados concatenados) e h tambm uma considervel divergncia
gentica intra-especfica dentro do grupo de que varia de 0 a 4,5%, sendo a maior
distncia observada entre os hapltipos do continente e da ilha. Estes resultados
sugerem uma possvel diferenciao gentica atravs de barreiras geogrficas mediante
ao de rios e lagos, baseado na hiptese de Barreiras ribeirinhas sobre mamferos
(Hershkovitz, 1972; Peres, Patton & da Silva, 1996). Nossas anlises no permitem
afirmar se este processo est em andamento e nem concluir se estas populaes
constituem espcies boas, uma vez que para Baker & Bradley (2001) a mdia de
intervalo para nveis intra-especficos para roedores est entre 0 a 6,29%.
Para o grupo C (Neacomys sp. 4 e N. guianae) confirmou-se a relao de txons
irmos, corroborando a posio e o alto suporte inferido anteriormente por Catzeflis &
Tilak (2009). Para estes autores estas espcies so amplamente aloptricas. Na nossa
matriz de divergncia (Tabela 4), so as espcies que apresentam um menor percentual
de distncia, sugerindo que se tratam dos txons que divergiram mais recentemente.
O clado B composto por Neacomys sp.1, Neacomys sp.2 e N. dubosti surgiu em
todas as anlises realizadas, embora com baixo suporte estatstico (53-84% nas anlises
de Cyt b e <50% nas anlises de dados concatenados). Com acrscimo de mais
amostras, este arranjo poder mudar em estudos futuros.
O agrupamento E (Neacomys sp.3, Neacomys sp.4, N. guianae e N. minutus),
apesar de apresentar baixo suporte na topologia de Cyt b (todas as anlises <50%), nos
dados concatenados apresenta suporte moderado em ML (73%) e IB (88%). O que torna
claro que o acrscimo de outros marcadores pode recuperar resolues filogenticas.
O clado F (N. musseri, Neacomys sp.3, Neacomys sp.4, N. guianae e N. minutus)
apresenta baixo suporte nas anlises de MP, moderado para ML, mas alto suporte na IB.
No estudo realizado por Catzeflis & Tilak (2009), as espcies N. musseri, Neacomys
sp.4, N. guianae e N. minutus formaram um clado com baixo suporte de MP e ML. Os

32
autores no realizaram anlise de IB e nem incluram a espcie Neacomys sp.3 em seu
estudo.
Outros agrupamentos obtidos em nossas anlises foram os clados D e G, com
suportes estatsticos muito baixos indicando alta probabilidade de serem alterados em
anlises futuras.
Sobre a inconsistncia dos ns basais, como observado anteriormente, em ambas
as topologias houve suportes altos nos txons terminais, o que sugere a eficincia dos
genes mitocondriais como ferramentas para a taxonomia molecular. De fato, as anlises
aqui realizadas foram satisfatrias para a delimitao de grupos correspondentes a
espcies e alguns grupos de espcies. Porm, a sua eficincia para resolues
filogenticas em grupos mais abrangentes ainda questionvel. Outros gneros de
sigmodontneos tambm apresentam baixa resoluo em anlises utilizando-se o gene
Cyt b, como Sigmodon (Peppers, 2002) e Calomys (Salazar-Bravo et al., 2001), e
fenmeno semelhante observado para o gene COI, ao menos em lepidpteras
(Hajibabaei et al., 2006; Hajibabaei et al., 2007). De acordo com Steppan e al. (2005), a
dificuldade de se obter uma resoluo filogentica pelos genes mitocrondriais pode estar
relacionada quantidade de homoplasia acumulada nestes marcadores.
4.2 Divergncias
Nos ltimos anos, dois estudos avaliaram as distncias nucleotdicas baseados
nas seqncias cyt b de vrios grupos de mamferos, em especial morcegos e roedores
(Baker & Bradley, 2001; 2006). Com base no conceito gentico de espcie, os autores
apresentaram estimativas de distncias consideradas em variados nveis. Em roedores,
valores de divergncia variaram de 0 a 2,4% no nvel intra-populacional , de 0 a 6,5%
no nvel intraespecfico, de 1,2 a 19,5% entre espcies irms e de 2,2 a 21,9% dentro
do gnero.
Os valores de divergncia nucleotdica intra-populacional para o marcador Cyt b
encontrado neste estudo foi de 0 a 4,7%, o que representa quase o dobro em relao aos
valores encontrados por Baker & Bradley (2001; 2006), porm mais semelhante
variao de 0 a 3,87% encontrada em outros trabalhos (Smith & Patton, 1993; Miranda
et al., 2007; DEla et al., 2008). As divergncias intraespecficas variaram de 0 a

33
9,1%, valores que incluem as porcentagens mdias de 2 a 6,9% de divergncia intraespecfica relatada para o gnero por Patton et al. (2000), mas esto acima dos
mencionados por Baker & Bradley (2001; 2006) para roedores. No entanto, estes
valores so iguais aos encontrados para outros grupos de roedores sigmodontneos na
literatura (Smith & Patton, 1991; Smith & Patton, 1993; Hoffmann et al., 2002). As
divergncias inter-especficas variaram de 8,9 a 19,9%, valores semelhantes aos
encontrados por Patton et al. (2000) na regio do rio Juru (10,8 a 18,1%), porm mais
amplos que os encontrados por Catzeflies & Tilak (2009) na regio das Guianas (11,5 a
15,7%). Os nveis de divergncias inter-especficos observados para o gnero Neacomys
neste trabalho esto dentro da mdia encontrada por Baker & Bradley (2001; 2006),
mas acima dos valores encontrados para outros roedores sigmodontneos nos demais
estudos disponveis (entre 5 a 19%; Myers et al., 1995; Andrade & Bonvicino, 2003;
DElia et al., 2008).
A anlise de distncia neste estudo reuniu o maior nmero de hapltipos (123
hapltipos), abrangncia das localidades e espcies do gnero Neacomys j estudado.
Estudos anteriores utilizaram sete espcies e 30 (Patton et al., 2000) a 34 hapltipos
(Catzeflis et al., 2009).
Dentre as unidades evolutivas independentes aqui identificadas, trs j foram
reconhecidas em trabalhos anteriores: Neacomys sp.2, Neacomys sp.3 e Neacomys sp.4.
Todas estas linhagens foram detectadas por Patton et al. (2000), para as quais foram
encontradas respectivamente 13,8% a 17,4%, 10,8 a 15,5% e 11,6 a 17% de
divergncias nucleotdicas para Cyt b em relao s demais espcies por eles analisadas.
Outras trs linhagens evolutivas independentes foram detectadas no presente trabalho:
Neacomys sp.1, Neacomys sp.5 e Neacomys sp.6. O valor de divergncia entre estas e as
demais espcies aqui analisadas para Cyt b variou entre 9,6 e 19,2%, 9,1 e 19,9%, 9,1 e
19,9%, respectivamente.
Thomas (1905) descreveu a espcie N. guianae, cuja validade foi confirmada
mediante dados moleculares (Catzeflis & Tilak, 2009) e dados morfolgicos (Voss et
al., 2001). O menor valor de divergncia gentica mdia para o marcador Cyt b do
presente estudo (8,9%) foi encontrado entre N. guianae e sua espcie irm Neacomys
sp. 4, esta ltima j reconhecida (mas no descrita) na literatura (clado 6 de Patton et al.,

34
2000). Segundo Baker e Bradley (2006), a variao esperada nas divergncias
nucleotdicas intra-especficas para o gene Cyt b em roedores de 0 a 6,5%. Segundo os
autores,

acima

destes

valores

podese

inferir

um

isolamento

gentico

conseqentemente a formao de linhagens distintas, alcanando o isolamento gentico


necessrio para que se reconhea uma espcie. Assim, todas as linhagens sugeridas para
este trabalho so as que apresentam o nmero de divergncia maior que a encontrada
entre N. guianae e Neacomys sp.4, ou seja, 8,9%, estando de acordo com a argio
de Baker e Bradley (2006).
O grupo que agrupou os hapltipos referentes espcie N. minutus foi o que
apresentou o maior percentual de divergncia intra-especfica (9,1%). Os hapltipos
mais divergentes so provenientes de Nuevo San Juan, departamento de Loreto, Peru e
da comunidade Bela Vista, estado do Amazonas, Brasil. Foram realizados testes de
distncias entre estes hapltipos em separado e as demais espcies analisadas neste
estudo, e a divergncia gentica mdia foi mais baixa em relao s novas linhagens
identificadas neste trabalho (7% menor distncia com N. minutus). Neste estudo no
reconhecemos valores mdios de divergncia gentica menores que 8,9% para o
marcador Cyt b em Neacomys como indicativos da existncia de espcies distintas.
Contudo, pela alta distncia gentica intra-populacional e o processo de isolamento
gentico que N. minutus aparentemente apresenta, mais amostras de outras localidades
so necessrias para concluirmos se este txon deve ser tratado como um complexo de
espcies. Patton et al, (2000) avaliaram a morfometria destas amostras e baseados em
anlise discriminante no observaram diferenas entre os caracteres analisados. Embora
os autores reconheceram a diferena entre os hapltipos, no apresentaram
consideraes taxonmicas a respeito. importante mencionar que complexos de
espcies so reconhecidos em outros roedores sigmodontneos a partir de valores de
divergncia gentica semelhantes aos encontrados para N. minutus (Smith & Patton,
1999; Andrade & Bonvicino, 2003).
4.3 Consideraes sobre Neacomys minutus
A espcie N. minutus apresenta duas populaes diferenciadas que podem ser
observadas pelas distncias genticas e topologias de seus hapltipos no cladograma de
Cytb nas anlises de MP, MV e IB. Esta separao tambm foi observada por Patton et

35
al. (2000), que determinaram dois grupos: um da regio do baixo Juru (Igarap
Arabidi, Altamira, Barro Vermelho) e outro do alto Juru (Sacado e Penedo). Segundo
os autores, N. minutus apresenta uma quebra filogeogrfica, no havendo
compartilhamento de hapltipos entre a regio do baixo e alto Juru. s amostras
utilizadas por Patton et al. (2000) ns acrescentamos outras trs procedentes de Nuevo
San Juan, Loreto, Peru; Abun, Rondnia, Brasil; e Comunidade Bela Vista, Amazonas,
Brasil. A amostra de Nuevo Sn Juan agrupou-se com hapltipos do alto Juru,
corroborando o agrupamento apresentado na topologia de Catzeflis & Tilak (2000). J
as amostras de Abun e Comunidade Bela Vista, que se situam s margens do rio
Madeira, agruparam-se com as amostras do baixo Juru, confirmando o padro
filogeogrfico j observado por Patton et al. (2000).
Os hapltipos de Nuevo San Juan e Comunidade Bela Vista foram os que
apresentaram maior divergncia no gene Cyt b dentro do grupo (9,1%) e representam os
extremos de sua distribuio, evidenciando o isolamento gentico destas duas
populaes. Este isolamento pode estar sendo provocado por barreiras entre as duas
localidades, como a formao do Arco de Iquitos, que segundo Rodaz et al. (2005) e
Patton et al. (2000) atuou como divisor de drenagens no Plioceno. A hiptese dos arcos
considerada, em alguns estudos, como sendo a origem de diferenciao da fauna na
regio (Lundberg et al., 1998; Silva & Patton, 1998; Patton et al., 2000).
4.4 Consideraes biogeogrficas
Desde o estudo realizado por Wallace (1852), no qual padres diferenciados da
fauna primatas entre as regies da Amaznia foram relatados, vrios estudos
biogeogrficos corroboraram a diviso da Amaznia em reas de endemismo com base
em diferentes grupos de vertebrados (Sick 1967; Haffer, 1992, Ayres & Clulton
Brock, 1992, Avila-Pires, 1995). Estes estudos mostraram que nem todas as espcies
so distribudas amplamente na regio (Silva et al., 2005), ocorrendo em regies
claramente delimitadas (Haffer, 1978, 1987; Haffer & Prance, 2001; Cracraft 1985).
O gnero Neacomys est aparentemente distribudo em sete das oito reas de
endemismo atualmente reconhecidas na Amaznia: Inambari, Napo, Imeri, Xingu,
Tapajs, Rondnia e Guiana. A maioria das espcies analisadas nesse estudo tem sua

36
distribuio restrita a uma rea de endemismo, como segue: Neacomys dubosti
(Guianas), Neacomys guianae (Guianas), Neacomys sp.2 (Xingu/ilha de Maraj),
Neacomys sp.6 (Xingu), Neacomys sp.1 (Rondnia), Neacomys musseri (Inambari), e
Neacomys sp.6 (Imeri). Neacomys sp.5 est aparentemente fora dos limites das reas de
endemismo estabelecidos na literatura, mas a nossa nica amostra est mais prxima
rea de endemismo de Inambari. Foram observadas quatro espcies que tem sua
distribuio em pelo menos duas ou mais reas de endemismo: N. paracou (Guiana e
Rondnia), N. spinosus (Inambari, Tapajs e Rondnia), N. minutus (Rondnia e
Inambari) e Neacomys sp.3 (Inambari e Napo).
Atravs das topologias observadas neste trabalho, juntamente com o padro de
distribuio destas espcies, pode-se inferir que o gnero Neacomys diversificou-se em
diferentes momentos e locais na Amaznia. Catzeflis & Tilak (2009) observaram que as
espcies da regio das Guianas (rea de endemismo Guianas) no formam um grupo
monofiltico e provavelmente no passado estiveram em outras regies da Amaznia.
Nossos resultados corroboram os autores supracitados e indicam que os rios amaznicos
aparentemente funcionam como barreiras biogeogrficas distribuio de algumas
espcies. Evidentemente, a efetiva atuao destes rios como barreiras biogeogrficas
necessita ser confirmada mediante estudos taxonmicos com amostras mais numerosas
do que as utilizadas no presente estudo.
4.5 Consideraes Gerais
Nos ltimos dez anos alguns estudos baseados em dados morfolgicos e
moleculares apontaram para a diversidade subestimada do gnero Neacomys. Nosso
estudo corrobora este fato, uma vez que detectamos seis novas linhagens para o gnero,
sendo trs nunca antes reconhecidas na literatura, totalizando 14 espcies para o gnero.
Duas destas novas linhagens ocorrem na Amaznia oriental, regio at ento
subamostrada para o gnero. Este trabalho proporciona novos pontos para a
investigao deste gnero: se h diferenciao destas linhagens em relao morfologia
ou se corresponde espcies crpticas. As divergncias nucleotdicas observadas neste
trabalho indicam que algumas espcies podem estar sofrendo processo de isolamento
gentico. Nossos resultados apontam tambm nveis altos de divergncias nucleotdicas
entre as espcies e dentro de uma espcie em particular: Neacomys minutus, com 9,1%

37
de divergncia intra-especfica. Estudos futuros so necessrios para inferir se este
grupo trata-se de um complexo de espcies. Padres de distribuio foram verificados
para este gnero, no qual os principais rios amaznicos parecem atuar como barreiras
distribuio de vrias espcies, e ao menos um destes rios (rio Negro) pode ter tipo
papel fundamental na especiao deste grupo por vicarincia.

AGRADECIMENTOS
Este estudo um produto de uma dissertao de mestrado do Programa de PsGraduao em Zoologia convnio do Museu Paraense Emlio Goeldi (MPEG) e
Universidade Federal do Par (UFPA), apoiado por uma bolsa de mestrado da
Fundalao de Amparo Pesquisa do Estado do Par (FAPESPA). Agradecemos
especialmente ao Laboratrio de Gentica e Biologia Molecular do Instituto de Estudos
Costeiros (IECOS), campus de Bragana da UFPA por todo apoio durante este trabalho.
E agradecemos Suely Marques-Aguiar (curadora) e Jos de Sousa e Silva Jnior da
Diviso de Mamferos MPEG. Agradecemos tambm Maria de Nazareth Ferreira da
Silva (Curadora da Seo de Mamferos do Instituto Nacional de Pesquisas da
Amaznia), James L. Patton (Museum of Vertebrate Zoology, University of Califrnia,
Berkeley), Mario de Vivo (curador da coleo de mamferos do Museu de Zoologia da
Universidade de So Paulo), a Joo Alves de Oliveira (curador da coleo de mamferos
do Museu Nacional do Rio de Janeiro), Cludia Silva (IEPA), Manoel Santos-Filho
(UNEMAT) por nos conceder o acesso a importantes espcimes, tecidos e seqncias.

Referncias
Aljanabi, S.M., Martinez, I. 1997 Universal and rapid salt-extraction of high quality
genomic DNA for PCR-based techniques. Nucleic Acids Research, 25, 46924693.
Allen, J.A. 1912. Mammals from western Colombia. Bulletin American Museum
Natural History. Vol. XXXI. 71-95.

38
Amman, B. R., Hanson, J. D., Longhofer, L.K., Hoofer, S.R., Bradley, R.D. 2006.
Intron 2 of the alcohol dehydrogenase gene (ADH I2): A nuclear DNA marker
for mammalian systematics. Occasional Papers. Museum of Texas Tech
University, 256, 1-16 .
Anderson, S. 1997. Mammals of Bolivia, taxonomy and distribution. Bulletin American
Museum Natural History. 231, 652 p.
Andrade, A.F.B., Bonvincino, C.R. 2003. A new karyological variant of Oecomys
(Rodentia: Sigmodontinae) and its phylogenetic relationship based on molecular
data. Genome, 46, 195-203.
vila - Pires, T. C. S. 1995. Lizards of Brazilian Amazonia. Zoologische
Verhandelingen, Leiden, 299,1706.
Avise. J.C., Arnold, J., Ball, R.M., Bermingham, E., Lamb. T., Neigel, J.E., Reeb, C.
A., Saunders, N.C. 1987. Intraspecific plylogeography: The mitochondrial DNA
bridgebetween population genetics and systematics. Annals Review Ecology e
Systematics. 18, 489-522.
Ayres, J. M., Clutton-Brock, T.H. 1992. River boundaries and species range size in
Amazonian primates. The American Naturalist, 14, 531537.
Baker, R., Bradley, R. 2006. Speciation in mammals and the genetic species concept.
Journal of Mammalogy, 87(4), 643662.
Bradley, R.D., Baker, R.J. 2001. A test of the genetic species concept: cytochrome-b
sequences and mammals. Journal of mammalogy, 82(4), 960-973.
Bonvicino, C.R., Moreira, M.A.M. Molecular Phylogeny of the Genus Oryzomys
(Rodentia: Sigmodontinae) Based on Cytochrome b DNA Sequences. Molecular
Phylogenetics and Evolution,vol. 18, 2, 282292.
Bonvincino, C.R., Oliveira, J.A., Dandrea, P.S. 2008. Guia dos roedores do Brasil, com
chaves para gneros baseadas em caracteres externos. Centro Pan- Americano de
Febre Aftosa OPAS/OMS, Rio de Janeiro, 120 p.

39
Borisenko, A.V., Lim, B.K., Ivanova, N.V., Hanner, R.H., Hebert, P.D.N. 2008. DNA
barcoding in surveys of small mammal communities: a Field study in Suriname.
Molecular Ecology Resources, vol. 8, 471-479.
Brito, P.H., Edwards, S.V. 2009. Multilocus phylogeography and phylogenetics using
sequence-based markers. Gentica, 135, 439455
Cabrera, A. 1961. Catalogo de los mamiferos de America del Sur. Revista Del Museo
Argentino de Ciencias Naturales Bernadino Rivadavia, Zoologia, vol. 4, n. 2, 309732.
Catzeflis, F., Tilak, M. 2009. Molecular systematic of Neotropical spiny
mice(Neacomys: Sigmodontinae, Rodentia) from the Guianan Region. Mammalia,
v. 73, 239- 247.
Cracraft, J. 1985. Historical biogeography and patterns of differentiation within the
South American avifauna: areas of endemism. Ornithological Monographs 36, 49
84.
Dickerman, A.W. E Yates, T. L. 1995. Systematics of Oligoryzomys: Protein
electrophoretic analyses. Journal Mammalogy, 76, 172 188.
DElia, G, Pardias, U.F.J., Teta, P, Patton, J.L. 2007. Definition and diagnosis of a new
tribe of sigmodontine rodents (cricetidae: sigmodontinae), and a revised
classification of the subfamily. Gayana 71(2), 187-194.
DElia, G., Pardias, U.F.J., Jayat, J.P. & Salazar-Bravo, J. 2008 Systematics of
Necromys (Rodentia, Cricetidae, Sigmodontinae): species limits and groups, with
comments on historical biogeography. Journal of Mammalogy, 89(3), 778-790.
Ellerman, J. R. 1941. The families and genera of living rodents. Vol. II. Family
Muridae. British Museum (Natural History), London, 690 p.
Farris, J. S., Kallersjo, M., Kluge, A. G. & Bult, C. 1995. Testing Significance of
Incongruence. Cladistics 10(3), 315-319.

40
Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the
bootstrap. Evolution, 39, 783791.
Folmer, O., Black, M. Hoeh, W., Lutz R., Vrijenhoek, R. 1994. DNA primers for
amplification of mitochondrial cytochrome c oxidase subunit I from diverse
metazoan invertebrates. Molecular Marine Biology and Biotechnology. 3, 294297.
Gardner, A. L.; PATTON, J.L. 1976. Karyotypic variation in oryzomyinae rodents
(Cricetinae) with comments on chromosomal evolution in the Neotropical
cricetinae complex.Occasional Papers of the Museum of Zoology, Louisiana State
University, n. 49, 1-48.
Godman, J. 1912. E. A. New mammals from eastern Panama. Smithsonian
Miscelaneous Collection, 60(2), 18 p.
Guindon, S., Gascuel, O. 2003. A simple, fast, and accurate algorithm to estimate large
phylogenies by maximum likelihood. Systematic Biology, 52(5), 696-704.
Gyldenstolpe, N. 1932. A manual of Neotropical sigmodont rodents. K. Sven.
Vetenskapsakad. Handl., Ser. 3, Band 11(3), 164 p. 118 pl.
Haffer, J. 1978. Distribution of Amazon birds. Bonner Zoologischen Beitrage, 29, 38
78.
Haffer, J. 1987. Biogeography of Neotropical birds. Pages 105150 in T. C. Whitmore
and G. T. Prance, editors. Biogeography and Quaternary history in tropical
America. Clarendon Press, Oxford, United Kingdom.
Haffer, J. 1992. On the river effect in some forest birds of southern Amazonia.
Boletim do Museu Paraense Emlio Goeldi, Srie Zoologia, 8, 217245.
Haffer, J., Prance, G.T.. 2001. Climatic forcing of evolution in Amazonia during the
Cenozoic: on the refuge theory of biotic differentiation. Amazoniana, 16, 579
607.

41
Hajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W. Hebert, P.D.N. 2006b. DNA
barcodes distinguish species of Lepidoptera. Proceedings of the National
Academy of Sciences, USA, 103, 968-971.
Hajibabaei, M., Singer, G.A.C., Hebert, P.D.N, Hickey, D. A. 2007. DNA barcoding:
how it complements taxonomy, molecular phylogenetics and population genetics.
Trends in Genetics, 23, 167-172.
Hall, T. A. 1999. Bioedit: A user-friendly biological sequence alignment editor and
analysis program for windows 95/98/nt. Nucleic Acids Symposium Series, 41, p.
95-98.
Hershkovitz, P. 1940. A new spiny mouse of the genus Neacomys from eastern
Ecuador. Occasional Papers of the Museum of Zoology. 419, 1-4.
Hershkovitz, P. 1972. The recent mammals of the neotropical region: a zoogeographica
and ecological review. In: Keast, A., Erk, F.C., Glass, B. eds. Evolution,
mammals, and southern continents. Albany: State University of New york, 311431.
Ivanova, N.V., Zemlak, T.S., Hanner, R.H., Hebert, P.D.N. 2007. Universal primer
cocktails for fish DNA barcoding. Molecular Ecology Notes, 7, 544548.
Kimura, M. 1980. A simple method for estimating evolutionary rate of base
substitutions through comparative studies of nucleotide sequences. Journal of
Molecular Evolution, 16, 111-120.
Lara, M.C., Patton, J.L., da Silva, M.N.F. 1996. The simultaneous diversification of
south american echimyid rodents (Histricognathi) base don complet cytochrome b
sequences. Molecular Phylogenetics and Evolution, 5(2), 403-413.
Leite, Y.L.R., Patton, J.L. 2002. Evolution of South American spiny rats (Rodentia:
Echimyidae): the star-phylogeny hypotesis revisited. Molecular Phylogenetics and
Evolution, 25, 455-464.

42
Lundberg, J.G, Marshall, L. G., Guerrero, J., Horton, B., Malabarba, M. C. S. L.;
Wesselingh, F. The stage for Neotropical Fish Diversification: A History of
Tropical South American Rivers. in: Malabarba, L.R.; Reis, R.P.; Vari, R.P.;
Lucena, Z. M. S.; Lucena, C.A.S. (eds). Phylogeny and Classification of
Neotropical Fishes. EdiPucrs, Porto Alegre. 1998. 1348.
Miranda, G.B. 2007. Relaes filogenticas entre as espcies de roedores sulamericanos da tribo Orizomini analizadas pelos genes Citocromo b e IRBP. Tese
de Doutorado. Universidade Federal do Rio Grande do Sul. Porto Alegre, 180 p.
Miranda, G.B., Oliveira, L.F.B., Andrades-Miranda, J., Langguth, A., CallegariJacques, S.M., Mantevi, M.S. 2009. Phylogenetic and Phylogeographicn Patterns
in Sigmodontine Rodents of the Genus Oligoryzomys. Journal of Heredity.
100(3): 309321.
Moojen, J. 1952. Os Roedores do Brasil. Ministrio da Educao e Sade: Instituto
Nacional do Livro. Rio de Janeiro, 214 p.
Morin, P.A., Luikart, G., Wayne, R. K. & SNP Workshop Group. 2004. SNPs in
ecology, evolution and conservation. Trends in Ecology and Evolution. 19 (4),
208-216.
Musser, G.G., Carleton, M.D. 1993. Family Muridae. In: Wilson, D.E.; Reeder, D.M.
(Eds.). Mammal species of the world, a taxonomic and geographic reference, 2a
Edio, Smithsonian Institution Press, Washington D.C., 501-755.
Musser, G.G., Carleton, M.D. 2005. Superfamily Muroidea. In: Wilson, D.E., Reeder,
D.M. (EDS.). Mammals species of the World, a taxonomic and geographic
reference. 3a. Edio, Vol. 2. The Johns Hopkins University Press, Baltimore,
894-1531.
Myers, P., Lundrigan, B. e Tucker, P. K. 1995. Molecular Phylogenetics of Oryzoyine
Rodents: The Genus Oligoryzomys. Molecular Phylogenetics and Evolution 4.
n4, 372-382

43
Oliveira, J.A. Bonvicino, C. R. 2011. Ordem Rodentia. In: Reis, N.R.; Peracchi, A.L.;
Pedro, W.A.; Lima, I.P. (eds). Mamferos do Brasil. 2 Edio. Universidade
Estadual de Londrina, Londrina, 437 p.
Patterson, B.D. 2000. Patterns and trends in the discovery of New Neotropical
Mammals. Diversity and Distribuitions, 6: p. 145-151.
Patterson, B.D.; Velazco, P.M. 2006. A distinctive new cloud-forest rodent
(Hystricognathi: Echimyidae) from the Manu Biosphere Reserve, Peru.
Mastozoologa Neotropical, 13(2), p. 175-191.
Patton, J.L.; da Silva, M.N.F. 1995. A review of the spiny mouse genus Scolomys
(Rodentia: Muridae: Sigmodontinae) whith the description of a new species from
the western Amazon of Brazil. Proceedings of the Biological Society of
Washington. 108(2), p. 319 337.
Patton, J.L.; da Silva, M.N.F; Malcolm, J.R. 2000. Mammals of the rio Juru and the
evolutionary and ecological diversification of Amazonia. Bulletin of the American
Museum of Natural History, n. 244, p. 1-306.
Peppers, L.L.; Carrol, D.S.; Bradley, R.D. 2002. Molecular systematics of the genus
Sigmodon (Rodentia: Muridae): evidence from the mitochondrial cytochrome-b
gene. Journal of Mammalogy, 83(2), p. 396407.
Percequillo, A.R.; Weksler, M; Costa, L.P.C. 2011. A new genus and species of rodent
from the Brazilian Atlantic Forest (Rodentia: Cricetidae: Sigmodontinae:
Oryzomyini), with comments on oryzomyine biogeography. Zoological Journal of
the Linnean Society, 161, p. 357390.
Peres, C. A., J. L. Patton, and M. N. F. da Silva. 1996. Riverine barriers and gene flow
in Amazonian saddle-back tamarins. Folia Primatologica. 67, p. 113124.
Posada, D. (2008). Jmodeltest: Phylogenetic model averaging. Molecular Biology
Evolution, 25, p.1253-1256.

44
Reig, O.A. 1980. A new fossil genus of South American cricetid rodents allied to
Wiedomys, with an assessment of the Sigmodontinae. Journal of Zoology, London,
n. 192, p. 257-281.
Reig, O.A. 1984. Distribuio geogrfica e histria evolutiva dos roedores muroideos
sulamericanos (Cricetidae: Sigmodontinae). Revista Brasileira de Gentica, vol. 7,
p. 333-365.
Ronquist, F. & Huelsenbeck, J.P. 2003. MrBayes 3: Bayesian phylogenetic inference
under mixed models. Bioinformatics Applications Note, 19(12), p. 1572-1574.
Salazar-Bavo, J., Draggoo, J.W., Bowen, M.D., Peters, C.J., Kasiazek, T.G., Yates, T.L.
2001. Natural nidality in Bolivian hemorrhagic fever and the systematics of the
reservoir species. Infection, Genetics and Evolution, 1, 191199.
Sambrook, J., Fritsh, E.F., Matias, T. 1998. Molecular cloning: a laboratory manual.
New York: Cold Sring Harbor Lab. Press. 2a ed.
Sanger, F., Nicklen, S., Coulson, A.R. 1977. DNA sequencing with chain-terminating
inhibitors. Proc. Nati. Acad. Sei. USA 74, 5463-5467.
Sick, H. 1967. Rios e enchentes na Amaznia como obstculo para a avifauna. Atas do
Simpsio sobre a Biota Amaznica 5 (Zoologia), 495520 (in Portuguese).
Silva, M. N. F., Patton, J. L. 1998. Molecular phylogeography and the evolution and
conservation of amazonian mammals. Molecular Ecology, 7: 475-486.
Silva, J.M.C, Rylands, A.B.; Fonseca, G.A.B. 2005. The Fate of the Amazonian Areas
of Endemism. Conservation Biology, vol. 19, 3, 689694.
Smith, M.F., Patton, J.L. 1991. Variation in mitochondrial cytochrome-b sequence in
natural

populations

of

South

American

akodontine

rodents

(Muridae:

Sigmodontinae). Molecular Biology and Evolution, v. 8, 85-103.


Smith, M.F., Patton, J.L. 1993. The diversification of South American murid rodents:
evidence from mitochondrial DNA sequence data for akodontine tribe. Biological
Journal of Linnean Society, vol. 50, 149-177.

45
Smith, M.F., Patton, J.L. 1999. Phylogenetic relationships and the radiation of
sigmodontine rodents in South America: evidence from Cytochrome b. Journal of
Mammalian Evolution, vol. 6, n. 2, 89-128.
Steppan, S.J., Adkins, R.M., Spinks, P.Q., Rale, C. 2005. Multigene phylogeny of the
Old World mice, Murinae, reveals distinct geographic lineages and the declining
utilityof mitochondrial genes compared to nuclear genes. Molecular Phylogenetics
and Evolution, 37, 370388.
Turvey, S.T.; Weksler, M.; Morris, E.L.; Nokkert, M. 2010. Taxonomy, phylogeny, and
diversity of the extinct Lesser Antillean rice rats (Sigmodontinae: Oryzomyini),
with description of a new genus and species. Zoological Journal of the Linnean
Society, 160, p.748 772.
Tate, G.H.H. 1939. Mammals of the Guiana region. Bulletin of the American Museum
of Natural History . 76: 151229.
Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. 2011. MEGA5:
Molecular Evolutionary Genetics Analysis using Likelihood, Distance, and
Parsimony methods. Molecular Biology and Evolution.
Thomas, O. 1882. On a collection of rodents from north Peru. Proceedings of the
Zoological Society of London 1882, 98111 1 pl. IV.
Thomas, O. 1900. New South American mammals. Annals and Magazine of Natural
History 7(5), 148153.
Thomas, O. 1903. On the mammals collected by Mr. A. Robert at Chapada Mato
Grosso (Percy Sladen Expedition to Central Brazil). Proceedings of the Zoological
Society of London, 2: p. 232-244. PI.XXVII.
Thomas, O. 1905. New Neotropical Chrotopterus, Sciurus, Neacomys, Coendou,
Proechimys, and Marmosa. Annals and Magazine of Natural History, 7(16), 308
314.

46
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G. 1997.
The CLUSTAL X windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools, Nucleic Acids Reseach, 25, 4876-4882.
Van Valen, L. 2004. Chapter 8: Adaptation and the Origin of Rodents. Bulletin of the
American Museum of Natural History, 285,110-119.
Voss, R.S; Lunde, D.P.; Simmons, N.B. 2001. The mammal of Paracou, French Guiana:
a Neotropical lowland rainforest fauna part 2. Nonvolant species. Bulletin of the
American Museum of Natural History, n. 263, 1-236.
Wallace, A. R. 1852. On the monkeys of the Amazon. Proceedings of the Zoological
Society of London 20, 107110.
Weksler, M. 2003. Phylogeny of neotropical oryzomyine rodents (Muridae:
Sigmodontinae) based on the nuclear IRBP exon. Molecular Phylogenetics and
Evolution, vol. 29, 331-349.
Weksler, M. 2006. Phylogenetic relattioships of oryzomine rodents (Muroidea:
Sigmodontinae): separate and combined analyses of morphological and molecular
data. Bulletin of the American Museum of Natural History, n. 296, 149 pp.
Woodman, N., R. M. Timm, R. Arana C., V. Pacheco, C. A. Schmidt, E. D. Hooper; C.
Pacheco A. 1991. Annotated checklist of the mammals of Cuzco Amazonico,
Peru. Occasional Papers of the Museum of Natural History University of
Kansas.145: p. 12
Xia, X. & Xie, Z. 2001. DAMBE: Software package for data analysis in molecular
biology and evolution. The Journal of Heredity, 92(4), 371 373.

47
APNDICE A
LISTA DE LOCALIDADES
Bolvia: Santa Cruz. [01] El Refugio, margem direita do rio Paragua/Tavo. 1445S
6101W (Coletor).
Brasil: Acre. [02] Igarap Porongaba, margem direita rio Juru. 0822S 7247W
(etiqueta do espcime). [03] Sobral (sede), margem esquerda rio Juru. 0822S
7249W (etiqueta do espcime). Amap [04] Ferreira Gomes, Rio Araguari.
005011,6N 511716,8W (Coletor). [05] Laranjal do Jari, Cachoeira Santo Antnio,
TCD/AP. 0035'S 5214'W (Coletor). [06] Laranjal do Jari, Itapeuara. 00 29N 52
41W (Coletor). [07] Laranjal do Jari, Resex Cajari, Marinho. 0035'S 5238'W
(Coletor). Amazonas [08] Altamira, margem direita rio Juru. 0635S 6854W
(etiqueta do espcime).[09] Barro Vermelho, margem esquerda rio Juru. 0628S
6846W (etiqueta do espcime). [10] Colocao Vira-Volta, margem esquerda rio
Juru, Igarap Arabidi. 0317S 6614W (etiqueta do espcime). [11] Comunidade
Bela Vista, margem esquerda do rio Madeira. 051446S 604250W (etiqueta do
espcime). [12] Penedo, margem direita do rio Juru. 0644S 7013W (etiqueta do
espcime). [13] RESEX Baixo Juru, Comunidade Botafogo, margem direita rio Juru.
031124S 655514W (Coletor). [14] Rio Ja, margem direita acima da foz.
015754 612914W (etiqueta do espcime). [15] Sacado, margem direita Rio
Juru. 0645S 7051W (etiqueta do espcime). [16] Seringal Condor, margem
esquerda rio Juru. 0545S 7051W (Patton et al., 2000). [17] Tambor, margem
esquerda rio Ja. 0213S 6226W (etiqueta do espcime). Mato Grosso [18]
Araputanga, Jauru, SUDAN. 151514S 582720 (Coletor). [19] Aripuan. 1010S,
5927W (Coletor). [20] Cludia. 1135 S 5508W (Coletor). [21] Cotriguau.
Fazenda So Nicolau. S 0950'10.0S W 05815'09.1 (Coletor). [22] Gacha do Norte.
1302S 5312W (Coletor). [23] Indiava, Fazenda gua limpa. 151652S
583720 (Coletor). [24] Indiava, Fazenda Pitomba. 151926S 582715W
(Coletor). [25] Indiava, UHE Jauru. 1527S 5833W (Global Gazetter). [26] Rio
Branco, Fazenda Nutrix. 152005S 580416W. (Coletor). [27] Paranaita. Rio Teles
Pires. 09 3455S 564239,5W (Coletor). Par [28] Almeirim, Floresta Estadual
Paru, margem direita do rio Paru de Leste. 0056'S 5314'W (Coletor). [29] Almeirim,

48
Monte Dourado. 004125,9S 52499,2 (Coletor). [30] Almeirim, Reserva Biolgica
Maicuru. 0049'N 5355'W (Coletor). [31] Altamira, Cachoeira do Espelho, Rio Xing.
0339S 5222W (etiqueta do espcime). [32] Anapu, Caracol, margem direita do Rio
Xing. 0328S 5140W (Coletor). [33] Chaves, Fazenda Tauar, margem direita do
baixo rio Cururu. 0010'S 4955'W (Paynter & Traylor 1991). [34] Juruti, Mutum
(antigo acampamento da ALCOA). 0236'S 5611'W (etiqueta do espcime). [35] Juruti,
Plat Capiranga. 0230'S 5611'W (etiqueta do espcime). [36] Mami, LT-OriximinMacap. 0401'S 6252'W (Coletor). [37] Marab, Floresta Nacional Tapirap-Aquiri,
Projeto Salobo CVRD, rea Controle. 0550'55S 5032'10W (Coletor). [38] Marab,
Floresta Nacional Tapirap-Aquiri, Projeto Salobo CVRD, Barragem de Finos. 0549'S
5029'W (Coletor). [39] Marab, Floresta Nacional Tapirap-Aquiri, Projeto Salobo
CVRD, Igarap Mano. 0546'S 5033'W (Coletor). [40] bidos, Estao Ecolgica
Gro-Par Centro. 0037'N 5543'W (Coletor). [41] bidos, Floresta Estadual de
Trombetas. 0057'S 5531'W (Coletor). [42] Oriximin, Estao Ecolgica Gro-Par
Norte. 0117'N 5841'W (Coletor). [43] Vitria do Xing, Bom Jardim, margem
esquerda do Rio Xing. 0324'S 5140'W (Coletor). Rondnia [44] Abun, margem
esquerda do rio Madeira. 093205,8S 652037,8W (etiqueta do espcime). [45]
Terra Indgena Uru-Eu Wau Wau. 104154,5 S 632721W. (Coletor).
Equador: Napo [46] Parque Nacional Yasuni, Onkone Gare, 38 km S Pompeya Sur.
003800S 763560W (Coletor). Pastaza [47] Tiguino, 130 km S of Coca, 300 m,
0107S 7657W.
Guiana: Barima-Waini [48] Baramita. 0722N 6029W (Gardner, 2007).
Peru: Amazonas [49] Huampami, Rio Cenepa, 210 m, 0428S 7810W (Gardner,
2007). Cuzco [50] Pacuaratambo, 72 km NE, 1,460 m, ca. 1311S 7133W (Coletor).
[51] Tangoshiari, 2 km SW. 1146S 7326W (Gardner, 2007). Loreto [52] Nuevo San
Juan, Ro Galvez, 150 m. 0515S 7310W

(Gardner, 2007). [53] San Jacinto.

044026S 735733 (Global Gazetteer). Madre de Dios: [54] Reserva Cuzco


Amaznico, 14 km E de Puerto Maldonado, ca. 200 m. 1233S 6903W (Gardner,
2007). Puno: [55] 11 km NNE Ollachea. 1344S 7026W (Gardner, 2007).

49
APNDICE B
Espcies, localidade, origem, sigla e nmero de coleo, de cada amostra utilizada para cada
fragmento de gene. As amostras da fonte: A= J.L. Patton (as sequencias referentes a esta fonte
so somente o fragamento do gene Cyt b) B= Este Trabalho.

Espcies

Localidade

Fonte

Sigla/n
depsito

N. dubosti
N. dubosti
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. minutus
N. musseri
N. musseri
N. musseri
N. musseri
N. musseri
N. musseri
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou

Brasil: PA: E. Ecolgi. Gro-Par


Brasil: PA: Almeirim: R. Maicuru
Brasil: AM: rio Juru: Sacado
Brasil: AM: rio Juru: Penedo
Brasil: AM: rio Juru: Penedo
Brasil: AM: rio Juru: Ig. Arabidi
Brasil: AM: rio Juru: Ig. Arabidi
Brasil: AM: rio Juru: Ig. Arabidi
Brasil: AM: rio Juru: Ig. Arabidi
Brasil: AM: rio Juru: Bar. Vermelho
Brasil: AM: rio Juru: Bar. Vermelho
Brasil: AM: rio Juru: C. Botafogo
Brasil: AM: rio Juru: Altamira
Brasil: AM: rio Juru: Altamira
Brasil: AM: rio Juru: Altamira
Brasil: AM: rio Juru: Altamira
Brasil: AM: rio Juru: Altamira
Brasil: AM: rio Madeira: Bela Vista
Brasil: AM: rio Madeira: Bela Vista
Brasil: Rondnia: Abun
Peru: Loreto: Nuevo San Juan
Brasil: AC: Igarap Porangaba
Peru: MD: Res. Cuzco Amazonico,
Peru: Cuzco: 72km NE Paucartambo,
Peru: Cuzco: 72km NE Paucartambo,
Peru: Loreto: Nuevo San Juan
Peru: Loreto: Nuevo San Juan
Brasil: AP: Araguari: Ferreira Gomes
Brasil: AP: L. Jari: C. Sto. Antonio
Brasil: AP: L. Jari: C. Sto. Antonio
Brasil: AP: L. Jari: C. Sto. Antonio
Brasil: AP: L. Jari: C. Sto. Antonio
Brasil: PA: E.E. Gro Par Norte
Brasil: PA: E.E. Gro Par Norte
Brasil: PA: E.E. Gro Par Norte
Brasil: PA: Almeirim: Flota Paru
Brasil: PA: Almeirim: Flota Paru
Brasil: PA: bidos: Flota Trombetas
Brasil: PA: bidos: Flota Trombetas
Brasil: PA: bidos: Flota Trombetas
Brasil: PA: bidos: Flota Trombetas
Brasil: PA: bidos: Flota Trombetas
Brasil: PA: Mami
Brasil: PA: bidos:F. Trombetas
Brasil: PA: bidos:F. Trombetas
Brasil: PA: Almeirim: Itapeuara
Brasil: AP: L. do Jari: Itapeuara

B
B
A
B
A
B
A
B
A
B
A
B
B
B
B
B
B
B
B
B
A
A
A
A
A
A
A
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B

MPEG40489
MPEG41806
INPA3891
INPA3054
MVZ190358
MVZ190363
INPA3051
MPEG28621
MPEG28623
MVZ190359
INPA3047
EE110
MVZ191209
MVZ190360
INPA3047
INPA3048
INPA3049
MCA14
MCA19
INPA4664
AMNH 272867
INPA3046
KU144300
MVZ171488
MVZ171487
AMNH 272676
AMNH 272687
IEPA 2697
IEPA2465
IEPA2468
IEPA2464
IEPA2466
MPEG 40487
MPEG 40476
MPEG 40478
MPEG 41808
MPEG 41810
MPEG 41809
MPEG 40001
MPEG 40031
MPEG 40000
MPEG 39998
IEPA2024
MPEG 40009
MPEG 40021
IEPA2469
IEPA2470

Genes sequenciados
Cyt b COI ADH-I2
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X

50
Continuao do apndice B

Espcies
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. paracou
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
N. spinosus
Neacomys sp.1

Localidade

Fonte

Sigla/n
depsito

Brasil: PA: Juruti


Brasil: PA: Mami
Brasil: AP: L. Jari: Resex Cajari
Brasil: PA: Mami
Brasil: AP: L. Jari: Resex Cajari
Brasil: PA: Mami
Brasil: PA: Mami
Brasil: PA: Mami
Brasil: PA: Monte Dourado
Brasil: PA:Almeirim:R. Maicuru
Brasil: AP: L. Jari: Resex Cajari
Brasil: PA: Juruti
Brasil: AP: L. Jari: Resex Cajari
Brasil: PA: Mami
Brasil: AP: L. Jari: Resex Cajari
Brasil: AP: L. Jari: Resex Cajari
Brasil: PA: Mami
Brasil: PA: Mami
Guiana: BA: Baramita
Brasil: Mato Grosso: Teles Pires
Brasil: Mato Grosso: Aripuan
Brasil: Mato Grosso: Aripuan
Brasil: Mato Grosso: Teles Pires
Brasil: Mato Grosso: Teles Pires
Brasil: Mato Grosso: Teles Pires
Brasil: Mato Grosso: Cotriguau
Brasil: Mato Grosso: Cotriguau
Brasil: Mato Grosso: Cotriguau
Brasil: Mato Grosso: Jauru
Brasil: AC: rio Juru: Sobral
Brasil: AC: rio Juru: Sobral
Brasil: AC: Igarap Porangaba
Brasil: AM: rio Juru: S. Condor
Brasil: AC: Igarap Porangaba
Brasil: Mato Grosso: G. Norte
Brasil: AM: rio Juru: Penedo
Brasil: MT : Claudia
Brasil: MT G: G. Norte
Brasil: MT: Aripuan
Brasil: MT : Claudia
Brasil: MT: Jauru
Brasil: RO: Uru-Eu Wau Wau
Brasil: RO: Uru-Eu Wau Wau
Equador: NA: PN Yasuni
Equador: NA: PN Yasuni
Equador: NA: PN Yasuni
Bolvia: El Refugio: Santa Cruz
Bolvia: El Refugio: Santa Cruz
Bolvia: El Refugio: Santa Cruz
Peru: CZ: Tangoshiari
Peru: CZ: Tangoshiari
Brasil: PA: Juruti

B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
B
A
B
B
A
B
B
B
B
B
B
B
A
B
A
A
B
A
B
A
A
A
A
B
B
B
A
A
A
A
A
A
A
A
B

MPEG 38527
IEPA2023
RSX09
MM58
IEPA2029
IEPA2457
IEPA2478
IEPA2477
INPA5214
MPEG41807
IEPA1619
MPEG38501
IEPA1618
IEPA2455
RSX15
RSX01
MM103
MM53
ROM101114
UTP644
IB/USP 392
IB/USP 389
UTP 645
UTP 646
PL43
MSN23
MSN22
MSN14
MSF857
MPEG28126
INPA3062
INPA3060
MVZ190372
MPEG28125
MZUSP29538
INPA3065
IB/USP 513
MZUSP29537
IB/USP 665
IB/USP 534
MSF1143
MNFS2203
MNFS2181
ROM105264
ROM105282
ROM105278
USNM417
USNM1558a
USNM584544
USNM778
USNM779
MPEG40671

Fragmentos sequenciados
Cyt b COI ADH-I2
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
-

51
Continuao do apndice B

Espcies
Neacomys sp.1
Neacomys sp.1
Neacomys sp.1
Neacomys sp.2
Neacomys sp.2
Neacomys sp.2
Neacomys sp.2
Neacomys sp.2
Neacomys sp.2
Neacomys sp.3
Neacomys sp.3
Neacomys sp.3
Neacomys sp.3
Neacomys sp.3
Neacomys sp.3
Neacomys sp.3
Neacomys sp.3
Neacomys sp.4
Neacomys sp.4
Neacomys sp.4
Neacomys sp.4
Neacomys sp.5
Neacomys sp.6
O. microtis

Localidade

Fonte

Sigla/n
depsito

Brasil: PA: Juruti


Brasil: PA: Juruti
Brasil: PA: Juruti
Brasil: PA: Chaves
Brasil: PA: Chaves
Brasil: PA: Altamira: Xingu
Brasil: PA: Chaves
Brasil: PA: Marab: Salobo
Brasil: PA: Marab: Salobo
Peru: AM: Huampami
Equador: NA: PN Yasuni
Equador: NA: PN Yasuni
Equador: NA: PN Yasuni
Equador: NA: PN Yasuni
Peru: LO: San Jacinto
Peru: LO: San Jacinto
Peru: LO: San Jacinto
Brasil: AM: rio Ja
Brasil: AM: rio Ja
Brasil: AM: rio Ja
Brasil: AM: rio Ja
Peru: Puno: 11 km NE Ollachea
Brasil:PA: Vitria do Xingu
Brasil: AC: Igarap Porangaba

B
B
B
B
B
B
B
B
B
A
A
A
A
A
A
A
A
A
A
A
A
A
B
A

MPEG40665
MPEG38502
MPEG38694
MPEG40443
MPEG40439
MZUSP21319
MPEG40446
MPEG41805
MPEG41804
MVZ155299
ROM104560
ROM105265
ROM105314
ROM105315
KU158172
TK73347
TK73493
INPA4192
INPA4189
INPA4190
INPA4191
MVZ172655
MPEG41811
INPA1321

Fragmentos sequenciados
Cyt b COI ADH-I2
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X

Legenda: AMNH American Museum Natural History; EE Material coletado por E. Eler;
INPA Instituto Nacional de Pesquisas da Amaznia;

IB-USP: Instituto de Biocincias,

universidade de So Paulo. KU Kansas University; MPEG Museu Paraense Emlio Goeldi;


MCA - Material coletado por M. C. Arteaga; MSF Material Coletado por M. Santos-Filho;
MZUSP: Museu de Zoologia da USP; MVZ Museum Vertebrate Zoology; MM e RSX
Material coletado por C. R. Silva; MSN, UTP e PL, Material proveniente da Universidade
Federal do Mato Grosso; ROM Royal Ontario Museum; TK Material coletado por
J.L.Patton; USNM National Museum of Natural Histoty;

52
FIGURAS

Figura 1. Distribuio aproximada do gnero Neacomys na regio Neotropical atualizada neste


estudo. A distribuio foi baseada nos pontos de coleta de exemplares examinados por E. M.
Cardoso e pontos de ocorrncias registradas na literatura.

53

Figura 2. rvore de anlise de Mxima Verossimilhana de 124 seqncias e 651 pares de base
do gene Cyt b. O suporte de Bootstrap > 50% so mostrados nos ramos. Acima dos ramos esto
os valores dos suportes das anlises de Mxima Verossimilhana. Abaixo dos ramos, os
suportes das anlises de Mxima Parcimnia e Inferncia Bayesiana. Foi usado o modelo de
substituio nucleotdica GTR como a distribuio gamma = 1.6199.

54

Figura 3. rvore de anlise de Mxima Verossimilhana de 31 seqncias e 1734 pares de base


de genes concatenados: Cyt b, COI e ADH I2. O suporte de Bootstrap > 50% so mostrados
nos ramos. Acima dos ramos esto os valores dos suportes das anlises de Mxima Parcimnia
e Inferncia Bayesiana. Abaixo do ramo, os suportes da anlise de Mxima Verossimilhana.
Foi usado o modelo de substituio nucleotdica GTR como a distribuio gamma = 1.2547.
Legenda: Altamira= margem esquerda, Altamira= margem direita.

55

Figura 4. Distribuio das amostras de espcies de Neacomys seqenciadas neste estudo. A


distribuio foi baseada nos pontos obtidos das amostras. Legenda: crculos slidos N.
spinosus (preto), N. Paracou (cinza). Crculo vazado Neacomys sp.6. Estrelas slidas:
Neacomys sp.2 (preto), Neacomys sp.3 (cinza). Estrela vazada Neacomys sp.4. Tringulos
slidos: N. dubosti. Tringulos vazados: N. minutus. Quadrado slidos: N. guianae (preto), N.
musseri (cinza). Losngulo slido: Neacomys sp. 1(preto). Losngulo vazado: Neacomys sp.5.

56
TABELAS E DADOS SUPLEMENTARES
Tabela 1. Txons nominais do grupo da espcie associados a Neacomys e suas respectivas
localidades tipo (Cabrera 1961; Musser & Carleton, 2005). Txons nominais atualmente
reconhecidos como espcies vlidas possuem asterisco (*).
Epteto especfico

Localidade - tipo

dubosti* Voss, Lunde & Simons, 2001

Guiana Francesa, Paracou. 515'N 53W

guiane* Thomas, 1905

Guiana Inglesa, Rio Demerara, 36 m. 6 47' 60 N 58


10' W

minutus* Patton, da Silva & Malcolm, Brasil, Amazonas, margem esquerda do rio Juru,
2000

Altamira. 635S, 6854W.

musseri* Patton, da Silva & Malcolm, Peru, Cusco, Manu Biosphere Reserve, 72 km,
2000

NE Paucartambo, 152 km, 1460 m. 13 18' 56S 71


35' 30W

paracou* Voss, Lunde & Simons, 2001 Guiana Francesa, Paracou. 515'N 53W
pictus* Godman, 1912

Panam, Provncia de Drien, Santa Cruz de Cana, no


alto Tuyra. 549 m. 8.345N

78.0661111W
spinosus* (Thomas, 1882)
amoenus Thomas, 1903

Per, Huambo, 1128 m. 6 22' 0S 77 28' 0W


Brasil, Mato Grosso, Santana da Chapada, 800 m. 1525'
60S 5545'W

carceleni Hershkovitz, 1940

Equador, Isla Llunchi, Rio Napo, Napo-Pastaza, 250 m.


037S 7646W.

tenuipes* Thomas, 1900

Colmbia,

Cundinamarca,

Regio

de

Bogot,

Guaquimay 700 m. 528'00''S -7411'00''W


pusillus, Allen, 1912

Colmbia, San Jos, distrito de Cauca. 2 57' 44N 77


35' 55W

57
Tabela 2. Seqncias do GenBank utilizadas nas anlises filogenticas.
Espcies
Neacomys dubosti

N GenBank

Localidade

Gene

FM210777

[56] Suriname, Sipaliwini District, Oelemarie. 0306N

Cyt b

5431W (Catzeflis & Tilak, 2009).


Neacomys dubosti

FM210780.1

[57] Guiana Francesa,

Sal. 0337N 5312W

Cyt b

[58] Suriname, Nickerie District, Sipaliwi Airstrip.

Cyt b

(Catzeflis & Tilak, 2009).


Neacomys dubosti

FM210781.1

0202N 5607W (Catzeflis & Tilak, 2009).


Neacomys guianae

FM210778.1

[58] Suriname, Nickerie District, Sipaliwi Airstrip.

Cyt b

0202N 5607W (Catzeflis & Tilak, 2009).


Neacomys guianae

FM210779.1

[59] Suriname, Saramacca District, Tafelberg. 0355N

Cyt b

5610W (Catzeflis & Tilak, 2009).


Neacomys guianae

EU096810.1

[58] Suriname, Nickerie District, Sipaliwi Airstrip.

COI

0202N 5607W (Borisenko et al., 2008).


Neacomys guianae

EU096811.1

[58] Suriname, Nickerie District, Sipaliwi Airstrip.

COI

0202N 5607W (Borisenko et al., 2008).


Neacomys paracou

EU096816.1

[58] Suriname, Nickerie District, Sipaliwi Airstrip.

COI

0202N 5607W (Borisenko et al., 2008).


Neacomys paracou

EU096815.1

[58] Suriname, Nickerie District, Sipaliwi Airstrip.

COI

0202N 5607W (Borisenko et al., 2008).


Neacomys spinosus

EU649002.1

[49] Per, Amazonas, Huampami, rio Cenepa. 0428S

ADH

7810W (Hanson & Bradley, no publicado).


Neacomys musseri

EU649001.1

[52] Peru, Loreto, Nuevo San Juan. 0515S 7310W

ADH

(Hanson & Bradley, no publicado).


Neacomys minutus

EU648998.1

[60] Equador. (Hanson & Bradley, no publicado).

ADH

Neacomys minutus

EU649000.1

[52] Peru, Loreto, Nuevo San Juan. 0515S 7310W

ADH

(Hanson & Bradley, no publicado).

58
Tabela 3. Anlises realizadas para os bancos de dados dos genes mitocondriais Cyt b e COI e
gene nuclear ADH-I2.
Anlises Filogenticas

Cytb

COI

ADH-I2

Concatenado

Mxima Verossimilhana (ML)

Mxima Parcimnia (MP)

Inferncia Bayesiana (IB)

Tabela 4. Estimativas de distncia sobre pares de seqncias de genes concatenados: Cyt b,


COI e ADH I2 entre espcies de Neacomys so mostradas na parte inferior da tabela. Todos os
resultados so baseados na anlise de 31 sequncias com 1734 pares de base incluindo todas as
posies dos cdons. O desvio padro mostrado na parte superior da tabela e foram obtidos
atravs do clculo de distncia corrigida de Kimura 2 parmetros, bootstrap de 1000 rplicas.
A taxa de variao entre os stios foi obtida atravs da distribuio gamma (shape parameter =
1.2547). Todos os valores esto mostrados em porcentagem.
ESPCIES

1. Neacomys spinosus

10

1.0

2.0

0.9

0.9

0.8

2.2

1.6

0.8

0.8

2.3

1.1

1.0

1.0

2.2

1.6

1.0

1.1

2.3

1.9

1.9

1.6

1.5

2.1

2.4

1.1

1.1

2.3

2.1

0.9

1.0

0.7

1.8

1.3

0.9

0.9

1.7

1.6

0.9

0.9

1.8

2.0

2.3

1.5

1.5

2. Neacomys paracou

11.4

3. Neacomys guianae

18.6

19.1

4. Neacomys dubosti

8.0

10.2

18.1

5. Neacomys minutus

10.8

11.6

15.5

9.3

6. Neacomys musseri

9.5

10.2

16.5

9.0

8.3

7. Neacomys sp.3

18.9

19.4

13.8

16.1

14.8

12.9

8. Neacomys sp.4

17.5

16.6

9.1

15.9

14.5

13.9

13.2

9. Neacomys sp.2

9.9

11.7

17.6

7.5

10.6

9.7

16.3

15.3

10. Neacomys sp.1

9.5

13.0

19.4

7.8

10.1

9.6

17.9

15.8

0.6
6.3

59
Tabela 5. Estimativas de distncia sobre pares de seqncias de Cyt b entre espcies de
Neacomys so mostradas na parte inferior da tabela. Todos os resultados so baseados na anlise
de 123 sequncias com 651 pares de base incluindo todas as posies dos cdons. O desvio
padro mostrado na parte superior da tabela e foram obtidos atravs do clculo de distncia
corrigida de Kimura 2 parmetros, bootstrap de 1000 rplicas. A taxa de variao entre os
stios foi obtida atravs da distribuio gamma (shape parameter = 1.6199). Todos os valores
esto mostrados em porcentagem.
ESPCIES

1. Neacomys spinosus

10

11

12

1.3

2.0

2.0

2.1

1.7

1.8

2.2

2.1

1.7

1.9

1.4

1.8

1.9

2.0

1.9

1.7

1.9

1.9

1.8

1.9

1.2

1.9

1.7

1.8

1.5

1.6

1.8

1.6

1.6

2.1

1.9

2.1

1.9

1.8

1.8

1.8

2.2

2.0

1.9

1.9

1.7

1.3

1.9

2.1

2.2

1.8

1.8

1.7

1.4

1.6

2.0

1.6

1.9

1.7

1.9

2.1

1.8

1.7

1.9

2.1

1.9

1.9

2.1

1.4

2.0

2. Neacomys sp.5

9.9

3. Neacomys minutus

18.5

16.4

4. Neacomys paracou

18.3

16.0

17.9

5. Neacomys guianae

18.0

16.8

15.2

18.0

6. Neacomys dubosti

14.9

15.9

16.7

18.5

16.4

7. Neacomys musseri

16.6

13.2

14.3

18.7

16.4

16.2

8. Neacomys sp.3

18.2

15.6

14.5

17.3

13.6

14.8

13.2

9. Neacomys sp.4

18.1

15.3

15.9

16.0

8.9

14.3

16.5

14.2

10. Neacomys sp.2

15.0

15.6

15.7

16.5

17.0

11.8

16.5

15.7

16.2

11. Neacomys sp.1

15.4

16.0

15.4

19.2

18.1

12.6

16.3

16.5

15.3

9.6

12. Neacomys sp.6

10.6

9.1

19.9

18.2

19.4

17.2

19.4

18.4

17.5

16.8

1.9
16.0

60
Tabela 6. Estimativas de distncia intra especfica sobre pares de seqncias de Cyt b, entre
espcimes de Neacomys que tiveram mais de duas amostras. A primeira coluna apresenta
variao intra-especfica para cada txon. A segunda coluna apresenta as localidades que mais
divergiram entre si. A distncia foi obtida atravs do clculo de distncia corrigida de Kimura 2
parmetros, bootstrap de 1000 rplicas. A taxa de variao entre os stios foi obtida atravs da
distribuio gamma (shape parameter = 1.6199). Todos os valores esto mostrados em
porcentagem.
Espcies

Variao intra-especfica

Maiores Divergncias

1. Neacomys dubosti

0,3 a 0,6%

Rebio Maicuru [30] e Oelemarie [56]

2. Neacomys minutus

0,2 a 9,1%

Com. Bela Vista [11] e Nuevo San Juan [52]

3. Neacomys musseri

1,4 a 3,6%

Cuzco Amazonico[54] e Nuevo San Juan [52]

4. Neacomys paracou

0,2 a 2,2%

Resex Cajari [07] e Baramita [48]

5. Neacomys spinosus

0 a 4%

6. Neacomys sp.2

0 a 4,5%

7. Neacomys sp.3

0,5 a 2,3%

Aripuan [19] e PN Yasuni [46]


Chaves [33] e Marab [39]
PN Yasuni [46] e Huampami [ 49]