Você está na página 1de 119

UNIVERSIDADE ESTADUAL DE SANTA CRUZ

PR-REITORIA DE PESQUISA E PS-GRADUAO


PROGRAMA DE PS-GRADUAO EM GENTICA E BIOLOGIA MOLECULAR

Anlise da biodiversidade metagenmica bacteriana de um solo de


Mata Atlntica da Bahia e isolamento de DNA de alto peso
molecular visando aplicaes biotecnolgicas

Tharcilla Nascimento da Silva

ILHUS BAHIA BRASIL


Abril de 2007

THARCILLA NASCIMENTO DA SILVA

Anlise da biodiversidade metagenmica bacteriana de um solo de


Mata Atlntica da Bahia e isolamento de DNA de alto peso
molecular visando aplicaes biotecnolgicas

Dissertao apresentada Universidade Estadual de Santa Cruz, como


parte das exigncias para obteno do ttulo de Mestre em Gentica e Biologia
Molecular.

ILHUS BAHIA BRASIL


Abril de 2007

THARCILLA NASCIMENTO DA SILVA

Anlise da biodiversidade metagenmica bacteriana de um solo de


Mata Atlntica da Bahia e isolamento de DNA de alto peso molecular
visando aplicaes biotecnolgicas.

Dissertao apresentada Universidade Estadual de Santa Cruz, como parte


das exigncias para obteno do ttulo de Mestre em Gentica e Biologia Molecular.

APROVADA:

Dra. Ana Paula Trovatti

Dr. Eduardo Gross

Dr. Martin Brendel

(UESC)

(UESC)

Uetanabaro
(UEFS)

Dr. Jlio Czar de Mattos Cascardo


(UESC Orientador)

"No confunda jamais conhecimento


com sabedoria. Um o ajuda a ganhar
a vida; o outro a construir uma vida."
(Sandra Carey)

A Deus por ter me capacitado e me


concedido mais uma vitria, sabendo que
muito mais ainda est porvir. A Ele todo
louvor e glria!
DEDICO

Aos meus pais, Juracy e Ftima, por todo


sacrifcio, carinho, apoio, confiana, pelas
palavras proferidas nos momentos de tanta
dificuldade. Agradeo a eles por tudo que
tenho e sou.
s minhas irms, Cntia, Thirza e Vvian por
todo incentivo e amor.
Ao meu esposo Wagner Macena por tanto
amor, compreenso, pacincia e incentivo
nos momentos mais precisos, at mesmo
quando estava distante fisicamente.
Com mor
OFEREO

ii

AGRADECIMENTOS

A Deus, que me deu fora e serenidade para persistir diante das dificuldades
e para cumprir esta jornada.
Ao meu querido orientador, Dr. Jlio Cezar de Mattos Cascardo, pela
orientao, confiana neste nosso desafio, e constante disponibilidade, presteza e
boa vontade.
A Dra Rachel Passos Rezende pela co-orientao, confiana e incentivo.
Ao Prof Dr. Joo Carlos Teixeira Dias pela importante contribuio no
desenvolvimento

deste

trabalho,

assim

tambm

pelo

estmulo

pelos

conhecimentos trocados.
Ao Mestrado em Gentica Biologia Molecular da Universidade Estadual de
Santa Cruz e Fundao de Amparo Pesquisa do Estado da Bahia (FAPESB),
pela oportunidade de realizao do curso e pela bolsa concedida.
Aos professores do Mestrado em Gentica e Biologia Molecular da UESC,
pelos ensinamentos.
Ao professor Carlos Priminho Pirovani pela amizade, apoio, incentivo,
disposio, mesmo em atividades extra-acadmicas, conselhos, enfim... Se
algum que desejo deixar bem clara minha gratido e satisfao pela amizade, a
voc Priminho.
Aos colegas Ramon Vidal e Cristiano Villela pela grande colaborao nos
trabalhos de bioinformtica.
Aos amigos do laboratrio de Gentica, Monitoramento Ambiental, Cultura de
Tecidos e Marcadores Moleculares pelos auxlios direto ou indireto, e pelos
momentos compartilhados.
s amigas e colegas de mestrado, em especial Carol, Lvia, Brena e Jamilly
pelo apoio, incentivo e sincera amizade.
Ao Gileno Jr. e ao Jaime Henrique pela unio e parceria, todos em busca de
um mesmo ideal, a obteno de muito resultados e o progresso da metagenmica
na UESC.
Ao Robson pelo Seqenciamento das placas de 16S e Fosmdeos.

iii

Tambm ao Antnio Carlos, o Pel! Pessoa muito prestativa, que sempre me


deu apoio e ajuda nos momentos em que precisei, naqueles de muita atividade
laboratorial.
Ao meu amorzinho, que por tanto tempo, ficou me acompanhando durante a
semana, inclusive sbados, domingos e feriados, onde saamos da UESC altas
horas, muitas vezes, tinha at que me ajudar, para que ns no ficssemos at
mesmo nas madrugadas nos laboratrios.Os experimentos pareciam que nunca iam
acabar, foi muito suor e dedicao minha, e muita pacincia e compreenso sua
meu amor.
A todos que direta ou indiretamente colaboraram na conduo deste trabalho.

iv

NDICE

EXTRATO ................................................................................................................................vii
ABSTRACT ...............................................................................................................................ix
LISTA DE FIGURAS..................................................................................................................xi
LISTA DE TABELAS................................................................................................................xiv
1. INTRODUO.......................................................................................................................1
2. REVISO BIBLIOGRFICA...................................................................................................3
2.1. Mata Atlntica................................................................................................................3
2.2. Os microrganismos e o solo ........................................................................................4

2.3. Organismos vivos e sua diversidade.................................................................7


2.4. A diversidade microbiana e os mtodos moleculares aplicados na sua deteco
.......................................................................................................................................9
2.5. Marcadores Moleculares no estudo da diversidade .......................................12
2.6. A metagenmica e a biotecnologia ................................................................14
3.METODOLOGIA.......................................................................................................18
3.1. Coleta das amostras de solo da Mata Atlntica..............................................18
3.2. Mtodos de extrao ex situ de DNA utilizados..............................................18
3.3. Clonagem do DNA para estudo da biodiversidade do solo em estudo...........20
3.3.1. Amplificao do gene 16S rDNA ............................................................20
3.3.2. Ligao do 16S rDNA ao vetor ...............................................................20
3.3.3. Transformao bacteriana .................................................................... .20
3.3.4. Coleta dos clones transformantes ..........................................................21
3.3.5. Extrao do DNA plasmidial dos clones para sequenciamento .............21
3.4. Anlise de Bioinformtica das seqncias obtidas pelo sequenciamento......21
3.4.1. Preparo das seqncias para filtrao das seqncias 16S rDNA........21
3.4.2. Diagnstico filogentico .........................................................................22
3.5. Anlise Restrio de DNA Ribossomal Amplificado (ARDRA) ......................23
3.5.1 A anlise de filogenia a partir de ARDRA ................................................24
3.6. Clonagem do DNA para estudo funcional .....................................................24

3.6.1. Identificao dos clones..........................................................................27


3.6.2. Coleta dos clones ...................................................................................27
3.6.3. Induo dos clones fosmdeos a um alto nmero de cpia ...................27
3.6.4. Extrao do DNA plasmidial dos clones para sequenciamento .............28
3.6.5. Digesto dos clones para confirmar insero dos fragmentos ..............28
3.6.6. Anlise de Bioinformtica das seqncias .............................................28
4. RESULTADOS.........................................................................................................29
4.1. Anlise fsico-qumica do solo de Mata Atlntica..................................................29
4.2 Extrao de DNA.............................................................................................29
4.3. Anlise da Biodiversidade ....................................................................................32
4.3.1 Construo da biblioteca de 16S rDNA ...................................................32
4.3.2. Sequenciamento dos clones contendo o inserto de 16S rDNA ..............33
4.3.3 Anlise de Bioinformtica das seqncias obtidas pelo sequenciamento .........33
4.4. Anlise dos dados obtidos pela anlise de ARDRA ............................................43
4.5. Confeco da biblioteca de fosmdeo com solo de Mata Atlntica ......................49
5. DISCUSSO............................................................................................................53
5.1. Microrganismos e o solo de Mata Atlntica ...............................................55
5.2. Biodiversidade bacteriana do solo de Mata Atlntica.................................55
5.3 Confeco de biblioteca fosmdeos.............................................................61
6. CONCLUSES........................................................................................................62
7. REFERNCIAS BIBLIOGRFICAS........................................................................63
8. APNDICES ...........................................................................................................80

vi

EXTRATO

SILVA, Tharcilla Nascimento. Universidade Estadual de Santa Cruz, Ilhus, abril de


2007. Anlise da biodiversidade metagenmica bacteriana de um solo de Mata
Atlntica da Bahia e isolamento de DNA de alto peso molecular visando
aplicaes biotecnolgicas. Orientador: Jlio Czar de Mattos Cascardo. Coorientadora: Rachel Passos Rezende. Conselheiro: Joo Carlos Teixeira Dias.

A Mata Atlntica a segunda maior floresta tropical mida do Brasil, possui


uma importncia social e ambiental enorme. Encontra-se hoje extremamente
reduzida, sendo uma das florestas tropicais mais ameaadas do globo. Apesar de
reduzida a poucos fragmentos, a biodiversidade de seu ecossistema uma das
maiores do planeta. Muito se conhece sobre a diversidade de sua fauna e flora, mas
pouco se conhece acerca da sua diversidade bacteriana. Esse trabalho revela as
primeiras descries da diversidade bacteriana do solo de Mata Atlntica atravs de
mtodos moleculares independentes de cultivo. O DNA total dessas amostras foi
extrado e usado tanto para anlise de filogenia como para identificao de
possveis genes com aplicaes biotecnolgicas. As amostras de solo, foram
coletadas da Fazenda Caimbi, distrito de Olivena -Ilhus/BA. Para o primeiro
objetivo, usou-se o DNA total como molde em uma reao de PCR com iniciadores
universais para o gene 16S rDNA de Bacteria. O produto de PCR amplificado foi
clonado no vetor pTZ57R/T e a seqncia do gene 16S rDNA foi determinada
atravs do sequenciamento. Alm do estudo baseado em sequenciamento das
amostras, o perfil molecular da comunidade microbiana foi determinado tambm por
ARDRA, utilizando-se as enzimas AluI,HhaI e MspI, para ratificar os dados obtidos e
a eficcia de ambas as tcnicas. ARDRA se revelou um marcador promissor para
vii

comparar a comunidade microbiana presente neste solo. Com fim biotecnolgico, o


DNA total foi fisicamente fragmentado por seringa ficando entre 25-40kb e clonado
em vetores fosmdeos, conforme as instrues do fabricante do CopyControl
Fosmid Library Production Kit (Epicentre Biotechnologies) as seqncias dos clones
foram determinadas atravs de sequenciamento e comparadas em banco de dados
para anlise de similaridades com outras seqncias j descrita A comparao das
seqncias de 634 clones com o banco de dados de 16S rRNA do RDP II indicou
que o filo com maior predominncia foi o de Proteobacteria nas amostras de solo
com 59,9% das seqncias. O segundo filo com maior predominncia foi o de
Firmicutes com 29,4% das seqncias. Tambm foram encontrados representantes
do filo Planctomycetes. Alm disso, aproximadamente 5% das seqncias no
apresentaram similaridade com seqncias de 16S rDNA de bactrias conhecidas e
no foram classificadas. Quanto a identificao de genes com aplicao
biotecnolgica, foram identificadas duas enzimas de interesse nesta era.

Palavras-chave: Fosmdeos, metagenmica, biotecnologia, diversidade bacteriana,


16S rDNA.

viii

ABSTRACT

SILVA, Tharcilla Nascimento. Universidade Estadual de Santa Cruz, Ilhus, 30 de


abril de 2007. Metagenomic bacterial biodiversity of an Atlantic Forest soil and
high molecular weight DNA isolation aiming biotechnological aplications.
Advisor: Jlio Czar de Mattos Cascardo. Co-advisors: Rachel Passos Rezende.
and Joo Carlos Teixeira Dias.

The Atlantic Forest is the second largest tropical humid Brazilian forest,
possessing a high social and environmental role. It is currently reduced and is
considered one of the most threatened tropical forests of the globe. Despite being
reduced to few fragments, its biodiversity is one of the largest of the world. A lot is
known about its fauna and flora, but few is known about its soil bacterial diversity.
This work reveals one of the first descriptions of Atlantic Forest bacterial soil
diversity, independent of cultivation. Total DNA from soil samples was extracted and
used for phylogenetic studies and to search for new genes with biotechnological
application. Soil samples were collected at Caimbi Farm, district of Olivena, Ilhus,
Bahia. Initially the DNA was used as a template in a PCR, using 16S rDNA universal
bacterial primers. The PCR product was cloned in a vector (pTZ57R/T) and the
isolated clones were sequenced. In parallel to the high throughput sequencing, the
16S molecular profile of the microbial diversity was accessed by ARDRA in order to
ratify the obtained data and confirm the efficacy of both techniques. ARDRA
revealed to be an promising marker to compare the microbial community present in
this soil. For biotechnological purposes, soil DNA was physically fragmented to a
size ranging from 25-40 Kbp, and cloned in fosmids (CopyControl Fosmid Library
Production Kit (Epicentre Biotechnologies). The sequences of the obtained clones
ix

were determined by fosmid end-sequencing and compared by BlastX with Gen


Bank. The comparison of the 634 valid sequences against the 16S rRNA from RDP
II indicate that the predominant phylum was that of the Proteobacteria with 59.9 % of
the sequences. The second largest phylum was that of the Firmicute, with 29.4% of
the sequences. It was also found representatives belong to the phylum
Planctomycetes. Furthermore, approximately 5% of the sequences didnt show any
similarity with known 16S rDNA bacterial sequences and, or were not classified.
Despite the difficulties to sequence the fosmid ends, two genes with possible
biotechnological applications were already identified.

Key words: Fosmids, metagenomics, biotechnology, bacterial diversity, 16S rDNA.

LISTA DE FIGURAS

Figura 1. Diviso dos 5 reinos segundo a taxonomia Lineana..................................8

Figura 2. Representao filogentica da diversidade de organismos vivos,


evidenciando a abrangncia dos principais grupos de microrganismos ...................9

Figura 3. Modelo da estrutura secundria do 16S E 18S rRNA..............................14

Figura 4. Diagrama da estratgia de busca e descoberta de produtos microbianos


atravs da clonagem e expresso do DNA extrado diretamente da amostra
ambiental.................................................................................................................17

Figura 5. Descrio esquemtica do processo utilizado na anlise das distncias


filogenticas das seqncias 16S ..........................................................................24

Fig. 6. Mapa do vetor pCC1FOS............................................................................27


Figura. 7. Viso geral da construo de biblioteca de fosmdeo utilizando o sistema
CopyControl, e subseqente induo dos clones um alto nmero de cpia
..................................................................................................................................28

Figura 8. Mtodos de extrao de DNA de solo de Mata Atlntica. Tubo esquerdo:


mtodo A; Tubo direito mtodo B .......................................................................32

Figura 9. Eletroforese em gel de agarose 0,8%. Da esquerda para direita:


marcador de Alto Peso Molecular (8-48 kb); DNA extrado pelo mtodo A; DNA
extrado pelo mtodo B ...........................................................................................32

xi

Figura 10. Produto de PCR do 16S rDNA obtidos pelo mtodo B e pelas
purificaes 1 e 2 ....................................................................................................33

Figura 11. Eletroforese em gel de agarose 0,8%, mostrando DNA total e DNA total
digerido.....................................................................................................................34

Figura 12. Eletroforese em gel de agarose 1,0 %, mostrando extrao de DNA


plasmidial (miniprep) de alguns clones da biblioteca de 16S.rDNA.........................35

Figura 13. Classificao dos filos identificados no domnio Bactria.......................36

Figura 14. Distribuio das classes do filo Gammaproteobacteria..........................37

Figura 15. Distribuio dos gneros encontrados...................................................38

Figura 16. Dendograma mostrando a distribuio e as distncias filogenticas dos


microrganismos, os clones esto identificados como PxxNxx, onde Pxx a
identificao da placa e Nxx o identificador do clone na placa ...............................44

Figura 17. PCR 16S rDNA da placa 04 (PL04). Mostrando o fragmento de


aproximadamente 1500pb........................................................................................45

Figura 18. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da


comunidade bacteriana do solo de Mata Atlntica amplificados com os iniciadores
27F e 1525R, e digeridos com: Enzima de restrio AluI - poro baixa do gel,
digesto com a enzima HhaI poro intermediria e MspI poro inferior. Nas
extremidades ladder de 100 1000pb.....................................................................46
Figura 19. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da
comunidade bacteriana do solo de Mata Atlntica amplificados com os iniciadores
27F e 1525R, e digeridos com: Enzima de restrio AluI - poro baixa do gel,
digesto com a enzima HhaI poro intermediria e MspI poro inferior. Nas
extremidades ladder de 100 1000pb.....................................................................47

xii

Figura 20. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da


comunidade bacteriana do solo de Mata Atlntica amplificados com os iniciadores
27F e 1525R, e digeridos com: Enzima de restrio AluI - poro baixa do gel,
digesto com a enzima HhaI poro intermediria e MspI poro inferior. Nas
extremidades ladder de 100 1000pb......................................................................47

Figura

21.

Dendograma

gerado

pelo

NTSYS,

segundo

dados

obtidos

por

ARDRA...................................................................................................................................50

Figura 22. Dendograma gerado pelo DNAMLK, segundo dados obtidos pelo
sequeciamento..........................................................................................................50

Figura 23. Eletroforese em gel de agarose de 0,8%, mostrando o DNA de alto peso
molecular obtido pela metodologia desenvolvida. M marcador, 1-3 extraes
independentes de DNA de solo de Mata Atlntica ...................................................51

Figura 24. Eletroforese em gel de agarose 1% a 33% por 16h, obtido a partir da
fragmentao do DNA de alto peso molecular para posterior clonagem no vetor
pCC1FOSTM (Epicentre Biotechnologies) ..............................................................52

Figura 25. Eletroforese em gel de agarose 1% a 50V por 12h. Digesto de alguns
clones de fosmdeo com as enzimas de restrio EcoRI e HindIII. Essas enzimas
liberam o clone inteiro (aproximadamente 8kb) e, caso ele tenha algum stio interno
para essas enzimas, outros fragmentos conforme mostrado nas canaletas 2, 3, 13 e
14. A seta vermelha indica a liberao do vetor pCC1FOSTM (Epicentre
Biotechnologies)........................................................................................................52

Figura 26. Resultados de BLAST-X de seqncias de pontas de fosmdeos,


indicando que efetivamente foram clonados fragmentos de DNA metagenmico de
solo de Mata Atlntica...............................................................................................54

xiii

LISTA DE TABELAS

Tabela 1. Nmeros de clulas microbianas associadas a diferentes tipos de solos


....................................................................................................................................7

Tabela 2. Genes funcionais e enzimas derivados de metagenoma recentemente


descobertos, com potencial em aplicaes industrial e farmacutica ......................18

Tabela 3. Composio qumica e fsica do solo de Mata Atlntica ..........................31

xiv

1. INTRODUO

A Mata Atlntica considerada uma das grandes prioridades para a


conservao de biodiversidade em todo o continente americano, contudo sua
cobertura florestal atual encontra-se reduzida a cerca de 7,6% da rea original, que
ocupava uma extenso de aproximadamente 1.306.421 km2. Sendo um dos 25
centros de biodiversidade reconhecidos no mundo, j perdeu mais de 70% de sua
cobertura vegetal original, contudo estes centros de biodiversidade juntos, abrigam
mais de 60% de todas as espcies terrestres do planeta (MYERS et al., 2000). Este
rico complexo bitico de natureza florestal encontra-se distribudo por mais de 17
estados brasileiros. Apesar da devastao acentuada, este Bioma ainda contm uma
parcela significativa da diversidade biolgica do Brasil, com altssimos nveis de
endemismo (MARTINI et al., 2007) A poro do Nordeste brasileiro, entre os rios
Jequitinhonha e Contas, concentra a parcela mais significativa da diversidade deste
Bioma, sendo considerada por alguns ambientalistas como um dos principais centros
de endemismo da Mata Atlntica. Seus remanescentes regulam o fluxo dos
mananciais hdricos, asseguram a fertilidade do solo, controlam o clima, protegem
escarpas e encostas das serras, alm de preservar um patrimnio histrico e cultural
imenso.
Os microrganismos podem existir em uma grande variedade de habitats,
incluindo ambientes quentes, abissais, bastante frios e reas quimicamente
contaminadas (WHITMAN et al., 1998).
O solo por ser um ambiente muito complexo, considerado o principal
reservatrio da diversidade microbiana (BERTRAND et al., 2005). Cerca de um
grama de solo deve conter cerca de 10 bilhes de microrganismos individuais,
representando milhares de espcies (ROSSEL-MORA; AMANN, 2001). A maior
parte da diversidade bacteriana na natureza desconhecida. Estima-se que menos

de 10% dos microrganismos existentes no planeta tenham sido caracterizados e


descritos (STALEY, 1998). Estimativas atuais mostram que o nmero de espcies de
procariotos incultivveis em um grama de solo muito mais significativo que o
nmero de espcies de procariotos cultivveis (TORSVIK et al., 2002), e estes
microrganismos incultivveis, eram at pouco tempo atrs inacessveis aos
pesquisadores.
Em meados de 1980, a anlise direta de seqncias de gene rRNA mostrou
que a maioria dos microrganismos no-cultivveis presentes em um ambiente no
so capturados por mtodos tradicionais de cultivo (HANDELSMAN, 2004). J em
1990, com o advento das tcnicas de biologia molecular, mais especificamente da
PCR (Reao em Cadeia da Polimerase), tornou-se possvel o estudo de organismos
procariotos de um determinado ambiente que ainda no so possveis de serem
cultivados e, o nmero de espcies descrito na literatura vem crescendo nos ltimos
anos.
Esta nova metodologia baseada na anlise direta do DNA da amostra
ambiental, no s fornece informaes em nvel de filogenia da comunidade
microbiana, como oferece a oportunidade de capturar operons ou genes que
participam de ciclos que podem dirigir a sntese de molculas complexas, como
antibiticos, e genes responsveis pelas mais diversas funes, como por exemplo,
genes envolvidos em novas vias metablicas, enzimas, genes com atividades
antimicrobianas, dentre outros (ESCALANTE-LOZADA et al., 2006).
Diante desta situao, este trabalho objetivou clonar DNA diretamente de
amostra ambiental, para fazer um estudo inicial da biodiversidade bacteriana presente
em um solo da Mata Atlntica, atravs da construo de bibliotecas de rDNA 16S,
assim como tambm, com DNA de alto peso molecular, identificar novos
genes/enzimas, envolvidos na rota de produo de antibiticos e outros compostos,
oriundos de microrganismos que habitam este solo, atravs da construo de
bibliotecas genmicas utilizando vetores fosmdeos.

2. REVISO BIBLIOGRFICA

2.1 Mata Atlntica


Na poca do descobrimento do Brasil, a Mata Atlntica brasileira ocupava
praticamente toda a costa brasileira, formando um manto de cobertura florestal desde
o Rio Grande do Sul at o Rio Grande do Norte, distribudo por mais de 17 estados
brasileiros, com amplas extenses para o interior do pas, cobrindo cerca de 1,3
milho de quilmetros quadrados. Considerada um dos 25 centros de biodiversidade
reconhecidos no mundo. Sendo estes centros, reas que perderam pelo menos 70%
de sua cobertura vegetal original, mas que, juntas, abrigam mais de 60% de todas as
espcies terrestres do planeta (MYERS et al., 2000), considerado o bioma mais rico
em biodiversidade do planeta e declarada pela UNESCO como Reserva da Biosfera,
um verdadeiro Patrimnio da Humanidade. O valor da biodiversidade da Mata
Atlntica incalculvel pelo potencial que esse manancial possui para o benefcio do
homem, do meio ambiente e do uso sustentvel da agricultura e pecuria nas regies
tropicais.
Atualmente restam apenas cerca de 7% da cobertura original da floresta, tendo
sido inclusive identificada como a quinta rea mais ameaada e rica em espcies
endmicas do mundo (GALINDO-LEAL; CMARA, 2005), e considerada a mais velha
floresta do planeta (www.cepf.net/xp/cepf/static/pdfs/Final.AtlanticForest.EP.pdf). A
poro do Nordeste brasileiro que concentra a parcela mais significativa deste Bioma
encontra-se entre os rios Jequitinhonha e Contas, sendo esta regio considerada por
alguns ambientalistas como um dos principais centros de endemismo da Mata
Atlntica, bastante rica em biodiversidade, sendo uma das mais importantes para a
conservao da biodiversidade global. Alm das inmeras espcies de plantas, a

Mata Atlntica abriga diversas espcies de microrganismos, animais, peixes, insetos,


aracndeos e crustceos, dentre outros, de significativa importncia para o
ecossistema, para a cincia e para a vida humana.
As bactrias e archaeas representam dois teros da vida no planeta e, no
entanto, menos de 1% das espcies so conhecidas. Grande parte desta diversidade
est nas comunidades microbianas do solo que at pouco tempo atrs eram
inacessveis aos pesquisadores.
Conservados adequadamente e explorados de maneira sustentvel, esses
recursos

biolgicos

podero

servir

como

fonte

inesgotvel

de

alimentos,

medicamentos, fitoterpicos, celulose, polmeros diversos, enzimas, genes e produtos


gnicos.
Atravs das ferramentas modernas da biotecnologia, essa biodiversidade pode
ser explorada e utilizada no isolamento e caracterizao bioqumica de novos
compostos com propriedades fsicas, qumicas e, ou biolgicas, de interesse
econmico, como na produo de antibiticos, bioinseticidas, enzimas, cidos graxos
termoestveis e produtos biotecnolgicos diversos.

2.2 Os microrganismos e o solo


A biosfera dominada por microrganismos (WHITMAN et al., 1998; RONDON
et al., 2000), muitos deles ainda no estudados (RONDON et al., 2000). A diversidade
de microrganismos to vasta quanto desconhecida. Os microrganismos vm
evoluindo a aproximadamente 4 bilhes de anos, e at 2 bilhes de anos atrs eram
a nica forma de vida na Terra (WARD, 1998b). A diversidade bacteriana
inigualvel dentro do mundo biolgico.
Os estudos com microrganismos tiveram incio em 1673, com Van
Leeuwenhoek, contudo s ganharam impulso em 1857, com os estudos de Louis
Pasteur em 1870. Suas descobertas forneceram ferramentas para o desenvolvimento
da taxonomia e gentica bacterianas (KELLER; ZENGLER, 2004). Avanos
significativos, no entanto, podem ser notados a partir da segunda metade do sculo
XIX (TORTORA et al., 2000).
O solo um ambiente muito complexo, considerado o principal reservatrio da
diversidade microbiana (BERTRAND et al., 2005). O solo um ambiente
heterogneo, composto por fases slida, lquida e gasosa (SMILES, 1988). A fase

slida formada por substncias inorgnicas (areia, silte e argila) e materiais


orgnicos (cidos hmicos, ligninas, hemicelulose, celulose, amido, pectina, lignina,
lipdeos, etc.). A fase lquida compreende a poro do solo, onde se encontram em
suspenso elementos qumicos e molculas solveis. A fase gasosa, representada
pelos gases que circulam entre as partculas do solo, originria de processos
bioqumicos, como a respirao.
Um grama de solo pode conter 10 bilhes de microrganismos, representando
milhares de espcies (ROSSEL-MORA; AMANN, 2001). Segundo CURTIS et al.
(2002), a maior parte da diversidade de bactrias na natureza desconhecida, mas
atravs de comparao, os oceanos foram estimados em apresentar at 2 milhes de
espcies, considerando que uma tonelada de solo deve conter 4 milhes de espcies.
Estimativas atuais de espcies de procariotos incultivveis em um grama de solo
variam de cem a quase nove ordens de magnitude maior que estimativas baseadas
em procariotos cultivveis (TORSVIK et al., 2002). Com base nesta estimativa,
DYKHUYZEN (1998) especulou que devem existir 10 bilhes de espcies de
bactrias na Terra. Representando esta, uma proporo significativa de toda a
diversidade evolutiva (WOESE, 1987; WOESE et al., 1990).
Os solos executam uma gama de funes que, direta ou indiretamente,
sustentam a populao humana do mundo. Eles possuem uma importncia vital na
produo de alimentos e como reservatrios de gua. No aspecto global os solos
atuam, por exemplo, estocando grande parte do carbono do planeta (duas vezes mais
o que existe na atmosfera), tamponando e filtrando grande parte dos poluentes e
tambm como os principais mediadores dos ciclos biogeoqumicos (ODONNELL;
GRRES, 1999).
As partculas do solo so organizadas estruturalmente de forma que produz um
habitat espacialmente heterogneo para os microrganismos caracterizados por
diferentes substratos, nutrientes, concentrao de oxignio, contedo de gua e
valores de pH (LADD et al., 1996). O solo se distingue de outras formaes
geolgicas justamente por apresentar sua atividade biolgica, principalmente devido
diversidade de microrganismos que nele existem (VARGAS; HUNGRIA, 1997). Os
microrganismos constituem uma interface biolgica com os ambientes fsicos e
qumicos da Terra, seja atuando diretamente em processos como a mineralizao da
matria orgnica ou indiretamente, atravs de simbioses como na fixao de
nitrognio (ODONNELL; GRRES, 1999).
5

A composio de comunidade microbiana tem demonstrado variar conforme o


uso do solo (BORNEMAN; TRIPLETT, 1997; NUSSLEIN; TIEDJE, 1999), espcies de
planta (MARSCHNER et al., 2001; KUSKE et al., 2002), prtica de crescimento
agrcola (MCCAIG et al., 1999; BUCKLEY; SCHMIDT, 2001), temperatura (WARD et
al., 1998), quantidade de nutrientes (BROUGHTON; GROSS, 2000), salinidade
(NUBEL et al., 2000), contaminao com poluente (MULLER et al., 2001), predao
(JURGENS; MATZ, 2002) e outras variveis ambientais (Tabela 1).
A reduo da diversidade microbiana no solo pode ser um importante indicador
da perda de equilbrio e, por conseqncia, da qualidade do solo. A abundncia de
algumas espcies de microrganismos parece no ser to importante quanto a
manuteno da diversidade, uma vez que a abundncia reflete de forma mais
imediata a flutuao microbiana de curto prazo e a diversidade revela o equilbrio
entre os diversos organismos e os domnios funcionais no solo (KENNEDY, 1999;
LAVELLE, 2000).
Novas atividades microbianas no solo tm sido descobertas gerando novos
conceitos nos ciclos do carbono, nitrognio, ferro, mangans e permitindo especular a
existncia de novos ciclos biogeoqumicos como o ciclo do fosfato, por exemplo
(KELLER; ZENGLER, 2004).

Tabela 1 - Nmeros de clulas microbianas associadas a diferentes tipos de solos

Nmero de clulas microbianas por cm em diferentes ambientes. Os dados apresentados so


extrapolaes de resultados obtidos por microscopia de fluorescncia (adaptado de TORSVIK, 2002)

2.3 Organismos vivos e sua diversidade


O sistema de classificao tradicional conhecido como taxonomia Lineana,
que inclui conceitos como a estruturao em nveis e a nomenclatura binomial. Ela
baseada em dados morfolgicos e fisiolgicos, e todas as formas de vida na Terra
podem ser classificadas em 5 reinos: Animalia, Plantae, Fungi, Protista e Monera (
Figura 1). Sendo a vida tambm dividida em dois tipos fundamentais: aqueles que
possuem uma membrana nuclear (eucariotos) e aqueles que no a possuem
(procariotos), de modo que a maior diversidade da vida na terra era devida aos
Eucariotos.
WOESE et al. (1990) propuseram que a classificao dos seres vivos fosse
substituda por um esquema baseado em trs reinos ou domnios (Bacteria, Archaea
e Eukarya) (Figura 2), sendo os dois primeiros exclusivamente microbianos e
compostos por clulas procariticas. O terceiro domnio (Eukarya) engloba todos os
organismos eucariotos, incluindo os fungos, as microalgas e os protozorios. Para
esta classificao WOESE et al. (1990) utilizaram as comparaes de seqncias de
16S e 18S rRNA propondo assim uma nova classificao universal para a grande
diversidade de vida na Terra. Os procariotos eram considerados simples, primitivos e
relativamente uniformes em suas caractersticas (HUGENHOLTZ; PACE, 1996). Pela
primeira vez uma proposta completa de classificao foi feita baseada em dados
moleculares e no morfolgicos.
A partir de ento muitos pesquisadores vm descobrindo que o domnino
Bacteria possui muito mais filos do que Woese descreveu, em sua proposta inicial
(WOESE, 1987) e muitos representantes destes filos, sendo incultivveis (DELONG;
PACE, 2001). Contudo, mais recentemente, RAPP; GIOVANNONI (2003), tambm
utilizando seqncias 16S rDNA amplificados de DNA total de diversos ambientes,
aumentaram esse nmero para 52 filos.
Estima-se que menos de 10% dos microrganismos existentes no planeta
tenham sido caracterizados e descritos (STALEY, 1998). Embora sejam menos
estudados, muitos grupos de microrganismos so essenciais para a sobrevivncia
das formas de vida na Terra (HAMOND, 1995). O nmero de espcies microbianas
cresce a cada ano, sendo descritos mais de 47.000 fungos, 30.000 protozorios,
26.000 algas, 5.000 bactrias e 1.000 vrus (WILSON, 1998; ROSSELL-MORA;

AMMAN, 2001) . As bactrias e arqueas representam dois teros da vida no planeta


e, no entanto, menos de 1% das espcies so conhecidas. Grande parte desta
diversidade est nas comunidades microbianas do solo que at pouco tempo atrs
eram inacessveis aos pesquisadores.

Figura 1- Diviso dos 5 reinos seguindo a taxonomia Lineana (Whittaker, 1969)

Figura 2 - Representao filogentica da diversidade de organismos vivos, evidenciando a


abrangncia dos principais grupos de microrganismos.

Os microrganismos podem existir em uma grande variedade de habitats,


incluindo ambientes quentes, abissais, bastante frios e reas quimicamente
contaminadas (WHITMAN et al., 1998).
A diversidade microbiana um componente crucial para o funcionamento dos
ecossistemas naturais porque existe a necessidade da manuteno de processos
ecolgicos como a decomposio da matria orgnica, alterando a disponibilidade de
nutrientes para as plantas, controle de patgenos, alm de influenciar as
propriedades fsicas do solo, como a estabilidade dos agregados (KENNEDY, 1999).
Em virtude de sua longa histria evolutiva e da necessidade de adaptao aos
ambientes mais distintos, os microrganismos acumularam uma impressionante
diversidade gentica, que excede, em muito, a diversidade dos organismos
eucariotos (HUGENHOLTZ et al., 1998a).
Os microrganismos que vivem no solo e em plantas promovem transformaes
que exercem efeitos diretos e indiretos na produtividade e na qualidade dos produtos
agrcolas. O conhecimento desses processos e seus efeitos so essenciais para o
manejo apropriado do meio ambiente, como fonte para o crescimento e para o uso
racional dos recursos naturais.

2.4 A diversidade microbiana e os mtodos moleculares aplicados na sua


deteco.

Em termos moleculares, a diversidade caracterizada pelo nmero de


diferentes tipos de seqncias de DNA encontradas no ambiente (LIESACK et al.,
1997).
Estudos filogenticos baseados em seqncias do 16S rDNA mostram, por
exemplo, que a distncia filogentica entre dois grupos de bactrias haloflicas e
espiroquetas 2,5 vezes maior que a distncia entre os animais e as plantas, que
so classificados em reinos diferentes (WOESE et al., 1990; HUGENHOLTZ et al.,
1998b7y). Sendo assim, os microrganismos representam o repertrio mais rico em
diversidade qumica e molecular na natureza, constituindo a base de processos
ecolgicos, alm de manterem relaes vitais entre si e com os organismos
superiores (HUNTER-CEVERA, 1998).

Em funo do paradigma cientfico que exigia que os organismos fossem


estudados in vitro (LAVELLE, 2000; BULL et al., 2000) at h pouco tempo, a
deteco e identificao de microrganismos em amostras ambientais eram realizadas
atravs de seu isolamento em meios de cultura (TORSVIK; OVREAS, 2002). Esta
tcnica identificava poucos indivduos porque o meio de cultura , em maior ou menor
grau, seletivo para um ou outro grupo de microrganismo. Por outro lado, as contagens
de clulas por microscopia refletem apenas uma avaliao quantitativa da populao
microbiana, sendo pouco informativas sobre a diversidade dos organismos em uma
amostra (ZAK et al., 1994; ROSADO, 2000).
Em 1980, Torsvik publicou o primeiro protocolo de extrao de DNA de
amostra de solo. Resultados de estudos moleculares de solos, ambientes marinhos e
comunidades de ambientes extremos, tm demonstrado que populaes de
microrganismos isoladas em cultivo a partir de amostras destes habitats no
representam necessariamente os organismos dominantes nos ambientes naturais
(HUNGENHOLTZ et al., 1998a). Uma das razes para esta discrepncia o fato de
que os mtodos de cultivo tradicionalmente utilizados em laboratrio, no
representam as condies encontradas em ambientes naturais e tendem a selecionar
microrganismos de crescimento rpido, adaptados ao meio de cultivo utilizado.
A maioria dos microrganismos em amostras ambientais no pode ser
detectada atravs da microscopia convencional, pois eles aderem s partculas de
solo tornando-se invisveis. Atualmente os especialistas reconhecem que apenas
uma pequena frao dos microrganismos que ocorre na natureza foi at agora
isolada e caracterizada (TORVISK et al., 1990). At o presente momento dependendo
do hbitat estudado, menos de 0,1% e no mximo 10% das espcies microbianas
tm sido estudadas (ROSSELMORA; AMMAN, 2001). Uma provvel explicao
que at pouco tempo atrs, os microrganismos tinham que ser cultivados para serem
estudados (PACE, 1985) e, alm disso, o seu tamanho microscpico e a freqncia
de ocorrncia das populaes, a sazonalidade, e em muitos casos, a dependncia de
hospedeiros e/ou substratos especficos para sua sobrevivncia e multiplicao eram
tambm limitaes importantes (TORSVIK; OVREAS, 2002).
Associado a descoberta de que a maioria dos microrganismos presentes no
ambiente no so capturados por mtodos tradicionais de cultivo (HANDELSMAN,
2004), melhorias nos mtodos de isolamento e sequenciamento de DNA ambiental,
conduziram a um crescimento no estudo da gentica de populaes microbiana, e ao
10

surgimento do termo metagenmica (HANDELSMAN et al., 1998). O qual se refere a


anlise direta de amostra ambiental, sem cultivo prvio.
A revoluo genmica, em 1990, tinha como alvo estudo de genomas
individuais de microrganismos, plantas e animais. Enquanto que atualmente, realizase a anlise de misturas complexas de microrganismos, incluindo a compreenso da
extenso e do papel da diversidade microbiana, sendo o contedo de taxonomia de
uma determinada amostra normalmente calculado atravs da comparao com
bancos de dados que apresentam sequncias conhecidas (HUSON et al., 2007).
Com o advento das tcnicas de reao em cadeia da polimerase (PCR) (SAIKI
et al., 1988) e seqenciamento de DNA (SANGER et al., 1977), os mtodos
moleculares, especialmente aqueles baseados no estudo da seqncia do 16S rDNA,
tm sido muito teis na descoberta de novos microrganismos. Tornou-se possvel o
estudo de organismos procariotos de um determinado ambiente que ainda no so
possveis de serem cultivados, e que representam mais do que 99% dos organismos
em alguns ambientes (AMANN et al., 1995). Esse acesso edificou-se em avanos
recentes da genmica microbiana, na reao em cadeia da polimerase (PCR), e na
clonagem de genes conservados, como 16S rRNA, nif, recA, diretamente a partir de
amostras ambientais (PACE et al., 1985).
Para obteno da anlise estrutural e da diversidade microbiana, o
fingerprinting desta comunidade baseado no mtodo de extrao de cidos
nuclicos diretamente de amostras ambientais, seguido de amplificao por PCR dos
genes 16S rDNA, em bactrias, e 18S rDNA, para fungos (GOMES, 2003;
DUINEVELD et al., 1998; LIU et al., 1997; LEE et al., 1996; MUYZER et al., 1993) e
posteriormente caracterizado atravs da clonagem e seqenciamento ou ento
analisado por eletroforese, por meio das tcnicas de Anlise de Restrio de DNA
Ribossomal Amplificado (ARDRA), Polimorfismo do Tamanho do Fragmento de
Restrio Terminal (T-RFLP), RAPD (Amplificao Aleatria de DNA Polimrfico),
Anlise do Espao Ribossomal Intergnico (RISA), Eletroforese em Gel com
Gradiente Desnaturante (DGGE), Eletroforese em Gel de Gradiente de Temperatura
(TGGE) e Polimorfismo Conformacional de Fita Simples (SSCP) (RANJARD et al.,
2000; KOZDRJ; ELSAS, 2001).

11

2.5 Marcadores Moleculares no estudo da diversidade


Atualmente, anlises comparativas da estrutura primria dos genes de rRNA
transformaram a taxonomia microbiana de um simples sistema de identificao para
um sistema estruturado de sistemtica, baseado na histria evolutiva dos organismos
(OLSEN et al., 1994). Estudos da evoluo e ecologia dos microrganismos so
centralizados nas seqncias de genes rRNAs.
Os primeiros autores a sugerirem o uso do gene 16S rDNA como um marcador
molecular para o estudo de populaes microbianas em amostras ambientais,
independente do seu cultivo foram PACE et al. (1986).
A anlise de restrio do DNA ribossomal amplificado (ARDRA) tem sido muito
utilizada para estudar as comunidades microbianas em diferentes tipos de solo e
tambm quando se deseja acessar de maneira rpida alteraes genotpicas atravs
do tempo ou entre locais diferentes, refletindo diferentes condies ambientais. O
mtodo se baseia no princpio de que os stios de restries, existentes no operon de
rRNA, so relativamente conservados e refletem padres filogenticos avaliando,
diferenas entre grupos filogenticos dominantes presentes na comunidade, assim
so feitas investigaes de parte da seqncia do DNA, notadamente o gene 16S
rDNA, em bactrias, e 18S rDNA, para fungos, que amplificado por PCR e
posteriormente caracterizado atravs de anlise de subseqentes digestes com
enzimas de restrio, obtendo-se assim, um perfil da comunidade microbiana
(NSSLEIN; TIEDJE, 1999; PETERS et al., 2000).
Os RNAs ribossmicos e outros genes centrais envolvidos na transferncia de
informaes, aparentemente no sofreram uma extensa transferncia lateral,
produzindo a mais coerente base para entender e inter-relacionar os principais ramos
evolutivos da rvore da vida (OCHMAN et al., 2000).
A escolha do 16S rDNA decorreu do fato dele apresentar todas as
caractersticas necessrias a um marcador molecular ideal: possui uma distribuio
universal, estrutura e funo conservadas entre os taxa e um tamanho suficiente que
permita o aparecimento de divergncias na seqncia. Alm disso, sua estrutura
primria possui uma alternncia entre regies mais e menos conservadas permitindo
a investigao de um amplo espectro de distncias filogenticas (LUDWIG;
SCHLEIFER, 1994).

12

O gene 16S rRNA uma das molculas que compe, juntamente com outras
21 protenas, a subunidade menor do ribossomo nos domnios Bactria e Archaea. O
16S rRNA possui tambm 9 regies variveis, alternadas com regies conservadas,
denominadas de V1 a V9 (Figura 3). Estas regies podem, juntamente com as
regies das hlices, serem utilizadas para determinao de filogenia (WOESE et al.,
1983; DAMS et al.,1988). Pesquisas demonstraram que os stios nucleotdicos mais
variveis possuem uma taxa de substituio at sete mil vezes maior do que aqueles
com a menor taxa de substituio e tambm que existem bases em certas posies
que so absolutamente conservadas entre diferentes filos bacterianos (VAN DER
PEER et al.,1996).

Figura 3. Modelo da estrutura secundria do 16S e 18S rRNA:


As hlices so numeradas de acordo com a ocorrncia a partir da extremidade 5 (seta preta).
- Hlices caracterizadas apenas por nmeros so caractersticas de procariotos e eucariotos.
- Hlices cujo nmero precedido por P so exclusivas de procariotos.
- Hlices que apresentam nmeros hifenados representam bifurcaes de uma hlice principal. - As
linhas mais escuras representam regies mais conservadas e as linhas mais finas representam regies
variveis (V1 a V9).
- A seqncia do 16S rRNA domnio Archaea segue o mesmo padro geral de Bacteria com exceo
da hlice 35 que no ramificada.
- Procariotos no possuem V4.
- Hlices em linha pontilhada so consideradas raras. (Modelo reproduzido a partir de DAMS et al.,
1988).

13

2.6 A metagenmica e a biotecnologia


O dilema da incapacidade para cultivar a vasta maioria dos microrganismos
presentes na maioria dos nichos microbianos (AMANN, et al., 1995) forou cientistas
a desenvolverem mtodos para explorar os genomas destas bactrias por
biotecnologia sem cultivo prvio (WOLFGANG, et al., 2004). As novas tcnicas
evidenciaram a enorme diversidade gentica de bactrias presentes em apenas 1
(um) grama de solo. Este novo e excitante campo da pesquisa coletivamente
denominado Metagenmica e a chave da tecnologia tem sido resumida na publicao
de SCHMIDT et al.(1991).
Enquanto as amplificaes por PCR requerem um conhecimento prvio da
seqncia do gene para o desenho dos primers para a amplificao, a extrao direta
e clonagem de DNA podem teoricamente acessar genes com qualquer seqncia ou
funo. A clonagem direta oferece a oportunidade de capturar operons ou genes que
participam de ciclos que podem dirigir a sntese de molculas complexas, como
antibiticos.
Esta nova metodologia no s fornece informaes em nvel de filogenia da
comunidade microbiana, que importante para o seu entendimento ecolgico, mas
tambm possibilita o isolamento de novos genes responsveis pelas mais diversas
funes, como por exemplo, genes envolvidos em novas vias metablicas, enzimas,
genes com atividades antimicrobianas, elementos de regulao gnica, genes
responsveis por patogenicidade e resistncia a antibiticos provenientes em sua
maioria de microrganismos no cultivveis (ESCALANTE-LOZADA et al., 2006).
A importncia da metagenmica para a biotecnologia torna-se bvia se
considerar que em 1 g de solo pode conter mais de 10.000 diferentes espcies
(TORSVIK et al., 2002). Todavia, 98,0 99,0% dos microrganismos presentes neste
nicho microbiano no podem ser cultivados com tecnologias disponveis atualmente
(ELLIS et al., 2003). Recentemente esto listadas no National Center for
Biotechnology Information (NCBI) 152 sequenciamentos completos de genomas de
procariotos (WOLFGAN, 2004). Se um gene coberto consiste de 103 pbs, 1 g de solo
deve conter mais de 6,1 x 1010 pbs, representando cerca de 6,1 x 107 genes. Este
nmero excede, por no mnimo, duas ordens de magnitude o nmero total de genes
seqenciados de genomas bacterianos cerca de 10 anos atrs. Tal clculo simples

14

pode fornecer uma impresso do nmero total de genes que resta para ser
descoberto pela metagenmica.
Duas metodologias tm sido utilizadas para obter informaes a partir de
bibliotecas metagenmicas: uma baseada na funo induzida, na qual bibliotecas
metagenmicas so inicialmente classificadas avaliando-se uma caracterstica
fornecida, e uma outra baseada na seqncia induzida, na qual bibliotecas so
classificadas por uma seqncia particular de DNA.
Nas ltimas dcadas crescente o nmero de bactrias patognicas tanto
para humanos como para outros animais que apresentam multi-resistncia a drogas
sendo que, em alguns casos, foi constatada a existncia de bactrias resistentes a
todas as drogas antimicrobianas hoje disponveis para o tratamento. Dentro deste
grupo

de

bactrias

multi-resistentes

pode-se

citar

Staphylococcus

aureus,

Enterococcus sp, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterobacter


cloacae, Mycobacterium tuberculosis, Salmonella entrica, Shigella spp. entre outros.
A aplicao da metagenmica nestes casos se faz bastante til, j que tem grande
possibilidade de encontrar novas protenas com potencial antimicrobiano. As
aplicaes da metagenmica so teis nos mais diversos campos da indstria (Figura
4).
H uma evoluo continuada de resistncia aos antibiticos em nveis nacional
e internacional. Alm de tentar limitar a expanso de resistncia, existem consensos
crescentes que a exigncia base o desenvolvimento de novos antibiticos para
ajudar a reparar o dano contra os antibiticos disponveis. (CHRISTOPHER et al.,
2004). Existe, portanto a necessidade urgente da busca de novas drogas
antimicrobianas.
Antibiticos e enzimas esto entre as recentes descobertas da metagenmica
(PATRICK; JO, 2003). Atualmente o refinamento de novos mtodos que enriquecem
o conhecimento de genes acelera a descoberta de molculas teis (UCHIYAMA et al.,
2005).
O isolamento dos antibiticos turbomicina A e B, a partir de biblioteca
metagenmica, construda de DNA oriundo de microrganismos do solo foi
demonstrado por GILLESPIE e colaboradores (2002). Os resultados demonstraram o
sucesso da expresso heterloga de DNA extrado diretamente a partir do solo, como
um meio de acessar previamente pequenos compostos orgnicos no caracterizados,

15

servindo como exemplo de um caminho para a gerao/identificao de novas


estruturas qumicas.
Os microrganismos de solo tm sido uma grande fonte de produtos naturais,
estabelecendo industrialmente, antibiticos importantes bem como esto sendo
utilizados como substncias biocatalticas (ROLF, 2004).
Em recentes estudos, muitas procuras em metagenmica focalizaram
principalmente no isolamento de um grupo bastante pequeno de genes que codificam
para biocatalizadores e enzimas envolvidas na produo de antibiticos e de
vitaminas. As lipases e esterases esto entre o grupo amplamente usado de
biocatalizadores qumicos orgnicos, e no requerem co-fatores (JAEGER; EGGERT,
2002). Ento, vrios estudos tm focalizado no isolamento desta classe de
hidrolases. Similarmente, enzimas com polissacardeos modificados so de interesse
considervel indstria de alimento, por exemplo, a, 1,4-amilases e a glucoamilases
(Tabela 2).
As oxidoredutases representam outro exemplo de biocatalizadores sendo
excelentes enantimeros. Eles so usados para a sntese de compostos carbonil,
hidroxicidos, aminocidos e lcoois quirais que so frequentemente difceis de
preparar quimicamente (DAVIS, BOYER, 2001). Em particular, na produo da lcool
redutase NAD(P)-dependente, na produo de hidroxiacetona e como ferramentas
para anlise enzimtica de lipdeo srico (HUMMEL, 1999).

Figura 4. Diagrama da estratgia de busca e descoberta de produtos microbianos atravs da clonagem


e expresso do DNA extrado diretamente da amostra ambiental (metagenoma) (adaptado de
BRUGGEMAN, 1998).

16

Tabela 2. Genes funcionais e enzimas derivados de metagenoma recentemente descobertos, com


potencial em aplicaes industrial e farmacutica.

Lipases/esterases
Enzimas modificadoras de polissacardeos
-Amilases
Enzimas de ramificao de - 1,4 glicano
-agarases
Quitinases
Celulases
Oxidoredutases/desidrogenases
Oxidoredutases de lcoois
Redutases de di-ceto-d-cido glicnico
Desidrogenases de 4-hidroxibutirato
Outras enzimas
Proteases
Nitilases
Biosnteses de vitaminas
Biosnteses de biotina
Produo em massa de produtos qumicos
Biosnteses de 1,3-Propanodiol
3. METODOLOGIA
Biosnteses de drogas e antibiticos
Turbomicina A,B
Policetdeo sintases
Violacena
N-aciltirosinas de cadeia longa
Indirubina
Terraginas

17

3. METODOLOGIA

3.1 Coleta das amostras de solo da Mata Atlntica


As amostras do solo foram coletadas na Fazenda Caimbi, Ilhus - Bahia,
Brasil e foi classificado como um solo argilo arenoso. Foram coletadas 10, ao longo
das estaes do ano, amostras de solo da camada de superfcie da terra at uma
profundidade de 10 cm, utilizou-se esptulas estreis. As amostras foram transferidas
para vasos de vidro tambm estries. A ltima coleta do solo foi realizada em pontos
traados em um raio de 3 metros, aproximadamente. Porm, estes pontos foram bem
distantes em relao s amostras coletadas anteriormente, durante um ano de coleta.
As coordenadas geogrficas das amostras foram determinadas com um
aparelho GPS, sendo a mdia dos dados: Latitude (S) 14 48', Longitude (O) 39 03',
altitude 20 metros. Esta regio apresenta mdia histrica de precipitao
pluviomtrica de 1988 mm/ano, temperatura mdia de 23,4 +/-1,5C, umidade relativa
mdia 85,4 +/- 4,0%.
A anlise fsico-qumica das amostras de solo coletadas foi executada no
Laboratrio de Solos e Nutrio de plantas da EMBRAPA/CNMF, Cruz das Almas,
Bahia.

3.2 Mtodos de extrao ex situ de DNA

Mtodo A para extrao ex situ de DNA de solo de Mata Atlntica (Maciel, BM, 2004)
Em Erlenmeyer de 250 mL, adicionou-se 4 g de solo a 50 mL de tampo
fosfato de sdio (NaH2 PO4 .H2O + Na2HPO4 .7 H2O) pH 7,4 + Tween 80 a 0,1%, por
180 r.p.m em mesa agitadora por toda a noite. Distribuiu-se o sobrenadante em tubos
de centrfuga com fundos cnicos. Centrifugou-se a 5000 r.p.m. (rotaes por minuto)
18

por 10 minutos e descartou-se o sobrenadante. Fez-se quatro lavagens em Tampo


TE 50/50 mM (Tris-HCl + EDTA), pH 8,1, seguindo de centrifugao de trs minutos a
5000 r.p.m para cada lavagem, tendo sido descartado o sobrenadante. A lise das
clulas foi feita por macerao do precipitado aps congelamento com nitrognio
lquido. Ressuspendeu-se o macerado em 1 mL de TE 50/50 e adicionou-se 1 mL de
fenol/clorofrmio/ lcool isoamlico (25:24:1, pH 7,3). Coletou-se a fase superior e
precipitou-se com isopropanol absoluto e acetato de sdio 3 M. Lavou-se duas vezes
o precipitado em lcool 70%. Ressuspendeu-se em 100 L de gua ultra pura estril.
Purificou-se em coluna de Sephadex G-200 (Amersham).

Mtodo B para extrao ex situ de DNA de solo de Mata Atlntica (mtodo utilizando
glass beads)

Em Erlenmeyer de 250 mL, adicionou-se 4g de solo em 50 mL de tampo


fosfato de sdio + Tween 80 a 0,1% em mesa agitadora por toda a noite. Distribuiu-se
o sobrenadante em tubos de centrfuga com fundos cnicos. Centrifugou-se a 5000
r.p.m. por 10 minutos e descartou-se o sobrenadante. Adicionou-se glass beads
(prolas de vidro) ao precipitado para aumentar o nmero de clulas disponveis na
fase de lise e assim, aumentar o rendimento de DNA recuperado. Lavou-se quatro
vezes em tampo PBS (Phosphate Buffer Solution) 1X, pH 7,4, com centrifugao de
3 minutos a 5000 r.p.m. cada lavagem. Lavou-se em tampo TE 50/50 mM (Tris-HCl
+ EDTA), pH 8,1 por quatro vezes, tambm com centrifugao de trs minutos a 5000
r.p.m cada lavagem, descartou-se o sobrenadante e ressuspendeu-se o pellet em 3
mL desse tampo. Incubou-se a temperatura ambiente por 20 minutos. Adicionou-se
200 L de SDS a 20%. A lise das clulas foi feita por choque trmico do pellet
alternando nitrognio lquido (1 min) e gua em fervura (4 min) em 3 ciclos.
Adicionou-se fenol/clorofrmio/ lcool isoamlico (25:24:1, pH 7,3) na proporo de
1:1 v/v. Coletou-se a fase superior e precipitou-se com isopropanol absoluto e acetato
de sdio 3 M. Lavou-se o precipitado por duas vezes em lcool 70%. Ressuspendeuse em 100 L de gua ultra-pura (estril). Purificou-se em coluna de Sephadex G200. Purificou-se por 1, 2 e 3 vezes passando na coluna de Sefhadex G-200.

19

3.3

3.3.1

Clonagem do DNA para estudo da biodiversidade do solo em estudo.

Amplificao do gene 16S rDNA

Para estudo da biodiversidade bacteriana presente neste solo, o gene 16S


rDNA foi amplificado por PCR (Reao em cadeia da ploimerase) utilizando o
conjunto de iniciadores 27F/1525R para o domnio Bactria. Permitindo a
amplificao de um fragmento de DNA de aproximadamente 1500 pares de bases.
A PCR foi realizada em termociclador MJC Research PTC200 (Eppendorf). Na
reao foram utilizadas as seguintes condies de tempo e temperatura: 1 ciclo 94C
por 5 minutos; 34 ciclos de 94C por 1 minuto, 59C por 1 minuto e 72C por 2
minutos, finalizando com 1 ciclo de 72C por 10 min utos.
A PCR foi amplificada contendo as seguintes propores de reagentes: 2,5 L
de tampo 10X da reao para a Taq DNA polimerase (100 mM Tris-HCl, pH 8,8 a
25C, 500 mM KCl, 0,8%) concentrao final de 1X; 3 ,7 mM de cloreto de magnsio,
0,4 pmol/L de deoxinucleotdeos (dATP, dTTP, dCTP e dGTP), 0,4 pmol/L de cada
iniciador, 0,4 mM de BSA (Albumina Soro Bovina), 3 unidades de enzima Taq DNA
polimerase (Fermentas),e gua ultra pura estril para um volume de final de 25 L.
Como molde para a reao foram utilizadas alquotas de 150 ng do DNA total das
amostras de solo diludas na proporo 1:1000.

3.3.2 Ligao do 16S rDNA ao vetor

A ligao dos produtos de PCR dos genes 16S rDNA amplificados das
amostras de solo com o vetor pTZ57R/T foi realizada utilizando-se o kit comercial
InsTAclone PCR Cloning Kit (Fermentas), e seguindo as informaes do fabricante,
sendo a proporo vetor/inserto e 1:3. A reao de ligao foi incubada de um dia
para o outro a -4C.
3.3.3 Transformao bacteriana

A transformao se deu via eletroporao, onde foram utilizados 20 L das


clulas E. coli DH10 eletro competentes (Invitrogen) e 4 L da reao de ligao. A
amostra foi submetida a um choque eltrico de 2,5 kV/4,9 segundos, no eletroporador
GenePulser II (BioRad). s clulas de E. coli foi adicionado 1 mL de meio SOC e
20

incubadas por 1 hora sob agitao a 37C. Aps este tempo, a amostra foi plaqueada
em meio slido LB contento o antibitico ampicilina na concentrao de 100 g/mL, e
tambm IPTG (Isopropyl -D-1-thiogalactopyranoside) e X-gal (5-bromo-4-cloro-3indolil--Dgalactopiranosideo) como substrato para a enzima -galactosidase nas
concentraes de 200 g/mL e 20 g/mL, respectivamente. Em seguida as placas
foram incubadas na estufa a 37C por 16 horas.

3.3.4 Coleta dos clones transformantes

Os clones transformantes (colnias brancas) foram coletados com o auxlio de


dois catadores e organizados em placas de Petri contendo meio slido LB e
ampicilina a 100 g.mL-1. As placas foram inoculadas a 37C em estufa por 14 h, e
depois foram colocadas a 4C. Dois dias depois, as bactrias foram inoculadas em
placas de polietileno de 96 poos preenchidas com 70 L de meio lquido LB
contendo ampicilina a 100 g.mL-1, utilizOu-se mais antibitico para a bactria no
expulsar o plasmdeo e incubadas sob agitao por 14h a 37C. No dia seguinte
foram adicionados 70 L de glicerol estril a 16% s culturas. As placas foram ento
seladas com adesivos estreis e armazenadas em freezer a -80C, at a data de uso.

3.3.5 Extrao do DNA plasmidial dos clones e sequenciamento


A extrao do DNA plasmidial dos clones que continham os insertos de
interesse foi realizada segundo a mesma metodologia utilizada para o Programa
Genoma do Crinipellis perniciosa, assim tambm a reao de sequenciamento no
seqenciador MegaBACE 1000 (Amersham Bioscience), contudo utilizou-se o
iniciador M13F. Foram seqenciadas nove placas contendo 96 clones de cada.

3.4 Anlise de Bioinformtica das seqncias obtidas pelo sequenciamento


3.4.1 Preparo das seqncias para filtrao das seqncias 16S rDNA

Antes de submeter as seqncias para a anlise filogentica foi preciso


remover as regies das seqncias de baixa qualidade. Tambm foram eliminados
clones que no possuem nenhum 16S rDNA, assim como as regies que no fazem

21

parte da sua regio informativa (possveis vetores ou adaptatores) utilizando o BLAST


contra o banco de dados de seqncias ribossomais: Ribossomal Database Project
release 9.43 (RDP) (COLE, 2005).
Para o clculo das distncias filogenticas utilizando alinhamento mltiplo,
todas as seqncias foram editadas (recortadas) para representarem a mesma parte
da regio informativa do 16S rDNA, por exemplo: se uma seqncia vai da posio
20 at a posio 500 do 16S rDNA e uma outra seqncia vai da posio 100 at a
posio 600, ento somente a interseco das duas seqncias ser utilizada.
Recorta-se a primeira seqncia na posio 100 e a segunda at a posio 500. Isso
deve ser feito tanto nos clones seqenciados como nas seqncias do banco de
dados que so utilizados em conjunto.

3.4.2 Diagnstico filogentico

Todos os clones foram analisados utilizando o classificador Bayesiano de


seqncias 16S rDNA de bactrias (http://rdp.cme.msu.edu). Este mtodo trabalha
bem com seqncias parciais, aproximadamente 500 bases em mdia, e tem uma
eficincia maior que 99,2% no diagnstico do filo, 98,4% na classe, 96,6% na ordem,
93,0% na famlia e 87,7% no gnero usando um limiar de 80%. As informaes
geradas por esse classificador foram tratadas com scripts perl para identificao
dessas informaes no estudo de distncias filogenticas. As seqncias com
classificao possvel foram, ento, rotuladas com essas informaes sobre sua
taxonomia hierrquica.
Foi realizado, em seguida, o alinhamento mltiplo global de todas as
seqncias, clones e seqncias similares, editados para estarem na mesma regio
do 16S rDNA, utilizando o CLUSTALW (verso 1.83) (THOMPSON, 1994). A partir do
alinhamento mltiplo a anlise filogentica foi feita com o pacote PHYLIP (verso
3.66) (FELSENSTEIN, 1989) pois os programas so mais adequados para a
abordagem da filogenia da biodiversidade.
Para estimar a filogenia foi utilizado o DNAMLK que baseado no mtodo da
mxima verossimilhana, esse modelo permite diferentes freqncias previstas para
os quatro nucleotdeos (A, T, C ou G), taxas desiguais de transies e transverses,
ou seja, a substituio de uma pirimidina por uma purina tem um peso diferente da
substituio de uma purina por uma outra purina e tambm foi usado o modelo Oculto
22

de Markov de penalidades, com o programa inferindo as penalidades de cada posio


da seqncia.
A consistncia estatstica dos ramos foi avaliada por bootstrap usando
SEQBOOT que produz mltiplos conjuntos de dados (100 rplicas nesse caso
especfico) a partir do alinhamento mltiplo inicial. O DNAMLK capaz de tratar um
arquivo mltiplo gerado pelo SEQBOOT e gerar mltiplos dendogramas que so
avaliados pelo programa CONSENSE que mede a consistncia estatstica de cada
ramo existente, o CONSENSE tambm pode gerar um dendograma consenso.

Figura 5. Descrio esquemtica do processo utilizado na anlise das distncias filogenticas das
seqncias 16S rDNA.

3.5 Anlise Restrio de DNA Ribossomal Amplificado (ARDRA)

Com o intuito de ratificar os dados obtidos via seqenciamento e testar a


eficincia da tcnica de ARDRA, fez-se uma diluio de 1/100 de 96 minipreps de
clones (placa 04). Desta diluio utilizou-se 1 L da diluio para realizar uma PCR
nas mesmas condies do item 3.1, para um volume de final de 50 L.
Aps eletroforese e confirmao da amplificao, fez-se uma coleta aleatria de
48 amostras amplificadas e, utilizando-se 10 L de cada, fez-se trs reaes de
digesto com enzimas de corte freqente (4 pb).
Na reao contendo a enzima de restrio AluI, adicionou-se: 10 L da amostra,
3 L do tampo Tango 10X, 1 unidade da enzima AluI, completou-se o volume para
30L com gua ultra pura.

23

reao contendo a enzima de restrio HhaI adicionou-se: 10 L da amostra,


3L do tampo Tango 10X, 1 unidade da enzima HhaI, completou-se o volume para
30L com gua ultra pura estril.
reao contendo a enzima de restrio MspI, adicionou-se: 10 L da amostra,
3 L do tampo Tango 10X, 1 unidade da enzima MspI, completou-se o volume para
30 L com gua ultra pura.
As reaes foram incubadas em banho maria a 37C por 16h e posteriormente
inativadas a 65C AluI e MspI e a 80C HhaI, todas por 20 minutos.
Foi realizada eletroforese em gel de agarose de 2,0 % a 120V por 1h, corado
com Brometo de Etdio e os fragmentos visualizados em luz UV.

3.5.1 A anlise de filogenia a partir de ARDRA

Critrios utilizados pra anlise de similaridade entre os indivduos

O padro de bandas obtido com ARDRA para cada indivduo foi analisado com
intuito de se obter um coeficiente de similaridade entre os mesmos. Foram
consideradas apenas as bandas mais evidentes que foram mensuradas com auxlio
do software da KODAK o EDAS 900, com o resultado das mensuraes foi possvel
confeccionar uma matriz binria para o padro de bandas dos indivduos, sendo
presena de uma determinada banda assinalada com (1) e ausncia (0). Foram
considerados idnticos os padres de bandas que apresentaram o mesmo nmero de
fragmentos de idnticos pesos moleculares. O agrupamento das amostras, de acordo
com a similaridade nos padres de bandas, foi realizado empregando-se o mtodo de
UPGMA (Unweighted pair-group method with arithmetical averages) e utilizou-se o
coeficiente de Jacar. Este coeficiente de similaridade simples obtido por meio do
programa NTSYS (Numerical taxonomy system of multivariate programs), foi utilizado
para

se

obter

um

dendrograma

partir

dos

dados

de

similaridade.

3.6 Clonagem do DNA para estudo funcional

Aps extrao do DNA pelo mtodo B, acima citado, a construo da biblioteca


se deu utilizando-se fragmentos entre 25 e 40 Kb, uma vez que o vetor utilizado foi o
fosmdeo pCC1FOS (figura 6) e este recebe com estabilidade fragmentos de DNA
24

dessa faixa de tamanho. Para isto, o DNA foi fragmentado por seringa e fez-se
eletroforese em gel de agarose 1% para avaliar se o DNA estava com o tamanho
desejado, aps esta etapa, fez-se o reparo das pontas do DNA utilizando-se a enzima
de

reparo

do

CopyControl

Fosmid

Library

Production

Kit

(Epicentre

Biotechnologies), seguindo recomendaes do fabricante. Aps isto, aplicou-se todo


o DNA (~ 0,5 g) em gel de agarose 1% a 31 V por toda a noite. O DNA do tamanho
de interesse foi excisado do gel e fez-se a solubilizao da agarose com a enzima
gelase tambm do Kit acima citado. Seguindo-se da inativao da enzima por 70C
por 10 minutos. Aps este passo o DNA foi purificado com 10% de acetato de sdio 3
M, pH 7,0 e etanol absoluto 2,5 vezes o volume. Aps a purificao, o DNA foi
precipitado e ressuspenso em 40 L de TE pH 8,0. Fez-se a ligao do DNA ao vetor
fosmdeo (pCC1FOS) (Figura 6). Todos os constituintes da reao, exceto a gua e o
DNA, foram fornecidos no kit acima citado. Incubou-se temperatura ambiente por 2
horas, seguindo da inativao da enzima, em banho-maria a 72C por 10 minutos.
O empacotamento dos clones foi realizado utilizando-se extratos de fagos
lambda e E.coli (EPI300-T1R) fornecidos pelo kit. A princpio, inoculou-se 2 L da
EPI300-T1R em 10 mL de meio lquido LB + 10 mM de MgSO4 , incubou-se em mesa
agitadora a 180 r.p.m. a 37C por toda a noite. Transferiu-se 5 mL desta cultura para
um Erlenmeyer de 250 mL, contendo 50 mL de LB lquido + 10 mM de MgSO4,
incubou-se a 180 r.p.m. em mesa agitadora a 37 C, at obter OD600 = 1,0. Colocouse ento 10 L da reao de ligao em um tubo eppendorf contendo 25 L do
extrato de empacotamento lambda. Incubou-se a 30C por 90 minutos, em seguida
adicionou-se mais 25 L do extrato de empacotamento, e foi feita incubao por mais
90 minutos a 30C. Aps a segunda incubao por 90 minutos, adicionou-se Phage
Diluition Buffer completando o volume para 1 mL. A este adicionou-se 25 L de
clorofrmio. Misturou-se e estocou-se na geladeira. Para posterior infeco das
clulas.

25

Figura 6. Mapa do vetor pCC1FOS

Figura. 7. Viso geral da construo de biblioteca de fosmdeo utilizando o sistema CopyControl


(Epicentre

Biotechnologies), e subseqente induo dos clones um alto nmero de cpia.

26

3.6.1 Identificao dos clones

Todas as amostras foram plaqueadas em placas contendo meio slido LB e o


antibitico cloranfenicol na concentrao de 12,5 g/mL. Em seguida, as placas foram
incubadas em estufa a 37C por toda a noite.
0s clones transformantes foram coletados com o auxlio de dois catadores e
organizados em placas de Petri contendo meio slido LB e cloranfenicol a 12,5
g/mL. As bactrias foram incubadas em estufa por 14h a 37C, e depois foram
colocadas na geladeira. As bactrias foram inoculadas em placas de 96 poos
contendo 70 L de meio lquido LB contendo cloranfenicol a 12,5 g/mL, e incubadas
sob agitao por 14h a 37 C. No dia seguinte foram adicionados 70 L de glicerol
estril a 16% s culturas. As placas foram ento seladas com adesivos e
armazenadas em freezer a -80C.

3.6.2 Coleta dos clones


Os clones transformantes (colnias brancas) foram coletados com o auxlio de
dois catadores e organizados em placas de Petri contendo meio slido LB e
cloranfenicol a 12,5 g/mL. As culturas ficaram em estufa por 14h a 37C, e depois
foram colocadas na geladeira. Dois dias depois, as bactrias foram inoculadas em
placas do tipo ELISA de 96 poos preenchidas com 70 L de meio lquido LB
contendo cloranfenicol 12,5 g/mL, e incubadas sob agitao por 14h a 37C. No d ia
seguinte foram adicionados 70 L de glicerol 16% estril s culturas. As placas foram
ento seladas com adesivos e armazenadas em freezer a -80C.

3.6.3 Induo dos clones fosmdeos a um alto nmero de cpia

Adicionou-se em placa de 96 poos, 1 mL de meio LB contendo 12,5 g/mL de


cloranfenicol por poo, e tocou-se com replicador automtico na placa de 96 poos
contendo o estoque dos clones fosmdeos em glicerol. Colocou-se o adesivo para
tampar a placa e perfurou o mesmo para aerar o ambiente. Fez-se incubao por
37C por 16h a 260 r.p.m. Passado este perodo, transferiu-se 200 L das clulas
crescidas, para outra placa de 96 poos contendo 800 L de LB com 12,5 g/mL de

27

cloranfenicol e 1 L da induction solution (consta no kit), deixando por 37C por 5h a


260 r.p.m.

3.6.4 Extrao do DNA plasmidial dos clones para sequenciamento


Aps a induo de um alto nmero de cpia por clula, foi feita a extrao do
DNA plasmidial dos clones, segundo a mesma metodologia de rotina, utilizada no
laboratrio de Genmica e Expresso Gnica da UESC/BA, como tambm a reao
de sequenciamento, contudo utilizou-se os iniciadores pCC1 / pEpiFOS Forward
e o pCC1 / pEpiFOS Reverse. Foi seqenciada uma placa contendo 96 clones.
Seqncia dos inciadores utilizados:
5' - GGATGTGCTGCAAGGCGATTAAGTTGG - 3' Forward
5' - CTCGTATGTTGTGTGGAATTGTGAGC - 3' Reverse
3.6.5 Digesto dos clones para confirmar insero dos fragmentos

Utilizou-se cerca de 20 clones para fazer a digesto utilizando enzimas de


corte nico no vetor, so elas: EcoRI e HindIII. Utilizou-se cerca de 15 L do DNA
plasmidial e 1 unidade (1L) de cada enzima, 3 L de tampo Red 10X, o volume foi
completado para 30 L com gua ultra pura estril, e a reao foi incubada a 37C
por toda a noite. Fez-se uma eletroforese em gel de agarose 1% e os fragmentos
foram corados com Brometo de Etdio e visualizados em luz ultravioleta (UV).

3.6.6 Anlise de Bioinformtica das seqncias

As seqncias obtidas atravs do sequeciamento foram analisadas por


bioinformtica utilizando-se o programa Basic Local Alignment Search Tool (BLAST),
disponvel

no

National

Center

for

Biotechnology

Information

(NCBI,

http://www.ncbi.nlm.nih.gov/BLAST) para comparar a similaridade das seqncias


submetidas com as disponveis no banco de dados.

28

4. RESULTADOS

4.1 Anlise fsico-qumica do solo de Mata Atlntica


As caractersticas fsico-qumicas das amostras de solo tambm foram
determinadas (Tabela 3). As amostras apresentaram pH pouco cido, em torno de
6,0.
Tabela 3. Composio qumica e fsica do solo de Mata Atlntica.

4.2 Extrao de DNA

As extraes de DNA das amostras de solo foram feitas utilizando-se o mtodo


A e B anteriormente descritos. A extrao obtida pelo mtodo B apresentou-se
melhor, quanto a pureza do DNA, uma vez que precisa-se de um DNA o mais isento
possvel de constituintes, como cido hmico, para que no afete a atividade das
enzimas empregadas na biologia molecular (Figuras 8 e 9).

29

Figura. 8. Mtodos de extrao de DNA de solo de Mata Atlntica. Tubo esquerdo: mtodo A; Tubo
direito: mtodo B.

Figura. 9. Eletroforese em gel de agarose 0,8%, 80V por 45min. Da esquerda para direita: marcador de
Alto Peso Molecular (8-48 kb); DNA extrado pelo mtodo A; DNA extrado pelo mtodo B.

Inicialmente os DNAs extrados por ambos os mtodos, foram utilizados como


molde para a amplificao em PCR. Uma reao teste com DNA controle proveniente
da Salmonella ssp. foi realizada para verificar se estava ocorrendo inibio da enzima
Taq DNA polimerase por constituintes presentes na soluo de DNA do solo. O teste
foi feito adicionando-se 10ng do DNA do solo, obtido por cada metodologia, e a cada
tubo de 200 L para PCR. Adicionando-se tambm em um outro tubo a mesma
quantidade de DNA controle e verificou-se que houve amplificao do gene 16S rDNA
nos tubos contendo DNA controle e no tubo contendo DNA extrado pelo mtodo B.
S no amplificando o DNA obtido pelo mtodo A. Mesmo a amostra de DNA
ambiental estando ainda com um teor considerado de constituintes que pudessem
inibir a ao da Taq DNA polimerase (o que bem menos que a quantidade no
mtodo A). Ainda assim, os DNAs extrados do solo foram diludos em gua ultra pura

30

estril na proporo de 1:200 visando diluir tambm os inibidores existentes nas


amostras.
Nenhuma amplificao foi obtida pelo mtodo A. Por outro lado, dos trs tipos
de purificao do mtodo B, apenas 1 e 2 mostraram-se amplificveis por PCR (dado
no mostrado), embora seus resultados de leitura em espectrofotmetro nas razes
260/230 nm e 260/280 nm tenham mostrado nvel aceitvel de contaminao para
eDNA (environmental DNA). A forma 3, por apresentar grande perda de DNA durante
o processo, no se mostrou amplificvel, nem confivel para estudo de
biodiversidade. A metodologia B funcionou muito bem para vrios solos.

1500pb

Figura 10. Produto de PCR do 16S rDNA obtidos pelo mtodo B e pelas purificaes 1 e 2. Canaleta 1marcador 200- 3000 pb; Canaleta 2 e 3 Raso da Catarina (Cerrado); 4 e 5 Mangue, 6 e 7 Mata
Atlntica. Controle negativo (C-); e amostra de DNA de Salmonella ssp.,controle positivo (C+).

Com o mtodo B, obteve-se um rendimento de, em mdia, 596 ng/L,


enquanto com o mtodo A, obteve-se rendimento de, em mdia, 310 ng/L. O
resultado dessas leituras em espectrofotmetro mostram que o mtodo B tem um
rendimento quase duas vezes maior que o do mtodo A. Essa diferena de
rendimento tambm foi observada visualmente pela anlise de bandas aps
eletroforese dos DNAs extrados pelos mtodos A e B (Figura 11). As principais
diferenas entre os dois mtodos de extrao esto na adio de Glass Beads no
mtodo B, enquanto no mtodo A isso no acontece, e na etapa de lise, na qual no
mtodo B, utiliza-se choque trmico e no mtodo A, macerao. Estas duas
diferenas podem ser as principais explicaes para o maior rendimento de DNA pelo
mtodo B.

31

Figura 11. Eletroforese em gel de agarose 0,8%, mostrando DNA total e DNA total depois de digesto:
Canaleta 1- marcador de alto peso molecular 8-48 kb. 2- DNA extrado pelo mtodo B, purificado 1 vez
e sem digesto. 3- DNA extrado pelo mtodo B purificado 1 vez e digerido por EcoRI. 4- DNA extrado
pelo mtodo B purificado 2 vezes e digerido por BamHI. 5- DNA extrado pelo mtodo B purificado 2
vezes e sem digesto. 6- DNA extrado pelo mtodo B purificado 2 vezes e digerido por EcoRI. 7- DNA
extrado pelo mtodo B purificado 2 vezes e digerido por BamHI. 8- DNA extrado pelo mtodo A sem
digesto. 9- DNA extrado pelo mtodo A parcialmente digerido por EcoRI. 10- DNA extrado pelo
mtodo A parcialmente digerido por BamHI.

4.3 Anlise da Biodiversidade


4.3.1 Construo da biblioteca de 16S rDNA
Os produtos de PCR foram utilizados para construir bibliotecas de genes 16S
rDNA,

utilizando-se

os

inciadores

27F/1525R.

Foram

obtidos

864

clones

transformantes que foram divididos em 9 placas de ELISA contendo 96 clones cada.


A organizao da biblioteca gnica nas placas se deu da seguinte maneira:
Identificao da placa por incio da monagem (ex: PL 01 PL09). Seguido do nome
do solo e regio de interesse. (ex. PL01 Mata Atlntica 16S). A nomenclatura dos 96
clones em cada placa foi feita identificando as linhas de A a H e as colunas de 1 a 12.
A extrao do DNA plasmidial que contm o inserto correspondente ao gene
16S rDNA foi feita utilizando-se o suporte tecnolgico de rotina do laboratrio de
Genmica e Expresso Gnica da UESC/BA (Figura 12).

32

Figura 12. Eletroforese em gel de agarose 1,0 %, mostrando extrao de DNA plasmidial (miniprep) de
alguns clones da biblioteca de 16S.rDNA.

A construo da biblioteca com os iniciadores 27F e 1525R, foi escolhida, por


que estes so considerados universais, ou seja, anelam no 16S rDNA de bactrias de
praticamente todos os filos conhecidos. Estes iniciadores tm sido amplamente
utilizados na anlise de comunidades bacterianas de diversos ambientes.

4.3.2 Sequenciamento dos clones contendo o inserto de 16S rDNA


Assim como a extrao do DNA plasmidial, a reao de seqenciamento dos
864 clones foi realizada tambm, utilizando-se o suporte tecnolgico de rotina do
laboratrio de Genmica e Expresso Gnica da UESC/BA. O seqenciamento dos
clones foi feito com os iniciadores M13 F.

4.3.3 Anlise de Bioinformtica das seqncias obtidas pelo sequenciamento


Para estudo dos dados de bionformtica alcanados via seqenciamento,
foram analisadas no total 659 seqncias com tamanho superior a 200 bp, o
suficiente para realizar predies de hierarquia taxonmica com alta confiana, as

33

demais seqncias foram descartadas, por no apresentarem tamanho suficiente


para este tipo de anise.
Desse total, 631 seqncias foram classificadas como bactria e 28
seqncias no tiveram classificao de domnio. Dos filos do domnio bactria, 374
so Proteobacterias, 191 so Firmicutes, cinco Planctomycetes e apenas uma
Acidobacteria. Assim, 60 seqncias classificadas no domnio Bactria tm filo
desconhecido (Figura 13).

Bacteria - Filos

Acidobacteria
Firmicutes
Planctomycetes
Proteobacteria
Desconhecidas

Figura 13. Classificao dos filos identificados no domnio Bacteria

Dos 191 organismos do filo Firmicutes, 184 seqncias foram classificadas


como Bacilli e uma nica seqncia faz parte da classe Clostridia. Todas as trs
seqncias do filo Planctomycetes pertencem a classe Planctomycetacia. O clone de
Acidobacteria pertence a classe Acidobacteria.

Dos 374 organismos do filo Proteobacteria, a classe Alphaproteobacteria tem


trs seqncias representantes, Betaproteobacteria tem 3 seqncias representantes
e a maioria, 359, pertencem a classe Gammaproteobacteria. Das classes
identificadas, a Gammaproteobacteria a que tem maior diversidade de ordens,
sendo que 50 seqncias so Xanthominadales, 105 so Pseudomonadales e 192
so Enterobacteriales (Figura 14).

34

Um total de 245 seqncias obteve qualidade e tamanho suficientes para


deteco do gnero, que o mais especfico que a ferramenta de deteco pode
chegar. Os resultados mostram uma grande diversidade de gnero, contudo uma
maior quantidade de Caryophanon, Bacillus, Flavimonas, Stenotrophomonas e
Acinetobacter (Figura 15).

Gammaproteobacteria

Enterobacteriales
Pseudomonadales
Xanthomonadales

Figura 14. Distribuio das classes do filo Gammaproteobacteria

Gneros

Acidobacterium
Acinetobacter
Afipia
Bacillus
Burkholderia
Caryophanon
Citrobacter
Enterobacter
Flavimonas
Hafnia
Isosphaera
Paenibacillus
Phenylobacterium
Pseudomonas

Figura 15. Distribuio dos gneros encontrados.

35

Para a anlise de distncia filogentica foram utilizadas, do total, 380


seqncias que estavam todas na regio inicial da seqncia ribossomal entre os
nucleotdeos 1 500; seqncias que no compartilharam essa mesma regio foram
descartadas, isso necessrio para realizar o alinhamento global.
O dendograma se mostrou coerente com os dados de predio de hierarquia
taxonmica, agrupando corretamente as classes (Figura 16).

36

37

38

39

40

41

Figura 16. Dendograma mostrando a distribuio e as distncias filogenticas dos microrganismos, os


clones esto identificados como PxxNxx, onde Pxx a identificao da placa e Nxx o identificador do
clone na placa.

42

4.4 Anlise dos dados obtidos pela anlise de ARDRA

Este passo foi realizado a fim de confirmar a validade dos dados alcanados
pelo sequenciamento, e tambm de corroborar a eficincia de ambas as tcnicas,
uma vez que por si s, os resultados obtidos via sequenciamento dos clones, seriam
suficientes o bastante para gerar dados informativos da diversidade microbiana
presente no solo em estudo.
Assim, o DNA plasmidial de 48 clones transformantes da placa 04 (placa
escolhida aleatoriamente,foi extrado e amplificado com os iniciadores 27F/1525R
para confirmar se os clones possuam ou no o inserto correspondente ao gene 16S
rDNA (Figura 17). As enzimas AluI, HhaI e MspI foram utilizadas na anlise de
restrio do rDNA amplificado (ARDRA) para avaliar o perfil de restrio dos clones
selecionados (Figura 18, 19 e 20). O mtodo para analisar este perfil gerado aps
eletroforese em gel de agarose 2,0% a 120V por 2 horas, foi o NTSYS (Figura 21).

Figura 17. PCR 16S rDNA da placa 04 (PL04). Mostrando o fragmento de


aproximadamente 1500pb.

43

A1

B1

C1

D1

E1

F1

G1

H1

A2

B2

C2

D2

E2

F2

G2

H2

A3

B3

Figura 18. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade


bacteriana do solo de Mata Atlntica amplificados com os iniciadores 27F e 1525R, e
digeridos com: Enzima de restrio AluI - poro acima do gel, digesto com a
enzima HhaI poro intermediria e MspI poro inferior. Nas extremidades
ladder de 100 1000pb.

44

C3

D3

F3 G3

H3

A4

B4 C4

D4

E4

D7

E7

F7

G7

H7

E8

F8

G8

Figura 19. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade


bacteriana do solo de Mata Atlntica amplificados com os iniciadores 27F e 1525R, e
digeridos com: Enzima de restrio AluI - poro acima do gel, digesto com a
enzima HhaI poro intermediria e MspI poro inferior. Nas extremidades
ladder de 100 1000pb.

45

G8

H8

D9

E9

F9

G9

H9

D10

E10 F10 G10

H10 M

Figura 20. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade


bacteriana do solo de Mata Atlntica amplificados com os iniciadores 27F e 1525R, e
digeridos com: Enzima de restrio AluI - poro acima do gel, digesto com a
enzima HhaI poro intermediria e MspI poro inferior. Nas extremidades
ladder de 100 1000pb.

46

O padro de bandas obtido com ARDRA para cada indivduo foi analisado
considerando-se apenas as bandas mais evidentes que foram mensuradas, com o
resultado das mensuraes foi possvel confeccionar uma matriz binria para o
padro de bandas dos indivduos (Apndice 2).
Fez-se o agrupamento das amostras, de acordo com a similaridade nos
padres de bandas, foi realizado empregando-se o mtodo de UPGMA (Unweighted
pair-group method with arithmetical averages).
O coeficiente de similaridade simples obtido por meio do programa NTSYS
(Numerical taxonomy system of multivariate programs), foi utilizado para se obter um
dendrograma a partir dos dados de similaridade (Figura 21).
Como nem todas as seqncias (obtidas pela tcnica de sequenciamento) que
foram escolhidas da placa 04, apresentaram tamanho suficiente para os clculos de
filogenia, algumas seqncias tiveram que ser excludas. Assim, fez-se a anlise da
mesma forma do item 3.4 da metodologia. Contudo, utilizando-se somente 34 clones
(Figura 22). J para a tcnica de ARDRA fez-se 2 dendogramas, onde um contm as
48 seqncias (Apndice 1) e outro as mesmas 34 seqncias obtidas pelos dados
de sequenciamento, para comparar com os dendogramas obtidos. As amostras de
ambas as tcnicas se agruparam, o que mostra o potencial da tcnica de ARDRA.
Alm disto para anlise dos dados obtidos pelo sequenciamento necessrio um
nmero mnimo de pares de bases, caso contrrio esta anlise no possvel, foi o
que aconteceu com as 14 seqncias excludas.

47

Figura 21. Dendograma gerado pelo NTSYS, segundo dados obtidos por ARDRA

Figura 22. Dendograma gerado pelo DNAMLK, segundo dados obtidos pelo
sequeciamento.

48

4.5 Confeco da biblioteca de fosmdeo com solo de Mata Atlntica

O kit utilizado permite a introduo e manuteno de uma nica cpia de DNA,


o que evita recombinaes. Outra vantagem desse kit que a fragmentao do DNA
se d por processo fsico de quebra do DNA. Isso evita a introduo de erros (bias)
decorrentes da digesto por enzimas de restrio. A fragmentao por passagem do
DNA em seringas mostrou-se eficaz, pois permitiu um controle preciso dos tamanhos
dos fragmentos gerados (Figura 23).

Figura 23. Eletroforese em gel de agarose de 0,8%, mostrando o DNA de alto peso molecular obtido
pela metodologia B desenvolvida. M marcador de alto peso molecular, 1-3 extraes independentes de
DNA de solo de Mata Atlntica.

49

Figura 24. Eletroforese em gel de agarose 1% a 33V pr 16h, obtido a partir da fragmentao do DNA
TM

de Mata Atlntica de alto peso molecular para posterior clonagem no vetor pCC1FOS

(Epicentre

Biotechnologies). O retngulo amarelo indica a faixa de DNA que foi recuperada do Gel via digesto
com gelase para clonagem (entre 40 e 25 kbp).

Figura 25. Eletroforese em gel de agarose 1% a 50V por 12h. Digesto de alguns clones de fosmdeo
com as enzimas de restrio EcoRI e HindIII. Essas enzimas liberam o clone inteiro (aproximadamente
8kb) e, caso ele tenha algum stio interno para essas enzimas, outros fragmentos conforme mostrado
TM

nas canaletas 2, 3, 13 e 14. A seta vermelha indica a liberao do vetor pCC1FOS


Biotechnologies).

50

(Epicentre

A partir dos primeiros clones de fosmdeos obtidos partiu-se para o


sequenciamento das extremidades dos mesmos. Essa etapa foi um pouco trabalhosa
em virtude de se obter DNA em quantidade para o sequenciamento, mas o maior
problema foi a metodologia de sequenciamento que apresenta-se totalmente diferente
da utilizada na rotina do laboratrio de Genmica e Expresso Gnica da UESC.
Mesmo assim, j obtive-se alguns resultados como os mostrados a seguir (Figura 26).
Ainda assim, os resultados so promissores, pois se pode observar a presena de
dois genes bacterianos que codificam para uma hidrolase dependente de metal e
uma cardiolipina, o que confirma a potencialidade da tcnica.

51

Figura 26. Resultados de BLAST-X de seqncias das extremidades de fosmdeos, indicando que
efetivamente foram clonados fragmentos de DNA metagenmico de solo de Mata Atlntica.

52

5. DISCUSSO

5.1 Microrganismos e o solo de Mata Atlntica

A Mata Atlntica, bioma com grande diversidade biolgica, tem um enorme


potencial

como

fonte

de

novas

biomolculas,

sobretudo

com

atividade

antimicrobianas, uma vez que a competio por espao e nutrientes neste ambiente
severa, forando os microrganismos a produzirem substncias inibidoras de
crescimento de seus competidores (COSTA; SIQUEIRA, 2004). Via de regra, ela
possui um solo rico em matria orgnica, com componentes que interferem nas
reaes necessrias explorao de seu potencial biotecnolgico, especialmente o
cido hmico, composto por materiais (elementos) de alto peso molecular, contendo
nitrognio em formas cclicas e anis aromticos formados por poli-condensao
durante a decomposio da matria orgnica no solo (PAUL; CLARK, 1989). A
interferncia que muitos constituintes provocam nas molculas de DNA, inviabilizam
reaes enzimticas que so determinantes na construo de uma biblioteca
metagenmica, tais como digesto, amplificao e ligao. O cido hmico desnatura
o DNA pela ligao de seus grupos fenlicos a amidas ou por serem oxidados e
formarem quinonas que se ligam covalentemente ao DNA (ROBE et al., 2003).
A Taq polimerase especialmente sensvel ao cido hmico e outros
inibidores em potencial encontrados no solo. A inibio desta enzima pode inviabilizar
amplificaes via PCR, uma das principais tcnicas aplicadas ao DNA extrado do
solo em estudos de filogenia (WHITEHOUSE; HOTTEL, 2007).
Em estudos com fins biotecnolgicos, como identificao de novas substncias
com aplicaes mdicas e industriais, alm da necessidade de um DNA livre de
constituintes interferentes, o mtodo de extrao deve proporcionar uma quantidade
de DNA suficiente para as reaes. Nestas situaes, quanto maior a quantidade de
53

DNA, maior a representatividade da amostra, apresentando uma amostra mais


fidedigna

elevando

possibilidade

de

se

encontrar

um

novo

gene

consequentemente, um novo produto gnico (LAMMLE et al., 2007). Desta forma,


conseguir extrair DNA em quantidade e qualidade adequada construo de uma
biblioteca metagenmica de solo de Mata Atlntica tornou-se uma necessidade.
A amplificao via PCR uma boa estratgia de avaliao do nvel de pureza
do DNA, uma vez que envolve sucessivas reaes enzimticas (SIGLENTON et al.,
2003). A acoplagem das DNA polimerases molcula de DNA exige stios livres de
contaminao (ROH et al., 2006). Sendo assim, eDNA no amplificvel em condies
timas de reao provavelmente tem sua amplificao inibida por contaminantes,
como os cidos hmicos, que impedem a ao da Taq - DNA polimerase (ROBE et
al., 2003; KOZDROJ;VAN ELSAS, 2001; ROH et al., 2006).
As prolas de vidro (Glass Beads) foram adicionadas no intuito de aumentar o
nmero de clulas bacterianas disponveis, liberadas das partculas de solo pelos
choques que estas sofreriam com as prolas de vidro, desfazendo a adeso das
clulas a estas partculas do solo. As bactrias dispem de mecanismos de adeso
as partculas de solo (ROBE et al, 2003). No liber-las significaria perder DNA
durante os processos de lavagem iniciais, que consistem em eliminar os interferentes,
incluindo as partculas de solo.
A lise por choque trmico tambm contribuiu para um maior rendimento uma
vez que, estando o material exposto a diferenas bruscas de temperatura, todas as
clulas presentes sofrero esta presso, aumentando a eficincia de lise. J a
macerao, pode no expor tantas clulas sua presso de lise quanto o choque
trmico, especialmente quando se leva em conta a habilidade manual no
procedimento (DUBEY et al., 2006). Alm disso, o resultado de leitura na razo
260/230 nm para DNA extrado com o mtodo B, foi, em mdia, 1,9. Para DNA
extrado com o mtodo A, foi em mdia, 1,25. Isso mostra que o mtodo B tambm
rende um DNA mais livre de cidos hmicos que o do mtodo A, visto que admite-se
resultado igual ou maior que 2 na razo 260/230 nm para DNA livre de contaminao
por cidos hmicos (ROH et al., 2006). O resultado de leitura na razo 260/280 nm
para DNA extrado com o mtodo B foi, em mdia, 0,35 e 0,5 para DNA extrado com
o mtodo A. Isso mostra que ambos os DNAs esto livres de contaminao por
protena, tomando com referncia o limite mximo de 1,7 (ROH et al., 2006). Essa
diferena no nvel de pureza entre os DNAs acabou por interferir na digesto com as
54

enzimas EcoRI e BamHI, onde o DNA extrado com o mtodo B em sesu dois tipos
de purificao foi perfeitamente digerido tanto por EcoRI quanto por BamHI. J o DNA
extrado com o mtodo A foi apenas parcialmente digerido, como mostrado
anteriormente (Figura 12).

5.2 Biodiversidade bacteriana do solo de Mata Atlntica


Neste estudo, foi detectada uma grande diversidade de bactrias no solo de
Mata Atlntica, tanto pelo mtodo de sequenciamento, quanto pelo de ARDRA.
Bactrias so organismos relativamente simples, microscpicos, cujo material
gentico no est envolvido por um envelope nuclear (clulas procariticas).
Possuem importncia indiscutvel na sustentabilidade da biosfera e tm um papel
preponderante nos ciclos biogeoqumicos. As espcies bacterianas so definidas
filogeneticamente, empregando-se para tal a relao evolutiva entre seqncias de
genes conservados, notadamente rRNA 16S, e o grau de similaridade entre os
genomas dos organismos.
As bactrias apresentam uma diversidade de vias metablicas muito grande,
reunindo

organismos

(heterotrficos

especializados

organotrficos)

na

ou

utilizao

inorgnicos

de

compostos

como

fonte

de

orgnicos
energia

(quimiorganotrficos e litotrficos), ainda aqueles capazes de utilizar luz como fonte


de energia no metabolismo (fototrficos). Esta incrvel versatilidade metablica das
bactrias justifica a sua ocorrncia em diferentes ambientes e condies de
sobrevivncia. Os estudos de seqncias de rRNA de organismos ambientais
identificam os organismos que provavelmente so mais abundantes no ambiente
estudado e, por conseqncia, aqueles que participam ativamente na manuteno da
comunidade (HUGENHOLTZ et al., 1998b).
Resultados de alguns estudos baseados em anlise direta da diversidade
bacteriana em amostras ambientais por meio de mtodos moleculares indicam que
alguns grupos do Domnio Bacteria apresentam distribuio cosmopolita, ao passo
que outros parecem estar restritos a ambiente particulares (SCHLEGEL; JANNASCH,
1992). Alguns dos grupos filogenticos de distribuio cosmopolita so bem
conhecidos a partir de estudos de isolamento e cultivo, ao passo que outros so
ainda pouco conhecidos/estudados ou no foram ainda detectados atravs de cultivo.

55

Segundo Hugenholtz et al. (1998a, b), o Domnio Bacteria compreende pelo


menos 36 divises, incluindo, alm das 12 divises descritas por Woese (1987),
baseadas principalmente em seqncias de rRNA 16S de organismos cultivados, 12
novas divises putativas, descritas em estudo recente envolvendo a anlise de
seqncias de rDNA 16S isoladas diretamente do meio ambiente (HUGENHOLTZ et
al., 1998a), e 12 linhas de descendncia descritas em outros estudos (MAIDAK et al.,
1997).
O termo diviso/filo definido como um grupo filogentico contendo duas ou
mais seqncias de rDNA 16S reprodutivelmente monofilticas e no afiliadas com os
outros grupos filogenticos que integram o Domnio Bacteria (HUGENHOLTZ et al.,
1998a). Nos quatro volumes do Bergey`s Manual of Systematic Bacteriology
(KRIEG;HOLT, 1984; SNEATH; HOLT, 1986; STALEY; HOLT, 1989; WILLIAMS et al.,
1989), so descritos 33 agrupamentos ou sees de microrganismos que
compreendem os representantes dos Domnios Bacteria e Archaea. Nos manuais de
Bergey so descritos um total de 384 gneros de bactrias. Dados de 1998, afirmam
que as bactrias e archaeas compreendem um total de 4.167 espcies com descrio
taxonmica

vlida,

distribudas

em

791

gneros

(http://www.dsmz.de/bactnom/bactname.htm). J em 2007 esta mesma fonte


informou que existem 1.563 gneros de bactrias.
A intensificao dos estudos voltados para a ecologia microbiana tem
contribudo significativamente para tal avano na taxomia microbiana. Neste trabalho
foi possvel identificar cerca de 230 gneros distintos de bactrias, j que nem todas
as seqncias apresentaram qualidade e tamanho suficiente para deteco do
gnero, o mximo que a ferramenta alcanava detectar. Se as demais 406
sequncias tivessem apresentado tamanho suficiente para identificao, muito
provavelmente este nmero tivesse sido bem maior.
A classificao hierrquica dos txons no Domnio Bacteria pode ser encontrada no
site do NCBI Taxonomy Homepage (http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html).
A abundncia de algumas espcies de microrganismos parece no ser to
importante quanto a manuteno da diversidade, isso porque a abundncia reflete de
forma mais imediata a flutuao microbiana de curto prazo e a diversidade revela o
equilbrio entre os diversos organismos e os domnios funcionais no solo (KENNEDY,
1999; LAVELLE, 2000). E, de certa forma, a identificao desta biodiversidade, reflete
a importncia do solo de Mata Atlntica para este ecossistema como um todo.
56

Das 634 seqncias vlidas utilizadas neste trabalho, as 606 que so do


domnio bactria, possuem uma diversidade bastante grande, apresentando mais de
228 gneros distintos. Os dados mostraram ainda 28 seqncias que no tinham filo
conhecido, o que pode significar bactrias no-cultivveis ainda no identificadas por
qualquer metodologia direta ou indireta, e por isto a falta de classificao ainda.
Dentre os trs filos conhecidos que apresentaram indivduos, o filo
Planctomycetes, foi o que apresentou menor nmero de indivduos. Originalmente
classificado como fungos, estas bactrias voltaram a se classificar como bactria pela
homologia de suas seqncias do 16S rRNA comparadas a outras bactrias. Os
Planctomycetes so bactrias aerbias e embora tenham sido observados
originalmente em hbitats aquticos, um dos resultados de estudos de ecologia
molecular foi avaliao da ocorrncia deles em solo e tambm foram identificados em
animais invertebrados (WANG et al., 2002).
Os Planctomycetes so alocados nos gneros Pirella e Planctomyces. Estes
organismos no apresentam peptidioglicano na parede celular. As clulas encontramse, muitas vezes, aderidas superfcie de substratos pelo auxlio de estruturas
celulares

externas

caractersticas,

tais

como

hastes,

hifas

ou

apndices

citoplasmticos. Alguns organismos podem apresentar reproduo por brotamento. A


maioria dos microrganismos deste filo quimiorganotrfico.
O filo Firmicutes apresentou cerca de 178 indivduos, sendo em sua maior
parte pertencente a classe Bacilli. O Firmicutes um filo de bactrias onde a maioria
Gram-positiva. Muitos Firmicutes produzem endosporos que so resistentes, e pode
sobreviver em condies extremas. Eles so encontrados em vrios ambientes, e
alguns so patognicos. Ley et al. (2005) acharam em humanos e ratos obesos uma
menor porcentagem de uma famlia de bactrias chamada Bacteroidetes e uma maior
taxa de Firmicutes, contudo eles no esto seguros se Firmicutes causam obesidade
ou se as pessoas que esto obesas cultivam mais daquele tipo de bactrias.
A classe Bacilli composta de organismos aerbios obrigatrios ou
facultativos, j a classe Clostridia composta de organismos anaerbios. O termo
Bacilli, singular bacillus, usado para referir-se a qualquer bactria em forma de
bastonete. Nesta classe incluem vrias bactrias gram-positivas. As relaes entre
eles ainda so um pouco incertas, e eles parecem ser parafilticos. Eles podem
formar dois grupos separados, formas de bacilo que produz endosporos e formas que

57

no produzem, como a ordem Lactobacillales. Doenas freqentemente causadas por


bacilos incluem antraz, botulismo e ttano.
Algumas espcies de Bacillus so consideradas significantes na medicina,
dentre elas: B. anthracis que causa antraz e B. cereus que causa uma doena
atravs de alimentos contaminados. A espcie B.subtilis uma bactria Grampositiva, encontrada em solo (RYAN; RAY, 2004). O B. subtilis tem a habilidade para
formar endosporos, o que permite o organismo tolerar condies ambientais
extremas. O B. subtilis foi classificado historicamente como organismo aerbico
obrigatrio, contudo pesquisa recente demonstrou que isto no est estritamente
correto (NAKANO; ZUBER, 1998). B. subtilis produz uma enzima proteoltica, a qual
tem sido relacionada com doena pulmonar (FLIND, 1969).
O Bacillus mycoides um organismo tpico de solo, de organizao em cadeia,
imvel, e bem semelhante ao B. cereus. Fermenta alguns carboidratos cidos
produzindo glicose, podem hidrolisar amido e produzem lectinase.
B. cereus sobrevive bem em solo e plantas. Tradicionalmente, foi considerado
que B. cereus no pode crescer a menos de 10C, porm li nhagens parecem ter se
adaptado e mostra crescimento a temperaturas de refrigerao (4-6 C). Intoxicao
gastrointestinal ocasionada por ingesto de alguns alimentos como arroz, macarro,
temperos e derivados do leite, contaminados por endosporos ou toxinas do B. cereus
so os veculos mais comuns que foram associados ao B. cereus. Estes organismos
podem ser identificados com base em reaes bioqumicas, produzindo catalase,
hidrolisando amido e casena, e produzindo lectinase.
Membros do filo Proteobacteria foram os mais numerosos no solo analisado.
As Proteobacterias compem o maior e mais diverso grupo de bactrias cultivveis.
Ele inclue diversos gneros patognicos, tais como Escherichia, Salmonella, Vibrio,
Helicobacter, e muitos outros. Dentre alguns dos papis desempenhados por esse
grupo de bactria est a participao ativa no ciclo do nitrognio, o que
provavelmente justifica a presena do grande nmero desses indivduos no solo de
floresta. A dominncia de Proteobacteria ocorre geralmente em solos de cultivo
(NSSLEIN; TIEDJE, 1999). Estudos envolvendo amplificao, clonagem e
seqenciamento de rRNA 16S, realizados em amostras de

solos amaznicos,

revelaram a ocorrncia de microrganismos pouco comuns em amostras ambientais e


demonstraram tambm o impacto do desmatamento sobre a diversidade microbiana.
Os resultados demonstraram o predomnio do nmero de organismos do Domnio
58

Bacteria (98) em relao a Archaea (2), sendo que algumas seqncias sugerem a
existncia de um novo grupo de Proteobacteria (BORNEMAN;TRIPLETT, 1997).
O filo das Proteobacterias apresenta 5 subdivises/classes: alfa (), beta (),
gama (), delta () e epsilon (). Os organismos alocados nesses grupos apresentam
colorao Gram-negativa e uma enorme diversidade morfolgica e metablica,
mesmo dentro de uma mesma radiao filogentica.
O grupo alfa compreende a maioria das bactrias prpura no-sulfurosas e
organismos no-fotossintticos com metabolismo diverso. As radiaes dentro da
subdiviso alfa so geralmente correlacionadas com propriedades fenotpicas,
destacando-se os grupos das nitrificantes (Nitrobacter spp.) e denitrificantes
(Rhodopseudomonas spp.), organismos com capacidade de fixao de nitrognio
(gneros Bradyrhizobium, Rhizobium e outros), parasitas intracelulares de clulas
eucariticas (gneros Bartonella e Rochalimaea) (CANHOS; MANFIO). A classe de proteobacteria consiste em vrios grupos de bactrias aerbias ou facultativas que
so altamente versteis nas capacidades de degradao, mas tambm contm
gneros de quimiolitotrfico (por exemplo o o gnero Nitrosomonas que so
oxidadores de amnia) e alguns fototrficos (gneros Rhodocyclus e Rubrivivax).
Muitos deles so encontrados em amostras ambientais, como gua ou solo. Espcies
patognicas dentro desta classe so a Neisseriaceae (gonorria e meningoencefalite)
e espcies do gnero Burkholderia.
No grupo beta esto tambm alocadas as espcies Spirillum, Thiobacillus e
Zymomonas, entre outros 12 gneros definidos. O grupo gama compreende os
gneros Chromatium, Escherichia e outras bactrias entricas, alm de Legionella,
Vibrio e outros 9 gneros. As proteobactrias apresentam grande diversidade
fisiolgica e de morfologia celular. As estratgias para obteno de energia so
vrias, incluindo organismos com metabolismo quimiolitotrfico, quimiorganotrficos e
fototrfico, alm de outras vias metablicas especializadas em organismos adaptados
a nichos ecolgicos diversos.
Em alguns estudos, as tentativas de se associar a diversidade de
microrganismos do solo com a qualidade do mesmo foram realizadas. Smit e
colaboradores (2001) compararam seus resultados com dados de seqncia do 16S
rDNA da literatura entre cinco filos bacterianos (Acidobacterium, Proteobacteria,
Nitrospira, cianobactria e bactrias verdes sulforosas), para avaliar a relao entre a
abundncia dos grupos microbianos e as condies de fertilidade do solo. Os
59

resultados mostraram que nos solos com alto teor de nutrientes disponveis h uma
seleo positiva de bactrias das divises de e -proteobacteria, isto , seleo de
bactrias com altas taxas de crescimento, o que aconteceu com o solo de Mata
Atlntica. Essa tendncia tambm foi observada em um estudo recente feito em solos
de Cerrado Brasileiro (QUIRINO et al., 2007). Por sua vez, nos solos com baixo teor
de nutrientes disponveis, ou alto teor de substratos recalcitrantes, a percentagem de
Acidobacterium foi mais alta, sendo uma seleo de bactrias com baixo potencial de
crescimento, mas com alta capacidade de competir por substratos. A partir desses
dados, Smit et al. (2001) sugeriram que a razo entre o nmero de Proteobacteria e
Acidobacterium serve como indicativo da condio nutricional do solo. Os menores
valores para essa razo seriam observados em solos oligotrficos; as intermedirias,
em solos agrcolas com baixo aporte de matria orgnica; os altos, em solos
agrcolas com alto aporte de matria orgnica. Outro motivo que tambm pode ter
levado a ausncia do grupo Acidobacterium, no caso do solo de Mata Atlntica, pode
ter sido por que os organismos deste grupo habitam ambientes bastante cidos.
De acordo a anlise dos dendogramas gerados tanto pela tcnica de ARDRA,
como pelo sequenciamento, a distribuio dos grupos bacterianos se assemelhou,
contudo, na anlise no ARDRA, conseguiu-se analisar todos os 48 indivduos
(Apndice 1) em estudo. Uma vez que a anlise feita com base no tamanho do
fragmento gerado por digestes com enzimas de restrio de cortes freqentes; j
para anlise de sequenciamento, necessrio, um mnimo nmero de pares de
bases gerados, caso contrrio, no possvel fazer anlise de similaridade entre os
organismos. A comparao entre diferentes mtodos de avaliao da biodiversidade
de microrganismos de solo mostrou que ambas as tecnologias so eficientes, porm
apresentam diferenas. Isso tambm foi mostrado num recente trabalho de Smalla et
al. (2007) onde vrios mtodos foram comparados, e diferenas tambm foram
observadas. A tcnica de ARDRA tem se mostrado interessante com relao a
custos, praticidade e rapidez na anlise, alm de alcanar dados que muitas vezes
superaram a anlise por sequenciamento, como foi o caso neste trabalho, onde 14
seqncias foram descartadas por no apresentarem tamanho suficiente para
anlise.

60

5.3 Confeco de biblioteca fosmdeos

Uma primeira biblioteca de fosmdeos foi confeccionada com o solo de Mata


Atlntica, porm a quantidade de DNA (at 1 mg) estava um pouco aqum do
recomendado pelo kit utilizado. Assim, obteve-se um nmero menor de clones
metagenmicos. Contudo, j foi suficiente para identificar via sequenciamento, dois
genes bacterianos. Uma seqncia parcial do gene codificador de cardiolipina e outra
de uma hidrolase dependente de metal. As cardiolipinas so muito encontradas em
Bacillus, o que pode explicar seu aparecimento logo no incio do sequenciamento
(KAWAI, et al., 2006; NISHIBORI, et al., 2005; VON WALLBRUNN, et al., 2002;
GUO;TROPP, 1998).
Atualmente, uma nova biblioteca est sendo montada, e as extremidades de
pelo menos 5000 clones da biblioteca (10000 pontas no total de primers Forward e
Reverse) sero seqenciadas e estes sero testados para diversos bioensaios em
busca de protenas com potencial biotecnolgico.

61

6. CONCLUSES

Foi possvel aperfeioar o protocolo de extrao de DNA do solo de Mata


Atlntica, uma vez que o solo contm muita matria orgnica o que dificulta a sua
anlise por tcnicas moleculares. Tornou-se possvel a obteno de DNA de boa
qualidade, com uma quantidade mnima de cidos hmicos, no suficiente para
atrapalhar anlises. Quanto quantidade, tambm muito significativa se comparada
com outros protocolos de extrao de DNA disponveis na literatura.
O sequenciamento da regio 16S rDNA foi eficaz para anlise da diversidade
da comunidade bacteriana, contudo a tcnica de ARDRA revelou-se tambm
promissora para comparar a comunidade bacteriana presente nestes solos.
Foi observada uma grande diversidade de gneros bacteriano no solo de Mata
Atlntica analisado, o que favorecer a descoberta de novos genes.
Como perspectiva futura pretende-se construir bibliotecas metagenmicas, j
que so ferramentas muito importantes para a obteno de novas biomolculas, ela
acessa comunidades de microrganismos cultivveis ou no-cultivveis, gerando
probabilidade muito maior de identificar genes e seus produtos com aplicaes
biotecnolgicas.

62

7. REFERNCIAS BIBLIOGRFICAS

AMANN, R.I.; LUDWIG, W.; SCHLEIFER, KH - Phylogenetic edentification and in situ


detection of individual microbial cells without cultivation. Microbiology and Molecular
Biology Reviews, v. 59, p. 143-169, 1995.

BERTRAND, H.; POLY, F.; VAN, V.T.; LOMBARD, N.; NALIN, R.; Vogel, T.M.;
SIMONET, P. High molecular weight DNA recovery from soils prerequisite for
biotechnological metagenomic library construction. Journal of Microbiological
Methods, v. 62, p. 1-11, 2005.

BORNEMAN, J.; TRIPLETT, E.W. Molecular microbial diversity in soils from eastern
Amazonia: evidence for unusual microorganisms and microbial population shifts
associated with deforestation. Applied and Environmental Microbiology, v. 63, p.
26472653, 1997.

BROUGHTON, L.C.; GROSS, K.L. Patterns of diversity in plant and soil microbial
communities along a productivity gradient in a Michigan oil-field. Oecologia. v. 125, p.
420427, 2000.

BRUGGEMAN, T.J. Innovations in drug discovery and development. BioPharm, v. 11,


p. 7, 1998.

BUCKLEY, D.; SCHMIDT, T. The structure of microbial communities in soil and the
lasting impact of cultivation. Microbial Ecology, v.42, p. 1121, 2001.

BULL, A.T.; WARD, A.C.; GOODFELLOW, M. Search and discovery strategies for
biotechnology: the paradigm shift. Microbiology and Molecular Biology Reviews, n.
3, v. 64, p.573-606, 2000.

CANHOS; MANFIO. Recursos Microbiolgicos para Biotecnologia.

63

COLE J.R.; CHAI B.; FARRIS R.J.; WANG Q.; KULAM S.A.; MCGARRELL D.M.;
GARRITY G.M.; TIEDJE J.M. The Ribosomal Database Project (RDP-II): sequences
and tools for high-throughput rRNA analysis. Nucleic Acids Research, v.33, P. 294296, 2005.

COSTA, R.; GOMES, C.M.N.; MILLING, A.; SMALLA, K. An optimized protocol for
simultaneous extraction of DNA and from soils. Brazilian Journal of Microbiology, v.
35, p. 230-234, 2004.

COSTA, J.L.; SIQUEIRA, E.R. Anlise de DNA dos solos e atividade enzimtica como
bioindicadores de diversidade microbiana em sistemas de restaurao florestal da
Mata Atlntica. II Seminrio de Pesquisa FAP-SE, Embrapa, SE. 2004.

CURTIS, T.P.; SLOAN, W.T.; SCANNELL, J.W. Estimating prokaryotic diversity and
its limits Proceedings of the National Academy of Sciences of the
United States of America, v. 99, p. 10494-10499, 2002.

DAMS, E.; HENDRIKS, L.; VAN DE PEER, Y.; NEEFS, J-M.; SMITS, GEERT.;
VANDENBEMPT, I.; WACHTER, R. Compilation of small ribosomal subunit RNA
sequences. Nucleic Acids Research, v. 16, p. 87-173, 1988.

DAVIS, B.G.; BOYER, V. Biocatalysis and enzymes in organic synthesis. Natural


Product Reports, v. 18, p. 618-640, 2001.

DE LONG, E.F.; PACE, N.A. Enviromental diversity of bacteria and archaea.


Systematic Biology, v. 50, n. 4, p. 470-478, 2001.

DUBEY, S.K.; TRIPATHI A.K.;, UPADHYAY S.N. Exploration of soil bacterial


communities for their potential as bioresource. Bioresourse Technology, v. 97, p.
22172224, 2006.

DUINEVELD, B.; ROSADO, A.S.; ELSAS, J.D.V.; VEEN, J.A.V. Analysis of the
dynamics of bacterial communities in the rhizosphere of the chrysanthemum via

64

denaturing gradient gel electrophoresis and substrate utilization patterns. Applied and
Environmental Microbiology, v. 64, p. 4950-4957, 1998.

DYKHUIZEN, D. E; ROSALIA, S. revisited: why are there so many species of


bacteria? Antonie van Leeuwenhoek, v. 73, p. 2533, 1998.

Ecosystem Profile Atlantic Forest Biodiversity Hotspot, Conservation International


Critical

ecosystem

Partnership

Fund.

2001

(www.cepf.net/xp/cepf/static/pdfs/Final.AtlanticForest.EP.pdf)

ELLIS, R.J.; MORGAN, P. ; WEIGHTMAN, A.J.; FRY J.C.; Cultivation-Dependent and


-Independent Approaches for Determining Bacterial Diversity in Heavy-MetalContaminated Soil. Applied Environmental Microbiology, v. 69, n. 6, p. 32233230,
2003.

ESCALANTE-LOZADA, A.; GOSSET-LAGARDA, G.; MARTNEZ-JIMNEZ, A.;


BOLVAR-ZAPATA, B. SOIL BACTERIAL DIVERSITY: MICROBIAL CULTUREINDEPENDENT

METHODS

OF

STUDY

AND

BIOTECHNOLOGICAL

IMPLICATIONS. Departamento de Ingeniera Celular y Biocatlisis. Instituto de


Biotecnologia, 2006.

FELSENSTEIN, J. PHYLIP - Phylogeny Inference Package. Cladistics, v. 5, p. 164166, 1989.

FLINDT, M. Pulmonary disease due to inhalation of derivatives of Bacillus subtilis


containing proteolytic enzyme, Lancet, v. 1, n. 7607, p. 1177-1181, 1969.

FUERST, J.A.; GWILLIAM, H.G.; LINDSAY, M.; LICHANSKA, A.; BELCHER, C.;
VICKERS, J.E.; HUGENHOLTZ, P. Isolation and molecular identification of
planctomycete bacteria from postlarvae of the giant tiger prawn, Penaeus monodon.
Applied and Environmental Microbiology, v. 63, p. 254-262, 1997.

65

FUERST, J.A.; WEBB, R.I. Membrane-bounded nucleoid in the eubacterium


Gemmata obscuriglobus. Proceedings of the National Academy of Sciences of the
United States of Amrica v.88, p. 8184-8188, 1991.

FUERST,J.A. Planctomycetes a phylum of emerging interest for microbial evolution


and ecology. Department of Microbiology and Parasitology, University of Queensland,
Brisbane, Queensland, Australia.

GALINDO-LEAL, C.; CMARA, I. Breve histria da conservao da Mata Atlntica. In:


Mata Atlntica: biodiversidade, ameaas e perspectivas. So Paulo: Fundao SOS
Mata Atlntica - Belo Horizonte: Conservao Internacional, 427p, 2005.

GILLESPIE, D.; BRADY, S.; BETTERMANN, A.; CIANCIOTTO, N.; LILES, M.;
RONDON, M.; CLARDY, J.; GOODMAN, R.; HANDELSMAN, J. Isolation of
turbomycin A and B from metagenomic library soil microbial DNA. Applied
Environmental Microbiology, v. 68, p. 4301-4306, 2002.

GOMES, N.C.M.; FAGBOLA, O.; COSTA, R.S.; RUMJANEK, N.G.; BUCHNER, A.;
MENDONA-HAGLER, L.C.S.; SMALLA, K. Dynamics of fungal communities in bulk
and maize rhizosphere soil in the tropics. Applied and Environmental Microbiology,
v. 69, p. 3758-3766, 2003.

GUO, D., TROPP, B.E. Cloning of the Bacillus firmus OF4 cls gene and
characterization of its gene product. Biochimica et Biophysica Acta, n.1, v. 1389,
p.34-42,1998.

HAMOND. The current magnitude of biodiversity. In: Global Biodiversity


Assessement, 1995

HANDELSMAN,

J.

Metagenomics:

application

of

genomics

to

uncultured

microorganisms. Microbiology Molecular Biology Review, v. 68, p. 669 685,


2004.

66

HANDELSMAN, J.; RONDON, M.R.; BRADY, S.F.; CLARDY, J.; GOODMAN, R.M.
Molecular biological access to the chemistry of unknown soil microbes: a new frontier
for natural products. Chemistry & Biology, v. 5, p. 245249, 1998.

HEUER, H.; WIELAND, G.; SCHONFELD, J.; SCHNWALDER, A.; GOMES, N.C.M.;
SMALLA, K. Bacterial community profiling using DGGE or TGGE analysis.
Environmental Molecular Microbiology: Protocols and Applications (ed. P.A.
Rochelle), Horizon Scientific Press.

HORNER-DEVINE, M.C.; CARNEY, K.M.; BOHNNAN, B.J.M. An ecological


perspective on bacterial biodiversity. Proceedings the Royal Society of London,
v.271, p. 113-122, 2004.

HUGENHOLTZ, P.; PACE, N.R. Identifying microbial diversity in the natural


environment: a molecular phylogenetic approach. Trends in Biotechnology, v. 180,
n. 14: p. 190-197, 1996.

HUGENHOLTZ, P.; GOEBEL, B.M.; PACE, N.R. Impact of culture-independent


studies on the emerging phylogenetic view of bacterial diversity. Journal of
Bacteriology, v. 180, n. 18, p. 4765-4774, 1998a.

HUGENHOLTZ, P.; PITULLE, K.L.; PACE, N.R. Novel division level bacterial diversity
in a Yellowstone hot spring. Journal of Bacteriology, v. 180, p. 366-376, 1998b.

HUMMEL, W. Large-scale applications of NAD(P)-dependent oxidoreductases: recent


developments. Trends in Biotechnogy, v.17, p. 487-492, 1999

HUNTER-CEVERA.

The

value

of

microbial

diversity.

Current

Opinion

in

Microbiology, v. 1: p. 278-285. 1998.

HUSON, D.H.; AUCH, A.F.; QI, J.; SCHUSTER, S.C. Megan analysis of metagenomic
data. Genome Research, v.17, p. 377-386, 2007.
67

JAEGER K.E.; EGGERT, T. Lipases for biotechnology. Current Opinion in


Biotechnology, n. 4, v. 13, p. 390-397, 2002.

JAEGER K.E, REETZ M.T: Microbial lipases form versatile tools for biotechnology.
Trends Biotechnogy, v.16, p. 396-403, 1998.

JURGENS, K.; MATZ, C. Predation as a shaping force for the phenotypic and
genotypic composition of planktonic bacteria. Antonie van Leeuwenhoek, v.81, p.
413 - 434. 2002.

KAWAI F.; HARA H.; TAKAMATSU H.; WATABE K.; MATSUMOTO K. Cardiolipin
enrichment in spore membranes and its involvement in germination of Bacillus
subtilisMarburg.

Genes

&

Genetic

Systems.

n.2,

v.81,

p.69-76.

2006.

KELLER, M.; ZENGLER, K. Tapping into microbial diversity. Nature Reviews, v. 2, p.


141-150, 2004.

KENNEDY, A.C. Bacterial diversity in agroecosystems. Agriculture, Ecosystems


and Environment, n. 1, v. 74, p. 65-76, 1999.

KOZDROJ, J.; VAN ELSAS, J.D. Structural diversity of microbial communities in


arable soils of a heavily industrialised area determined by PCR-DGGE fingerprinting
and FAME profiling. Applied Soil Ecology, v. 17, p. 3142, 2001.

KRIEG, N.R. & HOLT, J.G. (eds) Bergey.s manual of systematic bacteriology. Volume
1: Gram-negatives of general, medical, or industrial importance. Baltimore: Williams
& Wilkins, Co. 1984.

KUSKE, C.R. ; TICKNOR, L.O.;

MILLER, M. E.; DUNBAR,

J.M.;

DAVIS, J.A.;

BARNS, S.M.; BELNAP, J. Comparison of soil bacterial communities in rhizospheres


of three plant species and the interspaces in an arid grassland. Applied and
Environmental Microbiology, v. 68, p.18541863, 2002.

68

LADD, J.N.; FOSTER, R.C.; NANNIPIERI, P.; OADES, J.D. Soil structure and
biological activity. Soil Biology and Biochemistry, v. 9, p. 23-78, 1996.

LAMMLE, K.; ZIPPER, H.; BREUER, M.; HAUER, B.; BUTA, C.; BRUNNER, H.;
RUPP, S. Identification of novel enzymes with different hydrolytic activities by
metagenome expression cloning. Journal of Biotechnology, v. 127, p. 575592,
2007.

LAVELLE, P. Ecological challenges for soil science. Soil Science, n. 1, v. 165, p. 7386, 2000.

LEE, D.H.; ZO, Y.G.; KIM, S.J. Nonradioactive Method To Study Genetic Profiles of
Natural Bacterial Communities by PCRSingle-Strand-Conformation Polymorphism.
Applied and Environmental Microbiology, n. 9, v. 62, p. 31123120, 1996.

LEY, R. E.; BACKHED, F.; TURNBAUGH, P.; LOZUPONE, C. A.; KNIGHT, R. D.;
GORDON, J.I. Obesity alters gut microbial ecology. Proceedings of the National
Academy of Sciences of the United States of America, n.31, v.102, p.1107011075, 2005.

LIESACK, W.; JANSSEN, H. P.; RAINEY, F. A.; WARD-RAINEY, N. L.;


STACKEBRANDT, E. Microbial diversity in soil: the need for a combined approach
using molecular and cultivation techniques. In: Modern Soil Microbiology. VAN
ELSAS, J.D.; TREVORS, J.T.; WELLINGTON, E.M.H. Marcel Dekker, Inc. New York,
p. 712, 1997.

LIU, W.T.; MARSH, T.L.; CHENG, H.; FORNEY, L.J. Characterization of Microbial
Diversity by Determining Terminal Restriction Fragment Length Polymorphisms of
Genes Encoding 16S rRNA. Applied and Environmental Microbiology, n. 11, v. 63,
p. 45164522, 1997.

LUDWIG, W.; SCHLEIFER, K. H. Bacterial phylogeny based on 16S and 23S rRNA
sequence analysis. FEMS Microbiology Reviews, v. 15, p. 155-173, 1994.
69

MAIDAK, B.L.; OLSEN, G.J.; LARSEN, N.; OVERBEEK, R.; MCCAUGHEY, M.J. &
WOESE, C.R. The RDP (Ribosomal Database Project). Nucleic Acids Research., v.
25, p. 109-110, 1997.

MACIEL, B.M. Estudos Prospectivos de Microrganismos de Solo de Landfarm com


Potenciais Aplicaes em Estratgias de Biorremediao de reas Contaminadas por
Petrleo. Tese de mestrado, 2004.

MARSCHNER, P. YANG C.-H. ; LIEBEREI R.; CROWLEY D. E. Soil and plant specific
effects on the bacterial community composition in the rhizosphere. Soil Biology and
Biochemistry, v. 33, p. 1437-1445, 2001.

MARTINI, A.M.Z.; FIASCHI, P.; AMORIM, A.M.; PAIXO, J.L. A hot-point within a hotspot: a high diversity site in Brazil's Atlantic Forest. Biodiversity and Conservation.
2007.

MCCAIG, A.E.; GLOVER, L.A.; PROSSER, J.I. Molecular analysis of bacterial


community structure and diversity in unimproved and improved upland grass pastures.
Applied and Environmental Microbiology, v. 65, p. 17211730, 1999.

MULLER, A.K. ; WESTERGAARD, K..; CHRISTENSEN, S.; SORENSEN, S.J. The


effect of long-term mercury pollution on the soil microbial community. FEMS
Microbiology Ecology, v. 36, p. 11 -19, 2001.

MUYZER, G.; WAAL, E.C.; UITIERLINDEN, A.G. Profiling of Complex Microbial


Populations by Denaturing Gradient Gel Electrophoresis Analysis of Polymerase
Chain Reaction-Amplified Genes Coding for 16S rRNA. Applied and Environmental
Microbiology , n. 3, v. 59, p. 695-700, 1993.

MYERS. Environmental services of biodiversity. Proceedings of the National


Academy of Sciences of United States of America, v. 93, n. 7, p. 2764-2769, 1996.

70

MYERS, N.; MITTERMEIER, R.A.; MITTERMEIER, C.G.; DA FONSECA, G.A.B.;


KENT; J. Biodiversity hotspots for conservation priorities. Nature, v. 403, p. 853-858,
2000.

NAKANO, M. M.; ZUBER, P. ANAEROBIC GROWTH OF A "STRICT AEROBE"


(BACILLUS SUBTILIS). Annual Review of Microbiology, v. 52, p. 165-190, 1998.

NEEF, A.; AMANN, R.; SCHLESNER, H.; SCHLEIFER, K.H. Monitoring a widespread
bacterial group: in situ detection of planctomycetes with 16S rRNA-targeted probes.
Microbiology-Uk, v.144, p. 3257-3266, 1998.

NISHIBORI

A.;

KUSAKA

J.;

HARA

H.;

UMEDA

M.;

MATSUMOTO

K.

Phosphatidylethanolamine domains and localization of phospholipid synthases in


Bacillus subtilis membranes. Journal of Bacteriology. n. 6, v.187, p.2163-2174,2005.

NUBEL, U.; GARCIA-PICHEL, F.; CLAVERO, E.; MUYZER, G. Matching molecular


diversity and ecophysiology of benthic cyanobacteria and diatoms in communities
along a salinity gradient. Environmental Microbiology. v. 2, p. 217226, 2000.

NSSLEIN, K.; TIEDJE, J.M. Soil bacterial community shift correlated with change
from forest to pasture vegetation in a tropical soil. Applied

and Environmental

Microbiology, n. 8, v. 65, p. 3622-3626, 1999.

OCHMAN, H.; LAWRENCE, J.G.; GROISMAN, E.A. Lateral gene transfer and the
nature of bacterial innovation. Nature, v. 405, p. 299-304, 2000.

ODONNELL, A.G.; GRES, H.E. 16S rDNA methods in soil microbiology. Current
Opinion Biotechnology, v. 10, p. 225-229, 1999.

OLSEN, G.J.; WOESE, C.R.; OVERBEEK, R.; The winds of (evolutionary) change:
breathing new life into microbiology. Journal of Bacteriol. V. 176, p. 1-6, 1994.

71

PACE, N.R.; STAHL, D.A.; OLSEN, G.J.; LANE, D.J. Analyzing natural microbial
populations by rRNA sequences. American Society for Microbiology News 51: p.
412, 1985.

PACE, N.R.; STAHL, D.A.; LANE, D.J.; OLSEN, G.J. The analysis of natural microbial
populations by ribosomal RNA sequences. Advances in Microbial Ecology, v. 9, n.
1, p. 1-55, 1986.

PATRICK, D.S.; JO, H. Biotechnological prospects from metagenomics. Current


opinion, p. 303-308, 2003.

PAUL, E.A.; CLARK, F.E. Soil Microbiology and Biochemistry. New York: Academic
Press, 1989.

PETERS, S.; KOSCHINSKY, S.; SCHWIEGER, F.; TEBBE, C.C. Secession of


microbial communities during hot composting as detected by PCR Single- StrandConformation Polymorphism-based genetics profiles of small-subunit rRNA genes.
Applied and Environmental Microbiology, v. 66, p. 930-936, 2000.

QUIRINO, B. F.; PAPPAS, G.J.; TAGLIAFERRO, A.C.; COLLEVATTI, R.G.; NETO,


E.D.; SILVA, M.R.S.S.; BUSTAMANTE, M. M. C.;

KRGER, R.H. Molecular

phylogenetic diversity of bacteria associated with soil of the savanna-like Cerrado


vegetation. Microbiological Research, In Press, 2007.

RANJARD, L.; POLY, F.; NAZARET, S. Monitoring complex bacterial communities


using culture-independent molecular techniques: application to soil environment.
Research in Microbiology, n. 3, v. 51, p. 167177, 2000.

RAPP, M.S.; GIOVANONNI, S.J. The uncultured microbial majority. Annu. Rev.
Microbiol, v. 67, p. 369-394, 2003.

ROBE, P.; NALIN R.; CAPELLANO C.; VOGEL T.M.; SIMONET P. Extraction of DNA
from soil. European Journal of Soil Biology, v. 39, p. 183-190, 2003.

72

ROH, C.; VILLATTE, F.; KIM, B.G.; SCHMID, R.D. Comparative study of methods for
extraction and purification of
enviromental DNA from soil and sludge samples. Applied Biochemistry and
Biotechnology, v. 134, p. 97-112, 2006.

ROLF, D. The soil metagenome a rich resource for the discovery of novel natural
products. Current opinion, v. 15: p.199-204, 2004.

RONDON M.R, AUGUST, P.R.; BETTERMANN, A.D.; BRADY, S.F.; GROSSMAN,


T.H.;

LILES, M.;

LOIACONO, K.A.;

TIONG, C.L.; GILMAN,M.;

LYNCH, B.A.; MACNEIL, I.A.; MINOR, C.;

OSBURNE,M.S.; CLARDY, J.; HANDELSMAN,J.;

GOODMAN, R.M. Cloning the soil metagenome: a strategy for accessing the genetic
and functional diversity of uncultured microorganisms. Applied and Environmental
Microbiology, v. 66, p. 2541-2547, 2000.

ROSADO, A. S. Diversidade e ecologia de microrganismos do solo. In: Reunio


Brasileira de Fertilidade e Nutrio de Plantas, 23 Reunio Brasileira sobre
Micorrizas, 7 Simpsio Brasileiro de Microbiologia do Solo, 5 Reunio Brasileira de
Biologia do Solo, 2, 2000, Santa Maria. Anais. Santa Maria: UFSM, 2000. CD-ROM.

ROSSEL-MORA, R.; AMANN, R. The species concept for prokaryotes. FEMS


Microbiology Review, n. 1, v. 25, p. 39-67, 2001.
RUTH E. L., FREDRIK, B., PETER, T., CATHERINE, A. L., ROBIN D. K., JEFFREY I.
G. Obesity alters gut microbial ecology. Proceedings of the National Academy of
Sciences of United States of America, n. 31, v.102, p.11070-11075, 2005.

RYAN K.J.; RAY C.G., Sherris Medical Microbiology, 4th ed., McGraw Hill. ISBN 08385-8529-92004

SANGER, F.; NICKLEN, S.; COULSON, A. R. DNA sequencing with chain terminating
inhibitors. Proceedings of the National Academy of Sciences of United States of
America, v. 74, p. 5463-5467, 1977.

73

SAIKI, R.K.; GELFAND, D.H.; STOFFEL, S.; SHARF, S.J.; HIGUCHI, R.; HORN,
G.T.; MULLIS, K.B.; ERLICH, H. A. primer-directed enzymatic amplification of DNA
with a thermostable DNA polymerase. Science, v. 239, p. 487, 1988.

SCHIMEL. Ecosystem consequences of microbial diversity and community structure.


Ecolog. Study, v. 113, p. 239-254, 1995.

SCHLEGEL, H.G.; JANNASCH, H.W. Prokaryotes and their habitats. In: Ballows, A.,
Truper, H.G.; Dworkin, M.; Harder, W. & Schleifer, K.-H. (eds.). The prokaryotes. Vol.
I. New York: Springer Verlag. p. 75-125, 1992.

SCHLESNER, H. The development of media suitable for the microorganisms


morphologically

resembling

Planctomyces

spp,

Pirellula

spp,

and

other

Planctomycetales from various aquatic habitats using dilute media. Systematic and
Applied Microbiology v.17, 135-145, 1994.

SCHMIDT, T.M.; DELONG, E.F.; PACEEE, N.R.; Analysis of a marine picoplankton


community by 16S rRNA gene cloning and sequencing. Journal of Bacteriology, v.
173, p. 4371-4378, 1991.

SMALLA, K.; OROS-SICHLER, M.; MILLING, A.; HEUER, H.; BAUMGARTE, S.;
BECKER, R.; NEUBER, G.; KROPF, S.; ULRICH A.;. TEBBE, C. C. Bacterial diversity
of soils assessed by DGGE, T-RFLP and SSCP fingerprints of PCR-amplified 16S
rRNA gene fragments: Do the different methods provide similar results? Journal of
Microbiological Methods, doi:10.1016/j.mimet.2007.02.014, 2007.

SMILES, D.E. Aspects of the physical environment of soil organisms. Biology and
Fertility of Soils, n. 3, v. 6, p.204-215, 1988.

SMIT, E.; LEEFLANG, P.; GOMMANS, S.; VAN DEN BROEK, J.; VAN, M.S.;
WERNARS, K. Diversity and seasonal fluctuations of the dominant members of the
bacterial soil community in a wheat field as determined by cultivation and molecular
methods. Applied and Environmental Microbiology, v. 67, 2284-2291, 2001.

74

SNEATH, P.H.A.; HOLT, J.G. (eds.). Bergey`s manual of systematic bacteriology.


Volume 2: Gram positives other than Actinomycetes. Baltimore: Williams & Wilkins,
Co. 1986.

STALEY, J.T.;HOLT, J.G. (eds.). Bergey`s manual of systematic bacteriology. Volume


3: Archaeobacteria, Cyanobacteria, and the remaining Gram-negatives. Baltimore:
Williams & Wilkins, Co. 1989.

STALEY, J. Microbial Diversity and the Biospher, 1998.


http://www.bdt.fat.org.br/oea/sib/staley.

THOMPSON, J.D. CLUSTAL W: improving the sensitivity of progressive multiple


sequence alignment through sequence weighting, position specific gap penalties and
weight matrix choice. Nucleic Acids Research, v. 22, p. 4673-80, 1994.

THOMSON, C.J.; POWER. E.; RUEBSAMEN-WAIGMANN, H.; LABISCHINSKI. H.


Antibacterial research and development in the 21st Century an industry perspective
of the challenges. Current Opinion in Microbiology, v. 7, p. 445450, 2004.

TORSVIK, V.; GOKS0YR, J.; DAAE, F.L. High Diversity in DNA of Soil Bacteria.
Applied And Environmental Microbiology, v. 56, n. 3, p. 782-787, 1990.

TORSVIK, V.L. Isolation of bacterial DNA from soil. Soil Biology & Biochemistry, v.
12, p. 15-21, 1980.

TORSVIK, V.; OVREAS, L. Microbial diversity and function in soil: from genes to
ecosystems. Current Opinion in Microbiology, n. 3, v. 5, p. 240245, 2002.

TORSVIK, V.; OVREAS, L.; THINGSTAD, T.F. Prokaryotic diversity: magnitude,


dynamics, and controlling factors. Science, v. 296, p.10641066. 2002.

TORTORA, G.J.; FUNKE, B.R.; CASE, C.L. Livro de Microbiologia. 6. ed. Porto
Alegre: Artemed, p. 827, 2000.

75

TURNBULL P.C.B. Bacillus. In: Barron's Medical Microbiology (Barron S et al, eds.),
4th ed., Univ of Texas Medical Branch. (via NCBI Bookshelf) ISBN 0-9631172-1-1.
(1996).

UCHIYAMA, T. ; et al. Substrate-induced gene-expression screening of environmental


metagenome libraries for isolation of catabolic genes. Nature Biotechnology, v. 23,
n. 1, p. 88-93, 2005.

VAN DE PEER, Y.; CHAPELLE, S.; DE WACHTER, R. A quantitative map of


nucleotide substituion rates in bacterial rRNA. Nucleic Acids Research, v. 24, n 17,
p. 3381-3391, 1996.

VARGAS, M. A. T.; HUNGRIA., E.D.; VARGAS, M. A. T.; Biologia dos solos dos
Cerrados. Planaltina: EMBRAPA-CPAC, p. 34, 1997. -CPAC, p. 34, 1997.

VON WALLBRUNN, A.; HEIPIEPER, H.J.; MEINHARDT, F. Cis/trans isomerisation of


unsaturated fatty acids in a cardiolipin synthase knock-out mutant of Pseudomonas
putida. Applied Microbiology and Biotechnology. n.1-2, v.60, p.179-185, 2002.

YEATS, C. et al. Methods for microbial DNA extraction from soil for PCR amplification.
Biological procedures online. v. 1, n. 1, 1998.

WANG, J.; JENKINS, C.; WEBB, R.I.; FUERST, J.A. Isolation of Gemmata-like and
Isosphaera-like planctomycete bacteria from soil and freshwater. Applied and
Environmental Microbiology, v.68, p. 417-422, 2002.

WARD, D.M. ; FERRIS, M,J.; NOLD, S.N.; BATESON, M.M. A natural view of
microbial biodiversity within hot spring cyanobacterial mat communities. Microbiology
and Molecular Biology Reviews, v. 62, p. 13531370. 1998b.

WARD, D.M. A natural species concept for prokaryotes. Current Opinion in


Microbiology, n. 3, v. 1, p. 271-277, 1998.

76

WILLIAMS, S.T.; SHARPE, M.E. & HOLT, J.G. (eds.). 1989. Bergey.s manual of
systematic bacteriology. Volume 4: Actinomycetes. Baltimore: Williams & Wilkins, Co.

WILSON, E.O. The current state of biology diversity. Biodiversity. National


Academy Press, p. 3-18, 1988.

WHITMAN, W.B.; COLEMAN, D.C.; WIEBE, W.J. Prokaryotes: the unseen majority.
Proceedings of the National Academy of Sciences of the United States of
America, v. 95, p. 65786583, 1998.

WHITEHOUSE, C.A.; HOTTEL, H.E. Comparison of five commercial DNA extraction


kits for the recovery of Francisella tularensis DNA from spiked soil samples.
Molecular and Cellular Probes, v. 21, p.9296, 2007.

WOESE C.R.; FOX, G.E. Phylogenetic structure of the prokaryotic domain: The
primary kingdoms. Proceedings of the National Academy of Sciences of the
United States of America, v. 74, p. 5088-5090, 1977.

WOESE, C.R.; GUTELL, R.; GUPTA, R.; NOLLER, H.F. Detailed Analysis of the
Higher-Order Structure of 16S-Like Ribosomal Ribonucleic Acids. Microbiological
Reviews, v. 47, n. 4, p. 621-669, 1983.

WOESE, C.R.; KANDLER, O.; WHEELIS, M.L. Towards a natural system of


organisms: proposal for the domains Archaea, Bacteria and Eucarya. Proceedings of
the National Academy of Sciences of the United States of Amrica, v. 87, p.
45764579, 1990.

WOESE, C. R. Bacterial evolution. Microbiological Reviews, n. 2, v. 51, p. 221271,


1987.

WOLFGANG, R.S.; ROLF, D.; KARL-ERICH, J. Prospecting for biocatalysts and


drugs in the geneomes of non-cultured microorganisms. Current opinion. v. 15, p.
285-290, 2004.

77

WILSON, E.O. The current state of biology diversity. In: WILSON, E.O. (Org.).
Biodiversity. Washington: National Academy Press, p. 3-18, 1998.

ZAK, J.C.; WILLIG, M.R.; MOORHEAD, D.L.; WILDMAN, H.G. Functional diversity of
microbial communities: a quantitative approach. Soil Biology and Biochemistry, n.
9, v. 26, p. 1101-1108, 1994.

78

8. APNDICES

1. Dendograma feito a partir de resultados obtidos pela tcnica de ARDRA.

79

2. Matriz binria das 34 amostras

A lu I 1
A lu I 2
A lu I 3
A lu I 4
A lu I 5
A lu I 6
A lu I 7
A lu I 8
A lu I 9
A lu I 1 0
H haI 1
H haI 2
H haI 3
H haI 4
H haI 5
H haI 6
H haI 7
H haI 8
H haI 9
H haI 10
H haI 11
M spI 1
M spI 2
M spI 3
M spI 4
M spI 5
M spI 6
M spI 7
M spI 8
M spI 9
M spI 10
M spI 11
M spI 12
M spI 13
M spI 14
M spI 15
M spI 16
M spI 17
M spI 18
M spI 19
M spI 20
M spI 21
M spI 22
M spI 23
M spI 24
M spI 25

A1 B1 C 1 D1 E1 F1 G 1 H 1 A2 B2 C 2 E2 G 2 H 2 B3 C3 F3 H 3 C4 E4 F7 G 7 H 7 F8 G 8 H 8 F9 G 9 H 9 D 10 E10 F10 G 10 H 10
0
0
0
0
0
0
0
0
1
1
0
0
0
0
0
1
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
1
0
0
1
0
0
1
0
1
0
0
1
0
0
1
0
1
0
1
1
1
1
0
0
0
1
0
1
1
1
0
0
1
1
0
0
0
0
1
1
0
1
0
1
1
0
1
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
1
1
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
1
0
1
0
0
0
0
0
0
1
0
0
0
0
0
0
0
1
1
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
1
0
1
1
1
1
1
1
0
0
0
0
1
1
1
0
1
1
0
0
1
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
1
1
1
1
0
0
0
0
0
1
0
0
0
1
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
1
0
0
0
0
1
0
0
0
1
0
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
0
1
1
1
1
1
1
0
1
1
1
1
0
1
1
1
1
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
1
0
1
1
1
0
1
0
0
0
0
0
0
0
0
0
0
0
1
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
1
0
0
0
0
1
1
0
0
0
0
0
1
0
0
0
1
0
0
0
0
0
0
1
0
0
1
1
1
1
1
1
1
1
0
1
0
1
0
0
0
0
1
0
0
1
0
0
1
0
0
0
0
1
0
0
1
0
1
1
1
0
1
0
0
0
1
0
1
1
1
0
1
1
1
1
1
1
1
0
1
0
0
0
1
1
1
1
1
1
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
1
1
0
0
1
0
0
0
0
1
0
0
1
0
1
1
1
1
0
1
1
1
1
1
1
1
1
0
0
1
1
1
1
1
0
0
1
0
0
1
1
0
1
0
1
1
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
1
0
1
0
0
0
0
1
1
1
1
0
0
0
0
0
1
1
0
0
0
0
0
0
0
1
1
0
1
1
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
1
0
0
0
0
0
0
1
0
0
1
0
0
1
0
0
0
0
1
0
1
1
1
1
1
1
1
1
0
1
1
1
1
1
0
1
1
1
1
1
0
0
1
1
0
0
1
0
1
1
1
1
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
1
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
1
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
1
1
1
0
1
0
0
0
0
0
1
0
1
0
1
1
0
1
0
0
1
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
1
0
1
0
0
0
0
0
0
0
1
1
1
1
1
1
1
1
0
0
1
1
1
1
0
1
0
0
0
1
0
1
0
0
0
0
0
0
0
0
0
0
1
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
1
0
1
0
0
0
0
0
1
1
0
0
1
0
1
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
1
1
0
0
1
0
0
0
0
1
0
0
0
1
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
1
1
1
1
1
1
0
1
0
1
0
0
0
0
1
1
1
0
1
1
1
1
0
0
0
0
0
1
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
1
1
0
0
0
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
1
0
1
0
0
1
1
1
1
1
1
0
1
1
1
1
1
1
0
1
1
1
1
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
1
1
1
0
1
1
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0
0
0
0
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1
0
0
0

80

3. Matriz gerada pelos dados de sequenciamento da biblioteca 16S do solo de Mata Atlntica
A (%) antes do nome indica os resultados obtidos usando o primer reverso da seqncia consultada. Para o domnio bactria e Archaea, obteve-se sempre homologia de 100%, por isto foi excluso da tabela.
O nvel de ideal confiana considerado foi maior ou igual a 80%
Lineage: Root(774)
Details:
P01/A01

Bactria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

97,00%

Pseudomonadales

88,00%

Moraxellaceae

84,00%

Acinetobacter

P01/A02

Bactria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

74,00%

P01/A03

Bactria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

84,00%

P01/A04

Bactria

85,00%

Firmicutes

44,00%

Bacilli

19,00%

Bacillales

16,00%

Bacillaceae

13,00%

Filobacillus

P01/A09

Bactria

91,00%

Firmicutes

35,00%

Bacilli

22,00%

Bacillales

20,00%

Planococcaceae

11,00%

Filibacter

11,00%

P01/A10

Bactria

100,00%

Proteobacteria

98,00%

Gammaproteobacteria

98,00%

Enterobacteriales

94,00%

Enterobacteriaceae

94,00%

Leclercia

43,00%

P01/A11

Archaea

18,00%

Euryarchaeota

8,00%

P01/A12

Bactria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

P01/B02

Bacteria

98,00%

Firmicutes

74,00%

P01/B03

Bacteria

100,00%

Firmicutes

100,00%

P01/B10

Bacteria

96,00%

Firmicutes

P01/B11

Bacteria

78,00%

P01/B12

Bacteria

96,00%

P01/C01

Bacteria

88,00%

P01/C03

Archaea

65,00%

P01/C04

Bacteria

P01/C05
P01/C10

Methanopyri

3,00%

Methanopyrales

3,00%

Methanopyraceae

3,00%

Methanopyrus

80,00%

6,00%

3,00%

98,00%

Enterobacteriales

96,00%

Enterobacteriaceae

96,00%

Trabulsiella

Bacilli

68,00%

Bacillales

67,00%

Planococcaceae

34,00%

Filibacter

34,00%

Bacilli

100,00%

Bacillales

91,00%

Bacillaceae

85,00%

Bacillus

52,00%

48,00%

Bacilli

33,00%

Bacillales

30,00%

Bacillaceae

10,00%

Jeotgalibacillus

Proteobacteria

47,00%

Gammaproteobacteria

38,00%

Enterobacteriales

26,00%

Enterobacteriaceae

26,00%

Trabulsiella

5,00%

Firmicutes

68,00%

Bacilli

55,00%

Bacillales

28,00%

Bacillaceae

24,00%

Jeotgalibacillus

3,00%

Proteobacteria

30,00%

Alphaproteobacteria

19,00%

Rhodobacterales

16,00%

Rhodobacteraceae

16,00%

Rubrimonas

16,00%

Euryarchaeota

56,00%

Thermococci

14,00%

Thermococcales

14,00%

Thermococcaceae

14,00%

Palaeococcus

14,00%

100,00%

Acidobacteria

83,00%

Acidobacteria

83,00%

Acidobacteriales

83,00%

Acidobacteriaceae

83,00%

Gp2

83,00%

Archaea

28,00%

Crenarchaeota

18,00%

Thermoprotei

18,00%

Desulfurococcales

13,00%

Desulfurococcaceae

12,00%

Sulfophobococcus

11,00%

Bacteria

98,00%

Proteobacteria

94,00%

Gammaproteobacteria

67,00%

Pseudomonadales

31,00%

Moraxellaceae

25,00%

Alkanindiges

25,00%

P01/C11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P01/C12

Bacteria

94,00%

Proteobacteria

79,00%

Gammaproteobacteria

74,00%

Enterobacteriales

73,00%

Enterobacteriaceae

73,00%

Leclercia

46,00%

P01/D01

Bacteria

99,00%

Firmicutes

93,00%

Bacilli

85,00%

Bacillales

60,00%

Bacillaceae

48,00%

Jeotgalibacillus

33,00%

P01/D02

Bacteria

90,00%

Proteobacteria

56,00%

Gammaproteobacteria

27,00%

Methylococcales

3,00%

Methylococcaceae

3,00%

Methylosphaera

3,00%

P01/D03

Archaea

39,00%

Crenarchaeota

14,00%

Thermoprotei

14,00%

Thermoproteales

11,00%

Thermoproteaceae

10,00%

Thermoproteus

10,00%

P01/D04

Bacteria

100,00%

Proteobacteria

92,00%

Gammaproteobacteria

74,00%

Alteromonadales

13,00%

Incertae sedis 7

8,00%

P01/D05

Bacteria

90,00%

Cyanobacteria

3,00%

Cyanobacteria

Microcystis

1,00%

P01/D11

Archaea

58,00%

Crenarchaeota

45,00%

Thermoprotei

45,00%

Desulfurococcales

29,00%

Pyrodictiaceae

11,00%

Pyrolobus

P01/D12

Bacteria

87,00%

Firmicutes

26,00%

Clostridia

21,00%

Clostridiales

19,00%

Clostridiaceae

13,00%

Soehngenia

P01/E01

Bacteria

95,00%

Firmicutes

50,00%

Bacilli

37,00%

Bacillales

35,00%

Bacillaceae

22,00%

Jeotgalibacillus

12,00%

P01/E02

Bacteria

99,00%

Proteobacteria

97,00%

Gammaproteobacteria

96,00%

Enterobacteriales

93,00%

Enterobacteriaceae

93,00%

Leclercia

20,00%

P01/E04

Archaea

43,00%

Euryarchaeota

33,00%

Thermoplasmata

14,00%

Thermoplasmatales

14,00%

Picrophilaceae

11,00%

Picrophilus

11,00%

3,00%

81

Family 1.1

3,00%

Alishewanella

87,00%

5,00%

8,00%

10,00%
5,00%

P01/E05

Bacteria

100,00%

Planctomycetes

98,00%

Planctomycetacia

98,00%

Planctomycetales

98,00%

Planctomycetaceae

98,00%

Isosphaera

98,00%

P01/E06

Archaea

24,00%

Crenarchaeota

24,00%

Thermoprotei

24,00%

Desulfurococcales

24,00%

Desulfurococcaceae

24,00%

Acidilobus

24,00%

P01/E08

Bacteria

97,00%

Bacteroidetes

10,00%

Flavobacteria

9,00%

P01/E09

Bacteria

81,00%

Proteobacteria

51,00%

Gammaproteobacteria

P01/E10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P01/E11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P01/E12

Bacteria

92,00%

Proteobacteria

85,00%

Gammaproteobacteria

70,00%

Pseudomonadales

41,00%

P01/F01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P01/F02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P01/F03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

97,00%

Bacillaceae

67,00%

P01/F04

Bacteria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

98,00%

Enterobacteriales

98,00%

Enterobacteriaceae

98,00%

Trabulsiella

57,00%

P01/F06

Archaea

43,00%

Crenarchaeota

22,00%

Thermoprotei

22,00%

Thermoproteales

12,00%

Thermoproteaceae

10,00%

Thermoproteus

10,00%

P01/F10

Bacteria

60,00%

Planctomycetes

12,00%

Planctomycetacia

12,00%

Planctomycetales

12,00%

Planctomycetaceae

12,00%

Isosphaera

11,00%

P01/F11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

100,00%

26,00%

Flavobacteriales
Pseudomonadales

9,00%

Flavobacteriaceae

7,00%

Pseudomonadaceae

89,00%

Bacillaceae
Enterobacteriaceae
Moraxellaceae

6,00%

Epilithonimonas

7,00%

Flavimonas

89,00%

Bacillus

2,00%
6,00%
63,00%

100,00%

Trabulsiella

90,00%

21,00%

Alkanindiges

19,00%

100,00%

Leclercia

53,00%

100,00%

Citrobacter

26,00%

Paucisalibacillus

13,00%

P01/F12

Bacteria

92,00%

Proteobacteria

73,00%

Gammaproteobacteria

60,00%

Xanthomonadales

48,00%

Xanthomonadaceae

48,00%

Luteimonas

35,00%

P01/G02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

99,00%

Enterobacteriales

98,00%

Enterobacteriaceae

98,00%

Leclercia

55,00%

P01/G03

Bacteria

100,00%

Firmicutes

Bacilli

96,00%

Bacillales

95,00%

Caryophanaceae

46,00%

Caryophanon

46,00%

P01/G04

Bacteria

100,00%

Proteobacteria

100,00%

Leclercia

38,00%

P01/G09

Archaea

36,00%

Euryarchaeota

23,00%

Archaeoglobi

P01/G10

Bacteria

85,00%

Firmicutes

58,00%

Bacilli

49,00%

Bacillales

P01/G11

Archaea

15,00%

Crenarchaeota

10,00%

Thermoprotei

10,00%

Desulfurococcales

6,00%

P01/H01

Bacteria

96,00%

Bacteroidetes

17,00%

Sphingobacteria

15,00%

Sphingobacteriales

15,00%

P01/H03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

P01/H09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

P01/H10

Archaea

12,00%

Crenarchaeota

10,00%

Thermoprotei

10,00%

Desulfurococcales

P01/H11

Bacteria

100,00%

Firmicutes

78,00%

Bacilli

67,00%

Bacillales

44,00%

Bacillaceae

97,00%

Gammaproteobacteria

100,00%
8,00%

Enterobacteriales
Archaeoglobales

100,00%
8,00%
35,00%

8,00%

Enterobacteriaceae
Archaeoglobaceae
Planococcaceae
Desulfurococcaceae
Crenotrichaceae

Pyrodictiaceae

100,00%
8,00%
16,00%

Ferroglobus
Filibacter

7,00%
16,00%

6,00%

Thermodiscus

5,00%

12,00%

Rhodothermus

11,00%

100,00%

Stenotrophomonas

99,00%

100,00%

Stenotrophomonas

98,00%

7,00%

Pyrolobus

34,00%

Paraliobacillus

2,00%
11,00%

P01/H12

Bacteria

98,00%

Firmicutes

46,00%

Bacilli

32,00%

Bacillales

31,00%

Planococcaceae

12,00%

Filibacter

2,00%

P02/A03

Archaea

29,00%

Crenarchaeota

14,00%

Thermoprotei

14,00%

Desulfurococcales

10,00%

Desulfurococcaceae

10,00%

Acidilobus

4,00%

P02/A04

Bacteria

91,00%

Thermodesulfobacteria

P02/A05

Bacteria

100,00%

Firmicutes

99,00%

Bacilli

97,00%

Bacillales

97,00%

Caryophanaceae

39,00%

Caryophanon

39,00%

P02/A06

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

94,00%

Bacillaceae

90,00%

Bacillus

73,00%

P02/A07

Archaea

59,00%

Crenarchaeota

28,00%

Thermoproteus

P02/A09

Bacteria

100,00%

Proteobacteria

100,00%

P02/A11

Bacteria

99,00%

Firmicutes

82,00%

Bacilli

76,00%

Bacillales

68,00%

Bacillaceae

34,00%

Ornithinibacillus

14,00%

P02/B02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

89,00%

Planococcaceae

37,00%

Filibacter

33,00%

P02/B03

Bacteria

100,00%

Firmicutes

78,00%

Bacilli

72,00%

Bacillales

71,00%

Bacillaceae

57,00%

Jeotgalibacillus

42,00%

P02/B04

Bacteria

100,00%

Proteobacteria

9,00%

100,00%

Thermodesulfobacteria

Thermoprotei
Gammaproteobacteria

Gammaproteobacteria

9,00%

Thermodesulfobacteriales

9,00%

Thermodesulfobacteriaceae

9,00%

28,00%

Thermoproteales

17,00%

Thermoproteaceae

17,00%

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

100,00%

82

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Thermodesulfatator

Stenotrophomonas

Acinetobacter

9,00%

6,00%
95,00%

100,00%

P02/B05

Bacteria

100,00%

Firmicutes

99,00%

Bacilli

97,00%

Bacillales

85,00%

Bacillaceae

84,00%

Jeotgalibacillus

31,00%

P02/B06

Bacteria

99,00%

Proteobacteria

83,00%

Gammaproteobacteria

46,00%

Pseudomonadales

16,00%

Moraxellaceae

13,00%

Alkanindiges

12,00%

P02/B09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Shigella

32,00%

P02/B10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

70,00%

P02/B11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

P02/B12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

P02/C02

Bacteria

100,00%

Proteobacteria

98,00%

Gammaproteobacteria

98,00%

Enterobacteriales

98,00%

Enterobacteriaceae

98,00%

Salmonella

40,00%

P02/C03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Shigella

49,00%

P02/C04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Shigella

43,00%

P02/C05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

Caryophanon

52,00%

P02/C09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

25,00%

P02/C10

Bacteria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

99,00%

Enterobacteriales

97,00%

Enterobacteriaceae

97,00%

Leclercia

35,00%

P02/C11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

39,00%

P02/C12

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

Caryophanon

91,00%

P02/D01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

Flavimonas

95,00%

P02/D02

Bacteria

63,00%

Firmicutes

28,00%

Bacilli

18,00%

Bacillales

18,00%

Bacillaceae

13,00%

Halolactibacillus

P02/D03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

99,00%

Bacillales

99,00%

Caryophanaceae

42,00%

Caryophanon

P02/D04

Bacteria

100,00%

Proteobacteria

Gammaproteobacteria

94,00%

Xanthomonadales

80,00%

Xanthomonadaceae

80,00%

Stenotrophomonas

35,00%

P02/D10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

97,00%

Bacillales

74,00%

Bacillaceae

67,00%

Jeotgalibacillus

26,00%

98,00%

99,00%

Bacillales

98,00%

Caryophanaceae

50,00%

Caryophanon

50,00%

100,00%

Acinetobacter

100,00%

52,00%

91,00%
100,00%

3,00%
42,00%

P02/D12

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

75,00%

Caryophanon

75,00%

P02/E03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P02/E04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Kluyvera

42,00%

P02/E09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

99,00%

P02/E12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

99,00%

P02/F01

Bacteria

100,00%

Proteobacteria

90,00%

Gammaproteobacteria

69,00%

Pseudomonadales

49,00%

Moraxellaceae

49,00%

Alkanindiges

45,00%

P02/F02

Bacteria

100,00%

Firmicutes

98,00%

Bacilli

93,00%

Bacillales

91,00%

Planococcaceae

25,00%

Filibacter

23,00%

P02/F03

Bacteria

100,00%

Proteobacteria

P02/F04

Bacteria

93,00%

P02/F05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

P02/F06

Bacteria

97,00%

Proteobacteria

60,00%

Gammaproteobacteria

39,00%

Enterobacteriales

21,00%

Enterobacteriaceae

P02/F09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

99,00%

Bacillales

90,00%

Bacillaceae

P02/F11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

P02/G02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

P02/G03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

99,00%

Bacillales

99,00%

Caryophanaceae

61,00%

Caryophanon

61,00%

P02/G04

Bacteria

100,00%

Proteobacteria

Gammaproteobacteria

97,00%

Enterobacteriales

96,00%

Enterobacteriaceae

96,00%

Leclercia

66,00%

P02/G05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Bacillaceae

62,00%

Jeotgalibacillus

38,00%

P02/G06

Bacteria

100,00%

Firmicutes

99,00%

Bacilli

97,00%

Bacillales

90,00%

Bacillaceae

84,00%

Paraliobacillus

22,00%

Firmicutes

100,00%
21,00%

97,00%

Gammaproteobacteria
Mollicutes

100,00%

Pseudomonadales

100,00%

8,00%

Anaeroplasmatales

8,00%

83

Moraxellaceae
Anaeroplasmataceae

100,00%
8,00%

Acinetobacter
Asteroleplasma

100,00%
8,00%

Citrobacter

24,00%

21,00%

Sodalis

11,00%

89,00%

Paucisalibacillus

24,00%
100,00%
66,00%

P02/G07

Bacteria

91,00%

Proteobacteria

66,00%

Gammaproteobacteria

57,00%

Pseudomonadales

49,00%

Pseudomonadaceae

49,00%

P02/G09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

P02/G10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

P02/G11

Archaea

57,00%

Methanopyrales

P02/H03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P02/H04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P02/H06

Archaea

26,00%

Crenarchaeota

18,00%

Thermoprotei

18,00%

Thermoproteales

8,00%

Thermofilaceae

6,00%

Thermofilum

6,00%

P02/H08

Bacteria

100,00%

Proteobacteria

98,00%

Gammaproteobacteria

96,00%

Pseudomonadales

84,00%

Moraxellaceae

82,00%

Acinetobacter

69,00%

Thermoprotei

12,00%

Thermoproteales

11,00%

Thermoproteaceae

11,00%

Thermoproteus

Euryarchaeota

28,00%

Methanopyri

P02/H09

Archaea

28,00%

Crenarchaeota

12,00%

P03/A01

Bacteria

100,00%

100,00%

P03/A02

Bacteria

90,00%

Proteobacteria
DeinococcusThermus

P03/A03

Bacteria

100,00%

Proteobacteria

80,00%

Gammaproteobacteria

P03/A04

Bacteria

100,00%

Proteobacteria

100,00%

P03/A05

Bacteria

100,00%

Firmicutes

100,00%

P03/A06

Bacteria

100,00%

Firmicutes

P03/A07

Bacteria

100,00%

P03/A09

Bacteria

100,00%

P03/A10

Bacteria

P03/A11
P03/A12

9,00%

Gammaproteobacteria
Deinococci

99,00%
16,00%

100,00%
9,00%

Bacillales

Pseudomonadales
Thermales

68,00%

Xanthomonadales

Gammaproteobacteria

100,00%

Bacilli

100,00%

100,00%

Bacilli

Firmicutes

100,00%

Proteobacteria

100,00%

100,00%

Proteobacteria

Bacteria

100,00%

Bacteria

100,00%

P03/B01

Bacteria

P03/B02

Bacteria

P03/B03
P03/B04

75,00%

Flavimonas

49,00%

Stenotrophomonas

97,00%

Paucisalibacillus

11,00%

Bacillaceae

74,00%

16,00%

Methanopyraceae

16,00%

Methanopyrus

16,00%

96,00%

Planococcaceae

46,00%

Filibacter

46,00%

100,00%

Leclercia

39,00%

100,00%
9,00%

Enterobacteriaceae

Moraxellaceae
Thermaceae

100,00%
9,00%

Acinetobacter
Vulcanithermus

7,00%
100,00%
9,00%

51,00%

Xanthomonadaceae

51,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Bacillales

100,00%

Caryophanaceae

71,00%

100,00%

Bacillales

100,00%

Caryophanaceae

Bacilli

100,00%

Bacillales

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

99,00%

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

62,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacteria

100,00%

Proteobacteria

97,00%

Gammaproteobacteria

96,00%

Pseudomonadales

84,00%

P03/B05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P03/B06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

90,00%

Pseudomonadales

68,00%

P03/B07

Bacteria

84,00%

Proteobacteria

38,00%

Gammaproteobacteria

22,00%

Xanthomonadales

14,00%

P03/B09

Archaea

24,00%

Euryarchaeota

20,00%

Methanobacteria

P03/B10

Bacteria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

99,00%

Enterobacteriales

P03/B11

Bacteria

98,00%

Cyanobacteria

14,00%

Cyanobacteria

14,00%

Family 3.1

P03/B12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P03/C01

Bacteria

100,00%

Proteobacteria

83,00%

P03/C02

Bacteria

100,00%

Proteobacteria

100,00%

P03/C03

Bacteria

100,00%

Proteobacteria

P03/C04

Bacteria

100,00%

Proteobacteria

P03/C05

Bacteria

100,00%

P03/C07

Bacteria

100,00%

5,00%

99,00%

99,00%

Bacillaceae

Caryophanaceae

22,00%

Leclercia

41,00%

Caryophanon

71,00%

78,00%

Caryophanon

78,00%

99,00%

Bacillus

90,00%

Caryophanon

68,00%

100,00%

68,00%

Raoultella

33,00%

Enterobacteriaceae

100,00%

Erwinia

39,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

97,00%

100,00%

Enterobacteriaceae

Enterobacteriales

100,00%

Xanthomonadales

100,00%

Bacillales

100,00%

Caryophanaceae

62,00%

Caryophanon

62,00%

Moraxellaceae

84,00%

Acinetobacter

81,00%

100,00%

Enterobacter

31,00%

Moraxellaceae

66,00%

Acinetobacter

51,00%

Xanthomonadaceae

14,00%

Xylella

4,00%

Methanothermobacter

5,00%

Methanobacteriales

5,00%
96,00%
8,00%
100,00%

Enterobacteriaceae

Methanobacteriaceae
Enterobacteriaceae
Halospirulina

100,00%

Xanthomonadales

Gammaproteobacteria

71,00%

Pseudomonadales

50,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

84

Xylella

99,00%

Xanthomonadaceae
Moraxellaceae

5,00%
96,00%

Leclercia

50,00%

8,00%
100,00%

100,00%

Acinetobacter

46,00%

100,00%

Citrobacter

46,00%

Enterobacteriaceae

100,00%

Escherichia

Moraxellaceae

100,00%

Acinetobacter

100,00%

Enterobacteriaceae

100,00%

Enterobacter

68,00%

Bacillus

83,00%

Bacillaceae

46,00%

Stenotrophomonas

98,00%

30,00%

P03/C08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

P03/C09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

P03/C10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

P03/C11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P03/C12

Bacteria

100,00%

Proteobacteria

96,00%

Gammaproteobacteria

95,00%

Pseudomonadales

93,00%

Moraxellaceae

93,00%

Acinetobacter

93,00%

P03/D01

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

Caryophanaceae

74,00%

Caryophanon

74,00%

P03/D03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

98,00%

Xanthomonadaceae

98,00%

Stenotrophomonas

78,00%

P03/D04

Bacteria

98,00%

Firmicutes

80,00%

Bacilli

77,00%

Bacillales

69,00%

Bacillaceae

36,00%

Jeotgalibacillus

20,00%

P03/D05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

91,00%

Bacillaceae

88,00%

Bacillus

49,00%

P03/D06

Bacteria

100,00%

Firmicutes

96,00%

Bacilli

91,00%

Bacillales

82,00%

Bacillaceae

73,00%

Jeotgalibacillus

P03/D07

Bacteria

100,00%

Proteobacteria

P03/D08

Bacteria

99,00%

Bacteroidetes

24,00%

P03/D09

Bacteria

100,00%

Proteobacteria

100,00%

Alphaproteobacteria

100,00%

P03/D11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

100,00%

Gammaproteobacteria

100,00%

100,00%

Gammaproteobacteria
Sphingobacteria

100,00%

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

17,00%

Sphingobacteriales

17,00%

Flexibacteraceae

Caulobacterales

96,00%

Caulobacteraceae

Bacillales

100,00%

Caryophanaceae

Xanthomonadales

100,00%

71,00%

8,00%

Flavimonas

95,00%

16,00%

Emticicia

10,00%

96,00%

Phenylobacterium

69,00%

47,00%

Caryophanon

47,00%

P03/D12

Bacteria

100,00%

Proteobacteria

Stenotrophomonas

99,00%

P03/E01

Bacteria

100,00%

Firmicutes

97,00%

Bacilli

97,00%

Bacillales

70,00%

Bacillaceae

60,00%

Jeotgalibacillus

15,00%

P03/E02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Bacillaceae

99,00%

Bacillus

94,00%

P03/E03

Bacteria

84,00%

Firmicutes

26,00%

Bacilli

12,00%

Bacillales

7,00%

Bacillaceae

4,00%

P03/E04

Bacteria

100,00%

Proteobacteria

86,00%

Gammaproteobacteria

80,00%

Pseudomonadales

54,00%

Pseudomonadaceae

P03/E05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

P03/E06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P03/E07

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

P03/E09

Bacteria

100,00%

Proteobacteria

100,00%

Betaproteobacteria

100,00%

Burkholderiales

100,00%

P03/E10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

P03/E11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

P03/E12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

P03/F01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

P03/F02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

P03/F03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P03/F04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P03/F05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P03/F06

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

61,00%

Caryophanon

61,00%

P03/F07

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

98,00%

Bacillaceae

74,00%

Jeotgalibacillus

47,00%

P03/F08

Bacteria

100,00%

Proteobacteria

100,00%

Betaproteobacteria

100,00%

Burkholderiales

100,00%

Comamonadaceae

100,00%

P03/F09

Bacteria

81,00%

Proteobacteria

31,00%

Alphaproteobacteria

23,00%

Rhodospirillales

17,00%

Acetobacteraceae

17,00%

Paracraurococcus

P03/F10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Caryophanaceae

53,00%

Caryophanon

P03/F11

Bacteria

96,00%

Firmicutes

74,00%

Bacilli

36,00%

Bacillales

34,00%

Bacillaceae

26,00%

Paucisalibacillus

85

Xanthomonadaceae

100,00%

61,00%
100,00%

100,00%

Paucisalibacillus

2,00%

54,00%

Flavimonas

30,00%

Pseudomonadaceae

100,00%

Flavimonas

95,00%

Enterobacteriaceae

100,00%

Erwinia

78,00%

51,00%

Caryophanon

51,00%

Burkholderiaceae

100,00%

Burkholderia

99,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

85,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

Moraxellaceae

100,00%

Acinetobacter

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

97,00%

100,00%

Enterobacteriaceae

100,00%

Citrobacter

54,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

24,00%

Pseudomonadales

98,00%

Acinetobacter

93,00%

Leclercia

43,00%

Moraxellaceae

96,00%
100,00%

Variovorax

98,00%
100,00%

100,00%
6,00%
53,00%
7,00%

P03/F12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

56,00%

P03/G01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

63,00%

P03/G02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

98,00%

P03/G04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

53,00%

P03/G05

Archaea

47,00%

P03/G06

Bacteria

P03/G07
P03/G09

Caryophanaceae

53,00%

Caryophanon

Crenarchaeota

27,00%

Thermoprotei

27,00%

Thermoproteales

11,00%

Thermoproteaceae

11,00%

Thermoproteus

7,00%

100,00%

Firmicutes

97,00%

Bacilli

95,00%

Bacillales

84,00%

Bacillaceae

75,00%

Jeotgalibacillus

33,00%

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Caryophanaceae

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

P03/G10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P03/G11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P03/H01

Bacteria

100,00%

Proteobacteria

74,00%

Gammaproteobacteria

P03/H02

Bacteria

100,00%

Proteobacteria

100,00%

P03/H03

Bacteria

100,00%

Proteobacteria

100,00%

P03/H04

Bacteria

96,00%

Bacteroidetes

37,00%

P03/H05

Bacteria

100,00%

Proteobacteria

100,00%

P03/H06

Bacteria

100,00%

Firmicutes

100,00%

P03/H07

Bacteria

100,00%

Proteobacteria

P03/H08

Bacteria

100,00%

Proteobacteria

P03/H09

Bacteria

100,00%

Firmicutes

P03/H10

Bacteria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

99,00%

Pseudomonadales

99,00%

P03/H11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

62,00%

Caryophanon

62,00%

100,00%

Enterobacteriaceae

100,00%

Enterobacter

69,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

92,00%

74,00%

Pseudomonadales

72,00%

Pseudomonadaceae

72,00%

Flavimonas

67,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

25,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Buttiauxella

33,00%

30,00%

Flavobacteriales

30,00%

Flavobacteriaceae

30,00%

Kordia

15,00%

Gammaproteobacteria

100,00%

Enterobacteriales

98,00%

Enterobacteriaceae

98,00%

Leclercia

49,00%

Bacilli

100,00%

Bacillales

100,00%

Bacillaceae

100,00%

Bacillus

99,00%

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

64,00%

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

53,00%

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

56,00%

Caryophanon

56,00%

Moraxellaceae

98,00%

Acinetobacter

98,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

Flavobacteria

P03/H12

Bacteria

97,00%

Firmicutes

51,00%

Bacilli

39,00%

Lactobacillales

23,00%

Carnobacteriaceae

20,00%

Isobaculum

P04/A01

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

95,00%

Bacillales

86,00%

Bacillaceae

81,00%

Paraliobacillus

20,00%

P04/A02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Acinetobacter

100,00%

P04/A03

Bacteria

96,00%

Proteobacteria

32,00%

Gammaproteobacteria

16,00%

Enterobacteriales

P04/A04

Bacteria

98,00%

Proteobacteria

60,00%

Gammaproteobacteria

40,00%

Pasteurellales

P04/A05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P04/A06

Bacteria

75,00%

P04/A07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P04/A08

Bacteria

95,00%

Proteobacteria

37,00%

Gammaproteobacteria

17,00%

Enterobacteriales

13,00%

P04/A09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

P04/A10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P04/A11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P04/A12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

P04/B01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

P04/B02

Bacteria

100,00%

Proteobacteria

100,00%

Alphaproteobacteria

93,00%

Hyphomicrobiaceae

P04/B03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

Chloroflexi

4,00%

Chloroflexi

4,00%

97,00%
100,00%

86

Enterobacteriales
Chloroflexales

Rhizobiales
Pseudomonadales

100,00%
9,00%
19,00%
100,00%
4,00%

99,00%

100,00%

Moraxellaceae
Enterobacteriaceae

Pragia

6,00%

19,00%

Nicoletella

8,00%

100,00%

Citrobacter

37,00%

4,00%

Roseiflexus

3,00%

Enterobacteriaceae

100,00%

Citrobacter

68,00%

Enterobacteriaceae

13,00%

Buchnera

13,00%

Pasteurellaceae
Enterobacteriaceae
Chloroflexaceae

Moraxellaceae

9,00%

18,00%

100,00%

Acinetobacter

95,00%

Paenibacillus

95,00%

100,00%

Citrobacter

61,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

99,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

63,00%

Paenibacillaceae

Moraxellaceae

50,00%
100,00%

Prosthecomicrobium
Acinetobacter

100,00%

45,00%
100,00%

P04/B04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Buttiauxella

47,00%

P04/B05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

92,00%

P04/B06

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

41,00%

Caryophanon

41,00%

P04/B07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonas

81,00%

P04/B08

Bacteria

98,00%

Firmicutes

28,00%

Jeotgalibacillus

17,00%

11,00%

Bifidobacteriaceae

41,00%

Bacilli
Actinobacteria

36,00%

Bacillales

17,00%

Actinobacteridae

82,00%
100,00%

Caryophanaceae
Pseudomonadaceae

32,00%

Bacillaceae

15,00%

Bifidobacteriales

P04/B09

Bacteria

95,00%

Actinobacteria

17,00%

P04/B10

Bacteria

100,00%

Proteobacteria

100,00%

P04/B12

Bacteria

92,00%

P04/C01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

100,00%

P04/C02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

100,00%

P04/C03

Bacteria

100,00%

Firmicutes

80,00%

Bacilli

59,00%

Bacillales

51,00%

P04/C04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P04/C06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P04/C07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P04/C08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P04/C09

Bacteria

97,00%

P04/C10

Bacteria

100,00%

P04/C11

Bacteria

93,00%

P04/D01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

P04/D02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P04/D03

Bacteria

95,00%

Proteobacteria

41,00%

Deltaproteobacteria

12,00%

Bdellovibrionales

P04/D04

Archaea

11,00%

Euryarchaeota

11,00%

Thermoplasmata

11,00%

Thermoplasmatales

P04/D05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

98,00%

Bacillales

P04/D06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P04/D07

Bacteria

84,00%

Proteobacteria

34,00%

Gammaproteobacteria

P04/D08

Bacteria

100,00%

Proteobacteria

42,00%

Alphaproteobacteria

P04/D09

Bacteria

81,00%

Proteobacteria

37,00%

Deltaproteobacteria

P04/D10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

Firmicutes

Firmicutes
Proteobacteria
Firmicutes

32,00%

71,00%
100,00%
38,00%

Alphaproteobacteria
Bacilli

Bacilli
Gammaproteobacteria
Bacilli

100,00%
21,00%

50,00%
100,00%
27,00%

100,00%
7,00%
28,00%
8,00%

Rhizobiales
Bacillales

100,00%
20,00%

Bradyrhizobiaceae
Planococcaceae

100,00%
8,00%

Afipia
Filibacter

44,00%

Paraliobacillus

18,00%

100,00%

Caryophanaceae

62,00%

Caryophanon

62,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

41,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

97,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

67,00%

Bacillales
Enterobacteriales
Bacillales

Enterobacteriales

25,00%
100,00%
24,00%
100,00%
98,00%

Bacillaceae
Enterobacteriaceae
Bacillaceae
Enterobacteriaceae
Bacillaceae

17,00%
100,00%
16,00%

Jeotgalibacillus
Salmonella
Saccharococcus

47,00%

98,00%

Bacillus

58,00%

7,00%

Bacteriovoracaceae

7,00%

Peredibacter

7,00%

11,00%

Ferroplasmataceae

11,00%

Ferroplasma

11,00%

83,00%

Bacillaceae

83,00%

Jeotgalibacillus

20,00%

Leclercia

68,00%

100,00%

Enterobacteriaceae

100,00%

Chromatiales

5,00%

Ectothiorhodospiraceae

4,00%

Arhodomonas

3,00%

Rhodobacterales

8,00%

Rhodobacteraceae

8,00%

Methylarcula

5,00%

6,00%

Sorangineae

4,00%

Polyangiaceae

Myxococcales

100,00%

Enterobacteriaceae

100,00%

Escherichia

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

P04/E02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

P04/E03

Bacteria

86,00%

P04/E04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

P04/E05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

P04/E06

Bacteria

99,00%

Proteobacteria

94,00%

Gammaproteobacteria

91,00%

Enterobacteriales

86,00%

Enterobacteriaceae

86,00%

Leclercia

P04/E09

Archaea

39,00%

Crenarchaeota

35,00%

Thermoprotei

35,00%

Desulfurococcales

30,00%

Desulfurococcaceae

30,00%

Desulfurococcus

P04/E10

Bacteria

100,00%

Caryophanaceae

77,00%

Caryophanon

Firmicutes

100,00%

Bacilli

27,00%

100,00%

87

8,00%

Shigella

Bacteria

Gammaproteobacteria

9,00%
47,00%

100,00%

P04/E01

39,00%

7,00%

Bacillaceae

P04/D12

Proteobacteria

9,00%
83,00%

Enterobacteriales

Bacillales

99,00%

11,00%

100,00%

Bacillaceae

98,00%

Bacillus

4,00%
20,00%
89,00%

100,00%

Acinetobacter

100,00%

Caryophanaceae

73,00%

Caryophanon

73,00%

Enterobacteriaceae

11,00%

Leclercia

10,00%

63,00%

Caryophanon

63,00%

100,00%

Acinetobacter

100,00%
59,00%
4,00%
77,00%

P04/E11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

P04/E12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

P04/F01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

P04/F02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

72,00%

P04/F03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

81,00%

Bacillus

46,00%

P04/F04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Stenotrophomonas

87,00%

P04/F05

Archaea

17,00%

Euryarchaeota

14,00%

Halobacteria

P04/F06

Bacteria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

P04/F07

Bacteria

100,00%

Firmicutes

P04/F08

Bacteria

100,00%

Proteobacteria

P04/F09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Bacillaceae

P04/F10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

72,00%

Caryophanon

P04/F11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

60,00%

Caryophanon

60,00%

P04/F12

Archaea

74,00%

Crenarchaeota

47,00%

Desulfurococcaceae

39,00%

Sulfophobococcus

22,00%

100,00%

Citrobacter

63,00%

100,00%
25,00%

66,00%

Bacilli
Deltaproteobacteria

Thermoprotei

7,00%
99,00%
100,00%
21,00%

Xanthomonadales
Halobacteriales
Xanthomonadales
Bacillales
Desulfuromonales

66,00%

Desulfurococcales

96,00%
100,00%
7,00%
99,00%
100,00%
14,00%

Bacillaceae
Xanthomonadaceae
Halobacteriaceae

100,00%
7,00%

Haloterrigena

70,00%
100,00%
43,00%

3,00%

Xanthomonadaceae

99,00%

Stenotrophomonas

59,00%

Caryophanaceae

68,00%

Caryophanon

68,00%

7,00%

Malonomonas

Desulfuromonaceae

100,00%

Bacillus

7,00%
100,00%
72,00%

P04/G01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P04/G02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

74,00%

Caryophanon

74,00%

P04/G04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Bacillaceae

94,00%

Vulcanibacillus

38,00%

P04/G05

Bacteria

97,00%

P04/G06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

P04/G07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Erwinia

50,00%

P04/G08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

48,00%

P04/G09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

P04/G10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

97,00%

Pseudomonadales

60,00%

Moraxellaceae

58,00%

Acinetobacter

54,00%

P04/G11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P04/G12

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Bacillus

P04/H01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Shigella

49,00%

P04/H02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

86,00%

P04/H03

Bacteria

100,00%

Planctomycetes

91,00%

91,00%

Planctomycetales

91,00%

Planctomycetaceae

91,00%

Gemmata

60,00%

P04/H04

Bacteria

86,00%

Thermomicrobia

4,00%

P04/H05

Archaea

25,00%

Crenarchaeota

P04/H06

Bacteria

100,00%

Planctomycetes

P04/H07

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

P04/H08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

P04/H09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

73,00%

Caryophanon

73,00%

P04/H10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

99,00%

Bacillales

90,00%

Bacillaceae

89,00%

Bacillus

39,00%

P04/H11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

64,00%

Caryophanon

64,00%

P04/H12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

Klebsiella

32,00%

Chlamydiae

8,00%

Chlamydiae

Planctomycetacia
Thermomicrobia

21,00%

Thermoprotei

99,00%

Planctomycetacia

8,00%

Chlamydiales

8,00%

99,00%

Waddliaceae

Bacillaceae

7,00%

4,00%

Thermomicrobiales

4,00%

Thermomicrobiaceae

4,00%

21,00%

Desulfurococcales

19,00%

Desulfurococcaceae

99,00%

Planctomycetales

99,00%

Bacillales

93,00%

100,00%

88

Waddlia

7,00%
100,00%

100,00%

98,00%

Thermomicrobium

4,00%

19,00%

Desulfurococcus

9,00%

Planctomycetaceae

99,00%

Isosphaera

94,00%

Bacillaceae

93,00%

Bacillus

63,00%

Stenotrophomonas

99,00%

100,00%

100,00%

pl05/A03

Bacteria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

98,00%

Enterobacteriales

96,00%

Enterobacteriaceae

96,00%

Salmonella

52,00%

pl05/A09

Bacteria

100,00%

Firmicutes

76,00%

Bacilli

74,00%

Bacillales

73,00%

Bacillaceae

38,00%

Jeotgalibacillus

29,00%

pl05/A10

Bacteria

100,00%

Proteobacteria

Salmonella

35,00%

pl05/B01

Bacteria

100,00%

Firmicutes

98,00%

Bacilli

98,00%

Bacillales

98,00%

Caryophanaceae

35,00%

Caryophanon

35,00%

pl05/B03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

45,00%

Caryophanon

45,00%

pl05/B06

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

99,00%

Bacillales

88,00%

Bacillaceae

83,00%

Bacillus

52,00%

pl05/B10

Bacteria

98,00%

Firmicutes

89,00%

Bacilli

88,00%

Bacillales

74,00%

Bacillaceae

43,00%

Jeotgalibacillus

42,00%

pl05/B11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

Raoultella

38,00%

pl05/B12

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

Caryophanon

77,00%

pl05/C02

Bacteria

96,00%

pl05/C03

Bacteria

100,00%

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Proteobacteria

56,00%

Gammaproteobacteria

43,00%

Oceanospirillales

6,00%

Firmicutes

99,00%

Bacilli

98,00%

Bacillales

98,00%

Enterobacteriaceae

Oceanospirillaceae
Planococcaceae

100,00%

100,00%
77,00%
4,00%

Oleispira

4,00%

44,00%

Filibacter

44,00%

pl05/C06

Bacteria

99,00%

Proteobacteria

51,00%

Gammaproteobacteria

34,00%

Xanthomonadales

13,00%

Xanthomonadaceae

13,00%

Fulvimonas

12,00%

pl05/C07

Bacteria

98,00%

Proteobacteria

95,00%

Gammaproteobacteria

79,00%

Chromatiales

33,00%

Chromatiaceae

26,00%

Thiococcus

16,00%

pl05/C09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

84,00%

Bacillaceae

84,00%

Jeotgalibacillus

20,00%

pl05/C10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

47,00%

pl05/C12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

99,00%

pl05/D03

Bacteria

96,00%

Firmicutes

61,00%

Bacilli

52,00%

Bacillales

35,00%

Bacillaceae

22,00%

Halolactibacillus

11,00%

pl05/D04

Bacteria

100,00%

Firmicutes

92,00%

Bacilli

80,00%

Bacillales

59,00%

Bacillaceae

45,00%

Jeotgalibacillus

3,00%

pl05/D06

Bacteria

85,00%

Aquificae

9,00%

Aquifex

9,00%

pl05/D07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

pl05/D08

Bacteria

92,00%

Proteobacteria

70,00%

Gammaproteobacteria

47,00%

Pseudomonadales

13,00%

pl05/D09

Bacteria

91,00%

Firmicutes

25,00%

Clostridia

19,00%

Thermoanaerobacteriales

pl05/D10

Bacteria

100,00%

Firmicutes

99,00%

Bacilli

99,00%

Bacillales

90,00%

Caryophanaceae

pl05/D11

Bacteria

100,00%

Firmicutes

99,00%

Bacilli

99,00%

Bacillales

99,00%

pl05/D12

Bacteria

97,00%

Firmicutes

65,00%

Clostridia

58,00%

Clostridiales

50,00%

pl05/E02

Bacteria

100,00%

100,00%

pl05/E03

Bacteria

96,00%

Firmicutes

31,00%

Bacilli

18,00%

Bacillales

14,00%

Bacillaceae

12,00%

Vulcanibacillus

1,00%

pl05/E04

Bacteria

90,00%

Aquificae

10,00%

Aquificae

10,00%

Aquificales

10,00%

Incertae sedis 2

10,00%

Desulfurobacterium

9,00%

pl05/E05

Bacteria

93,00%

Bacteroidetes

18,00%

Flavobacteria

11,00%

Flavobacteriales

11,00%

Flavobacteriaceae

11,00%

Empedobacter

4,00%

pl05/E07

Bacteria

100,00%

Firmicutes

88,00%

Bacilli

85,00%

Bacillales

80,00%

Bacillaceae

34,00%

Jeotgalibacillus

21,00%

pl05/E08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

Flavimonas

86,00%

pl05/E09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

Jeotgalibacillus

23,00%

pl05/E10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

69,00%

pl05/E11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

96,00%

pl05/E12

Bacteria

91,00%

Planctomycetes

43,00%

Planctomycetacia

43,00%

Planctomycetales

43,00%

Planctomycetaceae

43,00%

Isosphaera

21,00%

pl05/F01

Bacteria

96,00%

Proteobacteria

72,00%

Gammaproteobacteria

55,00%

Pseudomonadales

39,00%

Moraxellaceae

35,00%

Acinetobacter

34,00%

pl05/F03

Bacteria

100,00%

Firmicutes

96,00%

Bacilli

94,00%

Bacillales

94,00%

Bacillaceae

53,00%

Jeotgalibacillus

44,00%

Proteobacteria

100,00%

Aquificae

Gammaproteobacteria

9,00%

100,00%

100,00%
98,00%

89

Aquificales

Pseudomonadales

Pseudomonadales
Bacillales

9,00%

9,00%

100,00%
84,00%

Aquificaceae
Enterobacteriaceae
Moraxellaceae
Thermoanaerobacteriaceae

9,00%
100,00%
10,00%
9,00%

Raoultella

41,00%

Alkanindiges

10,00%

Thermovenabulum

9,00%

26,00%

Caryophanon

Caryophanaceae

70,00%

Caryophanon

70,00%

Acidaminococcaceae

35,00%

Thermosinus

15,00%

Pseudomonadaceae

100,00%

Flavimonas

88,00%

Pseudomonadaceae
Bacillaceae

100,00%
74,00%

26,00%

pl05/F04

Bacteria

100,00%

Proteobacteria

90,00%

Gammaproteobacteria

89,00%

Enterobacteriales

66,00%

Enterobacteriaceae

pl05/F05

Bacteria

94,00%

Firmicutes

52,00%

Bacilli

36,00%

Bacillales

19,00%

Planococcaceae

6,00%

pl05/F06

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

53,00%

Caryophanon

pl05/F07

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

pl05/F08

Bacteria

100,00%

Proteobacteria

pl05/F10

Bacteria

100,00%

Firmicutes

pl05/G02

Bacteria

93,00%

Bacteroidetes

26,00%

Bacteroidetes

pl05/G04

Bacteria

90,00%

Proteobacteria

36,00%

Deltaproteobacteria

pl05/G05

Archaea

12,00%

Euryarchaeota

11,00%

Thermoplasmata

pl05/G06

Bacteria

100,00%

Proteobacteria

86,00%

Alphaproteobacteria

pl05/G08

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

pl05/G09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

pl05/G10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

pl05/G11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

pl05/H03

Bacteria

100,00%

Firmicutes

pl05/H05

Archaea

7,00%

Euryarchaeota

6,00%

pl05/H06

Bacteria

100,00%

Proteobacteria

67,00%

Alphaproteobacteria

27,00%

Rhodospirillales

20,00%

Acetobacteraceae

20,00%

Belnapia

18,00%

pl05/H10

Bacteria

99,00%

Firmicutes

72,00%

Bacilli

59,00%

Bacillales

59,00%

Bacillaceae

41,00%

Jeotgalibacillus

27,00%

P06/A01

Archaea

28,00%

Euryarchaeota

P06/A02

Bacteria

100,00%

Firmicutes

P06/A03

Bacteria

100,00%

Proteobacteria

P06/A04

Bacteria

100,00%

Proteobacteria

P06/A06

Archaea

37,00%

P06/A08

Bacteria

83,00%

P06/A09

Bacteria

P06/A10
P06/A11

95,00%
100,00%

97,00%

24,00%

Gammaproteobacteria
Bacilli

Bacilli
Methanobacteria

95,00%
100,00%
5,00%
17,00%
9,00%
70,00%

97,00%
1,00%

66,00%

Hafnia
Filibacter

37,00%
6,00%
53,00%

Bacillaceae

89,00%

Paraliobacillus

27,00%

Pseudomonadales

95,00%

Pseudomonadaceae

95,00%

Flavimonas

85,00%

Bacillales

98,00%

Bacillaceae

93,00%

Bacillus

90,00%

Bacteroidales
Bdellovibrionales
Thermoplasmatales
Rhizobiales

Bacillales
Methanobacteriales

5,00%
11,00%
9,00%
43,00%

99,00%
100,00%
96,00%
1,00%

Rikenellaceae
Bdellovibrionaceae
Picrophilaceae
Phyllobacteriaceae

Caryophanaceae
Enterobacteriaceae
Caryophanaceae
Methanobacteriaceae

5,00%

Marinilabilia

5,00%

11,00%

Bdellovibrio

11,00%

9,00%

Picrophilus

18,00%

Pseudaminobacter

9,00%
15,00%

57,00%

Caryophanon

57,00%

100,00%

Acinetobacter

100,00%

63,00%

Caryophanon

63,00%

Cedecea

44,00%

Caryophanon

48,00%

100,00%
48,00%
1,00%

Methanothermobacter

1,00%

Methanococci

14,00%

Methanococcales

14,00%

Methanococcaceae

14,00%

Methanothermococcus

14,00%

Bacilli

96,00%

Bacillales

71,00%

Bacillaceae

69,00%

Ornithinibacillus

32,00%

98,00%

Gammaproteobacteria

95,00%

Enterobacteriales

91,00%

Enterobacteriaceae

91,00%

Leclercia

45,00%

91,00%

Gammaproteobacteria

82,00%

Oceanospirillales

27,00%

Halomonadaceae

12,00%

Cobetia

11,00%

Crenarchaeota

31,00%

Thermoprotei

31,00%

Sulfolobales

13,00%

Sulfolobaceae

13,00%

Stygiolobus

10,00%

Bacteroidetes

27,00%

Bacteroidetes

8,00%

8,00%

Rikenellaceae

5,00%

Rikenella

5,00%

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Leclercia

62,00%

Bacteria

81,00%

Proteobacteria

20,00%

Bacteria

100,00%

Proteobacteria

100,00%

P06/A12

Bacteria

100,00%

Proteobacteria

P06/B01

Bacteria

100,00%

Proteobacteria

P06/B02

Bacteria

100,00%

P06/B03

Archaea

P06/B04
P06/B05

100,00%

Bacteroidales

100,00%

Enterobacteriales

Gammaproteobacteria

10,00%

Oceanospirillales

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

100,00%

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

95,00%

Pseudomonadales

70,00%

Moraxellaceae

40,00%

Alkanindiges

40,00%

63,00%

Euryarchaeota

33,00%

Methanopyri

11,00%

Methanopyrales

11,00%

Methanopyraceae

11,00%

Methanopyrus

11,00%

Bacteria

100,00%

Proteobacteria

100,00%

Escherichia

43,00%

Archaea

64,00%

Crenarchaeota

49,00%

P06/B06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P06/B07

Bacteria

100,00%

Proteobacteria

100,00%

P06/B08

Bacteria

100,00%

Proteobacteria

100,00%

P06/B09

Archaea

63,00%

Euryarchaeota

37,00%

Gammaproteobacteria

100,00%
5,00%

Enterobacteriaceae
Halomonadaceae

5,00%

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

49,00%

Thermoproteales

21,00%

Thermoproteaceae

18,00%

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

Betaproteobacteria

100,00%

Burkholderiales

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

99,00%

21,00%

Methanobacteriales

21,00%

Thermoprotei

Methanobacteria

90

Salicola

5,00%
66,00%

Caldivirga

10,00%

100,00%

Hafnia

44,00%

Alcaligenaceae

100,00%

Pusillimonas

24,00%

Moraxellaceae

99,00%

Acinetobacter

95,00%

Methanobacteriaceae

21,00%

Methanothermobacter

19,00%

P06/B10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

98,00%

Caryophanaceae

50,00%

Caryophanon

P06/B11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Caryophanaceae

42,00%

Caryophanon

42,00%

P06/B12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

Citrobacter

53,00%

P06/C01

Bacteria

81,00%

Lentisphaerae

P06/C02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Bacillaceae

P06/C03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

P06/C04

Archaea

26,00%

Crenarchaeota

16,00%

Sulfolobales

12,00%

P06/C06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P06/C07

Bacteria

99,00%

Proteobacteria

99,00%

P06/C08

Bacteria

100,00%

Proteobacteria

100,00%

P06/C09

Bacteria

100,00%

Proteobacteria

P06/C10

Bacteria

94,00%

P06/C11

Archaea

51,00%

P06/C12

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

P06/D01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P06/D02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P06/D03

Bacteria

80,00%

Aquificae

20,00%

Aquificae

P06/D04

Bacteria

88,00%

Proteobacteria

27,00%

Betaproteobacteria

P06/D05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

P06/D06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P06/D07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P06/D08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P06/D09

Bacteria

100,00%

Firmicutes

P06/D10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P06/D11

Bacteria

84,00%

Proteobacteria

31,00%

Gammaproteobacteria

P06/D12

Archaea

60,00%

Crenarchaeota

50,00%

Thermoprotei

P06/E01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P06/E02

Bacteria

100,00%

Firmicutes

100,00%

P06/E03

Bacteria

100,00%

Proteobacteria

100,00%

P06/E04

Bacteria

100,00%

Proteobacteria

P06/E05

Bacteria

100,00%

P06/E06

Bacteria

100,00%

P06/E08

Bacteria

87,00%

P06/E09

Bacteria

87,00%

P06/E10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P06/E11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P06/E12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

8,00%

Lentisphaerae

Thermoprotei

8,00%

16,00%

Lentisphaerales

100,00%
8,00%

Enterobacteriaceae
Lentisphaeraceae

100,00%
8,00%

Lentisphaera

50,00%

8,00%

42,00%

Jeotgalibacillus

38,00%

Caryophanaceae

57,00%

Caryophanon

57,00%

Sulfolobaceae

12,00%

Sulfurisphaera

12,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

100,00%

Pseudomonadales

Gammaproteobacteria

98,00%

Enterobacteriales

97,00%

Enterobacteriaceae

97,00%

Leclercia

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

45,00%

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

89,00%

Proteobacteria

33,00%

Gammaproteobacteria

13,00%

Oceanospirillales

11,00%

Halomonadaceae

11,00%

Salicola

11,00%

Euryarchaeota

36,00%

Methanopyri

12,00%

Methanopyrales

12,00%

Methanopyraceae

12,00%

Methanopyrus

12,00%

Bacillales

100,00%

Caryophanaceae

47,00%

Caryophanon

47,00%

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

36,00%

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

51,00%

Desulfurobacterium

11,00%

20,00%
9,00%

Aquificales
Burkholderiales

20,00%
5,00%

Incertae sedis 2
Oxalobacteraceae

17,00%
3,00%

75,00%

Naxibacter

3,00%

100,00%

Flavimonas

93,00%

100,00%

Pseudomonadaceae

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Klebsiella

41,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

97,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

56,00%

Bacillales

96,00%

Planococcaceae

40,00%

Filibacter

40,00%

Pseudomonadales

90,00%

Moraxellaceae

89,00%

Acinetobacter

75,00%

22,00%

Thiotrichales

13,00%

Piscirickettsiaceae

13,00%

Hydrogenovibrio

13,00%

50,00%

Desulfurococcales

17,00%

Desulfurococcaceae

16,00%

Thermosphaera

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

Bacilli

100,00%

Bacillales

39,00%

Filibacter

39,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

89,00%

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Hafnia

34,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Hafnia

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

100,00%

Proteobacteria

67,00%

Gammaproteobacteria

58,00%

Pseudomonadales

34,00%

Pseudomonadaceae

34,00%

Flavimonas

32,00%

Firmicutes

38,00%

Bacilli

1,00%

Turicibacter

1,00%

Enterobacteriaceae

100,00%

Escherichia

37,00%

99,00%

Bacilli

99,00%
100,00%

5,00%

Bacillales

97,00%

5,00%

Planococcaceae

Turicibacteraceae

8,00%
66,00%

31,00%

Enterobacteriales

100,00%

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

81,00%

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

43,00%

91

P06/F01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P06/F02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

P06/F03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P06/F04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P06/F05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P06/F06

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

47,00%

Caryophanon

47,00%

P06/F07

Bacteria

100,00%

Firmicutes

98,00%

Bacilli

90,00%

Bacillales

55,00%

Bacillaceae

55,00%

Paucisalibacillus

15,00%

P06/F08

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

90,00%

Planococcaceae

64,00%

Filibacter

64,00%

P06/F09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

99,00%

Acinetobacter

97,00%

P06/F10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

35,00%

P06/F11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

95,00%

P06/F12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

55,00%

P06/G01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

98,00%

P06/G02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

P06/G03

Archaea

33,00%

Crenarchaeota

20,00%

20,00%

Desulfurococcales

13,00%

Desulfurococcaceae

9,00%

Acidilobus

3,00%

P06/G04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

99,00%

Enterobacteriaceae

99,00%

Trabulsiella

38,00%

P06/G06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

31,00%

P06/G07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

98,00%

Moraxellaceae

98,00%

Acinetobacter

73,00%

P06/G08

Bacteria

98,00%

Bacillales

55,00%

Planococcaceae

20,00%

Filibacter

20,00%

P06/G09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

93,00%

P06/G10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

35,00%

P06/G11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Hafnia

59,00%

P06/G12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

49,00%

P06/H01

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

94,00%

Caryophanaceae

66,00%

Caryophanon

66,00%

P06/H02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Planococcaceae

55,00%

Filibacter

55,00%

P06/H03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P06/H04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

98,00%

Pseudomonadales

86,00%

Moraxellaceae

P06/H05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

Bacillales

76,00%

Bacillaceae

P06/H06

Bacteria

68,00%

Firmicutes

15,00%

Clostridia

10,00%

Clostridiales

10,00%

Eubacteriaceae

P06/H07

Bacteria

95,00%

Proteobacteria

72,00%

Gammaproteobacteria

64,00%

Pseudomonadales

18,00%

P06/H09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

P06/H10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P06/H11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

99,00%

P06/H12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

28,00%

P07/A01

Bacteria

87,00%

Bacteroidetes

7,00%

Cardinium

7,00%

P07/A03

Bacteria

88,00%

Bacteroidetes

26,00%

P07/A06

Archaea

30,00%

Crenarchaeota

23,00%

Firmicutes

76,00%

Thermoprotei

Bacilli

Sphingobacteria

100,00%
99,00%

57,00%

100,00%

Pseudomonadales
Bacillales

100,00%
79,00%

84,00%

Pseudomonadaceae
Bacillaceae

100,00%

Pseudomonas

56,00%

Paucisalibacillus

42,00%

100,00%

Escherichia

18,00%

Enterobacteriaceae

100,00%

Escherichia

58,00%

Enterobacteriaceae

100,00%

Escherichia

39,00%

Moraxellaceae

78,00%

97,00%
100,00%

100,00%

Acinetobacter
Flavimonas

90,00%
100,00%

Erwinia

48,00%

77,00%

Alkanindiges

68,00%

71,00%

Paraliobacillus

19,00%

3,00%

Anaerofustis

3,00%

Pseudomonadaceae

18,00%

Flavimonas

14,00%

Xanthomonadaceae

100,00%

Bacillaceae

84,00%

Stenotrophomonas

87,00%

Jeotgalibacillus

31,00%

7,00%

Sphingobacteriales

7,00%

Flexibacteraceae

7,00%

Bacteroidetes

7,00%

Bacteroidales

7,00%

Prevotellaceae

6,00%

Xylanibacter

6,00%

Thermoprotei

23,00%

Caldisphaerales

7,00%

Caldisphaeraceae

7,00%

Caldisphaera

7,00%

92

P07/A07

Bacteria

100,00%

Proteobacteria

100,00%

P07/A09

Archaea

34,00%

Euryarchaeota

21,00%

Methanopyri

P07/A10

Bacteria

100,00%

Firmicutes

97,00%

Bacilli

P07/B02

Bacteria

100,00%

Proteobacteria

100,00%

P07/B03

Archaea

52,00%

Crenarchaeota

31,00%

P07/B04

Bacteria

100,00%

Proteobacteria

100,00%

P07/B06

Bacteria

100,00%

Proteobacteria

100,00%

P07/B07

Bacteria

100,00%

Planctomycetes

99,00%

P07/B08

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

P07/B11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P07/B12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

66,00%

P07/C01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

P07/C03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P07/C04

Bacteria

96,00%

P07/C05

Archaea

9,00%

Crenarchaeota

5,00%

Thermoprotei

5,00%

Caldisphaerales

2,00%

Caldisphaeraceae

2,00%

P07/C06

Bacteria

100,00%

Cyanobacteria

9,00%

Cyanobacteria

9,00%

Family 1.1

8,00%

Microcystis

8,00%

P07/C07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

P07/C08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

P07/C10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

Enterobacteriaceae

Firmicutes

47,00%

Gammaproteobacteria

Gammaproteobacteria

100,00%
6,00%
91,00%

Pseudomonadales
Methanopyrales
Bacillales

100,00%
6,00%
61,00%

Methanopyraceae
Bacillaceae

100,00%

Flavimonas

83,00%

6,00%

Methanopyrus

6,00%

57,00%

Paraliobacillus

23,00%

Pseudomonas

75,00%

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

31,00%

Desulfurococcales

12,00%

Desulfurococcaceae

12,00%

Sulfophobococcus

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

99,00%

Acinetobacter

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

99,00%

99,00%

Planctomycetales

99,00%

Planctomycetaceae

99,00%

Gemmata

93,00%

95,00%

Thermoprotei

Planctomycetacia

Bacilli

36,00%

Bacillales

32,00%

P07/C12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

98,00%

Enterobacteriales

94,00%

P07/D02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

P07/D04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

P07/D05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

P07/D06

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

P07/D08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P07/D09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P08/A03

Bacteria

97,00%

Proteobacteria

71,00%

P08/A04

Bacteria

100,00%

Firmicutes

99,00%

P08/A05

Bacteria

100,00%

Proteobacteria

P08/A07

Bacteria

100,00%

Firmicutes

P08/A08

Bacteria

99,00%

Firmicutes

P08/A10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

P08/A11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

95,00%

P08/A12

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

P08/B02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P08/B03

Archaea

33,00%

Crenarchaeota

15,00%

P08/B06

Bacteria

100,00%

Firmicutes

97,00%

100,00%

Pseudomonadaceae

8,00%
99,00%

Caryophanon

95,00%

100,00%

Citrobacter

48,00%

Pseudomonadaceae

66,00%

Flavimonas

60,00%

Pseudomonadaceae

100,00%

Flavimonas

88,00%

Enterobacteriaceae

100,00%

Escherichia

39,00%

Jeotgalibacillus

24,00%

Bacillaceae

27,00%

94,00%

Caldisphaera

Leclercia

2,00%

50,00%
51,00%
100,00%
47,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

99,00%

100,00%

Enterobacteriaceae

100,00%

Citrobacter

57,00%

Bacillales

100,00%

Bacillaceae

100,00%

Bacillus

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

Gammaproteobacteria

59,00%

Enterobacteriales

27,00%

Enterobacteriaceae

27,00%

Leclercia

Bacilli

98,00%

Bacillales

98,00%

Caryophanaceae

52,00%

Caryophanon

Gammaproteobacteria

96,00%

Bacilli

72,00%

Bacilli

100,00%

Enterobacteriales

89,00%

Bacillales

53,00%

Bacillales

99,00%

Xanthomonadales

Thermoprotei

15,00%

Thermoproteales

Bacilli

95,00%

Bacillales

93

100,00%

Enterobacteriaceae

81,00%

Bacillaceae

48,00%

Bacillaceae

100,00%

Enterobacteriaceae

100,00%

100,00%

100,00%
72,00%
100,00%
6,00%
52,00%

Trabulsiella

71,00%

65,00%

Jeotgalibacillus

18,00%

31,00%

Oceanobacillus

17,00%

Escherichia

28,00%
32,00%

100,00%

Bacillaceae

95,00%

Paucisalibacillus

Caryophanaceae

71,00%

Caryophanon

71,00%

96,00%

Xanthomonadaceae

96,00%

Pseudoxanthomonas

55,00%

3,00%

Thermoproteaceae

83,00%

Bacillaceae

3,00%
79,00%

Thermoproteus
Bacillus

2,00%
52,00%

P08/B07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

55,00%

P08/B09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Pseudoxanthomonas

71,00%

P08/B10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

49,00%

P08/B11

Bacteria

71,00%

P08/B12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P08/C01

Bacteria

100,00%

Proteobacteria

100,00%

P08/C02

Bacteria

100,00%

Proteobacteria

100,00%

P08/C03

Bacteria

100,00%

Proteobacteria

100,00%

Spirochaetes

9,00%

9,00%

Spirochaetales

100,00%

Enterobacteriales

Gammaproteobacteria

99,00%

Gammaproteobacteria

100,00%

Gammaproteobacteria

100,00%

9,00%

Leptospiraceae

9,00%

Turneriella

9,00%

100,00%

Salmonella

30,00%

100,00%

Enterobacteriaceae

Enterobacteriales

95,00%

Enterobacteriaceae

95,00%

Leclercia

38,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

35,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

55,00%

P08/C04

Bacteria

100,00%

Firmicutes

Bacilli

94,00%

Bacillales

82,00%

Bacillaceae

60,00%

Jeotgalibacillus

21,00%

P08/C06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

93,00%

Pseudomonadales

79,00%

Moraxellaceae

65,00%

Acinetobacter

61,00%

P08/C07

Bacteria

98,00%

Proteobacteria

47,00%

Gammaproteobacteria

28,00%

Pseudomonadales

7,00%

P08/C08

Bacteria

99,00%

Firmicutes

72,00%

Bacilli

68,00%

Bacillales

65,00%

Planococcaceae

40,00%

Filibacter

39,00%

P08/C10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

95,00%

Bacillaceae

95,00%

Bacillus

39,00%

P08/C11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Bacillaceae

99,00%

Bacillus

96,00%

P08/C12

Bacteria

83,00%

Bacteroidetes

10,00%

P08/D03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P08/D04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P08/D05

Bacteria

97,00%

Firmicutes

82,00%

Bacilli

70,00%

Bacillales

55,00%

Bacillaceae

27,00%

P08/D06

Bacteria

97,00%

Proteobacteria

76,00%

Gammaproteobacteria

49,00%

Pasteurellales

10,00%

Pasteurellaceae

10,00%

P08/D07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

P08/D08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Erwinia

58,00%

P08/D09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

38,00%

P08/D10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

81,00%

P08/D11

Bacteria

100,00%

Firmicutes

36,00%

Isobaculum

32,00%

P08/D12

Archaea

17,00%

Euryarchaeota

P08/E01

Bacteria

89,00%

Thermodesulfobacteria

16,00%

Thermodesulfobacteria

16,00%

Thermodesulfobacteriales

16,00%

Thermodesulfobacteriaceae

16,00%

Thermodesulfatator

P08/E02

Bacteria

97,00%

Firmicutes

60,00%

Bacilli

47,00%

Bacillales

44,00%

Bacillaceae

23,00%

Jeotgalibacillus

19,00%

P08/E04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

99,00%

P08/E05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

90,00%

P08/E06

Bacteria

100,00%

Proteobacteria

96,00%

Gammaproteobacteria

94,00%

Xanthomonadales

91,00%

Xanthomonadaceae

91,00%

Stenotrophomonas

55,00%

P08/E07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

99,00%

Enterobacteriaceae

99,00%

Escherichia

27,00%

P08/E08

Bacteria

87,00%

11,00%

Lachnospiraceae

P08/E10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P08/E12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P08/F02

Bacteria

99,00%

Firmicutes

79,00%

Bacilli

71,00%

Bacillales

70,00%

Bacillaceae

58,00%

P08/F03

Bacteria

100,00%

Firmicutes

97,00%

Bacilli

97,00%

Bacillales

96,00%

Planococcaceae

P08/F04

Bacteria

100,00%

Firmicutes

96,00%

Bacilli

96,00%

Bacillales

88,00%

Bacillaceae

Firmicutes

98,00%

Spirochaetes

99,00%
5,00%

18,00%

Bacteroidetes

Bacilli
Methanobacteria

Clostridia

5,00%

99,00%
2,00%

13,00%

94

Bacteroidales

5,00%

Enterobacteriales

100,00%

Xanthomonadales

100,00%

Lactobacillales
Methanobacteriales

Clostridiales

40,00%
2,00%

Enterobacteriales

100,00%

Xanthomonadales

100,00%

Pseudomonadaceae

Bacteroidaceae

7,00%

4,00%

Flavimonas

Pontibacter

7,00%

4,00%

Enterobacteriaceae

100,00%

Leclercia

Xanthomonadaceae

100,00%

Stenotrophomonas

99,00%

Saccharococcus

10,00%

Phocoenobacter

7,00%

Carnobacteriaceae
Methanobacteriaceae

1,00%

8,00%

Methanosphaera

Anaerostipes

51,00%

100,00%

1,00%
16,00%

8,00%

Enterobacteriaceae

100,00%

Citrobacter

57,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

99,00%

Bacillus

51,00%

68,00%

Filibacter

68,00%

82,00%

Jeotgalibacillus

33,00%

P08/F05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

28,00%

P08/F06

Bacteria

97,00%

Proteobacteria

81,00%

Gammaproteobacteria

64,00%

Pseudomonadales

46,00%

Pseudomonadaceae

45,00%

Flavimonas

43,00%

P08/F07

Bacteria

100,00%

Firmicutes

P08/F08

Bacteria

100,00%

P08/F10

Bacteria

100,00%

P08/F11

Bacteria

100,00%

Bacilli

100,00%

Bacillales

Proteobacteria

100,00%

Firmicutes

100,00%

100,00%

Proteobacteria

100,00%

Bacillaceae

100,00%

Bacillus

97,00%

Gammaproteobacteria

100,00%

Bacilli

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Pectobacterium

38,00%

Bacillales

100,00%

Caryophanaceae

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

P08/F12

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

97,00%

P08/G01

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

P08/G02

Bacteria

100,00%

Firmicutes

77,00%

Bacilli

74,00%

Bacillales

71,00%

P08/G03

Bacteria

86,00%

Firmicutes

27,00%

Clostridia

22,00%

Clostridiales

22,00%

P08/G04

Bacteria

89,00%

Firmicutes

50,00%

Bacilli

29,00%

Bacillales

18,00%

P08/G05

Bacteria

100,00%

Proteobacteria

P08/G07

Bacteria

100,00%

Firmicutes

P08/G09

Bacteria

100,00%

Proteobacteria

P08/G10

Bacteria

100,00%

P08/G11

Bacteria

100,00%

P08/G12

Bacteria

P08/H01

100,00%
32,00%

Gammaproteobacteria
Bacilli

100,00%
31,00%

Bacillales

31,00%

66,00%
100,00%

Bacillaceae

96,00%

Bacillus

92,00%

Caryophanaceae

42,00%

Caryophanon

42,00%

Bacillaceae

47,00%

Jeotgalibacillus

30,00%

Clostridiaceae

10,00%

Gracilibacter

4,00%

Bacillaceae

17,00%

Paucisalibacillus

6,00%

Enterobacteriaceae
Turicibacteraceae

100,00%

Escherichia

31,00%

Turicibacter

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Bacilli

100,00%

Bacillales

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P08/H05

Bacteria

97,00%

Actinobacteria

19,00%

Actinobacteria

19,00%

Actinobacteridae

17,00%

Actinomycetales

P08/H06

Bacteria

91,00%

Firmicutes

21,00%

Clostridia

15,00%

Clostridiales

14,00%

Eubacteriaceae

P08/H07

Bacteria

99,00%

Firmicutes

89,00%

Bacilli

86,00%

Bacillales

86,00%

Bacillaceae

P08/H09

Archaea

45,00%

Euryarchaeota

23,00%

P08/H11

Bacteria

100,00%

Proteobacteria

100,00%

P09/A01

Bacteria

100,00%

Firmicutes

P09/A03

Bacteria

91,00%

P09/A04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

P09/A07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P09/A08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P09/A11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

97,00%

P09/A12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P09/B01

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P09/B02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

61,00%

P09/B03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P09/B04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P09/B05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

71,00%

Pseudomonadales

27,00%

Moraxellaceae

16,00%

Alkanindiges

14,00%

P09/B06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

100,00%

Flavimonas

96,00%

P09/B07

Bacteria

89,00%

Actinobacteria

51,00%

Micrococcineae

34,00%

Proteobacteria

98,00%

Bacilli

53,00%

Gammaproteobacteria

Actinobacteria

Methanopyrales
Enterobacteriales

92,00%

Bacillales

14,00%

Enterobacteriales

51,00%

95

Actinobacteridae

100,00%

Acinetobacter

100,00%

Xanthomonadaceae

100,00%

100,00%

Caryophanaceae

31,00%

Firmicutes

6,00%

Moraxellaceae

33,00%

Proteobacteria

100,00%

100,00%

Flavimonas

Gammaproteobacteria

Methanopyri

Pseudomonadales

100,00%

100,00%

Caryophanon

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

66,00%

6,00%
100,00%
63,00%
5,00%

99,00%

44,00%

100,00%

Stenotrophomonas

97,00%

69,00%

Caryophanon

69,00%

Enterobacteriaceae

100,00%

Enterobacter

73,00%

Enterobacteriaceae

100,00%

Salmonella

38,00%

Micrococcineae

11,00%

Methanopyraceae
Enterobacteriaceae
Bacillaceae
Enterobacteriaceae

17,00%
7,00%
30,00%
6,00%
100,00%
61,00%
5,00%

Jeotgalibacillus
Methanopyrus

7,00%
21,00%
6,00%

Citrobacter

40,00%

Paraliobacillus

23,00%

Sodalis

2,00%

Caryophanon

53,00%

100,00%

Citrobacter

40,00%

100,00%

Salmonella

44,00%

Enterobacteriaceae

97,00%

Salmonella

74,00%

Enterobacteriaceae

100,00%

Salmonella

25,00%

Bacillus

80,00%

Bacillaceae

Pseudomonadaceae
Actinomycetales

53,00%

Pseudoramibacter

96,00%

41,00%

P09/B10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Pseudomonas

P09/B11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

66,00%
35,00%

P09/B12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

100,00%

P09/C01

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

Bacillales

86,00%

Bacillaceae

85,00%

Jeotgalibacillus

P09/C03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

99,00%

Pseudomonadales

97,00%

Moraxellaceae

97,00%

Acinetobacter

97,00%

P09/C04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

42,00%

P09/C05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

46,00%

P09/C07

Bacteria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

95,00%

Pseudomonadales

69,00%

Pseudomonadaceae

24,00%

Flavimonas

23,00%

P09/C08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

52,00%

P09/C09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Pseudomonas

95,00%

P09/C10

Bacteria

98,00%

Proteobacteria

80,00%

Gammaproteobacteria

66,00%

Pseudomonadales

59,00%

Pseudomonadaceae

59,00%

Chryseomonas

15,00%

P09/C11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

P09/D01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

P09/D04

Bacteria

98,00%

Proteobacteria

48,00%

P09/D05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

Xanthomonadaceae

80,00%

Stenotrophomonas

P09/D06

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

77,00%

Caryophanon

77,00%

P09/D07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

Stenotrophomonas

99,00%

P09/D08

Archaea

39,00%

Euryarchaeota

P09/D09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

P09/D10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

P09/D12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P09/E02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P09/E03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

P09/E04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Caryophanaceae

64,00%

Caryophanon

P09/E05

Bacteria

87,00%

Firmicutes

32,00%

Clostridia

27,00%

Clostridiales

25,00%

Acidaminococcaceae

10,00%

Anaeromusa

8,00%

P09/E06

Bacteria

100,00%

Proteobacteria

92,00%

Gammaproteobacteria

86,00%

Pseudomonadales

56,00%

Moraxellaceae

42,00%

Alkanindiges

31,00%

P09/E07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

99,00%

Enterobacteriales

99,00%

Enterobacteriaceae

99,00%

Escherichia

31,00%

P09/E08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

91,00%

P09/E09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

78,00%

P09/E10

Bacteria

100,00%

Proteobacteria

97,00%

Gammaproteobacteria

93,00%

Pseudomonadales

78,00%

Pseudomonadaceae

78,00%

Flavimonas

44,00%

P09/E11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

P09/E12

Bacteria

97,00%

Firmicutes

64,00%

Bacilli

50,00%

Bacillales

46,00%

P09/F02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

P09/F03

Bacteria

96,00%

Proteobacteria

64,00%

Gammaproteobacteria

49,00%

Xanthomonadales

30,00%

P09/F04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

P09/F05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

95,00%

P09/F06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

95,00%

21,00%

Alphaproteobacteria

Methanococci

20,00%
96,00%

11,00%

96

Rhodobacterales
Xanthomonadales

Methanococcales

5,00%
80,00%

11,00%

Rhodobacteraceae

5,00%

100,00%

Hirschia

28,00%

45,00%
100,00%
2,00%
37,00%

Methanocaldococcaceae

11,00%

Methanotorris

9,00%

Caryophanaceae

74,00%

Caryophanon

74,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

Enterobacteriaceae

100,00%

Kluyvera

Enterobacteriaceae

100,00%

Salmonella

Bacillaceae

100,00%

Bacillus

52,00%
33,00%
100,00%
64,00%

Serratia

64,00%

Bacillaceae

30,00%

Saccharococcus

10,00%

Caryophanaceae

77,00%

Caryophanon

77,00%

Xanthomonadaceae

30,00%

Luteimonas

30,00%
100,00%

P09/F07

Archaea

48,00%

Crenarchaeota

28,00%

28,00%

Thermoproteales

10,00%

Thermoproteaceae

7,00%

P09/F08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

P09/F09

Bacteria

100,00%

Proteobacteria

98,00%

Gammaproteobacteria

98,00%

Enterobacteriales

97,00%

Enterobacteriaceae

97,00%

P09/F10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

P09/F11

Bacteria

99,00%

P09/F12

Bacteria

100,00%

Proteobacteria

P09/G01

Bacteria

100,00%

P09/G02

Bacteria

100,00%

P09/G03

Bacteria

100,00%

Firmicutes

P09/G04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

P09/G05

Bacteria

93,00%

Proteobacteria

52,00%

Gammaproteobacteria

P09/G06

Bacteria

100,00%

Proteobacteria

95,00%

P09/G07

Bacteria

100,00%

Proteobacteria

100,00%

P09/G08

Bacteria

88,00%

Bacteroidetes

28,00%

P09/G09

Bacteria

100,00%

Proteobacteria

100,00%

P09/G10

Bacteria

100,00%

Proteobacteria

100,00%

P09/G11

Bacteria

96,00%

Proteobacteria

P09/G12

Bacteria

100,00%

P09/H01

Bacteria

P09/H02
P09/H03

Firmicutes

75,00%

Thermoprotei

Bacilli

100,00%

Gammaproteobacteria

Proteobacteria

100,00%

Firmicutes

100,00%
29,00%

Bacilli

58,00%

Bacillales

100,00%

Bacilli

100,00%
15,00%

Kluyvera

60,00%

Stenotrophomonas

99,00%

Ornithinibacillus

9,00%

100,00%

Stenotrophomonas

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

45,00%

Bacillales

100,00%

Caryophanaceae

87,00%

Caryophanon

87,00%

Bacillales

15,00%

Turicibacteraceae

13,00%

Turicibacter

13,00%

Xanthomonadales

96,00%

Xanthomonadaceae

96,00%

Stenotrophomonas

63,00%

39,00%

Oceanospirillales

23,00%

Oceanospirillaceae

22,00%

Oleispira

21,00%

Gammaproteobacteria

92,00%

Enterobacteriales

91,00%

Enterobacteriaceae

91,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

26,00%

Sphingobacteriales

26,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

65,00%

Gammaproteobacteria

53,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

98,00%

Pseudomonadales

Bacteria

100,00%

Firmicutes

97,00%

Bacilli

94,00%

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

P09/H04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

P09/H05

Bacteria

100,00%

Proteobacteria

81,00%

Gammaproteobacteria

64,00%

Pseudomonadales

40,00%

P09/H06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

P09/H07

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P09/H08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

P09/H09

Archaea

39,00%

Crenarchaeota

P09/H10

Bacteria

100,00%

12,00%

Gammaproteobacteria

28,00%

25,00%

Xanthomonadaceae

100,00%

Xanthomonadales

Bacillaceae

4,00%

Salmonella

100,00%

Firmicutes

100,00%

49,00%

Thermocladium

Sphingobacteria

Thermoprotei
Bacilli

12,00%
100,00%

Pasteurellales

Leclercia

34,00%

100,00%

Acinetobacter

92,00%

25,00%

Leadbetterella

19,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

Moraxellaceae
Flexibacteraceae

Gallibacterium

7,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

86,00%

Moraxellaceae

86,00%

Acinetobacter

54,00%

Bacillales

87,00%

Bacillaceae

85,00%

Bacillus

80,00%

Bacillales

100,00%

Caryophanaceae

81,00%

Caryophanon

81,00%

Bacillales

100,00%

Caryophanaceae

82,00%

Caryophanon

82,00%

Moraxellaceae

30,00%

Alkanindiges

28,00%

Pseudomonas

59,00%

Bacillales

97,00%
100,00%
6,00%
100,00%

Pasteurellaceae

84,00%

8,00%

Thermoproteales

8,00%

100,00%

Pseudomonadaceae
Bacillaceae
Moraxellaceae
Thermofilaceae
Caryophanaceae

100,00%
97,00%
100,00%

Bacillus
Acinetobacter

86,00%
100,00%

3,00%

Thermofilum

3,00%

68,00%

Caryophanon

68,00%

P09/H11

Bacteria

98,00%

Proteobacteria

30,00%

Gammaproteobacteria

13,00%

Enterobacteriales

8,00%

Enterobacteriaceae

8,00%

Buchnera

8,00%

P10/A02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Leclercia

70,00%

P10/A04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

54,00%

Caryophanon

54,00%

P10/A07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

98,00%

Xanthomonadaceae

98,00%

Stenotrophomonas

89,00%

P10/A08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

44,00%

P10/A09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

36,00%

P10/A10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

75,00%

Caryophanon

75,00%

P10/B01

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

Caryophanaceae

41,00%

Caryophanon

41,00%

P10/B02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Acinetobacter

100,00%

97

100,00%

Moraxellaceae

P10/B04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

Caryophanon

50,00%

P10/B05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

99,00%

P10/B06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

100,00%

P10/B07

Bacteria

99,00%

P10/B08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

69,00%

P10/B09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P10/B11

Bacteria

100,00%

Proteobacteria

62,00%

Gammaproteobacteria

61,00%

Pseudomonadales

56,00%

56,00%

Alkanindiges

55,00%

P10/B12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

Raoultella

25,00%

P10/C02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

81,00%

Caryophanon

81,00%

P10/C03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

67,00%

Caryophanon

67,00%

P10/C05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Buttiauxella

41,00%

P10/C06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

63,00%

P10/C09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

Bacillus

93,00%

P10/C10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

Citrobacter

37,00%

P10/C11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

99,00%

Bacillales

80,00%

Bacillaceae

Paucisalibacillus

19,00%

P10/D01

Bacteria

84,00%

Actinobacteria

24,00%

Actinobacteria

24,00%

Actinobacteridae

24,00%

Bifidobacteriales

P10/D02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

P10/D03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

P10/D04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

P10/D05

Bacteria

100,00%

Proteobacteria

98,00%

Gammaproteobacteria

97,00%

Enterobacteriales

96,00%

Enterobacteriaceae

P10/D06

Bacteria

100,00%

Proteobacteria

92,00%

Gammaproteobacteria

75,00%

Enterobacteriales

14,00%

Enterobacteriaceae

P10/D07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P10/D08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

P10/D09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

Firmicutes

91,00%

Bacilli

84,00%

Bacillales

70,00%

99,00%
100,00%

Bacillaceae

Moraxellaceae

Bacillaceae
Enterobacteriaceae

50,00%

62,00%

100,00%

99,00%
100,00%
80,00%
7,00%
100,00%

Paraliobacillus

Bifidobacteriaceae

13,00%

7,00%

Escherichia

61,00%

Acinetobacter

99,00%

Stenotrophomonas

96,00%

96,00%

Salmonella

71,00%

14,00%

Sodalis

6,00%

Enterobacteriaceae

100,00%

Erwinia

70,00%

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

Enterobacteriaceae

100,00%

Kluyvera

78,00%

99,00%

100,00%

P10/D11

Bacteria

88,00%

Bacteroidetes

34,00%

Flavobacteria

12,00%

Flavobacteriales

12,00%

Flavobacteriaceae

12,00%

Mesonia

12,00%

P10/E01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

92,00%

Xanthomonadales

88,00%

Xanthomonadaceae

88,00%

Xylella

29,00%

P10/E03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

99,00%

Enterobacteriales

99,00%

Enterobacteriaceae

99,00%

Erwinia

14,00%

P10/E04

Bacteria

97,00%

Proteobacteria

66,00%

Gammaproteobacteria

50,00%

Enterobacteriales

18,00%

Enterobacteriaceae

18,00%

Sodalis

P10/E05

Bacteria

100,00%

Firmicutes

87,00%

Bacilli

86,00%

Bacillales

80,00%

Planococcaceae

28,00%

Filibacter

22,00%

P10/E07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

Stenotrophomonas

87,00%

P10/E08

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P10/E09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

P10/E10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

P10/E11

Bacteria

99,00%

Firmicutes

54,00%

Bacilli

41,00%

Bacillales

26,00%

P10/E12

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

P10/F02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

P10/F03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

98

100,00%
99,00%

Xanthomonadaceae
Caryophanaceae

100,00%
63,00%

7,00%

Caryophanon

63,00%

Enterobacteriaceae

100,00%

Kluyvera

51,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

Bacillaceae

19,00%

Saccharococcus

100,00%

Caryophanaceae

72,00%

Caryophanon

100,00%

Enterobacteriaceae

100,00%

Enterobacter

51,00%

Bacillus

91,00%

97,00%

Bacillaceae

97,00%

7,00%
72,00%

P10/F04

Bacteria

100,00%

100,00%

Enterobacter

90,00%

P10/F05

Bacteria

94,00%

Proteobacteria
Firmicutes

66,00%

Bacilli

44,00%

Bacillales

39,00%

Bacillaceae

37,00%

Cerasibacillus

15,00%

P10/F07

Bacteria

100,00%

Firmicutes

94,00%

Bacilli

76,00%

Bacillales

52,00%

Turicibacteraceae

25,00%

Turicibacter

25,00%

P10/F08

Bacteria

82,00%

P10/F09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

44,00%

P10/F10

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Bacillaceae

100,00%

Bacillus

48,00%

P10/F11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

99,00%

P10/G02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

P10/G03

Archaea

22,00%

Euryarchaeota

15,00%

P10/G05

Bacteria

100,00%

Proteobacteria

100,00%

P10/G06

Bacteria

91,00%

Proteobacteria

P10/G07

Bacteria

100,00%

P10/G08

Bacteria

97,00%

P10/G10

Bacteria

100,00%

Firmicutes

P10/G11

Bacteria

100,00%

Firmicutes

P10/H02

Bacteria

100,00%

Planctomycetes

P10/H03

Bacteria

100,00%

P10/H04

Bacteria

100,00%

P10/H05

Bacteria

99,00%

P10/H06

Bacteria

100,00%

P10/H07

Bacteria

100,00%

P10/H08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

P10/H09

Bacteria

91,00%

Proteobacteria

48,00%

Gammaproteobacteria

14,00%

Enterobacteriales

3,00%

Enterobacteriaceae

3,00%

P10/H10

Bacteria

100,00%

Thermomicrobia

Firmicutes
Actinobacteria

100,00%

8,00%

68,00%
100,00%
14,00%

Gammaproteobacteria

Thermomicrobia

Archaeoglobi
Gammaproteobacteria
Betaproteobacteria
Bacilli
Actinobacteria

100,00%

Bacilli

98,00%

Bacilli

100,00%

Planctomycetacia

Proteobacteria

100,00%

Firmicutes

100,00%

Firmicutes

100,00%

8,00%

6,00%
100,00%
30,00%
100,00%
14,00%

Enterobacteriales

Thermomicrobiales

Archaeoglobales
Enterobacteriales
Burkholderiales
Bacillales
Rubrobacteridae

100,00%

Bacillales

97,00%

Bacillales

100,00%

Planctomycetales

Gammaproteobacteria

100,00%

Bacilli

100,00%

98,00%

Bacilli

Proteobacteria

88,00%

Firmicutes

93,00%

Firmicutes

100,00%

100,00%

8,00%

100,00%
6,00%

Enterobacteriaceae

Thermomicrobiaceae

8,00%

Thermomicrobium

8,00%

Caryophanaceae

69,00%

Caryophanon

69,00%

Moraxellaceae

99,00%

Acinetobacter

76,00%

Archaeoglobaceae

100,00%

Enterobacteriaceae

25,00%

6,00%
100,00%

Geoglobus
Leclercia

5,00%
87,00%

Comamonadaceae

18,00%

Alicycliphilus

7,00%

100,00%

Caryophanaceae

72,00%

Caryophanon

72,00%

8,00%

Rubrobacterales

8,00%

100,00%

Caryophanaceae

74,00%

Caryophanon

89,00%

Bacillus

96,00%

Bacillaceae

Rubrobacterineae

8,00%
74,00%
75,00%

100,00%

Planctomycetaceae

100,00%

Isosphaera

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

23,00%

Bacillales

100,00%

Caryophanaceae

82,00%

Caryophanon

82,00%

98,00%

Bacillales

98,00%

Caryophanaceae

39,00%

Caryophanon

39,00%

Gammaproteobacteria

77,00%

Pseudomonadales

45,00%

Moraxellaceae

44,00%

Acinetobacter

44,00%

Bacilli

93,00%

Bacillales

93,00%

Caryophanaceae

38,00%

Caryophanon

38,00%

Erwinia

64,00%

Bacilli

100,00%

Bacillales

97,00%

Bacillaceae

96,00%

Ewingella
Bacillus

100,00%

3,00%
69,00%

P10/H12

Archaea

12,00%

P11/A01

Bacteria

100,00%

Firmicutes

P11/A02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

P11/A03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

98,00%

P11/A05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

P11/A06

Bacteria

100,00%

Planctomycetes

100,00%

Planctomycetacia

100,00%

Planctomycetales

100,00%

Planctomycetaceae

100,00%

Isosphaera

P11/A07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

94,00%

P11/A08

Bacteria

100,00%

Proteobacteria

88,00%

Gammaproteobacteria

72,00%

Pseudomonadales

41,00%

Pseudomonadaceae

17,00%

Chryseomonas

15,00%

P11/A09

Bacteria

100,00%

Firmicutes

Bacillaceae

99,00%

Bacillus

78,00%

P11/A10

Bacteria

100,00%

Proteobacteria

87,00%

Gammaproteobacteria

81,00%

Enterobacteriales

72,00%

Enterobacteriaceae

72,00%

Hafnia

53,00%

P11/A11

Bacteria

98,00%

Proteobacteria

81,00%

Gammaproteobacteria

70,00%

Pseudomonadales

57,00%

Pseudomonadaceae

51,00%

Flavimonas

48,00%

P11/A12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Xanthomonadales

100,00%

Xanthomonadaceae

100,00%

Stenotrophomonas

98,00%

P11/B01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

30,00%

Crenarchaeota

9,00%
98,00%

100,00%

Thermoprotei
Bacilli

Bacilli

9,00%
96,00%

100,00%

99

Sulfolobales
Bacillales

Bacillales

6,00%
96,00%
100,00%

100,00%

Sulfolobaceae
Caryophanaceae
Enterobacteriaceae
Bacillaceae

6,00%
42,00%
100,00%

Stygiolobus
Caryophanon

6,00%
42,00%

Salmonella

35,00%

93,00%

Bacillus

82,00%

77,00%

Caryophanon

77,00%
100,00%

P11/B02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

79,00%

P11/B03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

32,00%

P11/B04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

Caryophanon

48,00%

P11/B05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

22,00%

P11/B06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Serratia

41,00%

P11/B07

Bacteria

99,00%

Proteobacteria

99,00%

Gammaproteobacteria

98,00%

Enterobacteriales

98,00%

Enterobacteriaceae

98,00%

Leclercia

71,00%

P11/B08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

40,00%

P11/B09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

Caryophanon

75,00%

P11/B10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

P11/B12

Bacteria

97,00%

Proteobacteria

81,00%

Gammaproteobacteria

56,00%

Oceanospirillales

17,00%

Oceanospirillaceae

16,00%

P11/C01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Erwinia

70,00%

P11/C02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

38,00%

P11/C03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

67,00%

Caryophanon

67,00%

P11/C04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P11/C05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Bacillaceae

100,00%

Bacillus

100,00%

P11/C06

Bacteria

100,00%

Firmicutes

99,00%

Bacilli

99,00%

Bacillales

83,00%

Bacillaceae

74,00%

Jeotgalibacillus

P11/C07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

99,00%

Moraxellaceae

99,00%

Acinetobacter

98,00%

P11/C08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

Citrobacter

45,00%

P11/C09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

78,00%

Caryophanon

78,00%

P11/C10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P11/C11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P11/C12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

80,00%

P11/D01

Bacteria

100,00%

Proteobacteria

98,00%

Gammaproteobacteria

98,00%

Xanthomonadales

90,00%

Xanthomonadaceae

90,00%

Stenotrophomonas

56,00%

P11/D02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Pseudomonas

85,00%

P11/D03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

98,00%

Pseudomonadales

97,00%

Moraxellaceae

84,00%

Acinetobacter

81,00%

P11/D04

Bacteria

100,00%

Proteobacteria

55,00%

Gammaproteobacteria

46,00%

Aeromonadales

39,00%

Succinivibrionaceae

39,00%

Ruminobacter

39,00%

P11/D05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

76,00%

Caryophanon

76,00%

P11/D06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

99,00%

P11/D07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Erwinia

84,00%

P11/D08

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

Caryophanon

68,00%

P11/D09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Erwinia

41,00%

P11/D10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

100,00%

Flavimonas

84,00%

P11/D11

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Bacillaceae

100,00%

Bacillus

P11/D12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Salmonella

25,00%

P11/E02

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

20,00%

P11/E03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

37,00%

P11/E04

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

98,00%

99,00%

100

Bacillales

99,00%

Caryophanaceae

48,00%

75,00%

100,00%

68,00%

Salmonella

35,00%

Oleispira

13,00%

26,00%

100,00%

P11/E05

Bacteria

100,00%

Proteobacteria

P11/E06

Bacteria

100,00%

Firmicutes

100,00%

P11/E07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

P11/E08

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

P11/E09

Archaea

29,00%

Euryarchaeota

18,00%

P11/E11

Bacteria

92,00%

Deferribacteres

4,00%

P11/E12

Bacteria

100,00%

Proteobacteria

100,00%

P11/F01

Bacteria

100,00%

Proteobacteria

100,00%

P11/F02

Bacteria

100,00%

Firmicutes

P11/F03

Bacteria

100,00%

Firmicutes

P11/F04

Bacteria

100,00%

P11/F05

Bacteria

100,00%

P11/F06

Bacteria

P11/F07

99,00%

Gammaproteobacteria
Bacilli

100,00%
99,00%
100,00%

Bacillales
Enterobacteriales

99,00%
100,00%

Enterobacteriaceae
Caryophanaceae
Enterobacteriaceae

100,00%
49,00%
100,00%

Raoultella

47,00%

Caryophanon

49,00%

Leclercia

45,00%
42,00%

98,00%

Caryophanaceae

42,00%

Caryophanon

8,00%

Methanopyrales

8,00%

Methanopyraceae

8,00%

Methanopyrus

8,00%

Deferribacteres

4,00%

Deferribacterales

4,00%

Incertae sedis 3

4,00%

Caldithrix

4,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

94,00%

100,00%

Bacilli

100,00%

Bacillales

100,00%

100,00%

Bacilli

100,00%

Bacillales

97,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Erwinia

62,00%

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

84,00%

Caryophanon

84,00%

P11/F08

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Enterobacter

41,00%

P11/F09

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Bacillaceae

Paraliobacillus

15,00%

P11/F10

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Escherichia

27,00%

P11/F11

Bacteria

95,00%

Proteobacteria

55,00%

30,00%

Bradyrhizobiaceae

18,00%

Oligotropha

14,00%

P11/G01

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

52,00%

Caryophanon

52,00%

P11/G02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

64,00%

Caryophanon

64,00%

P11/G03

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Pseudomonadaceae

Flavimonas

92,00%

P11/G04

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

P11/G05

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P11/G06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Pseudomonadales

100,00%

Moraxellaceae

100,00%

Acinetobacter

100,00%

P11/G07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

38,00%

P11/G08

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

Bacillus

74,00%

P11/G09

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

41,00%

P11/G11

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Raoultella

51,00%

P11/G12

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

53,00%

P11/H01

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

Enterobacteriaceae

100,00%

Citrobacter

74,00%

P11/H02

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

100,00%

Bacillales

100,00%

Caryophanaceae

87,00%

Caryophanon

87,00%

P11/H03

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

98,00%

Bacillales

94,00%

Bacillaceae

86,00%

Bacillus

48,00%

P11/H04

Bacteria

100,00%

Proteobacteria

99,00%

Pseudomonadales

98,00%

Moraxellaceae

91,00%

Acinetobacter

91,00%

P11/H05

Bacteria

100,00%

Firmicutes

100,00%

Bacilli

Bacillales

92,00%

Bacillaceae

90,00%

Bacillus

75,00%

P11/H06

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

85,00%

Pseudomonadales

79,00%

Moraxellaceae

45,00%

Acinetobacter

33,00%

P11/H07

Bacteria

100,00%

Proteobacteria

100,00%

Gammaproteobacteria

100,00%

Enterobacteriales

100,00%

100,00%

Escherichia

27,00%

P11/H08

Bacteria

100,00%

Proteobacteria

99,00%

Gammaproteobacteria

88,00%

Pseudomonadales

62,00%

56,00%

Alkanindiges

36,00%

99,00%

Gammaproteobacteria

39,00%

99,00%

100,00%

101

Bacillales

100,00%

Methanopyri

Alphaproteobacteria

99,00%

Enterobacteriales

Rhizobiales

Bacillales

88,00%

95,00%

Enterobacteriaceae

Buttiauxella

33,00%

72,00%

Acinetobacter

55,00%

Caryophanaceae

89,00%

Caryophanon

89,00%

Bacillaceae

97,00%

Bacillus

82,00%

100,00%

Flavimonas

98,00%

100,00%

Enterobacter

58,00%

Moraxellaceae

Bacillaceae

Bacillaceae

Enterobacteriaceae
Moraxellaceae

100,00%

92,00%

100,00%
85,00%

94,00%

Bacillus

56,00%

P11/H11

Bacteria

100,00%

Proteobacteria

74,00%

Gammaproteobacteria

67,00%

Enterobacteriales

49,00%

Enterobacteriaceae

49,00%

Tatumella

14,00%

P11/H12

Bacteria

83,00%

Proteobacteria

47,00%

Gammaproteobacteria

25,00%

Aeromonadales

16,00%

Succinivibrionaceae

16,00%

Succinimonas

14,00%

102