Você está na página 1de 414

Organizadores:

Maria Cristina Dreher Mansur


Cintia Pinheiro dos Santos
Daniel Pereira
Isabel Cristina Padula Paz
Manuel Luiz Leite Zurita
Maria Teresa Raya Rodriguez
Marinei Vilar Nehrke
Paulo Eduardo Aydos Bergonci

Patrocnio e Apoio:

Organizadores:
Maria Cristina Dreher Mansur
Cintia Pinheiro dos Santos
Daniel Pereira
Isabel Cristina Padula Paz
Manuel Luiz Leite Zurita
Maria Teresa Raya Rodriguez
Marinei Vilar Nehrke
Paulo Eduardo Aydos Bergonci

Porto Alegre
2012

Organizadores:
Maria Cristina Dreher Mansur
Cintia Pinheiro dos Santos
Daniel Pereira
Isabel Cristina Padula Paz
Manuel Luiz Leite Zurita
Maria Teresa Raya Rodriguez
Marinei Vilar Nehrke
Paulo Eduardo Aydos Bergonci
Projeto editorial:
Guacira Gil e Salete Campos de Moraes
Redes Editora
Projeto grfico, editorao e capas:
Eleandro Moyss
Foto capa:
Macroaglomerado de mexilho-dourado, Lago Guaba, RS. M.C.D. Mansur.
Impresso:
Grfica Evangraf
Tiragem: 1000 exemplares

Dados Internacionais de Catalogao na Publicao (CIP)


E24

Moluscos lmnicos invasores no Brasil : biologia, preveno e controle / organizador


Maria Cristina Dreher Mansur ... [et al.]. Porto Alegre : Redes Editora, 2012.
412 p. ; 29,7 cm.
ISBN: 978-85-61638-46-7
1. Meio Ambiente Brasil. 2. Moluscos Lmnicos.
3. Moluscos Invasores no Brasil. 4. Mexilho-Dourado.
I. Mansur, Maria Cristina Dreher.
CDD 639.42
Bibliotecrio Responsvel
Ginamara Lima Jacques Pinto
CRB 10/1204

Redes Editora Ltda.


Av. Plnio Brasil Milano, 388, conj. 501 90520-000 Porto Alegre/RS Brasil
http://www.redeseditora.com.br/loja - E-mail: redeseditora@redeseditora.com.br
F: (51)8109.4238

Sumrio
PREFCIO.................................................................................... 09
APRESENTAO................................................................. 11
LISTA DE COLABORADORES............................ 13
SEO 1
Moluscos invasores nos ecossistemas
continentais do Brasil
CAPTULO 1............................................................................. 19
Abordagem conceitual dos moluscos
invasores nos ecossistemas lmnicos brasileiros
CAPTULO 2............................................................................. 25
Espcies de moluscos lmnicos
invasores no Brasil
CAPTULO 3............................................................................. 51
Gentica da bioinvaso do mexilho-dourado
SEO 2
Biologia de moluscos invasores
CAPTULO 4............................................................................. 61
Bivalves invasores lmnicos: morfologia
comparada de Limnoperna fortunei
e espcies de Corbicula spp.
CAPTULO 5............................................................................. 75
Identificao e diferenciao dos bivalves
lmnicos invasores dos demais bivalves
nativos do Brasil
CAPTULO 6............................................................................. 95
Morfologia e ciclo larval comparados de
bivalves lmnicos invasores e nativos

CAPTULO 7.......................................................................... 111


A gametognese em Limnoperna fortunei
(Dunker, 1857)
CAPTULO 8.......................................................................... 119
Dinmica reprodutiva de Corbicula fluminea
e Corbicula largillierti
CAPTULO 9......................................................................... 125
Gastrpodes lmnicos invasores:
morfologia comparada
SEO 3
Monitoramento de moluscos invasores
CAPTULO 10.......................................................................139
Como monitorar bivalves invasores no plncton?
Mtodo da microscopia ptica
CAPTULO 11....................................................................... 143
O mtodo molecular de prospeco
do mexilho-dourado
CAPTULO 12....................................................................... 149
Mtodo de deteco e quantificao de larvas
do mexilho-dourado Limnoperna fortunei,
usando PCR quantitativo em tempo real
CAPTULO 13.......................................................................155
Como monitorar moluscos lmnicos
invasores bentnicos e
macroinvertebrados associados?
SEO 4
Aspectos populacionais de moluscos
invasores e relaes com variveis ambientais

CAPTULO 14....................................................................... 187


Limnoperna fortunei na Bacia da
Lagoa dos Patos e Lagoa Mirim

CAPTULO 23.......................................................................255
Os impactos do mexilho-dourado sobre
a comunidade planctnica

CAPTULO 15.......................................................................193
Limnoperna fortunei na bacia hidrogrfica
do baixo Rio Jacu e Lago Guaba,
Rio Grande do Sul

SEO 7
Preveno

CAPTULO 16.......................................................................197
Limnoperna fortunei na bacia do Rio
Paraguai, Mato Grosso do Sul
CAPTULO 17.......................................................................201
Limnoperna fortunei associada a
macrfitas aquticas na bacia do
Rio Paraguai, Mato Grosso

CAPTULO 24...................................................................... 265


Aes de EletrobrasFURNAS na divulgao da
Campanha de Controle do Mexilho-Dourado
CAPTULO 25.......................................................................271
Aes desenvolvidas pelo Ministrio
do Meio Ambiente 2001 a 2011
SEO 8
Delineamento experimental:
seleo de mtodos de controle populacional

CAPTULO 18...................................................................... 207


Experincia da procura e monitoramento
no incio da invaso de mexilho-dourado
no Rio Paran e no reservatrio de Itaipu

CAPTULO 26.......................................................................279
Planejamento experimental para a seleo
de mtodos de controle populacional
de moluscos invasores

SEO 5
Moluscos invasores e a
comunidade bentnica

SEO 9
Controle populacional de bivalves
invasores: mtodos qumicos

CAPTULO 19.......................................................................221
Distribuio espacial do mexilho-dourado
na bacia do mdio Rio Tiet/Jacar, So Paulo,
Brasil: relao com moluscos lmnicos,
fitoplncton e qualidade da gua

CAPTULO 27...................................................................... 297


Controle Qumico: conceitos bsicos

CAPTULO 20...................................................................... 235


Efeito do macrofouling sobre a comunidade
de invertebrados aquticos

CAPTULO 29.......................................................................303
Formas de Cloro

CAPTULO 21.......................................................................243
Limnoperna fortunei na bacia hidrogrfica
do baixo Rio Jacu: relaes com a
comunidade de macroinvertebrados bentnicos

CAPTULO 28...................................................................... 299


Microencapsulados

CAPTULO 30.......................................................................307
Sulfato de Cobre
CAPTULO 31....................................................................... 311
Outros compostos

SEO 6
Efeito da filtrao de bivalves invasores
sobre a comunidade planctnica

CAPTULO 32....................................................................... 317


Seleo de materiais e revestimentos para
o controle de incrustaes do
mexilho-dourado em hidreltricas.

CAPTULO 22...................................................................... 249


O impacto de Limnoperna fortunei
sobre as cianobactrias

CAPTULO 33.......................................................................323
Tintas anti-incrustantes no controle
do mexilho-dourado

SEO 10
Controle populacional de bivalves
invasores: mtodos fsicos

SEO 12
Modelos de anlise de risco e previso de
cenrios de disperso de moluscos invasores

CAPTULO 34........................................................................... 331


Controle Fsico: conceitos bsicos

CAPTULO 40...........................................................................367
Anlise de risco de introduo de
moluscos aquticos invasores

CAPTULO 35........................................................................... 335


Controle de Limnoperna fortunei com
aplicao de radiao ultravioleta
CAPTULO 36........................................................................... 339
Controle de bivalves com a
utilizao do ultrassom
SEO 11
Controle populacional de bivalves
invasores: mtodos biolgicos
CAPTULO 37........................................................................... 345
Controle Biolgico: conceitos bsicos
CAPTULO 38........................................................................... 351
Controle Microbiano
CAPTULO 39........................................................................... 357
Predadores potenciais para o
controle do mexilho-dourado

CAPTULO 41........................................................................... 373


Modelos de previso da distribuio do
mexilho-dourado no Brasil
CAPTULO 42...........................................................................377
Previso de cenrios de distribuio de
Limnoperna fortunei na Laguna dos Patos
SEO 13
Manejo de Espcies Invasoras
CAPTULO 43........................................................................... 383
Manejo integrado de espcies
invasoras de moluscos lmnicos
REFERNCIAS........................................................................ 389

Prefcio

Com vistas a incentivar a busca constante por inovaes e fazer
frente aos desafios tecnolgicos do setor eltrico, foi regulamentado o
Programa de Pesquisa e Desenvolvimento (P&D). Neste contexto, as empresas concessionrias, permissionrias ou autorizadas de distribuio,
transmisso e gerao de energia eltrica devem aplicar anualmente um
percentual mnimo de sua receita operacional lquida no Programa de
Pesquisa e Desenvolvimento do Setor de Energia Eltrica (ANEEL).

Esta publicao produto final do Projeto Estudos biolgicos e
ambientais como base preveno e ao controle do mexilho-dourado,
Limnoperna fortunei (Dunker, 1857), em rios e reservatrios brasileiros,
que foi financiado pelo Programa de P&D ANEEL/FURNAS, tendo
como sede das pesquisas o Centro de Ecologia da Universidade Federal
do Rio Grande do Sul (UFRGS) e a Fundao Luiz Englert como administradora junto citada Universidade. Est subdividido em 13 sees,
dentro das quais esto distribudos 43 captulos, redigidos por diversos
especialistas de projeo no Brasil e no exterior alm dos pesquisadores
envolvidos diretamente no projeto. Sua importncia singular, devido
ao somatrio de pesquisas direcionadas compreenso do comportamento e do ciclo de vida do mexilho-dourado, como base aos diferentes
mtodos testados para a preveno e ao controle do mesmo.

A chegada do mexilho-dourado L. fortunei marcou um dos mais
alarmantes casos de bioinvaso das guas continentais brasileiras. Atravs do seu alto poder reprodutivo este invasor tem causado srios problemas de entupimento nos sistemas coletores de gua, canalizaes, refrigeradores de indstrias, unidades geradoras de energia e sistemas de
cultivo em tanques-rede, bem como impactos ambientais, devido a sua
alta densidade populacional. Os impactos no ambiente podero ser mais
expressivos em longo prazo com trocas na estrutura da cadeia trfica,
como j relatados na Argentina e no Brasil. As espcies invasoras foram
consideradas como a terceira maior ameaa para a biodiversidade pela
Unio Internacional para a Conservao da Natureza (IUCN) e o Governo brasileiro. J o Ministrio do Meio Ambiente MMA considera
espcies introduzidas a segunda maior causa de extino de espcies.

A presente obra recebe importante contribuio com base em anlises genticas das populaes invasoras da espcie L. fortunei no Brasil,
que podem ser resumidas como: o mexilho-dourado invadiu as guas

continentais brasileiras mais de uma vez; as populaes que invadiram


o Brasil vieram de diferentes locais; a migrao natural no vetor mais
importante deste processo de bioinvaso.

A capacidade de deteco precoce de espcies aquticas invasoras
durante o processo de sua disperso essencial para a definio de medidas de controle ou erradicao. O monitoramento de bivalves invasores
pode se dar por vrios mtodos. O mais bvio e simples a observao
das conchas dos indivduos adultos no ambiente. Embora esta seja a maneira mais fcil, a deteco tardia e prejudica aes de controle ou
eliminao dos moluscos. Para contornar este problema, so apresentados, neste Guia, mtodos clssicos de deteco morfolgica das larvas,
e tcnicas mais sensveis e especficas que se referem deteco via PCR
e quantificao de larvas em amostras de plncton por PCR em tempo
real.

Na tentativa de controlar as espcies invasoras, so apresentados
mtodos qumicos, fsicos e biolgicos, com comentrios sobre as vantagens e desvantagens de cada um deles.

O controle de organismos invasores (bioincrustaes) no mundo
est sendo impulsionado pela busca por maior eficincia com baixo custo, associado a um baixo impacto ambiental e operacional. Vale ressaltar, que novas informaes e desdobramentos dessa pesquisa financiada
atravs do Programa da ANEEL de Pesquisa e Desenvolvimento, possibilitaro a melhoria de procedimentos e a aplicao de aes preventivas e
corretivas que aumentem a eficincia no controle do mexilho-dourado,
contribuindo efetivamente para uma performance adequada do setor
eltrico, preservando e cuidando do meio ambiente.

Paulo S. Formagio

10

Apresentao

O ambiente de gua doce, j to disputado pelo homem e que em
futuro muito prximo dever apresentar os problemas mais crticos no
nosso planeta devido escassez de gua, nas ltimas dcadas tem servido de cenrio para as invases causadas por moluscos lmnicos, com
todas as consequncias para o ecossistema e aos sistemas construdos
pelo homem. Os impactos destas invases tm sido complexos e incalculveis. No meio ambiente, a integridade das comunidades naturais
afetada com reflexos na biodiversidade, na cadeia trfica, na qualidade
ambiental, com riscos sade humana e problemas sanitrios imprevisveis. Nos sistemas de hidroeltricas, barramentos, refrigerao de indstrias, canalizaes, tratamento de gua, pesca, turismo etc., os prejuzos
econmicos ultrapassam a casa dos bilhes de dlares americanos.

As invases causadas por espcies exticas so uma consequncia
da prpria evoluo do homem moderno. As companhias de comrcio
operam globalmente (Walker, 2005), contribuindo para a eliminao ou
reduo das barreiras naturais que sempre separaram e mantiveram a
integridade dos ecossistemas (Silva et al., 2004).

Os bivalves asiticos do gnero Corbicula chegaram por primeiro
na dcada de 1970 e o mexilho-dourado na de 1990. Todas as reas dos
primeiros registros foram nas cercanias de portos, recaindo a suspeita de
que tenham sido transportados na gua de lastro de navios transocenicos.

Acompanhamos pessoalmente as invases dos bivalves junto bacia do Lago Guaba que banha Porto Alegre, capital do Rio Grande do
Sul, no extremo sul do Brasil. Como especialista em bivalves nativos,
foi muito difcil explicar o que estvamos presenciando. As primeiras
dvidas surgiram com todas aquelas formas diferentes de Corbicula que
foram aparecendo em sequncia, uma dando lugar outra. Seriam uma
ou mais espcies? Nossa espcie nativa Cyanocyclas limosa, da mesma
famlia, havia praticamente desaparecido. Depois o mexilho-dourado.
Em aproximadamente dois anos aps os primeiros registros, a populao alcanou densidades de 140.000 indivduos e recrutas em mais de 1
milho por m2 . Ficamos pasmos com a rapidez da modificao do ambiente lacustre. Cada ms que amos a campo havia uma surpresa, uma
nova alterao, principalmente em se tratando da fauna e flora ripria e
bentnica. Todas as estaes de tratamento da gua e sistemas de refrigerao de fbricas que utilizam gua bruta no entorno do lago, tiveram
problemas de entupimentos e partiram para solues emergenciais nem

11

12

sempre recomendadas ambientalmente. Foi tambm dificlimo, inicialmente, convencer e sensibilizar os rgos ambientais para obtermos
licenas de coleta e os financiadores de pesquisa, sobre a necessidade
de desenvolvermos pesquisas sobre o tema e ter projetos aprovados.

Esta obra representa o esforo de uma equipe de bilogos especializados em diferentes reas, desde a Taxonomia, Ecologia, Biologia Molecular e Controle Biolgico, com apoio de engenheiros qumicos, ambientais, e barrageiros, no sentido de reunir dados disponveis e integrar
os conhecimentos. O ponto de partida para a organizao de todos os estudos e subprojetos foi, inicialmente, a pesquisa bsica, que nos permitiu
aprofundar os conhecimentos sobre taxonomia e morfologia comparada
das espcies de bivalves invasores, em todas as fases de desenvolvimento,
dando-nos a certeza da identidade, do nmero de espcies e das respectivas reas de invaso. Calcados neste pilar, e no aprendizado de novas
tcnicas de coleta e monitoramento foi possvel, com mais segurana,
direcionar as pesquisas para a compreenso das interferncias e atuaes
das espcies invasoras no meio ambiente e realizar experimentos para
adequar e adaptar tcnicas direcionadas ao controle das diferentes espcies invasivas de moluscos no ambiente lmnico brasileiro. E, por ltimo,
objetivando um controle com tcnicas ambientalmente compatveis, sugerir um manejo integrado.

A ideia do livro surgiu durante a elaborao de um projeto de
Pesquisa e Desenvolvimento (P & D) sugerido pelo biol. Rodrigo De
Filippo, da empresa FURNAS, por demanda da mesma. Este projeto foi
idealizado em 2008/9, iniciado em outubro de 2009, com a finalizao
prevista para setembro de 2012 e o lanamento do livro em julho deste
ano. Reunimos neste livro tambm o resultado de projetos desenvolvidos
anteriormente, com recursos do GLOBALLAST que subsidiou a Fora
Tarefa Nacional de Combate ao Mexilho-Dourado no perodo de 2003
a 2004; com o Auxlio para pesquisa CTHIDRO/CNPq durante o perodo de 2005 a 2008, sob a coordenao geral do Dr. Flvio da Costa
Fernandes do IEAPM Marinha do Brasil, alm de recursos obtidos
pelo edital Universal do CNPq e projetos de P & D financiados pela
TRACTEBEL, AES Tiet, ENERPEIXE e CEEE.

Parte das pesquisas que compem vrios captulos deste livro, foram desenvolvidas no Centro de Ecologia da Universidade Federal do
Rio Grande do Sul, com recursos FURNAS/ANEEL que permitiram
equipar e adaptar oito laboratrios para estudos do mexilho-dourado.
Tambm foram convidados pesquisadores de outras instituies brasileiras
(IEAPM, IFRR, NUPLIA/UEM, FURG, UFMT, UERJ, ICMBio, IBAMA, MMA, FURG, FIOCRUZ, UFP) e do exterior (UNRN e UNLP, na
Argentina, e ICPIEE, no Japo), que contriburam com textos de altssima qualidade para a obra apresentada.

Quando este livro estiver publicado possvel que invasoras mais
agressivas tenham chegado ao nosso pas e novas tcnicas mais eficientes
tenham sido pesquisadas e testadas. Assim este livro no definitivo,
mas uma ponte para facilitar novos estudos e descobertas.

Maria Cristina Dreher Mansur

Colaboradores
ARCHUBY, FERNANDO

Universidad Nacional de Ro Negro (UNRN), Instituto


de Paleobiologa y Geologa, Calle Isidro Lobos y
Belgrano, 8332, General Roca, Ro Negro, Argentina,
e-mail: invasion@fcnym.unlp.edu.ar

ARENZON, ALEXANDRE

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia, Av.
Bento Gonalves, 9500, setor 4, prdio 43411, Cx.
postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: alex@ufrgs.br

ARRUDA, JANINE OLIVEIRA

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia, Av.
Bento Gonalves, 9500, setor 4, prdio 43411, Cx.
postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: arrudajo@gmail.com

BARBOSA, FABIANA GONALVES

Universidade Federal do Rio Grande (FURG),


CENOSYS, Av. Itlia km 8, Carreiros, 96203-900
Rio Grande, RS, Brasil,
e-mail: fabibarbos@gmail.com

BASEGIO, TANIA MARIA

Universidade Federal do Rio Grande do Sul (UFRGS),


Escola de Engenharia, Departamento de Materiais,
Av. Osvaldo Aranha, 99, Centro, 90035-190
Porto Alegre, RS, Brasil,
e-mail: tania-basegio@ufrgs.br

BERGONCI, PAULO EDUARDO AYDOS

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: paulobergonci@gmail.com

BERUTTI, FELIPE AMORIM

Universidade Federal do Rio Grande do Sul


(UFRGS), Escola de Engenharia, Departamento
de Materiais, Av. Osvaldo Aranha, 99 sala
705C, 90035-190 Porto Alegre, RS, Brasil,
e-mail: fila@ufrgs.br

BOEGER, WALTER ANTONIO

Universidade Federal do Paran (UFPR), Departamento


de Zoologia, Setor de Cincias Biolgicas, Grupo
Integrado de Aquicultura e Estudos Ambientais, Av.
Francisco H. dos Santos, s/n, Jardim das Amricas,
Cx. postal 19073, 81531-980 Curitiba, PR, Brasil,
e-mail: wboeger@ufpr.br

CALAZANS C., SVIO HENRIQUE

Instituto de Estudos do Mar Almirante Paulo zoreira (IEAPM),


Rua Kioto, 253, Praia dos Anjos, 28930-000
Arraial do Cabo, RJ, Brasil,
e-mail: saviocalazans@gmail.com

CALHEIROS, DBORA FERNANDES


Embrapa Pantanal
Rua 21 de Setembro, 1880, Corumb, MS
e-mail: debora@cpap.embrapa.br

BELZ, CARLOS EDUARDO

CALLIL, CLAUDIA TASSO

BEMVENUTI, CARLOS EMLIO

COLLING, LEONIR ANDR

Universidade Federal do Paran (UFPR),


Centro de Estudos do Mar, CEM, Av. Beira Mar, s/n,
Balnerio Pontal do Sul, Pontal do Paran, 83255-000
Pontal do Paran, PR, Brasil,
e-mail: belzoceanos@ufpr.br
Universidade Federal do Rio Grande (FURG),
Instituto de Oceanografia, Laboratrio de Ecologia
de Invertebrados Bentnicos, Campus Carreiros, Base
Oceanogrfica, Av. Itlia, Km 8, s/n, Cx. postal 474, 96201-900
Rio Grande, RS, Brasil,
e-mail: docbemve@furg.br

BERGMANN, CARLOS PREZ

Universidade Federal do Rio Grande do Sul


(UFRGS), Escola de Engenharia, Departamento
de Materiais, Av. Oswaldo Aranha 99 sala
705, 90035-190 Porto Alegre, RS, Brasil,
e-mail: bergmann@ufrgs.br

Universidade Federal do Mato Grosso (UFMT),


Instituto de Biocincias, Departamento de Biologia e
Zoologia, Av. Fernando Correa da Costa, n 2367,
Bairro Boa Esperana, 78060-900 Cuiab,
MT, Brasil, e-mail: callil@ufmt.com
Universidade Federal do Rio Grande (FURG),
Instituto de Oceanografia, Laboratrio de Ecologia
de Invertebrados Bentnicos, Av. Itlia, Km 08,
Cx. postal 474, 96203-000 Rio Grande, RS, Brasil,
email: lcolling@furg.br

COUTINHO, RICARDO

Instituto de Estudos do Mar Almirante Paulo Moreira (IEAPM),


Rua Kioto, 253, Praia dos Anjos, 28930-000
Arraial do Cabo, RJ, Brasil,
e-mail: rcoutinhosa@yahoo.com

13

DANELON, OLGA MARIA

Instituto de Estudos do Mar Almirante Paulo Moreira (IEAPM),


Rua Kioto, 253. Praia dos Anjos, 28930-000
Arraial do Cabo, RJ, Brasil,
e-mail: olga.danelon@gmail.com

DARRIGRAN, GUSTAVO

Museo de La Plata, Divisin Zoologa Invertebrados


(UNLP - FCNyM), Grupo de Investigacin
sobre Moluscos Invasores/Plagas (GIMIP),
Paseo del Bosques /n, La Plata 1900, La Plata, Argentina,
www.malacologia.com.ar , e-mail: invasion@fcnym.unlp.edu.ar

DE FILIPPO, RODRIGO

Rua Pitangueiras 315/73, Mirandpolis, 04052-020


So Paulo, SP, Brasil,
e-mail: rodrigo.de.filippo@gmail.com

ENDO, NORIYUKI

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Laboratrio de Invertebrados
Bentnicos I, Av. Bento Gonalves, 9500, prdio 43435,
sala 204, 91501-970 Porto Alegre, RS, Brasil,
e-mail: suzana.freitas@ufrgs.br

FUJITA, DANIELE SAYURI

Instituto Federal de Educao, Cincia e Tecnologia de


Roraima (IFECTR), Campus Amajari, Av. Tepequm, s/n
Centro, 69343-000 Amajari, RR, Brasil,
e-mail: daniele.fujita@ifrr.edu.br

GAZULHA, VANESSA

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970, Porto Alegre, RS, Brasil,
e-mail: vanessagazulha@gmail.com

Instituto Central de Pesquisa da Indstria de Energia


Eltrica (ICPIEE), Laboratrio de Pesquisa de Cincias
Ambientais, 1646 Abiko, Abiko-shi, Chiba-ken 270-1194,
Japo, Endereo atual: Himeji Eco tech Co., Ltd.,
Himeji, 672-8023 Hyogo, Japo,
e-mail: endo@himeji-ecotec.com

GOMES, ANA LCIA TEIXEIRA

FACHINI, ALINE

GONALVES, ISABELA CRISTINA BRITO

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: ali.fachini@gmail.com

FERNANDES, FLAVIO DA COSTA

Universidade Federal de Mato Grosso (UFMT),


Instituto de Biocincia, Laboratrio de Ecologia Animal
CCBS-III, Av. Fernando Corra da Costa, n 2367,
Bairro Boa Esperana, 78060-900 Cuiab, MT, Brasil,
e-mail: lu_teyxeyra@hotmail.com
Universidade do Estado do Rio de Janeiro (UERJ),
Instituto de Biologia Roberto Alcntara Gomes,
Laboratrio de Malacologia Lmnica e Terrestre,
Rua So Francisco Xavier, 524, PHLC 525-2, Maracan,
20550-900 Rio de Janeiro, RJ, Brasil,
e-mail: isabelabiouerj@yahoo.com.br

GOULART, MARCILIA BARBOSA

Instituto de Estudos do Mar Almirante Paulo Moreira (IEAPM),


Rua Kioto, 253. Praia dos Anjos, 28930-000
Arraial do Cabo, RJ, Brasil,
e-mail: flaviocofe@yahoo.com

Estao de Hidrobiologia e Piscicultura de Furnas,


Rua Lavras 288, Usina de Furnas, 37945-000
So Jos da Barra, MG, Brasil

FERNADES, LIVIA VIANA DE GODOY

e-mail:lihage@yahoo.com.br

Instituto de Estudos do Mar Almirante Paulo


Moreira (IEAPM), Rua Kioto, 253.
Praia dos Anjos, 28930-000 Arraial do Cabo, RJ,
e-mail: liviadomar@hotmail.com

FERNANDEZ, MONICA AMMON

HAGE-MAGALHES, LILIAN RIBEIRO


KAPUSTA, SIMONE CATERINA

Instituto Federal de Educao, Cincia e Tecnologia do


Rio Grande do Sul (IFECTRGS), Campus Porto Alegre,
Rua Cel. Vicente, 281, 90.030-040, Porto Alegre, RS, Brasil,
e-mail: sikarieck@yahoo.com.br

Laboratrio de Malacologia, Instituto Oswaldo


Cruz (FIOCRUZ), Av. Brasil 4365, Manguinhos,
21040-900 Rio de Janeiro, RJ, Brasil,
e-mail: ammon@ioc.fiocruz.br

LOPES, MICHELLE DAS NEVES

FIGUEIREDO, GABRIELA CRISTINA SANTOS DE

MANSUR, MARIA CRISTINA DREHER

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: gab.figueiredo@hotmail.com

14

FREITAS, SUZANA MARIA FAGONDES DE

FORMAGIO, PAULO SERGIO

Estao de Hidrobiologia e Piscicultura de Furnas


(ELETROBRAS/FURNAS). Rua Lavras 288,
37945-000 Furnas, MG, Brasil,
e-mail: formagio@furnas.com.br

Centro Universitrio (FACVEST, NDE), Cincias Biolgicas,


Av. Marechal Floriano, 947, Centro, 88501-103 Lages, SC, Brasil,
e-mail: michellenlopes@gmail.com
Universidade Federal do Rio Grande do Sul (UFRGS),
Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: mcrismansur@gmail.com

MARAL, SANDRA FRANCISCA

Universidade Federal de Mato Grosso(UFMT), Programa


de Ps Graduao em Ecologia e Conservao da
Biodiversidade, Av. Fernando Correa da Costa, 2367,
Bairro Boa Esperana, 78060-900 Cuiab, MT, Brasil,
e-mail: sandraabio@gmail.com

MASSOLI, EDSON VIANA JUNIOR

PEDROZO, CATARINA DA SILVA

MELO, ADRIANO SANCHES

PEREIRA, DANIEL

Universidade de Varzea Grande (UNIVAG),


Centro Universitrio, GPA Cincias Agrrias e Biolgicas,
Av. Dom Orlando Chaves, 2655, Cristo Rei, 78118-900
Vrzea Grande, MT, Brasil,
e-mail: massolijr@hotmail.com
Universidade Federal de Gois (UFG), Instituto
de Cincias Biolgicas, Campus Samambaia,
Cx. postal 131, 74001-970 Goinia, GO, Brasil,
e-mail: asm.adrimelo@gmail.com

MIYAHIRA, IGOR CHRISTO

Universidade do Estado do Rio de Janeiro (UERJ),


Instituto de Biologia Roberto Alcntara Gomes, Laboratrio de
Malacologia Lmnica e Terrestre, Rua So Francisco Xavier 524,
PHLC 525-2, Maracan, 20550-900 Rio de Janeiro, RJ, Brasil,
e-mail: icmiyahira@yahoo.com.br

NEHRKE, MARINEI VILAR

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: marineivilar@gmail.com

NOGATA, YASUYUKI

Instituto Central de Pesquisa da Indstria de Energia


Eltrica (ICPIEE), Laboratrio de Pesquisa de Cincias
Ambientais 1646 Abiko, Abiko-shi, 270-1194 Chiba, Japo,
e-mail: noga@criepi.denken.or.jp

OLIVEIRA, ARTHUR SCHRAMM DE

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: asoliveira22@gmail.com

OLIVEIRA, MARCIA DIVINA DE

Empresa Brasileira de Pesquisa Agropecuria (EMBRAPA - Pantanal),


Limnologia, Rua 21 de setembro, 1880, 79320-900
Corumb, MS, Brasil,
e-mail: mmarcia@cpap.embrapa.br

OSTRENSKY, ANTONIO

Universidade Federal do Paran (UFPR),


Departamento de Zootecnia, Grupo Integrado de
Aquicultura e Estudos Ambientais, setor de Cincias
Agrrias, Rua dos Funcionrios, 1540, Juvev, 80035-050
Curitiba, PR, Brasil,
e-mail: ostrensky@ufpr.br

PATELLA, RAQUEL

Universidade Federal do Paran (UFPR),


Departamento de Zoologia, Grupo Integrado de Aquicultura
e Estudos Ambientais, setor de Cincias Biolgicas,
Av. Francisco H. dos Santos, s/n, Jardim das Amricas,
Cx. postal 19073, 81531-980 Curitiba, PR, Brasil,
e-mail: raquelpatella@hotmail.com

PAZ, ISABEL CRISTINA PADULA

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: isapaz@gmail.com

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: catarina@ecologia.ufrgs.br

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: danimdourado@gmail.com

PIMPO, DANIEL MANSUR

Instituto Brasileiro do Meio Ambiente e dos Recursos


Naturais Renovveis (IBAMA), Rua 229, n. 95, Setor
Leste Universitrio, 74605-090 Goinia, GO, Brasil,
e-mail: danielpimpao@yahoo.com.br

PINILLOS, ANA CECILIA MAGARIO

Universidade Federal do Mato Grosso (UFMT),


Instituto de Biocincias, Graduanda em Cincias
Biolgicas, Av. Fernando Corra da Costa, n 2367,
78060-900 Cuiab, MT, Brasil,
e-mail: ana_kubana@hotmail.com

PINOTTI, RAPHAEL MATHIAS

Universidade Federal do Rio Grande (FURG), Instituto de


Oceanografia, Laboratrio de Ecologia de Invertebrados
Bentnicos, Av. Itlia, km 8, Campus Carreiros,
Cx. postal 474, 96201-900 Rio Grande, RS, Brasil,
e-mail: raphael.oceano@gmail.com

POMBO, VIVIAN BECK

Ministrio do Meio Ambiente (MMA), Departamento de


Conservao da Biodiversidade, Esplanada dos Ministrios,
Bloco B, 70068-900 Braslia, DF, Brasil,
e-mail:vivian.pombo@mma.gov.br

POSTIGLIONE, RAONI ROCHA

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: raropos@hotmail.com

RAYA-RODRIGUEZ, MARIA TERESA

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: raya.rodriguez@ufrgs.br

RESENDE, FERNANDO ANTONIO BLANCO


Departamento de Equipamento Rotativo, Furnas Centrais
Eltricas - Escritrio Central, Rua Real Grandeza 219,
Botafogo, 22281-900 Rio de Janeiro, RJ, Brasil.

SANTOS, CINTIA PINHEIRO DOS

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411, Cx.
postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: cipinheiro@yahoo.com.br

15

SANTOS, SILVIO CARLOS ALVES DOS

AES Tiet, Departamento de Meio Ambiente, Usina


Hidreltrica de Promisso Rua Olavo Bilac, 620,
Cx. Postal 64, 16400-970 Lins, SP, Brasil,
e-mail: silvio.santos@aes.com

SANTOS, SONIA BARBOSA

Universidade do Estado do Rio de Janeiro (UERJ),


Instituto de Biologia Roberto Alcntara Gomes,
Laboratrio de Malacologia Lmnica e Terrestre,
Rua So Francisco Xavier 524, PHLC 525-2,
Maracan 20550-900 Rio de Janeiro, RJ, Brasil,
e-mail:sbsantos@uerj.br

SEBASTIANY, JULIANA BRASILIENSE

Instituto Biolgico do Meio Ambiente (IBIOMA),


Rua Conselheiro Arajo, Centro, 80060-230 Curitiba, PR, Brasil,
e-mail: juliana@ibioma.org

SILVA, EDSON PEREIRA DA

Universidade Federal Fluminense (UFF), Instituto de


Biologia, Departamento de Biologia Marinha, Laboratrio de
Gentica Marinha e Evoluo, Outeiro So Joo Batista, s/n,
Valonguinho, Cx. postal 100.644, 24001-970 Niteri, RJ, Brasil,
e-mail: gbmedson@vm.uff.br

SOARES, MRIAM DE FREITAS

Fundao Estadual de Proteo Ambiental


Henrique Luiz Roessler (FEPAM), Departamento
de Laboratrios, Diviso de Qumica, Rua Aurlio
Porto, 45, 90620-090 Porto Alegre, RS, Brasil,
e-mail: mfs2002@hotmail.com

SOARES, VINCIUS CORREA DA COSTA

Universidade Federal do Mato Grosso (UFMT),


Instituto de Biocincias, Departamento de Biologia e Zoologia,
Laboratrio de Ecologia Animal, Avenida Fernando
Corra da Costa, n 2367, Boa Esperana, 78060-900
Cuiab, MT, Brasil,
mail: vinissc@hotmail.com

SOUZA, ANDRESSA MORAES SOFIA DE

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411, Cx.
postal 15007, 91501-970 Porto Alegre, RS, Brasil,
mail: dessayukino@gmail.com

SOUZA, ESTEVO CARINO FERNANDES DE


Instituto Chico Mendes de Conservao da Biodiversidade
(ICMBio), Cx. postal 7993, 70670-350 Braslia, DF, Brasil,
e-mail: estevao.carino@icmbio.gov.br

TAKEDA, ALICE MICHIYO

Universidade Estadual de Maring (UEM), DBI/PEA/NUPELIA,


Av. Colombo, 5790, Bloco H-90, 87020-900 Maring, PR, Brasil,
e-mail: alicemtakeda@yahoo.com.br

16

THIENGO, SILVANA CARVALHO

Instituto Oswaldo Cruz (FIOCRUZ), Laboratrio de


Malacologia, Av. Brasil 4365 Manguinhos, 21040-900
Rio de Janeiro, RJ, Brasil,
e-mail: sthiengo@ioc.fiocruz.br

TSCH, MARCEL KRUCHELSKI

Universidade Federal do Paran (UFPR),


Departamento de Zoologia, Grupo Integrado de Aquicultura
e Estudos Ambientais, Setor de Cincias Biolgicas,
Av. Francisco H. dos Santos, s/n, Jardim das Amricas,
Cx. postal 19073, 81531-980 Curitiba, PR, Brasil,
e-mail: tscha@ufpr.br

UHDE, VERA

Universidade Federal de Mato Grosso (UFMT), Instituto


de Biocincias, Laboratrio de Ecologia Aqutica,
Av. Fernando Corra da Costa, n 2367,
Bairro Boa Esperana, 78060-900 Cuiab, MT, Brasil,
e-mail: v_uhde@hotmail.com

VANIN, ALINE SALVADOR

Universidade Federal do Rio Grande do Sul (UFRGS),


Instituto de Biocincias, Centro de Ecologia,
Av. Bento Gonalves, 9500, setor 4, prdio 43411,
Cx. postal 15007, 91501-970 Porto Alegre, RS, Brasil,
e-mail: linysv@yahoo.com.br

VICENZI, JULIANE

Universidade Federal do Rio Grande do Sul (UFRGS),


Escola de Engenharia, Departamento de Materiais,
Av. Osvaldo Aranha, 99, Centro, 90035-190
Porto Alegre, RS, Brasil,
e-mail: jvicenzi@ufrgs.br

VIEIRA, JOO PAES

Universidade Federal do Rio Grande (FURG),


Instituto de Oceanografia, Av. Itlia, km 8, Vila Carreiros,
96201-900 Rio Grande, RS, Brasil.
e-mail: vieira@mikrus.com.br

VILLANOVA, DANIELA LUPINACCI

Instituto Federal de Educao, Cincia e Tecnologia do Rio


Grande do Sul (IFECTRGS), Campus Farroupilha. Av. So
Vicente, 785, Centro, 95180-000 Farroupilha, RS, Brasil,
e-mail: danielal.villanova@gmail.com

XIMENES, RENATA FREITAS

Universidade do Estado do Rio de Janeiro (UERJ), Instituto


de Biologia Roberto Alcntara Gomes, Laboratrio de
Malacologia Lmnica e Terrestre, Rua So Francisco
Xavier 524, PHLC 525-2, Maracan, 20550-900
Rio de Janeiro, RJ, Brasil
e-mail: renatafximenes@yahoo.com.br

ZURITA, MANUEL LUIZ LEITE

M & Z Gesto e Processos Ambientais, Rua


Prof. Cristiano Fischer 181 /802, 91410-001
Porto Alegre, RS, Brasil,
e-mail: lzurita@terra.com.br

Seo
Moluscos invasores
nos ecossistemas
continentais do Brasil

CAPTULO 1
Abordagem conceitual dos moluscos invasores
nos ecossistemas lmnicos brasileiros
Flavio da Costa Fernandes
Maria Cristina Dreher Mansur
Daniel Pereira
Livia Viana de Godoy Fernandes
Svio Calazans Campos
Olga Maria Danelon


Quando abordamos o tema espcies invasoras, inmeros conceitos disponveis na literatura cientfica podem ser adotados, assim
como uma ampla discusso pode ser estabelecida. No entanto, do ponto de vista prtico
e considerando o pblico alvo ao qual ele se
destina, dentre os quais cabe citar o setor eltrico e os rgos ambientais, faz-se necessria
a apresentao de alguns conceitos seguidos no
exterior e no Brasil.

As espcies introduzidas ou exticas correspondem quelas presentes em um ecossistema de onde ela no originria, ou seja, nativa.
Vrias designaes de espcies introduzidas so
utilizadas: espcies no indgenas; aliengenas;
no nativas; estrangeiras; exticas; transplantadas e alctones (Espinola & Ferreira Junior,
2007).

Algumas espcies exticas tm grande capacidade de invaso e de colonizao de
ambientes devido s caractersticas biolgicas,
genticas, fisiolgicas e ecolgicas que confe-

rem tolerncia maioria dos fatores ambientais


(Machado & Oliveira, 2009). Ainda segundo
os mesmos autores, ao longo das ltimas dcadas, o processo de globalizao, associado
intensificao e velocidade do deslocamento
humano e de cargas pelos quatro cantos do
mundo contribuiu, sobremaneira, para a quebra de barreiras ecolgicas, tendo como uma
de suas consequncias o aumento expressivo
da introduo de espcies exticas nas sociedades. Segundo Valry et al. (2008a) a invaso biolgica consiste de espcies que adquirem uma vantagem competitiva, seguida do
desaparecimento de obstculos naturais sua
proliferao, o que permite que ela se disperse
rapidamente e conquiste novas reas, nas quais
se torna uma populao dominante.

Ainda cabe citar o conceito de espcies
engenheiras do ecossistema, estabelecido por
Jones et al. (1994). O autor define como engenheiros de ecossistema os organismos que direta ou indiretamente modificam a disponibilida-

19

Abordagem conceitual dos moluscos


invasores nos ecossistemas lmnicos brasileiros
Fernandes et al.

de de recursos para outras espcies, causando


alteraes biticas e abiticas. Dessa forma, espcies introduzidas com caractersticas invasivas, que se enquadram no conceito de espcies
engenheiras do ecossistema, causam impacto
ainda maior sobre o funcionamento do ecossistema.

Espinola & Ferreira Junior (2007) apresentaram uma ampla discusso sobre conceitos, modelos e atributos de espcies invasoras. Os autores ressaltaram a necessidade de
elaborar legislaes com base em conceitos
claros e de aplicao direta, extremamente
desejveis para subsidiar aes estratgicas
que previnam invases biolgicas. Tambm
apontam que a Portaria do Instituto Brasileiro
do Meio Ambiente e dos Recursos Naturais
Renovveis (IBAMA) N 145-N, de 29 de outubro de 1998, apresenta diversos termos para
denominar espcies introduzidas, levando a
confuses tcnicas e recomendam a utilizao
do termo espcie no indgena, no importando se a espcie proveniente de outro pas ou
no. Considerando as dimenses continentais
do Brasil, muito comum a introduo de espcies nativas com potencial invasivo, de uma
bacia hidrogrfica em outra na qual no ocorria.

No entanto, sem considerar a questo levantada pelos autores acima, Lopes & Villac
(2009) uniformizam os conceitos sobre espcie
extica e espcie invasora no livro editado e
publicado pelo Ministrio do Meio Ambiente
intitulado Informe sobre espcies exticas invasoras Marinhas no Brasil. Esta nomenclatura seguida por este Ministrio e seus rgos
no processo de tomadas de decises quanto a
esta problemtica ambiental. As categorias que
compem esta nomenclatura seguem abaixo:

20

Categorias genricas


Extica: espcie registrada fora de sua
rea de distribuio original.

Nativa: espcie que vive em sua regio
de origem (em contraste espcie extica).

Criptognica: espcie de origem biogeogrfica desconhecida ou incerta este termo
deve ser empregado quando no existe uma
evidncia clara de que a espcie seja nativa ou
extica.

Categorias especficas para


espcies exticas:


Contida: quando a presena da espcie
extica foi detectada apenas em ambientes artificiais controlados, isolados total ou parcialmente do ambiente natural (aqurio comercial,
cultivo para fins cientficos, tanque de gua de
lastro de navios etc.).

Detectada: quando a presena da espcie extica foi detectada no ambiente natural,
porm sem aumento posterior de sua abundncia e/ou de sua disperso (considerando o
horizonte de tempo das pesquisas ou levantamentos a respeito); ou, alternativamente, sem
que tenham sido encontradas informaes subsequentes sobre a situao populacional da espcie (registro isolado).

Estabelecida: quando a espcie introduzida foi detectada de forma recorrente, com
ciclo de vida completo na natureza e indcios
de aumento populacional ao longo do tempo
em uma regio restrita ou ampla, porm sem
apresentar impactos ecolgicos ou socioeconmicos aparentes.

Invasora: quando a espcie estabelecida possui abundncia ou disperso geogrfica
que interferem na capacidade de sobrevivncia
de outras espcies em uma ampla regio geogrfica ou mesmo em uma rea especfica, ou
quando a espcie estabelecida causa impactos
mensurveis em atividades socioeconmicas ou
na sade humana.

Aspectos da bioinvaso


As caractersticas biolgicas, qumicas
e fsicas do ecossistema determinam a sua vulnerabilidade invaso. Por exemplo, um ambiente muito degradado estar mais suscetvel
invaso do que ambientes ecologicamente
equilibrados. Contudo, importante ressaltar
que baixa a probabilidade de uma espcie
extica sobreviver e, alm disso, se estabelecer
em um ecossistema diferente do de sua origem.
Somente espcies com caractersticas invasivas
conseguem romper barreiras fisiolgicas e ecolgicas, estabelecendo-se em reas distintas da
original com sucesso reprodutivo, crescimento
populacional e disperso geogrfica acelerada.
Tambm importante considerar que a inva-

CAPTULO 1
Seo 1

so biolgica apresenta diferentes fases. Uma


espcie inicialmente no considerada como invasora, e sim simplesmente extica, pode apresentar comportamento invasivo com o passar
do tempo. Darrigran & Damborenea (2009a),
com base em autores consagrados, sintetizam
as fases de uma invaso biolgica: repouso ou
espera, quando uma espcie chega no ambiente
e se encontra dentro da capacidade de carga do
mesmo, com crescimento populacional lento;
pnico, quando a populao se expande de forma acelerada, excedendo a capacidade de carga
do ambiente invadido, e freio, quando ocorre a
diminuio do crescimento exponencial da fase
anterior at uma capacidade de carga menor a
inicial, passando para uma etapa de equilbrio
oscilatrio. Porm, uma vez estabelecida, dificilmente a invaso ser reversvel num ecossistema.

Naturalmente, h a disperso de espcies
onde anteriormente no eram nativas. O vetor
natural pode ser alguma outra espcie, como
peixes ou corrente marinha, etc. A capacidade
do homem de transportar por longas extenses
de terra, mar ou rio trouxe o aumento da possibilidade de introduo de espcies por onde
ele circule. Com o advento da navegao e,
mais recentemente, com a globalizao, a introduo de organismos aquticos em ambientes
no nativos se tornou caso frequente. Os navios
transportam, no intencionalmente, organismos
incrustados em sua estrutura, como casco e hlice. Mais importante que isso, os navios transportam gua de lastro (esta confere estabilidade
ao navio), a qual representa o principal vetor de
introduo de espcies exticas. Quando o navio no est transportando mercadoria, ele fica
leve e precisa encher seus tanques de lastro com
gua, para garantir flutuabilidade e navegabilidade. Ao deslastrar para carregar a mercadoria,
o navio joga gua de outra localidade neste porto. Nesta gua deslastrada, esto presentes varias formas de vida que podem encontrar boas
condies para sobreviver e se estabelecer neste
novo local. Quanto maior a carga de indivduos
introduzidos e a frequncia com que isto acontece, maior a probabilidade da introduo e invaso
serem bem sucedidas. Portanto, com o aumento
do transporte martimo, devido ao crescente intercmbio comercial entre os pases, torna-se
maior o nmero de casos de espcies invasoras
no Brasil e no mundo (Silva et al., 2004).


Os problemas causados por espcies invasoras levam, no mnimo, ao desequilbrio
ecolgico, principalmente, quando no encontram predador local. Por exemplo, o mexilho-zebra (Dreissena polymorpha) tem causado
prejuzos imensos por incrustao nos Grandes
Lagos, nos EUA; a disperso global de clera
(Vibrio cholerae) tem causado grave problema
sanitrio; o ctenforo Mnemiopsis leidy, invasor no Mar Negro, causou reduo drstica na
pescaria de enchovas e espadas; na Austrlia,
a estrela-do-mar Asterias amurensis causou
grande prejuzo ao cultivo de marisco; o bivalve Isognomon bicolor invadiu a regio intermareal do litoral brasileiro, impedindo a fixao
de muitas espcies nativas (Silva et al., 2004;
Darrigran & Damborenea, 2009a).

Como parar a disperso de espcies exticas pelo mundo via gua de lastro e bioincrustao dos navios? Com certeza no iremos
parar de usar os navios. A engenharia procura alternativas para um navio que no precise de lastro para garantir o equilbrio, mas o
caminho longo. As indstrias e institutos de
pesquisa buscam por material ou tinta anti-incrustante para as estruturas dos navios sujeitas
incrustao. Pesquisam, tambm, por produtos ou processos que possam tratar a gua de
lastro, visando morte do maior nmero de
indivduos possvel, presentes ali. Entretanto,
qualquer alternativa de soluo dever prevenir
o surgimento de novos problemas que impossibilitem seu uso. Por exemplo, o tratamento no
pode causar poluio do meio ambiente, nem
danificar as estruturas do navio, to pouco ser
economicamente invivel.

As preocupaes envolvendo introduo
de espcies exticas por gua de lastro vm
crescendo em todo o mundo desde a dcada
de 90. Ainda no h legislao internacional
vigente com diretrizes para o controle e gerenciamento da gua de lastro, apenas algumas recomendaes da Organizao Martima Internacional (IMO). Entretanto, em alguns pases,
j existe uma legislao nacional para controle
da gua de lastro. Desde 2005, entrou em vigor no Brasil, a Norma da Autoridade Martima 20 (NORMAM 20), a qual exige que o
navio em viagem internacional, que traga gua
de lastro, faa troca em alto mar, ou seja, numa
profundidade superior a 200 m. O mtodo pre-

21

Abordagem conceitual dos moluscos


invasores nos ecossistemas lmnicos brasileiros
Fernandes et al.

ventivo de troca de gua em alto mar baseia-se


no fato que o meio ambiente ocenico inspito a organismos de gua doce, estuarinos e
a maioria dos organismos de guas costeiras e
vice-versa. Ou seja, uma vez que os portos ficam em regies costeiras ou de rios, a troca em
alto mar levar guas dos portos para o oceano
e do oceano para os portos, o que minimiza
muito a transferncia de espcies indesejveis.
A NORMAM 20 tambm exige que navios em
cabotagem, oriundos de portos de gua doce,
faam tambm a troca no mar antes de deslastrarem em outro porto de gua doce (Silva et
al., 2004; Fernandes et al., 2009).

A introduo de espcies com potencial
invasivo pode ocorrer por diferentes formas.
Os moluscos bivalves invasores apresentam um
desenvolvimento inicial em forma de larva que
passa por vrias fases at chegar ao juvenil que
ser recrutado no ambiente bentnico, onde se
desenvolver at a fase adulta (ver Captulo 6).
Em algumas espcies, as larvas se desenvolvem
no plncton; em outras, se desenvolvem dentro
do corpo da me, sendo liberadas, na fase final

de larva ou como juvenil, no bentos. Na fase larval, os organismos podem ser sugados por bombas para o interior de tanques destinados a conter a gua de lastro (Fig. 1). Tambm podem ser
sugados para o interior de cisternas, de estaes
de tratamento de gua, canais de irrigao e sistemas de refrigerao de indstrias e usinas geradoras de energia eltrica. Outra forma de transporte
seria atravs da disperso de indivduos adultos
de espcies incrustantes, por meio de cascos de
embarcaes que circulam pelas hidrovias.

A seguir esto alguns potenciais vetores
que causam a introduo e a disperso de moluscos lmnicos invasores:

a) Alm da gua de lastro, outra via de
introduo a prtica de aquariofilia.

b) Embarcaes de pequeno a grande
porte em trnsito pelas hidrovias ou mesmo via
terrestre, pois alguns bivalves incrustados podem sobreviver por dias expostos ao ar.

c) guas contidas em tanques e cisternas
das embarcaes, contaminadas com larvas e
juvenis de moluscos invasores, transportadas
para outra bacia hidrogrfica.

22
Figura 1. Navio deslastrando gua contaminada, enquanto carregado com mercadorias; ciclo de vida do mexilho-dourado:
fases planctnica e bentnica (M.C.D. Mansur).

CAPTULO 1
Seo 1


d) A areia retirada de rios, contaminada
com moluscos invasores, transportada para outros mananciais.

e) Desvio de cursos naturais de corpos
hdricos (transposio de bacias) contaminados
com espcies invasoras.

f) A aquicultura torna-se um potencial
vetor, uma vez que a gua contendo os alevinos
ou os peixes pode conter larvas ou at mesmo
organismos adultos de moluscos invasores.

g) Peixes malacfagos so potenciais vetores de introduo, pois h disseminao do
molusco pela rea de abrangncia do peixe, j

que alguns mexilhes podem passar atravs do


tubo digestrio dos peixes e sarem vivos nas
fezes (ver Captulo 39).

h) A gua dos recipientes que transportam as iscas vivas para pesca pode conter larvas
dos bivalves invasores.

i) A utilizao de moluscos invasores
como isca constitui risco de disperso em festivais de pesca.

j) A transposio, por via terrestre, de
barcos utilizados para pesca, lazer ou inspeo
do reservatrio de bacias contaminadas para
bacias no contaminadas.

23

CAPTULO 2
Espcies de moluscos
lmnicos invasores
no Brasil
Sonia Barbosa dos Santos
Silvana Carvalho Thiengo
Monica Ammon Fernandez
Igor Christo Miyahira
Isabela Cristina Brito Gonalves
Renata de Freitas Ximenes
Maria Cristina Dreher Mansur
Daniel Pereira

1. Introduo


Os moluscos so animais invertebrados
que apresentam o corpo coberto pelo manto,
geralmente protegido por uma concha ( exceo: lesmas e polvos). Os moluscos esto divididos em sete subgrupos ou Classes, de acordo com certas caractersticas como a forma da
concha e do p. No ambiente de gua doce temos moluscos de dois grupos apenas, os bivalves e os gastrpodes. Os bivalves, geralmente chamados de mariscos, como o nome diz,
apresentam a concha dividida em duas valvas
articuladas. Os gastrpodes ou caracis apresentam uma concha geralmente helicoidal.
Nos ambiente de gua doce do Brasil temos
espcies invasoras tanto de bivalves como de
gastrpodes. senso comum que as espcies
exticas trazem prejuzos ao meio ambiente e
economia. Todavia, outras questes relativas
ao processo evolutivo (Mooney & Cleland,
2001), biologia da conservao (Coblentz,
1990; Olden et al., 2004) e introduo de

novos parasitos que afetam a sade humana


e animal, incluindo as relaes ecolgicas das
comunidades invadidas (Font, 2003; Torchin
et al., 2003) so ainda pouco exploradas no
Brasil.

Bivalves lmnicos invasores

2.1. Caractersticas da espcie

2. O mexilho-dourado
Limnoperna fortunei
(Dunker, 1857)


O mexilho-dourado, L. fortunei (Fig.
1), um bivalve pequeno (entre 2 e 3 cm) com
caractersticas tpicas da famlia dos mexilhes
marinhos (Mytilidae), como: formato da concha mitiloide, modo de vida gregrio, formando incrustaes sobre substratos duros (Fig.
1B), onde se fixa com auxlio de fios de bisso.
No entanto, o nico que vive na gua doce
(ver morfologia no Captulo 4).

25

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.


As incrustaes formadas pelo mexilho-dourado so volumosas. Vrios indivduos que se sobrepem fixando-se ao substrato e
entre si, pelos fios de bisso. Os menores preenchem os espaos entre os maiores, formando
assim verdadeiros macroaglomerados compactos e resistentes fora da correnteza.

Desenvolve-se preferencialmente em ambientes lticos e bem oxigenados; apresenta
um comportamento invasivo (Morton, 1973,
1977; Darrigran & Damborenea, 2006a), e
transformador do meio ambiente, pois altera a
composio do bentos e a paisagem ribeirinha
(Mansur et al., 2004a, b).

2.2. Etimologia


O nome comum dourado deriva de sua
cor predominantemente amarelada. O nome
cientfico do gnero Limnoperna compos-

des populacionais e a capacidade de causarem


impactos ambientais considerveis. Karatayev
et al. (1997) observaram que D. polymorpha,
aps invadir um ambiente, torna-se o nico invertebrado bentnico dominante, superando a
biomassa dos outros componentes da comunidade. Martin & Darrigran (1994), Darrigran
et al. (1998a), Darrigran (2002) e Darrigran
& Damborenea (2005) descrevem exemplos
do impacto ambiental negativo observado no
ecossistema aps o assentamento do L. fortunei
nas margens da bacia do Rio de La Plata. Destacam a alterao da composio da malacofauna nativa, com o deslocamento das trs espcies de gastrpodes mais comuns no litoral,
que passam a ter uma ocorrncia espordica ou
acidental com a presena do mexilho-dourado, enquanto outra nativa passa a aumentar sua
populao proporcionalmente do invasor.

Desde os primeiros registros da pre-

Figura 1. Limnoperna fortunei


(Dunker, 1857): 1A, vista
externa do mexilho-dourado (valvas esquerdas);
1B, macroaglomerados do
mexilho-dourado sobre
tronco de madeira retirados do fundo do Lago Guaba, Porto Alegre, RS, Brasil
(Fotos: M.C.D. Mansur).

to pelas palavras gregas que significam gua


doce para Limno e mexilho para perna.
O nome especfico fortunei provavelmente refere-se cor dourada da concha ou sua elevada
abundncia.

26

2.3. Impactos ambientais


O mexilho-dourado (L. fortunei) e o
mexilho-zebra Dreissena polymorpha (Pallas,
1771) compartilham uma srie de caractersticas prprias das espcies invasivas e semelhanas quanto: ao tamanho; disperso atravs
de larva planctnica; serem dioicos, com capacidade de adeso ao substrato duro atravs
da formao de fios de bisso bastante fortes
e resistentes; comportamento gregrio com
crescimento rpido alcanando altas densida-

sena do mexilho-dourado no Lago Guaba


(Mansur et al., 1999), coletas quantitativas
revelaram que L. fortunei alterou a vegetao
marginal (Mansur et al., 2003). No lago predominam grandes sacos (baas) vegetadas por
juncos da espcie Scirpus californicus (C.A.
Mey.) Steud. Os substratos rochosos limitam-se aos pontais e algumas ilhas, portanto, so
relativamente escassos. O mexilho fixou-se
inicialmente na base dos juncos mais afastados
da margem, cujos rizomas e razes de cabeleiras
(Fig. 2A) ficam expostos devido remoo do
sedimento pelas ondas. A seguir, o mexilho
se aglomerou ocupando grandes superfcies sobre os rizomas dos juncos (Fig. 2B), formando
verdadeiros colches (mussel beds) sobre o
sedimento. Depois de um tempo, observou-se
que os juncos apodreceram, restando apenas os

CAPTULO 2
Seo 1

aglomerados do mexilho. A diminuio dos


juncais foi acompanhada e documentada por
fotos (Figs. 2C e 2D).

Alm dos substratos duros, como troncos e pedras, L. fortunei tambm se fixa sobre vrios animais bentnicos como bivalves,
gastrpodes e crustceos, prejudicando-os ou
levando-os morte precoce, interferindo deste modo na biodiversidade bentnica. No caso
dos bivalves, o mexilho prefere fixar-se regio posterior, que fica exposta (Figs. 2E e 2F).
O aglomerado impede o movimento das valvas
e tambm dificulta os processos de inalao,
filtrao, excreo e locomoo, levando o molusco morte. Aglomerados em gastrpodes
podem impedir o fechamento do oprculo (Fig.
2G), tornando o molusco vulnervel predao. Houve um registro da fixao do L. fortunei nas partes moles do bivalve nativo Leila
blainvilliana Lea, 1834, no interior da rea do
sifo exalante (Mansur et al., 2003).

No vero, o nvel da gua diminuiu, ex-

pondo os aglomerados, que apodrecem, exalando cheiro repugnante. Aps a rarefao dos
juncais, o mexilho fixou-se em outras plantas
marginais como o sarandi Cephalanthus glabratus (Spreng.) K. Schum que, devido ao peso
dos aglomerados, acaba tombando e quebrando (Fig. 2H). Conchas do mexilho-dourado
roladas e partidas, em grandes quantidades,
modificam a paisagem (Fig. 2I).

2.4. Impactos econmicos


As aglomeraes formadas pelo mexilho-dourado causam a obstruo de encanamentos, reduo do dimetro de tubulaes,
entupimentos de filtros, bombas, grades e
trocadores de calor, principalmente em usinas
geradoras de energia (Figs. 3A, 3B, 3C), em
indstrias que utilizam gua bruta para refrigerao e em estaes de tratamento da gua
bruta para abastecimento (Figs. 3D, 3E, 3F).
A parada destas unidades para a retirada dos

Figura 2. Danos ambientais causados pelo Limnoperna fortunei


no Lago Guaba, RS, Brasil: 2A,
assentamento sobre o rizoma
do junco Scirpus californicus;
2B, mussel beds sobre Scirpus
californicus no segundo ano da
invaso; 2C, juncais em 2001,
antes da invaso; 2D, modificao da paisagem, aps 2 anos de
assentamento nos rizomas; 2E,
aglomerado sufocando o bivalve
nativo Diplodon sp.; 2F, aglomerado sufocando o bivalve nativo
Leila blainvilliana; 2G, no umblico do gastrpode Pomacea canaliculata (Lamarck, 1822); 2H,
aglomerados sobre ramos do
sarandi Cephalanthus glabratus; 2I, conchas roladas, modificando a paisagem das praias na
orla (Fotos: M.C.D. Mansur).

27

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

Figura 3. Danos econmicos causados pelo Limnoperna fortunei: 3A, filtro autolimpante obstrudo; 3B, detalhe da tampa;
3C, cilindros do interior do mesmo filtro; 3D, incio do processo de limpeza de uma bomba captadora de gua incrustada;
3E, bomba iada com guindaste pelo teto; 3F, grade protetora
da bomba; 3G, trapiche de marina; 3H, casco de embarcao
utilizada para pesca no Lago Guaba e Lagoa dos Patos, sendo
transportada por rodovia para outro manancial, oferecendo
risco de contaminao. Fontes: A, B, C Gustavo Darrigran,
www.malacologia.com.ar; D, E, F Jos Imada, CORSAN; G,
Augusto Chagas: Biocincias, 2004, 13(1); H, M.C.D. Mansur:
Revista Brasileira de Zoologia 2003, 20(1).

28

aglomerados e consequente desentupimento


gera despesas considerveis. Em apenas um dia
de limpeza so computadas perdas econmicas
na ordem de milhes de reais.

No caso do entupimento de uma estao
de tratamento de gua pelo mexilho-dourado,
so necessrias vrias etapas de limpeza, considerando que cada estrutura ou subsistema
exige um procedimento diferente. Exemplificamos como segue: a) parada do sistema, b)
abertura da casa de captao para a retirada
de uma bomba e a grade protetora, com um
guindaste (Figs. 3E, 3F); c) raspagem de cada

estrutura para a retirada dos mexilhes e dos


fios do bisso (Fig. 3D); d) lixa das superfcies
para receber uma nova pintura; e) pintura; f)
desobstruo dos encanamentos com maior
dimetro com ajuda de mergulhadores; g) raspagem das paredes internas dos encanamentos
(em algumas estaes foi construda uma rede
secundria para revezamento nas limpezas); h)
retirada dos mexilhes das paredes e da superfcie nos tanques de floculao, decantao e
filtragem; i) montagem da unidade do sistema;
j) tratamento especial da gua para recuperar a
potabilidade e o sabor da gua, aps este tratamento em funo da presena do mexilho-dourado. Tubulaes menores devem ter caixas de inspeo. No caso de filtros e trocadores
de calor, estes devem ser desmontados e raspados. Antes de qualquer medida, as estruturas
devem ser limpas. Colocar somente substncias
moluscicidas no resolve, pois os aglomerados
continuam fixos pelos fios de bisso, por muito
tempo.

Prejuzos tambm foram sentidos em
marinas e na navegao interna (Figs. 3G,
3H). Em embarcaes o mexilho se incrusta
no somente no casco, mas tambm no interior dos motores, dos encanamentos, das
bombas, dos sistemas de refrigerao com
gua bruta, nos lemes e nas hlices (Mansur
et al., 2003), o que danifica as peas e diminui o desempenho e a velocidade da nave.
Em tanques-rede, muito utilizados atualmente na piscicultura, o mexilho adere s telas e
demais estruturas de suporte e flutuao dos
mesmos. A obstruo dessas estruturas altera
a oxigenao do tanque e o peso dos aglomerados pode afund-lo, facilitando a fuga dos
alevinos (Fig. 4).

Quando o mexilho se incrusta sobre
madeira, ferro ou concreto, pode fechar toda
a superfcie criando um ambiente anxico sob
a camada incrustante. Este ambiente propcio
s bactrias anaerbicas que produzem cido
sulfrico durante seu metabolismo. Este cido,
muitssimo corrosivo, acelera o apodrecimento
e a corroso do material da base.

O mau cheiro e as conchas quebradas
roladas nas margens durante o perodo de estiagem, afastam os turistas que normalmente
frequentam os balnerios e marinas nas orlas
de veraneio.

CAPTULO 2
Seo 1

Figura 4. Rede de um tanque para a criao de esturjo no Rio


Uruguai. Fonte: Gustavo Darrigran, www.malacologia.com.ar

2.5. Danos sade


Por serem ativos filtradores, os moluscos bivalves em geral, costumam atuar como
bioacumuladores de uma srie de substncias
txicas, inclusive metais pesados, em seus
tecidos e na concha. Como os bivalves so
muito apreciados pelos peixes, existe risco
sanitrio de bioacumulao de metais nos
humanos que consomem peixes e em sua alimentao.

Grande parte dos moluscos bivalves dulccolas hospeda trematdeos que completam
seu ciclo em peixes, aves e mamferos e, muito raramente, no homem. Estes parasitos so
geralmente danosos aos moluscos. Instalam-se
nas gnadas provocando a castrao do animal. Hiroko et al. (2004) estudaram o efeito de
um trematdeo sobre o crescimento e a reproduo do mexilho-dourado no Japo e constataram que a produo de gametas foi inibida
pelo parasita. No entanto, at o momento, no
foram registrados trematdeos parasitos do
mexilho-dourado, que completem seu ciclo
no ser humano.

Em moluscos estuarinos como Mytella
guyanensis (Lamarck, 1819) (Bivalvia: Mytilidae) e nos cultivos de mexilhes marinhos
foram encontrados stios de infeco por protozorios do gnero Nematopsis Schneider,
1892 (Apicomplexa: Eugregarinida: Porosporidae) em vrias reas da costa brasileira do
norte, nordeste e do sul, at Santa Catarina
(Matos et al., 2001; Pinto & Boehs, 2008).
No entanto, nada ainda foi registrado para o
mexilho-dourado.

2.6. Origem e disperso.


L. fortunei nativa do sudeste asitico, vivendo nos ambientes de gua doce como, lagos,
rios e regies estuarinas, com baixa salinidade (<13), da Coria, China, Laos, Camboja,
Vietn, Indonsia e Tailndia (Ricciardi, 1998).
Matsui et al. (2002), com base nos trabalho de
Nishimura & Habe (1987), mencionam que essa
espcie provavelmente chegou ao Japo em 1987,
aderida s valvas de corbculas asiticas que importam da China, como alimento. Foi introduzida em Taiwan (2000) e na Amrica do Sul (1991),
provavelmente via gua de lastro (Pastorino et al.,
1993; Darrigran & Pastorino, 1995).

2.7. Distribuio Geogrfica na

Amrica do Sul

Na Amrica do Sul o mexilho-dourado
foi primeiramente registrado no Rio de La Plata
(Pastorino et al., 1993; Darrigran & Pastorino,
1995) e, subindo o Rio Paran, dispersou-se em
direo norte, alcanando em 10 anos, cinco pases, na seguinte sequncia: Argentina (em 1991),
Uruguai (em 1994), Paraguai (em 1997), Brasil e
Bolvia (em 1998) (Darrigran & Mansur, 2006,
2009). Estes autores (op. cit.) apresentam detalhada cronologia da invaso do mexilho-dourado na Amrica do Sul. Assim, neste captulo,
apresentamos uma sntese, com atualizao dos
registros a partir do ano de 2006 e, na Figura
5, um mapa com a distribuio atual de L. fortunei, os primeiros registros, locais com danos
econmicos e registros de exemplares, porm,
em populaes no consolidadas.

No Rio Paraguai, o ponto mais montante do registro de ocorrncia do mexilho-dourado ainda a cidade de Cceres, onde foi
encontrado em cisterna de embarcao num
estaleiro, porm, a populao ainda no se estabeleceu no meio ambiente. Registros consolidados referem a espcie para a baa da Gava e
no curso inferior do Rio Cuiab.

Em 2001, foi registrado para o curso inferior do Rio Uruguai e na hidreltrica de Salto
Grande (Darrigran & Mansur, 2006, 2009).
Em 2007, na foz do Rio Quara, na fronteira
com o Brasil (Correio do Povo, 31/1/2007a).

Existe ainda um registro para o Arroio
Touro Passo (Correio do Povo, 13/03/2007b), nas

29

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

proximidades da cidade de Uruguaiana, no Rio


Grande do Sul, porm no soubemos da existncia de exemplares-testemunho para comprovar a
ocorrncia deste registro e do anterior, em Quara.

Considerando o alto Rio Paran, existem
registros para a represa de Jaciret (1998) e Itaipu
(2001), e vrias outras nos afluentes como o Iguau (2003), Paranapanema (2002), Tiet (2004) e
no Paranaba, at a jusante da represa de So Simo, onde permanece sem avanar, desde 2004
(Darrigran & Mansur, 2006, 2009). Registros
recentes (novembro de 2011) para os reservatrios de Porto Colmbia, Mascarenhas de Moraes
e Marimbondo, marcam a presena da espcie
em grande parte do Rio Grande, fronteira do estado de So Paulo com Minas Gerais.

Uma invaso secundria, originria, provavelmente, da gua de lastro de navios argentinos, trouxe o mexilho-dourado at o porto de
Porto Alegre, junto ao Lago Guaba, onde foi
detectado pela primeira vez em 1998. Este lago
integra as bacias do Atlntico Sul e Sudeste, sem
comunicao direta com as bacias do Paran ou
Uruguai, no Rio Grande do Sul (Mansur et al.,
2004a). Desse lago o mexilho-dourado se dispersou montante da bacia do Rio Jacu, e ao
extremo sul do Estado, em direo Repblica
Oriental do Uruguai, pelo lado Leste, onde hoje
ocupa vrias sub-bacias. Levantamentos efetuados no perodo de 2005 a 2008 na sub-bacia
do Rio Jacu, pertencente bacia do Atlntico
Sul e Sudeste, permitiram verificar a distribuio do mexilho-dourado montante deste rio
at a desembocadura do Rio Pardo e no porto
graneleiro de Estrela. Em novembro de 2009,
foi registrada a presena do mexilho-dourado
na barragem Capingui, municpio de Marau, no
alto Jacu. Uma nova bacia, a das lagoas da Plancie Costeira do Rio Grande do Sul, situada a
Nordeste do sistema Guaba Patos Mirim,
foi contaminada em 2009 (Freitas et al., 2009).


3. O berbigo asitico
Corbicula fluminea
(Mller, 1774)

30

3.1. Caractersticas da espcie


C. fluminea (Fig. 6A) semelhante a um
berbigo marinho, porm habita somente ambientes de gua doce. A concha robusta com

Figura 5. Distribuio atual do mexilho-dourado destacando


a invaso cronolgica e reas com danos econmicos. Mapa:
L. Lucatelli e M.C.D. Mansur.

um comprimento que varia entre 2 e 6 cm,


tendo altura menor que o comprimento. O formato da concha cordiforme em vista frontal.
Possui superfcie externa castanho escura, com
algum brilho, ondulaes comarginais espaadas (1 mm cada) e posteriormente um prolongamento denominado rostro (ver morfologia
no Captulo 4). Produz fios de bisso diferentes
do produzido pelo mexilho-dourado. Nesta
espcie o bisso se constitui num cordo mucilaginoso elstico presente apenas na fase de recrutamento. Acima de 5 mm de comprimento,
no produz mais o cordo mucoso. Este fio ou
cordo mucoso auxilia na locomoo do animal, aglutinando areia e evitando o arraste do
molusco pela correnteza. No forma aglomerados como o mexilho-dourado; vive livremente
no sedimento onde costuma enterrar-se parcial
ou totalmente. Seu comportamento gregrio,
formando densas populaes (Fig. 6B). Apresenta estratgias de sobrevivncia e reproduo
surpreendentes. Geralmente considerada hermafrodita, porm estudos recentes revelaram

CAPTULO 2
Seo 1

Figura 6. Corbicula fluminea (Mller, 1774) o berbigo asitico: 6A, vista interna e externa das valvas de quatro exemplares
em diferentes tamanhos (Foto: M.C.D. Mansur), escala 1 cm; 6B, concheiro natural indicando a alta densidade da espcie nas
margens do Lago Guaba em janeiro 2012 (Foto: G. Figueiredo), escala 10 cm.

aspectos pouco comuns sobre a biologia reprodutiva da espcie como, poliploidia, espermatozoide biflagelado e diploide, clonagem e
andrognese (Komaru & Konishi, 1996, 1999;
Komaru et al., 1997; Qiu et al., 2001).

Assim como o mexilho-dourado, uma
espcie com caractersticas invasivas e transformadoras do meio ambiente. Foi considerada
praga nos Estados Unidos onde espcie causou
imensos problemas ambientais e econmicos.
O comportamento infaunal, ou seja, afunda-se no substrato, onde vive total ou semienterrada. Prefere ambientes lticos. Em ambientes
lnticos ocupa reas marginais bem oxigenadas,
com declive suave e substrato preferencialmente
arenoso. Segundo Ituarte (1994), grandes populaes de C. fluminea e C. largillierti (Philippi,
1844) conviviam ao longo de extensas superfcies arenosas na poro intertidal do esturio do
Rio de La Plata. No entanto, segundo Darrigran
(1991), as espcies competem entre si e depois
de alguns anos, s se encontra C. fluminea.

3.2. Etimologia


O nome cientfico do gnero Corbicula e
da famlia Corbiculidae tem sua origem na palavra latina corbis que significa cesto. A forma
arredondada e inflada da concha, a cor de palha e a ornamentao ondulada lembram uma
pequena cestinha ou bolsinha. A terminao
cola tambm de origem latina, se refere produo ou formao de algo, portanto, corbi + cola
seria aquela ou aquele que produz a cestinha.


O nome popular s citado nas enciclopdias portuguesas como amijoa asitica. Em
algumas regies do Brasil conhecida como
berbigo asitico. Em meios acadmicos, simplesmente por corbcula asitica ou simplesmente corbcula.

3.3. Impactos ambientais


Aps a invaso de C. fluminea em vrias
bacias hidrogrficas brasileiras, houve uma
diminuio drstica das populaes nativas
de moluscos bentnicos, principalmente dos
bivalves das famlias Mycetopodidae e Hyriidae. Este lamentvel fato foi observado e relatado aps vrios anos de trabalho de campo
por Takeda et al. (2000) no alto Rio Paran e
por Beasley et al. (2003) no Par. Em todas as
bacias ocupadas por esta espcie, C. fluminea
passou a apresentar, em poucos anos, densidades populacionais bem maiores do que as
espcies nativas. Isom (1986) considera que
densidades de C. fluminea acima de 200 indivduos por metro quadrado constituem um
potencial para severos problemas ambientais
e econmicos. Mansur & Garces (1988) encontraram densidades de at 5295 ind/m 2 em
canal da regio do Taim, no extremo sul do
Rio Grande do Sul, em um canal que drena
um aude junto ao curso inferior do Rio Ca
no Rio Grande do Sul. Mansur et al. (1994)
observaram uma populao de 4173 ind/m 2 ,
com exemplares maiores que 7,7 mm de comprimento, aglomerando-se em at trs nveis

31

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

de profundidade no substrato. Segundo Isom


(1986), citando Prokopovich (1969), as corbculas, durante o processo de filtrao, consolidam uma grande quantidade de partculas
em suspenso, envolvendo-as em muco que
rejeitado como pseudofezes e sedimentado no
fundo. Estas, junto com o acmulo de conchas,
alteram profundamente o ambiente bentnico.
Sousa et al. (2008a, b), ainda mencionam que
esta espcie, devido grande abundncia, pode
interferir significativamente na reciclagem de
nutrientes e na interao bntico-pelgica e
deste modo ser potencialmente responsveis
por importantes alteraes ecolgicas. Sousa
et al. (2009) alertam, tambm, que seus efeitos
modificadores do ambiente se equiparam ao de
um invasor engenheiro de ecossistema e que
esta espcie deveria ser considerada com muita
seriedade nas iniciativas de conservao, manejo e restaurao do ambiente.

32

3.4. Impactos econmicos


A espcie pode causar obstruo de encanamentos, canais, sistemas de refrigerao
de indstrias, usinas atmicas (nos EUA) e de
hidreltricas (Fig. 7). A entrada dos exemplares nos sistemas d-se na fase larval final como
pedivliger ou juvenil que, devido s pequenas
dimenses e leveza, so sugados para dentro
do sistema, passando pelos filtros protetores.
Geralmente crescem dentro dos trocadores de
calor, obstruindo as aberturas e provocando,
consequentemente, um superaquecimento do
sistema. Paralisao de usinas hidreltricas e
sistemas de abastecimento urbano de gua por
esta espcie, j foram registradas no Brasil.

Na Amrica do Norte, onde C. fluminea foi introduzida em torno do ano de 1922
(Counts, 1986), passou a despertar grande
interesse devido aos problemas ambientais e
econmicos ocasionados. Foram realizados
vrios simpsios, com publicao de inmeros
trabalhos. Calculam-se investimentos acima de
um bilho de dlares americanos anuais para
reduzir a eficincia da espcie. Capital este, investido em equipamentos, pesquisa, montagem
de laboratrios e planos de controle da espcie
(Isom, 1986).

importante ainda mencionar que
a areia utilizada na construo, uma vez

contendo corbculas, forma um concreto de


pssima qualidade. As conchas se descalcificam
rapidamente, favorecendo infiltraes de gua
que danificam a estrutura, provocando rachaduras. As conchas fechadas contm ar em seu
interior que pode migrar para a superfcie durante a concretagem, fragilizando a estrutura
(Isom, 1986).

3.5. Danos sade


Segundo Bendati (2000), o corbiculdeo
nativo Neocorbicula limosa, por ser um filtrador, como os demais representantes da famlia Corbiculidae, atua como bioacumulador
inclusive de metais pesados que podem entrar
na cadeia alimentar, o que pode trazer alto
risco para sade humana. Os moluscos constituem alimento para os peixes carnvoros e
omnvoros. Cataldo et al. (2001) utilizaram C.
fluminea como biomarcador de gradientes de
poluio e constataram nos tecidos da mesma,
o acmulo significativo de cobre e cdmio em
reas mais poludas do delta do Rio Paran,
Argentina. As corbculas tambm podem ser
hospedeiros intermedirios de trematdeos.
Chung, et al. (2001) constataram em laborat-

Figura 7. Registro da obstruo pelo berbigo asitico Corbicula fluminea (Mller, 1774), na UHE Porto Colmbia, bacia
do Rio Grande, alto Rio Paran, MG, em 1998. 7A, em encanamentos; 7B, em trocadores de calor (Foto: E.T Monteiro da
Silva - FURNAS).

CAPTULO 2
Seo 1

rio a possibilidade de C. fluminea ser um segundo hospedeiro de Echinostoma cinetorchis


Ando & Ozaki, 1923 (Trematoda: Echinostomatidae). Mamferos carnvoros, roedores e
inclusive o homem, alm de aves aquticas, servem de hospedeiros definitivos desta espcie.
Os hospedeiros definitivos tornam-se infectados ao ingerirem os hospedeiros secundrios
do trematdeo, ainda cru ou mal cozido.O
trematdeo adulto se instala no intestino delgado podendo causar fortes dores abdominais,
nusea, vmitos, diarreia e febre.

3.6. Origem e disperso


originria da sia, Coria e sudeste da
Rssia. Segundo Sousa et al. (2008a, b), considerada como a espcie invasora NIS (Nuisance Invasive Species) de maior importncia
nos ecossistemas aquticos. Nos ltimos 80
anos, foi introduzida nas Amricas, na frica
e na Europa, provavelmente via gua de lastro,
com registros para ilhas do Pacfico (Araujo et
al., 1993). Invadiu os Estados Unidos (na dcada de 1920), primeiramente na parte oeste
e em poucos anos ocupou todos os ambientes
de gua doce daquele pas (Counts, 1986). Na
Amrica do Sul, os primeiros registros datam
da dcada de 70, hoje ocupa as bacias sul-americanas, desde a Colmbia at o norte da Patagnia (Mansur et al., 2011a, 2012).

3.7. Distribuio geogrfica


Apareceu na Amrica do Sul na dcada
de 70, nas proximidades do porto de Buenos
Aires, Argentina (Ituarte, 1981), e em Porto
Alegre, no sul do Brasil (Veitenheimer-Mendes, 1981). Em torno de 1985, Martinez (1987)
identificou a corbcula como C. manilensis
(Philippi, 1844), um sinnimo de C. fluminea,
na Venezuela. Em 1994, no limite norte do
Peru com o Equador e em 2000, em rios que
correm para o Pacfico neste pas (Mansur et
al., 2004c). Desde o registro destes primeiros
focos de invaso, a espcie vem se dispersando
montante e por todas as bacias do continente
(Fig. 8). No Rio Uruguai, foi registrada para o
curso inferior em 1986, para o curso mdio em
1988/9 e para o superior nas nascentes junto ao
Rio Pelotas, em 1996 (Rodrigues et al., 1998a,

Figura 8. Distribuio atual do berbigo asitico Corbicula fluminea (Mller, 1774) na Amrica do Sul. Mapa: G. Figueiredo
e M.C.D. Mansur.

b). Callil & Mansur (2002) registram a chegada de C. fluminea no Pantanal Norte, prximo
de Cuiab em 1998. Um ano antes, Cazzaniga (1997) relata sobre a chegada da espcie na
Patagnia, Argentina. No alto Rio Paran, em
1997 (Pereira, 1997). Na bacia Amaznica foi
registrada desde 1997/8 para o baixo Rio Tocantins (Beasley et al., 2003); nas nascentes do
Tocantins, em 1999 (Thiengo et al., 2005); no
alto Rio Solimes (Lee et al., 2005); no Rio
Negro, Amaznia Central, prximo de Manaus (Pimpo & Martins, 2008; Pimpo et al.,
2008).


4. O berbigo asitico roxo
Corbicula largillierti

(Philippi, 1844)

4.1. Caractersticas da espcie


Corbicula largillierti (Fig. 9) apresenta a
concha mais frgil, menor e menos inflada que
C. fluminea (no ultrapassa 2,5 cm de comprimento), formato triangular, quase equilateral,
altura menor que o comprimento, umbos baixos e arredondados, sem rostro, ondulaes

33

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

ou estrias comarginais na superfcie externa,


muito finas e justapostas (2 a 3 por mm, na
parte mediana da concha), peristraco de cor
esverdeada, palha ou arroxeada, pouco brilho.
Por dentro roxo escuro ou cinza, sem brilho,
linha palial evidente e sem sinus (ver morfologia no Captulo 4). Facilmente confundida
com a nativa Cyanocyclas (=Neocorbicula) limosa, quando vista externamente (Mansur et
al., 2012) e com C. fluminea, principalmente
quando esta no atingiu seu desenvolvimento completo. Produz fios de bisso diferentes
do produzido pelo mexilho-dourado. Nesta
espcie o bisso se constitui num cordo mucilaginoso elstico, presente apenas na fase de
recrutamento. Este fio, tambm chamado de
cordo mucoso, auxilia na locomoo do animal, aglutinando areia e evitando o arraste do
molusco pela correnteza. No forma aglomera-

dos como o mexilho-dourado, vive livremente


no sedimento onde costuma enterrar-se parcial
ou totalmente. Seu comportamento tambm
invasivo, vive de forma gregria, formando
densas populaes. No entanto, quando compartilha o mesmo ambiente que C. fluminea,
com o passar do tempo sua populao diminui
gradativamente e pode desaparecer (Darrigran,
1991). Apresenta o comportamento infaunal.
Habita ambientes bentnicos de gua doce tanto lticos como lnticos, dando preferncia por
guas mais oxigenadas, declive suave do terreno, substrato macio com a presena de areia
fina. Geralmente mais abundante em audes
e reservatrios do que C. fluminea.

4.2. Etimologia


Como a espcie acima o nome da famlia
Corbiculidae e do gnero Corbicula vem dos
termos latinos corbis e cola de origem latina,
que se referem ao produtor de uma cesta. A
palavra largillierti foi dada em homenagem ao
colecionador Largilliert.

um Corbiculidae com aspecto de um
berbigo de gua doce de colorao mais esverdeada por fora e roxo por dentro, razo do
nome berbigo roxo. Em meios acadmicos a
espcie conhecida por corbcula asitica roxa
ou simplesmente corbcula roxa.

4.3. Impactos ambientais


Em grandes densidades C. largillierti
provoca, assim como C. fluminea, alteraes
no sedimento dos mananciais e causa a diminuio drstica das populaes da fauna nativa de moluscos bentnicos, principalmente do
Corbiculidae nativo, Cyanocyclas (=Neocorbicula) limosa. Em todas as bacias ocupadas por
C. largillierti, esta passou a apresentar, em poucos anos, densidades populacionais bem maiores do que das espcies nativas.

34
Figura 9. Corbicula largillierti (Philippi, 1884) o berbigo asitico roxo: 9A, Acima, vista externa da valva esquerda; em
baixo, vista interna da valva direita (Foto: M.C.D. Mansur); 9B,
Registro da obstruo dos trocadores de calor de uma unidade hidroeltrica (Foto: W. Santiago).

4.4. Impactos econmicos


A espcie tem causado os mesmos problemas de obstrues em sistemas de resfriamento de termo e hidreltricas (Fig. 9B), e de
abastecimento de gua, exigindo a parada destes sistemas e mo de obra especializada para

CAPTULO 2
Seo 1

a limpeza, com consequentes perdas econmicas. Como C. fluminea, a entrada dos exemplares nos sistemas d-se na fase de vliger
tardio ou pedivliger que, devido s pequenas
dimenses, passam pelos filtros protetores. Geralmente crescem dentro dos trocadores de calor, obstruindo as aberturas, provocando superaquecimento do sistema. Deve-se considerar
que a areia contendo corbculas roxas, tambm
fragiliza a concretagem.

4.5. Danos sade


As espcies do gnero Corbicula so bioacumuladoras de metais pesados, que podem
entrar na cadeia alimentar atravs de peixes
carnvoros e onvoros que, por sua vez, servem
de alimento para populaes humanas, o que
implicaria em riscos para sade. No se conhecem trematdeos que se hospedem nesta espcie, nem da possibilidade de ser intermedirio
de alguma zoonose.

4.6. Lugar de origem e disperso


Espcie de origem asitica, originalmente descrita do Rio Yangtse-Kiang da China. Sua
distribuio compreende a China central e norte, assim como a pennsula Coreana (Ituarte,
1994). Foi introduzida na Amrica do Sul e no
Brasil, provavelmente via gua de lastro.

Figura 10. Distribuio atual do berbigo asitico roxo Corbicula largillierti (Philippi, 1884) na Amrica do Sul. Mapa: G.
Figueiredo e M.C.D. Mansur.

Atlntico. No foi ainda registrada para o alto


Rio Paran. Mais recentemente foi detectada
pela primeira vez no Rio Tocantins, iniciando assim sua disperso pela bacia Amaznica
(Figueiredo et al., 2011; Mansur et al., 2011a,
2012).


5. O berbigo asitico
Corbicula fluminalis
C. largillierti encontra-se introduzida na (Mller, 1774)
4.7. Distribuio Geogrfica


Amrica do Sul (Ituarte, 1981, 1982, 1984a e
1994; Olazarri, 1986; Mansur et al., 2004c,
2012; Callil & Mansur, 2002). Por guardar
certas semelhanas com a Corbiculidae nativa,
Cyanocyclas (=Neocorbicula) limosa, a invasora passou muito tempo despercebida no incio de sua disperso na Amrica do Sul. Foi, e
ainda hoje tem sido, tambm confundida com
C. fluminea. Fatos estes, dificultam sobremaneira o mapeamento de sua distribuio. Hoje
ocupa duas grandes reas na Amrica do Sul
(Fig. 10): o Nordeste e Leste do Brasil, desde
o Cear at o Rio de Janeiro e, mais ao Sul, a
bacia do baixo e mdio Paran e o Rio Paraguai; o Rio Uruguai e o sistema das bacias da
Laguna dos Patos e Mirim que drenam para o

5.1. Caractersticas da espcie

Corbicula fluminalis (Mller, 1774) (Fig.


11) apresenta concha robusta quase equilateral,
inflada, altura igual ou maior que o comprimento que varia de 1 a 3 cm, linhas comarginais semelhantes s de C. fluminea, porm
menos espaadas (uma a cada 0,7 mm) e baixas, charneira muito arqueada, umbos muito
altos e praticamente centrados (quase na metade do comprimento), sem rostro, cor mais
escura, tendendo ao roxo forte internamente e
o peristraco, do marrom ou negro. Conchas
pequenas geralmente mais claras (detalhes da
morfologia, ver no Captulo 4).

35

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

Figura 11. Corbicula fluminalis (Mller, 1774) o berbigo asitico: A, vista externa da valva esquerda; B, vista interna da
valva direita (Foto: M.C.D. Mansur).

36

5.2. Etimologia


O nome especfico fluminalis, vem do
latim flumen que significa rio. Corbicula
fluminalis poderia ser definida como a espcie
com a concha em forma de cestinha, que vive
nos rios. Em algumas regies como RJ e MG
so chamadas de berbiges asiticos. Em meios
acadmicos todas as espcies de corbculas so
mais conhecidas como corbcula asitica ou somente corbcula.

Segundo Korniushin (2004), a espcie
que durante muitos anos foi considerada por
Morton (1982) revisor da espcie como
C. fluminalis, seria, na realidade, uma espcie muito afim estuarina Corbicula japonica. Esta confuso de Morton (op. cit.) trouxe
muitas incertezas na identificao da espcie.
A morfologia da espcie conferia com os exemplares coletados no baixo Rio Jacu, bacia do
Atlntico Sul, em 1990, porm o ambiente aqui
apresenta salinidade zero. Por precauo, Mansur et al. (2004c) a chamaram inicialmente de
Corbicula sp b. Martins et al. (2004) a registram como C. aff. fluminalis para o Lago Guaba, RS. Somente aps a reviso de Korniushin
(2004) foi possvel determinar a espcie C. fluminalis com segurana na Amrica do Sul.

5.3. Impactos ambientais


As populaes desta espcie encontradas
no sul do Brasil so pequenas e pouco densas.

Geralmente so encontradas em margens rasas,


arenosas e nas proximidades de juncais. Martins et al. (2004) revelaram que de 317 exemplares do gnero Corbicula coletados entre junho de 2002 a junho de 2003 no Lago Guaba,
RS, 185 corresponderam a C. fluminea, 98 a C.
fluminalis e 34 a C. largillierti.

No foram documentados impactos ambientais advindos da presena desta espcie.
At o momento observou-se que na presena
de C. fluminea, as populaes de C. fluminalis
diminuem gradativamente em nmero. Porm,
por ser uma invasora e ainda pouco conhecida, no sabemos das suas qualidades invasivas nem do seu perodo de repouso no novo
ambiente, pois se trata de uma introduo relativamente recente. Mansur et al. (2004c) a
coletou em 1990 no baixo Rio Jacu, RS e a
identificou como Corbicula sp b. Martins
et al. (2004) registram C. aff. fluminalis para
o Lago Guaba, Viamo, RS, com as datas de
coleta no perodo de junho de 2002 a junho
de 2003. Segundo Darrigran & Damborenea
(2009b) o crescimento populacional de uma
espcie invasora passa por uma srie de fases.
Quando a espcie invasora chega num novo
ambiente, seu crescimento inicial lento, compreendendo a fase do repouso ou espera.
Este perodo varia para cada espcie e pode at
levar muitos anos. A seguir, na segunda fase,
denominada de pnico, a populao cresce e
se expande rapidamente. Na terceira fase acontece um freio e uma reduo no crescimento
populacional com um declnio na densidade.
a fase do equilbrio oscilatrio. No entanto,
dependendo das condies ambientais de cada
local, a fase do pnico pode retornar.

5.4. Impactos econmicos


No foram documentados impactos econmicos desta espcie sobre sistemas construdos.

5.5. Danos sade


As espcies do gnero Corbicula so bioacumuladoras de metais pesados, que podem
entrar na cadeia alimentar atravs de peixes
carnvoros e omnvoros que, por sua vez, servem de alimento para populaes humanas,

CAPTULO 2
Seo 1

presena de C. fluminalis no Rio de La Plata


e contribuintes, nem no Rio Uruguai. Por comunicao pessoal do malaclogo Dr. Cristin
Ituarte, do Museu Argentino de Cincias Naturais Bernardino Rivadvia, Buenos Aires, C.
fluminalis ocorreu no Rio de La Plata, mas hoje
no mais encontrada.


6. O berbigo asitico rosa
Corbicula sp.

Figura 12. Mapa com a distribuio atual do berbigo asitico


Corbicula fluminalis (Mller, 1774) na Amrica do Sul. Mapa:
G. Figueiredo e M.C.D. Mansur.

o que implicaria em riscos para sade. No se


conhecem trematdeos que se hospedem nesta
espcie, nem da possibilidade de ser intermedirio de alguma zoonose.

6.1. Caractersticas da espcie

Corbicula sp. apresenta concha robusta


quase equilateral, inflada (Fig.13), altura menor que o comprimento que chega a 4,3 cm,
sem rostro, margem anterior levemente cncava
na frente dos umbos, linhas comarginais mais
delicadas, semelhantes s de C. largillierti (uma
a cada 0,7 mm) e baixas, charneira reforada,
relativamente pouco arqueada, umbos baixos e
arredondados, levemente voltados para a frente
(prosgiros) e quase centrados (quase na metade do comprimento), internamente cor clara,


5.6. Lugar de origem e disperso

nas reas invadidas

Originalmente descrita do Rio Eufrates, na Mesopotmia, sia menor (Araujo et
al., 1993). Posteriormente, tambm foi registrada para sia Central, Cucaso, frica
(Korniushin, 2004) e China (Glaubrecht et al.,
2007), sendo esta provavelmente a distribuio
original da espcie. Foi introduzida na Europa,
Amrica do Sul e no Brasil, provavelmente via
gua de lastro.

37

5.7. Distribuio Geogrfica


Registros da espcie se limitam ao complexo lagunar e fluvial do sistema GuabaPatos-Mirim, no Rio Grande do Sul e no Uruguai
e na bacia do Rio de La Plata, na Argentina
(Fig. 12). No h citaes para outras bacias
no Brasil (Mansur et al., 2011a, 2012). No
existem tambm registros publicados sobre a

Figura 13. Corbicula sp. o berbigo asitico rosa: 13A, vista


interna da valva direita; 13B, vista externa da valva esquerda
(Foto: M.C.D. Mansur).

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

levemente lils ou rosa e o peristraco castanho


com brilho. Muito semelhante a C. largillierti,
porm bem mais robusta.

6.2. Etimologia


A espcie no foi determinada. Em meios
acadmicos do sul do Brasil conhecida por
corbcula ou berbigo rosa.

6.3. Impactos ambientais


As populaes desta espcie encontradas
no sul do Brasil so pequenas e pouco densas.
Geralmente so encontradas em margens rasas,
arenosas e nas proximidades de juncais.

6.4. Impactos econmicos

entrar na cadeia alimentar atravs de peixes


carnvoros e omnvoros que, por sua vez, servem de alimento para populaes humanas,
o que implicaria em riscos para sade. No se
conhecem trematdeos que se hospedem nesta
espcie, nem da possibilidade de ser intermedirio de alguma zoonose.

6.6. Lugar de origem e disperso

Provavelmente do sudeste asitico

6.7. Distribuio Geogrfica


Registros da espcie (Fig. 14) se limitam
ao complexo lagunar e fluvial do sistema Guaba-Patos, no Rio Grande do Sul, Brasil (Mansur et al., 2011a).


Gastrpodes lmnicos invasores


7. O caracol asitico ou

6.5. Danos sade
caramujo-trombeta

As espcies do gnero Corbicula so bio- Melanoides tuberculata
acumuladoras de metais pesados, que podem (Mller, 1774)

No foram documentados impactos econmicos desta espcie sobre sistemas construdos.

38
Figura 14. Distribuio atual do berbigo asitico rosa Corbicula sp., na Amrica do Sul. Mapa: G. Figueiredo e M.C.D.
Mansur


7.1. Caractersticas da espcie


Melanoides tuberculata (Mller, 1774)
um Caenogastropoda da famlia Thiaridae,
cujas conchas em geral so espessas e fortemente esculturadas (Fig. 15). A concha de M.
tuberculata moderadamente grossa, alongada
e espiralada, turriforme (em forma de torre),
com 12 a 16 voltas nos animais adultos, alcanando em mdia 35 mm de comprimento e 12
mm de largura, mas alguns indivduos podem
ultrapassar 40 mm de comprimento e 14 mm
de largura (Brandt, 1974). A descolorao do
pice e sua ausncia, assim como a ausncia das
voltas iniciais frequente, pois a concha sofre
a ao do cido carbnico presente na gua. O
umblico fechado. O peristraco amarronzado ou amarelado, mas existe grande variao
de cor de acordo com o ambiente. A abertura
relativamente pequena, oval-alongada. A concha bem ornamentada, apresentando linhas
espirais com tubrculos de tamanhos variados.
Manchas coloridas (flmulas) acastanhadas
ou marrons esto presentes, assim como uma

CAPTULO 2
Seo 1

banda colorida na base da columela em alguns


exemplares. Apresenta um oprculo crneo,
preso ao p, que fecha a abertura da concha
(Figs. 15, 16). O animal possui uma probscide
alongada e o p ovalado (Fig. 16). O manto
amarelado, com manchas escuras; o bordo do
mato franjado (Fig. 16). Os animais vivem sobre substratos lamosos, macios e turvos, onde

podem enterrar-se, mas tambm sobre substratos mais rgidos, formados por seixos de vrios
tipos e tamanhos (Fig. 17). Tambm so encontrados na vegetao aqutica, entre as razes
de plantas flutuantes e em substratos artificiais
como garrafas pet, caixas de papel, etc. Apresentam comportamento gregrio, formando
grandes aglomerados populacionais (Fig. 18).

Figura 15. Melanoides tuberculata (Mller, 1774): A, aspecto geral da concha. esquerda,
vista ventral; direita, vista dorsal. B, detalhe do oprculo crneo, paucispiral. C, detalhe
da escultura da concha de exemplar jovem microscopia de varredura (Fotos: A, P. M.
Coelho; B, I.C. Miyahira; C, A.C.N. Moraes, Laboratrio de Microscopia Eletrnica UERJ).

39

Figura 16. Melanoides tuberculata (Mller, 1774): A, aspecto do animal vivo, mostrando o
p ovalado com o oprculo preso em sua poro posterior, probscide alongada, tentculos filiformes, com os olhos na base. B, detalhe da poro anterior, vista dorsal, mostrando
as franjas do bordo do manto. C, detalhe da cabea e p, vista ventral, mostrando a pigmentao do manto (Fotos: A, P.M. Coelho; B, S.B. Santos; C, I.C. Miyahira).

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

Figura 17. Melanoides tuberculata (Mller, 1774): Tipos de substratos ocupados. A, substrato lamoso, fino,
guas turvas. B, substrato rgido, seixos de diversos tipos e tamanhos, guas lmpidas. (Fotos: A, S.B. Santos;
B, I.C. Miyahira).

Figura 18. Melanoides tuberculata (Mller, 1774): Agregado formado por centenas de indivduos em um riacho na Ilha Grande, Rio de Janeiro (Foto I.C. Miyahira).

40

7.2. Etimologia


O nome do gnero uma contrao do
nome genrico Melania com o sufixo latino oides, do grego eidos (), que significa forma,
aparncia, semelhana. Portanto, Melanoides
significa de forma similar Melania, que outro gnero do grupo Cerithioidea. Melania por
sua vez deriva do grego melaina (), que
significa escuro, preto, dizendo respeito cor
escura do peristraco desses gneros. A palavra
tuberculata significa tubrculos, se referindo
escultura em forma de tubrculos que cobre a
concha do animal. Na literatura a combinao
Melanoides tuberculatus muito comum, pois
o sufixo oides denota uma palavra mascu-

lina, de acordo com o Cdigo Internacional


de Nomenclatura Zoolgica (ICZN, 2000).
De acordo com o Artigo 30.1.4.4. do ICZN
(2000), todo nome finalizado em -oides masculino, exceto quando o autor ao criar o gnero
estabeleceu o gnero feminino devido combinao especfica original. Como Melanoides
foi estabelecido por Olivier (1804) com a combinao original Melanoides fasciolata, ou seja,
um epteto feminino, a combinao correta
Melanoides tuberculata (Mller, 1774).

7.3. Impactos ambientais


Atualmente, os problemas relacionados
aos impactos no meio ambiente oriundos da

CAPTULO 2
Seo 1

introduo de M. tuberculata so os principais


observados no Brasil. uma espcie bentnica,
capaz de formar populaes extremamente
densas (Miyahira, 2010), que muitas vezes
cobrem inteiramente o substrato (Fig. 15C),
afetando assim diretamente as demais espcies
de macroinvertebrados bentnicos (Moreno &
Callisto, 2006). As interaes de M. tuberculata com outras espcies so pouco estudadas.
Freitas et al. (1987) sugerem uma diminuio
das populaes de Biomphalaria tenagophila (dOrbigny, 1835) e de Pomacea haustrum
(Reeve, 1856), em funo do crescimento da
populao de M. tuberculata na Lagoa da Pampulha, Minas Gerais. Giovanelli et al. (2003)
apresentam estudos de campo e laboratoriais
sugerindo o deslocamento de B. tenagophila

Figura 19. Melanoides tuberculata (Mller, 1774) com filamentos de macroalgas aderidas superfcie da concha (Foto I.C.
Miyahira).

Figura 20. Acmulos concntricos de conchas de moluscos


mortos quando da descida da gua em um aude no Nordeste do Brasil. No detalhe, conchas de Melanoides tuberculata
(Mller, 1774) e de Biomphalaria straminea (Dunker, 1848)
(Fotos S.B. Santos).

por M. tuberculata. Por sua vez, Thiengo et al.


(2005) relacionam o decrscimo das populaes de Aylacostoma tenuilabris (Reeve, 1860),
em funo do crescimento das populaes de
M. tuberculata na rea da Usina Hidreltrica de
Serra da Mesa, Gois. Efeitos negativos sobre o
tamanho populacional de macroinvertebrados
no-moluscos foram observados por Miyahira (2010) em um estudo realizado na Vila do
Abrao, Ilha Grande (Angra dos Reis, Rio de
Janeiro).

A capacidade de produzir material fino
particulado e liberar partculas de blocos
compactos comprovada para M. tuberculata
(Dudgeon, 1982). Alm de ocupar espao no
substrato, altera os processos de sedimentao
e turbao, modificando os processos fsicos
relacionados ao ambiente, afetando por fim as
espcies que nele vivem.

Melanoides tuberculata tambm disponibiliza no ambiente na qual introduzida um
novo substrato duro (a concha), que pode ser
colonizado por algas e outras espcies menores
de moluscos, como ancildeos e jovens bionfalrias, por exemplo, e invertebrados em geral.
Algas filamentosas (Fig. 19) e nematdeos de
vida livre tambm j foram observados aderidos s conchas de M. tuberculata (Miyahira,
2010). A disperso deste tiardeo extico pode
levar para outros lugares, inadvertidamente,
essas outras espcies aderidas s suas conchas.

Outro fator a ser considerado o mau
cheiro ocasionado pela morte de milhares de
exemplares quando ocorre a descida do nvel
da gua em reservatrios artificiais, por ocasies de seca (Fig. 20).

7.4. Impactos econmicos


No existem relatos de impactos econmicos extensos de M. tuberculata como aqueles
ocasionados por C. fluminea e L. fortunei, espcies capazes de parar indstrias e hidroeltricas devido obstruo de captaes de gua,
filtros e turbinas.

Podemos relacionar a introduo deste
tiardeos com impactos de menor monta. A introduo desta espcie em pisciculturas pode
levar a gastos com controle de pragas, alm de
representar uma possibilidade de estabelecimento de algumas verminoses nos peixes, le-

41

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

vando a prejuzos. Agudo-Padrn (2010) relatou a disperso de M. tuberculata associada ao


comrcio de camaro. A presena de impurezas
no produto comercializado (camaro) pode
acarretar na diminuio do valor final.

7.5. Impactos na sade humana


Melanoides tuberculata o primeiro hospedeiro intermedirio de vrios trematdeos
de importncia mdica, listados na Tabela I.
No Brasil, duas espcies de trematdeos foram
registradas por Pinto & Melo (2010a, b) infectando M. tuberculata: Centrocestus formosanus
(Nishigori, 1924) e Philophthalmus gralli Mathis & Leger, 1910. Centrocestus formosanus,
o helminto responsvel pela centrocestase,
tem como segundo hospedeiro intermedirio
diversas espcies de peixes dulceaqucolas e
como hospedeiros definitivos, aves e mamferos
(Scholz & Salgado-Maldonado, 2000; Aguilar-Aguilar et al., 2009). Espcies do gnero Philophthalmus Looss, 1899 parasitam os olhos
de aves, que so seus hospedeiros definitivos,
podendo infectar ocasionalmente o homem e
outros animais, atravs do contato direto com
os olhos ou por via oral (Waikagul et al., 2006;
Derraik, 2008).

Tambm h o relato de um caso humano autctone de paragonimase no Brasil, em
Salvador, Bahia, mas a participao de M. tuberculata na transmisso do parasito no foi
investigada (Lemos et al., 2007). A doena

provocada pela infeco por Paragonimus spp.,


que um parasito pulmonar (Keiser & Utzinger, 2009; Pinto, 2009).

No Brasil, imigrantes asiticos j foram
encontrados infectados por Clonorchis sinensis
(Cobbold, 1875), porm no h o registro de
transmisso autctone por este parasito no pas
(Leite et al., 1989). C. sinensis parasito das
vias biliares de seres humanos (Keiser & Utzinger, 2009; Pinto, 2009).

O fato de M. tuberculata participar do
ciclo de vida de vrias espcies de trematdeos justifica a necessidade de um maior conhecimento sobre a espcie, pois ela pode estar
envolvida na introduo, manuteno e disseminao de parasitos de interesse mdico no
Brasil. A Tabela II lista os casos mencionados
na literatura.

7.6. Origem e disperso.


Mller (1774) aponta como localidade-tipo
a costa do Coromandel, no sudeste da ndia,
mas existem divergncias quanto distribuio
original da espcie. Pilsbry & Bequaert (1927)
indicam como faixa original de distribuio o
norte e o leste da frica e o sul da sia, incluindo a Indonsia. Benthem-Jutting (1956) apresentou uma distribuio englobando a frica, sul
da sia e norte da Austrlia. Facon et al. (2003)
modificaram um pouco esta distribuio incluindo toda a Oceania. Glaubrecht et al. (2009)
tratam M. tuberculata como sendo espcie ex-

Tabela I. Trematdeos de importncia mdica que possuem Melanoides tuberculata (Mller, 1774) como primeiro hospedeiro
intermedirio.

42

Trematdeo

Enfermidade

rgos afetados

Segundo
hospedeiro
intermedirio

Hospedeiros
definitivos

Referncias

Paragonimus westermani
(Kerbert, 1878)

paragonimase

pulmes

Crustceos

Humanos
e outros animais

1, 4

Clonorchis sinensis
(Cobbold, 1875)

clonorquase

fgado

Peixes

Humanos

Centrocestus formosanus
(Nishigori, 1924)

centrocestase

intestino delgado

Peixes

Peixes, rpteis,
aves e mamferos

2, 4, 5

Haplorchis pumilio
(Looss, 1896)

haplorquase

intestino delgado

Peixes

Aves e mamferos

4, 5

Aves;
ocasionalmente
humanos e outros
animais

4, 5

Philophthalmus gralli
Mathis and Leger, 1910

filofitalmase

olhos

1- Guimares et al., 2001; 2- Umadevi & Madhavi, 2006; 3- Daz et al., 2008, 4- Derraik, 2008; 5- Pinto & Melo, 2010a, b.

CAPTULO 2
Seo 1

Tabela II. Trematdeos e tipos cercarianos encontrados em Melanoides tuberculata (Mller, 1774) no Brasil, com seus respectivos hospedeiros e locais de ocorrncia.

Espcie

Centrocestus formosanus

Philophthalmus gralli

Tipo cercariano

Pleurolophocercous cercaria

Megalurous cercaria

tica na Austrlia e afirmam que s recentemente foi introduzida naquele pas. Acreditamos
que a distribuio apresentada por Pilsbry &
Bequaert (1927) seja a mais prxima da original, por ser a mais antiga, antes da fase de expanso desta espcie. Esta distribuio tambm
a que no apresenta conflitos com as demais,
ou seja, Benthem-Jutting (1956) e Facon et al.
(2003).

Murray (1964) fez o primeiro registro
de M. tuberculata nas Amricas; a seguir, em
1967, a espcie foi registrada para o Brasil (Vaz
et al., 1986a). Estes seriam os dois primeiros
registros fora da rea natural de ocorrncia,
considerando o proposto por Pilsbry & Bequaert (1927). Na dcada de 70 temos outros
registros para os Estados Unidos da Amrica
(Abbott, 1973; Dundee & Paine, 1977) e para
o Mxico e Panam (Abbott, 1973). Durante a
dcada de 80 a espcie passou a ser encontrada nas ilhas do Caribe (Samadi et al., 1999) e
foi efetuada a primeira tentativa de introduo
com fins de controle biolgico de planorbdeos na mesma regio (Pointier et al., 1989). A
partir de ento temos registros para a Europa
(Stagl, 1993; Jurickov, 2006) e para a Oceania
(Duggan, 2002; Glaubrecht et al., 2009).

Atualmente, esta espcie pode ser chamada de cosmopolita (Fig. 21), como sugerem Ismail & Arif (1993) e Elkarmi & Ismail
(2007), pois temos registros da mesma para todos os continentes a exceo da Antrtica.

Na distribuio original de Pilsbry & Be-

Hospedeiro
definitivo

Peixe
Rptil
Ave
Mamfero

Ave;
ocasionalmente
humanos e
outros animais

Ocorrncia no Brasil

Referncias

RJ: Guapimirim,
Maric,
Rio de Janeiro
(Vargem Pequena,
Vargem Grande,
Prainha) e Angra dos
Reis (Ilha Grande).

Boaventura et al. (2002);


Bgea et al. (2005);
Ximenes (2011)

DF: Braslia
(Lago Parano)

Andrade et
al. (2008)

MG: Belo Horizonte


(Represa da Pampulha)

Pinto & Melo


(2010a)

MG: Belo Horizonte


Pinto & Melo (2010 b)
(Represa da Pampulha)

quaert (1927) a espcie estava limitada regio


tropical. Aparentemente, as regies mais frias
impem certos limites para uma maior expanso de sua distribuio, pois a maioria dos registros se encontra em regies de clima mais
ameno. Por exemplo, na Nova Zelndia os registros so limitados guas termais (Duggan,
2002; Derraik, 2008). No Brasil, a espcie ainda no foi encontrada no Rio Grande do Sul,
extremo sul do pas (Thiengo et al., 2007).

Os registros de M. tuberculata usualmente tratam de uma regio ou pas especfico
(e.g. Abbott, 1973; Vaz et al., 1986a; Duggan,
2002; Santos et al., 2007). Uma compilao
dos dados disponveis na literatura mostrou
que existem registros para 55 pases, sendo 25
(45,5%) dentro da rea natural de distribuio
e 30 (54,54%) fora desta rea, considerando-se a proposta de Pilsbry & Bequaert (1927)
para a rea nativa e ressaltando que esses autores apenas delimitaram uma rea no mapa,
no especificando os pases. Percebe-se a grande expanso desta espcie, pois na maior parte
dos registros da literatura foi classificada como
extica.

7.7. Meios de introduo


No Brasil, parece que a introduo de
M. tuberculata foi acidental, provavelmente via
comrcio aquarista (Vaz et al., 1986a). O primeiro relato sobre o encontro da espcie data
de 1967, quando o dono de uma indstria de

43

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

Figura 21. Distribuio conhecida de Melanoides tuberculata (Mller, 1774). Em azul, rea de distribuio original;
em vermelho, reas invadidas, segundo dados da literatura. Em amarelo, a provvel localidade-tipo (Mapa I.C.
Miyahira).

artefatos de conchas recebeu de um fornecedor


diversas conchas coletadas em local indeterminado no municpio de Santos, So Paulo (Vaz
et al., 1986a). Em 1971, seis exemplares foram
obtidos em uma loja de comrcio de peixes ornamentais em Atibaia, So Paulo, mas no foi
possvel descobrir a origem desses exemplares
(Vaz et al., 1986a). A partir do encontro de
exemplares no bairro do Macuco, Santos, em
1976, deflagrando-se a suspeita sobre a presena de um molusco extico em So Paulo, um
levantamento efetuado pela SUCEN (Superintendncia de Controle de Endemias), em 1984
e 1985 verificou sua ocorrncia em dez municpios, o que levou Vaz et al. (1986a) a suporem
que sua introduo no Brasil tenha sido anterior 1967. Aps o alerta sobre a presena de
um caracol extico no Brasil, diversos relatos
comearam a surgir, o primeiro para o Lago
Parano, Braslia, em 1984 (Vaz et al., 1987).

44

7.8. Formas de disperso


No Brasil, a disperso de M. tuberculata
tem sido relacionada principalmente ao comrcio aquarista (Vaz et al., 1986a). Os juvenis da
espcie, logo aps a liberao pela fmea, so

de tamanho diminuto, medindo entre 2,6 e 3,4


mm de altura (Berry & Kadri, 1974), portanto,
passando facilmente despercebidos aos comerciantes e aquarifilos, aderidos ao substrato ou
s plantas aquticas. Cowie & Robinson (2003)
citaram o comrcio de aqurio como fonte de
introduo intencional e acidental de diversas
espcies. A introduo acidental deste tiardeo
tambm pode ser relacionada piscicultura e ao
comrcio de conchas (Vaz et al., 1986a; Thiengo et al., 1998). Recentemente, Agudo-Padrn
(2010) reportou a disperso de M. tuberculata, Pomacea bridgesii (Reeve, 1856), P. lineata
(Spix, 1827) e P. canaliculata (Lamarck, 1819),
facilitada pela carcinicultura, atravs do transporte de camares das reas produtoras para
outras regies, sendo os moluscos transportados junto ao camaro.

A introduo e disperso intencional de
M. tuberculata foi reportada principalmente
para as ilhas do Caribe. A espcie foi utilizada como controle biolgico das espcies vetoras da esquistossomose, caramujos do gnero
Biomphalaria (Pointier & McCullough, 1989;
Pointier et al., 1989, 1993). A espcie rapidamente se estabeleceu nos locais onde foi introduzida. No Brasil, existem estudos utilizando

CAPTULO 2
Seo 1

M. tuberculata como controle biolgico, porm


a espcie j se encontrava introduzida antes dos
estudos (e.g. Freitas et al., 1987; Giovanelli et
al., 2005). No foram localizados registros formais da introduo intencional de M. tuberculata para controle biolgico ou qualquer outro
fim.

Alguns atributos biolgicos da espcie
facilitam a sua disperso e estabelecimento
em um novo ambiente. Por se tratar de uma
espcie na qual a partenognese comum,
formando populaes com predominncia de
fmeas, em teoria, basta a introduo de uma
nica fmea para o estabelecimento de uma
nova populao. A espcie tambm apresenta boa resistncia dessecao (Facon et al.,
2004) e capaz de suportar guas com temperaturas elevadas (Benthen-Jutting, 1956;
Duggan, 2002), assim como guas estuarinas
(Santos et al., 2007; Barroso & Matthews-Cascon, 2009) e at salgadas (Wingard et
al., 2008). Estas caractersticas aumentam a
probabilidade de sobrevivncia dos indivduos durante o transporte, seja esse acidental
ou intencional, aumentando ainda mais a
probabilidade de sobrevivncia ao transporte, facilitando a introduo em novas localidades e a reintroduo.

Apesar da grande ateno dada introduo passiva de M. tuberculata, acidental ou intencional, esses moluscos tambm
so capazes de se deslocar ativamente nos
corpos dgua, inclusive contra a correnteza
e escalando degraus naturais ou artificiais
(Fig. 22), como observado por Miyahira et
al. (2009).

Figura 23. Distribuio geogrfica de Melanoides tuberculata


(Mller, 1774) no Brasil (Mapa P.M. Coelho).

7.9. Distribuio geogrfica no Brasil


Melanoides tuberculata encontrada
em praticamente todas as regies hidrogrficas brasileiras, exceto no extremo sul da Bacia
do Atlntico Sul e Sudeste (inexistem registros
para o Rio Grande do Sul) e para a maior parte
da Bacia do Rio Amazonas (inexistem registros
para os estados do Acre, Amazonas, Rondnia,
Roraima e Amap), porm essas ausncias podem representar apenas um artefato da falta de
estudos. Segundo dados da literatura (Fernandez et al., 2003, Thiengo et al., 2005, 2007;
Souto et al., 2011) e em material depositado
em algumas colees cientficas, M. tuberculata est presente em 201 municpios brasileiros
(Fig. 23).

8. Helisoma duryi Wetherby, 1879)


e Helisoma trivolvis (Say, 1817)

Figura 22. Exemplares de Melanoides tuberculata (Mller,


1774) escalando ativamente um degrau artificial em um riacho na Ilha Grande, Rio de Janeiro (Foto I.C. Miyahira).

8.1. Caractersticas das espcies


Ambas as espcies, Helisoma duryi (Wetherby, 1879) e Helisoma trivolvis (Say, 1817),
pertencem famlia Planorbidae, apresentando
conchas planispirais, isto , os giros crescem

45

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

8.2. Etimologia


O nome do gnero vem do grego helis,
significando enrolado em espiral e soma, corpo, ou seja, corpo enrolado em espiral. O epiteto especfico duryi foi concedido em homenagem ao naturalista Charles Dury. O epteto
trivolvis significa trs voltas.

8.3. Impactos ambientais, econmicos

e na sade humana
Figura 24. Helisoma duryi (Wetherby, 1879). Aspecto do animal jovem, vivo (Foto P.M. Coelho).

em um mesmo plano, dando concha aspecto


de disco ou moeda (Fig. 24). A principal caracterstica a concha planispiral com giros que
crescem rapidamente em dimetro, com a sutura bem profunda em ambos os lados. O lado
direito cncavo e o esquerdo pouco escavado, tendendo a aplanado. A abertura da concha
torna-se, s vezes, muito dilatada, o que nos
permite diferenci-los de outros Planorbidae,
como Biomphalaria spp.

Segundo Paraense (1975, 1976a, b) Helisoma duryi (Fig. 25A, B) atinge 18 mm de
dimetro, 8,5 mm na largura da abertura e 5
giros, enquanto que Helisoma trivolvis (Figs.
25C, D) um pouco maior, alcanando 25 mm
de dimetro, 9 mm na largura da abertura e
5,5 giros. Em campo, sua diferenciao difcil, sendo necessria a dissecao para a correta identificao.


Embora no haja registro de qualquer
impacto ambiental ou econmico, a utilizao
de H. duryi no controle de moluscos hospedeiros de Schistosoma mansoni Sambon, 1907
e Schistosoma haematobium (Bilharz, 1852)
foi registrada na dcada de 70. Os trabalhos
de Milward-de-Andrade (1978a, b), Milward-de-Andrade & Souza (1979) e Milward-de-Andrade et al. (1979) mostraram as seguintes
vantagens adaptativas de H. duryi sobre Biomphalaria glabrata (Say, 1818), sob condies
de laboratrio: (1) ser mais proflera e possuir
menor mortalidade; (2) ser resistente ao dessecamento ambiental; (3) suportar a falta de
alimento; (4) ser refratria ao S. mansoni. Com
base nesses fatos, Milward-de-Andrade (1979)
conjecturou a capacidade de H. duryi colonizar
os ecossistemas neotropicais, e de maneira direta ou indireta, exercer importante papel no controle biolgico da esquistossomose mansnica.

Fernandez et al. (2010) assinalaram que,
at o presente, H. duryi no constitui ameaa
malacofauna nativa, nem tem causado perdas
econmicas ou danos sade humana. Entretanto, esses autores ressaltaram a importncia
da utilizao de mecanismos que impeam
a expanso da distribuio dessa e de outras
espcies exticas para a preservao de nossa
biodiversidade.

46
Figura 25. Aspecto da morfologia da concha das espcies de
Helisoma Swainson, 1840 presentes no Brasil. A (lado direito)
e B (lado esquerdo) da concha de H. duryi (Wetherby, 1879).
C (lado direito) e D (lado esquerdo) da concha de H. trivolvis
(Say, 1817) (Fotos P.M. Coelho).

8.4. Origem e disperso


Segundo Paraense (1981a) algumas espcies do gnero Helisoma Swainson, 1840 expandiram-se de seu domnio Nertico original
para a Amrica do Sul a oeste dos Andes, at
o Peru. A localidade-tipo de H. duryi Everglades da Flrida, Estados Unidos da Amrica. Aps estudo comparativo de amostras de

CAPTULO 2
Seo 1

populaes pertencentes ao gnero Helisoma,


Paraense (1976b) revelou as seguintes espcies nominais de H. trivolvis: Planorbis fovealis Menke, 1830 (Jamaica), Planorbis affinis
Adams, 1849 (Jamaica), Planorbis auriculatus
Clessin, 1884 (Jamaica), Planorbis intermedius
Philippi Dunker, 1850 (Mxico), Planorbis
ancylostomus Crosse & Fischer, 1879 (Mxico), Planorbis equatorius Cousin, 1887 (Guayaquil, Equador) e Planorbis lentus Say, 1834
(New Orleans, Estados Unidos da Amrica).
Este autor refere-se, alm das localidades-tipos
destas espcies nominais, outras localidades
de H. trivolvis: o Lago Xochimilco (Mxico),
Tembladera, Cajabamba, Puerto Chicama e
Lima (Peru), e o Lago Miragoane (Haiti).

8.5. Meios de introduo


Helisoma duryi vem sendo introduzida em diversas reas a leste dos Andes, seguramente por ao humana (Paraense, 1981a),
tendo sido encontrada como populao naturalizada no Brasil Central (Paraense, 1976a) ou
colonizando ambientes artificiais como aqurios ou lagos artificiais (Thiengo et al., 1998;
Fernandez et al., 2010).

Os meios de introduo de H. trivolvis
possivelmente so os mesmos de H. duryi, incluindo o transporte atravs de plantas aquticas, provvel meio de introduo da populao
encontrada pela equipe do Laboratrio de Malacologia do Instituto Oswaldo Cruz na cidade
do Rio de Janeiro.

8.6. Formas de disperso


Principalmente plantas aquticas que so
utilizadas para suprir o oxignio necessrio
criao e ao transporte de peixes de gua doce,
geralmente ornamentais. Nos Estados do Rio de
Janeiro e Cear, a ocorrncia de populaes de
H. trivolvis e H. duryi foi observada em locais
onde haviam peixes ornamentais destinados ao
comrcio ou como uma forma de controle biolgico das larvas de Aedes aegypti Linnaeus, 1758.
Os meios de disperso so por ao humana,
onde as desovas ou pequenos filhotes so carreados nas folhas ou talos das plantas aquticas, ou
ainda sobre conchas de outros moluscos, como
os ampularideos Pomacea spp., geralmente co-

Figura 26. Distribuio atual das espcies de Helisoma Swainson, 1840 no Brasil (Mapa I.C. Miyahira).

locados em aqurios para manterem os vidros


limpos, uma vez que so animais raspadores,
que se alimentam do limo que se forma nas
paredes. De acordo com Madsen & Frandsen
(1989) populaes de H. duryi so observadas
em aqurios na Europa, o que possivelmente
vem ocorrendo no Brasil com as espcies de
Helisoma.

8.7. Distribuio geogrfica no Brasil


Helisoma duryi se encontra presente nas
Bacias Hidrogrficas do Atlntico Nordeste
Oriental, do Atlntico Sul e Sudeste, Atlntico
Leste e do Tocantins-Araguaia. Helisoma trivolvis foi observado somente na Bacia Hidrogrfica do Atlntico Sudeste, no Rio de Janeiro
(Fig. 26).

9. Physa acuta Draparnaud, 1805


9.1. Caractersticas da espcie


Physa acuta um gastrpode Pulmonata Basommatophora (olhos na base dos tentculos), da famlia Physidae, caracterizada pela
concha sinistrgira (enrolamento da concha

47

Espcies de moluscos lmnicos


invasores no Brasil
Santos et al.

para a esquerda). A concha oval-alongada,


fina, lisa, moderadamente brilhante e translcida; cinco giros, espira curta e sutura ligeiramente marcada. Abertura grande, sinistrgira,
ocupando cerca de do total do comprimento da concha. Massa cefalopediosa uniforme,
de cor cinza escuro, teto da cavidade palial
profundamente pigmentado, visvel atravs da
concha. As conchas possuem em mdia 16 mm
de comprimento e 9 mm de largura (Paraense
& Pointier, 2003), mas podem alcanar mais
de 20 mm em ambientes com muita matria
orgnica disposio (Sonia B. Santos, observao pessoal). Apresenta grande plasticidade
fenotpica, fato que justifica a imensa lista com
155 sinnimos fornecida por Paraense (2011).
A Figura 27A mostra um topotipo, onde se
observa a concha com espira mais alongada
e volta corporal mais estreita, diferindo dos
exemplares de espira mais curta e volta corporal mais abaulada, comuns no Brasil (Figs. 27B,
28). Habita diversos tipos de ambientes lmnicos, inclusive antrpicos, alcanando elevada
densidade populacional, como registrado por

Frana et al. (2007), em reservatrios do baixo


Tiet, onde a espcie alcanou 4350 ind./m-2 no
perodo chuvoso. Toleram ambientes poludos
(Appleton, 1996; Fraga, 2002), sendo que na
frica do Sul podem atingir at 3.000 ind./m2
(Appleton, 1996).

9.2. Etimologia


O nome do gnero Physa originrio do
termo grego physao, que significa saco, bolsa,
enquanto o epteto especfico vem do termo em
latim acutus, cujo significado agudo, afiado.
Physa acuta Draparnaud, 1805 poderia ser definida como uma espcie com a concha em forma de bolsa com uma das extremidades afiada,
correspondendo ao pice da concha (Te, 1980).

9.3. Impactos ambientais e econmicos

No h registros.

9.4. Impactos na sade humana


No h registros. Todavia, existem evidncias, atravs de infeces experimentais,
de que P. acuta possa atuar como hospedeiro
intermedirio de Fasciola hepatica Linnaeus,
1758 (Barros et al., 2002) e de Echinostoma
spp. (Morales et al., 1987).
Figura 27. Physa acuta Draparnaud, 1805. Exemplares vivos.
A, topotipo, mostrando a espira mais alongada e a volta corporal mais estreitada. B, morfotipo comum no Brasil, com a
espira mais curta e volta corporal mais abaulada (Fotos: P.M.
Coelho).

48
Figura 28. Physa acuta Draparnaud, 1805: Aspecto da morfologia da concha; esquerda, lado dorsal; direita, lado ventral. Exemplar CMIOC 4798 (Fotos: P.M. Coelho).

9.5. Origem da espcie e disperso


Physa acuta foi descrita por Draparnaud
em 1805, baseada em espcimes coletados na
bacia do Rio Garonne, na Frana, mas provvel que P. acuta seja originria da Amrica do
Norte (Dillon et al., 2002).

Muitos registros dessa espcie fora de sua
localidade-tipo tm sido relatados em pases da
Europa, sia, frica, alm de registros na Austrlia, Hava e nos Estados Unidos (Paraense &
Pointier, 2003; Madsen & Frandsen, 1989): Europa (Alemanha, ustria, Blgica, Bulgria, Esccia, Espanha, Grcia, Holanda, Hungria, Inglaterra, Irlanda do Norte, Itlia, Polnia, Portugal,
Repblica Tcheca), sia (Azerbaijo, Bangladesh,
China, Gergia, ndia, Ir, Iraque, Israel, Japo,
Jordnia, Coria e Macau), frica (Arglia, Egito, Etipia, Qunia, Ilhas Maurcio, Rodsia,
Madagascar, La Reunion, Zimbbue, Marrocos,

CAPTULO 2
Seo 1

9.6. Meios de introduo


provvel que P. acuta tenha sido introduzida de forma no intencional, por meio do
comrcio ou transporte de plantas aquticas e
atividades de aquariofilia.

9.7. Formas de disperso


A aquariofilia e o comrcio de plantas
aquticas e de peixes para piscicultura so
considerados fontes de disperso dessa espcie em nvel global. uma espcie bastante
cosmopolita, capaz de se dispersar rapidamente
e colonizar diversas reas, encontrado em
variados ambientes de gua doce, como
tanques pequenos, represas, lagos e crregos,
geralmente de curso lento, eutrofizados ou no.

Figura 29. Distribuio atual de Physa acuta Draparnaud 1805
no Brasil (Mapa: P.M. Coelho).

Nambia, Nigria, frica do Sul, Uganda, Sudo,


Tunsia, Zaire), Austrlia, Hava e Estados Unidos (Massachusetts, Virgnia). H ainda ocorrncia dessa espcie nas Amricas Central e do Sul
(Argentina, Barbados, Bolvia, Brasil, Chile, Colmbia, Cuba, Equador, El Salvador, Guatemala,
Jamaica, Martinica, Mxico, Nicargua, Panam, Peru, Porto Rico, Santa Cruz, So Toms,
Trinidade, Uruguai e Venezuela).

9.8. Distribuio geogrfica no Brasil


Os registros de Physa acuta no Brasil (Fig. 29) esto, por ora, restritos s Bacias
Hidrogrficas do Atlntico Leste e Sudeste,
segundo dados da literatura (Thiengo et al.,
1998, 2004, 2005; Miyahira et al., 2010) e da
Coleo Malacolgica do Instituto Oswaldo
Cruz (CMIOC). Fernandez (2011) relatou o
encontro de populaes de P. acuta no reservatrio da Usina Hidreltrica de Serra da Mesa,
Bacia Hidrogrfica Tocantins-Araguaia, em
bitopos com ocorrncia de Physa marmorata
Guilding, 1828.

49

CAPTULO 3
Gentica da bioinvaso
do mexilho-dourado
Edson Pereira da Silva

Introduo

As bioinvases so a chegada, estabelecimento e subsequente difuso de espcies no
nativas em comunidades naturais nas quais elas
no existiam. A introduo destes organismos
, geralmente, mediada pela atividade humana
e pode alcanar nveis extremos (Souza et al.,
2009). A introduo de organismos exticos
pode ter consequncias irreversveis e devastadoras para os ecossistemas naturais, afetando
tanto a biodiversidade quanto as atividades
econmicas. Abordagens ecolgicas do problema esbarram em dificuldades que o uso da Gentica, em alguns casos, pode resolver (Silva,
2004). Por exemplo, o desenvolvimento da tcnica de PCR (Reao em cadeia da polimerase,
do ingls Polymerase Chain Reaction) proporcionou uma facilidade na identificao de ovos,
larvas e jovens no plncton (Pie et al., 2006;
Boeger et al., 2007). Este tipo de abordagem
extremamente til quando preciso identificar
as espcies invasoras nas fases mais iniciais do

desenvolvimento larval, como o caso das bioinvases mediadas pela gua de lastro. Dados
genticos gerados por eletroforese de aloenzimas ou pelas mais diversas tcnicas de DNA
podem, tambm, ser usados para distinguir
as espcies invasoras das nativas. Do mesmo
modo, esta capacidade de identificao molecular das espcies, pode auxiliar o sistemata
clssico no seu trabalho de pesquisar e definir
diferenas morfolgicas em grupos de espcies
de classificao difcil. Outra questo que pode
ser abordada a partir das tcnicas e teoria da
gentica a origem das populaes invasoras.
A resposta para esta questo pode ser inferida a
partir do clculo de ndices de identidade gnica entre populaes de vrios possveis pontos
de origem e a populao invasora em questo.
As identidades gnicas so calculadas par a par,
neste caso, o par populao invasorapopulao do possvel ponto de origem que apresentar o maior valor de identidade gnica estar
indicando, possivelmente, a origem geogrfica
da bioinvaso (Silva, 2001a). A Gentica pode

51

Gentica da bioinvaso
do mexilho-dourado
Edson Pereira da Silva

ser utilizada, tambm, no estudo da dinmica


dos processos de invaso e , a este caso, que
este captulo se dedica: compreender aspectos
da gentica e evoluo da bioinvaso do mexilho-dourado no Brasil.

A abordagem gentica aplicada ao problema da bioinvaso da espcie Limnoperna
fortunei (Dunker, 1857) envolve a busca e o
uso de marcadores moleculares (genes e seus
produtos diretos) e sua interpretao usando a
fundamentao terica da gentica de populaes. No prximo item esta abordagem sumariada.

A abordagem gentica


A constituio gentica dos indivduos
(gentipo) e o problema das leis governando
a sua herana constituem o objeto de estudo
da gentica. A gentica de populaes, por sua
vez, est preocupada com o estudo dos gentipos de grupos de indivduos, as populaes, e
como esta constituio gentica pode mudar ao
longo das geraes. A mudana da composio
gentica das populaes, ao longo das geraes, constitui o processo evolutivo e, por isto
mesmo, estudar gentica de populaes , tambm, estudar o processo evolutivo. Para que o
processo evolutivo ocorra, a primeira condio
que haja variao gnica presente nas populaes. De outro modo, no possvel que haja

mudana ao longo do tempo. Desta forma, o


trabalho de medir e caracterizar a variao
gnica presente em populaes naturais, bem
como o entendimento dos mecanismos que
determinam o seu padro de distribuio nas
populaes, condio fundamental para se
estudar gentica de populaes (Silva, 2001b).
Uma forma de medir e caracterizar a variao
gnica presentes nas populaes naturais a
utilizao de marcadores moleculares que so
locos gnicos que apresentam alguma variabilidade (Silva & Russo, 2000; Silva, 2004). A
clssica tcnica de eletroforese de aloenzimas,
que teve grande impacto nos estudos populacionais na dcada de 1960, cada vez menos usada,
e as vrias tcnicas de DNA, cada vez mais rotineiras, constituem as ferramentas moleculares
de amostragem de variao gnica teis para estudos a respeito da gentica e evoluo (Fig. 1).

A eletroforese pode ser definida, de maneira geral, como a migrao de partculas sob
a ao de uma corrente eltrica. A tcnica se
baseia nas caractersticas fsico-qumicas das
protenas, que apresentam cargas diferentes, e
no fato de que, pelos princpios da biologia molecular, espera-se certa correspondncia entre
sequncia de nucleotdeos no DNA e a sequncia de cidos aminados na protena por ele codificada, ou seja, entre o gene e o seu produto.
Desta forma, protenas diferentes apresentam
cargas diferentes, que por sua vez iro manifes-

52
Figura 1. A unio da gentica com a teoria evolutiva permite o entendimento de como a composio gentica das populaes
muda ao longo do tempo (gentica de populaes). A unio dos princpios da biologia molecular com a gentica permite estudar a variao fenotpica como variao em molculas como o DNA e as aloenzimas (os marcadores moleculares).

CAPTULO 3
Seo 1

Figura 2. Representao esquemtica do mtodo de eletroforese de aloenzimas para amostragem da variao gnica em populaes naturais.

tar diferentes mobilidades eletroforticas, que


representam diferentes alelos. Desta forma, estudar variao de protenas (aloenzimas) estudar variao no DNA (Silva, 2009). A Figura
2 apresenta um esquema deste mtodo.

No caso da variao de DNA, so vrias
as formas pelas quais ela pode ser estudada.
Por exemplo, segmentos de DNA amplificados
por intermdio de reaes em cadeia da polimerase (PCR), que contm sequncias repetitivas, constituem o tipo de variao conhecida
como microssatlites (repeties constitudas
de 2 a 10 pares de bases) ou minissatlites (mais
de 10 pares de base de repetio). Outra forma
de variao gnica aquela que tem origem em
mutaes pontuais. Neste caso, o estudo pode
ser feito pela utilizao de enzimas de restrio que cortam o segmento em regies por
elas reconhecidas (Polimorfismo de tamanho
dos fragmentos de restrio, RFLP do ingls
restriction fragment lenght polymorphism), por
processos desnaturativos que revelam mutaes pontuais refletidas em polimorfismos de
conformao das fitas simples de DNA (por

exemplo, a tcnica de SSCP, do ingls single


strand conformational polymorphism), ou ainda, por sequenciamento total do segmento.
Alternativamente, as facilidades da tcnica de
PCR podem ser utilizadas para amplificar segmentos aleatrios de DNA ao longo de todo o
genoma dos organismos, como no caso da tcnica de RAPDs (do ingls randomly amplified
polimorphic DNAs) (Avise, 2004). Na Figura 3
estas tcnicas esto esquematizadas de modo a
dar uma ideia daquilo que foi resumido aqui.

A escolha da tcnica a ser utilizada depende fundamentalmente do problema a ser investigado. Por exemplo, tcnicas como RAPDs
produzem uma quantidade muito grande de
variao observvel, o que til para estudos
de paternidade e modos de reproduo, mas
no so indicadas para estudo de filogenia (parentesco entre espcies diferente), para os quais
tcnicas como RFLPs e sequenciamento so
excelentes. Do mesmo modo, estudos de estruturao populacional tm em microssatlites e
aloenzimas uma boa alternativa de amostragem
de variao gnica (Silva & Russo, 2000).

53

Gentica da bioinvaso
do mexilho-dourado
Edson Pereira da Silva

Figura 3. Reao em cadeia da polimerase (PCR) e variao na forma de microssatlites (no exemplo, o motivo GATT tem uma,
duas e trs repeties), RFLP (no exemplo, um, dois e trs fragmentos de restrio), SSCP (desnaturao das fitas duplas de DNA
pela temperatura e polimorfismos de conformao das fitas simples) e RAPD (segmentos aleatrios amplificados por primers
em stios de homologia no DNA genmico).

54

Gentica da bioinvaso


Por definio, espcies exticas se acham
em regies biogeogrficas diferentes daquelas
nas quais evoluram e se adaptaram, dessa forma, bioinvasoras tm que enfrentar presses
seletivas novas bem como novas situaes de
stress (Souza et al., 2009). Dentre os tipos de
mudana evolutiva a que esto sujeitas as espcies invasoras podem ser citados: bottlenecks,
efeito de pequeno nmero de genes e hibridizao (Lee, 2002; Prentis et al., 2008).

Em populaes naturais pequenas, o acaso tem um papel importante na determinao
de quais genes estaro presentes na prxima
gerao, fora evolutiva conhecida como deriva
gentica. Um caso extremo de deriva a reduo drstica do tamanho populacional, que tem
como consequncia a reduo dos nveis de variao gnica da populao (bottleneck ou gar-

galo de garrafa, ver Figura 4). A chegada acidental de um ou poucos indivduos de uma espcie
em um novo ambiente, como se d no caso das
bioinvases, um exemplo de bottleneck (conhecido, nesse caso, como efeito fundador).
Modelos tericos tm sido desenvolvidos para
o estudo dessa dinmica da bioinvaso. Garcia-Ramos & Rodriguez (2002) examinaram a interao entre o processo de adaptaes locais e
a densidade populacional na velocidade do processo de invaso. O modelo mostrou que as interaes entre os fatores genticos e demogrficos
reduzem a velocidade de expanso das espcies,
comparado com outros modelos que levam em
conta apenas os fatores demogrficos. A reduo da velocidade de bioinvaso resultado de
uma limitada capacidade das populaes de se
adaptarem a ambientes novos devido aos baixos
nveis de variao gnica. Contudo, embora seja
geralmente considerado que as mudanas gen-

CAPTULO 3
Seo 1

tro fator importante para o sucesso das espcies


invasoras o estado de depauperamento do ambiente invadido (Cohen & Carlton, 1988). Ambientes poludos, por exemplo, podem facilitar
o crescimento de espcies invasoras que, nessas
condies, provavelmente, encontram um ambiente de menor competio (Duffy et al., 2000).

Figura 4. Efeito bottleneck a que esto sujeitas populaes invasoras, tendo como consequncia a reduo da quantidade
de variao presente na populao de origem.

ticas no so detectveis em tempos ecolgicos,


evidncias de estudos com seleo artificial tm
demonstrado que as populaes podem sofrer
mudanas rpidas de caracteres morfolgicos,
envolvendo em torno de apenas 100 geraes
(Barton & Turelli, 1989).

Uma alternativa s mudanas lentas envolvidas no processo de adaptao a hibridizao. Lee (2002) aponta que a hibridizao,
entre espcies ou entre populaes da mesma
espcie (dos bioinvasores com espcies nativas
ou com outras espcies invasoras) pode reduzir
a perda de variao gnica associada ao processo de bioinvaso (bottleneck), bem como
produzir uma gama de novos gentipos importantes adaptao da espcie invasora ao novo
ambiente. Os efeitos positivos da hibridizao
ao processo de bioinvaso incluem crescimento
mais rpido, maior tamanho dos hbridos e um
aumento da agressividade.

A variao gnica, seja ela de origem recombinacional ou mutacional, extremamente importante para o processo de adaptao.
Contudo, no se pode negligenciar o efeito de
um pequeno nmero de genes na habilidade de
colonizao das espcies invasoras. Exemplos
notveis do efeito de um ou poucos genes no
sucesso da colonizao de ambientes novos tem
sido demonstrado para espcies terrestres (Lee,
2002). Embora, no tenha sido encontrada,
ainda, uma contraparte para o ambiente aqutico, genes dessa natureza no devem ser exclusivos de determinados grupos.

Por fim, embora no seja uma estratgia
adaptativa, mas uma contingncia histrica, ou-

O mexilho-dourado


Para entender o padro de invaso do
mexilho-dourado nas guas brasileiras, foram
utilizados marcadores moleculares de aloenzimas para testar diferentes hipteses sobre a sua
dinmica de invaso. Foram feitas amostragens
(ver Figura 5) em trs pontos no Brasil (Lago
Guaba, RS; Porto Esperana, MS e Usina de
Itaipu, PR) e dois na Argentina (Balnerio Bagliardi e Usina de Yaciret).

As populaes invasoras de L. fortunei,
tanto no Brasil quanto na Argentina, apresentaram altos nveis de variao gnica (Fig. 6),
que no esto de acordo com um evento de
bottleneck, no qual as populaes so estabelecidas a partir de pequenos estoques com a consequente reduo da variao gnica da espcie
no novo ambiente. Altos nveis de variao gnica em espcies invasoras, embora surpreen-

55

Figura 5. Localizao das cinco populaes amostradas (Lago


Guaba, RS; Porto Esperana, MS; Usina de Itaipu, PR; Balnerio Bagliardi, ARG e Usina de Yaciret, ARG).

Gentica da bioinvaso
do mexilho-dourado
Edson Pereira da Silva

Figura 6. O elevado nvel de variao gnica da espcie Limnoperna fortunei pode ser visualizado no grfico que relaciona
o nmero de locos polimrficos (P) com a heterozigosidade
(H) em vrios grupos de organismos. A variao gnica de L.
fortunei (triangulo amarelo) est muito acima daquela observada para bivalves.

dentes, no so uma exceo. Holland (2000,


2001), por exemplo, estudando 6 populaes
nativas (2 do Brasil, incluindo Rio Grande, 1
da Venezuela e 3 do sul da frica) e 6 populaes invasoras (Golfo do Mxico) do mexilho
marrom Perna perna encontrou altos nveis de
variao gnica para dois locos de microssatlites, alm de pouca ou nenhuma diferena entre as populaes nativas e invasoras. Holland
concluiu, ento, que as populaes no Golfo do
Mxico foram o resultado de um nico evento
de bioinvaso, que ele denominou evento de
captura de pool gentico, provavelmente, decorrente de descarga de gua de lastro.

No caso do mexilho-dourado, no entanto, os nveis de variao gnica so elevados,
mas existe grande diferena gentica entre as
cinco populaes amostradas. Estes resultados

56
Figura 7. Efeito de mistura de populaes que produz o aumento da quantidade de variao da populao invasora em
relao s populaes originais (Pop 1-4).

sugerem que as populaes estudadas, provavelmente, foram fundadas a partir de muitos


eventos de invaso advindos de diferentes regies geogrficas. Este fenmeno de mistura
gentica de populaes oriundas de diferentes localidades chamado de Efeito Wahlund
(Fig. 7). Nestes casos, as populaes invasoras
apresentam altos nveis de variao gnica (resultado da mistura de populaes) e grandes
diferenas genticas entre elas (resultado das
diferentes regies). Outra caracterstica do
Efeito Wahlund so os desvios significativos ao
esperado pelo equilbrio de Hardy-Weinberg.

A hiptese do equilbrio de Hardy-Weinberg postula que a frequncia de alelos em uma
gerao exatamente a mesma da gerao anterior, ou seja, a frequncia de alelos permanece
a mesma, gerao aps gerao, quando ocorre
acasalamento ao acaso. A constncia da frequncia de alelos e consequentemente da composio genotpica da populao significa que, na
ausncia de foras evolutivas especficas (seleo
natural, deriva gentica, mutao e migrao)
para modificar as frequncias dos alelos, o mecanismo da herana mendeliana, por si s, mantm as frequncias dos alelos constantes e, assim,
preserva a variabilidade gentica (Hartl, 2000;
Silva, 2001a). Numa populao que o resultado da mistura de muitas populaes diferentes, as frequncias dos alelos so diferenciadas,
portanto, o equilbrio de Hardy-Weinberg s
pode ser alcanado depois de vrias geraes de
acasalamento ao acaso. Antes que isto acontea,
muitas das combinaes de alelos esperadas no
sero encontradas na populao misturada. No
trabalho com Limnoperna foram encontrados
muitos desvios significativos das propores esperadas pelo equilbrio de Hardy-Weiberg para
as trs populaes brasileiras e as duas argentinas, o que uma clara indicao de que elas
foram fundadas pela mistura de populaes de
diferentes origens geogrficas.

O fato de que as populaes invasoras,
tanto no Brasil como na Argentina, esto diferenciadas geneticamente conduz a outra concluso importante: a migrao natural no vetor
mais importante do processo de invaso da espcie L. fortunei em curso nas guas brasileiras.
Contudo, Kimura et al. (2003) estudando populaes de L. fortunei oriundas da Argentina,
Japo, Tailndia e China encontraram, tambm,

CAPTULO 3
Seo 1

grande diferenciao gentica entre as populaes do Japo e Tailndia, bem como diferenas relevantes entre Argentina e Japo/China.
Estes resultados indicam alto potencial de diferenciao gnica para a espcie L. fortunei,
pelo menos em nvel macrogeogrfico.

Concluso

As trs concluses principais das anlises
genticas com as populaes invasoras da espcie L. fortunei no Brasil podem ser resumidas
como se segue:

1) o mexilho-dourado invadiu as guas
continentais brasileiras mais de uma vez;

2) as populaes que invadiram o Brasil
vieram de diferentes locais;


3) a migrao natural no vetor mais
importante deste processo de bioinvaso.

O estudo da gentica das espcies invasoras tem sido pouco explorado, contudo,
seu conhecimento pode fornecer informaes
importantes sobre os padres de bioinvaso.
As invases biolgicas so, geralmente, constitudas de rpidos eventos evolutivos, resultando em populaes que so geneticamente
dinmicas, tanto no espao, quanto no tempo.
Espera-se ter demonstrado neste captulo que
a utilizao da abordagem gentica, a partir
do uso de marcadores moleculares, se constitui numa alternativa importante no esforo
para entender e controlar o processo de bioinvaso nos ecossistemas aquticos continentais
do Brasil.

57

Seo
Biologia de
moluscos invasores

CAPTULO 4
Bivalves invasores lmnicos:
morfologia comparada de
Limnoperna fortunei e
espcies de Corbicula spp.
Maria Cristina Dreher Mansur

1. Introduo


O conhecimento da morfologia externa
e interna funcional dos moluscos bivalves invasores de extrema importncia para a definio das espcies, do entendimento de seu papel
ecolgico nos ecossistemas, bem como para a
compreenso da ao dos mtodos de controle
populacional sobre seus organismos.

No Brasil, Limnoperna fortunei (Dunker,
1857) pode ser confundida com algumas espcies de Dreissenidae que ocorrem em gua doce
ou salobra, respectivamente, Mytilopsis lopesi
Alvarenga & Ricci, 1989 e Mytilopsis leucophaeta (Conrad, 1831).

As espcies invasoras Corbiculidae (C.
fluminea, C. largillierti, C. fluminalis e Corbicula sp.) so comumente confundidas com os
corbiculdeos nativos como Cyanocyclas limosa
e Cyanocyclas paranensis e outras espcies deste gnero que no foram ainda bem definidas e
que so abundantes nas regies norte e nordeste do Brasil.


Visando diferenciar as espcies invasoras
entre si e das demais espcies nativas e invasoras de bivalves de gua doce que ocorrem no
territrio brasileiro, num primeiro momento
descrevemos sua morfologia externa (concha) e
interna, e posteriormente, num quadro comparativo, apresentamos os aspectos morfolgicos
dos principais grupos de bivalves lmnicos brasileiros.

2. Morfologia externa e interna de


Limnoperna fortunei

2.1. Morfologia externa




A concha de L. fortunei (Fig. 1) formada por duas valvas iguais de contorno triangular com a base alongada; alcanando o comprimento de 2,5 a 3 cm, excepcionalmente 3,5 a 6
cm; a margem anterior arredondada e baixa
com umbos (protuberncia dorsal em cada valva) subterminais, no agudos, porm pequenos
e arredondados situados um pouco acima da

61

Bivalves invasores lmnicos: morfologia comparada de


Limnoperna fortunei e espcies de Corbicula spp.
M.C.D. Mansur

extremidade anterior e carenados em ambos


os lados da concha; esta carena umbonal segue pelas laterais das valvas de forma oblqua,
terminando junto extremidade posterior;
margem dorsal ascendente, reta; na metade do
comprimento, forma uma elevao arredondada (o topo), depois desce oblqua e levemente
curvada at a extremidade posterior que arredondada e se situa prximo da base; margem
ventral muito varivel em vista lateral, desde
reta at acentuadamente arqueada para dentro
ou cncava, porm, em vista frontal ela convexa.

Figura 1. Morfologia externa da concha de Limnoperna fortunei. Carena umbonal (C); topo (T); umbo (U). Escala: 1 cm.
(Foto: M.C.D. Mansur).

62

Figura 2. Vista externa da concha de Limnoperna fortunei,


com as variaes de colorao: Acima, exemplar albino; no
centro, exemplar rajado com raios internos sem a cor prpura
do ncar; em baixo, exemplar escuro, com o ncar interno de
cor prpura (regio anterior esquerda e posterior direita).
(Foto: M.C.D. Mansur).


A forma da concha lembra a de muitos
mexilhes marinhos de tamanho mediano a pequeno, como os de costes rochosos beira mar,
do gnero Brachidontes e o sururu do mangue do
gnero Mytela. Externamente, lembra tambm as
espcies do gnero Mytilopsis, como por exemplo, o M. lopesi presente nos rios do baixo Amazonas e o de gua salobra M. leocophaeta nativo
da Amrica do Norte, porm, recentemente, registrado para as proximidades do porto de Recife
(Souza et al., 2005).

A concha formada por trs camadas. A
mais externa o peristraco, depois vem a camada prismtica calcria, composta por cristais
microscpicos dispostos perpendicularmente
superfcie e por dentro a camada nacarada, composta por lamelas horizontais. O peristraco
orgnico, relativamente liso, fino, translcido, levemente amarelado ou castanho claro e brilhante. Apesar da superfcie externa ser relativamente
lisa, aparecem dbeis linhas de crescimento que
acompanham o contorno das bordas, so as linhas comarginais. Nas bordas da concha o peristraco mais espesso e virado para o interior da
concha (Morton, 1973). A cor da concha (Fig. 2)
geralmente marrom escura, s vezes esverdeada
acima e castanho claro abaixo da carena umbonal. A cor da superfcie externa depende da composio do ncar interno da concha que de cor
prpura acima e branco abaixo da carena umbonal (Morton, 1973). Comumente a rea prpura cruzada por raios brancos que partem dos
umbos em direo ao declive posterior. Exemplares mais velhos so geralmente mais escuros e os
menores mais claros. Frequentemente aparecem
albinos que, devido ausncia da cor prpura
interna, apresentam-se amarelados ou dourados
em vista externa.

Na superfcie interna da concha (Fig. 3),
podemos observar impresses ou cicatrizes musculares diferentes (heteromirios). Na regio anterior junto cavidade sub umbonal aparece a
impresso do msculo retrator anterior do bisso
e do p, que pequena; ventralmente na frente,
aparece a impresso do msculo adutor anterior
tambm pequena e elptica; abaixo do topo, uma
impresso pequena correspondente ao msculo
retrator posterior do p; a seguir as impresses
do msculo retrator posterior do bisso, que se
apresenta dividida em duas partes: a primeira
que bilobada (Fig. 3 - RPB1) seguida da segun-

CAPTULO 4
Seo 2


Como os demais mitildeos marinhos ou
de gua salobra, L. fortunei apresenta fios de bisso que permitem uma adeso firme ao substrato.
Fios de bisso tambm esto presentes no gnero
Mytilopsis (Dreissenidae) e em outros como nos
gneros Eupera e Byssanodonta (Sphaeriidae) nativos da Amrica do Sul.

Figura 3. Interior da valva direita do Limnoperna fortunei com
detalhe das impresses musculares: ligamento (L), linha palial
(LP), msculo adutor anterior (MAA), msculo adutor posterior (MAP), peristraco (PER), retrator anterior do bisso e p
(RABP), retrator posterior do bisso (RPB1), retrator posterior
do bisso (RPB2), retrator posterior do p (RPP), topo (T), umbo
(U). (Desenho: M.C.D. Mansur).

da simples (Fig. 3 - RPB2); logo atrs se encontra


a maior impresso, correspondente ao msculo
adutor posterior. A linha palial une as impresses
do adutor anterior e do posterior paralelamente
borda ventral. a linha onde os msculos da
borda do manto aderem concha.

O ligamento estreito e reto, composto por
protenas elsticas, conecta as valvas dorsalmente
atrs dos umbos. Isto significa que o mexilho
opistodtico. Microscopicamente o ligamento
formado por duas camadas de protenas elsticas
que esto cobertas pelo peristraco. Este tipo de
ligamento (com trs camadas) encontrado apenas nos mitildeos onde se inclui o L. fortunei.
Em Dreissena polymorpha o ligamento tambm
opistodtico, porm formado por apenas uma
camada complexa (Morton, 1973). Abaixo do ligamento existe a charneira que muito fina, reta
e desprovida de dentes. No existe apfise, nem
septo, nem chanfro ou entalhe bissal.

2.2. Morfologia interna de L. fortunei


Para observar a morfologia interna do
mexilho-dourado necessrio separar as valvas,
descolando-se os msculos e o manto da superfcie interna valvar. Para no destruir os rgos
internos, necessrio introduzir um bisturi de
ponta fina logo abaixo do topo, mas de forma
inclinada para afastar primeiramente os msculos da superfcie interna valvar e depois liberar
o manto de sua adeso junto linha palial. As
valvas ainda ficam unidas dorsalmente pelo ligamento.

Retirando-se as duas valvas, observa-se
o corpo do mexilho-dourado revestido pelo
manto e vrios msculos. Mais internamente, o
corpo do mexilho apresenta uma massa visceral
na parte dorsal e a cavidade do manto na regio
ventral. A massa visceral envolve os msculos e
os rgos responsveis circulao, reproduo,
digesto e filtrao. Uma vista esquemtica dos
principais rgos da cavidade do manto consta
na Figura 4. Uma descrio detalhada da morfologia interna e funcional de L. fortunei tambm
pode ser encontrada em Morton (1973). Muitos
aspectos internos tambm se assemelham aos do
mexilho marinho Mytilus edulis descrito conforme Renner & Cunha (1986) e Fox (2006a).
Figura 4: Vista esquemtica dos principais rgos da cavidade do manto do
mexilho-dourado: bisso (BI), borda do
manto (BM), boca (BO), cavidade palial
(CP), cavidade suprabranquial (CSB), demibrnquia externa (DBE), demibrnquia
interna (DBI), divertculos digestivos (DD),
ligamento (L), manto (M), msculo adutor
anterior (MAA), membrana branquial (MB)
msculo adutor posterior (MAP), palpo labial (PL), p (P), retrator anterior do bisso
e p (RABP), retrator posterior do bisso
(RPB1), retrator posterior do bisso (RPB2),
retrator posterior do p (RPP), sifo exalante (SE), sifo inalante (SI), umbo (U),
corrente inalante (), corrente exalante e
direo das fezes (), percurso e direo
das pseudofezes no sifo inalante ()
(Desenho: M.C.D. Mansur).

63

Bivalves invasores lmnicos: morfologia comparada de


Limnoperna fortunei e espcies de Corbicula spp.
M.C.D. Mansur

2.2.1. Musculatura


No corpo de L. fortunei pode-se reconhecer vrios msculos com diferentes funes (Fig.
4) Os msculos adutores que se estendem de
uma valva a outra so responsveis pela aduo
valvar (fechamento das duas valvas) e fixao
do corpo concha. O msculo adutor anterior
pequeno e se situa na frente, ventralmente;
o msculo adutor posterior grande, prximo
dos sifes posteriores. Dorsalmente, abaixo do
topo, existe um msculo grande e forte dividido
em dois componentes (msculo retrator posterior do bisso 1 e msculo retrator posterior
do bisso 2) que so responsveis pela adeso e
sustentao do bisso. Na frente destes dois msculos existe um menor que o msculo retrator
posterior do p, responsvel pelos movimentos de retrao do p. Sob a cavidade umbonal
destaca-se o msculo retrator anterior do bisso
e do p. Os dois msculos adutores so unidos
por uma linha de pequenos msculos, a linha
palial (Fig. 3), que acompanha a borda ventral
das valvas; esta linha ntegra, sem sinus palial
(reentrncia da linha palial). Na realidade estes
pequenos msculos so a insero dos msculos
radiais das bordas do manto que servem para o
controle e movimentao das dobras e aberturas
do manto e do sifo.

2.2.2. O manto

lante) e separados ventralmente junto abertura


do p. Atravs desta abertura, o p distende-se e
os fios do bisso exteriorizam-se.

Junto borda livre de cada lobo do manto
existem trs pregas: a prega externa responsvel pela formao das camadas da concha; entre
a externa e a mediana existe uma glndula que
produz o peristraco; a dobra interna sensitiva
e apresenta franjas que se expandem e retraem
junto ao sifo inalante.

2.2.3. Cavidade palial


Entre os dois lobos livres do manto, est
a cavidade palial ou do manto (Fig. 4) que se
estende para os lados da massa visceral. Divide-se em duas cmaras pelo diafragma ou septo
branquial situado na linha dorsal das brnquias
e entre os sifes: a cmara ventral grande e
facilmente visualizada, bastando separar as
valvas e os lobos do manto. Contm a abertura
inalante, as brnquias, o p, os palpos labiais e
a boca, rgos que atuam na conduo e seleo de partculas alimentcias, rejeio, troca
de gases, locomoo e fixao. A cmara dorsal ou suprabranquial (Fig. 4) muito estreita e
praticamente limitada ao canal suprabranquial,
os espaos do sifo exalante e, dorsalmente, o
nus. Para ser visualizada necessrio romper
a base dorsal das brnquias.

64


um rgo comum a todos os moluscos
(Fig. 4). De uma maneira geral ele reveste e
protege o corpo e responsvel pela formao da
concha. No caso dos bivalves, o manto tambm
tem outras funes importantes. Ele forma a
cavidade palial ou do manto que cheia de gua,
onde acontece a conduo e seleo de partculas
e, no caso dos Mitildeos, em cada lobo, o manto, internamente, abriga parte das gnadas. Nos
demais bivalves lmnicos dos gneros Dreissena,
Mytilopsis, Congeria que pertencem famlia
Dreissenidae, e as espcies de corbiculdeos, esferdeos e uniondeos, as gnadas esto presentes
somente na massa visceral e no no manto.

O manto formado por dois lobos, cada
um cobrindo a superfcie interna da respectiva
valva. No mexilho-dourado, os lobos esto fundidos dorsalmente acima do sifo exalante, entre
os sifes exalante e inalante (apenas acima do ina-

2.2.3.1. Sifes


So curtos formando simples aberturas
(Fig. 4) no portadoras de tentculos ou papilas:
o sifo exalante afunilado, formado somente
pela fuso das pregas internas da borda do manto que selam a cmara dorsal da cavidade palial,
logo acima do sifo inalante; o sifo inalante
aberto e, portanto, podemos tambm denomin-lo de abertura inalante. Isto significa que os
dois lobos do manto no se fundem ventralmente e que o sifo inalante no separado da fresta por onde se exterioriza o p/bisso. As bordas
deste sifo so onduladas e se distendem para
fora da concha quando o animal est em atividade de filtrao. Em Corbicula, Dreissena e
Mytilopsis forma-se um curto sifo inalante que
fechado ventralmente com curtos tentculos
na borda e separado da fresta do p bissado. O
sifo varia de comprimento conforme o gnero.

CAPTULO 4
Seo 2

Figura 5. Detalhe dos tentculos da


membrana branquial situada na base
dorsal da abertura inalante do Limnoperna fortunei: 5A, tentculo central
com ramificaes simples; 5B, tentculo central com ramificaes terminais.
Membrana branquial (MB), tentculo
ramificado (TR), tentculo simples (TS)
(Fotos: M.C.D. Mansur).

2.2.3.2. Membrana branquial

Presente na base dorsal da abertura inalante (Fig. 4) tem o formato de uma meia-lua e
tambm denominada de septo branquial por
Morton (1973). A borda distal desta membrana apresenta pequenos tentculos simples e um
maior no centro com ramificaes ou com um
conjunto de tentculos terminais (Figs. 5A e
5B). Pela associao com algumas espcies marinhas, Morton (1973) relaciona a funo desta
membrana com a de uma vlvula, presente em
algumas espcies marinhas. Com a presena
dos tentculos sugerimos ter tambm funo
sensitiva. Esses costumam curvar-se e direcionar sua extremidade distal para a abertura inalante, dando a impresso de funcionarem como
um periscpio.

2.2.3.3. Brnquias


Dentro da cavidade do manto ou cavidade palial e de cada lado do p esto as brnquias (Fig. 4). Cada brnquia compreende duas
demibrnquias, uma externa e outra interna.
Cada demibrnquia formada por uma lamela
descendente e uma ascendente (Fig. 6). As unidades de cada lamela so os filamentos. Cada
filamento possui clios frontais na parte mais
externa e clios laterais entre os mesmos e de
encontro aos clios do filamento vizinho. Os
clios laterais promovem as correntes respiratrias e de seleo das partculas. Os clios frontais movem as partculas alimentcias ao longo
da superfcie branquial em direo ao sulco
oral ventral (Fig. 6B).

As demibrnquias so muito alongadas
e semelhantes entre si, considerando a forma

muito achatada e o nmero de filamentos, no


entanto as externas so maiores que as internas
(Fig. 6A). As brnquias so do tipo primitivo
(filibranquiados), tpico dos mitildeos. Os filamentos apresentam-se justapostos, mas independentes, apenas unidos por fuso ciliar formando
as pontes ciliares ou junes interfilamentares,
assim como na juno das demibrnquias ao manto e massa visceral. Tambm existem junes
entre os filamentos da lamela ascendente e da
descendente. Estas so as junes interlamelares que mantem os filamentos opostos unidos,
mas no por clios, e sim por conexes muito
pequenas de tecido. Neste tipo de brnquia os
filamentos podem ser separados e individualizados com muita facilidade, o que no acontece
com os outros bivalves nativos e invasores que
ocupam as guas continentais brasileiras. Em
Dreissena os filamentos, entre si e as lamelas
ascendente e descendente, esto fortemente
fusionados por tecidos de conexo formando
verdadeiras lamelas branquiais (eulamelibrnquios) assim como os Corbiculidae, Sphaeriidae e Unionoida.

Os clios das brnquias formam correntes
para selecionar partculas. As partculas aceitas
so direcionadas por clios formando correntes
de aceitao que seguem at os palpos labiais e
destes em direo boca. Em L. fortunei ocorrem correntes de aceitao, na base dorsal das
demibrnquias somando trs de cada lado da
cavidade palial e mais duas nas margens das
demibrnquias (Fig. 6A). Nestas, forma-se um
verdadeiro canal longitudinal chamado sulco
oral, por onde passam as correntes de aceitao (Fig. 6B). Seriam, portanto, 5 correntes de
aceitao de cada lado do animal, o que aumenta a eficincia de filtrao nesta espcie em

65

Bivalves invasores lmnicos: morfologia comparada de


Limnoperna fortunei e espcies de Corbicula spp.
M.C.D. Mansur

comparao com os demais bivalves lmnicos


invasores e nativos. Nos demais bivalves lmnicos nativos, em Corbicula e Dreissena, s existe
um canal oral na demibrnquia interna, alm
de uma ou mais correntes de aceitao na regio dorsal das demibrnquias.

No animal vivo possvel visualizar o
movimento dos clios e a formao das correntes de aceitao na superfcie das brnquias.
Para tal, necessrio usar bastante aumento
na lupa cobrindo a brnquia com um filme de
gua. O batimento dos clios e movimento das
correntes pode ser visto onde a luz se reflete
ou colocando p de carmim ou grafite na superfcie da brnquia. As partculas so movidas
rapidamente sobre as brnquias em direo ao
sulco oral ventral na margem distal das brnquias (Fig. 6). Neste sulco as partculas selecionadas e aceitas so transportadas pelos clios
para frente do animal, passando das brnquias
em direo aos palpos labiais e boca, situada
na regio anterior do animal.

manto onde, uma vez envolvidas em muco, formam as pseudofezes que so levadas ao exterior
da cavidade palial atravs de correntes prprias.

2.2.3.5. P e bisso


delgado e afilado na extremidade distal
(Figs. 4, 7). Na fase de recrutamento e juvenil, o
p pode se distender muito, quase alcanando o
comprimento da concha. A medida que o animal
cresce e assume sua vida de epibionte (animal que
vive fixo sobre o substrato) graas a produo de
fios de bisso, o p torna-se reduzido a ponto de
no poder mais locomover o animal, quando arrancado do substrato. Os fios de bisso apresentam um aspecto crneo e so bastante resistentes. So secretados pela glndula do bisso que se
localiza na parte dorsal do interior do p, junto
massa visceral. O produto desta glndula se exterioriza por um canal bissal que se abre na face
ventral posterior do p. O bisso na realidade
um conjunto de fios. Cada fio produzido indiFigura 6. Brnquia esquerda de Limnoperna fortunei: 6A, Esquema de um corte
frontal da metade esquerda do animal
com as setas demarcando as correntes
de seleo de partculas nas superfcies
branquiais e os pontos negros demarcando o direcionamento das partculas via
oral; 6B, Detalhe da extremidade distal
de um filamento branquial com o perfil
do sulco oral, onde as partculas selecionadas so direcionadas por movimentos
ciliares aos palpos labiais e boca: clios
(CI), cavidade palial (CP), cmara suprabranquial (CSB), demibrnquia externa
(DBE), demibrnquia interna (DBI), dobras
da borda do manto (DBM), eixo central
(EC), gnadas (G), juno interlamelar
(JI), lamela ascendente (LA), lamela descendente (LD), manto (M), massa visceral
(MV), p (P), sulco oral (SO). (Desenho e
foto de M.C.D. Mansur).

66

2.2.3.4. Palpos labiais.


Dois de cada lado do corpo (Figs. 4 e 7),
so muito alongados e estreitos, conectando-se e
envolvendo a parte anterior das brnquias. As superfcies justapostas de cada par so pregueadas.
Estas pregas recebem as partculas vindas dos
sulcos orais das duas demibrnquias e, atravs de
uma srie de correntes, promovem a conduo
dos alimentos aceitos em direo boca. As partculas rejeitadas so conduzidas em direo ao

vidualmente e fixado pelo molusco ao substrato


atravs de um pequeno disco adesivo ou boto.
Este bisso permite ao animal fixar-se ao substrato
e tambm se aglomerar, formando incrustaes
volumosas, os macroaglomerados.

2.2.3.6. Funo da cavidade do manto


A principal funo da cavidade do manto
a seleo ou filtrao de partculas alimentcias
em suspenso que entram pelo sifo inalante.

CAPTULO 4
Seo 2


Estas partculas integrantes do plncton
so movimentadas por clios que se encontram
nas superfcies do manto, e dos demais rgos
contidos na cavidade palial. Na cmara ventral,
as correntes ciliares sobre as brnquias e entre
os palpos labiais so de aceitao e rejeio; as
correntes ciliares do manto que reveste a cavidade palial, incluindo as da massa visceral e
do p so todas de rejeio e servem para manter a limpeza desta cavidade (Morton, 1973).
Estas correntes conduzem as partculas rejeitadas para a regio posterior e, bem prximo da
borda interna posterior do sifo inalante, so
conduzidas para cima, em direo a abertura
exalante (Fig. 4). Durante o trajeto de rejeio,
as partculas so envolvidas por muco produzido por clulas especiais do manto, formando
ento as pseudofezes. Bem junto rea dorsal
da abertura inalante, as correntes de rejeio
de ambos os lados do manto se unem formando
um cordo nico de pseudofezes que expelido de forma quase contnua quando o animal
no perturbado. Este tipo de liberao das
pseudofezes pela regio dorsal da abertura inalante difere dos bivalves nativos e das corbculas onde as pseudofezes se concentram na base
inferior da abertura inalante sendo expelidas
por movimentos rpidos e intermitentes por
aduo valvar. Na cmara dorsal do L. fortunei, todas as correntes so de limpeza e saem
junto com as fezes pelo sifo exalante. Assim
fezes e pseudofezes so expelidas sob a forma
de cordes paralelos na mesma direo dorsal.

Estudos realizados Jrgensen (1990),
para medir o ndice ou taxa de filtrao de
partculas em suspenso em vrios bivalves revelaram que L. fortunei pode ser considerado
como um dos bivalves filtradores mais eficientes conhecidos at o momento. Assim possvel que o alto dinamismo da atividade ciliar
relacionado ao tamanho proporcionalmente
grande da cavidade palial, somado a ampla
superfcie ciliar disponvel nas brnquias e
palpos labiais e ao nmero proporcionalmente
alto (dez) de correntes de aceitao (Fig. 6A),
possa explicar a alta eficincia deste molusco
na seleo de partculas, o que colocaria em
risco a biodiversidade planctnica e a fauna
que depende desta. Mais detalhes nos Captulos 22 e 23.

2.3. rgos da massa visceral


Contem os rgos internos responsveis
pela digesto, circulao, excreo e reproduo
(Fig. 7). De uma maneira geral seguem o padro
das espcies marinhas do gnero Mytilus ou Perna.

2.3.1. Sistema digestivo


Inicia pela boca, seguindo pelo esfago,
estmago, glndula digestiva, saco do estilete, intestino e reto, percorrendo a parte mais
dorsal do animal (Fig. 7). As partculas aceitas pelas brnquias chegam aos palpos labiais,
pelo canal oral ventral de cada demibrnquia.
Entram pela boca em forma de fresta, percorrem o esfago curto e ciliado em direo ao
estmago alongado e pequeno. Na realidade
o esfago e o estmago tambm so reas de
seleo e conduo de partculas. O estmago
compreende internamente uma rede complexa
de reas de seleo formadas por sulcos, pregas
e duas tiflossoles ciliadas, cuja funo separar
as partculas orgnicas alimentcias das minerais indigestas. As partculas orgnicas seguem
em direo aos divertculos digestivos e as rejeitadas so conduzidas por um sulco regio
posterior do estmago que se comunica com
o intestino onde se formam as fezes. Existem
vrias aberturas da glndula digestiva no estmago. Inicialmente o intestino associado ao
saco do estilete e separado deste apenas pelas
duas tiflossoles que se prolongam para dentro
do estmago. O saco secreta o estilete cristalino que um bastonete transparente, gelatinoso
e longo, que se projeta para dentro do estmago em direo ao escudo gstrico, situado do
lado esquerdo. O estilete cristalino composto
por enzimas digestivas (Fox, 2006a) e, girando,
ajuda a mover um cordo de muco com partculas alimentcias que vem do esfago para
dentro do estmago. O intestino compreende
trs regies com aproximadamente o mesmo
comprimento: o intestino anterior associado ao
saco do estilete sai do estmago e segue at a
altura do msculo adutor posterior, formando
a primeira parte; volta para a frente da massa
visceral que seria a segunda poro, o intestino
mediano, e sobe formando a parte final, o intestino terminal, tambm denominado de reto,
que atravessa o pericrdio, penetra e atravessa

67

Bivalves invasores lmnicos: morfologia comparada de


Limnoperna fortunei e espcies de Corbicula spp.
M.C.D. Mansur

o ventrculo cardaco, contorna o msculo adutor posterior, terminando no nus prximo da


abertura exalante.

Os demais rgos da massa visceral,
tambm seguem o padro dos mexilhes marinhos. Mais detalhes sobre as estruturas e
funo das mesmas em todo o sistema digestivo, esto descritas detalhadamente por Morton (1973) que comenta que o intestino mdio
e o saco do estilete em L. fortunei seriam basicamente o mesmo que do mexilho azul do
mar Mytilus edulis descrito por Giusti (1971).

2.3.2. Sistema circulatrio


Est localizado dorsalmente, prximo do
final do ligamento e abaixo do topo da concha.
O corao composto por um ventrculo nico
situado dentro da cavidade pericrdica que constitui o espao do celoma que nos bivalves muito
reduzido (Fig. 7). A cada lado do ventrculo temos uma aurcula formada por finssima membrana, que recebe o sangue (hemolinfa) oxigenado oriundo do vaso eferente branquial que drena
as brnquias. O ventrculo envolve o reto (intestino posterior) que tambm penetra na cavidade do
pericrdio. Na frente do ventrculo encontra-se o
bulbo artico que recebe a aorta anterior.


2.3.4. Sistema excretor


Formado por dois nefrdios muito alongados situados na massa visceral, acima da base
dorsal das brnquias. Cada nefrdio se conecta
com a cavidade pericrdica e desemboca no canal
suprabranquial atravs de um nefridiporo ladeado por uma fina papila urinria que se localiza
na base posterior da papila genital. A glndula
pericrdica tambm est associada ao sistema excretor. lobulada e est conectada s aurculas.

2.3.5. Sistema nervoso


Formado por gnglios, conetivos e nervos
conforme o padro geral dos bivalves. Um par
de gnglios cerebrais est localizado nos lados
do esfago, e esto conectados ao estatocisto;
um par de gnglios pediosos muito prximos no
plano mediano do p e um par visceral na base
ventral do msculo adutor posterior.



Encontra-se na massa visceral e no me-
2.3.3. Sistema reprodutor


sossoma (Fig. 7), porm a maior parte das gnadas est no interior do manto. O mesossoma
uma bolsa de contorno arredondado situado
de cada lado da massa visceral, entre o p e o

68

msculo adutor posterior. Os folculos femininos, quando maduros, so amarelados. Os machos, de cor cinza claro. As gnadas de cada
lado do animal conectam-se com ductos que levam ao gonporo que apresenta papila genital.
Esta se localiza na cavidade suprabranquial.

3. Morfologia externa e interna


de Corbicula fluminea
(Mller, 1774)

3.1. Morfologia externa

A concha de Corbicula fluminea (Figs. 8,

Figura 7: Vista esquemtica dos principais rgos da massa visceral do


mexilho-dourado: nus (A), abertura
p-bisso (APB), aurcula (AU), bisso (BI),
boca (BO), demibrnquia externa (DBE),
demibrnquia interna (DBI), divertculo
digestivo (DD), estmago (E), esfago
(ES), gnadas (G), intestino anterior
(IA), intestino mdio (IM), intestino
terminal ou reto (IT), msculo adutor
anterior (MAA), msculo adutor posterior (MAP), membrana branquial (MB),
mesossoma (ME), p (P), palpos labiais
(PL), pericrdio (PR), rim (R), sifo exalante (SE), sifo inalante (SI), ventrculo
(V) (Desenho: M.C.D. Mansur).

CAPTULO 4
Seo 2

Figura 8. Concha de Corbicula fluminea (Mller 1774): vista


externa da valva esquerda (em baixo) e vista interna da valva
direita (acima) (Foto: M.C.D. Mansur).

9, 10) formada por duas valvas iguais de contorno triangular quase equiltero com a regio
posterior projetada formando o rostro. O comprimento varia de 2 cm a 4,8 cm, excepcionalmente mais de 5 cm. A forma da concha lembra
a de um berbigo marinho. bastante robusta
e vista de frente tem o contorno de um corao.
Todas as margens so regularmente arredondadas com exceo da posterior, que forma o
rostro cuja aresta posterior situa-se bem abaixo da impresso do msculo adutor posterior
(Ituarte, 1994). Os umbos situam-se na regio
dorsal, quase na metade do comprimento, e so
bem salientes inflados e afilados no bico (Fig.
10). A superfcie externa ripada por estrias ou
ondulaes comarginais (paralelas margem
so como estrias que acompanham a orientao da borda ou margem ventral) relativamente
espaadas, uma por milmetro (Mansur et al.,
2009) e recoberta por uma pelcula conhecida pelo nome de peristraco que liso, fino,
translcido, levemente amarelado, esverdeado
ou, castanho claro e brilhante. Em reas de
maior dinamismo da gua, a espcie costuma
apresentar menor altura, colorao escura, sem
brilho e muito erodida na rea umbonal, ficando mostra a camada subjacente da concha
que branca e calcria. Abaixo do peristraco,
a estrutura interna da concha composta por
vrias camadas de prismas que se organizam
de forma oblqua e cruzada conferindo muita
resistncia concha (Mansur & Meier-Brook,
2000). Este tipo de organizao se denomina
porcelanizada e particular dos bivalves da
ordem Veneroida onde se enquadram todos
os representantes da famlia Corbiculidae e a
maioria dos bivalves marinhos como berbiges,
mariscos brancos, maambiques e outros.


Dorsalmente e logo atrs dos umbos, as
duas valvas esto unidas pelo ligamento que
curto e saliente (Figs. 9, 10). Este compreende
uma formao protuberante, de aspecto crneo, composto de protena elstica.

Por dentro da valva (Fig. 10) e abaixo do
ligamento, as valvas apresentam uma superfcie
de articulao, mais ou menos reforada, denominada charneira. Esta tambm auxilia na
unio das valvas pela presena de dentes que
funcionam como uma engrenagem. Os dentes
cardinais so curtos, dispostos radialmente e
centralizados logo abaixo dos umbos, em nmero de trs em cada valva. Os dentes laterais
so alongados para frente e para trs dos umbos e apresentam as superfcies serreadas. A
charneira direita apresenta dois dentes laterais
anteriores e dois dentes laterais posteriores.
esquerda, apresenta apenas um dente lateral
alongado anterior e um posterior. Por dentro,
a cor branca ou levemente amarelada e sem
brilho no centro, com a borda abaixo da linha
palial, arroxeada ou marrom, com certo brilho. Na superfcie interna das valvas veem-se
ainda duas demarcaes arredondadas: a impresso do msculo adutor anterior e a impresso do msculo adutor posterior e uma linha
que une estas duas impresses paralela borda
ventral, ou seja, a linha palial. Nesta espcie,
como tambm nas outras corbculas invasoras,
esta linha ntegra, ou seja, sem a reentrncia
denominada sinus que comum nas espcies
nativas da mesma famlia, como Cyanocyclas
limosa (Ver Captulos 5 e 6).

Em reas de maior correnteza da gua
ou batimento de ondas provocadas pelo vento,
a espcie costuma apresentar-se muito erodida
na rea umbonal, menor altura, colorao escura e sem brilho, em relao s populaes de
guas mais calmas. Este fenmeno, estudado
e ilustrado por Ituarte (1994), tambm ocorre
com as demais espcies de Corbicula e mesmo
com as nativas Cyanocyclas.
3.2. Morfologia interna

Para observar as partes moles da Corbicula necessrio descolar da concha os dois
msculos adutores com um bisturi (Fig. 11).
Como as valvas e os adutores so muito robustos, muito difcil abrir a concha sem que-

69

Bivalves invasores lmnicos: morfologia comparada de


Limnoperna fortunei e espcies de Corbicula spp.
M.C.D. Mansur

Figura 9 e 10. 9, Vista externa esquemtica da valva esquerda da corbcula asitica Corbicula fluminea (Mller 1774), (Modificado de FOX, 2006b, por M.C.D. Mansur). 10, Vista interna esquemtica da valva direita de Corbicula fluminea (Modificado de
Fox, 2006b, por M.C.D. Mansur).

70

brar o bisturi. Assim recomenda-se anestesiar


os moluscos dentro de um pote pequeno com
gua natural, cobrindo-os o suficiente para que
e gua mal ultrapasse o nvel do animal. Sobre
a superfcie da gua, espalhar cristais de mentol at fechar a superfcie. Levar o pote parte inferior do refrigerador e esperar 48 horas.
Quando as valvas estiverem entreabertas e o p
no reagir ao toque, momento de observar o
corpo do animal, cortando os adutores e afastando as valvas. As valvas ainda ficam unidas
dorsalmente pelo ligamento.
O corpo coberto pelo manto de tecido
bastante fino e delicado. Este rgo apresenta dois lobos muito achatados que produzem a
concha pela superfcie externa e pelas bordas
livres. As bordas destes lobos esto unidas dorsalmente, acima e abaixo dos sifes exalante e
inalante, e separadas anteroventralmente junto
abertura do p. Atravs desta abertura, o p
se distende para cavar e enterrar o animal no
sedimento.

Junto borda livre de cada lobo do manto existem as trs pregas comuns aos demais
bivalves e com as mesmas funes sensitivas e
de formao das camadas da concha. Segundo Martins et al. (2006), a prega mediana
apresenta papilas distribudas desde a regio
posterior, que diminuem progressivamente de
tamanho at finalizarem prximo da regio
anterior; o manto de exemplares fixados de C.
fluminea apresenta uma colorao branca, de
aspecto leitoso o que contrasta com o manto
branco, translcido das outras duas espcies,
C. largillierti e C. fluminalis.

Como na maioria dos bivalves, o corpo

da Corbicula esta dividido numa massa visceral


compacta na parte dorsal e a cavidade do manto na regio ventral.

3.2.1. rgos da cavidade do manto


Afastando os lobos do manto e cortando
as unies acima e abaixo dos sifes exalante
e inalante, podemos visualizar a cavidade do
manto ou palial (Fig. 11). Nesta cavidade esto
expostos: o p central e nas laterais, as brnquias e os palpos labiais. Na regio posterior,
os sifes curtos e fechados apresentam bordas
ladeadas por tentculos dispostos em duas fileiras: uma de tentculos filtradores e a outra
de tentculos sensoriais, conforme Britton
& Morton (1982); Mansur & Meier-Brook
(2000) e Martins et al. (2006). Segundo os ltimos autores C. fluminea apresenta um denso
anel de pigmentos ao redor dos sifes inalante
e exalante.

O p volumoso, de perfil arredondado,
mais espesso na borda ventral. Na fase adulta
o p no apresenta glndula bissognica nem
forma fios de bisso. Quando recruta ou muito
jovem, o p produz um fio mucoso e pegajoso que serve para aderi-lo ao substrato ou em
gros de areia, para no ser arrastado pela correnteza. No firme como o fio de bisso do
mexilho-dourado, mas levemente elstico.
Este fio logo desaparece e no mais produzido quando o animal ultrapassa os 5 mm de
comprimento. O p da Corbicula est mais habilitado para enterrar o animal no sedimento
do que para a locomoo. Quando observamos
os bivalves nativos Unionoida rastejarem para

CAPTULO 4
Seo 2

guas mais profundas durante a seca, geralmente a Corbicula caminha para trs em crculos quando tenta fugir do mesmo problema
(Mansur & Meier-Brook, 2000).

Cada brnquia (uma de cada lado) formada por duas demibrquias (Fig. 12). Ao contrrio do mexilho-dourado, a demibrnquia
interna maior e mais ventral e a demibrquia
externa, menor e mais dorsal. As brnquias da
C. fluminea, como a grande parte dos bivalves
tem o filamento como unidade. No entanto, os
filamentos em Corbicula so unidos lateralmente
por tecidos e as lamelas descendente e ascendente
por sua vez tambm conectadas por pontes de
tecidos, formando assim brnquias verdadeiras
ou eulamelibrnquias, bastante reforadas. Segundo Martins et al. (2006) em C. fluminea a
demibrnquia externa atinge a metade da altura da interna. Em relao ao tipo de incubao
predomina e endobranquial, ou seja, a grande
parte dos embries se concentra no marspio da

demibrnquia interna. Esporadicamente so encontrados na externa, mas em geral em pequeno


nmero.

Alm disto, as grandes superfcies ciliadas nas brnquias, tambm tem a funo de
filtrar as partculas alimentcias que so inaladas junto com a corrente branquial atravs da
abertura inalante. Os clios formam correntes
de aceitao e rejeio (Fig. 12). As correntes
de aceitao e que conduzem o alimento para
a regio frontal esto situadas na base dorsal
das duas lamelas descendentes e no sulco ventral presente apenas na borda da demibrnquia
interna. Estas correntes seguem em direo aos
palpos labiais, onde so conduzidas boca. Os
palpos labiais, um par de cada lado da boca,
situados logo atrs do msculo adutor anterior,
so relativamente curtos e o contorno ventral
arredondado. Apresentam superfcies internas
com pregas que orientam e selecionam as partculas que vem das brnquias.

71

Figuras 11 e 12. 11, rgos da cavidade palial de Corbicula fluminea e parcialmente da massa visceral, aps remoo do lobo
esquerdo do manto: nus (A), aurcula (AU), bico (B), borda do manto (BM), boca (BO), cavidade palial (CP), demibrnquia externa (DBE), demibrnquia interna (DBI), divertculo digestivo (DD), dente lateral posterior (DLP), gnadas (G), intestino terminal
(IT), ligamento (L), lobo direito do manto (LDM), msculo adutor anterior (MAA), msculo adutor posterior (MAP), marspio
(MAR), massa visceral (MV), nefrdio (N), p (P), palpos labiais (PL), pericrdio (PR), sifo exalante (SE), sifo inalante (SI), umbo
(U), ventrculo (V). (Modificado de FOX, 2006b, por M.C.D. Mansur). 12, Esquema de um corte frontal da metade esquerda do
animal, com as setas demarcando as correntes de seleo de partculas nas superfcies branquiais e os pontos negros demarcando o direcionamento das partculas via oral: cavidade palial (CP), cmara suprabranquial (CSB), demibrnquia externa (DBE),
demibrnquia interna (DBI), dobras da borda do manto (DBM), eixo central (EC), septos interlamelares (SI), lamela ascendente
(LA), lamela descendente (LD), manto (M), massa visceral (MV), p (P), sulco oral (SO). (Desenho: M.C.D. Mansur).

Bivalves invasores lmnicos: morfologia comparada de


Limnoperna fortunei e espcies de Corbicula spp.
M.C.D. Mansur

72

3.2.2. rgos da massa visceral


O digestrio, com um trato que se inicia
pela boca, com dois palpos labiais de cada lado, o
esfago achatado, um estmago com muitas dobras e aberturas que se comunicam com a glndula digestiva (Mansur & Meier-Brook, 2000),
um saco do estilete cristalino e o intestino, que
depois de formar vrias voltas, atravessa o ventrculo cardaco finalizando junto ao sifo exalante; o sistema circulatrio, com um ventrculo
e duas aurculas laterais contidos no pericrdio; o
sistema excretor, representado por dois nefrdios;
o glandular, com duas glndulas pericrdicas; o
nervoso, formado por gnglios pares, situados no
p, acima do msculo adutor posterior e atrs do
msculo adutor anterior, conectados por nervos;
o sistema reprodutor compreende duas gnadas,
uma de cada lado do animal, formadas por folculos masculinos, femininos e hermafroditas,
que ocupam grande parte da massa visceral. Segundo Martins et al. (2006), as gnadas em C.
fluminea apresentam uma colorao verde acinzentada e, segundo Fox (2006b), correspondem
aos ovrios formados por folculos arborescentes;
s vezes, parte das gnadas apresenta-se de cor
branca brilhante que, segundo o mesmo autor,
correspondem aos testculos.

Os folculos escoam seu contedo por gonodutos que se exteriorizam por um nico poro
de cada lado do animal. Os espermatozoides so
biflagelados e quando maduros formam mrulas
espermticas que so liberadas ao meio ambiente. A fecundao interna, ocorrendo dentro dos
tubos aquferos situados nas brnquias, junto ao
marspio. Como visto acima, as brnquias, alm
da troca gasosa, tambm servem para incubao
dos embries junto a reas especiais situadas nas
demibrnquias internas, denominadas marspios
(ocasionalmente podem ser encontrados embries
fora do marspio, nas demibrnquias externas).

Nos guias para estudos morfolgicos e de
dissecao de Corbicula fluminea oferecidos por
Britton & Morton (1982) e Fox (2006b) podemos
encontrar mais detalhes sobre a anatomia desta
espcie. Estudos morfolgicos foram desenvolvidos por Mansur & Meier-Brook (2000), visando
o relacionamento filogentico das famlias Corbiculidae e Sphaeriidae, mostram dados comparativos da concha e partes moles, distintivos entre a
invasora C. fluminea e a nativa Cyanocyclas limosa. Martins (2004) e Martins et al. (2004, 2006)

trouxeram grande contribuio para a distino


das trs espcies do gnero Corbicula encontradas na bacia do Lago Guaba no Rio Grande do
Sul (C. fluminea, C. largillierti e C. fluminalis),
com base na morfologia da concha e das partes
moles, tais como: aberturas branquiais, brnquias e localizao dos marspios.

4. Morfologia externa e interna de


Corbicula largillierti
(Philippi, 1844)

4.1. Morfologia externa


A concha C. largillierti (Fig. 13) mais
frgil e menor que as outras corbculas citadas
(no passa de 2,5 cm de comprimento), umbos
baixos e arredondados, sem rostro, ondulaes comarginais na superfcie externa, muito finas e justapostas (duas a trs por mm na
parte mediana da concha), peristraco de cor
esverdeada palha ou arroxeada, pouco brilho.
Por dentro, na parte central a cor roxa escura
ou tendendo ao roxo ou cinza, sem brilho, a
borda tambm arroxeada, levemente brilhante
abaixo da linha palial que no apresenta sinus
palial. Facilmente confundida com a nativa
Cyanocyclas, quando vista externamente.

Comparando a concha, Callil & Mansur
(2002) observaram diferenas significativas na
relao entre peso e comprimento das espcies
C. fluminea e C. largillierti coletadas na parte
norte do Pantanal do Mato Grosso. A primeira
apresenta-se relativamente maior em termos de
comprimento e peso que a segunda.

Figura 13. Concha de Corbicula largillierti: vista externa da


valva esquerda (abaixo) e vista interna da valva direita (acima)
(Foto: M.C.D. Mansur).

CAPTULO 4
Seo 2

4.2. Morfologia interna


Considerando os dois sifes de C. largillierti, segundo Martins (2004) e Martins et
al. (2006), apenas o exalante apresenta o anel
externo com pigmentos, havendo uma concentrao maior na regio do diafragma que divide os sifes. Em C. largillierti, os tentculos
no sifo inalante apresentam uma organizao
aparente em trs fileiras desencontradas, sendo
a mais externa tambm de tentculos menores,
assim como observado nas outras duas espcies.

Massa visceral: Em C. largillierti a epiderme de um modo geral bastante translcida e fina, permitindo visualizar as gnadas
que tambm ocupam grande parte da massa
visceral. C. largillierti apresenta a incubao
endobranquial, com as larvas ocupando toda
extenso das demibrnquias internas; as externas so muito curtas no alcanando a metade
da altura das internas (Martins et al., 2006).
Tambm invasiva, mas pouco sabemos sobre a
biologia e o comportamento desta espcie, uma
vez que raros investimentos de pesquisa foram
direcionados a mesma na Amrica do Sul. Esta
espcie no ocorre na Amrica do Norte.

5. Morfologia externa e interna de


Corbicula fluminalis
(Mller, 1774)

5.1. Morfologia externa



A concha de Corbicula fluminalis (Mller, 1774) (Fig. 14) robusta, quase equilateral,
inflada, altura igual ou maior que o comprimento (<3 cm), linhas comarginais semelhantes s de C. fluminea, porm menos espaadas
(uma a cada 0,7 mm) e baixas, charneira muito
arqueada, umbos muito altos e praticamente
centrados (quase na metade do comprimento),
sem rostro, cor mais escura, tendendo ao roxo
forte internamente e o peristraco do castanho
esverdeado ao negro.

5.2. Morfologia interna


Em espcimes de C. fluminalis, os tentculos do sifo inalante esto organizados em

trs ou quatro fileiras, sendo uma fileira externa de tentculos menores e as fileiras mais
internas com tentculos maiores, entremeados
por tentculos de tamanhos intermedirios.
Na base dos sifes no ocorre um segundo
anel externo pigmentado, como descrito para
as outras espcies, C. fluminea e C. largillierti.
Porm, assim como nas outras duas espcies,
apresentam um anel interno de pigmentos localizado junto base dos tentculos do sifo
inalante.
Em C. fluminalis, segundo Martins et
al. (2006), a epiderme bastante translcida e
fina, permitindo igualmente visualizar as gnadas que tambm ocupam grande parte da
massa visceral como em C. largillierti. Quanto
s brnquias, os mesmos autores (op. cit.) constataram que C. fluminalis apresenta incubao branquial nas quatro brnquias, portanto
tetrabranquial, e as demibrnquias externas
atingem a metade da altura das demibrnquias
internas. A altura das demibrnquias externas
coincide com as das C. fluminea.

Korniushin (2004) tambm revisou a espcie quanto aos aspectos da concha, da anatomia interna, tipo de incubao branquial e
caracteres reprodutivos, redefinindo a espcie
com base no estudo de exemplares oriundos da
sia Central, frica e China. Aps estes estudos, o mesmo autor (op. cit.) considerou que a
espcie de Corbicula no incubadora de larvas,
identificada anteriormente por Morton (1982)
como C. fluminalis, apresenta caracteres anatmicos e reprodutivos diferentes e foi por ele reconsiderada como C. cf japonica (Prime, 1864).

Figura 14. Vista externa e interna da concha de Corbicula fluminalis (Mller, 1774). (Foto: M.C.D. Mansur).

73

74

Corbicula

Cyanocyclas

Pisidiu
Sphaerium
Musculium

Eupera
Byssanodonta

Diplodon
Castalia
Triplodon
Paxyodon
Prisodon

Anodontites
Mycetopoda
Mycetopodella
Leila
Haasica
Fossula
Monoconcylaea
Bartlettia

Corbiculidae

Corbiculidae

Sphaeriidae

Sphaeriidae

Hyriidae

Mycetopodidae
Sem ou com
dentes cardinais

Esquisodonte

varivel

varivel

Dentes cardinais e
laterais simples

Dentes cardinais e
laterais simples

Dentes cardinais e
laterais serreados

Dentes cardinais e
laterais serreados

Com septo e
apfise

Simples lisa
sem dentes

Charneira

pequena
ovalada

pequena
ovalada

triangular

triangular

mitiloide

mitiloide

Limnoperna
fortunei

Mytilopsis
lopesi

Forma
concha

Gneros e spp.

Dreissenidae

Caracteres
Famlia

no

no

sim

no

no

no

sim

sim

Bisso
na fase
adulta

eulamelibrnquia

eulamelibrnquia

eulamelibrnquia

eulamelibrnquia

eulamelibrnquia

eulamelibrnquia

eulamelibrnquia

filibrnquia

Tipo de
Brnquia

10

Correntes
aceitao nas
brnquias

6. Quadro comparativo da morfologia do L. fortunei e outras espcies de bivalves lmnicos brasileiros nativos e invasores.

lasdio

gloqudio

veliconcha

veliconcha

veliconcha

veliconcha

veliconha

veliconcha

Tipo de
larva

Marspio at
lasdio e
parasito peixe

Marspio at
gloqudio e
parasito peixe

Em sacos
embrionrios
no marspio
at jovem

No marspio
at jovem

No marspio
at jovem

No marspio
at veliger

Incubado no
marspio at
jovem

No plancton

Ciclo larval

varivel

geralmente
aberta

geralmente
aberta

fechada

desenvolvido

desenvolvido

fechada

fechada

fechada

fechada

aberta

Abertura
inalante

desenvolvido

desenvolvido

desenvolvido

reduzido

reduzido

Bivalves invasores lmnicos: morfologia comparada de


Limnoperna fortunei e espcies de Corbicula spp.
M.C.D. Mansur

CAPTULO 5
Identificao e diferenciao
dos bivalves lmnicos invasores
dos demais bivalves nativos do Brasil
Daniel Pereira
Maria Cristina Dreher Mansur
Daniel Mansur Pimpo


Com a introduo de espcies de moluscos lmnicos invasores de origem asitica no
Brasil, a busca por mtodos de controle populacional, visando minimizao dos danos
econmicos, tem sido alvo de investimentos
prioritrios pelos setores de gerao de energia
hidreltrica e termoeltrica, bem como de captao e tratamento de gua para abastecimento
pblico. Os programas de controle populacional de espcies de moluscos invasores envolvem
desde mtodos simples, como remoo mecnica, at mtodos mais complexos de controle fsico (UV e Ultrassom), qumico (clorao,
ozonizao, aplicao de sulfato de cobre, etc.)
e biolgico (bactrias malacopatognicas).

A eficcia do controle populacional dos
moluscos invasores requer o conhecimento prvio das caractersticas biolgicas e ecolgicas
da espcie-alvo. E o primeiro passo reconhecer a identidade taxonmica da espcie. Mesmo
sendo as espcies invasoras muito peculiares e
distintas das espcies nativas, a identificao
taxonmica errnea muito comum. Deve-se

considerar que nem sempre o controle realizado por bilogos, pois diferentes profissionais
atuantes na rea de meio ambiente coordenam
atividades em plantas industriais e nos sistemas
naturais nos quais estas esto inseridas.

Alm disso, cada vez mais preocupante
o estado de conservao das espcies nativas de
bivalves lmnicos, que vm sofrendo reduo populacional em decorrncia de diferentes atividades humanas impactantes aos ecossistemas aquticos continentais, so elas: destruio de habitats
marginais, assoreamento, alterao da qualidade
da gua, eutrofizao, barramentos, alteraes
populacionais e das rotas migratrias da ictiofauna, bem como a competio por recursos e habitats com espcies de moluscos lmnicos invasores.

Com base nessas consideraes, tomou-se
a iniciativa de elaborar uma chave dicotmica
para a identificao e diferenciao dos bivalves
invasores introduzidos no Brasil dos bivalves nativos encontrados no pas.

A determinao especfica de espcies de
bivalves de gua doce no uma tarefa fcil.

75

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.


Muitas espcies foram descritas para o
Brasil e o grande nmero de sinnimos um
fato marcante, sendo necessria a reviso taxonmica deste grupo.

Estruturas e orientao da
concha para estudo


As principais estruturas da concha utilizadas na diferenciao de gneros e espcies
de moluscos nativos e invasores encontram-se
discriminadas na Tabela I e na Figura 1.

A orientao da concha para a tomada
de medidas biomtricas para fins de diferenciao estatstica dos gneros e espcies realizada da seguinte forma: toma-se a concha
(Fig. 6A), orientando-se os umbos para cima
e a lnula para frente; o ligamento e o escudo
devem ficar voltados para o observador; assim,
a valva direita ser correspondente ao lado direito do observador e vice-versa; portanto, a
regio anterior estar voltada para frente e a

posterior, voltada para o observador; em caso


de dvidas, observar o ligamento que sempre posterior; para tomar as medidas de uma
concha necessrio visualizar duas linhas bsicas, x e y; aps marcar um ponto central em
cada msculo adutor, unindo-se estes pontos
se obtm a linha x; bipartindo o umbo, a linha
y passa pelo bico, perpendicularmente a linha
x, e finaliza na borda ventral. A largura da
concha (z) tomada com as duas valvas fechadas (Fig. 6B).

Para a diferenciao estatstica de espcies e gneros com base em medidas da concha
a anlise multivariada de discriminantes cannicas (ADC) um dos procedimentos mais utilizados (ver Captulo 6). Pereira et al. (2011a)
diferenciou 11 espcies do gnero Anodontites
com base no comprimento, altura, largura e
posio do umbo. Pimpo et al. (2012) tambm
comparou a morfometria de conchas larvais de
espcies amaznicas de Hyriidae por meio do
uso da ADC.

Tabela I. Termos malacolgicos citados na chave dicotmica.

Termo

76

Definio

Apfise (a)

Projeo aderida ao septo, junto ao compartimento mais interno da cavidade


umbonal, onde se fixa e se sustenta o msculo retrator do p.

Borda da concha

Extremidade marginal das valvas.

Bico (b)

Extremidade, pice da prodissoconcha e umbo. Pode ter direcionamento diferente do umbo (Fig. 1B, D e F).

Bisso (bi)

Filamento orgnico ou conjunto de fios fabricados pela glndula do bisso no


interior do p do animal e serve para fix-lo ao substrato. Presente em Limnoperna fortunei (Fig. 2A), Mytilopsis e Eupera spp.

Borda prismtica (bp)

Extremidade marginal interna das valvas, geralmente de aspecto visivelmente


diferente do restante da superfcie interna das valvas em Mycetopodidae.

Capacete

Prodissoconcha claramente separada e projetada formando uma tampa ou capacete.

Carena (ca)

Salincia externa que parte do umbo em direo a regio pstero-inferior.


Linha longitudinal que marca a troca de inclinao da superfcie externa da
concha (Fig. 1A).

Cavidade Subumbonal (csu)

Reentrncia interna dorsal, sob os umbos (Fig. 1B).

Charneira (c)

Regio de articulao das valvas, situada dorsalmente sob os umbos. Apresenta-se sob diversos aspectos: lisa, estreita espessa, provida de dentes, fossetas ou
lamelas cujas disposies variam muito (Fig. 1B, D e F).

Concha oval

Semelhante a um ovo com dois eixos de simetria.

Concha ovoide

Semelhante a um ovo com um eixo de simetria.

Concha romboide

Semelhante a uma elipse com bordas paralelas como um polgono paralelogramo (com quatro lados iguais e paralelos).

Concha triangular

Semelhante a um tringulo.

Dentes cardinais (dc)

Dentes situados na charneira, logo abaixo dos umbos (Fig. 1D e F).

Dente pseudocardinal anterior (dpa)


e posterior (dpp)

Dentes da charneira de formato irregular, de difcil individualizao e distino


entre eles, em alguns casos. Caractersticos de Hyriidae (Fig. 1B).

Dentes laterais (dl)

Dentes alongados em forma de lamela, situados na frente e atrs dos cardinais


(Fig. 1B, D e F).

CAPTULO 5
Seo 2

Tabela I. Termos malacolgicos citados na chave dicotmica.

Termo

Definio

Equilateral

Quando as valvas so simtricas em relao a um plano vertical que passa pelos


umbos e perpendicular charneira.

Escultura umbonal (eu)

Ornamentao externa da concha em forma de proeminncias. Pode ser radial


(Fig. 1A), concntrica e reticular.

Escudo

Depresso externa achatada na regio posterior delimitada pela carena (Fig.


6B).

Expanso alada

Projeo em forma de asa situada nas extremidades anterior/dorsal ou posterior/dorsal (Fig. 4A).

Fosseta

Cavidade na charneira para o encaixe de dente da valva oposta.

Heterodonte

Tipo de charneira que apresenta dentes cardinais medianos em nmero mximo de trs, com fossetas correspondentes em cada valva e ainda apresentam
antero e posteriormente aos cardinais, dentes laterais alongados (Presente em
Corbiculidae e Sphaeriidae) (Fig. 1D e F).

Impresso dos msculos anteriores (iaa)


e posteriores (iap)

Cicatrizes deixadas na superfcie interna da concha, onde os msculos do animal se fixam na mesma (Fig. 1B, D e F).

Impresso dos msculos adutores

Duas impresses grandes de contorno ovalado; uma situada na regio anterior


e a outra na regio posterior da concha (Fig. 1B, D e F).

Impresso dos msculos dorsais

Impresses pequenas na cavidade umbonal.

Inequilateral

Quando as valvas so assimtricas em relao a um plano vertical que passa


pelo umbo e perpendicular charneira.

Ligamento (l)

Estrutura orgnica que une as duas valvas dorsalmente e fora a abertura das
valvas quando do relaxamento dos msculos adutores. Firme, mas elstica
quando o animal est vivo; quebradia depois do animal morto, com o ressecamento da concha. Geralmente externo (Fig. 1A, B, D e F).

Linhas ou estrias comarginais (ec)

Marcas ou linhas na superfcie externa da concha que delimitam a margem de


um estgio de crescimento. Paralelas margem da valva (Fig. 1A e E).

Linha palial (lp)

Linha paralela aos bordos da margem ventral da concha, deixada pela aderncia
do manto. Liga as duas impresses dos msculos adutores (Fig. 1B, D, F e 3A).

Lnula

Depresso externa pequena na regio anterior logo aps os umbos (Fig. 6B).

Nodosidade

Salincia em forma de ndulo na superfcie externa da concha (Fig. 4B).

P em forma de machado

P tpico de bivalves Unionoida, em forma de lmina de machado (Fig. 5A).

P com extremidade intumescida

P alongado e com a extremidade intumescida, funcionando como uma ncora; no laminar distinto dos demais bivalves (Fig. 5B).

Peristraco

Camada orgnica, fina, que reveste a superfcie externa da concha. Protege as


camadas calcrias da dissoluo pela gua.

Rostro

Projeo da regio posterior da valva, que a torna inequilateral (Fig. 4C).

Prodissoconcha (pc)

Concha embrionria dos bivalves, secretada pela larva e geralmente mantida


nos indivduos adultos (Fig. 1E).

Septo (s)

Projeo que divide a cavidade umbonal de cada valva em dois compartimentos. Nele se fixa e se sustenta o msculo adutor anterior. (Fig. 2B).

Sinus palial ou seio palial (sp)

Reentrncia de linha palial em forma de U ou V invertido, junto a impresso do msculo adutor posterior (Presente em Leila blainvilliana (Fig. 3A, B)
e Neocorbicula).

Umbo (u)

Elevao na regio dorsal de cada valva (Fig. 1A, D, E e F). Quanto a sua localizao podem ser denominados frontais, terminais e subterminais. a regio
mais antiga da concha, geralmente gasta em Unionoida.

Diversidade de bivalves lmnicos


no Brasil: espcies invasoras
e nativas


So conhecidos 22 gneros de bivalves lmnicos para o Brasil, sendo que dois destes esto representados apenas por espcies invasoras

neste pas, so eles: Limnoperna (Mytilidae) e


Corbicula (Corbiculidae). A Tabela II apresenta
um resumo da classificao destes gneros.

A seguir, apresentada a primeira chave
para determinao e diferenciao das espcies
de bivalves lmnicos invasores dos demais bivalves nativos citados para o Brasil.

77

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.


A relao das espcies de moluscos citadas para o Brasil encontra-se discriminada na
Tabela III. So conhecidas 114 espcies de moluscos bivalves lmnicos com registros para o
Brasil, sendo que destas, apenas 5 espcies (4%
das espcies de bivalves lmnicos citados para o
pas) so invasoras (Fig. 7). No entanto, o impacto deste pequeno nmero de espcies inva-

78

soras aliado aos impactos ambientais de origem


antrpica tem contribudo para a diminuio
das populaes das espcies nativas. Dentre os
impactos decorrentes das espcies invasoras
podemos citar a competio por espao, recursos alimentares, bem como pela formao
de macroaglomerados bioincrustantes, quando
considerado o mexilho-dourado.

Figura 1. Estruturas da concha de bivalves lmnicos: 1A, vista externa da valva esquerda e 1B, interna da valva direita de Castalia sp;
1C, vista interna da valva direita de Anodontites patagonicus; 1D, vista interna da valva direita de Corbicula fluminea; 1E, vista externa da valva esquerda de Pisidium sp. e vista interna das valvas esquerda e direita de Pisidium sp. Prodissoconcha (pc); umbo (u); bico
(b); escultura umbonal (eu); carena (ca); declive dorsal (dd); estrias ou linhas comarginais (ec); ligamento (l); cavidade subumbonal
(csu); charneira (c); dente cardinal (dc); dente pseudocardinal anterior (dpa); dente pseudocardinal posterior (dpp); dente lateral (dl);
impresso do msculo adutor anterior (iaa); impresso do msculo adutor posterior (iap); linha palial (lp); borda prismtica (bp).
(Desenho: M.C.D. Mansur).

CAPTULO 5
Seo 2

Figura 2. Concha mitiloide: 2A, fios de bisso (bi) em Limnoperna fortunei; 2B, septo (s) e apfise (ap) em Mytilopsis. Escala: 0,5
cm. (Foto e desenho: M.C.D. Mansur).

Figura 3. Representao da linha palial (lp) e do sinus palial (sp) em conchas do gnero Leila (Unionoida, Mycetopodidae): 3A,
concha com a linha palial demarcada e 3B, no demarcada. A seta indica o sinus palial. Escala: 1 cm. (Fotos: M.C.D. Mansur).

Figura 4. Estruturas da concha: 4A, expanso alada em Hyriidae; 4B, nodosidades sobre o peristraco de Hyriidae; 4C, rostro
em Corbiculidae. Escala: 1 cm. (Fotos: M.C.D. Mansur e D. Pimpo).

79
Figura 5. P de bivalves lmnicos: 4A, p tpico dos bivalves lmnicos, em forma de machado representado por um indivduo do
gnero Leila; 4B, p de com extremidade intumescida, tpico do gnero Mycetopoda (Fotos: M.C.D. Mansur).

Figura 6. Orientao da concha de um bivalve: 6A, borda dorsal, ventral, anterior e posterior; 6B, vista da largura da concha
(z). Posio do umbo (pu) determinada pela distncia entre o bico do umbo e o limite anterior perpendicular linha Y (altura)
(Desenhos: M.C.D. Mansur).

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.

Tabela II. Gneros de bivalves lmnicos nativos e invasores citados para o Brasil.

80

Gneros
Classe BIVALVIA Linn, 1758
Subclasse PTERIOMORPHIA Beurlen, 1944
Ordem MYTILOIDA Frrusac, 1822
Superfamlia Mytiloidea Rafinesque, 1815
Famlia MYTILIDAE Rafinesque, 1815
Subfamlia Mytilinae Rafinesque, 1815
Gnero Limnoperna Rochebrune, 1882
Subclasse PALAEOHETERODONTA Newell, 1965
Ordem UNIONOIDA Stoliczka, 1871
Superfamlia UNIONOIDEA Fleming, 1828
Famlia HYRIIDAE Fleming, 1828
Subfamlia Hyriinae Swainson, 1840
Gnero Diplodon Spix, 1827
Gnero Castalia Lamarck, 1819
Gnero Prisodon Schumacher, 1817
Gnero Paxyodon Schumacher, 1817
Gnero Triplodon Spix, 1827
Superfamlia ETHERIOIDEA
Famlia MYCETOPODIDAE Gray, 1840
Subfamlia Anodontitinae Modell, 1942
Gnero Anodontites Bruguire, 1792
Subgnero Anodontites s.s.
Subgnero Lamproscapha
Subfamlia Mycetopodinae Adams & Adams, 1856
Gnero Mycetopoda Orbigny, 1835
Subfamlia Monocondylaeinae Modell, 1942
Gnero Monocondylaea Orbigny, 1835
Gnero Fossula Lea, 1870
Gnero Haasica Strand, 1932
Gnero Tamsiella Haas, 1931
Subfamlia Leilinae Morretes, 1949
Gnero Leila Gray, 1840
Subfamlia Bartlettiinae
Gnero Bartlettia H. Adams, 1866
Subclasse HETERODONTA Neumayr, 1884
Ordem VENEROIDA Adams & Adams, 1858
Subordem ARCTICINA Newell, 1965
Superfamlia SPHAERIOIDEA Rafinesque, 1820
Famlia SPHAERIIDAE Rafinesque, 1820
Subfamlia Sphaeriinae Baker, 1927
Gnero Musculium Link, 1807
Gnero Sphaerium (Scopoli, 1777)
Gnero Pisidium C. Pfeiffer, 1821
Subfamlia Euperinae Heard, 1965
Gnero Eupera Bourguignat, 1854
Superfamlia CORBICULOIDEA
Famlia CORBICULIDAE Gray, 1847
Gnero Corbicula Megerle Von Mhlfeld, 1811
Gnero Cyanocyclas Blainville, 1818
Gnero Polymesoda Rafinesque, 1828
Superfamlia DREISSENOIDEA
Famlia DREISSENIDAE
Gnero Mytilopsis Conrad, 1857

Origem

Invasor

Nativo
Nativo
Nativo
Nativo
Nativo

Nativo
Nativo
Nativo
Nativo
Nativo
Nativo
Nativo
Nativo
Nativo
Nativo

Nativo
Nativo
Nativo
Nativo

Invasor
Nativo
Nativo

Nativo

CAPTULO 5
Seo 2

Chave para determinao de gneros de bivalves lmnicos: diferenciao entre invasores e nativos

1 cm

1 cm

1 cm

81

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.

1 cm

1 cm

1 cm

1 cm

1 cm

82

1 cm

1 cm

CAPTULO 5
Seo 2

1 cm

1 cm

1 cm

1 cm

1 cm

83
1 cm

0,5 cm

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.

0,5 cm

0,5 cm

3 mm

1 mm

2 mm

84
1 mm

CAPTULO 5
Seo 2

Chave para determinao das espcies do gnero Corbicula

Adaptado de Mansur et al., 2011; Fotos: C.D. de Arajo.


Dentre as famlias mais representativas
em nmero de espcies podemos citar Hyriidae
(52 espcies; 45% das espcies de bivalves lmnicos), Mycetopodidae (32; 28%) e Sphaeriidae
(20; 17%), sendo todas estas espcies representantes da malacofauna nativa (Fig. 8).

Dentre os gneros mais representativos
em nmero de espcies podemos citar Diplodon (37 espcies; 32% das espcies de bivalves
lmnicos), Anodontites (14; 12%), Castalia (11;
10%), Eupera e Pisidium (9; 8%), e Monocondylaea (7; 6%), sendo todas estas espcies representantes da malacofauna nativa (Fig. 9).

O Brasil apresenta oito grandes bacias
hidrogrficas dos rios: 1, Amazonas; 2, Tocantins/Araguaia; 3, do Atlntico Norte/Nordeste;
4, So Francisco; 5, do Atlntico Leste; 6, Paran/Paraguai; 7, Uruguai; e 8, bacia do Atlntico Sul/Sudeste (Fig. 10). O maior nmero de
espcies verificado nas bacias: Paran/Paraguai (51 espcies; 22% das espcies de bivalves
lmnicos citados para o Brasil), Atlntico Sul/
Sudeste (43; 18%), Uruguai (42; 18%) e Amazonas (40; 17%) (Fig. 11). No entanto, esses
nmeros podem no representar a diversidade
real destas bacias, j que as bacias Amazonas,
Atlntico Norte/Nordeste, Atlntico Leste, To-

cantins/Araguaia e So Francisco carecem de


coletas e inventrios malacofaunsticos.

Das 114 espcies citadas para o Brasil,
45 carecem de reviso taxonmica (35% das
espcies citadas). As maiores dificuldades so
verificadas quanto identidade taxonmica
das espcies do gnero Diplodon que apresentam ampla variao morfolgica. A falta de

85

Figura 7. Nmero e percentual de espcies de moluscos bivalves lmnicos nativos e invasores citadas para o Brasil.

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.

Figura 8. Nmero e percentual de espcies de moluscos bivalves lmnicos conhecidos para as famlias citadas para o Brasil.

86

Figura 9. Nmero e percentual de espcies de moluscos bivalves lmnicos conhecidos para os gneros citados para o Brasil.

CAPTULO 5
Seo 2

conhecimento da real identidade taxonmica


das espcies um agravante no que diz respeito conservao, sendo que algumas espcies
constam em listas vermelhas. Apenas 1% das
espcies citadas para o Brasil est enquadrada
na categoria Criticamente Em Perigo (CEP) na
lista vermelha brasileira de espcies ameaadas; 11%, na categoria Em Perigo (EP) e 9% em
Vulnervel (VU) (Fig. 12). As demais espcies
no constam em listas, mas isso no significa
que no estejam ameaadas, pois as listas no
foram revisadas desde suas publicaes. Alm
disso, muitas destas espcies tm sofrido ameaas considerveis, destacando-se a construo
de novas barragens, assoreamento, desmatamento, destruio de habitats, poluio e a
ampliao da disperso das espcies de bivalves invasoras. Desta forma, 46 espcies (40,3%
das espcies de bivalves lmnicos citadas para
o Brasil) so sugeridas como candidatas avaliao criteriosa em nova reviso da lista de espcies ameaadas da fauna brasileira (Tab. III).

As demais espcies carecem de dados e, assim


como as espcies candidatas, devero ser alvo
de pesquisas quanto aos seus nveis populacionais, preferncias ambientais e distribuio geogrfica atual no pas.

Considerando dados histricos da malacofauna lmnica do estado de So Paulo
(Ihering, 1893; Vaz et al., 1983, 1985, 1986b,
1987, 1992; Teles et al., 1991; Frana et al.,
2007; Suriani et al., 2007) e o diagnstico
apresentado no Captulo 19 para a bacia do
Rio Tiet, alm de registros de colees de
museus, possvel estabelecer uma cronologia, a qual ilustra a diminuio da riqueza de
moluscos bivalves lmnicos ao longo dos anos
na bacia do Rio Tiet (Fig. 13). Cabe ressaltar
que a construo das barragens situadas nesta bacia ocorreu no perodo da ditadura militar. Naquela poca, o licenciamento ambiental de empreendimentos hidreltricos era um
processo novo no pas, carecendo de estudos
criteriosos sobre a biota aqutica e do estabe-

Figura 10. Bacias hidrogrficas do Brasil. Fonte: ANA


(http://www.aneel.gov.br/
area.cfm?id_area=104).

87

Figura 11. Nmero e percentual de espcies de


moluscos bivalves lmnicos citados nas bacias hidrogrficas do Brasil.

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.

Figura 12. Conservao das espcies


de bivalves lmnicos citados nas bacias
hidrogrficas do Brasil. Status de conservao das espcies presentes em
listas vermelhas de espcies ameaadas: criticamente em perigo (CEP), em
perigo (EP), vulnervel (VU). Espcies
candidatas lista de espcies ameaadas de extino do Brasil (CL) que devero ser avaliadas por meio de critrios
apropriados; espcies desconhecidas
(D) quanto a quaisquer aspectos da sua
conservao.

Figura 13. Diversidade histrica de bivalves lmnicos na bacia do Rio Tiet com base em reviso bibliogrfica.

88

lecimento de medidas mitigatrias e compensatrias eficazes para promover a conservao


da fauna bentnica, em especial os moluscos
bivalves de gua doce. Alm disso, a introduo das espcies invasoras somou outro impacto sobre as espcies nativas, competindo
por espao e recursos alimentares.

Tambm importante considerar as estratgias reprodutivas diferenciadas entre as

espcies de bivalves lmnicos invasores, desenvolvimento direto no plncton, e dos nativos,


que em grande parte indireto, utilizando os
peixes como vetores e dispersores (ver Captulo 6). As espcies que utilizam os peixes como
vetores e dispersores tem relao estreita com a
ictiofauna e o plano de aes estratgicas para
a conservao destes moluscos deve considerar
a conservao das espcies de peixes vetores.

CAPTULO 5
Seo 2

No entanto, a maioria dos vetores desconhecida, o que demonstra a carncia de dados que
possam dar suporte conservao de muitas
espcies de moluscos bivalves. A construo de
barragens, alm de provocar uma alterao ambiental ao transformar um rio em lago, muitas
vezes afeta a estrutura da ictiofauna (composio e abundncia de peixes), alm de suas rotas

migratrias. Portanto, de extrema importncia a pesquisa cientfica sobre a relao larva


gloqudio e ou lasdio com o peixe vetor e dispersor, visando descrever detalhadamente o ciclo parasitrio no peixe e o desenvolvimento da
larva do bivalve at sua fase adulta bentnica,
bem como a importncia das rotas migratrias
de peixes na disperso desses moluscos.

Tabela III. Espcies de bivalves lmnicos citados para as bacias hidrogrficas do Brasil com base principalmente nas seguintes
obras: Haas (1969); Ihering (1890, 1893, 1910); Ituarte & Mansur (1993); Mansur et al. (1987, 1988, 1991, 1994, 2008a, 2011a);
Mansur & Meier-Brook (2000); Mansur & Pereira (2006); Mansur & Silva (1990); Mansur & Valer (1992); Ortmann (1921); Pereira
et al. (2000a); Pimpo et al. (2008, 2012); Pimpo & Mansur (2009), Simone (2006), Scarabino & Mansur (2007), alm do exame
de colees cientficas. Status (S) de conservao das espcies: vulnervel (VU), em perigo (EP), criticamente em perigo (CEP),
conforme Amaral et al (2008). Candidata lista de espcies ameaadas de extino do Brasil (CL), espcies as quais so desconhecidas (D) quanto a quaisquer aspectos quanto a sua conservao *carece de reviso taxonmica.

Famlia/Gnero

Espcie

Bacias Hidrogrficas

Ameaas

Limnoperna fortunei
(Dunker, 1857)

Paran/Paraguai, Uruguai
e Atlntico Sul/Sudeste.

Mytilidae
Lymnoperna
Rochebrune, 1882
Mycetopodidae
Anodontites
Bruguire, 1792

Anodontites (A.) crispatus Amazonas, Paran/Paraguai,


Atlntico Norte/Nordeste.
Bruguire, 1792*
Anodontites (A.) elongatus
(Swainson, 1823)

Amazonas, Paran/
Paraguai, Uruguai.

Anodontites (L.)
ensiformis (Spix, 1827)

Amazonas, Tocantins/
Araguaia, Paran/
Paraguai, Uruguai.

Anodontites (A.)
ferrarisi (Orbigny, 1835)

Uruguai.

Anodontites (A.)
iheringi (Clessin, 1882)*

Atlntico Sul/Sudeste.

Anodontites (A.) lucidus


(Orbigny, 1835)

Uruguai, Atlntico
Sul/Sudeste.

Anodontites (A.)
moricandi (Lea, 1860)*

So Francisco.

Anodontites (A.) obtusus


(Lamarck, 1819)*

So Francisco, Atlntico
Norte/Nordeste.

Anodontites (A.)
patagonicus
(Lamarck, 1819)*
Anodontites (A.)
schombergianus
(Sowerby, 1870)*
Anodontites (A.)
soleniformis
(Lamarck, 1819)*
Anodontites (A.)
tenebricosus
(Lea, 1834)*
Anodontites (A.)
trapesialis
(Lea, 1860)

Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.
Amazonas e Tocantins/
Araguaia.
Amazonas, So Francisco,
Paran/Paraguai.
Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.
Amazonas, Tocantins/
Araguaia, Atlntico Norte/
Nordeste, So Francisco,
Atlntico Leste, Paran/
Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Assoreamento, eroso marginal,


poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso
marginal e poluio.

CL
VU
VU
EP
EP
CL
CL
CL
D
CL
VU
VU

VU

89

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.

Tabela III. Continua...

Famlia/Gnero

Espcie

Bacias Hidrogrficas

Ameaas

Anodontites (A.)
trapezeus (Spix, 1827)

Amazonas, Tocantins/
Araguaia, So Francisco,
Atlntico Leste, Paran/
Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Assoreamento, eroso
marginal e poluio.

EP

Mycetopoda
Orbigny, 1835

Mycetopoda legumen
(Martens, 1888)

Uruguai, Atlntico
Sul/Sudeste.

Eroso marginal, poluio,


barramento e barreiras piracema.

VU

Mycetopoda siliquosa
(Spix, 1827)

Amazonas, Tocantins/
Araguaia, Atlntico Norte/
Nordeste, So Francisco,
Atlntico Leste, Paran/
Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Eroso marginal, poluio,


barramento e barreiras piracema.

VU

Mycetopoda soleniformis
Orbigny, 1835

Paran/Paraguai, Uruguai.

Eroso marginal, poluio,


barramento e barreiras piracema.

CL

Mycetopodella
Marshall, 1927

Mycetopodella falcata
(Higgins, 1868)

Amazonas.

Eroso marginal, poluio,


barramento e barreiras piracema.

CL

Monocondylaea
Orbigny 1835

Monocondylaea
corrientesensis
Orbigny, 1834

Paran/Paraguai, Uruguai.

Monocondylaea costulata
Moricand, 1858

Amazonas, Tocantins/
Araguaia.

Monocondylaea
franciscana
(Moricand, 1837)

So Francisco.

Monocondylaea jaspidea
Hup, 1857

Amazonas, Tocantins/
Araguaia.

Monocondylaea minuana
Orbigny, 1835

Uruguai, Atlntico
Sul/Sudeste.

Monocondylaea
paraguayana
Orbigny, 1835

Paran/Paraguai.

Monocondylaea parchappi
Orbigny, 1835

Paran/Paraguai.

Fossula
Lea, 1870

Fossula fossiculifera
(Orbigny, 1835)

So Francisco,
Atlntico Leste, Paran/
Paraguai, Uruguai.

Tamsiella
Haas, 1931

Tamsiella amazonica
Bonetto, 1972*

Amazonas.

Tamsiella schroeteriana
(Lea, 1852)*

Amazonas.

Haasica
Strand, 1931

Haasica balzani
(Ihering, 1893)

Paran/Paraguai.

Leila
Gray, 1838

Leila blainvilliana
(Lea, 1834)

Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Leila esula
(Orbigny, 1835)

Amazonas, Tocantins/
Araguaia.

Bartlettia
H. Adams 1866

Bartlettia stefanensis
Moricand, 1856

Paran/Paraguai.

Mycetopodidae

90

Hyriidae

Assoreamento, eroso marginal,


poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e barreiras
piracema e espcies invasoras.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio e barramento.
-

CL
CL
CL
CL
D
VU
CL
EP
CL
CL
CL
EP
VU
VU

CAPTULO 5
Seo 2

Tabela III. Continua...

Famlia/Gnero

Espcie

Bacias Hidrogrficas

Hyriidae

Ameaas

Diplodon
Spix, 1827

Diplodon (D.) aethipos


(Lea, 1860)

Uruguai, Atlntico
Sul/Sudeste.

Diplodon (D.) berthae


Ortman, 1921

Uruguai, Atlntico
Sul/Sudeste.

Diplodon (D.) besckeanus


(Dunker, 1848)

Atlntico Leste.

Assoreamento, eroso
marginal e poluio.

CL

Diplodon (D.) caipira


(Ihering1893)*

Paran/Paraguai.

EP

Diplodon (D.) delodontus


(Lamarck, 1919)*

Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Diplodon (D.) dunkerianus


(Lea, 1956)*

Atlntico Leste.

Assoreamento, eroso
marginal e poluio.

EP

Assoreamento, eroso
marginal e poluio.

VU

So Francisco, Atlntico
Leste, Atlntico Sul/
Sudeste (?)
Paran/Paraguai, Atlntico
Diplodon (D.) expansus
Leste, Atlntico Sul/Sudeste (?).
(Kster, 1856)*
Diplodon (D.) ellipticus
(Wagner, 1827)*

Diplodon (D.) rhombeus


(Spix, 1827)*

So Francisco, Paran/
Paraguai.

Diplodon (D.) granosus


(Bruguire, 1792)*

Atlntico Leste,
Atlntico Sul/Sudeste.

Diplodon (D.) imitator


Ortman, 1921*

Atlntico Sul/Sudeste.

Diplodon (D.) martensi


(Ihering, 1893)*

Atlntico Leste, Uruguai,


Atlntico Sul/Sudeste.

Diplodon (D.) multistratus


(Lea, 1834)*

Atlntico Leste,
Atlntico Sul/Sudeste.

Diplodon (D.) obsolescens


(Baker, 1913)
Diplodon (D.)
parallelopipedon
(Lea, 1834)
Diplodon (D.) parodizi
Bonetto, 1960

Amazonas.

Paran/Paraguai, Uruguai.

Paran/Paraguai, Uruguai.

Diplodon (D.) paulista


(Ihering, 1893)*

Paran/Paraguai.

Diplodon (D.) piceus


(Lea, 1860)

Uruguai.

Diplodon (D.) rhuacoicus


(Orbigny, 1835)*

Uruguai, Atlntico
Sul/Sudeste.

Diplodon (D.) suavidicus


(Lea, 1856)

Amazonas.

Diplodon (D.) vicarius


Ortmann, 1821*

Paran/Paraguai.

Uruguai, Atlntico
Sul/Sudeste.

Paran/Paraguai, Uruguai.

Assoreamento, eroso marginal,


poluio e barramento.

CL

Uruguai, Atlntico
Sul/Sudeste.

Atlntico Sul/Sudeste.

Diplodon (D.) wynami


(Lea, 1860)*
Diplodon (R.)
burroughianus
(Lea, 1834)
Diplodon (R.) charruanus
Orbigny, 1835*
Diplodon (R.) deceptus
Simpson, 1914 sensu
Ortmann, 1921

91

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.

Tabela III. Continua...

Famlia/Gnero

Espcie

Bacias Hidrogrficas

Hyriidae

Diplodon (R.) funebralis


(Lea, 1860)*

So Francisco, Paran/
Paraguai.

Diplodon (R.) koseritzi


(Clessin, 1882)

Atlntico Sul/Sudeste.

Diplodon (R.) hildae


Ortman, 1921

Atlntico Sul/Sudeste.

Diplodon (R.) hylaeus


(Orbigny, 1835)

Amazonas, Tocantins/
Araguaia e Paran/
Paraguai (?).

Assoreamento, eroso marginal


e poluio, barramento.

CL

92

Ameaas

Diplodon (R.) iheringi


Atlntico Sul/Sudeste.
(Simpson, 1900)
Diplodon (R.) peraeformis
Uruguai.
(Lea, 1860)
Diplodon fontainianus
Paran/Paraguai.
(Orbigny, 1835)*
Diplodon greeffeanus
Paran/Paraguai.
Ihering, 1893*
Diplodon pfeifferi
Atlntico Leste.
(Dunker, 1848)
Diplodon paranensis
Paran/Paraguai.
(Lea, 1834)*
Tocantins/Araguaia, So
Diplodon rotundus
Francisco e Paran/Paraguai.
Wagner, 1827*
Diplodon uruguayensis
Uruguai.
(Lea, 1860)*

Castalia
Lamarck, 1819

Castalia ambigua
Orbigny, 1835*

Amazonas e Paran/
Paraguai.

Castalia duprei
(Rcluz, 1842)

Tocantins/Araguaia.

Castalia inflata
Orbigny, 1835

Amazonas, Paran/Paraguai.

Castalia martensi
(Ihering, 1891)

Uruguai, Atlntico
Sul/Sudeste.

Castalia nehiringi
(Ihering, 1893)

Paran/Paraguai.

Castalia orbignyi
(Deville & Hup, 1850)

Amazonas.

Castalia psammoica
(Orbigny, 1835)

Uruguai.

Castalia quadrata
(Sowerby, 1869)*

Amazonas.

Castalia schombergiana
Sowerby, 1869*

Amazonas.

Castalia sulcata
(Krauss, 1849)*

Amazonas.

Castalia undosa
Martens, 1885

Paran/Paraguai.

Paxyodon
Schumacher, 1817

Paxyodon
syrmathophorus
(Meuschen, 1781)

Amazonas, Tocantins/
Araguaia.

Assoreamento, eroso marginal


e poluio, barramento.
Assoreamento, eroso marginal
e poluio, barramento e
espcies invasoras.

Assoreamento, eroso marginal


e poluio, barramento.
Assoreamento, eroso marginal
e poluio, barramento.
Assoreamento, eroso marginal,
poluio, barramento.

Assoreamento, eroso marginal,


poluio, barramento.
Assoreamento, eroso marginal,
poluio, barramento.
Assoreamento, eroso marginal,
poluio, barramento.
Assoreamento, eroso marginal,
poluio, barramento.
Assoreamento, eroso marginal,
poluio, barramento, barreiras
piracema e explotao.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e barreiras
piracema e espcies invasoras.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento e
barreiras piracema.
Assoreamento, eroso marginal,
poluio, barramento, barreiras
piracema e explotao.

CL
CEP

EP
CL
EP

EP
CL
EP
CL
CL
CL
CL
CL
CL
CL
CL
CL
CL
CL
EP
CL

CAPTULO 5
Seo 2

Tabela III. Continua...

Famlia/Gnero

Espcie

Bacias Hidrogrficas

Hyriidae

Ameaas

Assoreamento, eroso marginal,


poluio, barramento, barreiras
piracema e explotao.
Assoreamento, eroso marginal,
poluio, barramento, barreiras
piracema e explotao.

Prisodon
Schumacher, 1817

Prisodon obliquus
Schumacher, 1817*

Amazonas, Tocantins/
Araguaia.

Triplodon
Spix, 1827

Triplodon corrugatus
(Lamarck, 1819)

Amazonas, Tocantins/
Araguaia.

Triplodon chodo
Mansur &
Pimpo, 2008

Amazonas.

Poluio e espcies invasoras.

CL

Mytilopsis lopesi
Alvarenga & Ricci, 1989

Amazonas, Tocantins/
Araguaia.

Assoreamento, eroso
marginal, poluio, barramento
e espcies invasoras.

CL

CL
CL

Dreissenidae
Mytilopsis
Conrrad, 1858
Corbiculidae
Cyanocyclas
Blainville, 1818

Corbicula Megerle
Von Mhlfeld, 1811

Cyanocyclas amazonica
(Prime, 1870)*

Amazonas.

Cyanocyclas brasiliana
(Deshayes, 1854)*

Amazonas.

Cyanocyclas limosa
(Maton, 1809)*

Paran/Paraguai, Uruguai.

Assoreamento, eroso marginal,


poluio e espcies invasoras.

CL

Cyanocyclas paranensis
(dOrbigny, 1835)*

Paran/Paraguai.

Assoreamento, eroso marginal,


poluio e espcies invasoras.

CL

Corbicula fluminalis
(Mller, 1774)

Atlntico Sul/Sudeste.

Corbicula fluminea
(Mller, 1774)

Polymesoda
Rafinesque, 1828

Corbicula largillierti
(Philippi, 1844)

Amazonas, Tocantins/
Araguaia, Atlntico Norte/
Nordeste, So Francisco,
Atlntico Leste, Paran/
Paraguai, Uruguai,
Atlntico Sul/Sudeste.
Tocantins/Araguaia,
Atlntico Norte/
Nordeste, So Francisco,
Atlntico Leste, Paran/
Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Corbicula sp.*

Atlntico Sul/Sudeste.

Polymesoda sp.*

Amazonas, Atlntico
Norte/Nordeste.

Atlntico Sul/Sudeste.

Poluio, drenagem de banhados


e remoo de macrfitas.

Uruguai, Atlntico
Sul/Sudeste.

Poluio, drenagem de banhados


e remoo de macrfitas.

Paran/Paraguai.

Poluio, drenagem de banhados


e remoo de macrfitas.

Uruguai.

Poluio, drenagem de banhados


e remoo de macrfitas.

Eupera bahiensis
(Spix & Wagner, 1827)

Atlntico Leste.

Poluio, drenagem de banhados


e remoo de macrfitas.

Eupera tumida
(Clessin, 1879)

Amazonas, So Francisco,
Atlntico Leste,
Paran/Paraguai.

Poluio, drenagem de banhados


e remoo de macrfitas.

Sphaeridae
Eupera
Bourguignat, 1854

Eupera klappenbachi
Mansur &
Veitenheimer, 1975
Eupera platensis
Doello-Jurado, 1921
Eupera elliptica
Ituarte & DreherMansur, 1993
Eupera doellojuradoi
Klappenbach, 1962

93

Identificao e diferenciao dos bivalves lmnicos


invasores dos demais bivalves nativos do Brasil
Pereira et al.

Tabela III. Continua...

Famlia/Gnero

Espcie

Bacias Hidrogrficas

Sphaeridae

Eupera simoni
(Jousseaume, 1889)

Amazonas, Paran/Paraguai.

Poluio, drenagem de banhados


e remoo de macrfitas.

Eupera guaraniana
Ituarte, 1994

Uruguai, Atlntico
Sul/Sudeste.

Poluio, drenagem de banhados


e remoo de macrfitas.

Paran/Paraguai.

Poluio, drenagem de banhados


e remoo de macrfitas.

Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Poluio e drenagem de banhados.

Musculium
Link, 1807

Eupera iguazuensis
Ituarte, 1989
Sphaerium cambaraense
Mansur, Meier-Brook
& Ituarte, 2008
Musculium argentinum
(DOrbigny, 1835)

Uruguai, Atlntico
Sul/Sudeste.

Poluio e drenagem de banhados.

Pisidium C.
Pfeiffer, 1821

Pisidium vile
Pilsbry, 1897

Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Poluio e drenagem de banhados.

Pisidium dorbignyi
Clessin, 1879

Poluio e drenagem de banhados.

Poluio e drenagem de banhados.

Poluio e drenagem de banhados.

Pisidium taraguyense
Ituarte, 2000

Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.
Amazonas, Paran/
Paraguai, Uruguai,
Atlntico Sul/Sudeste.
Amazonas, Tocantins/
Araguaia, So Francisco,
Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.
Paran/Paraguai, Uruguai,
Atlntico Sul/Sudeste.

Poluio e drenagem de banhados.

Pisidium forense
Meier Brook, 1967

Paran/Paraguai,
Atlntico Sul/Sudeste.

Poluio e drenagem de banhados.

Pisidium globulus*

Atlntico Sul/Sudeste.

Poluio e drenagem de banhados.

Pisidium bejumae
H.B. Baker, 1930*

Amazonas.

Poluio e drenagem de banhados.

Pisidium boliviense
Sturany, 1900*

Amazonas.

Poluio e drenagem de banhados.

Sphaerium
(Scopoli, 1777)

Pisidium sterkianum
Pilsbry, 1897
Pisidium punctiferum
(Guppy, 1867)*

Recomendaes

94

Ameaas


Abaixo so listadas algumas aes prioritrias necessrias para minimizar os efeitos das espcies invasoras sobre as espcies nativas, assim como
aes complementares visando conservao dos
bivalves nativos por meio da induo de projetos
de pesquisa (bsica e aplicada) e da apropriao dos
dados gerados pelos gestores que atuam em rgos
ambientais, responsveis pela conservao da biodiversidade e licenciamento ambiental no pas.

Os temas prioritrios de pesquisa so: impacto das espcies de bivalves lmnicos invasores
sobre os bivalves nativos; estudo morfolgico das
espcies nativas e invasoras visando elaborao
de chaves e catlogos; mapeamento das espcies
nativas de bivalves citadas para o Brasil, especialmente nas bacias subamostradas; descrio
do ciclo de desenvolvimento dos bivalves nativos
e reconhecimento das espcies de peixes vetores

e dispersores das larvas destes moluscos; relao


das rotas migratrias de peixes vetores com a disperso de bivalves lmnicos; criao de espcies de
bivalves lmnicos para repovoamento de reas com
declnio das populaes das mesmas; avaliao do
impacto da construo de reservatrios em srie
(cascata) sobre a distribuio da malacofauna e a
busca de estratgias alternativas para a conservao de espcies de bivalves tpicos de gua corrente, visando subsidiar o estabelecimento de medidas compensatrias e mitigadoras; reconstruo
de habitats em represas e nos seus tributrios para
a conservao da malacofauna; monitoramento populacional das espcies invasoras e nativas;
identificao de reas para a implantao de unidades de conservao; estabelecimento de estratgias de conservao; reviso das listas de espcies
ameaadas estaduais e a nacional, visando rever a
categorizao das espcies enquadradas e a categorizao de espcies que no constam nas listas.

CAPTULO 6
Morfologia e ciclo larval
comparados de bivalves
lmnicos invasores e nativos
Maria Cristina Dreher Mansur
Daniel Mansur Pimpo
Paulo Eduardo Aydos Bergonci
Cintia Pinheiro dos Santos
Gabriela Cristina Santos de Figueiredo


Moluscos bivalves invasores de origem
asitica que ocorrem no ambiente lmnico
brasileiro so, primordialmente, Limnoperna
fortunei (Dunker, 1857), Corbicula fluminea
(Mller, 1774) e Corbicula largillierti (Philippi,
1844). No extremo sul do Brasil temos ainda
duas espcies de Corbicula que se encontram
em reas muito restritas das bacias que drenam a Laguna dos Patos e Mirim: C. fluminalis
(Mller, 1774) e C. sp., ainda no identificada.
As espcies invasoras devem ser monitoradas
constantemente para o conhecimento de suas
densidades, interferncias ambientais e rotas
de disperso, principalmente em locais onde a
gua bruta utilizada para a gerao de energia
eltrica, resfriamento de indstrias ou abastecimento e irrigao.

Uma das maneiras de monitorar seria a
anlise direta do zooplncton, j que os moluscos bivalves desenvolvem-se atravs de fases larvais que podem frequentar o plncton,
principalmente em se tratando de invasoras. As
larvas no plncton acompanham a corrente da

gua, com pouca autonomia de movimentao.


Geralmente ficam no fundo, apresentando movimentos circulares de migrao vertical na coluna dgua. nesta fase planctnica que as espcies so facilmente levadas ou tragadas pelas
correntes para dentro de canais, encanamentos,
cisternas, bombas, tanques de alevinos, tanques
de gua de lastro, sistemas de refrigerao, etc.

As larvas so muito pequenas, variando
de 80 a 350 m no comprimento da concha
larval dependendo da espcie (Ortmann, 1921;
Bonetto, 1960; Bonetto, 1963; Bonetto & Ezcurra, 1963, 1965; Parodiz & Bonetto, 1963;
Mansur & Campos-Velho, 2000; Vale et al.,
2005). O pequeno tamanho das larvas facilita
sua disperso e transporte dentro de tubulaes
e bombas, alm de dificultar a localizao a olho
nu em aes de controle. Para a amostragem do
zooplncton sugere-se seguir os passos para o
monitoramento que constam no Captulo 10.

Para o reconhecimento das espcies invasoras na fase larval, necessrio diferenci-las
entre si e tambm das larvas de alguns bivalves

95

Morfologia e ciclo larval comparados de


bivalves lmnicos invasores e nativos
Mansur et al.

nativos que compartilham o mesmo ambiente.


Apesar desses bivalves serem facilmente diferenciveis na fase adulta, seu desenvolvimento
e a forma larval so muito semelhantes, principalmente nas ltimas fases larvais.

Apresentam-se neste captulo, alm das
tcnicas bsicas para a observao das larvas
ao microscpio, maneiras de reconhec-las
atravs da morfologia externa e da morfometria das conchas larvais. Objetiva-se tambm
auxiliar na compreenso da diversidade de estratgias de desenvolvimento e proteo das
crias no ambiente dulccola, descrevendo-se, ao
final do presente captulo, as fases e os ciclos de
desenvolvimento dos principais grupos de bivalves lmnicos que ocorrem no Brasil, mesmo
aqueles sem larva planctnica.

1. Tipos de larvas planctnicas


de bivalves lmnicos


As larvas dos bivalves que mais frequentam o plncton so as do tipo vliger, cujo corpo protegido por uma concha que pode ser
univalve ou bivalve. Na Figura 1, apresenta-se
uma chave pictrica para facilitar a diferenciao das conchas das principais formas larvais
que ocorrem no plncton, tanto de espcies invasoras como de nativas.

Assim, reconhecem-se inicialmente dois
tipos bsicos: o lasdio, com uma concha nica
em forma de oito, prprio dos bivalves nativos
da famlia Mycetopodidae; e as larvas com
conchas bivalves, que podem ser do tipo gloqudio, que apresenta uma aresta ventral, tpica
dos bivalves nativos da famlia Hyriidae ou do
tipo veliconcha, com a borda ventral arredondada, comum s invasoras.

96

1.1. Veliconcha de Limnoperna fortunei


A veliconcha de L. fortunei (Fig. 2) apresenta a charneira reta, sem deflexo central e
sem projees nas extremidades terminais; a
superfcie externa das valvas subdividida em
prodissoconcha I, relativamente pequena, ocupando aproximadamente 2/3 da altura da veliconcha, seguida da prodissoconcha II, que
ocupa o 1/3 restante. A superfcie da prodissoconcha I apresenta uma escultura central tipo
casca de ovo, sem estrias radiais; muito prximo

Figura 1. Chave pictrica para a identificao de larvas de


bivalves lmnicos que frequentam o plncton.

da linha dorsal, ocorre a demarcao da glndula conchfera, representada apenas por poucos e
pequenos poros centrais. A prodissoconcha II
bem demarcada por linhas comarginais.

A prodissoconcha I formada na fase
larval D, apenas pela produo da glndula
conchfera que deixa uma demarcao em forma de pequenos furos na regio central prxima da charneira. Quando o manto larval se
completa, a concha passa a ser produzida apenas pelas bordas do manto adquirindo ento as
demarcaes comarginais estriadas que acompanham o crescimento da concha e formam
a prodissoconcha II. Quando a veliconcha se
completa, temos a larva na fase de vliger que
envolve todo o corpo protegendo-o, quando

CAPTULO 6
Seo 2

fechada. Quando entreabre, expe o vu, um


rgo ciliado, responsvel pela locomoo do
animal. Os movimentos da larva so geralmente circulares e verticais (Ver mais detalhes no
item 5.1, deste captulo).

1.2. Veliconchas de Corbicula fluminea


e Corbicula largillierti


A veliconcha de C. fluminea (Fig. 3A) possui as duas extremidades da linha da charneira
projetadas e o centro levemente deflexionado. A
prodissoconcha I relativamente grande, ocupando 5/6 da altura da veliconcha enquanto a
prodissoconcha II apresenta-se muito reduzida,
o equivalente ao 1/6 restante. A concha possui
escultura radial na regio central, situada logo
abaixo da demarcao sob forma estrelada da
glndula conchfera. As larvas de C. largillierti
(Fig. 3B) apresentam a charneira reta e conchas
compostas apenas da prodissoconcha I, correspondendo ao estgio larval D. Na regio
central no se observaram estrias radiais bem
definidas como demarcaes da glndula conchfera, nem se encontraram estgios larvais
mais avanados que este, como na espcie acima
(mais detalhes no item 5.2).

1.3. O lasdio


Lasdio (Fig. 4) uma larva do tipo vliger transformada para assumir uma fase parasitria temporria em peixes. prprio da
famlia Mycetopodidae e apresenta caractersticas como: concha larval nica em forma de

Figura 2. Vista lateral da veliconcha do bivalve invasor Mytilidae, Limnoperna fortunei, sob microscopia eletrnica de
varredura. Charneira (C); demarcao da glndula conchfera
(GC); prodissoconcha I (PI); prodissoconcha II (PII). (Preparao e foto: G. Figueiredo e M.C.D. Mansur).

Figuras 3. Vista lateral das veliconchas dos bivalves invasores


Corbiculidae, sob microscopia eletrnica de varredura: 3A,
Corbicula fluminea; 3B, Corbicula largillierti. Charneira (C);
escultura radial (ER); demarcao da glndula conchfera (GC);
prodissoconcha I (PI); prodissoconcha II (PII). (Preparao e
foto: G. Figueiredo e M.C.D. Mansur).

capacete com uma reentrncia de cada lado, o


corpo composto por um rgo ciliado anterior
em forma de lngua ou bilobado, um corpo central com lobos ventrais e uma cauda posterior
tambm bilobada com ganchos terminais. Para
frente do animal, projeta-se um rgo adesivo
anterior transparente que, dependendo da espcie, pode ser em forma de fita, larga na base afilando distalmente (gnero Monocondylaea, Fig.
4), em forma de flagelo (Leila blainvilliana) ou
de flor de cartucheira com um microgancho em
uma das extremidades, conhecido para duas espcies do gnero Anodontites e uma de Mycetopoda (Fig. 17). No se conhecem os lasdios das
demais espcies e gneros desta famlia, como:
Mycetopodella, Fossula, Haasica e Bartlettia, todos monotpicos (com uma espcie por gnero)
e Tamsiella com duas espcies. O rgo adesivo
anterior uma estrutura que capacita a larva a
se fixar externamente na pele, escamas e nadadeiras ou nas brnquias dos peixes. Os lasdios,

97

Morfologia e ciclo larval comparados de


bivalves lmnicos invasores e nativos
Mansur et al.

assim como os gloqudios, so ectoparasitos


de peixes, no entanto crescem muito e emitem
haustrios que penetram nos tecidos dos peixes
de onde retiram nutrientes.

1.4. Gloqudio


Gloqudio um tipo de vliger habilitado
ao ectoparasitismo temporrio de peixes (Figs.
5 a 8), prprio dos representantes da famlia
Hyriidae. Recebe um nome especial por apresentar caractersticas distintas como: duas valvas com uma aresta na borda ventral, um gancho ventral em cada valva, um flagelo adesivo
(ausente em Castalia), clios sensitivos, cirros,
um msculo adutor central, um vu muito rudimentar e clulas fagocitrias forrando inter-

Figura 6. Larvas (gloqudios) de bivalves de gua doce do


gnero Diplodon. 6A, Diplodon obsolescens, vista interna das
valvas com gancho; 6B, Diplodon hylaeus, vista interna de
uma valva, sem gancho. Aresta ventral (AR), gancho (G). (Preparao e foto: D. Pimpo e M.C.D. Mansur).

Figura 4. Lasdio de Monocondylaea paraguayana dOrbigny,


1835 em vista dorsal, com os lobos posteriores recurvados e
escondidos sob a concha. rgo adesivo anterior em forma
de fita (AO); lobos anteriores (LA); concha larval (CL). (Fonte:
Bonetto & Ezcurra (1963), autorizado).

98
Figura 5. Gloqudio de Diplodon martensi (Ihering, 1893), parasito de peixe. Organizao interna em vista ventral. Clulas fagocitrias (CF); cirro sensitivo (CR); filamento adesivo
(F); msculo adutor (MA); rgo ciliado (OC). Fonte: Mansur
(1999) Revista Brasileira de Zoologia 16(2).

namente as valvas (Fig. 5). Com o flagelo e os


ganchos, o gloqudio torna-se habilitado para
se fixar s brnquias, nadadeiras ou escamas
dos peixes, que, por sua vez, so responsveis
pela disperso destes moluscos. Geralmente a
poca de liberao dos gloqudios por parte
dos adultos est relacionada piracema, movimento de migrao dos peixes montante dos
rios. Os gloqudios permanecem como parasitos dos peixes por um curto perodo de 20 a 30
dias, conforme Mansur & Silva (1999).

No entanto, dentre os Hyriidae do gnero Diplodon, temos excees. As espcies do
subgnero Diplodon (Rhipidodonta) possuem
gloqudios sem ganchos (Fig. 6B) e sem o filamento adesivo. Segundo Bonetto & Ezcurra
(1965), a presena de gancho est relacionada
condio parasitria.

Para observar os gloqudios necessrio
utilizar o microscpio ptico ou de varredura.
Suas valvas apresentam um contorno subtriangular com pequenas variaes entre os gneros.
Assim, necessrio em primeiro lugar enquadrar as valvas em trs padres: equiltero nas espcies do gnero Castalia (= Castalina e Callo-

CAPTULO 6
Seo 2

Figuras 7. Gloqudios de Hyriidae: 7A, D. suavidicus, vista interna; 7B, Castalia ambigua, em detalhe, vista lateral; 7C, Paxyodon
syrmatophorus vista externa lateral, com detalhe do gancho; 7D, Prisodon obliquus, vista lateral, com detalhe da escultura
externa em forma de espinhos; 7E, Triplodon corrugatus, vista interna de uma valva. Aresta ventral (AR), espinhos (E), gancho
(G). (Preparao e foto: D. Pimpo e M.C.D. Mansur).

naia) (Fig. 7B); issceles (Prisodon e Paxyodon,


Figs. 7C e 7D) e escaleno (Diplodon Figs. 6A,
6B e 7A) e Triplodon (Fig. 7E) conforme Pimpo
et al. (2012). Recomenda-se tambm observar
diferenas no comprimento dos ganchos [mais
curtos em Paxyodon e Prisodon (Fig. 7C e 7D),
e mais reforados em Triplodon (Fig. 7E)]. Em
Castalia os ganchos so triangulares (Fig. 7B).
Alm disto, as larvas de Paxyodon syrmatophorus e Prisodon obliquus apresentam projees
esculturais externas sob a forma de espinhos
(Fig. 7C e 7D) no existentes em outras larvas
de Hyriidae sul-americanos. Mais detalhes podem ser encontrados no artigo de Pimpo et al.
(2012) onde avaliam, alm das medidas do comprimento, altura e comprimento da linha dorsal,
o ngulo de obliquidade da extremidade ventral
em relao ao centro da base dorsal, o qual permitiu, atravs de uma anlise multivariada, observar maior divergncia do gloqudio de Castalia Lamarck, 1819 em relao s outras espcies
analisadas, considerando a varivel ngulo.

2. Como preparar larvas para


a observao ao microscpio?



Observar as larvas in vivo ajuda muito no
reconhecimento das espcies invasoras, principalmente do mexilho-dourado pelos movimentos
que costumam ser circulares e verticais. Tambm

auxilia no reconhecimento das diferentes fases


larvais. Uma vez entreabertas as valvas, podemos
detectar o vu e ou o p distendendo-se.

Atravs da lupa ou sob microscpio ptico,
podemos ver e fotografar as larvas in vivo e posteriormente, se necessrio, prepar-las de forma
permanente. A observao das larvas em maior
aumento permite diferenciar melhor ao nvel
especfico, detectar a fase larval por detalhes e
medidas na concha. Assim, conforme a necessidade, podemos utilizar recursos da microscopia
ptica comum ou da microscopia eletrnica de
varredura (MEV). lupa, basta colocar o material recolhido na rede de plncton em uma placa
pequena de vidro. Ao microscpio ptico as larvas podem ser colocadas vivas sobre lmina escavada com gua do local de coleta e cobertas com
lamnula. Para a visualizao de organelas como
o vu, o flagelo dos gloqudios ou o rgo adesivo
anterior do lasdio, bem como rgos internos e
sensitivos, necessrio corar a gua da preparao com um corante vital, como algumas gotas
de azul de metileno diludo a 1/1000.

2.1. Lminas permanentes de

conchas larvais.


Primeiramente as larvas vivas devem ser
anestesiadas colocando-se cristais de Mentol sobre a superfcie da gua da placa contendo larvas.

99

Morfologia e ciclo larval comparados de


bivalves lmnicos invasores e nativos
Mansur et al.

A gua tem que ser mineral ou natural do local


de coleta. Aps a anestesia, que leva algumas horas (acompanhar lupa), transferir as larvas para
uma proveta com auxlio de uma pipeta de Pasteur, desprezando-se o excesso de gua. Acrescentar 8 gotas de gua sanitria ou hipoclorito de
sdio comercial (5% NaOCl) para 10 ml de gua
deionizada durante aproximadamente 5 minutos.
O hipoclorito remove os tecidos. Acompanhar o
processo de limpeza atravs da observao direta na lupa. Lavar o material renovando a gua
a cada minuto (tempo suficiente para as larvas
decantarem ao fundo do tubo). Trocar o lquido
apenas acima do nvel das larvas. Desidratar rapidamente por uma srie crescente de lcool etlico
de 50, 60, 70, 80, 90, 96% e, ao final, dois banhos
de lcool isoproplico. Pipetar as veliconchas em
pequenas quantidades sobre lmina, montar com
algum blsamo de selagem histolgica e cobrir
com lamnula. Utilizar um anel ou moldura de
papel entre lmina e lamnula para o peso desta
no quebrar as conchas. Mais detalhes em Mansur & Campos-Velho (1990).

Atravs da microscopia ptica, observam-se vrios caracteres importantes na diferenciao interespecfica das conchas gloquidianas, como: a forma da charneira (rea de
articulao das valvas) reta ou com deflexo,
borda ventral com aresta ou arredondada, posio da aresta em relao ao centro da charneira, borda com reforo ou simples, presena
ou no de ganchos e os diferentes tipos destes.
Nas veliconchas das invasoras, a tcnica permite observar em L. fortunei a charneira reta e as
extremidades arredondadas, enquanto que em
C. fluminea e C. largillierti a charneira deflexionada na regio central e as extremidades
so levemente projetadas.

100


2.2. Observao de veliconchas sob o

microscpio eletrnico de varredura


Proceder anestesia e remoo dos tecidos como descrito acima. Depois, macerar em
gua deionizada durante dois dias, trocando o
lquido acima do nvel das larvas a cada minuto. Limpo o material, este deve ser pipetado sobre papel filtro para secar. Com um pincel fino
selecionar, sob lupa, as valvas mais ntegras
e fix-las sobre o suporte stub j preparado
com cola adesiva dupla face de cobre, devida-

mente numerada. Maiores detalhes em Mansur


& Campos-Velho (1990).

Sob microscopia eletrnica de varredura
possvel observar mais caracteres que reforam as diferenas entre as espcies invasoras,
L. fortunei (Fig. 2), C. fluminea e C. largillierti
(Figs. 3A e 3B), principalmente na superfcie
externa da veliconcha que pode apresentar esculturas ou no, vestgios da glndula conchfera e demarcaes que dividem as valvas em reas de propores diferentes que correspondem
a prodissoconcha I e prodissoconcha II.

3. Como avaliar a morfometria


larval?



Com base em apenas trs medidas da
concha larval (Fig. 8 e Quadro 1) referentes ao
comprimento, altura e comprimento da charneira, possvel diferenciar as espcies entre si
e as invasoras das nativas.

Por meio de lminas permanentes, conchas larvais so posicionadas em mxima horizontalidade com as bordas no foco e mensuradas conforme demonstrado na Figura 8. A
charneira representa a base e ponto de referncia. Assim, o comprimento mximo da concha
mensurado pelo paralelo e a altura pela perpendicular linha da charneira.

Para a discriminao das formas das conchas larvais a partir de variveis mensurveis
(Quadro 1), referimos a anlise multivariada
de fatores discriminantes cannicos, pois nesta

Figura 8. Orientao da concha larval, para a obteno de medidas (gloqudio de Triplodon corrugatus). Altura perpendicular linha da charneira (A), comprimento mximo paralelo ao
da charneira (C), comprimento da charneira (CC). (Preparao
e foto: D. Pimpo e M.C.D. Mansur).

CAPTULO 6
Seo 2

anlise a ideia principal retirar a influncia do


tamanho na discriminao entre as formas, resultando na identificao da varivel ou variveis
responsveis pela separao das mesmas (Perez-Neto, 1995). Este mtodo foi aplicado recentemente por Pimpo et al. (2012) para a discriminao morfomtrica de conchas larvais de espcies
amaznicas de Hyriidae. Para a realizao desta
anlise, recomenda-se a transformao dos dados
originais em logaritmos (Ln ou Log10) a fim de
diminuir a variabilidade entre os dados.

4. Morfometria larval comparada


A estatstica descritiva de variveis morfomtricas das conchas larvais de 10 espcies de
moluscos bivalves, sete nativas e trs invasoras,
pode ser verificada no Quadro 1. Constata-se
que Diplodon obsolescens apresenta os maiores
valores, ao passo que, L. fortunei, os menores.

Atravs da morfometria larval, possvel
diferenciar Corbicula fluminea de L. fortunei
atravs da conformao e medidas do com-

primento da charneira. Comparando as trs


espcies invasoras, L fortunei apresenta proporcionalmente as menores medidas de comprimento, de altura e a charneira mais curta.
C. largillierti possui charneira mais alongada
das trs espcies, mesmo considerando o fato
do material examinado no estar em estgio
larval to avanado como as demais, ou seja,
ainda em estgio de larva D.

A anlise discriminante cannica (ADC),
apresentada graficamente por meio da Figura
9A, diferencia a forma larval de L. fortunei
das demais espcies de bivalves com desenvolvimento no planctnico. Uma segunda ADC
realizada sem a presena de L. fortunei elucida
mais claramente as diferenas entre as formas
larvais das demais espcies, dada agora pela
varivel comprimento da charneira (Fig. 9B).
Nesta segunda anlise, as espcies de Diplodon e Prisodon (D. obsolescens, D. hylaeus, D.
suavidicus e P. obliquus) so discriminadas das
demais, bem como as outras duas espcies invasoras (C. fluminea e C. largillierti).

Quadro 1. Medidas de comprimento, altura e comprimento da charneira de larvas gloqudios (Hyriidae) e das invasoras Corbicula fluminea e C. largillierti (Corbiculidae) e Limnoperna fortunei (Mytilidae).

101

Morfologia e ciclo larval comparados de


bivalves lmnicos invasores e nativos
Mansur et al.

depois da absoro do vu e maior desenvolvimento do p, torna-se ps-larva ou juvenil.


Figura 9. Anlise discriminante cannica entre as variveis


mensuradas de 10 espcies de larvas de bivalves: 9A, anlise
com Limnoperna fortunei; 9B, anlise sem L. fortunei. Diplodon obsolescens (1); D. hylaeus (2); D. suavidicus (3); Prisodon
obliquus (4); Paxyodon syrmatophorus (5); Triplodon corrugatus
(6); Castalia ambigua (7); Corbicula fluminea (8); C. largillierti
(9); L. fortunei (10).

102

5. Descrio das fases larvais


das espcies invasoras e nativas


O embrio dos bivalves, at atingir a fase
juvenil passa, obrigatoriamente, por vrios estgios de desenvolvimento, a comear pelo ovo,
depois blstula, gstrula, trocfora, larva D
(quando se completa a veliconcha inicial correspondente a prodissoconcha I), vliger, com presena de um vu ciliado bastante evidente e o
incio da prodissoconcha II, e o pedivliger, que

5.1. Fases larvais de L. fortunei


L. fortunei libera os gametas para o meio
ambiente e os ovos, fertilizados externamente, se desenvolvem numa larva planctnica. Os
ovos fecundados (zigotos) so muito pequenos,
(aproximadamente 80 m) e o desenvolvimento
inicial do embrio, a partir da diviso dos primeiros blastmeros, passa gstrula, depois
fase de trocfora que leva ao todo de 5 a 6 horas. A trocfora se transforma em vliger atravs
do desenvolvimento do vu que uma organela
ciliada destinada locomoo e filtrao (Choi
& Kim, 1985; Choi & Shin, 1985). Estes autores reconheceram trs estgios de vliger que
denominaram de larva D: primria, mdia e
larva D propriamente dita, com os respectivos
tamanhos de: 140.0 m. 167.6 m e 210.0 m
de comprimento por 97.3 m, 137.6 m e 178.2
m em altura. O ltimo estgio larval no qual
o vu e o p, j bem desenvolvidos, esto presentes, trata-se de um juvenil em estgio inicial
ou uma larva umbonada, pronta para assentar e
colar ao substrato. Ressalta-se aqui que a denominao das fases larvais varia muito conforme
o autor.

As fases larvais de uma populao de L.
fortunei do sul do Brasil, foram descritas por
Santos et al. (2005) como apresentando cinco
estgios sem valvas e quatro valvados (Fig. 10).
O primeiro reconhecido como uma mrula ciliada (Fig. 10A), que se transforma numa trocfora (comprimentos respectivos de 80 m a 125
m) com quatro estgios distintos, trocfora de
1 4 (Figs. 10B a 10E). Na ltima fase de trocfora (Fig. 10E) aparecem os primrdios da concha. Os estgios valvados incluem: a larva D
(Fig. 10F, comprimento de 100 m a 130 m),
o vliger de charneira reta (Fig. 10G, comprimento de 140 m a 180 m), vliger umbonado
(Fig. 10H, comprimento de 190 m a 230 m)
e o pedivliger (Fig. 10I, comprimento de 230
m a 270 m). Nesta fase, o p se desenvolve
e o vu lentamente absorvido. Quando ps-larva ou plantgrada (Fig. 10J, comprimento
aproximado de 300 m), o p secreta, atravs
da glndula bissognica, fios de bisso que permitem sua fixao no substrato.

CAPTULO 6
Seo 2

Figura 10. Fases larvais


do mexilho-dourado (L.
fortunei). A, Mrula ciliada
(80 m); B a D, trocfora; E,
trocfora com os primrdios da concha; F, larva
D; G, vliger de charneira
reta; H, vliger umbonado ;
I, pedivliger e J, ps-larva.
(Desenhos M.C.D. Mansur).


Considerando o perodo de durao do
ciclo planctnico da larva como livre natante,
Choi & Shin (1985) referem aproximadamente
um ms, no reservatrio prximo de Seul, na
Coria do Sul.

5.2. Fases larvais de Corbicula spp.


Nos ambientes lmnicos do Brasil podemos encontrar quatro espcies invasoras de
origem asitica do gnero Corbicula: C fluminea, C., largillierti, C. fluminalis e C. sp. (ainda no identificada). Conforme Skuza et al.
(2009), as espcies do gnero Corbicula so
nicas em termos de reproduo, por serem
tanto hermafroditas quanto dioicas e, segundo
alguns autores, capazes de autofecundao
e ou clonagem (ver Captulo 8). Quanto ao
desenvolvimento larval, as espcies de Corbicula spp. podem ser ovparas, ovovivparas e
vivparas. As espcies de gua doce geralmente

Figura 11. Brnquia direita de Corbicula largillierti com a demibrnquia externa rebatida e a interna contendo embries
incubados. Demibrnquia externa (DBE), demibrnquia interna (DBI), embries (E), marspio (M). (Foto: M.C.D. Mansur).

so vivparas com a incubao das larvas at a


fase de ps-larva, no saco marsupial das demibrnquias internas (endobranquial caso mais
comum) ou nas quatro brnquias (tetrabranquial casual). Martins (2004) e Martins et
al. (2006) observaram em C. fluminea e C. largillierti a incubao como endobranquial (Fig.
11), e em C. fluminalis como tetrabranquial
(Ver Captulo 4).

O desenvolvimento larval foi descrito
para a espcie C. fluminea mais detalhadamente por Kraemer & Galloway (1986) e King et
al. (1986). Na Figura 12, esquematizam-se as
fases larvais que so incubadas nos marspios
at a fase de liberao ao meio ambiente. No
marspio se desenvolvem: o embrio, passando pelos estgios larvais desde o ovo, blstula
(175 m), gstrula (de 175 180 m), trocfora
(180 190 m), trocfora com primrdios da
concha (190 m), larva vliger com presena
de um vu ciliado bastante evidente (200 220
m) e larva pedivliger (225 230 m), que
depois de abortar o vu se torna ps-larva ou
juvenil, sendo ento liberada do marspio para
o exterior. Este juvenil mede em torno de 220
a 270 m de comprimento, no livre natante,
mas por ser muito leve, pode ser encontrado
tambm no plncton. Apresenta um p adaptado a rastejar em ambientes de correnteza,
onde pode se locomover sem ser arrastado pelas guas. Isto acontece graas a uma glndula
que existe no p e que produz um fio mucoso e
elstico. Este no um bisso, mas permite adeso ao substrato medida que o animal rasteja.
Este fio tambm auxilia o animal a assumir sua
vida bentnica infaunal (Kraemer & Galloway,
1986).

103

Morfologia e ciclo larval comparados de


bivalves lmnicos invasores e nativos
Mansur et al.

Figura 12. Esquema das fases larvais de Corbicula fluminea (Mller 1774) desde a formao do zigoto pelos gametas masculino
e feminino (a e b) at as fases incubadas no marspio (de C at I), incluindo a fase de pedivliger ou ps-larva que liberada
ao meio ambiente a partir da fase J (ps-larva J ou juvenil K). momento da liberao da larva no ambiente; vulo (A); espermatozoide (B); embrio em clivagem com os primeiros blastmeros (C); gstrula (D); trocfora (E); trocfora com primrdios da
concha (F); vliger de charneira reta (G); pedivliger (H); pedivliger abortando o vu (I); ps-larva com o manto e o p extrovertidos (J); juvenil (K). Fonte: Kraemer & Galloway (1986); King et al. (1986), adaptado por M.C.D. Mansur.


Nas espcies C. fluminea e de C. largillierti, tanto as larvas quanto a sequncia
de desenvolvimento no marspio muito semelhante (Figs. 13 e 14). Os embries esto
unidos por uma massa gelatinosa, formando
uma estrutura compacta, no formato cilndrico e ocupam os tubos aquferos das brnquias,
principalmente nas fases iniciais. Nas fases de
vliger em diante, ficam soltos e podem nadar
no interior da brnquia. Quando exemplares adultos com larvas incubadas entram em
stress ou quando, aps coleta, so colocados
em aqurio, facilmente liberam as larvas em
estgios de vliger que nadam livremente. No
sabemos sobre suas condies de sobrevivncia
e se conseguem completar o desenvolvimento.
C. fluminalis e C. sp. no tm seu desenvolvimento larval conhecido em nosso meio.

5.3. Fases larvais da espcie nativa

Cyanocyclas limosa

104


Considerando os Corbiculidae nativos,
s existem estudos realizados para a espcie
Cyanocyclas limosa (Ituarte, 1984b, 1994;
Focht & Veitenheimer, 2001) at recentemente conhecida por Neocorbicula limosa. Ituarte
(1984b) observou que os embries so incubados nas demibrnquias internas por longos perodos e se nutrem do vitelo contido no ovo.


Em geral, so liberados aos poucos, a
partir de 1,1 mm de comprimento, no na fase
de ps-larva, como em Corbicula fluminea,
mas como um juvenil em adiantado estado de
desenvolvimento, uma miniatura do indivduo
adulto (Fig. 15B). Seria um caso de euviviparia
(incubao prolongada, segundo Glaubrecht
et al., 2006). Entretanto, muitos ainda permanecem nas brnquias internas do indivduo
me. O nmero (assim como o tamanho) de
embries incubados varivel, no ultrapassando, em geral, 25 indivduos por demibrnquia. Raramente encontram-se 45 embries
nas duas demibrnquias e o desenvolvimento
destes embries no sincronizado como em
C. fluminea. Distinguem-se geralmente trs ou
quatro geraes com tamanhos diferentes, que
esto relacionadas s distintas fases reprodutivas do indivduo materno (Ituarte, 1984b).
Em estudos realizados com uma populao do
Lago Guaba, Focht & Veitenheimer-Mendes
(2001) confirmaram e ilustram o tipo de incubao dos juvenis nas demibrnquias internas.

5.4. Fases larvais de Hyriidae


Os bivalves nativos Hyriidae no Brasil,
renem os gneros Diplodon ( 37 espcies),
Triplodon (2 spp.), Paxyodon (1 sp.) e Prisodon
(1 sp.) e Castalia ( 13 spp). Todas as larvas das

CAPTULO 6
Seo 2

Figura 13. Fases larvais e recruta


de C. fluminea: 13A, trocfora; 13B,
vliger; 13C, pedivliger; 13D, ps
larva recm liberada; 13E. Recruta
com uma semana de vida livre. Clio
apical (CA), p (P), vu (V). (Fotos:
G. Figueiredo e M.C.D. Mansur).

105
Figura 14. Fases larvais incubadas
de C. largillierti. A. Embrio em
clivagem; B. Embrio com os primeiros blastmeros; C. Vliger;
D. Pedivliger e juvenil em fases
finais de incubao. Blastmeros
(B), embrio (E); clio apical (CA), p
(P), vu (V). (Fotos: G. Figueiredo e
M.C.D. Mansur).

espcies desta famlia recebem a denominao


de gloqudio, que seria um vliger transformado. Na fase larval so temporariamente ectoparasitos de peixes, utilizando-o como um dispersor das espcies pelas bacias hidrogrficas.

No entanto, h excees. Parte das espcies de


Diplodon, no parasita o peixe e no apresenta
ganchos gloquidianos. Completam o desenvolvimento larval passando por todas as fases no
interior dos marspios, sendo liberados como

Morfologia e ciclo larval comparados de


bivalves lmnicos invasores e nativos
Mansur et al.

Figura 15. Cyanocyclas limosa contendo juvenis em incubao: 15A, Esquema da cavidade palial de um exemplar adulto com
juvenis em processo de incubao na demibrnquia interna. (Desenho: M.C.D. Mansur); 15B, Detalhe de dois juvenis em adiantado estado de desenvolvimento, incubados na demibrnquia interna (foi afastado o manto, retirada a demibrnquia externa e
parte da demibrnquia interna para evidenciar os juvenis). Demibrnquia externa (DBE), demibrnquia interna (DBI), juvenis (J),
manto (M), marspio (MAR), p (P). Fonte: Focht & Veitenheimer-Mendes (2001) Revista Brasileira de Zoologia 18 (1).

ps-larvas diretamente no ambiente pelo bivalve me.



Os gloqudios parasitos, por sua vez, desenvolvem-se no interior dos marspios, desde
a formao do zigoto at a fase gloqudio (Fig.
16). Com o flagelo e os ganchos se prendem s
barbatanas, pele, escamas e brnquias dos peixes. Sobre o gloqudio fixo, forma-se um cisto que se rompe num perodo de 20 a 30 dias.
Durante este tempo o gloqudio completa seu
desenvolvimento at a fase juvenil. A concha
quase no cresce, mas a borda torna-se espessa, os dentes pendem para fora e internamente
surgem rgos definitivos, como o p e os filamentos branquiais, que podem ser visualizados
por transparncia, rompendo-se o cisto. Ao final do ciclo parasitrio, o gloqudio, agora um
juvenil, afasta as valvas com movimentos do p,
rompe o cisto e cai no substrato.

106

5.5. Fases larvais de Mycetopodidae


Os bivalves nativos Mycetopodidae esto
representados no Brasil pelos gneros Anodontites ( 14 espcies), Mycetopoda (3 spp.), Fossula (1 sp.), Haasica (1 sp.), Monocondylaea (8
spp.), Tamsiella (2 spp.) Mycetopodella (1 sp.)
Bartlettia (1 sp.) e Leila (2 spp).

As fases larvais iniciais dos Mycetopodidae, desde o ovo fecundado at a fase de lasdio,
se desenvolvem dentro de uma cpsula ovgera.


Os ovos, por sua vez, so incubados nos
marspios que comumente ocupam a parte
central anterior das demibrquias internas.
Quando o lasdio rompe a cpsula, liberado
ao meio ambiente e permanece no plncton por
um certo perodo espera da passagem do peixe (Fig. 21). Geralmente a liberao dos lasdios
coincide com a piracema, que o movimento
de migrao dos peixes para desova montante
dos rios. Na passagem do peixe, o lasdio se
cola pele do mesmo atravs do rgo adesivo
anterior, que pegajoso. Em seguida, o corpo
do lasdio se fixa ao peixe pela regio ventral,
unindo a regio posterior com a anterior. Ao
mesmo tempo, forma-se um cisto que envolve
o lasdio, unindo-o aos tecidos do peixe. No
centro da regio ventral a larva emite um haustrio em direo aos tecidos do hospedeiro,
penetrando na carne do peixe para absoro
de alimento. O lasdio cresce muito dentro do
cisto e comea a sofrer uma srie de transformaes que resultam no aparecimento de um
juvenil, miniatura do adulto, liberado quando
rompe o cisto, aps o perodo parasitrio de
aproximadamente 20 dias ou um pouco mais
(de 19 a 28 dias em Anodontites trapesialis).

Nos primeiros dias de parasitismo (Figs.
17 e 21) do lasdio de Mycetopoda legumen, a
larva, presa ao peixe, se curva e coberta pelo
tecido do peixe formando um cisto. A concha (com aproximadamente 120 m de com-

CAPTULO 6
Seo 2

Figura 16. Gloqudio de Diplodon


martensi (Ihering, 1893): 16A,
vista frontal da larva parasitria
de peixes, como encontrado no
plncton; 16B, gloqudio no 5 dia
de vida parasitria como ectoparasito de peixe; 16C, gloqudio no
30 dia de vida parasitria; 16D,
ps-larva no 1 dia de vida livre,
em vista ventral com as valvas cerradas; 16E, juvenil em vista lateral
com o p distendido. Concha larval (CL); corao (CO); dente gloquidiano (DG); filamentos branquiais (FB); msculo adutor central
(MA); msculo adutor anterior
(MAA); msculo adutor posterior
(MAP); p (P); quisto larval (QL);
raio da aleta do peixe (R). Fonte:
Mansur (1999), Revista Brasileira
de Zoologia, 16 (2).

Figura 17. Lasdio de Mycetopoda


legumen (Mycetopodidae): 17A,
vista dorsal de indivduo com o
rgo adesivo anterior completo;
17B, detalhe do lasdio em vista lateral, com a concha o corpo, e parte do rgo adesivo anterior; 17C,
lasdio no 5 dia, encistado na pele
do peixe; 17D, lasdio no 10 dia
de parasitismo; 17E, lasdio no 17
dia, encistado; 17F, lasdio no 18
dia, encistado, e 17G, no 21 dia,
juvenil afastando as valvas com o
p. Concha larval (CL); filamentos
branquiais (FB); haustrio (H); lobo
anterior (LA); lobo posterior (LP);
lobos ventrais (LV), rgo adesivo
anterior (AO), p (P); quisto larval
(QL). Fonte: Veitenheimer-Mendes
& Mansur (1978), Revista Brasileira
de Biologia 38 (3), adaptado.

primento) se prolonga pelos lados em direo


ventral, cobrindo as extremidades do corpo da
larva; os 4 lobos ventrais da larva unem-se e
projetam-se e no centro o haustrio se prolonga e faz contato com os tecidos do peixe. Por

transparncia pode-se ainda observar o corpo


do lasdio com os minsculos ganchinhos do
lobo posterior, dentro da concha. No dcimo
dia de parasitismo a larva pode atingir 346 m
de comprimento por 213 m de altura e toma a

107

Morfologia e ciclo larval comparados de


bivalves lmnicos invasores e nativos
Mansur et al.

forma de um rim. Na regio ventral, a concha


se solda deixando apenas a fresta para uma pequena poro projetada dos 4 lobos ventrais e
no centro o haustrio. No dcimo quarto dia,
o tamanho da larva passa a 545 m de comprimento por 407 m de altura. No dcimo
stimo dia, a larva, agora com o comprimento
que varia de 647 a 814 m de comprimento por
462 a 582 m de largura, apresenta na regio
dorsal, anterior e posterior, um marcado sulco que ir definir a futura diviso da concha
larval at agora nica em duas valvas. No
dcimo oitavo dia, por transparncia, possvel visualizar o p e os filamentos branquiais.
No vigsimo primeiro dia, a larva, agora com
837 m de comprimento por 647 m de altura,
mostra movimentos ativos do p, que promovem o afastamento das valvas e o rompimento
do cisto. Liberado, passa a ser um juvenil que
ir se desenvolver no bentos at a fase adulta.
Muitos juvenis desta famlia apresentam no p
um sulco ventral e produzem um fio de bisso
temporrio que os auxilia a se fixar junto vegetao marginal, para no serem arrastados
pela correnteza.

6. Ciclos larvais


Conforme a famlia ou grupo dos bivalves, a sequncia de estgios larvais pode acontecer de diferentes modalidades que dependem
do grau de proteo que conferido ao embrio ou de estratgias necessrias para a disperso da espcie. Assim, as larvas podem se
desenvolver livremente no plncton, ao sabor
da corrente; totalmente incubados e protegidos

108

Figura 18. rgos da cavidade palial de adulto do gnero Corbicula.


Em cor amarela destaca-se a demibrnquia interna que contm o
marspio, local de incubao das
larvas. (Desenho: M.C.D. Mansur).

dentro da concha me, em espaos denominados de marspios, geralmente situados nas


demibrquias internas (Fig. 18); parcialmente
incubados nos marspios, quando s as ltimas
fases so planctnicas; ou, ainda, parcialmente
incubados, completando seu desenvolvimento
como parasitos temporrios de peixes. Alm
disto, as larvas podem se desenvolver envoltas
ou no por cpsulas ovgeras, mesmo dentro
dos marspios. A proteo dos embries constitui quase uma regra para os bivalves nativos
de gua doce.

O desenvolvimento larval dos bivalves
lmnicos invasores e nativos que ocorrem no
Brasil, pode ser sumarizado em 5 modalidades,
conforme os esquemas a seguir (Figs. 19 a 23):

6.1. Ciclo completo planctnico


Todo o ciclo larval, desde a fecundao,
ocorre no plncton (Fig. 19). Na fase de pedivliger passa a frequentar o bentos como um
jovem recruta. o caso do mexilho-dourado,
bem como da maioria dos seus parentes marinhos (Mytilidae). Na Coria, L. fortunei libera
os gametas para o meio ambiente durante um
perodo de 15 a 20 dias entre julho e agosto
(Choi & Kim, 1985; Choi & Shin, 1985).

6.2. Ciclo parcialmente incubado

no marspio e planctnico

As primeiras fases larvais (desde ovo
at vliger) desenvolvem-se protegidas dentro
do marspio. So liberadas no meio ambiente,
num estdio de vliger ou pedivliger (Fig. 20).

CAPTULO 6
Seo 2


o caso das corbculas invasoras como
C. fluminea, C. largillierti e C. fluminalis, nas
quais todas as fases larvais, at pedivliger,
costumam acontecer dentro dos marspios.
Porm, eventualmente, por razes ainda desconhecidas, podem liberar larvas ainda nas fases
de vliger ou pedivliger.

6.3. Ciclo parcialmente incubado no

marspio e parasitrio de peixe
As primeiras fases larvais desde ovo at chegar
a um tipo de vliger transformado (lasdio em
Mycetopodidae, Fig. 21A; gloqudio em Hyriidae, Fig. 21B) permanecem incubados nos marspios. So ento liberados no plncton e, em
poucas horas, aderem s escamas, nadadeiras
ou brnquias de peixes hospedeiros. Nestes se
encistam e completam seu desenvolvimento
como ectoparasitas at a fase juvenil. Rompem
o cisto, passando a viver no bentos. o caso
dos bivalves de conchas nacaradas Mycetopodidae e da maior parte das espcies da famlia
Hyriidae.

Figura 19. Ciclo larval planctnico desde a fecundao at o


recrutamento.

Figura 20. Ciclo larval parcialmente incubado no marspio.


6.4. Ciclo completo incubado no

marspio


6.5. Ciclo completo incubado na

cavidade palial

o caso do nosso falso mexilho-dourado, Mytilopsis lopesi (Dreissenidae), endmico
do curso inferior do Rio Amazonas, excluindo
a rea do delta, cujos embries se desenvolvem
fora das brnquias, mas no interior da cavidade
palial, aderidos ao manto. Os jovens so liberados em adiantado estdio de desenvolvimento
(Mansur et al., 2011b, Fig. 23).

Figura 21. Ciclo larval parcialmente incubado no marspio


e parasitrio de peixe. 21A, Mycetopodidae (lasdio) e 21B,
Hyriidae (gloqudio).

109
Figura 22. Ciclo completo incubado no marspio at juvenil.
22A, Cyanocyclas em estgio adiantado de desenvolvimento;
22B, Diplodon (Rhipidodonta).

Figura 23. Ciclo completo incubado na cavidade palial e a liberao pelo sifo inalante de juvenis em estgio avanado
de desenvolvimento.

(Desenhos: M.C.D. Mansur).


Todo o desenvolvimento larval ocorre
protegido pela me dentro dos marspios.
So liberados na fase juvenil, como uma miniatura do adulto. o caso dos Sphaeriidae
(Eupera, Byssanodonta, Pisidium, Musculium
e Sphaerium), dos Corbiculidae nativos (Cyanocyclas) cujos juvenis so liberados em estdio adiantado de desenvolvimento (Focht &
Veitenheimer, 2001, Fig. 22A) e dos Hyriidae
do gnero Diplodon (Rhipidodonta), que no
utilizam o peixe como hospedeiro e dispersor
(Fig. 22B).

Morfologia e ciclo larval comparados de


bivalves lmnicos invasores e nativos
Mansur et al.


Mytilopsis lopesi Alvarenga & Ricci,
1989 apresenta aspecto mitiloide, vivendo
fixo por fios de bisso em substratos duros, formando incrustaes como pequenas manchas.
Por este motivo tem sido confundido com o
mexilho-dourado L. fortunei. Apesar da aparente semelhana, so de famlias e at ordens
de Bivalvia distintas. Segundo Cox (1969), os
representantes da famlia Dreissenidae, (com
os gneros Dreissena, Mytilopsis, Congeria)

110

apresentam a larva livre natante planctotrfica, passando por todas as fases larvais, desde
trocfora vliger, como a maioria das espcies
marinhas. No entanto, nosso falso mexilho
Mytilopsis lopesi, incuba as larvas at adiantado estado de desenvolvimento, no apresentando larva planctnica, motivo de no ter sido
considerado na morfologia larval comparada.
tambm um caso de euviviparia, mas fora das
brnquias.

CAPTULO 7
A gametognese em
Limnoperna fortunei
(Dunker, 1857)
Claudia T. Callil
Ana Lcia Teixeira Gomes
Ana Ceclia Pinillos Vinicius Soares


A intensa capacidade reprodutiva do mexilho-dourado, Limnoperna fortunei (Dunker,
1857), tem facilitado a rpida disseminao e
altas densidades desde a sua introduo acidental na Amrica do Sul, acerca de duas dcadas
(Pastorino et al., 1993; Mansur et al., 1999).
Dentre os requisitos necessrios para uma espcie se tornar um bioinvasor de sucesso, Ricciardi
& Rasmussen (1998) elencam que a espcie deve
apresentar um ciclo de vida curto; rpido crescimento, com maturidade sexual precoce e alta
fecundidade, caractersticas tpicas de espcies
estrategistas-r, como o mexilho-dourado, classificado assim por Morton (1977).

Informaes detalhadas relacionadas a
aspectos populacionais, em especial, s flutuaes reprodutivas sazonais (Cataldo & Boltovskoy, 2000), estrutura etria, proporo
entre os sexos (sex-ratio), dentre outras caractersticas, so essenciais, no apenas na investigao de mecanismos bsicos de reproduo e
desenvolvimento, mas tambm na previso de

sua propagao, sendo assim fundamentais para


a produo de estratgias adequadas de controle
e mitigao dos impactos. Neste captulo pretendemos relatar os processos de maturao e
as mudanas cclicas que ocorrem nas estruturas
reprodutivas formadoras de gametas.

Dioicos, porm hermafroditas,


como assim?


Bivalves, preferencialmente os de gua
doce, apresentam uma ampla plasticidade e
variabilidade de estratgias quando se trata de
produo de gametas. H muito se relata e se
descreve um gradiente compreendendo diferentes categorias sexuais, desde espcies exclusivamente dioicas, que apresentam sexos separados,
at aquelas que so invariavelmente hermafroditas funcionais (Coe, 1943). Em um mesmo gnero possvel observar em espcies simptricas,
que coexistem sob condies ambientais idnticas, padres gametognicos completamente

111

A gametognese em Limnoperna fortunei


(Dunker, 1857)
Callil et al.

Figura 1. Diferenciao sexual em indivduos de mexilho-dourado, Limnoperna fortunei ativos reprodutivamente (A). Vista
superficial externa em microscpio estereoscpico, do manto de um indivduo feminino em incio de maturao. As estruturas
na ponta das setas so os folculos em desenvolvimento (B). Fotos: A, A.L.T. Gomes e B, C.T. Callil.

distintos. Um exemplo desta plasticidade ocorre


com duas espcies de bivalves nativos do gnero
Anodontites: enquanto A. elongatus (Sawaison,
1829) exclusivamente dioico, o seu parente e
vizinho A. trapesialis (Lamarck, 1819) pode ser
considerado um hermafrodita funcional convicto, apresentando folculos femininos e masculinos ativos simultaneamente (Callil, 2003; Callil
& Mansur, 2007; Callil, 2009).

O mexilho-dourado dioico (Morton,
1982) (Fig. 1), apresenta sexos separados e
classificado por Choi & Shin (1985) como uma
espcie gonocorstica. Machos e fmeas geralmente esto presentes em iguais propores,
apesar de ocasionalmente ocorrer um ou outro
caso de hermafroditismo (Tab. I). De todos os
estudos disponveis sobre reproduo e sex-ratio, apenas em dois locais foram observados
indivduos hermafroditas: no Rio da Prata,
na Argentina (Darrigran et al., 1998b; 1999)
e no Rio Paraguai em Corumb, MS (Uliana
& Callil, 2006). Apesar da baixa porcentagem

de hermafroditismo em mexilho-dourado,
quando ocorre, os gametas femininos e masculinos so produzidos em folculos distintos
(Fig. 2). Para os Mytilidae, descritos geralmente como dioicos, o hermafroditismo espordico parece ser possvel (Villalobos et al., 2010),
porm, raro. Entre 4.309 espcimes de Perumytilus purpuratus (Lamarck, 1819) analisados
houve apenas um registro de hermafroditismo (0,023%) (Villalon apud Villalobos et al.,
2010) e o primeiro registro para o mexilho
Aulacomya ater (Molina, 1782) foi feito por Vinuesa (1977). Em Corbicula fluminea (Mller,
1774) a incidncia de hermafroditismo menos rara do que em mexilho-dourado, porm
ainda considerada como ocasional (Massoli &
Callil, 2012). Situao semelhante ocorre em
Dreissena polymorpha (Pallas, 1771) espcie
dioica, a qual relatada cerca de 4 a 8% de
hermafroditismo (Nichols, 1993). Seria oportuno investigar as causas do hermafroditismo
em espcies dioicas de comportamento invasor,

Tabela I. Frequncia de ocorrncia de machos, fmeas e hermafroditas de Limnoperna fortunei.

Fonte

112

Morton, 1982
Darrigran et al., 1999
Darrigran et al., 2003
Uliana & Callil, 2006
Marcelo & Callil, 2006
Pestana et al., 2008
Uliana et al., 2006
Gomes & Callil, 2010
Pinillos & Callil, 2011a
Pinillos & Callil, 2011b
Gomes & Callil, 2011

Local
Sudeste da sia
Rio da Prata, AR
Rio da Prata, AR
Rio Paraguai, MS
Praia do Veludo, RS
Res. Itaipu, PR
Corumb, MS
Rio Paran, PR
Rio Baa, PR
Ilha da Pintada, RS
Cais do Porto, RS

Ano

Machos

Fmeas

No Ident.

Hermafroditas

1971/74
1992/94
1992/94
2004/06
2002
2003/05
2006
2006/08
2006/08
2010
2010

34,30
45,00
61,47
35,00
45,10
55,80
42,00
37,00
41,76
36,00
37,00

65,70
40,00
38,28
56,11
54,90
26,90
46,60
40,00
55,58
50,00
56,20

0,00
15,00
0,00
8,89
0,00
15,40
10,60
23,00
2,35
14,00
6,00

0,00
0,00
0,25
0,00
0,00
0,00
0,60
0,00
0,00
0,00
0,00

CAPTULO 7
Seo 2

como L. fortunei, D. polymorfa e C. fluminea,


mesmo porque, apesar de apresentarem esta semelhana no comportamento reprodutivo, essas
espcies pertencem a grupos filogenticos distintos. Tal comportamento, mesmo que em baixas
propores, provavelmente seja acessado como
uma estratgia de estabelecimento populacional
no incio de instalao dos bioinvasores.

Estruturas reprodutivas



No mexilho-dourado, assim como em
outros Mytilideos, a produo de gametas
ocorre em estruturas acinosas que se distribuem
naturalmente pelo manto e ocasionalmente na
massa visceral (Fig. 1) (Morton, 1973, 1982).

No h dimorfismo sexual evidente, porm aps a abertura da concha, apesar da morfologia externa do manto ser semelhante entre
os machos e as fmeas, a presena de ovcitos
ou esperma pode ser identificada a olho nu,
por padres de textura e colorao distintos,
comuns nos Mytilidae. Fmeas maduras apresentam uma colorao que varia em tons de
castanho claro a acobreado quando no pico
de maturao, enquanto que os machos, nesse
momento, apresentam o manto branco leitoso
(Fig. 1). Esta diferenciao entre machos e fmeas ainda mais evidente no marisco Perna
perna (Linnaeus, 1758), um parente marinho
do mexilho-dourado, em que nos machos a
colorao branca-leitosa e nas fmeas vermelha-alaranjada (Lunetta, 1969).

Incontestavelmente, informaes mais
confiveis e teis sobre a morfologia so obtidas apenas a partir de preparaes histolgicas das gnadas (Seed & Suchanek, 1992).
Embora trabalhoso (provavelmente a razo
principal para o seu uso limitado), este mtodo
oferece informaes detalhadas sobre os tecidos e possibilita acompanhar pormenores do
ciclo reprodutivo completo, incluindo o tempo
real de desova. A identificao e descrio dos
elementos morfolgicos e gametognicos utilizados para o monitoramento do ciclo sexual
esto representados na Figura 2. Nas fmeas,
a gnada composta de vesculas, geralmente denominadas de cinos (Bielefeld, 1991) ou
de folculos ovarianos (Haag & Garton, 1992),
por ser o local aonde os ovcitos iro se desenvolver (Fig. 3). Nos machos, as vesculas onde

os espermatozoides se desenvolvem tm sido


denominadas de lobos espermatognicos (Garton & Haag, 1993) (Fig. 4).

Os ovcitos e espermatozoides apresentam produo cclica, culminando em um ou
mais momentos de desova, comumente associada a fatores ambientais. Esses processos coordenados (maturao e desova) dos gametas
so importantes para uma reproduo bem
sucedida. Para estudar a gametognese usual
categorizar e caracterizar as sucessivas alteraes que os folculos e lobos passam durante a
gametognese e, para isso, apresentamos uma
descrio simplificada, organizada em uma escala, compreendendo cinco fases de desenvolvimento gametognico para ambos os sexos:
IM Incio de Maturao, EM Em Maturao, MA Maturo, EL Eliminando e RP
Repouso (Figs. 3 e 4). Estes estdios foram
adaptados a partir de sistemas de classificao
proposto por Callil (2003) e validadas com
base em Damborenea & Penchaszadeh (2006).

A aplicao de estdios de desenvolvimento foi por muito tempo utilizado, mesmo
considerando a subjetividade do mtodo, uma
vez que, apesar de serem elencados critrios
morfo-histolgicos para a classificao, o treinamento e olhar do pesquisador podem ser
tendenciosos. Da a importncia de avaliaes
quantitativas (Callil & Mansur, 2007), minimizando a subjetividade categrica e transformando medidas como dimetro, rea ou permetro
de ovcitos, folculos e lobos em variveis contnuas, mais robustas analiticamente. Pensando
nisso, Pinillos & Callil, (2011a, b) validaram
quantitativamente os estdios de maturao,
a partir de aproximadamente 15 mil folculos
mensurados provenientes de amostras mensais
de 15 indivduos oriundos do Rio Baa, PR. A
varincia de dados biomtricos dos elementos
gametognicos (dimetro, rea e permetro de
ovcitos, folculos femininos e lobos espermatognicos) foi considerada como varivel-resposta e os estdios como a varivel-preditora.
O dimetro (20-300 m); rea (36-4525,3 m)
e permetro (85,4-876,5 m) diferem significativamente (p<0,001) quando considerados os
diferentes estdios (IM, EM, MA e EL). O estdio repouso (RP) no foi considerado devido ao
fato da populao, no local estudado, apresentar desenvolvimento gametognicos contnuo.

113

A gametognese em Limnoperna fortunei


(Dunker, 1857)
Callil et al.

Manto: a epiderme do manto caracterizada externamente por um epitlio simples


de clulas cbicas (Ee) e internamente por
uma camada simples de clulas colunares
(Ei). Na poro mediana observa-se um
estroma de preenchimento (Esp), que fica
quase que imperceptvel durante perodos de intensa atividade gametognica; o
manto est completamente ocupado por
folculos e lobos gametognicos.

Folculos e gametas femininos: estruturas


acinosas, delimitadas pelo epitlio folicular (Ef) composto por clulas germinativas
primordiais femininas (cgpf), que vo dar
origem s ovognias (ovg). Estas se desenvolvem em ovcitos (ovc), onde so
evidentes o ncleo (n) e nuclolo (nc).
possvel observar grnulos de vitelo (v)
nos ovcitos maduros e em eliminao.

Lobos e gametas masculinos: estruturas


acinosas (Lm), delimitadas pelo epitlio folicular (efm), composto por clulas
germinativas primordiais (cgp), que do
origem s espermatognias (esg) e vo
se diferenciar na srie espermtica radial
(SER): espermatcitos primrios (ep1) e
secundrios (ep2); espermtides (epm) e
espermatozoides (epz), que so eliminados atravs de ductos (dc).

Hermafroditismo: ocorrncia espordica


de um ou mais folculos masculinos dentre os femininos, podendo ocorrer o inverso. Darrigran et al. (1999) observaram
produo de ovcitos e espermatozoides
simultaneamente em um mesmo folculo.

Figura 2. Morfologia microscpica das estruturas gametognicas utilizadas como elementos de classificao dos estdios de
desenvolvimento folicular. A) manto feminino, B) manto masculino, C) folculos femininos, D) detalhes dos folculos femininos,
E) folculos masculinos, F) detalhes dos folculos masculinos, G) hermafrodita com manto masculino apresentando folculo
feminino, H) hermafrodita com manto feminino apresentando folculo masculino.

114

Ciclo reprodutivo


Os primeiros estudos que investigaram
a produo de gametas em mexilho-dourado
so oriundos dos locais de origem desta espcie. Na China, durante a fase de estabelecimento, a espcie apresentou dois picos reprodutivos
anuais Morton (1982), e em Kyoto, no Japo, a
atividade reprodutiva foi descrita como ocorrendo apenas uma vez ao ano (Iwasaki & Uryu,
1998). Segundo Morton (1982), duas desovas

anuais so comuns em bivalves que ocupam


guas rasas.

Durante o incio do processo de estabelecimento do mexilho-dourado na Amrica
do Sul, a produo de gametas foi contnua
com proliferao permanente de elementos gametognicos. Cinco picos de eliminao anuais foram inicialmente descritos no Balneario
Bagliardi, Rio da Prata, Argentina (Darrigran
et al., 1999). Boltovskoy & Cataldo (1999) inferiram uma desova contnua com base na den-

CAPTULO 7
Seo 2

IM Incio da Maturao: manto com


epiderme externa evidente e estroma de
preenchimento abundante. Os folculos
femininos so pequenos e esparsos e
apresentam o epitlio folicular espessado
pela presena de elementos proliferativos ovognias; possvel observar raros
ovcitos em incio de desenvolvimento.

EM Em Maturao: manto com presena de folculos femininos em expanso.


Internamente os ovcitos de tamanhos
variados esto em plena proliferao.
Epitlio folicular est se estendendo em
detrimento do aumento do volume dos
ovcitos. Processo de vitelognese ativo.

MA Maturo: manto completamente ocupado por folculos repletos de gametas


femininos. O intenso processo de vitelognese promove aumento expressivo no
tamanho dos ovcitos, tornando-os de
forma polidrica. Ncleos e nuclolos
aparentes.

EE Em Eliminao: observa-se o incio do


esvaziamento do manto e dos folculos.
Os folculos femininos apresentam espaos entre os ovcitos que esto sendo
eliminados atravs dos ductos. Os ductos
so constitudos de um epitlio simples
de clulas cuboides, densamente ciliadas
internamente.

Figura 3. Sucesso de estdios de desenvolvimento de gametas femininos de Limnoperna fortunei.

sidade de larvas no ambiente, porm, diferenas entre dados histolgicos e abundncia de


larvas no plncton podem ser explicadas como
resultante da deriva de larvas de aglomerados
de indivduos isolados em uma rea de estudo
contgua (Haag & Garton, 1992).

No Brasil, durante a fase de estabelecimento da populao na Praia do Veludo, Lago
Guaba, RS, a populao eliminou gametas
durante todo o perodo estudado (Marcelo
& Callil, 2006). Em experimentos desenvolvidos no reservatrio de Itaipu, Rio Iguau,
Silva (2006) descreve trs picos anuais e ainda
no Paran, no Rio Baa, o mexilho-dourado

tambm apresenta proliferao contnua com


dois picos pronunciados de eliminao. Neste
mesmo estudo, porm no Rio Paran, local relativamente prximo, a gametognese no foi
contnua, apresentando por trs meses consecutivos, um perodo de inatividade gonadal
Repouso (Gomes & Callil, 2010; Callil et al.,
2012). Os locais estudados no Rio Paran e no
Rio Baa so relativamente prximos, porm distintos quanto s caractersticas ambientais. Esse
padro de interrupo do processo gametognico, entrando em estado de Repouso, tambm foi
detectado no Rio Paraguai, em Corumb, MS,
regio central do Brasil (Uliana et al., 2008).

115

A gametognese em Limnoperna fortunei


(Dunker, 1857)
Callil et al.


Morton (1982) j afirmava que seria
muito difcil relacionar algum padro de desova, no apenas para L. fortunei, como tambm
para D. polymorpha e C. fluminea, porque estas
espcies geralmente so oportunistas, podendo
apresentar diversas estratgias para ocupar um
gradiente ambiental. A literatura disponvel
ilustra a afirmao de Morton (1982) e evidencia que durante o processo de estabelecimento
da espcie em um novo ambiente, ainda no
existem padres definidos, uma vez que h
uma grande variao na gametognese e momentos de desova e, consequentemente, nas
informaes relacionadas s densidades larvais
e ao perodo em que as larvas ocorrem em elevadas densidades.

Influncias ambientais
na gametognese


Muito se discute sobre a influncia de
fatores ambientais como agentes determinan-

tes de respostas reprodutivas. A temperatura,


disponibilidade de alimentos e os efeitos de
adensamento entre mexilhes vizinhos (macrofouling) tm sido descritas como variveis crticas que influenciam no processo de produo e
eliminao de gametas. No caso de organismos
de ampla distribuio, a identificao de fatores
que interferem diretamente em determinados
processos biolgicos pode ser bem complicada.
Desde o incio da invaso, durante o processo
de instalao de L. fortunei, a partir de uma
detalhada reviso da pouca literatura disponvel at ento, quase que exclusivamente relacionada distribuio desta espcie, Ricciardi
(1998) j sugeriu alguns limites de tolerncia s
variveis fsicas e qumicas da gua.

Todos os trabalhos disponveis sobre a
gametognese do mexilho-dourado associam
quase que exclusivamente temperatura como
fator determinante do desenvolvimento gametognico (Darrigran et al., 1999; Maroas et
al., 2003; Darrigran et al., 2003; Damborenea

Tabela II. Reviso dos estudos relacionados ao ciclo reprodutivo de mexilho-dourado na Amrica do Sul durante o perodo de
instalao e estabelecimento do mexilho-dourado, Limnoperna fortunei.

Fonte

116

Local

Perodo
amostral

Incio

Final

Abordagem

Variao
dos dados

Reproduo

Repouso

3 anos

1971

1974

Gametas

10,0-60,0m

mai/jun;
nov/dez

ausente

Morton, 1982

Hong Kong,
CH

Darrigran et al.,
1999

Rio de La Plata,
AR

30 meses

jul/92

nov/94

Gametas

41,19-64,37m

contnuo

ausente

Cataldo & Boltovskoy, 2000

Rio de La Plata,
AR

17 meses

set/97

jan/99

Larvas

0-28.000
ind.m-3

ago/abri

mai/jul

Darrigran et al.,
2002

Rio Paran,
AR

14 meses

abr/99

mai/01

Larvas

0-259,3 ind.m-3

out/mar

mai/ago

Uliana & Callil,


2006

Rio Paraguai,
MS

18 meses

ago/04

mar/06

Gametas

5,27-127,52
m

out/fev

jun/ago

Marcelo & Callil,


2006

Rio Jacu, RS

12 meses

jan/02

dez/02

Gametas

31,0-65,5 m

contnuo

ausente

Pestana et al.,
2008

Rio Paran,
PR

13 meses

jan/05

fev/06

Larvas

948,5 ind.m-3

jan/jun

jul/ago

Pestana et al.,
2008

Itaipu, R.
Iguau, PR

13 meses

jan/05

fev/06

Larvas

2.755 ind.m-3

set/fev

jul/ago

Boltovskoy et al.,
2009a

Paran-Prata,
AR

10 anos

1997

2006

Larvas

450-7.000
ind.m-3

vero> 17C

inverno
< 17C

Nakano et al.,
2010

Lago Takenuma,
JP

18 meses

jun/07

nov/08

Larvas

0-200 ind.m-3

jul/set
(17-28C)

out/mai

Nakano et al.,
2010

Lago Ohshio,
JP

18 meses

jun/07

nov/08

Larvas

0-10.000
ind.m-3

jul/set
(17-28C)

out/mai

Oliveira et al.,
2011

Rio Paraguai,
MS

47 meses

jan/04

nov/07

Larvas

1.629
4.571

set/abr
(28-35C)

ausente

Oliveira et al.,
2011

Rio Miranda,
MS

47 meses

jan/04

nov/07

Larvas

990 2.292

ago/set

fev/mar

CAPTULO 7
Seo 2

IM Incio da Maturao: no manto, o


estroma de preenchimento apresenta
inmeras clulas pequenas e isoladas,
ocupando a maior parte do manto. Lobos
gametognicos reduzidos e escassos. No
epitlio folicular so visveis espermatognias, sempre perifricas, e espermatcitos primrios desordenados.

EM Em Maturao: expanso dos lobos


pelo manto, que ainda apresenta-se razoavelmente ocupado pelo estroma. Nos
lobos, camadas de espermatognias desprendem-se do epitlio e comeam a se
diferenciar em espermatcitos primrios.
Apesar das clulas entrarem em meiose,
ainda no evidente a definio da srie
espermtica radial.

MA Maturao: os lobos aumentam muito em nmero e tamanho e preenchem


completamente o manto. A srie espermtica radial torna-se evidente e bem
organizada; os espermatozoides, aos milhares, aparecem sempre associados ao
lmen folicular.

EE Em Eliminao: lobos ainda ocupam


todo o manto, porm, com lmen evidente. Srie espermtica radial frouxamente
desorganizada. O lmen est mais amplo
que no estdio anterior e h a presena
quase que exclusiva de espermatozoides, que tambm podem ser visualizados
ocupando toda a extenso dos ductos.

Figura 4. Sucesso de estdios de desenvolvimento de gametas masculinos de Limnoperna fortunei.

& Penchaszadeh, 2006) e larval (Darrigran,


et al., 2002; Cataldo et al., 2005a; Bolovskoy
et al., 2009; Pestana et al., 2008; Oliveira et
al., 2011). de se esperar que a variao cclica da temperatura no esteja diretamente relacionada ao ciclo gametognico, mas sim, as
oscilaes repentinas de temperatura (Morton,
1982), que seriam o gatilho que dispara a desova (Ferreira & Magalhes, 2002). Entretanto,
quase consenso a ideia de que o efeito sinergtico de um conjunto de variveis ambientais
atua sincrnica e simultaneamente no ciclo reprodutivo. Morton (1982) j havia sinalizado
que existe uma multiplicidade de fatores que
determinam mudanas associadas qualidade

de gua e absolutamente um nico fator pode


no ser o determinante exclusivo pelo incio e
taxa de gametognese.

Em locais onde as variaes de temperatura so inexpressivas, as caractersticas da
gua podem ser reguladas pela dinmica hdrica, tpica das plancies de inundao sazonais, como o Pantanal e a Plancie Aluvial do
Rio Paran. Nestas reas midas, o pulso de
inundao peridico (Junk et al., 1989) pode
ser considerado o espelho que resume o sinergismo de fatores que regulam a dinmica sexual em moluscos lmnicos (Callil, 2003; Callil
& Mansur, 2007; Callil, 2009; Oliveira et al.,
2011; Callil et al., 2012).

117

A gametognese em Limnoperna fortunei


(Dunker, 1857)
Callil et al.


Sabemos que, para detectar fatores limitantes, experimentos rigorosos em campo e
laboratrio devem ser desenvolvidos a fim de
testar, inclusive, a variabilidade da tolerncia.
Estudos relacionados temperatura como fator regulador do desenvolvimento larval foram
conduzidos por Cataldo et al. (2005a), comprovando que h uma relao direta entre o incremento das taxas de desenvolvimento com o
aumento de temperatura. Oliveira et al. (2011)
demonstram que a temperatura, profundidade
e velocidade da gua so os fatores que afetam
estgios imaturos da populao de mexilho-dourado no Rio Paraguai, em Corumb, e discutem que o efeito combinado de vrias condies causadas por diferentes fatores podem
explicar as baixas densidades em alguns locais
do Pantanal.

Alm dos fatores abiticos, devemos levar em considerao as interferncias biticas
como qualidade e disponibilidade de recursos
alimentares e interaes inter e intraespecficas. O efeito da alimentao x sucesso reprodutivo tem sido atribudo por Borcherding
(1991), Ram et al. (1996) e Claxton & Mackie
(1998), sendo que a qualidade de alimento
pode influenciar inclusive o tamanho dos ovcitos (Wacker & Von Elert, 2003; Wilhelm &
Adrian, 2007). Morton (1982) ainda considerou a possibilidade de que a inalao de espermatozoides de indivduos da mesma espcie
induz desova simultnea. Esta estratgia

118

vantajosa para indivduos que formam aglomerados, maximizando o sucesso de fecundao,


principalmente durante o processo de instalao e estabelecimento da espcie em um novo
ambiente.
Apesar de seus impactos ecolgicos e
econmicos o mexilho-dourado pode ser usado como um novo recurso e de fcil obteno
para estudos de mecanismos de reproduo.

Fecundao

A proximidade de indivduos de sexos
opostos dentro dos agrupamentos, macrofouling, facilita o sucesso de fecundao externa. A
fecundao desta espcie externa e todas as
fases de desenvolvimento larval (mrula, trocfora, larva D, vliger, pedivliger e plantgrada)
so planctnicas, at que a fase de recruta ir
colonizar novos locais (Boltovskoy et al., 1999;
Santos et al., 2005). Liu et al. (apud Morton,
1982) afirmaram que L. fortunei incubam os
ovos dentro das quatro demibrnquias, porm,
o prprio Morton no confirma esta informao
e ainda questiona este tipo de comportamento,
uma vez que no usual dentre os Mytilidae,
os quais no apresentam estruturas adequadas
para a funo de incubao nos ctendeos. Ns
temos processado histologicamente vrias centenas de indivduos e em momento algum foram
observados casos de incubao, corroborando
os questionamentos de Morton (1982).

CAPTULO 8
Dinmica reprodutiva de
Corbicula fluminea e
Corbicula largillierti
Maria Cristina Dreher Mansur
Aline Salvador Vanin
Paulo Eduardo Aydos Bergonci
Arthur Schramm de Oliveira

1. Introduo


Espcies asiticas de Corbicula ocorrem
na Amrica do Sul desde o final da dcada de
60 e incio da de 70, no entanto, pouco ainda se
sabe sobre suas estratgias reprodutivas ao longo de gradientes climticos diferenciados nos
mananciais que ocuparam e seguem invadindo.
At h pouco tempo, os dados na literatura
eram extremamente contraditrios quanto
reproduo das corbculas de origem asitica.
C. fluminea (Mller, 1774) foi considerada
dioica com protandria, isto , as gnadas de
um mesmo indivduo seriam primeiramente
masculinas e mais tarde se tornariam femininas (Britton & Morton, 1982). Na Amrica do
Norte, Kraemer et al. (1986) observaram que
C. fluminea monoica com hermafroditismo
simultnea, ou seja, os folculos reprodutivos
so masculinos e femininos no mesmo indivduo. Mais tarde, Morton (1986) descreveu a
espcie C. fluminea da sia como dioica com
uma alta percentagem de hermafroditas em

ambientes lnticos, porm hermafrodita com


igual percentagem de fmeas e machos no ambiente ltico. Alm disso, vrias caractersticas
incomuns da biologia reprodutiva, tais como
poliploidia, esperma biflagelados diploides,
andrognese e clonalidade foram tambm observadas (Komaru & Konishi, 1996, 1999; Komaru et al., 1997; Qiu et al., 2001).

Kraemer & Galloway (1986) e Kraemer et al. (1986) constataram autofecundao e fecundao cruzada em C. fluminea, e
a presena de um espermatozoide biflagelado.
Estudos mais recentes surpreenderam com as
descobertas de Park & Chung (2004), que discordam quanto autofecundao. Estes autores observaram que: C. fluminea se reproduz
por partenognese, sem autofertilizao ou
fecundao cruzada por vulos ou espermatozoides; que a espcie um hermafrodita funcional, com as gnadas formadas por folculos
masculinos, femininos ou hermafroditas, no
mesmo indivduo; que no folculo hermafrodita, os vulos so circundados por inme-

119

Dinmica reprodutiva de
Corbicula fluminea e Corbicula largillierti
Mansur et al.

120

ros espermatozoides que atuariam apenas no


estmulo para a clivagem inicial dos vulos
maduros para a partenognese. Constataram
tambm triploidia, o que impediria uma fecundao cruzada normal.

Atravs dos estudos genticos desenvolvidos por Lee et al. (2005) sobre as populaes de Corbicula do continente americano
(incluindo populaes do Rio Paran), foi
constatada que grande parte da populao
seria triploide. Duas linhagens minoritrias,
ocorrendo em regies limitadas, foram ainda
detectadas com um padro diferenciado em
relao aos mitocndrios e ribossomos. No
entanto, todas as populaes apresentam o espermatozoide biflagelado, que seria o marcador morfolgico da clonalidade da espcie.

Para Fox (2004), os espermatozoides
que so liberados para o ambiente via abertura exalante, formam, ainda nos folculos,
grandes esferas denominadas esferas ou mrulas espermticas ou aglomerados espermticos (sperm clusters) segundo Park & Chung
(2004). Cada esfera formada por centenas de
espermatozoides. Esta esfera, uma vez liberada
no ambiente, entra atravs do sifo inalante na
cavidade palial de um outro indivduo. Ali, a
mrula se desmonta em espermatozoides individuais que atravessam as brnquias penetrando na cmara suprabranquial onde os vulos
presentes so fertilizados. Estes vulos, agora
embrionados, so incubados dentro dos tubos
aquferos das demibrnquias, na rea do marspio, permanecendo ali at a fase de pedivliger quando so liberados ao ambiente pela
abertura exalante.

Britton & Morton (1982) comentam
que o gnero Corbicula pode estar sujeito s
presses ambientais, tanto de espcies consideradas r estrategistas quanto as k estrategistas, o que explicaria seu grande sucesso
como invasora nos mananciais norte-americanos. Sob esta perspectiva, populaes localizadas em ambientes de guas lnticas, como
reservatrios, por exemplo, tendem a investir
no crescimento corporal, podendo atrasar o
perodo reprodutivo e at mesmo exibir fecundidade reduzida. Em habitat nativo, onde
esto sujeitas a condies variveis e menos
estveis, estes moluscos podem rapidamente
se ajustar como r estrategistas.

2. Perodos reprodutivos


Segundo Fox (2004), a liberao das larvas acontece duas vezes por ano: na primavera
e no outono.

Na Amrica do Sul, estudos revelaram
que C. fluminea apresenta um evento reprodutivo por ano: Cataldo & Boltovskoy (1999)
relataram para populaes do Rio Paran, um
perodo reprodutivo entre os meses de outubro e novembro; Ituarte (1985) observou na
populao do Rio da Prata, um pico no ms
de setembro. Massoli-Junior (2006) e Massoli-Junior & Callil (2012), ao analisarem aspectos
populacionais e reprodutivos de uma populao da praia da Vereda, Rio Cuiab, Municpio
de Santo Antnio do Leverger, MT, constataram que o incio do recrutamento ocorreu no
comeo da estiagem (junho de 2005), o declnio populacional no comeo da cheia (dezembro de 2004 e 2005) e um pico de atividade
reprodutiva no perodo da seca (setembro de
2005), com elevada proporo de indivduos
maturos e em maturao e com os maiores dimetros de folculos e ovcitos. Observaram,
ainda, a predominncia de folculos femininos
em relao aos masculinos e hermafroditas.

Sobre aspectos reprodutivos da espcie C.
largillierti (Philippi, 1844) encontram-se dados
apenas em Ituarte (1984a) que estudou a dinmica populacional desta espcie no Rio da Prata,
Argentina. O autor a descreveu como hermafrodita funcional com os tecidos masculinos e femininos no claramente segregados na massa visceral, e uma frao maior do feminino. Descreveu
tambm um ciclo reprodutivo bianual, com a liberao de larvas pedivliger na primavera e no
vero e um tempo de vida aproximado de 24 a
30 meses. Porm, encontrou ao longo de todo o
ano, indivduos com vulos maduros, e considerou que a temperatura seria o fator regulador do
sincronismo para a liberao das larvas. Observou tambm que as gnadas se desenvolvem cedo
nos indivduos e que 26% da populao apresentaram indivduos com embries nas brnquias, a
partir dos 11 a 12 mm de comprimento. A incubao dos embries ocorre nas demibrnquias
internas e a liberao dos mesmos se deu quando
atingiram a fase de larva vliger tardio (225 a
230 m de comprimento) ou de pedivliger (235
a 240 m de comprimento).

CAPTULO 8
Seo 2

3. Aspectos da dinmica
reprodutiva de C. largillierti e
C. fluminea em um reservatrio
tropical brasileiro.



Estudos recentes sobre duas populaes
(C. fluminea e C. largillierti) amostradas mensalmente (de fevereiro de 2010 a abril de 2011)
no reservatrio de Peixe-Angical, municpio de
Peixe, rio Tocantins, avaliaram a ocorrncia de
larvas incubadas (Mansur et al., 2011c). Exemplares foram coletados na margem do reservatrio, anestesiados com mentol e fixados em
lcool 70%. As valvas foram entreabertas para
a retirada das brnquias e estas examinadas
quanto presena e ausncia de embries (Fig.
1). As larvas foram separadas, homogeneizadas
em cmara de contagem (100 quadrculas/5
mm) (Fig. 2) sob a lupa. Quando em pequeno
nmero (<100) a contagem foi absoluta, acima
deste valor foi por sorteio de 10 quadrculas e
multiplicadas por 10.

A comparao entre o numero mdio de
indivduos incubados por espcie foi realizada
por meio do teste de Mann-Whitney (p =0,05).
O mesmo teste foi aplicado para a comparao
entre as estaes do ano (seca e chuvosa) para
cada espcie.

A temperatura na gua do reservatrio
variou de 26,4C a 34C, com as mais elevadas
de novembro a fevereiro. Os perodos de seca
na rea estudada vo de maio a setembro e os
de cheia, de outubro a abril.

Os resultados revelaram que durante o
perodo de fevereiro de 2010 a abril de 2011,
aproximadamente 1/3 dos indivduos adultos
apresentaram larvas incubadas nas brnquias.
Dentre os 909 espcimes de C. largillierti, 231
apresentaram larvas incubadas nas brnquias,
ou seja, 25,41% da populao analisada estavam em atividade reprodutiva. De maneira
semelhante, C. fluminea apresentou 334 indivduos incubados dentre os 1217 indivduos
analisados, isto , 27,44% do total estavam em
processo reprodutivo, com larvas incubadas
nas brnquias.

O exame do contedo larval junto s
brnquias revelou que as populaes das espcies C. largillierti e C. fluminea apresentaram
produo larval praticamente durante todo o
ano (Figs. 3 e 4), tanto durante o perodo de

Figura 1. Brnquia direita de Corbicula largillierti com a demibrnquia externa rebatida e a interna contendo embries encubados. Legenda: DBE demibrnquia externa, DBI demibrnquia interna, E embries, M marspio. Foto: M.C.D. Mansur

Figura 2. Cmara de contagem (100 quadrculas/ 5 mm). Foto:


M.C.D. Mansur

seca (maio a setembro) quanto no chuvoso (outubro a abril) (Fig. 4). Com base na Figura 5
tambm se observa que C. largillierti apresenta
uma diferena de cerca de 10% entre os perodos de seca e chuva, provavelmente relacionada
falta de exemplares desta espcie nos meses
de outubro e dezembro de 2010 e janeiro de
2011 (Fig. 3).

Em fevereiro (16/02/2011) constatou-se,
em trs exemplares de C. largillierti, ovos em
clivagem inicial, em grande quantidade, e raras larvas em estgio de ps-larva ainda retidas
nos marspios, demonstrando a continuidade
do ciclo (Fig. 6). A incubao de larvas nas
demibrnquias interna e externa dos bivalves
analisados revelou que tanto para C. largillierti
quanto para C. fluminea, a incubao ocorre
em sua maior parte nas demibrnquias internas
e eventualmente aparecem embries esparsos
nas externas, porm em baixa quantidade (Fig.
7). Comparando apenas a ocorrncia de embries nas demibrnquias externas, C. largillierti
apresentou proporcionalmente maior ocorrncia de larvas do que C. fluminea. A observao
dos estgios larvais revelou que o desenvolvimento dos embries e a liberao das larvas
sincronizado nas duas espcies.

121

Dinmica reprodutiva de
Corbicula fluminea e Corbicula largillierti
Mansur et al.

Figura 3. Variao temporal do percentual de indivduos de Corbicula largillierti incubados no reservatrio da UHE Peixe-Angical.

Figura 4. Variao temporal do percentual de indivduos de Corbicula fluminea incubados no reservatrio da UHE Peixe-Angical.

122

Figura 5. Percentual de indivduos adultos incubados e no incubados das duas espcies de corbculas por estao chuvosa e seca.

CAPTULO 8
Seo 2

Figura 6. Larvas de C. largillierti encubadas no marspio, em


fases larvais distintas de desenvolvimento: embrio em processo inicial de clivagem ( direita) e na fase final, antes da
liberao ( esquerda). (Foto: M.C.D. Mansur e A.S. Vanin).

Figura 7. Nmero de ocorrncias de larvas nas demibrnquias


interna (DI) e externa (DE) direita e esquerda de C. largillierti
e C. fluminea.

Figura 8. Nmero mdio de larvas incubadas (ep) por estao do ano (chuvosa e seca) e total em duas espcies de
corbiculdeos.

Figura 9. C. largillierti com embries em processo inicial de


clivagem no marspio, com massa gelatinosa envolvendo as
larvas. (Foto: M.C.D. Mansur e A.S. Vanin).


Dentre os exemplares incubados foram
encontradas 53.772 larvas em C. fluminea e
86.246 em C. largillierti, com o nmero mximo
de larvas por me de 6.044 em C. fluminea, e
de 6.714 em C. largillierti. A quantidade mdia
de larvas incubadas em C. largillierti significativamente superior (p= 0,001) quantidade
mdia de larvas incubadas em C. fluminea (Fig.
8). Da mesma forma, quando comparados por
perodo sazonal (chuva e seca), verificou-se
para C. largillierti maior quantidade de larvas
no perodo de seca que na chuva (p = 0,002).
J para C. fluminea, os valores mdios de larvas incubadas por estao do ano foram mais
prximos, fazendo com que estes no tenham
se distinguido estatisticamente (p = 0,289) (Fig.
8). O nmero mdio de larvas incubadas variou
sazonalmente nas duas espcies de corbiculdeos, sendo que C. largillierti apresentou um pico

no nmero total de larvas no perodo de seca e


em C. fluminea o nmero de larvas incubadas
manteve-se constante ao longo do ano.

Cabe ainda comentar que alm do sincronismo no desenvolvimento dos embries,
que formam verdadeiras ninhadas, os embries
esto envoltos e unidos por uma massa gelatinosa muito conspcua nas fases iniciais de
desenvolvimento, perceptvel, principalmente,
em C. largillierti (Fig. 9).

O comportamento reprodutivo das duas
espcies de Corbicula no reservatrio de Peixe-Angical difere daquele observado para as populaes destas mesmas espcies nas bacias hidrogrficas da regio subtropical, quais sejam:
um evento reprodutivo para C. fluminea na primavera (Ituarte, 1985; Cataldo & Boltovskoy,
1999) e para C. largillierti, na primavera e no
vero (Ituarte, 1984a), junto bacia do Paran.

123

Dinmica reprodutiva de
Corbicula fluminea e Corbicula largillierti
Mansur et al.


No Pantanal Norte, onde as temperaturas so sempre altas com ciclos de cheia e seca,
acontece um evento reprodutivo no incio da
seca para C. fluminea (Massoli-Junior, 2006).
No reservatrio do Rio Tocantins, ambas as espcies C. fluminea e C. largillierti apresentam
em torno de 26% dos indivduos com presena
de larvas incubadas durante todo o ano. O nmero mdio de larvas incubadas em C. largillierti foi significativamente maior na estao seca.

Segundo McMahon & Williams (1986)

124

temperaturas altas, prximas de 36C, seria o


limite letal de populaes naturais de C. fluminea nos EUA e temperaturas em torno de 30C
impediriam a formao do cordo mucoso no
juvenil, o que dificultaria o recrutamento dos
animais junto ao substrato. No entanto, mesmo
sob temperaturas extremas na gua do reservatrio, que podem chegar a 34C no perodo
de novembro a fevereiro, no foram observados
declnios na densidade larval nem populacional
das duas espcies (Mansur et al., 2011c).

CAPTULO 9
Gastrpodes lmnicos invasores:
morfologia comparada
Monica Ammon Fernandez
Sonia Barbosa dos Santos
Igor Christo Miyahira
Isabela Cristina Brito Gonalves
Renata de Freitas Ximenes
Silvana Carvalho Thiengo

1. Introduo


A morfologia da concha um dos mais
tradicionais critrios para a identificao sistemtica dos moluscos. Mesmo considerando a
convergncia morfolgica, que pode ser observada em grupos sem relacionamento filogentico prximo, ainda assim os detalhes da concha,
sua ornamentao e escultura, so importantes auxiliares nesta tarefa. A Classe Gastropoda tradicionalmente dividida nas Subclasses
Prosobranchia, Opistobranchia e Pulmonata
(Hyman, 1967; Ruppert et al., 2005). Essa
classificao admite como critrio as sucessivas
modificaes da cavidade palial (= cavidade do
manto) e das estruturas nela contidas. Assim,
Prosobranchia significa que a cavidade palial e
as estruturas associadas (entre elas brnquias e
osfrdio) esto situadas na poro anterior da
massa visceral, acima da cabea do gastrpode
(as brnquias esto situadas em posio anterior
ao pericrdio); nos Opistobranchia, a cavidade
palial e as brnquias, em consequncia de um

processo chamado detoro da massa visceral,


ocupam a posio posterior; nos Pulmonata, a
cavidade palial ocupa a posio anterior, assim
como nos prosobrnquios, mas as brnquias esto ausentes. Nesse caso, a troca gasosa passa
a ser efetuada por uma extensa rede vascular
no teto da cavidade palial. Em alguns grupos
a cavidade palial reduzida e em outros desaparece por completo, como em algumas lesmas
terrestres. Entre o molusco ancestral, o padro
prosobrnquio tpico, o padro opistobrnquio
tpico e o padro pulmonado, existem diversas
etapas intermedirias que suportam a hiptese gradista de evoluo no sentido Prosobranchia-Opistobranchia-Pulmonata (Hyman,
1967; Brusca & Brusca, 2007).

A Subclasse Pulmonata engloba gastrpodes lmnicos e terrestres, com conchas espiraladas, que podem estar reduzidas ou mesmo
ausentes, geralmente sem oprculo, hermafroditas, com uma aurcula anterior ao ventrculo,
sem brnquias e com a abertura da cavidade
do manto modificada pela fuso com a regio

125

Gastrpodes lmnicos invasores:


morfologia comparada
Fernandez et al.

Figura 1. Esquema generalizado de Prosobranchia. 1, propdio; 2, gnglio pleural esquerdo; 3, sifo; 4, comissura nervosa pleuro-intestinal; 5, osfrdio; 6, brnquia; 7, gnglio
supraintestinal; 8, aurcula; 10, ventrculo; 11, p; 12. oprculo; 13, gnglio pedioso esquerdo; 14, boca; 15, tentculo;
16, olho; 17, tentculo pedioso; 19, gnglio cerebroide direito;
20, comissura nervosa crebro-intestinal; 21, sulco genital;
22, cavidade palial; 23, gnglio subintestinal; 24, nus; 25,
hepatopncreas (=glndula digestiva); 26, poro genital masculino; 27, reto; 28, rim. (Fonte: https://commons.wikimedia.
org/wiki/File:Prosobranchia_male.svg. Michal Maas)

126

do pescoo, de modo a formar um saco pulmonar, o qual se comunica com o ambiente


exterior atravs de uma abertura contrtil, o
pneumstoma. Classicamente dividida em
trs Ordens: Stylommatophora, Systelommatophora e Basommatophora. Esta ltima engloba
gastrpodes lmnicos e marinhos e apresenta as
seguintes caractersticas: concha pateliforme,
planispiralada ou conispiralada, olhos na base
do nico par de tentculos no invaginveis,
hermafroditas, geralmente com duas aberturas genitais (Hyman, 1967; Brusca & Brusca,
2007). Embora na literatura possam ser encontrados arranjos diferentes, admite-se que
na Amrica do Sul cinco famlias representam
os Basommatophora no ambiente lmnico:

Ancylidae, Chilinidae, Physidae, Lymnaeidae


e Planorbidae (Paraense, 1981b). Inequivocamente, as duas ltimas so as mais estudadas,
por inclurem os moluscos transmissores da fasciolose e da esquistossomose, respectivamente.

Outra diviso dos Gastropoda leva em
conta a morfologia do sistema nervoso, considerando dois grupos: Streptoneura (= Prosobranchia), isto , com cruzamento dos conectivos
pleuro-viscerais e Euthyneura (= Opistobranchia + Pulmonata), que no apresentam esse
cruzamento (Hyman, 1967). Ambos os sistemas de classificao acima so considerados
obsoletos, no dando conta de abranger a
imensidade de padres morfolgicos encontrados nos gastrpodes e explic-los do ponto de vista filogentico. Detalhes sobre essas
divises podem ser vistos nos livros-textos de
Zoologia, como Ruppert et al. (2005) e Brusca
& Brusca (2007). Com o advento dos mtodos
cladsticos, a sistemtica de Gastropoda est
em franca modificao (Bieler, 1992), a qual
foi sumarizada mais recentemente por Bouchet
& Rocroi (2005). Abordagens filogenticas dos
diversos grupos de Gastropoda, bem como dos
demais moluscos, podem ser vistas em Ponder
& Lindberg (2008). A Figura 1 mostra um esquema de prosobrnquio generalizado.

A Subclasse Prosobranchia , numa viso gradista, subdividida em Ordens segundo
o grau de evoluo do complexo palial e das
estruturas do sistema reprodutor: Archaeogastropoda, Mesogastropoda e Neogastropoda.
Hoje, embora haja diferenas entre os autores,
reconhece-se, pela sistemtica cladstica, pelo
menos cinco grandes clados em Gastropoda:
Patellogastropoda, Vetigastropoda, Neritopsina, Caenogastropoda (=Mesogastropoda +
Neogastropoda) e Heterobranchia (Colgan et
al., 2003; Haszprunar, 1988; Ponder & Lindberg, 1997). Pulmonata est includo em Heterobranchia.

Usando uma conotao ampla, os prosobrnquios constituem um grupo muito diversificado de gastrpodes, com cerca de 55.000
espcies descritas, as quais ocupam uma ampla
gama de ambientes marinhos, estuarinos, lmnicos e terrestres, alm de famlias com hbito
parasitrio. As caractersticas externas mais
evidentes dos prosobrnquios so a concha
em geral cnico-espiralada, esculturada e/ou

CAPTULO 9
Seo 2

Figura 2. Conchas de representantes de prosobrnquios


em ambientes lmnicos no
Brasil: A, Hydrobiidae (Rissooidea); B, Ampullariidae,
C, Pleuroceridae D, Thiaridae. Escala, 1 cm. (Fotos: A,
S. Almeida; B e D, P.M. Coelho; C, L.R. Simone).

ornamentada, e a presena de um oprculo


crneo ou calcrio, preso regio dorsal do
p, que fecha a abertura da concha. Trata-se
de um grupo predominantemente marinho,
mas com diversas incurses na gua doce (por
exemplo, Ampullariidae, Hydrobiidae, Thiaridae e Pleuroceridae) e no ambiente terrestre
(por exemplo, Helicinidae e Cyclophoridae).
A Figura 2 mostra alguns representantes do
grupo em nossos sistemas lmnicos.


2. Morfologia comparada de

Melanoides tuberculata
(Mller, 1774)
Melanoides tuberculata um Caenogastropoda do clado Cerithioidea, considerado
monofiltico (Colgan et al., 2000; Simone,
2001; Lydeard et al., 2002) e um clado basal
em Caenogastropoda (Strong et al., 2011). Na
sistemtica gradista est inserido na Ordem
Mesogastropoda (Hyman, 1967). A morfologia da concha turriforme, com pequena abertura, canal sifonal anterior e uma ou mais
linhas espirais com tubrculos, espinhos ou
ndulos, considerada quase que exclusiva
dos Cerithioidea (Slgeback & Savazzi, 2006),
representando diversas adaptaes funcionais. Segundo Strong et al. (2011), o clado Cerithioidea caracterizado pelos machos aflicos, pelos gonodutos abertos e reproduo via
espermatforos, caracteres considerados plesiomrficos, alm da complexidade do trato
genital feminino.

Melanoides tuberculata, includa em Thiaridae, pode ser confundida com outras espcies
de moluscos lmnicos, tanto nativas do Brasil,
como as dos gneros Aylacostoma Spix in Wagner, 1827 (Thiaridae) (Fig. 4F) e Doryssa H. & A.

Adams, 1854 (Pleuroceridae) (Fig. 2C), como


as exticas, como por exemplo Tarebia granifera (Lamarck, 1822) (Thiaridae). Esta ltima
espcie ainda no foi registrada para o Brasil,
mas est presente na Amrica do Norte, Amrica Central e Caribe (Pointier et al., 1998). Na
Amrica do Sul, temos registros apenas na Venezuela (Pointier et al., 1994; Amarista et al.,
2001).

Segundo Simone (2006), existem 33
espcies nominais de Aylacostoma no Brasil,
as quais ocorrem em todas as regies de nosso pas. No gnero Doryssa so reconhecidas
37 espcies nominais, as quais se distribuem
principalmente no norte do Brasil, na regio
Amaznica (Simone, 2006). Ambos os gneros guardam muitas semelhanas, sendo difcil
separ-los somente pelos caracteres da concha
(Morrison, 1954).

Os Rissooidea lmnicos no Brasil so de
pequeno porte, com conchas na escala dos milmetros, raramente alcanando 7 mm. Podem ser
confundidos com jovens de M. tuberculata, com
at cinco ou seis voltas, especialmente os gneros com concha cnico-alongada, como Heleobia
Simpson, 1865 e Idiopyrgus Pilsbry, 1911. Um
exame sob binocular capaz de diferenci-los,
pois em geral os Rissooidea lmnicos apresentam conchas lisas, com voltas arredondadas e
raramente o pice perdido. Nos ambientes de
gua doce do Brasil este grupo representado
por pequenos caramujos pertencentes aos gneros Littoridina Eydoux & Souleyet, 1852 (=
Heleobia); Potamolithus Pilsbry, 1896; Lyrodes
Dring, 1884; Sioliella Haas, 1949 e Idiopyrgus,
segundo Simone (2006). Todavia, os Rissooidea
lmnicos no Brasil possuem a concha lisa (Fig.
2A), enquanto nos tiardeos a concha bastante
esculturada (Fig. 2D).

127

Gastrpodes lmnicos invasores:


morfologia comparada
Fernandez et al.

128

2.1. Morfologia externa


No Brasil existem poucos estudos sobre
a morfologia de M. tuberculata. Simone (2001,
2006) apresenta comparaes da morfologia da
concha e das partes moles com outros Cerithioidea. Descreve a concha como sendo de tamanho
mdio (cerca de 3 cm), cuja escultura apresenta
aspecto reticulado. O peristraco escuro, espesso, e o straco bege, com manchas marrons
em disposio axial. Simone (2001) tambm afirma que a presena de uma escultura radial bem
marcada distingue M. tuberculata das espcies
de Aylacostoma. Gonalves et al. (2010) acompanharam uma populao de M. tuberculata durante trs anos na Ilha Grande, Angra dos Reis,
RJ, e observaram a existncia de trs morfotipos
(Fig. 3), baseados nos padres de colorao. Lago
et al. (2009) analisaram a conquiliometria de 11
populaes de M. tuberculata oriundas do estado
do Rio de Janeiro, provenientes de dois diferentes
bitopos (rio e vala), encontrando diferena significativa apenas no dimetro da abertura entre
conchas dos dois bitopos.

Apesar das semelhanas com espcies
nativas de Thiaridae e de Pleuroceridae, alguns
detalhes permitem a sua diferenciao. As conchas de Pleuroceridae e de Thiaridae nativos,
usualmente so grossas e apresentam forte esculturao, composta por ndulos e costelas
(Fig. 2 C-D, Fig. 4F). difcil estabelecer um
quadro comparativo, pois existe uma ampla variao de forma nas espcies dos gneros, que
se refletem nas propores da concha e na colorao, como se observa em M. tuberculata (Fig.
4 A-E). Talvez a caracterstica mais conspcua
seja a espessura da concha, muito grossa e resistente em Aylacostoma e em Doryssa, quando
comparadas Melanoides Oliver, 1804, cuja
concha mais delicada, apesar de espessa.

A concha de Aylacostoma alongada,
mas existe uma tendncia ao abaulamento da
volta corporal em muitas espcies, com formao de uma quilha ou carena (Fig. 4F); em
Melanoides a concha nunca forma carena e o
perfil alongado cresce suavemente, sem abaulamento pronunciado da volta corporal, que em
geral no apresenta quilha (Fig. 4 A-E). Outra
diferena a presena de um curto entalhe sifonal na margem inferior da abertura da concha de Aylacostoma, aspecto no observado em
M. tuberculata.

Figura 3. Variao morfolgica em M. tuberculata (Mller,


1774) da Ilha Grande, Rio de Janeiro, mostrando as variaes
na ornamentao colorida da concha. A, ausncia de flmulas
acastanhadas e banda columelar; B, presena de flmulas e
ausncia de banda columelar; C, presena de banda columelar e flmulas. Escala = 1 cm (Fotos: I.C. Miyahira).

Figura 4. Morfologia de conchas de Melanoides tuberculata


(Mller, 1774) (A, B, C, D, E) em comparao com concha de
Aylacostoma sp. (F). A, Vila do Abrao, Ilha Grande, RJ; B, Praia
Vermelha, Ilha Grande, RJ; C, Vala da Fiocruz, Rio de Janeiro,
RJ; D, Maric, Rio de Janeiro, RJ; E, Jijoca de Jericoacoara, CE;
F, Mocambinho, MG. Todas as escalas = 1 cm.

CAPTULO 9
Seo 2


Em Doryssa encontramos desde conchas
lisas at fortemente esculturadas, com perda do
pice em algumas espcies. Em geral inexiste
entalhe sifonal, assim como em M. tuberculata;
a volta corporal abaulada em algumas espcies. Ou seja, existe uma superposio de caractersticas morfolgicas que dificultam uma
caracterizao exata, as quais exigem uma reviso das espcies atribudas Aylacostoma e
Doryssa.

Melanoides tuberculata possui p e cabea com colorao escura (Simone, 2001) ou
com manchas amareladas (Brandt, 1974). A probscide ampla, achatada dorso-ventralmente,
com a margem anterior bilobada. Os tentculos possuem comprimento semelhante ao da
probscide. Os olhos so escuros, prximos
base dos tentculos e sem omatforos (Simone,
2001). O bordo do manto franjado (Benthem-Jutting, 1956; Brandt, 1974, Simone, 2001).

2.2. Morfologia interna


Uma descrio detalhada da morfologia
interna de fmeas de M. tuberculata foi apresentada por Simone (2001). A disposio dos
principais rgos observados externamente
pode ser vista na Figura 5.
Manto

Apresenta colorao amarelo-creme plido, deixando perceber por transparncia os
rgos da massa visceral. O bordo do manto
esbranquiado e espessado, com lobos franjados, em geral de forma regular, mas podem ser
irregulares, como figurado por Simone (2001).

Cavidade palial


A abertura da cavidade palial ampla.

No teto da cavidade palial (Fig. 6) observamos o osfrdio, a brnquia e o oviduto.
O osfrdio alongado, semelhante a um sulco,
com aproximadamente metade a um tero do
comprimento da brnquia, situado posteriormente ao incio da mesma.

Figura 5. Fmea de Melanoides tuberculata (Mller, 1774), retirada da concha: bm, bordo do manto franjado; g, gnada
imersa na glndula digestiva; i, intestino; m, marspio; mv,
massa visceral. Escala= 1 cm. (Foto: R.F. Ximenes).

Sistema digestrio


O sistema digestrio completo, apresentando massa bucal, esfago, estmago, glndula

Figura 6. Desenho esquemtico do teto da cavidade palial de


Melanoides tuberculata (Mller, 1774). (Desenho: R.F. Ximenes).

digestiva, intestino e nus. O esfago no apresenta glndulas acessrias. O reto largo e amplo. O nus sifonado (Simone, 2001).

A rdula (Fig. 7) curta e possui um
formato semelhante ao de um S. Os dentes
raquidianos apresentam sete cspides cada; os
dentes laterais com cinco cspides cada, sendo a segunda mais larga; os dentes marginais
possuem cinco cspides cada (Simone, 2001).
A rdula do tipo tenioglossa, cuja frmula
radular 2.1.1.1.2 (Benthem-Jutting, 1956).
Brandt (1974) fornece a frmula radular com
a indicao do nmero de dentculos em cada
dente: C 4-1-4, L 1-1-4, M1 9, M2 10.

Sistema circulatrio


O sistema circulatrio similar ao de
outros tiardeos. Apresenta um corao grande, situado posteriormente na cavidade palial,
depois das brnquias. A aurcula maior que o
ventrculo (Simone, 2001, Fig. 8).

129

Gastrpodes lmnicos invasores:


morfologia comparada
Fernandez et al.

Figura 7. Rdula de Melanoides tuberculata,


exemplar oriundo da Vila do Abrao, Ilha
Grande, Angra dos Reis, Rio de Janeiro. A,
Panorama geral da rdula, escala = 100
m. B, Detalhe do dente raquidiano (central), escala = 10 m. C, Detalhe do dente
lateral, escala = 10 m. D, Detalhe dos
dentes marginais. Escala= 20 m. (Fotos:
A.C.N. Moraes, Laboratrio de Microscopia Eletrnica UERJ).

Sistema excretor


O sistema excretor apresenta rim grande, de cor creme, medindo aproximadamente
de um tero metade do comprimento da volta corporal, situado no limite posterior-direito
da cavidade palial. Possui dois lobos, ambos
relativamente ocos, com uma srie de septos
transversais. O nefrstoma est localizado na
extremidade posterior direita da membrana
entre o rim e a cavidade palial, prximo ao
reto (Simone, 2001, Fig. 8). Difere das espcies
nativas de Thiaridae j conhecidas, do gnero
Aylacostoma, que tambm apresentam um rim
bilobado, mas um dos lobos slido, glandular
(Simone, 2001).

Sistema reprodutivo


Melanoides tuberculata uma espcie
dioica, como a maioria dos prosobrnquios,
apesar da partenognese ser o meio de reproduo mais comum. As fmeas possuem um
sistema reprodutivo composto por ovrio, oviduto palial e marspio (Berry & Kadri, 1974).
O ovrio apresenta uma colorao amarelada
(Fig. 9A) e se encontra parcialmente inserido
na glndula digestiva (Berry & Kadri, 1974;
Heller & Farstay, 1989). O oviduto palial totalmente fechado, sendo um tubo estreito com
paredes espessas, com abertura prxima ao
nus, sem glndulas acessrias (Berry & Kadri, 1974; Simone, 2001). O marspio uma

130
Figura 8. Detalhe do complexo renopericrdico: esquerda, Melanoides tuberculata (Mller, 1774); direita, Aylacostoma
exoplicata Simone, 2001. (aa), aorta anterior; (au), aurcula; (cp), cavidade palial; (in), intestino; (mr), membrana renal; (nj), nefrstoma; (ov), oviduto; (pe), pericrdio; (ra), lobo renal anterior; (rp), lobo renal posterior; (se), saco do estilo; (ve), ventrculo.
Modificado de Simone (2001, figs. 176 e 120, respectivamente).

CAPTULO 9
Seo 2

cmara espaosa, localizado na regio anterodorsal do corpo, dorsal ao esfago, abrindo-se


para o exterior atravs de um pequeno poro do
lado direito, acima da massa pediosa, prximo
ao msculo columelar (Simone, 2001). Externamente, o marspio forma uma protuberncia
atrs dos tentculos e da massa bucal. O marspio internamente dividido por parties de
tecido muscular em compartimentos irregulares. Normalmente encontra-se no marspio
de M. tuberculata juvenis em todas as fases de
desenvolvimento, de ovos at juvenis de cinco
a seis voltas (Berry & Kadri, 1974; Dudgeon,
1986; Simone, 2001; Ben-Ami & Hodgson,
2005).

Os machos so raros e apresentam testculo grande e vermelho-acastanhado no animal vivo (Fig. 9B), com tamanho aproximado
ao da glndula digestiva (Heller & Farstay,
1989). O testculo lobulado e se estende ao
longo das voltas corporais, embutido na glndula digestiva. Os lobos testiculares confluem
em um ducto que conduz prstata. A partir
da prstata se estende um longo vaso deferente
(Livshits & Fishelson, 1983).

Figura 9. Melanoides tuberculata (Mller, 1774). Comparao


entre a colorao das gnadas de fmeas (A) e machos (B).
Fotos: R.F. Ximenes.

3. Helisoma duryi (Wetherby, 1879)



e Helisoma trivolvis (Say, 1817)

3.1. Morfologia comparada de


Helisoma spp.


Helisoma duryi (Fig. 10A) e Helisoma trivolvis
(Fig. 10B) podem ser confundidos com outros planorbdeos nativos, como por exemplo, Biomphalaria tenagophila (dOrbigny,
1835), Biomphalaria occidentalis Paraense,
1981 e Biomphalaria tenagophila guaibensis
Paraense, 1984, os quais geralmente apresentam conchas planispirais altas. A concha das
espcies mencionadas e de Helisoma spp. so
apresentadas na Figura 11. A diferenciao
dessas espcies importante tanto sob o ponto de vista biolgico, quanto parasitolgico,
uma vez que B. tenagophila uma das trs espcies transmissoras naturais de Schistosoma
mansoni Sambon, 1907, trematdeo que causa
a esquistossomose, uma das principais endemias do pas, pois ainda acomete milhares de
pessoas.

131

Figura 10. Exemplares vivos de Helisoma. A, H. duryi


(Wetherby, 1879); B, H. trivolvis (Say, 1817). Escala: 5 mm.
Fotos: P.M. Coelho.


As espcies de Biomphalaria (Fig. 11
C-E) possuem concha mais frgil e espessura da
borda da concha mais delicada, quando comparada s de Helisoma spp., embora a observao do complexo genital seja necessria para a
diferenciao especfica. A relao tamanho da

Gastrpodes lmnicos invasores:


morfologia comparada
Fernandez et al.

Figura 11. Conchas de espcies nativas e exticas de Planorbidae. Para cada espcie apresentada, respectivamente, o lado
direito, a viso frontal e o lado esquerdo. A, Helisoma duryi (Wetherby, 1879); B, Helisoma trivolvis (Say, 1817); C, Biomphalaria
tenagophila (dOrbigny, 1835); D, Biomphalaria occidentalis Paraense, 1981; E; Biomphalaria tenagophila guaibensis Paraense,
1984; Escala: 5 mm. (Fotos: P.M. Coelho).

132

concha e crescimento dos giros pode tambm


ser um indicativo, uma vez que em Helisoma os
giros crescem rapidamente em dimetro. Semelhanas entre Biomphalaria sp. e Helisoma sp.
encontram-se tambm na morfologia interna,
como por exemplo, no tubo renal (em forma
de J), mandbula (com uma pea transversal superior mais larga e duas peas laterais inferiores verticais muito mais estreitas), rdula (em
fita aproximadamente retangular), hemolinfa
(vermelha, devido presena de hemoglobina),
pseudobrnquia (folicea, aproximadamente
triangular, com a face lateral percorrida longitudinalmente pela extremidade da crista retal)
e posio de alguns rgos (glndulas salivares
passando por fora do anel ganglionar periesofagiano e intestino anterior cruzando a superfcie ventral da glndula do albmen), como
descrito por Paraense (1975).

3.2. Morfologia externa


H algumas dcadas, pelo menos duas
espcies, H. duryi e H. trivolvis, originrias dos
Estados Unidos da Amrica, tm sido registradas em algumas ilhas do Caribe e em pases da
Amrica do Sul, inclusive no Brasil. As conchas
destas duas espcies so muito semelhantes, o
que torna muito difcil a identificao apenas
pela conquiliologia (Tab. I).

Ambas as espcies apresentam concha plaTabela I. Diferenas entre as conchas de Helisoma trivolvis
(Wetherby, 1879); e Helisoma duryi (Say, 1817).

Helisoma trivolvis

Helisoma duryi

Dimetro da concha

At cerca de
25 mm

At cerca de
18 mm

Largura na abertura

9 mm

8,5 mm

5,5

Nmero de giros

Fonte: Paraense, 1975; Paraense, 1976a, b.

CAPTULO 9
Seo 2

nispiral, que aumentam rapidamente em dimetro, carenados (com vinco) no lado esquerdo e subcarenados no lado direito, separados por suturas
profundas; abertura da concha dilatada, quando
comparada s espcies do gnero Biomphalaria.
Em Helisoma, geralmente as estrias de crescimento so muito visveis nos giros, uma caracterstica
do gnero, de acordo com Paraense (1975).
Tanto B. occidentalis quanto B. tenagophila apresentam concha planispiral com aproximadamente 7 giros ou voltas que crescem
lentamente em dimetro, carenados, mais acentuadamente no lado esquerdo em B. tenagophila
e em ambos os lados em B. occidentalis; suturas profundas e abertura variando de deltoide
a cordiforme (Fig. 12). Ao descrever B. tenagophila guaibensis, Paraense (1984) comentou que
a concha dos espcimes do Guaba, RS, no se
distingue das de B. tenagophila. Estas trs espcies apresentam a concha mais alta quando comparada s demais espcies de Biomphalaria Sul-americanas, de acordo com Paraense (1981b).

Durante muito tempo B. occidentalis,
com ocorrncia principalmente no Brasil Central, foi identificada como B. tenagophila. O
estudo da morfologia interna, entretanto, re-

velou diferenas, entre elas, a ausncia de bolsa


vaginal em B. occidentalis e a forma e tamanho
do prepcio, maior nessa espcie (Fig. 13).
interessante ressaltar que apesar da grande semelhana, B. occidentalis no transmissora
da esquistossomose.

3.3. Morfologia interna


Os planorbdeos so hermafroditas, capazes de realizar a autofecundao, quando necessrio. Em linhas gerais o sistema reprodutor
composto por ovoteste (onde so produzidos
vulos e espermatozoides), vescula seminal,
ovispermiduto, oviduto, vagina, espermiduto,
prstata, espermateca, canal deferente, bainha
do pnis, prepcio e pnis. O complexo peniano de Helisoma (Fig. 13) difere na forma e tamanho dos rgos, quando comparado com as
espcies de Biomphalaria (Fig. 14).

As principais caractersticas que permitem a rpida distino entre H. duryi e H. trivolvis esto no comprimento do canal da espermateca, bem mais longo em H. trivolvis, e no
prepcio e bainha do pnis, em forma de pera
em H. duryi (Fig. 13, Tab. II).

133

Figura 12. Desenhos das conchas de espcies nativas e exticas de Planorbidae. Para cada espcie esto ilustrados, respectivamente, o lado esquerdo, a viso frontal e o lado direito. A, Helisoma duryi (Wetherby, 1879); B, H. trivolvis (Say, 1817); C, B.
tenagophila (dOrbigny, 1835); B. occidentalis Paraense, 1981; E, B. tenagophila guaibensis Paraense, 1984. Extrados de Paraense (1975, 1981b, 1984, 2003).

Gastrpodes lmnicos invasores:


morfologia comparada
Fernandez et al.

Tabela II. Diferenas na morfologia interna de Helisoma trivolvis (Say, 1817) e Helisoma duryi (Wetherby, 1879).

Helisoma trivolvis

Helisoma duryi

Prstata

Com cerca de 6 a 14 divertculos arborescentes

Com cerca de 4 a 8 divertculos longos, quase todos


arborescentes

Bainha do pnis

Aproximadamente cilndrica

Piriforme

Prepcio

Aproximadamente em forma de nfora

Com parede projetada lateralmente pelo rgo prepucial

Espermateca

Muito longa, canal geralmente mais de 1,5 ve- Ovoide ou claviforme, canal um pouco mais longo que
zes mais longo que o corpo e notavelmente ex- o corpo e alargando-se na direo da base.
pandido na base

Fonte: Paraense, 1975; Paraense, 1976a, b.

Figura 13. Sistema reprodutor. A, Helisoma duryi (Wetherby, 1879); B, Helisoma trivolvis (Say, 1817). bp, bainha do pnis; bo,
bolsa do oviduto; bv, bolsa vaginal; cc, canal coletor do ovoteste; cd, canal deferente; cop, canal do rgo prepucial; des, duto
da espermateca; ed, espermiduto; eg, encruzilhada genital; es, espermateca; gn, glndula nidamental; mr, msculo retrator
do complexo peniano; mp, msculo protrator do complexo peniano; odp, ovispermiduto proximal; odd, ovispermiduto distal;
ot, ovoteste; ov, oviduto; pp, prepcio; pr, prstata; ut, tero; va, vagina; vs, vescula seminal. Extrados de Paraense (1975,
1981b, 1984, 2003).

134

Figura 14. Sistema reprodutor de espcies de Biomphalaria. A, Biomphalaria tenagophila (dOrbigny, 1835); B, Biomphalaria
occidentalis Paraense, 1981; C, Biomphalaria tenagophila guaibensis Paraense, 1984; bo, bolsa do oviduto; bp, bainha do pnis;
bv, bolsa vaginal; cc, canal coletor do ovoteste; cd, canal deferente; cop, canal do rgo prepucial; des, duto da espermateca;
ed, espermiduto; eg, encruzilhada genital; es, espermateca; gn, glndula nidamental; mr, msculo retrator do complexo peniano; mp, msculo protrator do complexo peniano; odd, ovispermiduto distal; odp, ovispermiduto proximal; ot, ovoteste; ov,
oviduto; pp, prepcio; pr, prstata; ut, tero; va, vagina; vs, vescula seminal. Extrados de Paraense (1975, 1981b, 1984, 2003).

CAPTULO 9
Seo 2

4. Morfologia comparada de
Physa acuta Draparnaud, 1805,
Physa marmorata Guilding, 1828
e Lymnaea columella Say, 1817


4.1. Morfologia externa


Physa acuta Draparnaud, 1805 e Physa
marmorata Guilding, 1828 esto entre as espcies includas na famlia Physidae no Brasil,
enquanto Lymnaea columella Say, 1817 a
espcie mais amplamente distribuda de Lymnaeidae. De acordo com Simone (2006) outras duas espcies ocorrem no pas, Lymnaea
rupestris Paraense, 1982 e Lymnaea viatrix
dOrbigny, 1835.

A diferenciao entre fisdeos e limnedeos
importante, uma vez que L. columella a principal espcie vetora da Fasciola hepatica Linnaeus,
1758 no Brasil. Os limnedeos tm a concha cnica, com abertura dextrgira (voltada para direita), ao contrrio dos fisdeos que apresentam
concha sinistrgira (voltada para esquerda) (Figs.
15, 16). Os olhos esto situados na base interna
dos tentculos, os quais so achatados e triangulares nos limnedeos e alongados e filiformes nos
fisdeos. Outra diferena a forma do p, cordiforme em L. columella e alongado em Physa spp.
(Fig. 17). Ambas as famlias esto amplamente
distribudas nas regies tropicais do Continente
Sul-americano, habitando guas lnticas, porm
os fisdeos so mais tolerantes aos ambientes poludos (Paraense, 1981b).
4.2. Morfologia interna de

Physa acuta Draparnaud, 1805 e

Physa marmorata Guilding, 1828


As principais diferenas entre P. acuta
e P. marmorata encontram-se no sistema reprodutor (Fig. 18). De acordo com Paraense
(1986b, 1987) o ovoteste, ovispermiduto, vescula seminal, oviduto, glndula nidamental,
tero, vagina, espermoduto, prstata e vaso
deferente de ambas as espcies so iguais. A
principal diferena encontra-se na presena de
uma glndula prepudial sobre o prepcio em P.
acuta, a qual ocupa cerca de um tero do comprimento deste rgo, no encontrada em P.
marmorata. Alm desta, outras diferenas podem ser observadas nestas espcies (Tab. III).

Figura 15. Conchas de espcies de Physa e Lymnaea. A, Physa


marmorata Guilding, 1828; B, Physa acuta Draparnaud, 1805; C,
Lymnaea columella Say, 1817. Escala 5 mm. (Fotos: P.M. Coelho).

Figura 16. Desenhos das conchas: A, Physa acuta Draparnaud,


1805; B, Physa marmorata Guilding, 1828; C, Lymnaea columella
Say, 1817. Extrados de Paraense (1986a, b) e Paraense & Pointier
(2003).

135

Figura 17: Diferena entre os tentculos e forma do p: A, tentculos triangulares e p cordiforme em Lymnaea columella
Say, 1817; B, tentculos filifomes e p alongado em Physa
acuta Draparnaud, 1805. Escala 5 mm. (Fotos: P.M. Coelho).

Gastrpodes lmnicos invasores:


morfologia comparada
Fernandez et al.

Tabela III. Diferenas anatmicas entre Physa acuta Draparnaud, 1805 e Physa marmorata Guilding, 1828.

Physa acuta

Physa marmorata

Espermateca

Oval ou piriforme

Oblongo, com uma moderada constrio no meio e um tanto curvo

Canal da espermateca

Duto uniformemente estreito, com a base ex- Duto uniformemente estreito, um


pandida, um pouco mais longa que o corpo
pouco mais longo que o corpo

Bainha do pnis

Mesma largura do pnis e termina em um Bainha do pnis apresenta uma exbulbo um tanto mais estreito que a poro panso terminal bulbosa cuja extreproximal
midade se insere na poro caudal do
prepcio.

Prepcio

Muito mais largo que o bulbo da bainha do


pnis, com ombro pouco saliente

Com ombro bem definido, muito


mais largo que a poro estreita da
bainha do pnis

Canal peniano

Com abertura subterminal

Com abertura lateral, mais ou menos


na juno dos teros mdio e inferior

Proporo bainha do pnis/prepcio

Cerca de 1,49 (1,25 1,83 ).

Cerca de 2.08 (1,45 - 2,75).

Fonte: Paraense, 1986b; Paraense, 1987.

Figura 18. Desenhos esquemticos do sistema reprodutor: A, Physa marmorata Guilding, 1828; B, Physa acuta Draparnaud,
1805. (bbp), bulbo da bainha do pnis; (bp), bainha do pnis; (bv), bolsa vaginal; (cc), canal coletor do ovoteste; (cd), canal
deferente; (des), duto da espermateca; (dga), duto da glndula de albmen; (ed), espermiduto; (es), espermateca; (gn), glndula
nidamental; (gp), glndula prepucial; (mr/mrc), msculo retrator do complexo peniano; (mp), msculo protrator do complexo
peniano; (mpc), msculo protrator do complexo peniano; (odd); ovispermiduto distal; (odp), ovispermiduto proximal; (ot), ovoteste; (ov), oviduto; (pp), prepcio; (pp), prstata; (ut), tero; (va), vagina; (vs), vescula seminal. Extrados de Paraense (1975,
1981b, 1984, 2003).

136

Agradecimentos



Ao Dr. Luiz Ricardo Simone, do Museu de
Zoologia da Universidade de So Paulo pela cesso de algumas fotos e figuras que ilustram esse

capitulo. Ao Eduardo Prado e ao Pablo Menezes


Coelho, do Laboratrio de Referncia em Malacologia, Fiocruz, RJ, pelo trabalho iconogrfico.
Ao Laboratrio de Microscopia Eletrnica da
UERJ pela imagem de varredura da rdula.

Seo
Monitoramento de
moluscos invasores

CAPTULO 10
Como monitorar bivalves
invasores no plncton?
Mtodo da microscopia ptica
Cintia Pinheiro dos Santos
Marinei Vilar Nehrke
Maria Cristina Dreher Mansur
Vanessa Gazulha


Os ecossistemas so formados por diferentes organismos. Em ambientes aquticos encontramos o plncton, quaisquer organismos
encontrados na coluna dgua que so deslocados de acordo com as massas de gua (Esteves,
1988). O plncton pode ser classificado de diversas formas: em funo de suas dimenses,
do bitopo, distribuio vertical, durao da
vida planctnica e de sua nutrio (Omori &
Ikeda, 1984). O plncton de forma geral se divide em fitoplncton e zooplncton.

O fitoplncton constitui a poro vegetal do plncton, aquela capaz de sintetizar
matria orgnica atravs da fotossntese. Este
composto basicamente por algas, desempenhando um papel importante por estar na base
da cadeia alimentar. J o zooplncton constitudo por organismos heterotrficos (seres
incapazes de produzir seu prprio alimento e
se nutrem de substncias orgnicas produzidas
por outros seres), pertencentes ao reino animal,
como pequenos invertebrados e formas larvais
de alguns organismos. Muitos organismos do

zooplncton realizam migraes dirias, determinadas pela dinmica do ambiente.



A comunidade planctnica apresenta um
carter muito dinmico, com elevadas taxas de
reproduo e perda, respondendo rapidamente
s alteraes fsicas e qumicas do meio aqutico e estabelecendo complexas relaes intra e
interespecficas na competio e utilizao do
espao e dos recursos (Valiela, 1995).

Variaes no regime meteorolgico, caractersticas geomorfolgicas regionais e os impactos antropognicos nas reas costeiras, estabelecem, em conjunto, o regime hidrogrfico
particular de cada regio e, consequentemente,
as caractersticas taxonmicas e a dinmica
espao-temporal de suas comunidades planctnicas (Brandini et al., 1997).

As espcies de bivalves invasores encontrados no ambiente lmnico brasileiro so
principalmente Limnoperna fortunei (Dunker,
1857), Corbicula fluminea (Mller, 1774) e
Corbicula largillierti (Philippi, 1844). As espcies invasoras possuem uma grande capacidade

139

Como monitorar bivalves invasores no plncton?


Mtodo da microscopia ptica
Santos et al.

140

reprodutiva, geralmente causando problemas


ambientais e econmicos (ver Captulo 2). Devido a estes motivos, estas espcies invasoras
devem ser monitoradas constantemente considerando que as mesmas apresentam fase larval
total ou parcialmente planctnica (Detalhes de
diferenciao larval das espcies invasoras, ver
Captulo 6).

O xito de qualquer monitoramento sobre o plncton depende de um desenho amostral adequado de acordo com o tipo de informao que se deseja obter. Fatores importantes
a serem considerados so as variaes espaciais
horizontais e verticais, as variaes sazonais, o
tamanho dos organismos, e se o estudo qualitativo ou quantitativo. Estes fatores, entre outros, iro determinar os mtodos de amostragem e anlise mais adequados.

Os mtodos para a coleta de plncton podem agrupar-se em duas grandes categorias, as
garrafas e as redes (Gonzlez de Infante, 1988).
As garrafas, como por exemplo, as garrafas de
Van Dorn, so utilizadas para coletar um certo
volume de gua que deve ser concentrado por
filtrao ou sedimentao para reunir o plncton em um volume pequeno de gua. Tem como
vantagem a captura das formas pequenas do
plncton, porm, seu volume reduzido (de 2 a
6L) uma desvantagem quando a populao
pequena. As redes so os instrumentos de coleta
de plncton mais antigos e de uso mais generalizado. As redes podem apresentar diferentes modelos. O tecido filtrante das redes de plncton
de nylon e pode apresentar diferentes aberturas
de malha (m). As redes com aberturas de malha
mais reduzidas tm maior tendncia a acumular
os organismos e partculas suspensas, dificultando a filtrao. J as redes com maior abertura de malha tendem a perder os organismos
foradamente permanecendo em rede s os de
maior tamanho. Na base da rede deve haver um
copo coletor, as laterais do copo devero ser forradas com a mesma tela, assim, os organismos
coletados permanecero neste copo at o trmino da filtrao. As coletas podem ser feitas por
arrastos, em que a rede passada vrias vezes no
ambiente; ou a gua tambm pode ser recolhida
atravs de um balde; ou atravs de uma bomba e
passada pela rede em quantidades conhecidas. A
vantagem das redes o grande volume de gua
que pode ser coletado.


No caso das larvas planctnicas de bivalves invasores, o mtodo mais adequado para a
coleta a rede de plncton, devido especialmente baixa densidade destes organismos no
ambiente aqutico. importante obter amostras com rplicas (no mnimo, em triplicata) e
coletar em diferentes locais do corpo dgua,
especialmente, em lagos e reservatrios grandes, onde possa haver grande heterogeneidade
espacial.

Aps a coleta necessria a preservao
do material amostrado, a qual pode ser realizada por mtodo fsico via congelamento e posterior liofilizao, e qumico pelo uso de formol e
etanol. A utilizao do formol requer mais tempo para provocar a morte dos organismos, assim eles podem se contrair e expelir o contedo
dos intestinos. Portanto, recomenda-se a adio de anestsico antes da fixao. Alm disso,
o pH cido da soluo, com o tempo, pode causar danos aos animais (Haney & Hall, 1973).
A imerso em etanol uma tcnica simples e
eficiente, onde o material coletado imediatamente imerso em etanol 95%. Esse fixador
causa morte imediata e evita alguns problemas,
como distoro de corpos (Hall, 1964).

Para a obteno de larvas das espcies
invasoras citadas anteriormente, necessrio
efetuar coletas no plncton atravs de rede
de nylon, comumente utilizado em serigrafia,
com abertura de malha em torno de 30 m
(micrmetros) ou 150 fios. No laboratrio, o
contedo do copo coletor deve ser examinado
sob estereomicroscpio para quantificao,
uma vez que as larvas de bivalves possuem
tamanho diminuto. J para a identificao das
fases larvais, necessrio um microscpio com
grande resoluo ptica (Coelho, 2004). (Ver
Captulo 6).

Metodologia para coleta


e contagem de larvas

1.1. Coleta


A coleta de larvas realizada atravs
da filtrao de 1 m 3 de gua (Fig. 1), com
rede de plncton com malha de 30 m e com
o auxlio de uma bomba de suco (Fig. 1C),
o tempo de filtrao varia conforme a vazo

CAPTULO 10
Seo 3

do equipamento (Fig. 1A). Esta quantidade


elevada de gua (aprox. 1000L) que se costuma coletar para quantificao das larvas de
bivalves est relacionada ao fato de que estas
normalmente ocorrem em baixa densidade no
plncton. Ao trmino da filtrao, as larvas
concentradas so retiradas do tubo coletor,
o volume aproximado de 100 ml (Fig. 1D).
A amostra acondicionada em pote plstico
(Fig. 1E), logo deve-se adicionar 100 ml de
lcool 96% ao volume da amostra a fim de
preservar a mesma, totalizando 250 ml (Fig.
1F).

1.2. Quantificao da densidade larval


A anlise das amostras no laboratrio
envolve duas etapas: a preparao da amostra e
a quantificao.


* Com auxlio de uma pipeta, retira-se
a gua da superfcie do Becker at chegar ao
valor estipulado de 100 ml. Este ser o volume
a ser analisado.

1.2.2. Quantificao da amostra


Para a quantificao das amostras preparadas anteriormente em laboratrio (Fig.
2), estas so homogeneizadas e retira-se uma
alquota de 2 ml e coloca-se sobre uma placa de contagem quadriculada (Fig. 2A). Esta
amostra (Fig. 2C) quantificada com o auxlio do microscpio estereoscpico (Fig. 2B).
Cada larva encontrada (Figs. 2D e 2E) nas
alquotas quantificadas pipetada e retirada
da placa de contagem, procedimento adotado
para que no haja recontagem de larvas, evitando, assim, que a amostra seja superestimada.


1.2.1. Preparao da amostra a ser

analisada


* Troca-se o recipiente do campo por um
Becker de 400 ml;

* Espera-se 15 minutos para a amostra
decantar;


A densidade larval (ind.m-3) de cada espcie de bivalve (p. ex. L. fortunei, C. fluminea,
C. largillierti) obtida utilizando-se a seguinte
frmula (APHA, 2005):

1.3. Estimativa da Densidade Larval

141

Figura 1. Etapas da coleta. 1A: filtrao do plncton; 1B: detalhe da rede de plncton; 1C: detalhe da bomba de suco; 1D:
retirada das larvas concentradas no tubo coletor; 1E: acondicionamento da amostra e 1F: preservao da amostra coletada em
campo.

Como monitorar bivalves invasores no plncton?


Mtodo da microscopia ptica
Santos et al.

Figura 2. Etapas em laboratrio. 2A, placa contagem contendo 2 ml de amostra; 2B, microscpio estereoscpico utilizado para
quantificao; 2C, viso geral da amostra sob microscpio estereoscpico; 2D e 2E, larvas fotografadas sob microscpio ptico
encontradas nas amostras coletadas durante monitoramento; 2D, Limnoperna fortunei no estgio vliger (220 m) e 2E, larva
vliger de Corbicula fluminea (220 m).

onde,

C= nmero de indivduos contados

V= volume da amostra concentrada (mL)

V= volume da alquota (mL)

V= volume da amostra coletada (m3)

Por exemplo, se em campo foram coletados
1000L (=1 m) de gua e concentrados em frascos
de 100 mL, e em laboratrio, foram triadas alquotas referentes 10 mL da amostra e quantificados 200 indivduos (larvas) no total, o clculo da
densidade larval (ind.m-3) ser da seguinte forma:

142


Desta forma, o resultado do clculo indica
que a densidade larval na amostra em questo de
2000 ind/m. importante ressaltar que para uma
avaliao eficiente da densidade larval recomenda-se a triagem de alquotas referentes a, no mnimo,
10% do total da amostra. Quando o nmero de indivduos contados for inferior a 100, recomenda-se
a triagem de mais alquotas at a contagem mnima
de 100 larvas, ou ainda, a triagem total da amostra.

CAPTULO 11
O mtodo molecular
de prospeco do
mexilho-dourado
Marcel K. Tsch
Raquel Patella
Antonio Ostrensky
Walter A. Boeger


A capacidade de deteco precoce de espcies aquticas invasoras durante o processo
de sua disperso essencial para a definio
de medidas de controle ou mitigao. O monitoramento de bivalves invasores pode se dar
por vrios mtodos. O mais bvio e simples
a observao das conchas dos indivduos adultos no ambiente. Embora esta seja a maneira
mais fcil, a deteco tardia e prejudica aes
mitigadoras de controle ou eliminao dos moluscos. A presena de indivduos adultos quase
sempre j um indcio de que as populaes se
encontram em adiantado processo de colonizao do ambiente. Alm disso, a observao de
moluscos fixados em substratos em ambientes
de guas mais profundas ou turvas, sejam naturais ou artificiais, costuma ser pouco efetiva.

No caso de espcies que apresentam
fases larvais planctnicas, o monitoramento
tambm pode ser realizado pela prospeco de
larvas desses moluscos bivalves a partir da coleta de amostras do zooplncton, seguida da observao em microscpio estereoscpico. Essa

metodologia permite a deteco precoce dessas


espcies antes do estabelecimento de grandes e
extensas populaes, porm, apresenta desvantagens, pois exige experincia e conhecimento
taxonmico das larvas da espcie-alvo. Alm
disso, o processamento microscpico lento e
realizado geralmente a partir de subamostragens, o que pode resultar em falsos negativos.
Adicionalmente, a identificao de larvas de
moluscos bivalves geralmente possvel apenas atravs das fases larvais mais tardias ou de
microscopia ptica ou eletrnica de varredura
(Kimura & Sekiguchi, 1994; Ozawa & Sekiguchi, 2002). Na maioria das vezes, a prospeco sob lupa de larvas de espcies de bivalves
exige o conhecimento prvio sobre as espcies
de moluscos coexistentes na rea de interesse e
da morfologia geral de cada uma das suas fases larvais. Muitas larvas de bivalves possuem
extrema semelhana morfolgica induzindo
o identificador a erros, como frequentemente ocorre com as espcies Corbicula fluminea
(Mller, 1774) e Limnoperna fortunei (Dunker,

143

O mtodo molecular de prospeco


do mexilho-dourado
Tsch et al.

1857) em amostras de zooplncton de ambientes aquticos continentais sul-americanos.



O desenvolvimento de tcnicas para deteco molecular de organismos planctnicos,
todavia, tornou possvel o monitoramento de
larvas de espcies de bivalves (Claxton & Bouling, 1998; Toro, 1998). Com o uso desse mtodo, larvas podem ser detectadas com grande
sensibilidade e especificidade, em um curto
espao de tempo, sem necessariamente exigir
conhecimentos especficos em biologia larval
do tcnico responsvel.

O mtodo proposto por Pie et al. (2006),
utiliza marcadores moleculares para detectar o
DNA de L. fortunei em amostras de plncton.
Esse protocolo tornou-se uma ferramenta indispensvel, de agilidade e eficincia superior quando comparado aos mtodos tradicionais para a
prospeco precoce do mexilho-dourado.

O protocolo de prospeco molecular j
foi extensamente testado, tendo apresentado
resultados bastante satisfatrios quanto sua
especificidade (Boeger et al., 2007). A sensibilidade do mtodo , tambm, um de seus pontos
mais fortes. O limiar de deteco cerca de
600 vezes maior do que a quantidade de DNA
extrada de uma nica larva (Pie et al., 2006).
Assim, em teoria, o mtodo capaz de indicar
a presena de apenas uma larva em aproximadamente 200 L de gua filtrada com redes de
zooplncton. Na prtica, o protocolo tem se
mostrado eficiente na deteco de larva em baixa concentrao no ambiente, inclusive quando larvas no so detectadas atravs de anlises
microscpicas e quando adultos no so detectados em amostras ambientais (Boeger et al.,
2007; Darrigran et al., 2009).

O protocolo molecular descrito nesse
captulo de forma objetiva, apresentando detalhes de procedimentos e solues para problemas de processamento. Alternativamente, esse
protocolo pode ser utilizado para realizar a
identificao de animais jovens ou adultos, sempre que houver dvidas sobre sua identidade.

144


Coleta e fixao de material
biolgico



As amostras de zooplncton devem ser
coletadas dos locais onde se objetiva prospectar as fases larvais do mexilho-dourado, como

por exemplo, tanques de estaes de tratamento


de gua, reservatrio de usinas hidreltricas ou
no prprio curso natural de um rio. Esta coleta feita com a utilizao de redes de arrasto de
plncton, com abertura de malha de aproximadamente 53 m, em arrastos de cerca de 5 min,
preferencialmente em arrasto diagonal (do fundo
para a superfcie). Devido esperada natureza em
manchas na distribuio do plncton, mltiplas
amostras devem ser obtidas de cada ambiente.
Quando se capta gua diretamente do meio (ex.
sistema de resfriamento de usinas hidroeltricas),
recomenda-se a filtrao de cerca de 4.000 L de
gua.

Em campo, o material coletado por este
arrasto deve ser rapidamente concentrado por sedimentao (alguns minutos so suficientes para
que os organismos da amostra se concentrem no
fundo do recipiente) e remoo do excesso de
gua. Em seguida, etanol 92-95% deve ser adicionado em uma proporo aproximada de 1:2
(volume de amostra : volume de etanol). Cada
amostra deve ento ser devidamente etiquetada,
com anotaes do modo de arrasto (ou bombeamento e filtragem), local, data, horrio e responsvel pela coleta (dentre outras, conforme interesse especfico). A adequada etiquetagem dos
recipientes um procedimento imprescindvel.
Informaes adicionais quanto ao estado fsico
do zooplncton ou aparente presena de cianobactrias so de grande importncia para se determinar procedimentos subsequentes da anlise.

Sugere-se tambm que, a partir do material coletado sejam geradas subamostras antes do
incio das atividades em laboratrio, propiciando
assim, contraprovas das anlises (recomendaes
adicionais so encontradas no item Sugestes e
resoluo de problemas no final do captulo).

A amostra coletada deve ser ento encaminhada ao laboratrio, onde ser pr-processada com auxlio de uma bomba a vcuo (Fig.
2). O pr-processamento visa separar as partculas do plncton da gua, possibilitando a
extrao mais eficiente do DNA. Esse procedimento tem se mostrado bastante eficiente na
prtica, embora no seja imprescindvel. Amostras de animais adultos podem ser obtidas preservando um pedao de tecido (ex. msculo,
manto, gnada) em etanol 92% ou em outro
lquido utilizado nos procedimentos usuais de
laboratrios de gentica (ex. DMSO, tampes).

CAPTULO 11
Seo 3

Procedimentos laboratoriais


Uma sntese do processamento das amostras apresentada na Figura 1. A amostra de zooplncton coletada pr-processada atravs de um
conjunto de peneiras em srie, que removem parte
de organismos indesejveis na anlise molecular
(Quadro I e Fig. 2). Neste conjunto so utilizadas
duas peneiras com dimetro de abertura de malha
de 300 m e 100 m, considerando os tamanhos
registrados para as larvas de L. fortunei (Kimura e
Sekiguchi, 1994). Dessa maneira as formas de zooplncton menores que 100 m, incluindo os estgios larvais iniciais de mexilho-dourado, passam
pelas peneiras e so retidas em um filtro de papel
instalado abaixo no sistema. Tanto o material retido no filtro de papel, como nas demais malhas
do sistema de filtragem, raspado e o DNA total
da amostra extrado e purificado utilizando-se
procedimentos usuais de biologia molecular.

Figura 1. Sntese da metodologia molecular utilizada na prospeco das larvas de L. fortunei.

Quadro I. A bomba a vcuo de pr-processamento do zooplncton


O sistema descrito abaixo recomendado para o pr-processamento das amostras de zooplncton.
Este sistema composto por uma srie de malhas com aberturas distintas e um filtro de papel, utilizado
para reteno de material a ser processado a vcuo. O equipamento montado com material facilmente
encontrado no mercado, incluindo tubos de PVC, recipiente de acrlico e mangueiras. Um diagrama
explodido do mecanismo apresentado abaixo.
funil simples;
tubo PVC 2 de 15 cm sem rosca;
malha de abertura de 300 m;
unio roscvel 2;
tubo PVC 2 de 8 cm sem rosca;
malha de abertura de 100 m;
unio roscvel 2;
tubo PVC 2 de 8 cm com rosca;
papel filtro;
unio roscvel 2;
tubo PVC 2 de 15 cm com rosca;
bucha de reduo 2;
adaptador autoajustvel com rosca, anel
para caixa dgua e junta de vedao;
frasco de 2 L em acrlico com tampa de presso;
adaptador autoajustvel com rosca e junta
Figura 2. Sistema de filtragem acoplado bomba a vcuo
para pr-processamento do zooplncton. Esquema explodido direita

de vedao;
adaptador interno para mangueira.

Todas as peas devem ser conectadas uma a outra, na mesma ordem descrita acima. As duas ltimas
peas devem ser fixadas ao frasco por um orifcio artesanalmente aberto na lateral do recipiente, as
demais peas devem ser presas na tampa do frasco.

145

O mtodo molecular de prospeco


do mexilho-dourado
Tsch et al.

O procedimento de extrao utilizado no Laboratrio de Ecologia Molecular apresentado passo a passo no Quadro II.
Quadro II. Extrao do DNA
1.

Homogeneizar do filtrado com 98 L de tampo de digesto (Tris 50 nM, pH 8.0) e 2 L


de proteinase K (20 ng/mL) a 50C durante 3 h;

2. Adicionar 200 L de EZ-DNA (Genomic DNA Isolation Kit Biological Industries)


e incubar a 50C durante 30 min;
3. Centrifugar a 10.400 RPM por 10 min;
4. Passar o sobrenadante para novo tubo este procedimento elimina os fragmentos
insolveis;
5. Neste novo tubo, adicionar etanol absoluto e centrifugar a 7.300 RPM por 5 min para

precipitao do DNA;
6. Remover o etanol sobrenadante atravs de pipetagem ateno para no remover o
pellet que deve estar no fundo do tubo;
7.

Repetir os procedimentos 5 e 6 com aplicao de etanol 96% para a lavagem do DNA;

8. Secar a amostra em temperatura ambiente por cerca de 10 min;


9. Dissolver o DNA em 50 L de NaOH 8 mM.

146


O procedimento descrito representa a
aplicao do marcador molecular especfico
para prospeco do DNA do mexilho-dourado. O mtodo bastante simples e intuitivo e
baseia-se na Reao em Cadeia da Polimerase
do DNA (cuja sigla mais popular PCR Polymerase Chain Reaction).

Iniciadores da PCR especficos para L.
fortunei foram desenvolvidos a partir de um
fragmento de DNA mitocondrial, a subunidade I do gene do Citrocromo Oxidase (COI).
Na reao de PCR descrita a seguir, mesmo
na presena de DNA de outras espcies, os iniciadores especficos so capazes de amplificar
apenas o fragmento de COI de L. fortunei. Para
evitar falsos negativos, devido a problemas de
integridade do DNA total amostrado (decorrente, por exemplo, da m fixao no campo)
um par de iniciadores universais (fragmentos
do gene nuclear 18S) utilizado junto aos iniciadores/marcadores especficos. A reao do
marcador , portanto, conhecida como um
PCR multiplex (ou duplex) que o nome dado
a reaes que envolvam a amplificao de mais
de um fragmento de DNA. Ambos marcadores
moleculares utilizados esto listados na Tabela
I com suas respectivas sequncias. Veja procedimento no Quadro III:

Quadro III. Amplificao do DNA

A reao multiplex da PCR (Reao em Cadeia


da Polimerase) realizada em um volume total
de 25 L seguindo os seguintes passos:
1. Adicionar gua destilada ultrapura para
completar o volume de 24 L/tubo;
2. Preparar uma soluo estoque (em gelo)
contendo volume suficiente para o nmero
de amostras e controles (positivo e negativo)
contendo: 1,5 mM de MgCl2, 0,5 mM de dNTPs,
reao de buffer 1X, BSA 1:100, 0,625 unidades
enzima Taq polimerase, 0,8 mM de cada
indicador universal e 4 mM de cada indicador
especfico para L. fortunei.
3. Agitar em vrtex.
4. Distribuir 24 L em cada tubo de amostra e
controles;
5. Adicionar 1 L da amostra contendo o DNA
extrado na diluio desejada.
6. Programar o termociclador e proceder a PCR
da seguinte maneira:
a. desnaturao inicial a 94C por 4 min;
b. 32 ciclos de cada um dos seguintes:
b.1. desnaturao a 94C por 30 s.
b.2. anelamento a 58,2C por 30 s.
b.3. extenso a 70C por 1 min.
c. Extenso final a 70C, desta vez por 4 min;
7. Submeter o produto da PCR ao gel de
agarose 2% e eletroforese com voltagem
aproximada de 80V;
8. Corar o gel de agarose por 20 min em
soluo de brometo de etdio ou GelRed;
9. Visualizar sob luz ultravioleta.

CAPTULO 11
Seo 3

Tabela I. Sequncias dos marcadores moleculares universais (indicadores) e especficos empregados na prospeco molecular
do mexilho-dourado.

Nome do primer

Sequncia (5- 3)

Regio do DNA

Tipo do primer

COIR1

TCCAACCAGTCCCTACTCCACCCTCTA

COI

Especfico

COIF1

TTTAGAGTTAGCACGTCCTGGTAGGTT

COI

Especfico

7F

GCCCTATCAACTTACGATGGTA

18S

Universal

1100R

GATCGTCTTCGAACCTCTG

18S

Universal

Em todas as reaes, um controle positivo (DNA de L. fortunei adulto) deve ser includo como referncia para a posio das bandas
de cada fragmento e o correto funcionamento
dos reagentes. Um controle negativo (reao
sem amostra de DNA) , tambm, indispensvel na reao, pois controla eventuais contaminaes nas reaes.

O padro de bandas formado nos gis de
agarose pelas amostras em anlise comparado
com o padro de bandas produzido pelo controle positivo (Fig. 3, coluna C+). A coincidncia na presena de banda especfica (produzida
pelos marcadores/iniciadores especficos) indica
a presena de L. fortunei na amostra (Fig. 3, colunas 1 e 2). As amostras consideradas positivas
para o bivalve devem apresentar tambm as bandas universais (Fig. 3, colunas 1 e 2). Amostras

que apresentam apenas bandas resultantes dos


iniciadores universais (controle da qualidade
do DNA das amostras) devem ser consideradas
negativas para o mexilho-dourado. Devido aos
eventuais problemas relacionados concentrao do DNA de L. fortunei, todas as amostras
devem ser submetidas s reaes do marcador
em pelo menos duas diluies (1:1 e 1:100), preferencialmente trs (1:1, 1:10, 1:100).

Os resultados das reaes devem ser
confirmados periodicamente. Uma das formas
de realizar essa avaliao do procedimento
sequenciar amostras positivas para bandas
especficas escolhidas aleatoriamente, com
subsequente comparao de sua composio
nucleotdica com sequencias de L. fortunei disponveis em bancos de dados via internet (ex.
Genbank, BOLD).

147

Figura 3. Exemplo de gel de agarose visualizado em luz UV. L: Marcador de peso molecular. C+: controle positivo. 1 e 2: amostras positivas para L. fortunei. 3, 4, 5 e 6: amostras com integridade do DNA inadequada para anlise. 7 e 8: amostras negativas
para L. fortunei. C-: controle negativo.

O mtodo molecular de prospeco


do mexilho-dourado
Tsch et al.

Quadro IV. Sugestes e resoluo de problemas


1. Quais so os procedimentos adequados para se evitar dano ao DNA ou mesmo perda de material

durante a extrao?
1.1. Manter a amostra de zooplncton devidamente fixada e refrigerada entre 2 e 8C at a

aplicao do protocolo de extrao.
1.2. Fracionamento da amostra ou coleta de mais de uma amostra por ponto de coleta. Assim,

caso ocorram problemas durante o procedimento de extrao do DNA, as informaes ge

nticas no sero perdidas,
2. Nenhuma banda visvel nas amostras e controle positivo com bandas?
2.1. DNA degradado.
2.2. Observar se o extrato recebido apresenta excesso de cianobactrias e/ou resduos de solo,

fatores que podem inibir as reaes moleculares.
2.3. Verificar como o material foi armazenado durante a coleta e transporte. A m fixao e a

extensa exposio da amostra do zooplncton ao calor podem danificar o material coletado.

A verificao da concentrao e pureza de cada amostra extrada e um teste de amplificao

com iniciadores universais de fragmentos menores (em torno de 200pb) confirmar a frag

mentao do material gentico da amostra.
2.4. Reagentes mal conservados ou mal pipetados durante a aplicao do protocolo molecular

podem prejudicar a amplificao do DNA da amostra.
3. Apenas a banda do marcador especfico aparece nas amostras?
3.1. Os iniciadores especficos podem estar consumindo os reagentes para a amplificao do

fragmento universal.
3.2. Considerar resultado como positivo.
3.3. Verificar a qualidade da soluo do conjunto de iniciadores universais.

148

CAPTULO 12
Mtodo de deteco e quantificao de larvas
do mexilho-dourado Limnoperna fortunei,
usando PCR quantitativo em tempo real
Noriyuki Endo
Yasuyuki Nogata

Introduo


O mexilho-dourado Limnoperna fortunei
(Dunker, 1857) uma espcie bivalve de gua-doce invasora identificada como contribuinte
em vrios problemas ecolgicos e econmicos
(Darrigran et al., 1998a, Ricciardi, 1998, Penchaszadeh et al., 2000, Magara et al., 2001,
Boltovskoy et al., 2006, Pie et al., 2006). Em
2006, essa espcie foi identificada como uma
espcie extica invasora no Japo, devido a
seus efeitos adversos nos ecossistemas. Durante
o ciclo de vida do L. fortunei, a etapa planctnica uma fase importante em que a distribuio da espcie facilitada. A deteco e identificao precisa da larva do mexilho-dourado
geralmente so realizadas com o auxlio de
um microscpio ptico. Esse mtodo consome
muito tempo e requer experincia com taxonomia. Portanto, o desenvolvimento de um
mtodo mais direto seria benfico para estudos
sobre a ecologia e o gerenciamento dessa espcie. Pie et al. (2006) desenvolveram um mtodo

sensvel para a deteco de larvas do mexilho-dourado que emprega uma abordagem baseada no PCR (polymerase chain reaction, ou
seja, reao em cadeia da polimerase) usando
um conjunto especfico de primers: LIMNO.
COIR1 e LIMNO.COIF1. Assim, Boeger et al.
(2007) demonstram que esse mtodo permitiu
a deteco de 1 a 5 larvas. No entanto, o mtodo de deteco baseado em PCR no pode
ser utilizado para quantificar com preciso as
amostras de larvas.

O mtodo de deteco e quantificao
de organismos planctnicos usando a reao
em cadeia da polimerase quantitativa em tempo real (qPCR) foi reconhecido como uma ferramenta eficiente, por Darling e Blum (2007).
O qPCR permite detectar com preciso e quantificar um DNA especfico em uma mistura de
soluo de DNA complexa, mesmo que a quantidade do DNA alvo (organismo) esteja em uma
concentrao muito baixa. Na ltima dcada,
as aplicaes de qPCR passaram a ser ferramentas largamente utilizadas na deteco e

149

Mtodo de deteco e quantificao de larvas


do mexilho-dourado Limnoperna fortunei,
usando PCR quantitativo em tempo real
Endo & Nogata

quantificao de um DNA (organismo) especfico em misturas complexas, e foram aplicadas


no apenas na deteco e quantificao das larvas de mexilho-dourado (Endo et al., 2009),
mas tambm para larvas do abalone Haliotis
kamtschatkana (Vadopalas et al., 2006), para
13 espcies de cirripdios (Endo et al., 2010),
para o molusco asitico Corbula amurensis
(Smith et al., 2012), entre outros. O qPCR monitora a amplificao de DNA em tempo real
e detecta o DNA de espcies alvo. A quantidade
de DNA molde inicial quantificada baseada
no fator de amplificao.

O fluxograma de uma deteco de qPCR
e o mtodo de quantificao de larvas de mexilho-dourado exibido na Figura 1. As amostras de plncton obtidas em campo so submetidas extrao de DNA e anlise de qPCR
usando um conjunto de primers especficos
para o mexilho-dourado. O conjunto de primers foi desenvolvido no gene mitocondrial citocromo c oxidase subunidade 1 (CO1) do mexilho-dourado para a amplificao de qPCR.
A amplificao altamente especfica para a
espcie e amplifica apenas 138pb do fragmento
de DNA do mexilho-dourado, mesmo quando h DNA de outras espcies. A amplificao
do fragmento de DNA por qPCR utilizando o
conjunto de primers indica a existncia de larvas de mexilho-dourado na amostra analisada, sendo o nmero de larvas calculado pelo
fator de amplificao. O mtodo qPCR permite
a deteco e quantificao por meio de um processo de anlise simples, que economiza tempo. Alm disso, com o mtodo qPCR possvel
detectar e quantificar larvas com preciso, pois
no preciso experincia prvia em identificao de larvas de mexilho-dourado.

Este captulo explica o procedimento
de pr-tratamento de amostras para anlise da
qPCR. Desta forma, ser demonstrado como
ocorre o processo de deteco e quantificao
de larvas de mexilho-dourado usando a qPCR.

150

Mtodo de amostragem e
preparao de amostras para
anlise de qPCR


No mtodo padro para coleta de amostras de plncton do campo se utiliza uma rede
de plncton (NXX13, 300 mm de dimetro).

Figura 1. Fluxograma de uma deteco de qPCR e mtodo de


quantificao das larvas de mexilho-dourado. Os zooplnctons
maiores e outras substncias nas amostras so removidos atravs de malhas de nylon e a soluo resultante submetida extrao de DNA. Posteriormente, o DNA extrado usado como
modelo para a anlise quantitativa de PCR em tempo real (qPCR).


Geralmente, se coletam amostras a partir de 3 puxadas verticais da rede, a aproximadamente 10 m de profundidade em um ponto
de amostragem. O fluxmetro til para o
clculo da densidade larval. Para uma anlise mais precisa, importante reduzir a lama
que contamina a amostra. Os cidos hmicos
e outras substncias hmicas da lama formam
complexos com o DNA extrado que no so
separados facilmente e interferem na extrao
do DNA. Alm disso, essas substncias inibem
a reao da Taq polimerase, que a reao
enzimtica-chave do PCR (Burgmann et al.,
2001).

CAPTULO 12
Seo 3


As amostras so imediatamente fixadas
em etanol 99,5% e armazenadas a 4C at serem submetidas extrao de DNA. Esse processo evita que ocorra a degradao do DNA
na amostra pela DNase, sendo particularmente
importante para uma deteco e quantificao
precisa quando o mtodo qPCR usado.

Extrao do DNA molde a partir


de amostras de plncton obtidas
em campo


Os zooplnctons maiores e outras substncias, como areia, folhas cadas e demais
resduos contidos nas amostras so removidos
com uma malha de nylon de 420 m. O plncton que passa pela malha, incluindo as larvas
do mexilho-dourado, coletado utilizando
malhas de nylon de 74 m.

Um mtodo de isolamento de DNA baseado em filtro indicado para anlise de qPCR.
Em geral, a eficincia da extrao de DNA reduzida em proporo ao aumento da quantidade de amostras. A baixa eficincia na extrao
de DNA uma das causas para a diminuio da
preciso das anlises de deteco e quantificao. Assim, quantidades grandes de amostras
de plncton devem ser divididas em duas a dez
partes iguais (peso mido aproximado de 5 a
25 mg, consulte o manual de instrues do kit
de extrao do DNA), colocadas em tubos de
coleta de amostras de 1,5 ou 2 ml e submetidas
separadamente extrao de DNA.

O etanol removido do tubo de coleta de
amostra utilizando um evaporador centrfugo e
o plncton homogeneizado em um tubo de coleta com 3 a 5 esferas de zircnio (1 a 3 mm de
dimetro) utilizando um homogeneizador bead
beater em velocidade mxima por 5 minutos.
Em seguida, o DNA total extrado do plncton
homogeneizado com o mtodo de isolamento de
DNA baseado em filtro usando os kits de extrao Quick Gene-Mini80 e Quick Gene (Kurabo
Industries, LTD., Osaka, Japo).

Se as amostras estiverem contaminadas
com grandes quantidades de lama, a eficincia
da extrao de DNA pode ser aprimorada com
o uso de reagente especializado na extrao de
DNA do solo (por exemplo, o kit de isolamento de DNA do solo da Norgen Biotek Corporation, Ontrio, Canad). A soluo de DNA

resultante deve ser armazenada a uma temperatura entre -20 e -70C at ser submetida anlise de qPCR.

Amplificao de qPCR


A anlise de qPCR conduzida pelo mtodo de intercalao SYBR Green I usando um
SYBR Premix Ex TaqTM. A fluorescncia do
corante SYBR Green I aumenta entre 100 e
200 vezes quando vinculado ao sulco menor de
um DNA de cadeia dupla e o sinal fluorescente
corresponde quantidade de DNA de cadeia
dupla na soluo da reao. A fluorescncia
monitorada pelo detector do sistema PCR em
tempo real ao fim da etapa de prolongamento da
reao de PCR, tendo e a eficincia da reao
calculada. A amplificao de qPCR realizada
com um conjunto de primers especfico para o
mexilho-dourado (Limf-F: 5-TCTCTTCATTTAGCTGGTGCGTC-3 e Limf-R: 5-CAAAACAGATGTAACTGCAAGAGAC-3, Endo
et al., 2009) usando como um sistema Smart
Cycler II (TaKaRa Bio Inc.). A reao de PCR
em tempo real conduzida em um volume total
de 25 l de soluo de reao contendo 12,5
l de SYBR Premix Ex TaqTM , 2 l de DNA
molde extrado da amostra de plncton, 1 l de
cada primer especfico (0,2 M cada) e 8,5 l
de gua para PCR. Para a verificao da contaminao dos reagentes, sempre deve ser usado
com as amostras o controle negativo da reao
com a gua para PCR em vez do DNA molde.
A reao de amplificao conduzida a 95C
por 10 segundos, seguida por 40 ciclos de 95C
por 5 segundos e 60C por 30 segundos. Aps
a amplificao, o valor do ciclo limite (Ct)
calculado automaticamente a partir do cruzamento entre o traado de amplificao e a linha
limite (Fig. 2). O valor de Ct obtido traado
nas curvas padro e a quantidade de larvas
calculada (conforme ser descrito adiante).

Verificao de especificidade da
amplificao de qPCR


A especificidade das reaes de amplificao examinada atravs de curvas de desnaturao geradas aps a amplificao da qPCR. A
anlise das curvas de desnaturao usada para
distinguir amplificaes alvo de produtos no

151

Mtodo de deteco e quantificao de larvas


do mexilho-dourado Limnoperna fortunei,
usando PCR quantitativo em tempo real
Endo & Nogata

Figura 2. Exemplo de uma amplificao experimental realizada em um sistema Smart Cycler II (TaKaRa Bio Inc.). A amplificao
de qPCR foi conduzida em um conjunto de primers especfico para mexilhes dourados e 2 l de DNA molde extrados de uma
srie de larvas do mexilho (1, 2, 5, 10, 20 e 50 indivduos). O sinal de fluorescncia monitorado continuamente e o traado
de amplificao foi obtido a partir da unidade de fluorescncia relativa. Assim, a linha limite foi determinada automaticamente
para a posio ideal, e os valores de Ct foram calculados a partir do cruzamento do traado de amplificao e a linha limite.

especficos, como dmeros de primer e/ ou misprimed. A anlise da curva de desnaturao


realizada com uma transio de temperatura
linear de 60C a 95C aps a amplificao da
qPCR. A fluorescncia medida continuamente
e a temperatura de desnaturao dos produtos
do qPCR determinada pela diminuio de fluorescncia causada pela degenerao. O resultado
da anlise da curva de desnaturao da amplificao da qPCR do mexilho-dourado exibido
na Figura 3. A temperatura de desnaturao do
produto da qPCR obtido com um conjunto de
primers especfico para o mexilho-dourado
de aproximadamente 79C. Os produtos que
apresentam menor temperatura de desnaturao
so provavelmente produtos da amplificao de
dmeros de primer ou misprimed. A especificidade da qPCR pode ser aprimorada atravs da
otimizao das condies da reao de acordo
com o aparelho e os reagentes. Em alguns casos
a causa a degradao dos primers, ou a concentrao muito alta de DNA (incluindo DNA
alvo e no alvo) na soluo de reao. Uma boa
prtica realizar a anlise da curva de desnaturao aps cada reao de qPCR para controlar
a qualidade da identificao e da deteco.

152

Anlise dos dados


A quantidade de larvas de mexilho-dourado na soluo de DNA estimada traando-se os valores de Ct na curva padro.
Quando a amostra de plncton subdividida

em vrias partes, a quantidade de larvas na soluo de DNA multiplicada pelo nmero de


divises. A partir da quantidade de gua filtrada na amostragem de plncton obtida em
campo possvel calcular a densidade larval. A
curva padro obtida a partir da amplificao
de 2 l de DNA molde procedente da qPCR
de uma srie de larvas (por exemplo, 1, 2, 5,
10, 20 e 50 indivduos, Figura 4). A amplificao para curvas padro conduzida conforme
descrito acima. As eficincias de amplificao
(E) foram calculadas a partir da inclinao das
curvas padro de acordo com a equao E =
10(-1/inclinao)-1. Um E de 1,0 corresponde a uma
eficincia de amplificao de 100%. Os dados
quantitativos de alta qualidade podem ser obtidos na faixa E que vai de 0,9 a 1,1 e quando
houver um coeficiente de correlao alto (R 2
> 0,98). Ao usar um reagente de lotes diferentes, uma nova curva padro deve ser preparada
para uma anlise mais precisa.

A anlise de qPCR permite estimar no
apenas a quantidade de larvas de mexilho-dourado, mas tambm a quantidade de DNA
de mexilhes dourados encontrados em amostras de plncton. A quantidade de DNA de mexilhes dourados calculada traando-se os
valores de Ct na curva padro obtida de diluies seriais do DNA molde (por exemplo, 0,5,
2,5, 5, 10, 25 e 50 ng / l) extrado de um mexilho-dourado adulto. O contedo do DNA
na amostra est estreitamente relacionado ao
nmero de larvas, sendo assim, a dinmica

CAPTULO 12
Seo 3

Figura 3. Exemplo de anlise de uma curva de desnaturao experimental realizada em um sistema Smart CyclerII (TaKaRa
Bio Inc.). A anlise da curva de desnaturao realizada com uma transio de
temperatura linear de 60C a 95C aps a
amplificao da qPCR, com um conjunto
de primers especfico para o mexilho-dourado. 3A, o nico pico da curva de
desnaturao indica que a qPCR amplificou um nico fragmento de DNA. A temperatura de desnaturao do produto da
qPCR de aproximadamente 79C e o produto da amplificao foi estimado como
sendo o DNA alvo; 3B, curva de desnaturao com dois picos obtida a partir de uma
amplificao no especfica.

do do DNA, sendo esta til quando h dificuldade na coleta de larvas da curva padro.

Concluses

Figura 4. A curva padro obtida a partir da amplificao de


qPCR de 2 l de DNA molde extrado de uma srie de larvas
de mexilho-dourado (1, 2, 5, 10, 20 e 50 indivduos). Os valores para o ciclo limite (Ct) foram traados em relao ao logaritmo da quantidade de larvas. As eficincias de amplificao
(E) foram calculadas a partir da inclinao das curvas padro
de acordo com a equao E = 10(-1/inclinao)-1.

larval pode ser compreendida comparando-se


o contedo de DNA entre as amostras. No
necessrio fazer uma curva padro utilizando
uma preparao larval para o clculo do conte-


A dinmica larval um fator importante
que contribui para a distribuio e abundncia das populaes. A deteco do mexilho-dourado e sua quantificao larval utilizando
o mtodo qPCR, conforme explicado neste captulo, foi estabelecida pois possibilita examinar a dinmica larval bem como permite uma
investigao mais rpida e precisa de larvas.
Alm disso, essa tcnica permitir identificar
o habitat do L. fortunei a partir da deteco de
larvas no ambiente natural, mesmo quando a
observao direta dos indivduos adultos difcil. Assim, essa tcnica ser uma ferramenta
poderosa para esclarecer a ecologia desta espcie, alm de ser benfica para a previso da
expanso de habitat e para o desenvolvimento
de medidas de preveno de invaso.

153

CAPTULO 13
Como monitorar moluscos
lmnicos invasores bentnicos e
macroinvertebrados associados?
Daniel Pereira
Janine Oliveira Arruda
Paulo Eduardo Aydos Bergonci
Arthur Schramm de Oliveira
Raoni Postiglione
Maria Cristina Dreher Mansur


Macroinvertebrados bentnicos so animais que habitam o substrato de lagos, rios,
arroios, esturios e mares, podendo viver dentro ou sobre o substrato, por meio da construo de tubos ou casas, fixos sobre rochas ou
materiais orgnicos, nos quais vivem durante
parte ou todo o ciclo de vida. Por conveno,
segundo Hauer & Resh (1996), esses consistem
na fauna de invertebrados que retida numa
malha com dimetro de abertura de 500 m;
no entanto, alguns estdios de vida em que os
organismos apresentam menor tamanho no
so retidos nesta malha, o que justifica o uso de
malhas de aberturas inferiores (250-300 m).

A comunidade de macroinvertebrados
bentnicos lmnicos composta por uma variedade de grupos taxonmicos, incluindo moluscos, insetos (adultos e imaturos), crustceos,
aneldeos etc. Um dos grupos mais representativos em nmero de espcies depois dos insetos
so os moluscos de gua doce. Somente dentre
os bivalves so conhecidos cerca de 114 espcies para o Brasil (ver Captulo 5). Apesar do

pequeno nmero de espcies de moluscos invasores 5 de bivalves e 4 de gastrpodes ,


o impacto destas invasoras pode ser devastador pra os demais componentes da macrofauna
bentnica.

At a dcada de 1990, a bioincrustao
em ecossistemas lmnicos da Amrica do Sul
era pouco representativa, salvo aquelas formadas pelas espcies do filo Porifera. No entanto,
com a introduo do mexilho-dourado, Limnoperna fortunei (Dunker, 1857), em diversas
bacias hidrogrficas brasileiras, um novo cenrio se estabeleceu para macrofauna bentnica
lmnica. O mexilho-dourado produz fios de
bisso que possibilitam a incrustao do mesmo sobre diferentes tipos de substratos duros
formando macroaglomerados. Darrigran &
Armengol (1998) e Darrigran et al. (1998a) verificaram intensas modificaes na estrutura
da fauna bentnica na bacia do Rio La Plata
(Argentina) em decorrncia da colonizao de
substratos duros pelo mexilho-dourado.

O monitoramento de moluscos invasores

155

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

numa bacia hidrogrfica deve considerar no


somente a quantificao da populao destas
invasoras, mas tambm a avaliao da estrutura da comunidade bentnica, com o objetivo de
verificar alteraes e impactos sobre esta fauna
to importante para a manuteno dos ecossistemas aquticos e seus nveis trficos.

O plano de amostragem deve considerar distintas reas da bacia, desde tributrios
de altitudes elevadas at as terras baixas, nas
quais estaes de coleta devero ser definidas
com base nas zonas do rio, seus trechos de corredeiras e poes, bem como os respectivos micro-habitats (rocha contnua, seixos, cascalho,
areia, silte/argila, folhio) tpicos destes trechos
(Figs. 1 e 2). Na bacia do arroio Velhaco (Fig.
2), o diagnstico da distribuio espacial da
malacofauna nativa e invasora considerou distintas unidades de paisagem da bacia e Pereira

em fase de licenciamento devem ser diagnosticados quanto presena de espcies invasoras,


com o objetivo de subsidiar o manejo da fauna
bentnica aps a operao, bem como a minimizao de impactos gerados por bioincrustao em decorrncia de uma planta geradora
industrial projetada de forma alheia presena
de organismos bioincrustantes.

1. Equipamentos e mtodos
de amostragem


Diferentes equipamentos e mtodos de
amostragem da fauna bentnica e, em especial,
da malacofauna lmnica, foram desenvolvidos
para situaes especficas encontradas em diferentes ambientes e micro-habitats. A relao
comentada destes diferentes equipamentos e
mtodos de amostragem descrita a seguir.

Figura 1. Microhabitats de rios e riachos. Desenho adaptado de FISRWG (1998) por Daniel Pereira.

156

et al. (2011a) constataram que este gradiente


ambiental foi determinante na composio de
espcies ao longo do rio.

No caso de represas, deve-se avaliar a
localizao de estaes de amostragem no sentido da corrente do canal principal do rio, bem
como de transees perpendiculares margem
com no mnimo trs pontos equidistantes que
devero ser escolhidos com base na batimetria
e morfometria do reservatrio (Fig. 3). O plano
de amostragem de uma represa deve prever a
localizao de estaes de amostragem desde
o incio do reservatrio, aonde a gua ainda
corrente, at o barramento, alm dos seus prin-

cipais tributrios. A Figura 4 exibe um plano


de amostragem utilizado para o diagnstico
da malacofauna bentnica da UHE Ibitinga
no Rio Tiet. Critrios semelhantes devem ser
aplicados a sistemas lacustres, lagunares e estuarinos, desta vez no considerando corrente,
mas sim a direo dos ventos que influencia
nos processos deposicionais dos corpos dgua.
O monitoramento deve ser realizado de forma integrada nas bacias, com base na parceria entre diversas instituies. No apenas os
reservatrios construdos devem ser monitorados quanto presena de moluscos e outros
invertebrados invasores, mas tambm aqueles

CAPTULO 13
Seo 3

Figura 2. Unidades de paisagem de uma bacia e estaes


de coleta em um diagnstico
das espcies lmnicas nativas
e invasoras da malacofauna.
Fonte: Pereira et al. (2011), Biotemas 24.

1.1. Amostradores


A escolha do amostrador adequado requer um planejamento prvio, no qual se deve
considerar o tipo de ambiente (rio, riacho, represa, lago, lagoa, laguna, aude, etc.). Tambm importante considerar a profundidade
do local, o tipo de substrato e o habitat a ser
amostrado. Amostradores com grande superfcie amostral resultam em amostras grandes que
demandam elevado tempo de processamento.
Amostradores com superfcie amostral pequena resultam em amostras menores que consequentemente demandam menor tempo de processamento; no entanto, selecionam o tamanho
dos organismos a serem amostrados. Alm do
mais, a variabilidade das unidades amostrais
aumenta em razo do efeito de borda. O mais

Figura 3. Estaes de coleta situadas em um trecho do rio Tiet


e seus tributrios para o diagnstico da distribuio de espcies
invasoras e nativas da malacofauna. Mapa adaptado de Tundisi
et al. (2008), Estudos Avanados 22(63) por Daniel Pereira.

adequado escolher um tamanho de amostrador que possibilite a amostragem de populaes dos diferentes grupos taxonmicos que
compem a comunidade.

O delineamento de um plano amostral
deve considerar aspectos da morfologia do
corpo dgua como: tipologia e declividade de
margem; reas de poo e corredeira no caso
de rios; diferentes substratos; reas de maior
e menor velocidade; diferentes profundidades;
a localizao de tributrios; proximidade a locais propcios a contaminao por invasoras
(portos, piers, ancoradouros).

O ideal que em cada micro-habitat de
um determinado sistema sejam obtidos, no mnimo, trs unidades de amostra. No entanto, o
mais aconselhvel e realizar uma amostragem
piloto preliminar com a finalidade de avaliar
a suficincia amostral (ver Brandimarte et al.,
2004).

A periodicidade deve ser no mnimo sazonal, mas quanto se trata do monitoramento
de espcies invasoras e seu impacto sobre a
fauna bentnica recomendado amostragens
mensais.

1.1.1. Pegadores ou busca-fundos


Coletam uma rea conhecida de substrato por meio de sua penetrao no mesmo, em
funo de seu peso; o fechamento provocado
por mecanismos ativados por molas, gravidade, braos em alavanca ou cordas (Brandimarte
et al., 2004).

157

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

mais leves; para soltar a trava que mantm as


mandbulas abertas, libera-se a tenso exercida
na corda; quando o busca-fundo levantado, o
sistema de alavanca fecha as mandbulas, mordendo o substrato e coletando a amostra; amplamente usado para amostrar fundo compacto
constitudo de areia, cascalho e argila em reas
de correnteza e guas profundas. (APHA, 1992).

Hongzhu et al. (1999) coletaram exemplares de Nemertea, Nematoda, Annelida,
Mollusca (classes Bivalvia e Gastropoda) e Arthropoda no estudo preliminar de zoobentos
do Lago Poyang (China), utilizando um busca-fundo de Peterson de 0,0625 m2 . Wanganeo et
al. (2011), no estudo dos macroinvertebrados
bentnicos em dois reservatrios artificiais de
Bhoj (municpio de Bhopal, ndia) utilizaram
o mesmo amostrador, porm com 0,027 m 2
de rea, e capturaram exemplares dos grupos
Mollusca (incluindo exemplares do gnero Limnoperna), Arthropoda, Annelida e Crustacea.

Figura 4. Proposta de um plano de amostragem da malacofauna bentnica e macroinvertebrados associados em reservatrios. Pontilhado amarelo demarcam transeces centrais
paralelas margem e perpendiculares margem; as bolinhas
amarelas representam pontos de amostragem. Em zoom so
verificados habitats importantes para amostragem como rochas, a vegetao flutuantes e o sedimento de fundo. Desenho: A.S. de Oliveira.

Figura 5. Busca-fundo de Petersen de dois distintos modelos: A:


ao inox leve para guas mais calmas; B: ao inox pesada para
rios correntosos. Fotos: D. Pereira e J.O. Arruda.

158


1.1.1.1. Busca-fundo de Petersen: feito de
ferro ou ao inoxidvel; possui duas garras ou
mandbulas como se fossem valvas da concha
de um molusco bivalve; o busca-fundo pode
apresentar diferentes tamanhos, variando em
rea de 0,06 a 0,09 m2 (Fig. 5); seu peso aproximado de 13,7 kg, podendo chegar at 31,8
kg, quando pesos auxiliares so adicionados
nos lados; para us-la, as mandbulas abertas
so lentamente colocadas no fundo da estao
de coleta, evitando a perturbao dos materiais


1.1.1.2. Busca-fundo de Van Veen: os
longos braos do amostrador tendem a estabiliz-lo sem perturbar a gua na interface gua/
substrato; este basicamente uma verso melhorada do busca-fundo de Petersen (Fig. 6),
sendo usado nos substratos lama, cascalho, seixos e areia; este amostrador pesado e deve ser
lanado por meio de uma plataforma de barco
ou navio, por elevadores mecnicos ou hidrulicos; utilizado em amostragens em mar aberto
e em grande lagos (APHA, 1992).

No estudo de Ablio et al. (2007) sobre os
macroinvertebrados aquticos da bacia hidrogrfica do Rio Tapero, bioma caatinga (Brasil), foi
utilizado um busca-fundo Van Veen de 0,04 m2
de rea, cujos grupos amostrados foram Arthropoda, Mollusca (classes Bivalvia e Gastropoda),
Crustacea e Annelida. Ourives (2010), utilizando
o mesmo amostrador, porm com 0,12 m2, em
seu estudo da distribuio espacial da macrofauna
bntica no esturio do Rio Cachoeira (municpio
de Ilhus, Bahia, Brasil) coletou exemplares de
Mollusca (classes Bivalvia e Gastropoda), Polychaeta, Nemertea, Echinodermata e Crustacea.

1.1.1.3. Busca-fundo de Ekman: feito de
lato ou ao inoxidvel com bitola de 12 a 20
cm, pesando aproximadamente 3,2 kg (Fig. 7);
a parte que parece uma caixa, e que segura a

CAPTULO 13
Seo 3

Figura 6. Busca-fundo de Van Veen. Acima, da esquerda para


a direita: vista ventral com as mandbulas fechadas, ventral
com as mandbulas abertas; abaixo, vista dorsal e lateral. Fotos: A.S. de Oliveira.

Figura 7. Busca-fundo de Ekman, com as mandbulas fechadas


(esquerda) e abertas (direita). Fotos: A.S. de Oliveira.

Figura 8. Busca-fundo de Ponar, com as mandbulas fechadas


(esquerda) e abertas (direita). Fotos: A.S. de Oliveira e M.V.
Nehrke.

amostra, possui mandbulas na parte inferior,


operadas por molas, que so armadas manualmente (tomar cuidado ao erguer as mandbulas
e engatilh-las, pois estas podem se desarmar
e causar danos s mos do operador); no topo
do busca-fundo esto duas tampas sobrepostas curvadas, que so mantidas parcialmente
abertas pela gua que passa atravs do compartimento de amostragem durante a descida do
amostrador; quando este est sendo retirado
da gua, as tampas so mantidas fechadas pela
presso da gua; o acionamento do fechamento
das mandbulas feito atravs de um mensageiro; as dimenses mais utilizadas so: 15 x 15
cm (0,0225 m2), 23 x 23 cm (0,0529 m2) e 30 x
30 cm (0,09 m2); o amostrador no apropriado para fundos rochosos, arenosos e ou em ambientes com crescimento moderado de macrfitas, porque pequenos seixos, areia ou talos de
macrfitas dificultam o fechamento adequado
das mandbulas; utilizado exclusivamente em
amostragens de substrato lodoso e com lama,
em gua com pouca correnteza (APHA, 1992).

Na investigao sobre a comunidade de
macroinvertebrados do sistema hidrolgico do
Taim (Rio Grande do Sul, Brasil), Wrdig et al.
(2007) utilizaram um amostrador busca-fundo
Ekman, coletando exemplares de Oligochaeta,
Turbellaria, Hirudinea, Gastropoda, Bivalvia
(incluindo exemplares de bivalves invasores da
famlia Corbiculidae), Crustacea e Insecta. Siraj et al. (2010) coletaram Mollusca (gastrpodes da famlia Lymnaeidae e bivalves diversos,
incluindo da famlia Corbiculidae), Annelida
e Arthropoda no estudo ecolgico dos macrobentos no charco de Shallabugh (ndia) usando
o busca-fundo Ekman de 0,0015 m2 .


1.1.1.4. Busca-fundo de Ponar: similar
ao busca-fundo de Petersen em tamanho, peso,
sistema de alavanca, mecanismo de fechamento e compartimento de amostra (Fig. 8); possui
placas laterais e uma tela na parte superior do
compartimento da amostra para evitar perda
desta durante o processo de fechamento; pode
ser usado em todos os tipos de substrato, exceto em rochas, sendo mais eficiente quando
usado em areia, cascalho ou em pequenas pedras com lama; geralmente utilizado em rios
de profundidade mdia a profunda, em lagos e
reservatrios (APHA, 1992).

159

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.


Ramsey & White (2007) coletaram exemplares de Arthropoda, Annelida e Mollusca (bivalves, incluindo a famlia Corbiculidae) utilizando busca-fundo Ponar de 0,0522 m2 de rea
amostral no Lago Kentucky (EUA). Taurusman
(2010) fez uso do mesmo amostrador, porm
com 0,023 m2 de rea amostral, em seu estudo
sobre a comunidade de macroinvertebrados da
baa de Jakarta (ndia), coletando exemplares de
Polychaeta, Bivalvia e Crustacea.

1.1.2. Dragas


Usada em amostragens quali-quantativas. A draga usada para capturar membros da
epifauna, mas devido a sua limitada penetrao
no sedimento, no adequada em amostragens
de animais que se enterram (Holme & McIntyre, 1971).

160


1.1.2.1. Draga de arrasto modelo adaptado de Holme e McIntyre (1971): consiste
basicamente em duas armaes principais de
ferro no formato de um retngulo; uma armao molda a abertura do amostrador; a haste
de ferro do retngulo perfurada e apresenta duas alas em forma de meia-lua nas laterais de menor comprimento; na parte superior
das alas se encontram argolas para amarrar
os cabos ou cordas nas quais ser suspenso o
amostrador; outro retngulo sem alas forma o
fundo do amostrador; ambos os retngulos so
conectados por hastes de ferro aparafusadas;
anteriormente montagem da estrutura metlica, os sacos, o externo, de pano, e o interno,
com a malha amostral adequada, so presos aos
retngulos por anilhas plsticas; as laterais de
maior comprimento do retngulo da abertura
devem ser denteadas, com a finalidade de penetrar no substrato (Fig. 9); a draga, amarrada a
um cabo, deve ser colocada na gua na posio
horizontal e descida lentamente para que no
mude de posio, at que fique deitada sobre o
fundo; feito isso, o barco deve percorrer uma
distncia x ou deve-se anotar o tempo de arraste; em todas as estaes de coleta deve-se
usar o mesmo procedimento; por meio de um
guincho, o amostrador puxado at o barco
onde o mesmo virado sobre uma bandeja para
que a lama coletada seja escoada e posteriormente peneirada.

Figura 9. Draga de arrasto (modelo adaptado de Holme,


1971). Estrutura metlica em ferro (f). Foto: D. Pereira.


1.1.3. Extratores


Os extratores so usados em amostragens quali-quantitativas. Estes variam desde
tubos puxados manualmente at modelos impulsionados por exploso com flutuao automtica (APHA, 1992).
1.1.3.1. Corers (do ingls, extrator): so
artefatos cilndricos, simples ou mltiplos, que
coletam uma coluna de substrato por operao
manual, gravidade ou envio de mensageiros
(Fig. 10); possuem, frequentemente, mecanismo
de fechamento na extremidade superior que
impede a perda de material (Brandimarte
et al., 2004). So usados para amostrar
sedimentos profundos. So mais eficientes que
o amostrador Surber, quando usados em combinao com peneiras para sedimentos finos
em uma rea amostral pequena, de 0,0013 a
0,0026 m2 . Para o uso eficiente como amostradores de superfcie, necessria uma densa
populao de animais.

1.1.4. Amostradores por Suco



So cilindros que so forados contra
o substrato e recebem suco por bomba
compressora (de ar ou gua); consequentemente,

Figura 10. Amostrador Corer. Foto: A.S. de Oliveira.

CAPTULO 13
Seo 3

Figura 11. Amostrador de suco: 11A, viso tridimensional


do amostrador; 11B, disposio
dos equipamentos usados pelo
amostrador de suco, com o
amostrador em si, uma bomba
se suco e uma rede. Desenhos: J.O. Arruda adaptado de
Kikuchi et al. (2006), Acta Limnologica Brasiliensia, 18(1).

ocorre subida de gua, de sedimentos e de


organismos que so selecionados usando rede
in situ ou so totalmente recolhidos e selecionados a posteriori (Brandimarte et al., 2004).

cm de comprimento por 30 cm de largura e 30


cm de profundidade no Rio Tocantins (Brasil).


1.1.4.1. Amostradores por Suco de Kikuchi et al. (2006): o corpo consiste de uma
caixa quadrada de metal (placas de ferro galvanizadas) de 30 cm de altura por 30 cm de largura e 30 cm de profundidade; so adicionados
mais 10 cm em cada largura para a adio de
peso (Fig. 11); a parte de baixo da caixa aberta e encontra-se em contato com o sedimento
de fundo; as laterais da caixa so fechadas; na
parte superior h um tubo de ao inoxidvel de
5 cm de dimetro e 25 cm de comprimento que
penetra no meio da caixa; na extremidade superior deste tubo, do lado de fora da caixa, acoplado uma mangueira para aspirar o sedimento;
na extremidade posterior do tubo, que se encontra dentro da caixa, encontra-se um filtro com
malha de 1 cm de dimetro para impedir que
grandes objetos sejam aspirados e consequentemente danifiquem o equipamento; em cada uma
das quatro extremidades da regio superior da
caixa h uma ala que contm cordas que so
amarradas e se unem em uma braadeira e esta
ao cabo de ao do guincho; lastros so adicionados sobre a superfcie da caixa e nas laterais para
dar estabilidade ao amostrador.

Brooks & Boulton (1991) utilizaram
amostrador de suco que encobriu 0,05 m2 do
substrato a 10 cm de profundidade nas estaes
de coleta do Rio Finniss (Austrlia), onde exemplares de Nematoda, Annelida, Mollusca (classe
Gastropoda), Crustacea e Arthropoda foram
amostrados. Kikuchi et al. (2006) coletaram
Annelida, Mollusca (classes Bivalvia e Gastropoda), Crustacea, Arthropoda e Platyhelminthes utilizando um amostrador de suco de 30


Constam de aparelhos que delimitam
uma rea sobre o substrato para amostragem.
Estes podem estar associados a redes ou no.
A rea do substrato perturbada, em geral,
manualmente, com consequente liberao dos
animais, que so capturados pela rede. Exemplo: amostradores Surber e Hess. Mais detalhes
sobre sua estrutura e funcionamento so apresentados por Klemm et al. (1990). Tendo rea
delimitada, seus resultados so expressos em
densidade por metro quadrado.

1.1.5. Delimitadores


1.1.5.1. Quadrados ou cilindros: podem
ser feitos de diferentes materiais como PVC, ferro, ao inoxidvel e madeira, bem como podem
apresentar diferentes tamanhos (Fig. 12). Este
amostrador delimita uma rea sobre um substrato, onde os organismos so removidos por raspagem, com o auxlio de um pincel ou, no caso de
sedimento fino, com o auxlio de uma esptula
ou, simplesmente, catados manualmente.

Figura 12. Delimitadores no formato quadrado (ao fundo) e cilndrico ( frente). Foto: D. Pereira e J.O. Arruda.

161

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.


Pereira et al. (2001) coletaram moluscos
lmnicos no bentos marginal do arroio Capivara, municpio de Triunfo (Brasil), utilizando
quadrats de 0,22 m2. Kikuchi & Uieda (2005),
amostrando reas no crrego Itana no municpio de Itatinga (Brasil), delimitadas por
quadrante de 30 cm x 30 cm (0,09 m2), com
profundidade mxima de 10 cm, coletaram Platyhelminthes, Nematoda, Arthropoda, Mollusca (classes Bivalvia e Gastropoda) e Crustacea.
1.1.5.2. Surber: consiste em dois quadrados delimitadores de ferro (30 x 30 cm; 0,09
m2), unidos por uma extremidade articulvel,
sendo que um deles posicionado horizontalmente sobre o substrato enquanto que o outro
fica na posio vertical (Fig. 13); o conjunto
desses dois quadrados forma uma espcie de
L dobrvel; em cada lateral do L preso
um tecido em forma de tringulo; no quadrado
vertical preso um saco de malha de 250 m

Figura 13. Amostrador de Suber. Foto: D. Pereira e J.O. Arruda.

162
Figura 14. Amostrador de Hess. Foto: D. Pereira e J.O. Arruda.

e 60 cm de comprimento; o amostrador posicionado sob o substrato de forma que a abertura do saco junto ao quadrado vertical seja posicionada contra a correnteza; o coletor revolve o
substrato delimitado pela rea do quadrado horizontal e a correnteza leva os organismos para
dentro do saco; os tringulos laterais de pano
impossibilitam que os organismos fujam pela
lateral, fazendo com que a corrente de gua os
direcione para dentro do saco de malha.

Silva, L. et al. (2005), utilizando amostrador Surber de 0,225 mm de abertura de malha e
0,1 m2 de rea no Rio das Almas e no crrego do
Inferno (Minas Gerais, Brasil), coletaram exemplares de Arthropoda, Mollusca (classe Bivalvia), Annelida e Platyhelminthes. Kikuchi et al.
(2006) coletaram Annelida, Mollusca (classes
Bivalvia e Gastropoda), Crustacea e Arthropoda
utilizando Surber em estaes de coleta no Rio
Tocantins (Brasil). Milesi et al. (2009) usaram o
mesmo amostrador com 250 m de abertura de
malha e 0,1 m2 de rea amostral em riachos da
regio norte do Rio Grande do Sul (Brasil), coletando organismos dos grupos Platyhelminthes,
Annelida, Mollusca (classes Bivalvia e Gastropoda), Crustacea e Arthropoda.
1.1.5.3. Hess: consiste em um cilindro de
50 cm de altura com 30 cm de dimetro (0,15
m2); na parede do cilindro h duas aberturas retangulares (28 cm de largura por 40 cm de altura; 0,112 m2), uma na regio oposta da outra; em
uma delas encontra-se acoplado uma malha de
250 m, fechando esta abertura (regio anterior);
no retngulo oposto (regio posterior) h acoplado um saco no formato triangular de malha
de 250 m no qual, em sua extremidade distal,
acoplado um copo rosquevel similar aos utilizados em rede de plncton; o cilindro tambm
possui duas alas laterais situadas na sua parte superior; o cilindro colocado na posio vertical
sobre o substrato; apoiado pelas alas este girado para a esquerda e para a direita at penetrar no
substrato, sendo que a regio anterior deve ficar
posicionada no sentido contra a correnteza para
que a corrente de gua passe por essa abertura e
saia pela posterior, onde se localiza o saco triangular (Fig. 14); o coletor revolve com as mos
o substrato delimitado pelo fundo do cilindro;
a corrente de gua que passa pelo equipamento
carrega os detritos e os invertebrados para den-

CAPTULO 13
Seo 3

tro do saco triangular; depois de todo o material


retido no saco ter sido deslocado para dentro do
copo rosquevel, este desenroscado e o material
nele contido acondicionado em potes ou sacos
plsticos contendo lcool 80%.

Metzeling et al. (2003) coletaram exemplares de Mollusca (classes Gastropoda e Bivalvia, incluindo exemplares da famlia Corbiculidae), Arthropoda, Nemertea, Nematoda,
Annelida, Crustacea e Platyhelminthes com um
amostrador Hess de 0,1 m2 de rea e 0,25 mm
de abertura de malha em vrios rios dos estados
de Victoria e South Wales (Austrlia). Kikuchi
et al. (2006) coletaram Annelida, Mollusca
(classes Bivalvia e Gastropoda), Crustacea e
Arthropoda utilizando Hess em estaes de
coleta no Rio Tocantins (Brasil). Alonso & Camargo (2010), utilizando amostrador Hess com
malha de 250 m de abertura e 0,01815 cm2 de
rea amostral, coletaram no Rio Henares em
Guadalajara (Espanha) espcimes de Crustacea, Arthropoda, Mollusca (classes Bivalvia e
Gastropoda) e Platyhelmintes.

1.1.6. Conchas

vado, preso na ponta de um cabo (Fig. 16); a


extremidade reta da meia lua denteada; utilizada para raspar superfcies incrustadas por
bivalves em paredes de concreto; a rea amostrada delimitando, sendo a largura a mesma
do amostrador e a distncia perpendicular
largura do amostrador percorrida no processo
de raspagem o comprimento da rea amostral;
a multiplicao do valor da distncia raspada pela largura do amostrador fornece a rea
amostrada; a partir da rea possvel calcular a
densidade populacional na parede incrustada.

Figura 15. Coletores de moluscos ou conchas de captura.


Foto: Ministrio da Sade (2007).


1.1.6.1. Concha de captura (Carvalho et
al., 2005): a concha de captura constituda
de um recipiente de alumnio de fundo crivado
preso na ponta de um cabo (Fig. 15). A concha
empregada para coletar moluscos aderidos
vegetao submersa, emergente e flutuante,
permitindo o escoamento da gua e a reteno
dos moluscos. Tambm pode ser utilizada para
coletar moluscos junto ao sedimento de fundo.

No estudo do gastrpode Melanoides
tuberculatus no municpio de Guapimirim (RJ)
realizado por Giovanelli et al. (2005), foi utilizada uma concha metlica com malha de 4 mm
de abertura, que era movida um passo a cada
conchada aplicada, cobrindo uma distncia de
30 m em 20 minutos para cada estao de coleta. J no estudo de Nez (2010), uma concha
de captura com 15 cm de dimetro e abertura
da malha de 1,4 mm foi utilizada para coleta
do caramujo Physa acuta no municpio de La
Plata (Argentina).

1.1.6.2. Concha raspadora de superfcie: constituda de um recipiente de alumnio
em forma de meia-lua com o fundo reto e cri-

163

Figura 16. Concha raspadora de superfcie. Foto: D. Pereira e


J.O. Arruda.

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

1.2. Substratos artificiais


Os substratos artificiais so artefatos
que procuram imitar certas caractersticas do
ambiente a ser amostrado (Rosenberg & Resh,
1982), como disponibilizar material para colonizao por organismos bentnicos. Esse material pode ser encontrado tanto no ambiente a
ser amostrado quanto fora dele. Os substratos
artificiais so ferramentas amplamente utilizadas no monitoramento de macroinvertebrados
lmnicos e marinhos, especialmente de espcies
que se fixam ou formam incrustaes sobre superfcies duras. Os substratos artificiais padronizam a amostragem, reduzem a variabilidade
e o tempo de processamento de amostras (Gibbons et al., 1993). Podem ser seletivos para
certos organismos; no fornecem informao
sobre o substrato local; requerem tempo de
colonizao relativamente longo para que seja
alcanado o equilbrio da comunidade, o que o
torna inadequado para estudos de curta durao, sujeito a perda ou a alterao de eficincia,
em razo de vandalismo, sedimentao, secas
e enchentes, possibilidade de perda de organismos durante o recolhimento dos substratos
(Brandimarte et al., 2004).

O perodo mnimo de submerso de um
substrato artificial para a avaliao da colonizao da fauna bentnica em ecossistemas
lmnicos de 75 dias, de acordo com Henriques-de-Oliveira (2002). Para a colonizao de
substratos pelo mexilho-dourado recomenda-se o tempo mnimo de trs e cinco meses para
a visualizao de incrustaes por indivduos
adultos, o que varia em funo da disponibi-

lidade de densidades elevadas de larvas no


plncton, bem como de outros fatores como
a competio com outros organismos incrustantes (porfera, perifton, etc.), a qualidade e
velocidade da gua. Quando se objetiva apenas
avaliar o recrutamento do mexilho-dourado,
colonizaes resultantes de um ms de exposio so suficientes. A magnitude da incrustao pode ser avaliada por meio da quantificao da densidade de indivduos incrustados em
substratos submersos em diferentes perodos
de exposio (1 ms, 2 meses, 3 meses, ..., 12
meses), conforme a Figura 17, por meio de diferentes substratos que podero ser escolhidos
pelo coordenador do programa de monitoramento ou pelo pesquisador ,de acordo com o
objetivo proposto e a natureza dos dados que
se deseja coletar.


1.2.1. Estruturas tridimensionais de
amianto (Morton, 1977): so placas no formato
de um quadrado que so encaixadas e que,
em um primeiro momento, uma encontra-se
perpendicular a outra, formando um eixo X e
um eixo Y e, num segundo momento, adicionase uma outra placa que forma o eixo Z (Fig.
18). Esta estrutura tridimensional apresenta
24 superfcies que somadas fornecem a rea
amostral.

Morton (1977), no estudo da dinmica
populacional de L. fortunei em um reservatrio em Hong Kong, montaram duas sries
de armaes, penduradas a 0,3 m de profundidade em intervalos de 0 m, 0,3 m, 0,6 m,
0,9 m e 1,2 m de distncia entre si e ligadas
por uma linha de nylon a um peso de concreto

164
Figura 17. Delineamento amostral de monitoramento do mexilho dourado nas fases bentnicas (recruta e adulto) com substratos em forma de x de madeira submersos no delta do Jacu, Porto Alegre, RS, durante projeto coordenado pelo IEAPM (anos de
2006-2008), com financiamento do CT-HIDRO. Tempos de exposio dos substratos: 1 ms, densidade mensal (M), 2 meses (2),
3 meses (3), 4 meses (4), 5 meses (5), ..., 12 meses (12). As profundidades no diferem estatisticamente quanto a profundidade;
sendo assim, em cada conjunto se considera trs rplicas. Desenho: D. Pereira.

CAPTULO 13
Seo 3

Figura 18. Estrutura tridimensional de amianto proposto por Morton (1977). Desenho: J.O. Arruda e R. Postiglione. Adaptado
de Morton (1977), Malacologia 16(1).

deitado sobre o fundo e a boias. Cada srie


de armaes foi mensalmente inspecionada
por um perodo de 28 meses para verificar a
colonizao pelo mexilho-dourado. Uma vez
colonizado, os exemplares de mexilho foram
medidos em intervalos mensais para acompanhar seu crescimento de mm at o maior comprimento. A cada ms, seis exemplares adultos
de mexilho-dourado foram coletados sobre
pedras dentro do reservatrio para a inspeo
de seus ctendeos (tambm conhecidos como
brnquias), visando busca de ovos encubados
e larvas. No final do experimento as armaes foram levadas ao laboratrio e o nmero
total de exemplares assentados em cada uma
das superfcies e fendas de cada armao foi
registrado e medido. A temperatura e o oxignio dissolvido foram registrados, no local do
experimento a 0 m, 0,6 m e 1,2 m de profundidade. Estes dados tm sido correlacionados
poca de reproduo e o assentamento de
larvas de mexilho, objetivando estimar valores timos sobre quando esses processos ocorrero.

1.2.2. Estruturas tridimensionais de

PVC (Boltovskoy & Cataldo, 1999): armaes compostas por trs placas retangulares
de PVC dispostas entre si para definir trs planos perpendiculares (Fig. 19); esta presa ao
ancoradouro por dois furos opostos; este desenho garante que as superfcies orientadas em
todas as direes fiquem disponveis para colonizao e que todo o aparato fique orientado
da mesma forma, com a base da frente para a
jusante; o material aderido superfcie da armao removido e filtrado em um malha de

25 m de abertura, com o intuito de eliminar


as partculas de argila e slica; os mexilhes
maiores que 2-3 mm de comprimento retidos
so manualmente separados; o remanescente
da amostra reamostrando utilizando um separador de plncton Folsom at se obter uma
frao contendo ao menos 150 indivduos juvenis menores que 2 mm.

Boltovskoy & Cataldo (1999) estudaram a dinmica populacional do mexilho-dourado no baixo Rio Paran (Argentina)
utilizando amostradores tridimensionais de
PVC. Os autores fizeram amostragens mensais ao longo de 11 meses, em um ano onde
houve extrema influncia do fenmeno climtico El Nio. Os autores concluram que a
reproduo de L. fortunei foi contnua entre
os meses de setembro e maro, sendo que no
perodo de temperaturas mais baixas houve
um declnio acentuado da reproduo na populao estudada.

165

Figura 19. Amostrador tridimensional de PVC: 19A, estrutura


formada por trs placas de PVC perpendiculares; 19B, esquema de um separador de plncton de Folsom. Desenhos: Raoni
Postiglione. Adaptado de Boltovskoy & Cataldo, Biofouling
(1999), 14(3) por R. Postiglione.

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.


1.2.3. Estruturas tridimensionais de
PVC (Sylvester et al., 2007a): armao constituda de uma gaiola formada por trs placas
de PVC mutuamente perpendiculares, formando quatro sees; trs delas so recobertas por
telas protetoras de plstico com aberturas de
malha de 40, 15 e 5 mm cada uma (Fig. 20);
a armao colocada dentro da gua na rea
amostral e presa um metro abaixo da superfcie
dgua por um peso de 20 kg.

Figura 20. Amostrador tridimensional de PVC. Adaptado de


Sylvester et al. (2007), Hydrobiologia 589 por R. Postiglione.


Sylvester et al. (2007a) utilizaram a armao de PVC revestida por tela plstica de malha
de 5 mm para coletar L. fortunei no delta do
baixo Rio Paran (Argentina). Os demais grupos animais coletados junto com o mexilho-dourado foram Oligochaeta, Chironomidae,
Hirudinea, Rotifera, Copepoda, Turbellaria,
Nematoda, Insecta, Naupii, Tardigrada, Cladocera, Tanaidacea, Ostracoda, Hydracarina e
outros moluscos da classe Gastropoda.

166


1.2.4. Estruturas tridimensionais de madeira no formato de X (Fontes et al., 2002;
Mansur et al., 2009): o substrato consiste em
um x de madeira com alas metlicas pelas
quais o amostrador fixado a um per (Fig. 21),
paredo de concreto ou plataforma flutuante
por meio de cordas; geralmente so fixadas trs
rplicas conectadas por corda a 0,5 m de distncia uma da outra (em canais entre 5 e 6 m de
profundidade no se verifica diferenas significativas entre as rplicas, de acordo com Mansur
et al., 2009); para que o substrato permanea
na posio vertical na coluna dgua, um peso
(rocha, tijolo ou metal) fixado na ala inferior

da ltima rplica; aps o perodo de exposio


adotado, os substratos colonizados so primeiramente lavados sobre rede de plncton 30 m
com auxlio de gua destilada e de um pincel
para a remoo de recrutas e, posteriormente,
de esptulas para a remoo de adultos; os filtrados so fixados em lcool 70%; a contagem
total realizada no laboratrio e quando elevadas densidades so verificadas realizada a
quantificao por subamostragem; para tal, o
material fixado novamente filtrado por uma
rede de 150 m; o material retido examinado
ao microscpio estereoscpico para a remoo
e quantificao total dos adultos; o restante do
filtrado contendo os recrutas removido para
um copo de bquer de 25 ml, com o auxlio de
um pincel e gua destilada; o material contido
no bquer avolumado com lcool 70%; o volume agitado (25 vezes); com uma seringa
retirada uma alquota (2 ml) e removida para
uma placa quadriculada (rea total de 23 cm2
e quadrcula de 1 cm2); a placa agitada sobre
a bancada por meio de movimentos circulares
(25 vezes nos sentidos horrio e anti-horrio);
sob o microscpio estereoscpico o material
contido na placa quantificado; com base na
rea amostral do substrato artificial (0,0722
m2) tambm so calculadas as densidades mdias expressas em m 2 .

Oliveira et al. (2006) usaram amostrador artificial de concreto para o estudo do
mexilho-dourado no Rio Paraguai, Porto Esperana (Brasil) e, posteriormente, adotaram o
substrato de madeira na forma de X. Os autores encontraram uma densidade mdia de
523,8 e 238 ind.m-2 nos meses de agosto de
2001 e fevereiro de 2002, respectivamente.
Mansur et al. (2009) utilizaram o substrato
de madeira no formato de um X no estudo da
colonizao do mexilho-dourado no delta do
Rio Jacu e no cais do porto em Porto Alegre
(RS, Brasil). Foram utilizadas trs rplicas do
substrato artificial, expostas por trs meses,
nas profundidades de 1, 1,5 e 2 m. Os autores
no encontraram diferena significativa quanto
s diferentes profundidades testadas e nem em
relao posio do mexilho no substrato artificial. Entretanto, encontraram diferena na
densidade mdia dos adultos entre as estaes
de coleta estudadas. As densidades mdias de
adultos encontradas por Oliveira et al. (2006)

CAPTULO 13
Seo 3

Figura 21. Substrato artificial de madeira


em forma de X: 21A, esquema dos substratos suspensos por cordas em diferentes
profundidades, ancorados no sedimento
por um tijolo cermico; 21B, terminologia do substrato cermico; 21C, substrato sem incrustao (rea: 0,072m2); 21D,
substrato com incrustao; 21E, viso da
superfcie superior do substrato com incrustaes. Fonte: Mansur et al., 2009,
Biotemas 22(1).

foram inferiores a observadas por Mansur et


al. (2009) utilizando o mesmo substrato.

1.2.5. Substrato cermico tijolo (Santos
et al., 2008): os tijolos de cermica so retangulares e perfurados medindo aproximadamente 14 cm de comprimento x 10 cm de largura
(0,014 m2); os tijolos so inseridos em suportes
de ferro na forma de estantes, que por sua vez
so cravados no sedimento; permanecem suspensos a uma altura de no mnimo 20 cm do
fundo (Fig. 22); tambm podem ser fixados suspendendo-os por cordas em um per, plataforma
flutuante, paredo de hidreltrica ou porto; a
quantificao dos indivduos fixados ao substrato realizada nas duas fases bentnicas de desenvolvimento do mexilho (recruta< 0,5 mm;
adulto>0,5 mm); o microscpio estereoscpico
com ocular milimetrada utilizado na quantificao; a rea avaliada do tijolo computada
para que se possa calcular a densidade (ind.m-2).

Figura 22. Substrato artificial cermico (tijolo) para amostragem do mexilho-dourado:


22A, substratos fixados em suportes de
ferro na forma de estante; 22B, substrato
incrustado pelo mexilho-dourado. Lateral canaliculada incrustada (p) e furo
incrustado (f). Fonte: Santos et al., 2008,
Revista Brasileira de Zoologia 25(3).


Na investigao do mexilho-dourado
no delta do Rio Jacu, Lago Guaba e laguna
dos Patos no Rio Grande do Sul, Mansur et al.
(2003) utilizaram tijolos de cermica de 14 X
10,5 x 9,5 cm, vazados por seis perfuraes de
3 cm e duas de 1 cm de dimetro para coleta
quantitativa. Estes foram colocados quinzenalmente e mensalmente, na periferia e dentro de
juncais [Scirpus californicus (C. A. Mey) Steud.],
para a avaliao da incidncia e do tempo de
fixao do L. fortunei. Alm desses, outros tijolos foram mantidos por trs, seis meses e um
ano no local de amostragem. Cada tijolo era
numerado e ancorado ao fundo, atravs de uma
haste de ferro com 2 cm de comprimento e 0,5
cm de dimetro, transpassada por uma abertura de menor dimetro do tijolo e enterrada no
substrato a uma profundidade de aproximadamente 50 cm. Como a haste era longa, parte
dela encontrava-se emersa, facilitando a localizao do ponto de coleta. Esta permaneceu ao

167

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

Figura 23. Substrato cermico (tijoleta):


23A, superfcie canelada; 23B, superfcie
lisa; 23C, bastidor de ferro com substratos cermicos (tijoletas) fixados, modificado de Caprari (2006). Fonte: P.E.A. Bergonci et al., 2009, Biotemas 22(3). Fotos:
D.Pereira e P.E.A. Bergonci.

longo de todo o perodo de amostragem, sendo


substitudos periodicamente apenas os tijolos.

Santos et al. (2008) utilizaram tijolos
para o acompanhamento do crescimento do
mexilho-dourado na praia do Veludo em
Porto Alegre (RS, Brasil). As autoras utilizaram seis conjuntos de quatro tijolos cada na
rea amostral, que foram substitudos a cada
seis meses e retirados ao final de um ano. Na
contagem e medida do comprimento mximo
dos indivduos adultos, foram consideradas as
quatro superfcies maiores de cada tijolo alm
de distncia de 1 cm dentro de cada perfurao
dos tijolos. Os animais foram medidos usando
paqumetro digital de 0,01 mm de preciso. As
autoras encontraram uma diferena significativa do tamanho dos indivduos entre as estaes
primavera-vero e outono-inverno.

168


1.2.6. Substrato cermico tijoleta (Bergonci et al., 2009): o substrato (Fig. 23A, B) se
constitui de uma tijoleta de cermica medindo
21 cm de comprimento, 6 cm de largura e 1 cm
de espessura; os substratos so perfurados a 2
cm da extremidade com furadeira eltrica; so
fixados por meio de anilhas plsticas em estruturas metlicas denominadas bastidores (Fig.
23C); os bastidores so suspensos por cordas
junto a um per, plataforma flutuante, paredo
de hidreltrica ou porto; a quantificao dos
indivduos fixados ao substrato realizada nas
duas fases bentnicas de desenvolvimento do
mexilho (recruta<0,5 mm; adulto>0,5 mm);
o microscpio estereoscpico com ocular milimetrada utilizado na quantificao, com o
auxlio de uma malha transparente quadriculada e segmentada (Fig. 24), sobreposta s su-

perfcies do substrato; em cada segmento so


sorteadas cinco quadrculas (Qij) de 1 cm2 , nas
quais se quantificam os indivduos recrutas e
adultos; por meio da equao 1 (Dsn = (Qij/5))
so calculadas as densidades de indivduos
(ind.cm-2) nos trs segmentos (Dsn; n = I, II ou III),
de cada superfcie; quando no so detectados
indivduos nas quadrculas de um segmento,
procede-se quantificao total dos indivduos no segmento, dividindo-se o valor resultante da quantificao pela rea do segmento (42
cm); em seguida so obtidas as densidades das
superfcies (Dln; n = lisa, I ou canaliculada, II) por meio da
equao 2 (Dln = Dsn); a densidade mdia (D,
ind.cm-2) de indivduos no substrato cermico
obtida por meio da soma das densidades de
ambas superfcies por meio da equao 3 (D =
Dln). Os bastidores foram adaptados de modelos desenvolvidos por Caprari (2006) com a finalidade de fixar corpos de prova utilizados na
avaliao de revestimentos anti-incrustantes.

Bergonci et al. (2009) utilizaram o substrato artificial tijoleta para amostragem do mexilho-dourado no cais do porto e no canal do Rio
Jacu em Porto Alegre (RS, Brasil). Os autores

Figura 24. Malha quadriculada para sobreposio no substrato artificial e orientao da quantificao. Segmentos (Sn) na
tijoleta: SI, SII e SIII. Fonte: Bergonci et al., 2009, Biotemas
22(3).

CAPTULO 13
Seo 3

compararam as densidades mdias de recrutas e


adultos nas duas estaes de coleta, bem como
nas distintas superfcies da tijoleta (lisa e canaliculada) e seus segmentos. Concluram que houve
diferena estatstica nas densidades de recrutas
e adultos nas estaes de coleta, alm de terem
encontrado diferena entre os segmentos e as superfcies da tijoleta na estao do cais do porto.

1.2.7. Garrafa PET preenchida com o
retculo celulsico da fruta da bucha (Lufa cilindra L.) (Volkmer-Ribeiro et al., 2004): cada
amostrador consiste em duas garrafas verdes
tipo PET descartveis de dois litros cada, cujo
fundo de cada garrafa cortado com o auxlio de uma tesoura e desprezado; a cor verde
para diminuir a depredao causada pelo ser
humano, uma vez que uma garrafa verde submersa mais difcil se ser vista do que uma garrafa transparente (Fig. 25); o restante das garrafas lixado, tanto a superfcie interna como
a externa; as tampas so mantidas, fechando
as aberturas de ambas as garrafas; as garrafas
so cortadas longitudinalmente em seis tiras de
aproximadamente 2 cm de largura, comeando
pela base, com o auxlio de uma tesoura; em
cada tira so feitos pequenos cortes transversais a cada 2 mm, deixando-os com aparncia
de um pente; dentro das garrafas se adiciona
um enchimento natural, constitudo por uma
rede de celulose que abriga as sementes da
planta Luffa cylindra L.; o enchimento adaptado para o tamanho das garrafas que o abrigaro; uma garrafa inserida dentro da outra,
com as aberturas tampadas dispostas em lados
opostos e com o enchimento dentro delas; as
garrafas so ento envoltas por uma pequena
rede de nylon, cuja abertura fechada sob a
tampa de uma das garrafas PET; uma pea de
metal pesando aproximadamente 300 g fixada prximo tampa de uma das garrafas; um
fio de nylon de aproximadamente 3 m fixado
tampa da outra garrafa; o amostrador fixado, utilizando a corda de nylon, vegetao
adjacente ou a um tronco nas margens da estao de coleta e, em seguida, arremessado para
dentro da gua; para a retirada do amostrador
da gua, desprende-se o fio de nylon amarrado
margem do rio e usa-o como guia para determinar o local exato onde a garrafa se alojou, tomando o cuidado para no desloc-la; um saco

plstico mergulhado no fundo do rio e ento


o amostrador ensacado, sendo o saco amarrado e s ento emerso da gua; o saco plstico contendo o amostrador colocado em um
balde de plstico, aberto, adicionado formalina
5% para fixar o material, novamente fechado e
transportado para o laboratrio; o contedo de
cada saco, junto com o amostrador, evertido
sobre uma peneira forrada com algodo e lavado sobe gua corrente; em seguida as garrafas,
a rede de nylon e a rede de celulose so secas
para posterior exame da fauna associada; os
macroinvertebrados so identificados e contabilizados com o uso de estereomicroscpio.

Volkmer-Ribeiro et al. (2004) utilizaram
uma garrafa PET preenchida pela planta Luffa
cylindra L. para amostragem de macroinvertebrados bentnicos no Rio Ca e no arroio Bom
Jardim em Triunfo (RS, Brasil). Foram capturados exemplares de Turbellaria, Oligochaeta,
Mollusca (classes Gastropoda e Bivalvia, incluindo o mexilho-dourado), Crustacea, Insecta, Bryozoa e Porifera. Devido efetividade
na captura dos grupos mais representativos de
macroinvertebrados bentnicos, os autores recomendaram o uso deste amostrador no monitoramento desta comunidade.

1.2.8. Garrafa PET com preenchimento
por folhas de taboa (Typha dominguensis Pers.)
(Queiroz et al., 2007): o coletor de substrato
artificial desenvolvido baseia-se no estudo de
Volkmer-Ribeiro et al. (2004); so utilizadas
garrafas tipo PET com oito furos de 2 cm de
dimetro cada e 5 cm de distncia entre eles,
sendo quatro furos na parte superior e quatro

Figura 25. Esquema do amostrador de garrafa PET preenchido


com retculo celulsico da fruta da bucha. Desenho: R. Rosa.
Fonte: Volkmer-Ribeiro et al., 2004, Brazilian Journal of Biology 64(3A).

169

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

na parte inferior da garrafa; alm dos furos,


feito nas garrafas cortes longitudinais de 17 cm
de comprimento por 1,5 cm de largura, unindo
os furos superiores e inferiores de cada garrafa; estes cortes tm a funo de permitir que
se coloque 60 g de folhas de taboa (Typha dominguensis) dentro de cada garrafa (Fig. 26) e,
tambm, para que estas folhas se mantenham
em contato com a gua; as garrafas so fixadas em varas de bambu com 3 m de comprimento utilizando uma abraadeira de plstico,
mantendo-se uma distncia de 20 cm entre a
garrafa e a ponta da vara de bambu inserida no
fundo dos viveiros, de forma a manter a garrafa exatamente sobre o sedimento do fundo dos
viveiros; no topo de cada vara de bambu so
colocadas marcaes, como bandeiras coloridas, para diferenciar o tempo de permanncia
de cada garrafa na estao de coleta; aps o
tempo de amostragem, a garrafa retirada da
gua e as amostras so acondicionadas em sacos plsticos.

Queiroz et al. (2007) coletaram principalmente representantes de Gastropoda (famlia Thiaridae), Oligochaeta (Glossiphonidae) e
Diptera (Chironomidae), utilizando amostradores artificiais de garrafa PET preenchidos
por folhas de taboa em tanques de piscicultura
no municpio de Itupeva (SP, Brasil). Os autores
concluram que em 40 dias ocorreu a colonizao dos amostradores, sendo que aps este perodo constatou-se uma diminuio no nmero
de organismos no substrato.


1.2.9. Garrafa PET com tela de nylon (Pereira et al., 2010, adaptado de Volkmer-Ribeiro
et al., 2004): consiste numa garrafa PET com uma
tela de nylon (10 x 10 cm) presa na parede interna
do amostrador; a superfcie do amostrador perfurada com a finalidade de permitir o fluxo da
gua; aps a colonizao o fundo e o gargalo da
garrafa removido com o auxlio de uma tesoura
(Fig. 27); a malha de nylon (superfcie amostral 1)
removida e fixada em lcool 70%; a quantificao total de macroinvertebrados realizada sob o
microscpio estereoscpico, sendo os resultados
expressos em densidade mdia (ind.m-2); a malha
de nylon um material inerte; aps a retirada da
malha, a lateral da garrafa aberta, originando
um retngulo de aproximadamente 576 cm2 (superfcie amostral 2), o que varia de acordo com
o fabricante do recipiente; o material fixado na
superfcie externa quantificado sob o microscpio estereoscpico, os resultados podem ser expressos em densidade de organismos (ind.m2) ou
em percentual de cobertura (%), especialmente
no caso de esponjas incrustantes.

Pereira et al. (2010) amostraram moluscos bivalves (mexilho-dourado) e gastrpodes, bem como Chironomidae e Oligochaeta
no delta do Rio Jacu e no cais do porto de
Porto Alegre (RS, Brasil) utilizando o substrato
artificial acima descrito.

1.3. Substratos naturais

Os substratos naturais so muitos vari-

170
Figura 26. Amostrador de garrafa PET preenchida com por folhas de taboa: 26A, amostrador artificial feito com garrafa PET e
vara de bambu; 26B, detalhamento do amostrador com preenchido internamente com folhas de taboa. Fonte: Queiroz et al.,
2007, Circular Tcnica EMBRAPA 16.

CAPTULO 13
Seo 3

Figura 27. Esquema do amostrador de garrafa PET com tela de


nylon. Superfcie amostral 1 (a), malha de nylon (rea: 100cm2)
fixada na lateral interior da garrafa; superfcie amostral 2 (b),
retngulo (rea: 576cm2) formado pelo corte da lateral exterior da garrafa PET nas linhas tracejadas (lt); orifcios (o) com
dimetro de 1cm. Fonte: Pereira et al., 2010, Biotemas, 23(1).

veis quanto ao tamanho e a forma. As macrfitas


apresentam diferentes formas biolgicas e ocupam diferentes habitats. As rochas apresentam
diferentes tipos de texturas, porosidade, tamanho e composio mineral. Desta forma, a coleta
quantitativa nestes substratos uma tarefa difcil.
Alguns procedimentos so descritos a seguir:

1.3.1. Razes e talos de gua p: o aguap-de-barao Eichhornia azurea (Sw.) Kunth forma colnias fixas (Fig. 28), sendo que
sua raiz mais profunda se adere ao substrato.
Logo, essa poro da raiz serve de substrato para os bentos. Para a coleta dos bentos,
puxa-se para fora da gua, pela folhagem flutuante, um dos talos da macrfita. Continua-se puxando, com cuidado para no romper
o talo e sem deixar que ele retroceda para
dentro dgua, at que as vrias cabeleiras de
razes mais novas saiam da gua. Na sequncia, so deslocadas as razes fixas no substrato do fundo, o que se observa quando, alm
do barro, a raiz apresenta alguma quantidade
de lodo e, o talo e a raiz passam a apresentar
cor marrom enegrecida. Essa seco do talo,
com uma ou mais cabeleiras de razes, deve
ser cortada do talo subjacente e colocada em
saco plstico para anlise dos bentos. Uma
vez a raiz retirada da gua, esta no deve ser
novamente mergulhada no rio. A cabeleira selecionada opera como uma draga, trazendo
junto a si uma poro do substrato com a fauna dela contida. Por isso procura-se exercer
trao contnua no talo de modo a evitar que
as razes entrem novamente na gua e assim se
perca o material retido nas cabeleiras. No laboratrio, cada amostra retirada do saco plstico lavada em uma bacia com gua comum,

atravs de imerses sucessivas at que as cabeleiras das razes fiquem limpas do sedimento
e do lodo. O lodo, gua e sedimento que se
encontram no saco plstico tambm so vertidos nesta mesma bacia. O lodo resultando da
lavagem deixado para decantar. A gua sobrenadante escorrida utilizando um pano de
algodo para reter eventuais animais. O lodo,
ento, passado aos poucos em gua corrente
atravs do mesmo pano para reteno da fauna nele contida. Em seguida o pano fechado
em trouxa e mergulhado dentro de um frasco
contendo lcool 70% para posterior contagem
dos organismos. Estes so contados a olho nu
e tambm atravs de estereomicroscpio com
aumento de at 10x. As razes lavadas so separadas dos caules, restando destes apenas os
ns. Razes e ns de uma mesma amostra so
colocados em uma bandeja forrada com jornal para retirada do excesso de umidade. Esta
bandeja colocada em uma estufa com circulao forada de ar para secagem. No caso de
haver disponvel uma estufa comum ao invs
de uma com circulao forada de ar, o jornal
da bandeja dever ser trocado sempre que ficar
encharcado ou muito mido e as razes e caules
devero ser reviradas para acelerar a perda de
gua e evitar que a amostra mofe. Se possvel, a
amostra dever ficar exposta ao sol ou em um
ambiente que possua umidade baixa. Quando o
jornal estiver pouco mido, praticamente seco,
a bandeja ento levada a uma estufa a 70C
para secagem. O processo de secagem em uma
estufa comum, secagem prvia da amostra com
o uso de jornal, leva em torno de uma semana.
Aps a secagem das razes e caule, a amostra
pesada em uma balana digital analtica de
0,01 g de preciso. Com o peso do substrato
seco e a contagem do nmero de indivduos da
amostra, relaciona-se o percentual (para cada
100 g de raiz) ao nmero de indivduos de
cada um dos grupos faunsticos encontrados na
amostra. O mesmo procedimento de triagem e
secagem pode ser realizado a partir dos talos
do aguap. Os resultados devem ser expressos
separadamente para razes e talos.

1.3.2. Rochas: podem ser coletadas
manualmente na beira de rios e lagos, ou em
reas mais profundas por meio de mergulho
(Fig. 29); devem-se coletar rochas de tamanhos

171

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

Figura 28. O aguap-de-barao Eichhornia


azurea (Sw.) Kunth enraizado no substrato na margem de um corpo dgua.
Fonte: Volkmer-Ribeiro et al. 2004, Brazilian Journal of Biology 64(3A).

similares; os organismos aderidos so removidos com pincel umedecido em gua destilada e


por raspagem com esptula; os resultados podem ser expressos em densidade de organismos
(ind.m-2), quando for possvel quantificar a rea
da rocha (sendo que esta no uma tarefa fcil)
ou como abundncia de organismos em cada rplica do substrato. Um mtodo apropriado para
a quantificao de organismos em rochas encontra-se descrito em Fischer & Gaupp (2004).

2. Processamento de amostras
em campo e no laboratrio

2.1. Peneiramento das amostras de


sedimento

Figura 29. Macroinvertebrados aderidos a rochas: 29A, manchas


de cor bege so porferos; 29B, Limnoperna fortunei incrustado
em rocha com fauna acompanhante de gastrpodes do gnero
Potamolithus sp. Fotos: A, D. Pereira; B, M.C.D. Mansur.


As amostras de sedimento coletadas com
busca fundo, dragas e delimitadores (sem rede)
so peneiradas em uma srie de peneiras com
malhas diversas sobrepostas sobre uma mesa
(Fig. 30) e lavadas com gua corrente que pode
ser jorrada por uma mangueira conectada a
uma bomba a bateria.

172

2.2. Acondicionamento das amostras


As amostras so acondicionadas em
potes plsticos em diferentes tamanhos (Fig.
30A). As etiquetas de identificao devem ser
inseridas no interior do frasco junto amostra
e externamente ao frasco. A etiqueta interna
feita com papel vegetal e caneta nanquim e
posteriormente inserida num tubo de eppendorf (Fig. 30B) que colocado dentro do frasco, evitando se assim que o papel rasgue ou
se degrade. A etiqueta externa feita com fita
crepe larga com boa propriedade adesiva e a
anotao deve ser feita a lpis ou nanquim para
que no caso de vazamento do lcool este no
remova a anotao.

Figura 30. Conjunto de peneiras com malhas de 1 mm; 0,5mm


e 0,25 mm para a lavagem de sedimento e triagem prvia de
organismos bentnicos. Foto: D. Pereira.

Figura 31. Materiais utilizados no acondicionamento das amostras: 31A, potes plsticos de diferentes tamanhos, picetas contendo gua e lcool 70%, bandeja de plstico e alcometro; 31B,
tubos plsticos tipo eppendorf (os dois esquerda) e potes de
acrlico (os dois direita) que recebem. as etiquetas para identificao da amostra. Fotos: D. Pereira e J.O. Arruda.

Van Veen

Petersen

Mtodo de
amostragem
Rios, riachos e represas
com fundos de lama,
areia e cascalho.

Rios, riachos e represas


com fundos de lama,
areia e cascalho.

- material de alto custo;


- os maiores so muito pesados, requerendo
barco grande com guincho;
- mandbulas podem ser bloqueadas por pedras e galhos;
- no eficiente para organismos escavadores;
- no pode ser empregado em fundos lajeados ou com rochas muito grandes;
- necessita de guincho para retornar a superfcie com as amostras;
- se abrangem rea muito grande, como resultado pode haver aumento do tempo gasto na
triagem.

- encontrado no mercado
em vrios tamanhos;
- mecanismo de fechamento das mandbulas
melhor que do busca-fundo Petersen;
- amostra a maioria dos
tipos de substrato;
- ideal para amostrar locais profundos.

BUSCA-FUNDOS

Ecossistema/Habitat/
Microhabitat

- material de alto custo;


- modelo padro muito pesado, requerendo
barco grande com guincho;
- se descido rapidamente, pode causar ondas
de choque que perturbam o fundo;
- mandbulas no penetram profundamente, portanto, organismos em profundidades
maiores no so amostrados;
- mandbulas facilmente bloqueadas por detritos, causando perda de material;
- quando obstrudo, necessrio lanar novamente o amostrador, o que pode requerer um
maior tempo de coleta, alm de causar mltiplas perturbaes no substrato;
- no pode ser empregado em fundos lajeados
ou com rochas muito grandes;
- os modelos maiores necessitam de guincho
para retornar a superfcie com as amostras;
- se abrangem rea muito grande, como resultado pode haver aumento do tempo gasto
na triagem.

Desvantagens

- encontrado no mercado
em vrios tamanhos;
- se usado apropriadamente; permite amostragem
quantitativa;
- amostra a maioria dos tipos de substrato;
- ideal para amostrar locais
profundos.

Vantagens

Densidade (m2)

Densidade (m2)

Expresso de
Resultados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Limnoperna fotunei
Melanoides tuberculatus
Macroinvertebrados associados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Limnoperna fotunei
Melanoides tuberculatus
Macroinvertebrados associados

Espcie a ser monitorada

Tabela I. Mtodos e equipamentos de amostragem de moluscos invasores e macroinvertebrados associados. Modificado de Brandimarte et al. (2004), baseado em observaes de campo
e na literatura acima citada.

CAPTULO 13

Seo 3

173

174

Ponar

Ekman

Mtodo de
amostragem

Tabela I. Continua...

- material de alto custo;


- quando em grandes dimenses so muito
pesadas, requerendo um barco de porte compatvel com a instalao de um guincho;
- mandbulas podem permanecer abertas
quando obstrudas por pedras e detritos,
causando perda de amostra;
- a verso pequena no eficiente em guas
rpidas;
- se abrangem rea muito grande, como resultado pode haver aumento do tempo gasto
na triagem.

- material de alto custo;


- pelo fato de serem leves, as mandbulas no
penetram em substratos duros;
- mandbulas frequentemente no fecham
completamente por bloqueio ou falha no
mecanismo de fechamento;
- ineficiente onde a velocidade da gua relativamente alta;
- no pode ser empregado em fundos lajeados ou com rochas muito grandes;
- se abrangem rea muito grande, como resultado pode haver aumento do tempo gasto
na triagem.

- encontrado no mercado
em vrios tamanhos;
- fcil operao manual
em gua rasa, podendo
ser empurrada contra o
substrato;
- aberturas superiores
reduzem a formao de
ondas de choque ou e
perturbao do substrato;
- amostra substratos de
lama ou areia;
- ideal para amostrar locais profundos.
- encontrado no mercado
em vrios tamanhos;
melhor
penetrao
que outros busca-fundos
(mesmo a verso pequena
tem boa penetrao, considerado seu tamanho);
- placas laterais e telas reduzem formao de ondas
de choque;
- melhor amostrador
quantitativo para ambientes de gua doce;
- verso pequena pode
ser operada manualmente
sem barco ou guincho;
- amostra a maioria dos
tipos de substrato;
- ideal para amostrar locais profundos.

Ecossistema/Habitat/
Microhabitat

Rios, riachos e represas


com fundos de lama,
areia e cascalho.

Lagos, lagoas, lagunas e


audes com fundos de
lama e areia.

BUSCA-FUNDOS

Desvantagens

Vantagens

Densidade (m2)

Densidade (m2)

Expresso de
Resultados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Limnoperna fotunei
Melanoides tuberculatus
Macroinvertebrados associados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Limnoperna fotunei
Melanoides tuberculatus
Macroinvertebrados associados

Espcie a ser monitorada

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

Amostradores
por suco

Corers

Draga de arrasto
modelo adaptado
de Holme (1971)

Mtodo de
amostragem

Tabela I. Continua...

- frequentemente permitem estimativas populacionais com maior


exatido que pegadores e
corers.

- encontrado no mercado
em vrios tamanhos;
- boa penetrao em sedimentos moles;
- pequeno volume da unidade amostral permite
anlise de nmero maior
de rplicas em curto intervalo de tempo;
- no caso dos manuais,
podem ser usados em ambientes rasos;
- pequena perturbao da
interface gua/substrato.

- permite a coleta de organismos maiores que


no so capturados pelos
demais equipamentos;
- permite uma amostragem mais representativa
da composio de espcies do sedimento de
fundo.

Vantagens
DRAGA

- operao requer equipamentos caros (por


exemplo, compressor de ar) e, as vezes, mergulhador em locais profundos.

SUCO

- tamanho pequeno da unidade amostral


pode ser problema em situaes em que os
organismos so escassos ou com tamanho
maior que a rea amostral;
- no retm areia;
- pode ocorrer a perda de organismos pequenos e epibntonicos em funo de ondas de
choque;
- a variabilidade das unidades amostrais aumenta em razo do efeito de borda.

CORERS

- no comercializado, devendo ser manufaturado;


- difcil operao, pois a draga pode no descer na posio correta e subir sem material;
- necessita de guincho para retornar a superfcie com as amostras;
- coleta apenas organismos enterrados superficialmente no sedimento e no captura
organismos escavadores;
- pode ficar presa ao fundo quando presente
rochas, galhos ou troncos.

Desvantagens

Rios de grande porte,


com elevada profundidade e substrato rochoso do tipo lajeado,
cascalho, seixos, areia
e lodo.

Lagos, lagoas, lagunas e


audes.

Lagos, lagoas e lagunas.

Ecossistema/Habitat/
Microhabitat

Densidade (m2)

Densidade (m2)

Abundncia

Expresso de
Resultados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Melanoides tuberculatus
Macroinvertebrados associados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Melanoides tuberculatus
Macroinvertebrados associados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Limnoperna fotunei
Melanoides tuberculatus
Macroinvertebrados associados

Espcie a ser monitorada

CAPTULO 13

Seo 3

175

176
- a eficincia da amostragem depende de
correnteza, no sendo possvel amostrar em
gua parada;
- dificuldade de disposio em alguns tipos
de substrato;
- eficincia baixa em fluxo lenta porque os
organismos no so arrastados para o interior da rede;
- amostragem limitada a profundidades inferiores a 30 cm.
-os organismos com alta mobilidade podem
escapar quando o substrato perturbado;
-organismos menos mveis podem ser superestimados em relao aos com maior mobilidade.
- a eficincia da amostragem depende de
correnteza, no sendo possvel amostrar em
gua parada;
- dificuldade de disposio em alguns tipos
de substrato;
- amostragem limitada a profundidades inferiores a 80 cm; essa profundidade pode ser
varivel de acordo com a altura do cilindro
do amostrador.

- encontrado no mercado
em vrios tamanhos;
- facilmente transportado;
- ideal para coletas em locais rasos.

- encontrado no mercado
em vrios tamanhos;
- pode ser usado em leitos
cobertos por vegetao;
- ideal para coletas em locais rasos.
-os organismos com alta
mobilidade no escapam
quando o substrato
perturbado (por exemplo
caranguejos da famlia Aeglidae).

Quadrado ou
cilindro

Hess

Surber

- se a coleta for feita em uma rea com gua


corrente, o material coletado pode ser deslocado, perdendo se assim parte da amostra;
- no permite coleta em locais profundos.

- encontrado no mercado
em vrios tamanhos;
- facilmente transportado;
- ideal para a coleta de bivalves enterrados em sedimentos;
- ideal para coletas em locais rasos.

Ecossistema/Habitat/
Microhabitat

Rios e riachos, principalmente em corredeiras.

Rios e riachos, principalmente em corredeiras.

Riachos rasos, margens


de lagos, lagoas e de lagunas.

DELIMITADORES

Desvantagens

Vantagens

Mtodo de
amostragem

Tabela I. Continua...

Densidade (m2)

Densidade (m2)

Densidade (m2)

Expresso de
Resultados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Melanoides tuberculatus
Physa acuta
Helisoma spp.
Macroinvertebrados associados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Melanoides tuberculatus
Physa acuta
Helisoma spp.
Macroinvertebrados associados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Limnoperna fotunei
Melanoides tuberculatus
Macroinvertebrados associados

Espcie a ser monitorada

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

Estruturas
tridimensionais de
amianto (Morton
et al., 1977)

Concha raspadora
de superfcie

Concha coletora
de moluscos

Mtodo de
amostragem

Tabela I. Continua...

- material de baixo custo;


- no exige estruturas adicionais como bastidores,
podendo ser fixado por
meio de cordas;
- adequado para ambientes
lnticos, com ou sem batimento de ondas e lticos
em diferentes nveis de
correnteza;
- adequado para locais
profundos, como represas;
- fcil observao das distintas fases de vida (bentnicas), nveis de colonizao, e aglomerados;
- adequado para elevada
profundidade.

- material de baixo custo;


- fcil manuseio;
- adequado para ambientes lnticos, sem batimento de ondas;
- adequado para coletas qualitativas em reas
com vegetao submersa,
emergente e flutuante,
alm de sedimento de
fundo.
- material de alto custo;
- fcil manuseio;
- adequado para ambientes lnticos, com ou sem
batimento de ondas;
- ideal para coletas quantitativa de moluscos incrustantes em paredes de
concreto em hidreltricas,
portos, etc.

Vantagens

Ambientes construdos
nas margens de rios,
represas, lagos, lagoas e
lagunas.

- no comercializado, devendo ser manufaturado;


- no adequado para superfcies irregulares;
- uma coleta eficiente requer uma raspagem
contnua e uniforme.

- no comercializado, devendo ser manufaturado;


- o amianto um material cancergeno;
- difcil manuseio no microscpio estereoscpico;
- a raspagem dos aglomerados para coleta de
indivduos adultos pode danificar indivduos
recrutas e jovens;
- os substratos devem ser lavados com gua
destilada e pincel para que no ocorra a perda de indivduos jovens e recrutas.

Rios, represas, lagos,


lagoas e lagunas.

SUBSTRATOS ARTIFICIAIS

Rios, riachos, represas,


lagos, lagoas, lagunas e
audes.

CONCHAS

Ecossistema/Habitat/
Microhabitat

- no adequado para coletas quantitativas;


- se o coletor inclinar dentro dgua, a amostra pode ser perdida.

Desvantagens

Densidade (m2)

Densidade (m2)

Abundncia

Expresso de
Resultados

Limnoperna fotunei
Macroinvertebrados associados

Limnoperna fotunei
Macroinvertebrados associados
Macroinvertebrados associados

Corbicula largillierti
Corbicula fluminea
Corbicula fluminalis
Corbicula sp.
Melanoides tuberculatus
Physa acuta
Helisoma duryi
Helisoma trivolvis
Macroinvertebrados associados

Espcie a ser monitorada

CAPTULO 13

Seo 3

177

178

Estruturas
tridimensionais
de PVC (Sylvester
et al., 2007)

Estruturas
tridimensionais de
PVC (Boltovskoy
& Cataldo, 1999)

Mtodo de
amostragem

Tabela I. Continua...

- material de baixo custo;


- no exige estruturas adicionais como bastidores,
podendo ser fixado por
meio de cordas;
- adequado para ambientes
lnticos, com ou sem batimento de ondas e lticos
em diferentes nveis de
correnteza;
- adequado para locais
profundos, como represas;
- fcil observao das distintas fases de vida (bentnicas), nveis de colonizao, e aglomerados;
- adequado para elevada
profundidade.
- material de mdio custo;
- no exige estruturas adicionais como bastidores,
podendo ser fixado por
meio de cordas;
- adequado para ambientes
lnticos, com ou sem batimento de ondas e lticos
em diferentes nveis de
correnteza;
- adequado para locais
profundos, como represas;
- adequado para elevada
profundidade.

Vantagens

Ecossistema/Habitat/
Microhabitat

- no comercializado, devendo ser manufaturado;


- difcil manuseio no microscpio estereoscpico;
- as diferentes malhas selecionam tamanhos
dos organismos incrustantes ou colonizadores, dificultando a interpretao dos resultados.

- no comercializado, devendo ser manufaturado;


- difcil manuseio no microscpio estereoscpico;
- a raspagem dos aglomerados para coleta de
indivduos adultos pode danificar indivduos
recrutas e jovens;
- os substratos devem ser lavados com gua
destilada e pincel para que no ocorra a perda de indivduos jovens e recrutas.

Rios, represas, lagos,


lagoas e lagunas.

Rios, represas, lagos,


lagoas e lagunas.

SUBSTRATOS ARTIFICIAIS

Desvantagens

Abundncia

Densidade (m2)

Expresso de
Resultados

Limnoperna fotunei
Macroinvertebrados associados

Limnoperna fotunei
Macroinvertebrados associados

Espcie a ser monitorada

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

Estruturas de
cermica tijolo
(Santos et al.,
2008)

Estruturas
tridimensionais
de madeira no
formato de X
(Fontes et al.,
2002; Mansur et
al., 2009)

Mtodo de
amostragem

Tabela I.Continua...

- material de mdio custo;


- no exige estruturas adicionais como bastidores,
podendo ser fixado por
meio de cordas;
- adequado para ambientes
lnticos, com ou sem batimento de ondas e lticos
em diferentes nveis de
correnteza;
- adequado para locais
profundos, como represas;
- fcil observao das distintas fases de vida (bentnicas), nveis de colonizao, e aglomerados;
- adequado para elevada
profundidade.
- facilmente encontrado
no mercado;
- material de baixo custo;
- fcil manuseio no microscpio estereoscpico;
- adequado para o monitoramento em ambientes
lnticos, com reduzido
batimento de onda ou lticos, com baixa correnteza;
- fcil observao das distintas fases de vida (bentnicas), nveis de colonizao, e aglomerados;
- tima conservao do
material biolgico durante
o processamento em campo e laboratrio;
- pode ser facilmente fixado por cordas.

Vantagens

Ecossistema/Habitat/
Microhabitat
Rios, represas, lagos,
lagoas e lagunas.

Represas, lagos, lagoas


e lagunas.

- no comercializado, devendo ser manufaturado;


- difcil manuseio no microscpio estereoscpico;
- a raspagem dos aglomerados para coleta de
indivduos adultos pode danificar indivduos
recrutas e jovens;
- os substratos devem ser lavados com gua
destilada e pincel para que no ocorra a perda de indivduos jovens e recrutas.

- quando utilizadas estantes de ferro, o custo aumenta, alm de dificultar a fixao no


ambiente;
- no indicado para ambientes lticos, com
elevada correnteza;
- material frgil e quebradio;
- viabiliza elevado assentamento, devido s
caractersticas texturais do material, podendo no representar os nveis populacionais
em substratos naturais (exceto alguns tipos
de substratos rochosos);
- o material dever ser desidratado a 60o C em
forno de Pasteur at 24 horas.

SUBSTRATOS ARTIFICIAIS

Desvantagens

Densidade (m2)

Densidade (m2)

Expresso de
Resultados

Limnoperna fotunei
Macroinvertebrados associados

Limnoperna fotunei
Macroinvertebrados associados

Espcie a ser monitorada

CAPTULO 13

Seo 3

179

180

Garrafa
PET com
preenchimento de
material celulsico
da bucha de
Luffa cylindrica
(Volkmer-Ribeiro
et al., 2004)

Estruturas de
cermica tijoleta
(Bergonci et al.,
2009)

Mtodo de
amostragem

Tabela I. Continua...

- facilmente encontrado
no mercado;
- material de baixo custo;
- fcil manuseio no microscpio estereoscpico;
- adequado para o monitoramento em ambientes
lnticos, com reduzido
batimento de onda ou lticos, com baixa correnteza;
- fcil observao das distintas fases de vida (bentnicas), nveis de colonizao, e aglomerados;
- tima conservao do
material biolgico durante
o processamento em campo e laboratrio;
- os bastidores podem ser
reaproveitados.
- material de baixo custo;
- adequado para ambientes
lticos com baixa produo periftica, velocidade
reduzida e teor de slidos
sedimentveis reduzidos;
- no exige estruturas adicionais como bastidores,
podendo ser fixado por
cordas;
- o material coletado
lavado em peneira sobre
gua corrente para posterior anlise sob microscpio estereoscpico.

Vantagens

Ecossistema/Habitat/
Microhabitat

- no comercializado, devendo ser manufaturado;


- formao de biofilmes (algas e protozorios) ou acumulao de sedimentos na superfcie externa da garrafa;
- acumulao de sedimento internamente na
tela;
- a colonizao dos demais macroinvertebrados mais favorecida que a dos moluscos
invasores;
- rompimento das garrafas, em locais com
batimento de ondas, ou com elevada correnteza;
- o crescimento populacional no substrato
pouco representativo devido aos interferentes citados;
- no adequado para a observao de aglomerados e dos nveis de colonizao;
- no representam os nveis populacionais em
substratos naturais, dificultando qualquer
tipo de comparao.

- requer estruturas de ferro adequadas para


fixao (bastidores) de elevado custo;
- os bastidores no so encontrados no mercado, devendo ser manufaturados;
- os bastidores necessitam de manuteno
devido corroso;
- material (bastidores + substratos) pesado;
- no indicado para ambientes lticos, com
elevada correnteza;
- material frgil e quebradio;
- viabiliza elevado assentamento, devido s
caractersticas texturais do material, podendo no representar os nveis populacionais
em substratos naturais (exceto alguns tipos
de substratos rochosos);
- o material dever ser desidratado a 60o C em
forno de Pasteur at 24 horas.

Rios, riachos, audes,


represas, lagos, lagoas e
lagunas.

Represas, lagos, lagoas


e lagunas.

SUBSTRATOS ARTIFICIAIS

Desvantagens

Abundncia

Densidade (m2)

Expresso de
Resultados

Limnoperna fotunei
Macroinvertebrados associados

Limnoperna fotunei
Macroinvertebrados associados

Espcie a ser monitorada

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

Garrafa PET
com tela de nylon
(Pereira et al.,
2010)

Garrafa
PET com
preenchimento
por folhas de
taboa (Typha
dominguensis
Pers.) (Queiroz et
al., 2007)

Mtodo de
amostragem

Tabela I. Continua...

- material de baixo custo;


- adequado para ambientes
lticos com baixa produo periftica, velocidade
reduzida e teor de slidos
sedimentveis reduzidos;
- no exige estruturas adicionais como bastidores,
podendo ser fixado por
cordas;
- fcil manuseio das telas
sob o microscpio estereoscpico.

- material de baixo custo;


- adequado para ambientes
lticos com baixa produo periftica, velocidade
reduzida e teor de slidos
sedimentveis reduzidos;
- no exige estruturas adicionais como bastidores,
podendo ser fixado por
cordas;
- o material coletado
lavado em peneira sobre
gua corrente para posterior anlise sob microscpio estereoscpico.

Vantagens

Ecossistema/Habitat/
Microhabitat

- no comercializado, devendo ser manufaturado;


- formao de biofilmes (algas e protozorios) ou acumulao de sedimentos na superfcie externa da garrafa;
- acumulao de sedimento internamente na
tela;
- a colonizao dos demais macroinvertebrados mais favorecida que a dos moluscos
invasores;
- rompimento das garrafas, em locais com
batimento de ondas, ou com elevada correnteza;
- o crescimento populacional no substrato
pouco representativo devido aos interferentes citados;
- no adequado para a observao de aglomerados e dos nveis de colonizao;
- no representam os nveis populacionais em
substratos naturais, dificultando qualquer
tipo de comparao.
- no comercializado, devendo ser manufaturado;
- formao de biofilmes (algas e protozorios) ou acumulao de sedimentos na superfcie externa da garrafa;
- acumulao de sedimento internamente na
tela;
- rompimento das garrafas, em locais com
batimento de ondas, ou com elevada correnteza;
- o crescimento populacional no substrato
pouco representativo devido aos interferentes citados;
- no adequado para a observao de aglomerados e dos nveis de colonizao;
- no representam os nveis populacionais em
substratos naturais, dificultando qualquer
tipo de comparao.
Abundncia

Abundncia

Rios, riachos, audes,


represas, lagos, lagoas e
lagunas.

Expresso de
Resultados

Rios, riachos, audes,


represas, lagos, lagoas e
lagunas.

SUBSTRATOS ARTIFICIAIS

Desvantagens

Limnoperna fotunei
Macroinvertebrados associados

Limnoperna fotunei
Macroinvertebrados associados

Espcie a ser monitorada

CAPTULO 13

Seo 3

181

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.

Limnoperna fotunei
Melanoides tuberculatus
Rios, riachos, audes,
represas, lagos, lagoas e
lagunas.
- diferentes tamanhos de rocha so encontrados nos distintos trechos de uma bacia.
- a rea das rochas de difcil quantificao.

Abundncia ou
densidade.

Abundncia ou
densidade.
Rios, riachos, audes,
represas, lagos, lagoas e
lagunas.

Rochas

SUBSTRATOS NATURAIS

- em muitos locais no so verificados exemplares do aguap;


- num programa de monitoramento no so
encontradas muitas vezes a mesma espcie
de macrfita em todos os trechos e estaes
de coleta de uma bacia hidrogrfica, o que
dificulta a avaliao integrada de resultados;
- a fauna que ocorre neste substrato distinta daquela verificada no substrato de fundo,
sendo considerada uma amostragem complementar e no alternativa.

- o mtodo pode ser aplicado e adaptado a outras


macrfitas;
-permite amostrar com facilidade em locais onde os
rios so muito encaixados,
profundos e de fundo rochoso, sendo invivel a utilizao de amostradores;
- a fauna que ocorre neste
substrato mais rica que
em muitos substratos artificiais.
- amostragem fcil e rpida;
Razes e talos de
gua p

Mtodo de
amostragem

182

Tabela I. Continua...

Vantagens

Desvantagens

Ecossistema/Habitat/
Microhabitat

Expresso de
Resultados

Limnoperna fotunei
Melanoides tuberculatus
Physa acuta
Helisoma duryi
Helisoma trivolvis

Espcie a ser monitorada

2.3. Anestesia


Muitos organismos devem ser anestesiados antes de conservados, pois caso no sejam,
retraem o corpo, inviabilizando a posterior determinao especfica ou, em alguns casos, at
em nvel de gnero ou famlia. Alguns procedimentos so citados a seguir: para moluscos, colocar os indivduos em um recipiente com gua
e mentol, refrigerar em geladeira, procurando
no agitar o recipiente ou mov-lo de lugar para
que os organismos possam relaxar e atingir o
estgio de letargia; para hidroides, o anestsico
mais usado o mentol, sendo tambm usado o
cloreto e o sulfato de magnsio, dentre outros;
nos ectoprotozoa, usar uma soluo de 1% de
stovaine ou eucaine, que adicionado gota a
gota a intervalos de 10 a 15 minutos entre as
primeiras duas doses e 5 minutos para as sucessivas ou, como anestsico alternativo, usar
mentol; para os hirudneos, usar uma soluo
de lcool a 5-10%, suco de limo ou gua gasosa; para os crustceos, usar uma soluo de
formol a 1-2% (Mugnai et al., 2010).

2.4. Conservao das amostras


Apesar no uso consagrado de lcool 70%
para a conservao de amostras biolgicas, no
caso de amostras de sedimento para avaliao
da fauna bentnica, recomenda-se a utilizao
de lcool 80-85% uma vez que as amostras de
sedimento apresentam elevado teor de umidade
e matria orgnica. O uso de formol extremamente inapropriado j que causa a descalcificao das conchas dos moluscos, inviabilizando
assim a sua identificao.

2.5. Processamento de amostras em


laboratrio


O processamento das amostras ocorre
no laboratrio. Para a triagem de uma amostra,
o sedimento retirado do pote plstico e colocado por meio de uma colher de plstico sobre uma placa de acrlico (Fig. 32) escavada no
formato de um U, que levada ao estereomicroscpio para triagem dos organismos. Se h
uma grande quantidade de amostra, coloca-se

CAPTULO 13
Seo 3

apenas uma parte do sedimento na placa, sendo o restante adicionado medida que a triagem do material anterior tenha sido finalizada.
Na placa escavada e com o auxlio de pinas e/
ou agulha de ao inoxidvel, analisa-se o sedimento. Os organismos encontrados so pinados usando pina de ao malevel (Fig. 33) e
colocados em uma placa de acrlico com poos
escavados e preenchidos por lcool 70%. Posteriormente, esses organismos, se forem pequenos, so transferidos para tubos plsticos com
tampa tipo Eppendorfs e preenchidos com
lcool 70%; se forem maiores, so transferidos
para potes de acrlico que tambm so preenchidos por lcool 70%. So utilizadas pinas
maleveis, pincel e/ou pera de plstico para a
transferncia dos organismos para os recipientes anteriormente mencionados. Tanto o tubo
como o pote, deve conter uma etiqueta, feita
de papel vegetal e escrita a caneta nanquim,
com informaes sobre a amostra (data, coletor e local de coleta). Aps a identificao do
organismo, adicionada outra etiqueta ao tubo
ou pote com o nome do txon. Como o pote
de acrlico e o tubo plstico secam em contato
com lcool 70%, abrindo pequenas fissuras e
assim deixando vazar seu contedo, estes so
acondicionados em frascos de vidro (Fig. 28)
com tampa metlica preenchidos por lcool
70%. Assim, mesmo que apaream fissuras, o
organismo dentro do tubo ou frasco no se deteriorar com a evaporao do lcool.

Figura 32. Placas de acrlico escavada em formato de U (esquerda) e com oito poos escavados (direita). Foto: J.O. Arruda.

Figura 33. Materiais utilizados na triagem das amostras. Da


esquerda para a direita: pinas de diferentes tamanhos, agulha, pincel, pera de plstico e colher de plstico. Foto: J.O.
Arruda.

2.6. Identificao dos txons


Ser bentlogo no uma tarefa fcil,
pois exige conhecimento sobre a taxonomia de
vrios grupos de invertebrados. Assim como
uma nica pessoa no consegue se especializar
em todos os grupos taxonmicos que esto presentes na comunidade de macroinvertebrados,
por outro lado nem sempre se tm disposio
os especialistas dos grupos taxonmicos que
se necessita. Alm disso, um programa de monitoramento bem executado e planejado pode
gerar um nmero de amostras muito elevado,
dificultando ainda mais o processamento e determinao, pela falta de profissionais treinados.

183

Figura 34. Frascos de vidro preenchido por lcool 70% e contendo os tubos plsticos (esquerda) e potes de acrlicos (direita) com os organismos identificados das amostras coletadas.
Foto: J.O. Arruda.

Como monitorar moluscos lmnicos invasores


bentnicos e macroinvertebrados associados?
Pereira et al.


No caso do monitoramento de espcies
invasoras, a correta determinao especfica
das mesmas primordial. No s dos moluscos lmnicos, alvo de discusso neste livro, mas
tambm das demais espcies de macroinvertebrados invasores que ocupem os mesmos nichos. Num programa de monitoramento onde
se objetiva avaliar o impacto dos moluscos e
outros invertebrados invasores sobre a fauna

184

bentnica de forma geral, os demais macroinvertebrados devem ser identificados, no mnimo, em nvel de famlia. Quando espcies ameaadas e endmicas esto presentes na bacia
monitorada, o monitoramento deve considerar
a determinao especfica das mesmas, pois a
presena de espcies invasoras pode acarretar
no declnio das populaes de espcies ameaadas e endmicas.

Seo
Aspectos populacionais
de moluscos invasores e
relaes com variveis
ambientais

CAPTULO 14
Limnoperna fortunei
na Bacia da Lagoa dos Patos
e Lagoa Mirim
Leonir Andr Colling
Raphael Mathias Pinotti
Carlos Emlio Bemvenuti


Com uma rea aproximada de 10.227
km2 (265 km de extenso por at 60 km de
largura), a Lagoa dos Patos se encontra orientada no sentido NE-SO na plancie costeira
do extremo sul do Brasil, sendo considerada a
maior laguna estrangulada do mundo (Kjerfve,
1986). A conexo deste corpo lagunar com o
oceano atlntico ocorre em sua poro mais ao
sul atravs de um nico e estreito canal (0,5 a 3
km de largura), onde guas de origem marinha
se misturam com aquelas mais doces originando uma regio estuarina com cerca de 971 km2
(Asmus, 1997). A Lagoa Mirim, por sua vez,
apresenta uma rea aproximada de 3.749 km2
(185 km de extenso por 20 km de largura, em
mdia) e uma extensa bacia hidrogrfica transfronteiria (62.250 km2 de rea total), onde
prevalece o regime de guas compartilhadas
entre o Brasil (76%) e o Uruguai (FAO, 1972).

Conectando a Lagoa dos Patos (na altura
da cidade de Pelotas) ao extremo nordeste da
Lagoa Mirim, encontra-se o Canal So Gonalo, um canal de gua doce com 61 Km de

extenso que influenciado pelo desgue dos


rios tributrios Piratini, Tigre e Arroio Pelotas.
Alm destes rios, o Canal tambm recebe os
fluxos dos corpos lagunares (Patos e Mirim),
que dependem do desnvel entre ambas somada
ao dos ventos (Kotzian & Marques, 2004).
O fluxo de enchente ou vazante neste canal
controlado por uma barragem eclusa que impede a entrada de gua salgada proveniente da
regio estuarina da Lagoa dos Patos ao interior
da Lagoa Mirim, em perodos de forte estiagem (Burns et al., 2006a).

As caractersticas hidrogrficas na Lagoa dos Patos, em especial em sua regio estuarina, so fortemente influenciadas pelos
ciclos hidrolgicos (pluvial e fluvial) na bacia
de drenagem do Sistema Patos Mirim, onde
aproximadamente 85 % do volume de gua
proveniente dos rios Guaba, Camaqu e Canal
So Gonalo, que desguam nas regies norte, central e sul desta laguna, respectivamente
(Garcia, 1997).

Estudos pioneiros sobre a presena do

187

Limnoperna fortunei na Bacia da


Lagoa dos Patos e Lagoa Mirim
Colling et al.

188

bivalve extico de gua doce Limnoperna fortunei (Dunker, 1857) no Sistema Patos Mirim
evidenciam o incio de sua invaso e distribuio a partir do Lago Guaba em 1998 (Mansur
et al., 1999). A partir destes primeiros registros
de ocorrncia na poro norte (regio lmnica)
da laguna, a expanso da distribuio desta espcie extica foi observada mais ao sul (regio
pr-lmnica), tendo sido registrada a presena
de L. fortunei em Arambar no ano 2000 e em
So Loureno do Sul em 2001 (Mansur et al.,
2003).

Com a progressiva colonizao do bivalve em direo ao sul da Lagoa dos Patos, exemplares da espcie foram registrados no Arroio
Pelotas e no Canal So Gonalo, podendo assim ter dado incio expanso de sua distribuio no segundo maior corpo lagunar costeiro do Rio Grande do Sul e Uruguai, a Lagoa
Mirim (Brugnoli et al., 2005; Captoli et al.,
2008).

O Arroio Pelotas foi considerado um
local-chave na disperso da espcie, uma vez
que nesta rea foram identificados importantes
aspectos ecolgicos que facilitariam sua persistncia local e aumento de sua distribuio atravs de potenciais eventos reprodutivos (Captoli & Bemvenuti, 2004). Dentre os principais
fatores observados esto a presena de diversos
tipos substrato para sua fixao (marinas, trapiches e embarcaes) e o predomnio de gua
doce na rea, impedindo a ocorrncia de eventos de mortalidade devido elevada salinidade,
assim como a registrada na poro estuarina da
Lagoa dos Patos em 2004, durante um perodo
de estiagem.

O Canal So Gonalo tambm se mostrou um importante vetor na distribuio do
bivalve L. fortunei para a Lagoa Mirim. A
construo da barragem eclusa, que entrou em
funcionamento em 1977, dividiu este Canal em
dois setores caractersticos, os quais apresentam condies lmnicas montante (em direo Lagoa Mirim) e predomnio de condies
estuarinas jusante (em direo Lagoa dos
Patos), ambos importantes no processo de expanso geogrfica desta espcie. Quando efetuado o primeiro registro da espcie no setor
estuarino do Canal So Gonalo (2002), a
presena do bivalve ainda no havia sido registrada no setor lmnico do Canal, na Mirim e

nem nos seus tributrios (Captoli et al., 2008).


Entretanto, um prolongado perodo de predomnio de guas doces entre a eclusa e a Lagoa
dos Patos (durante os anos de 2002-2003), aliado permanente ocorrncia de condies lmnicas no So Gonalo ( montante da eclusa),
provavelmente possibilitaram a ocorrncia e
consequente expanso do bivalve para o interior da Lagoa Mirim, via Canal So Gonalo,
como registrado no ano de 2005 (Burns et al.,
2006b).

Pescadores do municpio de Arroio
Grande, moradores do distrito de Santa Isabel
(poro sul do Canal So Gonalo) relatam o
deslocamento de embarcaes artesanais at a
Lagoa dos Patos, apontando esta laguna como
a possvel origem do bivalve neste setor da Lagoa Mirim (Pieve et al., 2009), assim como discutido em estudos anteriores (Captoli & Bemvenuti, 2004; Brugnoli et al., 2005). Ainda, a
conexo de corpos de gua entre a Lagoa Mirim e a Reserva Ecolgica do Taim (localizada
na poro sudeste desta lagoa), provavelmente,
favoreceu a expanso na distribuio de L. fortunei nas reas de banhado e lagos interiores,
como na Lagoa Nicola (Burns et al., 2006a).

No Uruguai, a presena deste bivalve invasor havia sido reportada para quatro das seis
maiores Bacias Hidrogrficas do pas, as bacias
dos rios Prata, Santa Luca, Negro e Uruguai,
sem que se houvesse detectado sua presena
nas bacias do Atlntico e Laguna Mern (Brugnoli et al., 2005). No entanto, os primeiros registros de L. fortunei nesta ltima bacia (setor
uruguaio da Lagoa Mirim) foram includos no
trabalho de reviso de Langone (2005), reportando sua presena nas localidades de Balneario Mern e na usina de captao de gua de
Ro Branco, s margens do Rio Jaguaro. Posteriormente, sua presena tambm seria registrada na desembocadura do Rio Tacuar, um
dos rios uruguaios afluentes da Lagoa Mirim
(Brugnoli et al., 2009).

So recorrentes os relatos de prejuzos a
atividades humanas proporcionados por bivalves invasores. Dentre os principais registros so
citados o bloqueio de sistemas de captao de
gua, entupimento de filtros e incrustao de
superfcies submersas (Mackie, 1991; Smit et
al., 1992; Schloesser, 1995; Darrigran, 2002;
Mansur et al., 2003). No esturio da Lagoa dos

CAPTULO 14
Seo 4

Patos, uma regio com atividades econmicas


voltadas ao ambiente costeiro e numerosa frota
pesqueira artesanal, os problemas causados por
sua incrustao so relatados em comunidades
de pescadores, onde os organismos so encontrados fixos em cales de pesca, trapiches e embarcaes, alm dos registros de macrofouling
em tubulaes de resfriamento de indstrias e
refinarias nesta laguna (Captoli & Bemvenuti,
2004; Captoli et al., 2008).

Eventos em escala global como o ENSO
El Nio, que ocorrem em intervalos interanuais pouco previsveis e ocasionam um aumento
de precipitao no sul do Brasil (Ropelewski &
Halpert, 1987; Grimm et al., 2000), so associados a perodos prolongados de predomnio
de gua doce no esturio da Lagoa dos Patos.
Por outro lado, sob influncia de fenmenos
ENSO La Nia, a regio sul do Brasil e o
Uruguai sofrem anomalias negativas de precipitao seca (Grimm et al., 2000), ocasionando menores descargas de gua doce nesta
laguna. Por ser uma espcie de gua doce, L.
fortunei no tolera ambientes de guas salobras

ou marinhas, sendo assim estabelecidos limites


fisiolgicos que inibem sua presena e disperso
na regio estuarina da Lagoa dos Patos.

Neste sentido, a baixa tolerncia da espcie salinizao oferece um fator controlador natural sua distribuio no ambiente
estuarino, em diferentes cenrios hidrolgicos
(Captoli et al., 2008). O evento com influncia
mais evidente sobre a biota estuarina foi o El
Nio 2002-2003, sendo observado um prolongado cenrio de gua doce e expanso de L.
fortunei na regio (Fig. 1). Aps a diminuio
da vazo fluvial na bacia de drenagem, houve
um predomnio de guas salobras e salinidades elevadas entre os anos 2004-2006, ocasionando a mortalidade daquelas populaes do
bivalve amplamente distribudas e impedindo
novas colonizaes nos anos seguintes (Fig. 1).

Outro evento El Nio ocorrido no vero
2009-2010 provocou o predomnio de condies lmnicas na regio estuarina da laguna,
sendo novamente registrada uma colonizao
do bivalve (Fig. 1), observada atravs de experimentos de incrustao nos quais se utilizou pla-

189

Figura 1. Valores dirios (linha cinza) e mdia mvel trimestral (linha preta) da salinidade na regio estuarina da Lagoa dos
Patos, no perodo entre janeiro/2001 e setembro/2011 (Banco de Dados PELD Programas Ecolgicos de Longa Durao, Site
8). SOI = Southern Index Oscillation (Bom, 2011).

Limnoperna fortunei na Bacia da


Lagoa dos Patos e Lagoa Mirim
Colling et al.

cas de madeira como substrato para sua fixao


(Santos, C.L. 2011). A partir da elevao dos
valores de salinidade, novas colonizaes de L.
fortunei no foram encontradas, evidenciando
a variao deste parmetro ambiental como o
principal fator regulador da sobrevivncia e
distribuio das populaes desta espcie no
extremo sul da Lagoa dos Patos.


Uma sntese da distribuio de L. fortunei na Bacia Patos-Mirim pode ser visualizada
na Figura 2. A ampla distribuio de populaes deste bivalve encontra-se atualmente estabelecida em regies lmnicas, tanto lnticas
como lticas, no encontrando barreiras fisiolgicas para sua sobrevivncia e reproduo.
Situao particular ocorre na regio estuarina

190
Figura 2. reas de ocorrncia do bivalve invasor Limnoperna fortunei, at o presente: Lagoa dos Patos (LP) e sua regio estuarina (ELP); Canal So Gonalo e seus tributrios; e Lagoa Mirim (LM), tanto no estado do Rio Grande do Sul, quanto em territrio
uruguaio (UY).

CAPTULO 14
Seo 4

da Lagoa dos Patos, onde a ocupao temporria de L. fortunei dependente dos regimes de
adoamento ou salinizao, associados a diferentes eventos ENSO.

Neste ambiente estuarino, populaes
permanentes podem ser observadas por toda
a regio sul da laguna quando em regime de
condies lmnicas (BS: baixa salinidade El
Nio; Figura 2), ficando restritas a ambientes

de gua doce quando a regio estuarina se encontra sob alta salinidade (AS: alta salinidade
La Nia; Fig. 2). A correlao entre eventos
de colonizao deste bivalve relacionados a perodos de gua doce fornece subsdios para o estabelecimento de relaes positivas entre estes
dois processos, com provvel aumento da distribuio de L. fortunei pelo esturio da Lagoa dos
Patos durante os prximos eventos El Nio.

191

CAPTULO 15
Limnoperna fortunei na bacia
hidrogrfica do baixo
Rio Jacu e Lago Guaba,
Rio Grande do Sul
Paulo Eduardo Aydos Bergonci
Cintia Pinheiro dos Santos
Marinei Vilar Nehrke
Daniel Pereira
Maria Cristina Dreher Mansur


No Rio Grande do Sul so delimitadas
trs grandes regies hidrogrficas, reconhecidas pelas direes principais de escoamento
dos rios. Uma delas a Regio Hidrogrfica da
Bacia do Lago Guaba, tendo como principal
canal de escoamento o Rio Jacu. Esta regio
apresenta uma rea de 84.763,5 km2 , sendo a
mais densamente povoada do estado e de maior
concentrao de atividades comerciais e industriais. Nesta regio hidrogrfica so reconhecidas oito bacias, identificadas por um grande rio
ou lago formador, como o caso do Rio Jacu,
que forma duas bacias, uma denominada de bacia do alto Jacu (poro inicial) e outra de bacia do Pardo-Baixo Jacu (poro final). Dentre os rios da Bacia do Cai, Sinos e Gravata,
que juntamente com o Jacu desembocam no
Lago Guaba e assim formam o Delta do Jacu
(rea de 47,18 km2), o Rio Jacu responde por
84,6% do volume total de agua que desemboca
no Lago Guaba (Menegat & Kirchhein, 1998).
Na bacia do Guaba at o incio da dcada de
1990, conhecia-se apenas a invaso de bivalves

asiticos do gnero Corbicula, que foram introduzidos em meados da dcada de 1970 (Veitenheimer-Mendes, 1981). No incio de 1999 foi
constatada a presena do mexilho-dourado
nas margens do Lago Guaba (Mansur et al.,
1999). Como os corbiculdeos, esta tambm
uma espcie de bivalve invasora e oriunda do
sudeste asitico. De acordo com Mansur et al.
(2003), a introduo do mexilho-dourado na
bacia do Lago Guaba aconteceu de maneira
no intencional, atravs da gua de lastro de
navios, provavelmente, oriundos da Argentina, onde a espcie foi registrada pela primeira
vez, mais especificamente, no Rio da Prata, em
1991, prximo da cidade de La Plata (Pastorino et al., 1993).

L. fortunei distingue-se dos demais bivalves nativos do sul do Brasil (Unionoida e Veneroida) que vivem enterrados nos substratos
arenosos, a exceo das espcies bissadas de
Eupera Bourguinat, 1854 que no formam macroaglomeraes, por apresentar a produo
de fios de bisso, o qual possibilita sua fixao

193

Limnoperna fortunei na bacia hidrogrfica do baixo


Rio Jacu e Lago Guaba, Rio Grande do Sul
Bergonci et al.

e consequente formao de macroaglomerados


compactados sobre substratos duros (Mansur
& Pereira, 2006). Esta caracterstica dificulta
o monitoramento da espcie em ambiente natural, em funo da variabilidade de substratos
ao qual ela adere e da inaplicabilidade de mtodo tradicionais de amostragem (dragas, cores,
quadrats e pus, entre outros). Desta forma,
se faz necessria a utilizao de mtodos como
os substratos artificiais, uma vez que estes padronizam a amostragem, reduzem a variabilidade e o tempo de processamento das amostras
(Gibbons et al., 1993).

Sob esta perspectiva, diversos tipos de
substratos artificiais so utilizados para monitorar populaes de L. fortunei, como estruturas tridimensionais de abestos (Morton, 1977),
adaptaes em PVC (Boltovskoy & Cataldo,
1999), em madeira no formato de X (Fontes
et al., 2002; Mansur et al., 2009), garrafas PET
(Faria et al., 2006; Pereira et al., 2010) e substratos cermicos (Mansur et al., 2003; Santos,
2004; Terra et al., 2007; Santos et al., 2008;
Bergonci et al., 2009).

Os mtodos empregados pela equipe
coordenada pela Dra. Maria Cristina Dreher
Mansur constam em Mansur et al. (2003), San-

tos (2004), Santos et al. (2008), Bergonci et al.


(2009), Mansur et al. (2009) e Pereira et al.
(2010). Sero apresentados alguns dos resultados obtidos no monitoramento com substrato
artificial de madeira (Mansur et al., 2009). A
rea do monitoramento (Fig. 1) situa-se no delta do Rio Jacu, na unidade fisiogrfica da Depresso Central do Estado do Rio Grande do
Sul, na regio metropolitana de Porto Alegre.
O Rio Jacu desgua no Lago Guaba por meio
de um delta formado por uma srie de distributrios, dentre os quais se destaca o Canal do
Jacu (profundidade mdia de 8 m). No Cais do
Porto, junto rea urbana de Porto Alegre, a
paisagem marginal foi significativamente alterada por meio de um aterro. Atualmente, neste
local se verificam margens ngremes (paredes
concretadas) e guas profundas (5 m). As estaes de coleta situam-se no delta do Rio Jacu:
na margem direita do Canal do Jacu (CJ) e na
Ilha da Pintada e Cais do Porto (PO), no centro
da cidade.

Foram submersos doze conjuntos, com
trs rplicas, de um substrato artificial de madeira em forma de xis (Fig. 2) nas estaes de
coleta acima descritas. O perodo de submerso
foi de outubro de 2006 a setembro de 2007.

194

Figura 1. Estaes de coleta onde foram realizados os monitoramentos. CJ = canal do Rio Jacu; PO = Cais do Porto. Mapa: R.A.
Ramos (MCN/FZB-RS) em Pereira et al. (2010).

CAPTULO 15
Seo 4

Figura 2. a) Esquema com as trs rplicas do amostrador de


madeira em forma de xis; b) rplica com mexilhes aderidos.
Mtodo descrito em Mansur et al. (2009). (Foto: M.C.D. Mansur).


A cada ms foram retirados trs substratos, obtendo-se assim os indivduos para avaliao. A partir do quinto ms de exposio,
com o aparecimento dos indivduos adultos (tamanho superior a 5 mm), foram recolhidos ao
acaso 50 espcimes de cada rplica, totalizando
150 indivduos mensais para cada estao de
coleta, separados por amostras de cinco (5M),
seis (6M), at 12 meses (12M). Cada mexilho
foi mensurado em comprimento (C), altura
(H) e largura (L) da concha com auxlio de paqumetro digital de 0,01 mm de preciso. Em

seguida, sob balana de 0,0001 g de preciso,


foram mensurados o peso total (Pt) (concha
+ partes moles), peso mido das partes moles
(Pu), peso seco das partes moles (Ps) e o peso
da concha (Pc). O peso seco foi obtido por desidratao das partes moles em forno de Pasteur
(100oC/24h). A comparao entre as estaes
de coleta, para cada varivel mensurada, foi realizada pelo teste de Mann-Whitney com nvel
de significncia de 95%.

Os resultados encontrados demonstraram que em ambientes distintos de um mesmo
sistema hdrico (Delta do Rio Jacu), os mexilhes incrustados sobre o substrato artificial
de madeira apresentaram diferentes respostas quanto s variveis mensuradas na concha
(comprimento, altura e largura) e em peso (total, mido da parte mole, seco da parte mole e
concha) (Tab. I; Figs. 3A e 3B).

Os mexilhes retirados do canal principal do delta (elevada correnteza da gua)
apresentaram menor tamanho e peso em relao queles coletados em outro canal (baixa
correnteza). A significncia da diferena entre
esses resultados foi corroborada pelo teste estatstico de Mann-Whitney (p<0,001), que di-

Tabela I. Medidas de comprimento, altura e largura da concha, pesos total, mido, seco e da concha de L. fortunei aps monitoramento acumulativo por um ano em duas estaes de coleta (CJ = Canal do Rio Jacu; PO = Cais do Porto).

Mdia

Erro Padro

CJ

PO

CJ

PO

Dife

Comprimento (mm)

14,159

18,492

0,512

1,368

4,333

Altura (mm)

6,484

8,507

0,216

0,617

2,023

Largura (mm)

5,329

6,917

0,156

0,519

1,587

Peso Total (g)

0,180

0,412

0,018

0,077

0,232

Peso mido (g)

0,052

0,146

0,007

0,033

0,093

Peso seco (g)

0,006

0,017

0,000

0,004

0,011

Peso da concha (g)

0,072

0,162

0,006

0,029

0,090

Figura 3. 3A, Valores mdios e erro padro das variveis mensuradas na concha; 3B, Valores mdios e erro padro das variveis
mensuradas em peso (Pt = peso total; Pu = peso mido da parte mole; Ps = peso seco da parte mole; Pc = peso da concha.

195

Limnoperna fortunei na bacia hidrogrfica do baixo


Rio Jacu e Lago Guaba, Rio Grande do Sul
Bergonci et al.

ferenciou as duas estaes de coleta quanto ao


valor mdio anual das variveis mensuradas.
Para exemplificar, se considerarmos a varivel
comprimento, veremos que em mdia os mexilhes do Cais do Porto foram cerca de 4 mm
maior que os do canal do Jacu. Alm disso, a
distribuio de frequncia por classe de comprimento mostra que os mexilhes do Canal
do Jacu esto em maior quantidade nas classes
de 5 a 20 mm, ao passo que os mexilhes do
Cais do Porto esto em quantidades menores,
porm com distribuio em classe acima de 20
mm (5 a 29 mm) (Fig. 4).

Diferenas significativas entre o peso total e o comprimento de L. fortunei procedentes de quatro localidades na Bacia Hidrogrfica
do Lago Guaba foram verificadas por Mansur
et al. (2008b). No mesmo trabalho os autores
constataram que os indivduos dos aglomerados
de ambiente de baixa correnteza eram facilmente descolados do substrato, ao passo que os espcimes de ambiente de alta correnteza estavam
mais fortemente aderidos ao substrato. Tambm
neste monitoramento evidenciou-se que os mexilhes dos aglomerados formados no Cais do
Porto eram mais facilmente removidos e apresentavam um espaamento maior entre eles, ao
passo que os do Canal do Rio Jacu, eram mais

fortemente unidos com espao mnimo, configurando uma estrutura forte e coesa.

possvel, assim, que os espcimes encontrados em ambiente dinmicos (correnteza forte) tendem a investir maior energia no
processo de fixao do bisso e menos energia
no crescimento propriamente dito. Okamura
(1986) e Karatayev et al. (2006) observaram
que a correnteza elevada foi um fator inibidor
do crescimento do mexilho-zebra.

Outra diferena entre as estaes de coleta, que pode ter influenciado nas diferenas
biomtricas encontradas, o fato da maior
disponibilidade de alimento no Cais do Porto,
pois o local apresenta maior nvel de poluio
orgnica, com destaque ao nvel elevado de
nitrognio (Bendati et al., 2003). O enriquecimento orgnico de um ecossistema aqutico
aumenta a produo planctnica. Segundo Silva (2006), L. fortunei pode aumentar sua massa corprea em at 240%, com alimento (algas
planctnicas) em abundncia. O mesmo foi verificado por Mansur et al. (2008b), que perceberam que em ambientes de maior eutrofizao
e guas calmas (canal das Garas, Canoas, RS)
os mexilhes atingiram maior tamanho e peso
do que aqueles em ambientes de gua corrente
(canal do Rio Jacu, Ilha da Pintada, RS).

196
Figura 4. Classe de comprimento de L. fortunei ao longo de um perodo de um ano de monitoramento com substrato artificial
de madeira em duas estaes de coleta: CJ Canal do Jacu; PO Cais do Porto.

CAPTULO 16
Limnoperna fortunei
na bacia do Rio Paraguai,
Mato Grosso do Sul
Marcia Divina de Oliveira
Dbora Fernandes Calheiros

Introduo



Informao sobre limite de tolerncia
da espcie a variveis ambientais so essenciais
para prever novas invases e dimensionar os
impactos que a espcie pode causar. Relatos
de sobrevivncia, crescimento e reproduo
em condies estressantes revelam os limites
de tolerncia da espcie. Os estudos de Oliveira e colaboradores na plancie do Pantanal
ampliaram alguns dos limites de tolerncia do
molusco invasor Limnoperna fortunei (Dunker,
1857). A interao rio-plancie, numa das
maiores reas alagadas do mundo, provoca alteraes nas caractersticas da gua e apresenta
valores extremos de variveis limnolgicas que
causam a mortalidade da espcie anualmente,
representando um controle populacional natural. difcil apontar a varivel mais importante como controle, porque potenciais estressores
so variveis no tempo e no espao e tendem
a coincidir ou sobrepor-se no tempo. Quanto
mais reas forem colonizadas por L. fortunei

mais informao teremos sobre seus limites


ambientais, embora sua ampla tolerncia a fatores ambientais torne difcil identificar quais
variveis so realmente importantes no seu estabelecimento num novo ambiente.

rea de ocorrncia e densidades do


mexilho-dourado na
Bacia do Alto Paraguai



Na bacia do Alto Rio Paraguai, o primeiro registro de L. fortunei foi em 1998, no Rio
Paraguai (184918S e 573913W), prximo
a Corumb (MS). A rea de ocorrncia de L.
fortunei mostrada na Figura 1. Foram encontradas conchas entre 10 e 20 mm, indicando
que a espcie j estava no ambiente h aproximadamente um ano. A rea de ocorrncia atual
de L. fortunei no Pantanal est restrita ao canal
principal do Rio Paraguai, lagoas marginais conectadas e nas partes inferiores dos tributrios,
como os rios Cuiab, Miranda e Apa. O limite
superior no Rio Paraguai no est bem estabe-

197

Limnoperna fortunei na bacia do Rio Paraguai,


Mato Grosso do Sul
Oliveira & Calheiros

lecido. Callil, C.T. (comunicao pessoal) encontrou exemplares do mexilho-dourado no


porto de Cceres (norte do Mato Grosso), mas
a espcie no se estabeleceu.

Com relao aos tributrios do Rio Paraguai, L. fortunei ocorre no Rio Miranda desde
2003, e avanou aproximadamente 100 km rio

acima depois do primeiro registro (Albuquerque, S., comunicao pessoal). No Rio Apa a
espcie ocorre desde 2000 sem registro exato
da rea de ocorrncia, e na foz do Rio Cuiab,
2008, tambm sem registro exato da rea colonizada (Oliveira et al., 2011).

A introduo de L. fortunei na bacia do

198
Figura 1. Localizao da bacia do Alto Paraguai na Amrica do Sul, drenagem da Bacia do Alto Paraguai e rea de ocorrncia de
L. fortunei. Fonte: modificado de Oliveira et al. (2010a).

CAPTULO 16
Seo 4

Alto Rio Paraguai foi facilitada pelo trfego de


barcaas na hidrovia Paraguai-Paran, as quais
podem transportar os organismos no casco. A
disperso entre Rio Paraguai e afluentes tem
sido mais lenta devido ao menor trfego de embarcaes (Oliveira, M. et al., 2010a, 2011).

Depois de 2 a 3 anos da presena de L.
fortunei no Rio Paraguai, a densidade mdia de
L. fortunei, medida em reas com densa colonizao, foi de 1.772 ind./m3 para larvas, 88.853
juvenis/m2 e aproximadamente 35.000 adultos/
m2 . No Rio Miranda, as densidades hoje so
semelhantes s do Rio Paraguai, com maior
densidade nos afloramentos rochosos. O monitoramento da densidade da populao no Rio
Paraguai e tributrios no tem sido feito desde
2007.

Atividade reprodutiva e fatores


limitantes ao estabelecimento
do mexilho-dourado


A presena de larvas e juvenis indica reproduo quase contnua por cerca de 7-8 meses no Rio Paraguai, semelhante a outros lugares na Amrica do Sul (Cataldo & Boltovskoy,
2000; Santos et al., 2005).

Tanto a temperatura da gua quanto o
pulso de inundao influenciam significativamente a atividade reprodutiva e a densidade de
L. fortunei no Pantanal, embora de maneiras
diferentes. Enquanto a temperatura parece atuar diretamente no ciclo reprodutivo, a sazonalidade do pulso de inundao altera as variveis qumicas, como nos eventos de depleo de
oxignio, e causa mortalidade dos mexilhes
adultos (Oliveira et al., 2011), afetando diretamente a densidade e reproduo.

No Rio Paraguai L. fortunei est exposta a temperaturas relativamente elevadas (at
34C) em comparao ao seu ambiente nativo
na China (mdia mensal mxima at 27,8C)
(Ho et al., 2003) e outros ambientes na Amrica do Sul, onde a temperatura mxima mensal
da gua geralmente abaixo de 30C (Boltovskoy & Cataldo, 1999). Cataldo & Boltovskoy
(2000) sugerem que em temperaturas abaixo de
16,7C L. fortunei para de reproduzir. No entanto, observamos que uma queda na temperatura da gua no incio do inverno de 5 a 8C,
mais que valores absolutos, podem estimular a

parada reprodutiva de L. fortunei no Pantanal,


uma vez que as temperaturas mnimas no Rio
Paraguai ficam acima de 17C (Oliveira et al.,
2011).

De acordo com Mackie & Claudi (2010),
as variveis que mais afetam o potencial de sobrevivncia dos moluscos so os nveis de clcio, alcalinidade, pH e dureza total, as chamadas variveis essenciais.

Baseado nos ambientes onde ocorre L.
fortunei, Ricciardi (1998) sugeriu que o pH
ideal para infestaes de L. fortunei acima de
6,4. O pH do Rio Paraguai em torno de 6,5,
mas pH em torno de 6,0 bastante comum e
pode chegar a 5,0 ou menos, durante a fase de
inundao. Embora mortalidades tenham sido
observadas anualmente durante a inundao,
consideramos que em pH 6.0 possvel ter populao estabelecida, ainda que em densidades
menores quelas obtidas em lugares com pH
mais alto (Oliveira et al., 2011).

Oliveira et al. (2011) consideram que
guas com clcio acima de 1,0 mg/L tm potencial para receber o mexilho-dourado, embora
a espcie possa ocorrer em baixas densidades.
Durante as inundaes o ambiente pode ficar
limitante para o mexilho-dourado, que no
sobrevive quando concentraes de oxignio
dissolvido de 0.0 mg/l, pH em torno de 5.0,
ndice de saturao da Calcita (IScalcita) de 4,0,
CO2 livre por volta de 100mg/L, e temperatura maior que 30C ocorrem simultaneamente
(Oliveira, M. et. al., 2010b). Essas condies
foram observadas em eventos de depleo de
oxignio dissolvido denominado localmente
como decoada na Baa do Castelo (lago conectado ao Rio Paraguai), onde a espcie foi
eliminada no ano de 2007. Apesar de eliminada, provvel que a espcie volte a colonizar o
ambiente devido ao contato das guas da baa
com as do Rio Paraguai nos anos subsequentes,
porque outros lagos rio acima funcionam como
reservatrios de larvas, e no apresentam com
frequncia o fenmeno de decoada. Eventos
anuais de decoada no Rio Miranda (Passo do
Lontra), provavelmente foram responsveis por
baixas densidades de larvas e juvenis observadas neste rio (Oliveira et al., 2011). A predao
por peixes e a flutuao do nvel dgua tambm so fatores controladores da densidade da
espcie (Oliveira et al., 2006).

199

Limnoperna fortunei na bacia do Rio Paraguai,


Mato Grosso do Sul
Oliveira & Calheiros


L. fortunei tem sido considerada uma praga no Brasil por causar danos nas estaes de
captao de gua, sistemas de refrigerao de
hidreltricas, e sistemas de cultivo em tanques-rede, bem como impactos ambientais, devido a
sua alta densidade populacional. Incrustaes de
L. fortunei so observadas nas embarcaes que
navegam no Rio Paraguai, mas no representam
grandes desafios quanto ao controle, e nem
perdas econmicas, quando comparados ao
sistema de captao de gua e hidreltricas
localizadas no Rio Paran. Os impactos no
ambiente podero ser mais expressivos em longo
prazo com trocas na estrutura da cadeia trfica,
como relatado em ambientes da Argentina
(Darrigran & Damborenea, 2011).

Apesar da mortalidade anual e oscilao na densidade populacional, o que temos
observado que L. fortunei tem resistido, recolonizando os ambientes aps um perodo de

200

depleo de oxignio. Nos anos mais secos o


fenmeno de decoada de baixa intensidade e
favorece o crescimento da espcie por no haver mortalidades na populao.

Eventos de depleo de oxignio somente ocorrem na rea de inundao do Rio Paraguai, incluindo o trecho final dos tributrios
como Cuiab e Miranda. Quando L. fortunei
atravessa essa barreira no encontra fatores
limitantes ao seu desenvolvimento, se houver
meios de introduo, certamente a espcie ir
se estabelecer na parte alta dos rios da bacia.
Um indicativo desta invaso a expanso das
espcies tambm de moluscos invasores Corbicula fluminea (Mller, 1774), Corbicula largillierti (Philippi, 1844) e Melanoides tuberculatus na bacia do Rio Miranda (Oliveira, M. et
al., 2010c), cuja ocorrncia ampla, incluindo
a cabeceira do Rio Miranda e a maioria dos
tributrios.

CAPTULO 17
Limnoperna fortunei associada
a macrfitas aquticas
na bacia do Rio Paraguai,
Mato Grosso
Sandra F. Maral
Claudia T. Callil

Introduo

O bioma Pantanal caracterizado pela
inundao sazonal, que determina processos
ecossistmicos especficos, com a ocorrncia de
plantas e animais adaptados mudana anual
de encolhimento e expanso de habitats, em
virtude do regime hidrolgico sazonal (Junk et
al., 1989; Alho, 2011). Dessa forma, ocorrem
reas sujeitas a intenso alagamento, peridico
ou permanente, reas com baixo ndice de alagamento, e reas nunca alagadas (Scremin-Dias
et al., 2011).

Nas ltimas dcadas, a perda de habitats
e de biodiversidade tm se intensificado nesse
sistema, decorrentes do desmatamento, principalmente no Cerrado de Planalto, onde nascem os rios que alimentam o Pantanal (Silva et
al., 2010). Associado converso de habitats
naturais em pastagens, est a degradao dos
recursos hdricos pela contaminao por agrotxicos e herbicidas, resduos slidos urbanos e
tambm pela introduo de espcies exticas.


As espcies invasoras foram consideradas como a terceira maior ameaa para a biodiversidade pela Unio Internacional para a
Conservao da Natureza (IUCN) e Governo
brasileiro (Alho et al., 2011). J o Ministrio do
Meio Ambiente MMA, considera espcies introduzidas a segunda maior causa de extino
de espcies (Coradin, 2006).

A introduo de espcies exticas nos
ecossistemas aquticos e terrestres do Pantanal
e seu impacto sobre as populaes, comunidades e funcionamento do ecossistema devem ser
tema prioritrio para pesquisas na regio.

Dentre as espcies exticas aquticas, o
molusco bivalve trazido da China Limnoperna
fortunei (Dunker, 1957) o mais conhecido
atualmente. O mexilho-dourado foi registrado no Rio Paraguai a partir de 1999 (Oliveira et
al., 2000). A combinao da maturidade sexual
precoce, alta fecundidade, ampla tolerncia a
condies diversas permitem que L. fortunei
seja um invasor de sucesso em novos ambientes
(Darrigran, 2002). A colonizao pode ocorrer

201

Limnoperna fortunei associada a macrfitas aquticas


na bacia do Rio Paraguai, Mato Grosso
Maral & Callil

Figura 1. rea de ocorrncia de Limnoperna fortunei, referente aos estudos


desenvolvidos com macrfitas em lagos rasos adjacentes ao Rio Paraguai
(Imagem de satlite: Google Earth;
mapa: Maral & Callil, 2008. Acta liminologica Brasiliensia 20(4):359-371).

202

em estruturas no naturais ou naturais, como


troncos de rvores, razes, rochas e plantas
aquticas (Boltovskoy et al., 2006). No Pantanal, a ausncia de substratos duros fez com que
se fixasse em macrfitas aquticas (Callil et al.,
2006). Isso aumentou as preocupaes com o
crescimento populacional deste bivalve nos rios
e lagoas do Pantanal Matogrossense, pois se
acredita que em alta densidade, o agregamento dos indivduos possa alterar a composio e
abundncia da fauna de invertebrados nativos
(Darrigran & Pastorino, 2000). Assim, alguns
trabalhos foram desenvolvidos a fim de entender a dinmica populacional e possveis efeitos
na estrutura da comunidade de invertebrados
associados s razes da macrfita flutuante Eichhornia crassipes Mart. (Solms) (Callil et al.,
2006, Maral & Callil, 2008).

Locais e mtodo de amostragem


A rea de estudo abrangeu um trecho do
alto Rio Paraguai, entre o Parque Nacional do
Pantanal e a Reserva Particular do Patrimnio
Natural Acurizal, MT. Nesse trecho, 15 lagoas
marginais foram visitadas na estao seca, em
setembro de 2005.

Foram feitas amostragens de invertebrados associados a razes da macrfita flutuante
E. crassipes. Para isso, trplicas da vegetao
flutuante de estandes marginais monoespecficos foram coletadas com auxlio de uma tesoura de poda, utilizando-se um quadrado 25 x 25
cm. A coleta das rplicas foi realizada em trs
pontos distantes entre si em cada Lagoa e teve
como objetivo aumentar a variabilidade das
amostras nas unidades amostrais (lagoas).

CAPTULO 17
Seo 4


A biomassa da planta foi obtida tambm
a partir de amostras em trplica a partir da aerao forada em estufa a 60C (cerca de 72
horas) e pesagem em balana analtica.

Para estudo dos invertebrados, a massa
de razes das plantas foram lavadas em peneiras
de 2 mm, 1 mm e 0,25 mm, pr-triada e a parte
resultante retida na ltima peneira foi fixada
em lcool 70%. Os invertebrados foram triados
e identificados sob microscpio estereoscpico.

A densidade de L. fortunei nas plantas
foi obtida para cada lagoa. Para estudo da estrutura populacional de L. fortunei, os exemplares coletados foram medidos em seu maior
comprimento com auxlio de paqumetro digital.

A estrutura etria da populao foi avaliada utilizando um grfico de distribuio de
frequncias por classes de comprimento.

Anlise de dados



A abundncia da comunidade de macroinvertebrados obtidos para cada amostra foram somados e expressos em nmero de indivduos por 100 g de peso seco de raiz (ind.100 1
PS) e indivduos por metro quadrado (ind.m-2).
Avaliamos a relao da abundncia da comunidade de macroinvertebrados com a densidade
de L. fortunei utilizando correlao e anlise
multivariada (Maral & Callil, 2008).

Os dados de densidade, comprimento
mdio da concha e classe modal da populao
de mexilho-dourado foram apenas usados
para interpretaes da interferncia na estrutura da comunidade de macroinvertebrados associados a E. crassipes.

Caractersticas populacionais de
L. fortunei em lagoas do
Rio Paraguai



A densidade de L. fortunei obtida no estudo similar a j registrada para a regio do
Pantanal. Houve uma grande variao nesses
valores de densidade (21-3616 ind.m-2), e, em
grande parte, estes foram inferiores aos valores
observados em afloramentos rochosos no incio da colonizao dessa espcie no Rio Paraguai (1000 ind.m-2 em 1999) (Oliveira, 2003).

Nas 15 lagoas visitadas (Fig. 1), a densi-

dade mdia foi de 1327 ind.m-2 . As lagoas que


apresentaram as maiores abundncias e densidades foram: Turco com 576 indivduos (3616
ind.m-2); Canafisto com 501 (3008 ind.m-2);
Trs Bocas com 477 (2917 ind.m-2). Essa densidade de mexilho em E. crassipes superior
a registrada entre 2001 e 2002 por Oliveira et
al. (2006) em substratos artificiais de concreto
(88,9 ind.m-2) e madeira (523,8 ind.m-2) e em
2004 por Callil et al. (2006) em Eichhornia
azurea (107.75 ind.m-1), ambos no Rio Paraguai
(Tab. I).

A maior densidade observada em substratos rochosos em relao apresentada para
macrfitas demonstra que os primeiros oferecem maior estabilidade e maior possibilidade
de agregamento aos mexilhes. Assim como
observado para o mexilho-zebra Dreissena
polymorpha (Pallas, 1771) nos Grandes Lagos
dos Estados Unidos (Diggins et al., 2004), as
macrfitas parecem prover um substrato alternativo para o mexilho-dourado no Pantanal,
podendo atuar na disperso desse bivalve Rio
Paraguai abaixo por deriva.

Quanto ao comprimento mdio das valvas nas lagoas, observamos variao entre 1,8
9,26 mm (Lagoa Caracarazinho e Lagoa da
Cludia, respectivamente). A distribuio de
frequncia de L. fortunei por classes de comprimento demostrou classe modal no intervalo de
1,31-2,61 mm e 2,62-3,92 mm, com exceo da
Lagoa da Cludia, que apresentou comprimento modal entre 14,40-15,70 mm (Tab. I). Estes
valores so compatveis com aqueles descritos
por Marcelo et al. (2004) e Callil et al. (2006)
ambos no Rio Paraguai, os quais relatam que
as amplitudes de comprimento variam entre 1
a 28 mm e de 5 a 13 mm, respectivamente.

O aumento da populao de L. fortunei
no Rio Paraguai e em suas lagoas adjacentes
tm se mostrado diferente dos ambientes colonizados no Rio da Prata, onde o incremento
na populao desse bivalve se deu de maneira
acelerada, com rpida disperso e registro de
altas densidades em pouco tempo de colonizao, cerca de 150.000 ind.m-2 em trs anos de
invaso (Darrigran & Pastorino, 2000). Esse
crescimento explosivo foi tambm registrado
no Lago Guaba, RS, aonde L. fortunei chegou
a 143.500 ind.m-2 (Mansur et al., 2004c).

A baixa densidade de L. fortunei obser-

203

Limnoperna fortunei associada a macrfitas aquticas


na bacia do Rio Paraguai, Mato Grosso
Maral & Callil

vada no Rio Paraguai em relao aos registros


da regio Sul do Brasil, pode estar relacionada
s peculiaridades hidrolgicas dessa plancie de
inundao, a qual caracterizada pela flutuao sazonal do nvel da gua (Junk et al., 1989),
o que torna os substratos colonizados mais instveis. A grande escassez de substratos duros
e, quando existentes (pedras, afloramentos de
rochas e troncos de rvores), ficam expostos
dessecao no perodo de guas baixas. J no
perodo de guas altas, os estandes de E. crassipes e outras macrfitas podem ser arrastados.
Nesse perodo, ocorre tambm a decomposio
da matria orgnica carreada pela enchente,
que ao decompor-se diminui a concentrao
de oxignio na gua, controlando a reproduo (Uliana & Callil, 2006) e o crescimento
das populaes de L. fortunei (Oliveira et al.,
2006).

204

Fauna de macroinvertebrados
associados macrfita flutuante
E. crassipes



Nas 15 lagoas amostradas (Fig. 1) foram
coletados um total de 86.943 indivduos e 64
taxa de invertebrados, distribudos nos filos
Nematoda, Annelida, Mollusca e Arthropoda
(Tab. I, Fig. 2).

Desse total, Hydrobiidae foi o txon
mais abundante com 17966 indivduos (21%),
seguido de Ostracoda com 17872 (20,6%),
Hydracarina 11353 (13,05%) e Eupera sp.
(Sphaeridae) com 8322 (9,57%). Apresentaram
tambm abundncia expressiva os txons Chironomidae (7%), Trichoptera (5,4%), alm de
L. fortunei e Planorbidae que juntos somaram
8,83% do total de indivduos (Tab. I, Fig. 2).

A estrutura da comunidade de macroinvertebrados foi testada em relao variao
na abundncia de L. fortunei nas macrfitas.
O resultado demostrou que o mexilho-dourado no afetou a estrutura da comunidade de
macroinvertebrados amostrados nas plantas.
Porm, observamos por meio de correlao
uma presso negativa sobre Cladocera frente
abundncia de L. fortunei. Acreditamos que a
diluio das amostras pode ter enfraquecido o
resultado, devido ao grande nmero de lagoas
amostradas e o nmero de amostras coletadas
em cada uma. Porm, a densidade de L. fortu-

nei obtida foi muito baixa quando comparada


aos valores registrados para o sul do Brasil com
valores prximos a 100.000 ind.m-2 (Darrigran
& Pastorino, 2000).

A ocorrncia de altas densidades do mexilho-dourado na Amrica do Sul tem levado
a uma diminuio da abundncia e riqueza de
espcies de invertebrados (Darrigran et al.,
1998a; Ricciardi, 1998; Orensanz et al., 2002;
Conde et al., 2002; Mansur et al., 2003; Scarabino, 2004; Brugnoli et al., 2005).

Os resultados aqui apresentados no
so suficientes para demonstrar que o pulso
de inundao pode controlar a densidade de
mexilho-dourado no Rio Paraguai. Porm, o
tempo decorrido aps a introduo da espcie
e as baixas densidades registradas, nos faz inferir que esse processo possa ser determinante
no controle populacional. Entretanto, a inundao sazonal no Pantanal no pode conter a
disperso da espcie, que pode ocorrer devido
ao transbordamento lateral da gua para os
campos no perodo de cheia e maior densidade
de organismos nas lagoas laterais ao Rio Paraguai, que atuam como fontes dispersoras.

Considerando os resultados desse trabalho, fica evidente que no Pantanal a flutuao
anual do nvel da gua e a escassez de substratos estveis podem ser fatores limitantes
para o crescimento populacional de L. fortunei
(Oliveira et al., 2006), o que torna pouco provvel a ocorrncia de densidades equivalentes
s encontradas na Argentina (Darrigran & Pastorino, 2000) e sul do Brasil (Mansur et al.,
2004c).

No entanto, somente aps a realizao
de estudos mais detalhados sobre os fatores
que interferem no crescimento populacional
dessa espcie invasora, bem como a construo
de um conhecimento aprofundado das comunidades associadas a E. crassipes, que considerem
as variaes temporais e relaes trficas estabelecidas, ser possvel avaliar de forma efetiva
o efeito da introduo de L. fortunei na estrutura da fauna de macroinvertebrados.

Observaes e recomendaes


O equilbrio de um sistema natural depende da ao combinada e equilibrada entre a
estrutura do ambiente, que reflete o quo nte-

CAPTULO 17
Seo 4

Figura 2. Abundncia relativa (%) dos taxa de invertebrados associados a E. crassipes nas 15 lagoas marginais ao Rio Paraguai,
Mato Grosso amostradas em setembro de 2005. (Lagoas = L1 a L15).

gro este se encontra, com seu funcionamento,


determinando, assim, no apenas a estabilidade, mas tambm a amplitude de resilincia.
A ao de uma espcie invasora com um alto
poder de interferncia nestes atributos, integridade e estabilidade, deve receber ateno contnua (Fig. 3). Novos estudos so necessrios,
considerando o monitoramento dos fatores
ambientais e dos padres de biodiversidade,
para que se entenda a evoluo do mexilho-dourado nos sistemas aquticos do Pantanal.

A estratgia mais eficiente para o controle da disperso do mexilho-dourado e outras
espcies no Pantanal a sensibilizao para a
problemtica que os bioinvasores podem causar
para a fauna aqutica. Aes em diferentes nveis so necessrias como medidas mitigadoras,
iniciando pelos pescadores e ribeirinhos que
desconhecem os efeitos negativos de sua prtica, quando transportam de um lugar para outro, gua, iscas, e embarcaes, at os gestores e
autoridades ambientais que, no estado de Mato
Grosso, tem negligenciado a intensidade da
problemtica. Propomos aqui o planejamento
estratgico considerando cinco nveis para o desenvolvimento de aes especficas integradas,
como medidas de monitoramento e controle da
disperso de bioinvasores (Fig. 4).

Os efeitos dos impactos na bacia do Rio
Paraguai so evidentes quando causados pela
degradao do solo e poluio, porm so inconspcuos os efeitos causados nos sistemas
aquticos causados pela introduo de espcies
exticas. Alho (2011) e Alho et al. (2011) apontam a organizao e continuidade das pesquisas
na forma de um amplo programa de conservao. Este dever identificar, avaliar e mitigar os

impactos ambientais no Pantanal e dessa forma


restaurar, proteger e preservar habitats naturais
dos impactos causados pela m gesto dos recursos naturais, causada, dentre outros fatores,
pela fragilidade das organizaes ambientais
para aplicar a legislao. Dessa forma, a aprovao de projetos de desenvolvimento na regio
do Pantanal deve perpassar pela utilizao sustentvel dos recursos biolgicos. A investigao
cientfica poder incitar a discusso de avanos,
problemas e prioridades dentro um plano de
ao para conservar a biodiversidade regional.

205
Figura 3. Modelo conceitual bsico da ao de uma ou mais espcies invasoras frente aos principais atributos do ecossistema.

Figura 4. Nveis para o desenvolvimento de aes estratgicas


para a gesto adequada relacionada interferncia de espcies invasoras.

Limnoperna fortunei associada a macrfitas aquticas


na bacia do Rio Paraguai, Mato Grosso
Maral & Callil

Tabela I. Coordenadas geogrficas, biomassa de E. crassipes (raiz e total), densidade de invertebrados e de L.


fortunei o comprimento mdio de L. fortunei nas 15 lagoas marginais ao Rio Paraguai, Mato Grosso amostradas
em setembro de 2005. L1 a L15 = Lagoas, PS = Peso seco.
Coordenadas
Lagoas

206

Biomassa de
E. crassipes (PS)

Densidade de
Invertebrados

L. fortunei

Comp.
Mdio

ind.m-2

(mm)

Lat/Long

Raiz
(g.m-2)

Planta
(g.m-2)

ind/100g
PS

ind.m-2

Acurizal

S174924,8 W573348,9

609.76

1274.51

6399

39019

21

Caracar

S175250,9 W572824,8

881.07

1600.53

2884

25408

283

2,82

Joozinho

S175213,2 W572851,8

1248.16

2109.01

2348

29301

1792

3,93

Comprida

S175236,9 W573039,3

853.76

1509.76

6111

52171

533

3,7

Piuval

S175337,6 W572957,4

707.09

1865.39

4124

29157

827

6,38

Desprezo

S175353,4 W572900,8

997.76

1633.76

1930

19259

384

3,74

Turco

S174805,9 W571535,9

658.83

1535.79

5388

35499

3616

3,14

Bigueirinho

S174807,7 W5734 05,5

1041.65

1956.48

2091

21776

725

2,44

Canafisto

S174733,8 W573318,9

749.60

1677.92

2888

21648

3008

1,96

Caracarazinho

S175023,2 W572912,1

941.92

1839.79

2099

19771

219

1,8

Trs Bocas

S175121,1 W572857,1

1162.08

1973.33

1460

16971

2917

3,08

Cladia

S175120,1 W573011,2

1071.79

1936.80

5501

58955

443

9,26

Sandrinha

S175102,9 W572945,0

1220.80

1851.41

2446

29856

2539

3,18

Ins

S174954,9 W573146,4

1772.36

3738.45

1838

32568

2426

3,14

Figueira

S174832,5 W573235,3

991.68

1845.12

2920

28960

1483

2,43

CAPTULO 18
Experincia da procura e
monitoramento no incio da invaso
de mexilho-dourado no Rio Paran
e no reservatrio de Itaipu
Alice Michiyo Takeda
Daniele Sayuri Fujita


A procura de L. fortunei, seja da larva
ou do adulto, em um ambiente desconhecido
e nunca estudado, uma tarefa rdua para
muitos pesquisadores, quando solicitados por
rgos governamentais ou privados. Tendo em
vista a necessidade de uma anlise preliminar
do ambiente, muitas vezes ainda sem financiamento, preciso verificar com cuidado qual
mtodo poder ser utilizado naquele ambiente
para detectar esses bivalves. Dever-se- tentar
no incorrer no erro metodolgico. Mesmo assim, com todos os cuidados utilizados pode-se
no encontrar o mexilho-dourado, devido a
muitos fatores ainda no pesquisados sobre a
biologia dessa espcie (Takeda et al., no prelo).

Em janeiro de 2001, no reservatrio de
Itaipu ainda no havia sido detectado nenhum
mexilho-dourado, ento foi solicitada a verificao da sua existncia ao longo do canal
jusante da barragem desse reservatrio.

O reservatrio de Itaipu muito utilizado por pescadores, tanto amadores como profissionais, bem como por turistas que utilizam
os campings espalhados em suas margens. A

primeira ocorrncia de L. fortunei foi constatada na estao ICLI, onde se localiza o Iate Clube do Lago Itaipu, com embarcaes de turistas
advindas de diversos lugares.

O estudo desenvolvido ao longo de reservatrio, com incio em maio de 2001, foi o
primeiro no Brasil que utilizou uma abordagem
experimental dentro do reservatrio, em uma
extenso to ampla. Os experimentos conduzidos mostraram-se efetivos, possibilitando determinar a colonizao do mexilho-dourado
ao longo do reservatrio de Itaipu, desde a
zona lacustre at a de transio do reservatrio.

1. Fase I


As estaes de coletas foram identificadas
pela sigla E1 a E20 correspondendo, respectivamente, s estaes 1 a 20 desde Encarnacin,
jusante, at Ciudad del Este, montante (Fig. 1A
e B). Para realizarem-se as amostragens de campo
foi necessrio levar em considerao as seguintes
condies: o tempo disponvel, a segurana da
equipe de trabalho e a verba disponvel.

207

Experincia da procura e monitoramento


no incio da invaso de mexilho-dourado
no Rio Paran e no reservatrio de Itaipu
Takeda & Fujita


1.1. Morfologia e profundidades das

estaes de coleta jusante do

reservatrio de Itaipu.

As estaes foram distribudas em um
trecho de 344 km onde o Rio Paran corre diretamente sobre o basalto da Formao Serra
Geral. Esse trecho do rio flui atravs de uma
garganta, provavelmente de origem estrutural,
alcanando os maiores valores de velocidade
e profundidade em locais onde seu canal se
apresenta mais estreito. Consequentemente,
nesse trecho que o rio tem os maiores valores
de potncia de fluxo (power stream), exceto no
trecho das antigas Sete Quedas. Em algumas
estaes a velocidade atinge cerca de 2,46 m/s,
at 68 m de profundidade, para valores de potncia de fluxo em torno de 94,00 W/m-2 .


Muito embora o rio apresente um gradiente hidrulico variando entre 0,024 e 0,054
m/km, o gradiente do fundo, controlado por
tectonismo, apresentou valores totalmente
anmalos, inclusive com situaes de inverso
de gradiente. Isso provoca um fluxo extremamente turbulento com formao de vrtices,
correntes ascendentes e refluxos.

Os dados gerais referentes profundidade, velocidade de fluxo, gradiente hidrulico,
largura do canal e potncia de fluxo esto apresentados na Figura 2.

1.2. Amostragem de larvas de

Limnoperna fortunei

(Dunker, 1857)

As amostragens de campo foram realiza-

208
A
Figura 1. A, Mapa e localizao das estaes de coletas de E1 a E20.

CAPTULO 18
Seo 4

B
Figura 1.B, Perfis de profundidade das estaes.

das, mensalmente, na Fase I de janeiro a maro


de 2001, jusante do reservatrio de Itaipu (E1
a E20). Na Fase II coletou-se no reservatrio de
Itaipu de abril de 2001 a agosto de 2002.

Na Fase I do projeto realizaram-se as coletas no Rio Paran, onde as fortes correntezas
predominaram durante quase todo curso do
rio, com alguns trechos apresentando aflorao
de rochas, onde se formavam redemoinhos.

Durante a subida do rio, uma caminhonete da Itaipu/ Paraguai esperava a equipe no
local pr-determinado para o dia. No barco
tipo chato, motor 70, era carregado o material
de coleta, como bomba de suco, mangueiras,
potes, frascos de lcool, rede de plncton etc.

A equipe de coleta formada por dois tcnicos (Itaipu Brasil) para auxiliar as coletas,
parar o barco no meio do canal jogando uma
ncora de ferro e na filtrao de gua, um tc-

nico do Itaipu Paraguai para tomar as medidas de dados fsicos e qumicos da gua e duas
pesquisadoras da Universidade Estadual de
Maring para tomar os dados biolgicos.

Nessas condies, optou-se, para cada
estao, coletar 100 litros de gua com auxlio
de moto-bomba, pois em alguns trechos esse
volume de gua foi o mximo de tempo disponvel para o barco ficar parado no meio do
canal sem afundar. Na regio central, coletaram-se em trs profundidades: superfcie, meio
e fundo (comprimento mximo da mangueira
40 m), 60 litros de gua com balde, alm de
amostragem qualitativa com rede (5 minutos).
Na margem, tambm foram coletados 100 litros na superfcie, juntamente com a coleta de
balde. Portanto, em cada estao foi coletado
um total de 520 litros de gua, alm de amostra
para anlise qualitativa de rede.

209

Experincia da procura e monitoramento


no incio da invaso de mexilho-dourado
no Rio Paran e no reservatrio de Itaipu
Takeda & Fujita

Figura 2. Perfil batimtrico, velocidade de fluxo, gradiente hidrulico, largura do canal e potencia do fluxo das estaes de
coleta jusante do reservatrio. E = estao de coleta.


As coletas de gua, para verificar a ocorrncia de larvas de L. fortunei no reservatrio
de Itaipu, foram realizadas em quatorze estaes do corpo do reservatrio (Fig. 3).

R 2 = na praia de Santa Teresinha (25o2146,2S;


54o3024,9WO).
R3 = no municpio de So Miguel do Iguau, em frente foz do Rio Oco (25o1407,6S;
54o2712,8WO).
R4 = no municpio de Missal (25o0227,0S;
54o2603,0WO).
R 5 = no municpio de Missal perto da margem com pedreira, onde foi visto o mexilho
(25o0409,6S; 54o2251,3WO)
R6 = no municpio de Santa Helena
(24o4621,8S; 54o2135,3WO).
R7 = no municpio de Santa Helena (Sartori),
prxima a tanque rede onde j foi visto o mexilho (24o5002,0S; 54o1924,1WO).
R8 = no municpio de Pato Bragado (Porto
Britnia), no meio do canal (24o3855,0S;
54o1916,0WO).
R 9 = no municpio Entre Rios, no meio do canal (24o4055,5S; 54o2003,6WO).
R10 = no municpio de Marechal Cndido Rondon, no canal do reservatrio (24o2938,7S;
54o1938,6WO).
R11 = no municpio de Arroio Guau
(24o2251,6S; 54o1538,6WO).
R12 = no municpio de Guara, no meio dos paliteiros (24o0605,8S; 54o1919,2WO).
R13 = no municpio de Guara, fora do reservatrio, depois da Ponte MT-PR (24o0315,9S;
54o1522,4WO).
R14 = em frente do Iate Clube do Lago de Itaipu (25o2612,6S; 54o3045,4WO).

R1 = em frente Usina, mais ou menos prximo


a Unidade 11 (25o2340,6S; 54o3450,6WO).


Em cada estao, foram obtidas amostras em trs profundidades, utilizando-se uma


Em cada campanha, com 20 estaes, foram amostrados no total, 10.400 litros obtidos
com bomba e filtrada em rede de plncton de 25
m. Alm disso, realizou-se amostragem qualitativa de aproximadamente 10 minutos de gua
filtrada pela mesma rede. Nessa fase no foi detectada nenhuma larva nesse trecho do canal.

Em trs meses de coleta no foi observada nenhuma larva de L. fortunei. Devido forte correnteza desse trecho, seria pouco provvel
subida de larvas do reservatrio de Yacyret
para o reservatrio de Itaipu pelo estreito canal
do Rio Paran por meio natural. Provavelmente, o fator antrpico ajudou a subida dos invasores diretamente para regio prxima ou no
reservatrio de Itaipu.

2. Fase II


A partir de abril de 2001, aps o primeiro registro de um espcime adulto na Usina de
Itaipu (Zanella & Marenda, 2002), passou-se
a coletar amostras de gua, do substrato artificial e de zoobentos do reservatrio.

2.1. Amostragem e distribuio das

larvas de Limnoperna fortunei

210

CAPTULO 18
Seo 4

pelo mtodo tradicional, mais difcil devido


a pouca quantidade de adultos que esto se reproduzindo.

Observou-se um pico na densidade de
larvas em maio e junho de 2002, decrescendo
nos meses subsequentes (Fig. 4). O decrscimo dessas larvas pode indicar um perodo de
baixa reproduo, porm, destaca-se que essa
pesquisa enfocou o incio da colonizao do
mexilho-dourado no reservatrio, quando a
densidade ainda era muito baixa em relao
aos resultados observados na Argentina por
Cataldo & Boltovskoy (2000), que encontraram at 33.706 larvas m-3 no Rio de La Plata.
Dessa forma, nada pode ser concludo a respeito da atividade reprodutiva dessa espcie no
reservatrio de Itaipu.

Cataldo & Boltovskoy (2000) sugerem
a temperatura de 16-17C como limite para a
reproduo do mexilho-dourado. Tendo em
vista que as temperaturas da gua do reservatrio no decrescem tanto durante certo perodo
(de um ms ou mais), pode-se esperar que, com
a adaptao dessa espcie, a reproduo tenha
sido mais intensa do que na Argentina.

2.2. Amostragem e distribuio de

Limnoperna fortunei com substrato

artificial
Figura 3. Mapa do reservatrio de Itaipu com os pontos de
coleta de larvas de L. fortunei.

moto-bomba para filtrar 200 litros de gua por


amostra, em uma rede de plncton de 25 m
de abertura de malha. O material coletado em
campo foi acondicionado em frasco de polietileno devidamente etiquetado e fixado em lcool 70. As amostras foram analisadas no Laboratrio de Zoobentos do Nupelia.

Todas as larvas de Bivalvia encontradas
nas amostras foram retiradas e analisadas (medidas e morfologia externa) em microscpio
ptico. Para o reconhecimento de larvas de L.
fortunei foi necessrio ter muito cuidado na
identificao, principalmente onde havia muitos indivduos de Corbicula, como foi o caso do
reservatrio de Itaipu.

A deteco das larvas de L. fortunei no
reservatrio de Itaipu, apesar de intensas coletas de gua, foi observada apenas em fevereiro de 2002 (Fig. 4), sugerindo, assim, que
a deteco das larvas no incio da colonizao,


Os substratos artificiais so mais fceis
de serem controlados, servem para coletar os
invertebrados incrustantes.

Os substratos artificiais foram instalados em janeiro de 2001, em sete regies do
reservatrio de Itaipu e sem rplicas. A partir
de abril de 2001, instalaram-se mais substratos
artificiais ao longo do reservatrio de Itaipu,

Figura 4. Mdia das densidades de larvas registradas no reservatrio de Itaipu ao longo de dois anos de coleta.

211

Experincia da procura e monitoramento


no incio da invaso de mexilho-dourado
no Rio Paran e no reservatrio de Itaipu
Takeda & Fujita

com rplicas em cada regio, uma vez que o


monitoramento passou a ser no reservatrio,
abandonando-se as coletas jusante do mesmo.

Necessitou-se de constante reposio
dos 37 substratos artificiais instalados em maio
de 2001, ao longo e jusante do reservatrio,
devido ao desaparecimento constante dos mesmos. As coletas jusante do reservatrio foram
abandonadas devido a necessidade de reposio total a cada ms.

O substrato artificial foi feito com uma
boia fixada no leito do reservatrio (Fig. 5),
onde duas placas de madeira em X foram fixadas (Fig. 6). Um substrato foi instalado a 1,5 m
(S1) e outro a 3,0 m (S2) da superfcie da gua.
As amostras dos substratos foram raspadas,
mensalmente, utilizando-se um quadrado confeccionado com borracha e fixados imediatamente em lcool 70. Todo material foi triado
sob microscpio estereoscpio e os organismos
contados.

Os experimentos com substratos artificiais foram realizados no corpo do reservatrio
(Fig. 7) nas seguintes estaes:

Usina
U1 (substrato de madeira)
U2 (substrato de ao)
U3 (substrato de cimento)
Refgio
R1 (ao) 25o2414,8S 54o3445,9WO
R2 (cimento) 25o2406,7S 54o3448,5WO
R3 (madeira) 25o2340,6S 54o3450,6WO

Iate Clube ICLI
I1 25o2612,4S 54o3045,4WO
I2 25o2634,2S 54O2959,1WO
I3 25o2502,6S 54o3206,6WO

Santa Teresinha do Iguau
T1 25o2203,4S 54o3017,2WO
T2 25o2200,3S 54o3027,8WO
T3 25o2155,3S 54o3053,2WO

So Miguel
L1 25o1341,0 S 54o 1427,4WO
L2 25o1431,7 S 54o2347,2WO
L3 25o1315,1 S 54o2633,8WO

Santa Helena
H1 24o4834,1S 54o2001,4WO
H2 24o4729,0S 54o2057,9WO
H3 24o4643.2S 54o2111,8WO

Entre Rios
E1 24o4001,7S 54o1650,7WO
E2 24o3950,8S 54o1809,4WO
E3 24o4000,1S 54o1832,7WO

Figura 5. Boia do substrato artificial instalada no reservatrio


de Itaipu.


Pato Bragado (Porto Britnia)
B1 24o3844,5S 54o1842,6WO
B2 24o3839,5S 54o1911,4WO
B3 24o3835,8S 54o1922,8WO

Porto Mendes
M1 24o2644,5S 54o1837,7WO
M2 24o2715,0S 54o1859,3WO
M3 24o2916,1S 54o1946,2WO
Arroio-Guau
A1 24o2304,5S 54o1524,3WO
A2 24o2257,6S 54o1528,4WO
A3 24o2251,2S 54o1526,9WO

212

Figura 6. Substratos artificiais que ficam pendurados na boia.

Guara
G1 24o0619,9S 54o1854,3WO
G2 24o0512,9S 54o1749,7WO
G3 24o0619,9S 54o1854,3WO

CAPTULO 18
Seo 4

Lago de Itaipu, com a mxima densidade de


incrustao de 92.656 ind.m-2 nos substratos
desta mesma estao (Figs. 9 e 10).

O aumento exponencial de Limnoperna
nos substratos artificiais coincidiu com a diminuio de densidade das larvas de Chironomidae ao longo do tempo (Fig. 11).

A proliferao de L. fortunei deve afetar
outras comunidades do reservatrio de Itaipu,
mostrados aqui com o experimento realizado
com substrato artificial.

Para Oligochaeta (F(2, 1300)=59,708;
p<0,000), Cladocera (F(2, 1300)=12,371; p<0,000)
e Ostracoda (F(2, 1300)=30,103; p<0,000) observou-se uma preferncia pelo estrato boia, enquanto Limnoperna (F(2, 1300)=13,501; p<0,000)
e Trichoptera (F(2, 1300)=5,9603; p<0,00265) foram registrados em maiores densidades nos estratos
S1 e S2 (Fig. 12). Ephemeroptera (F(2, 1300)=3,3303;
p<0,003609) apresentou maiores abundncias
nos estratos superiores (boia e S1). Para as larvas
de Chironomidae no foram observadas preferncias por um dos estratos (boia, S1 e S2).

Figura 7. Mapa do reservatrio de Itaipu com a localizao de


substrato artificial.

Figura 9. Substrato artificial ainda no colonizado por mexilho-dourado.

Figura 8. Mdia e erro padro da densidade de Limnoperna


fortunei nos substratos artificiais ao longo dos meses.


Nos substratos artificiais instalados no
reservatrio de Itaipu desde maio de 2001, observou-se a rpida colonizao e disperso de
L. fortunei ao longo do mesmo. A densidade de
L. fortunei mostrou aumento progressivo desde sua primeira ocorrncia em agosto de 2001
(Fig. 8), na estao em frente ao Iate Clube do

Figura 10. Substrato artificial no final do experimento, com


bastante mexilho-dourado.

213

Experincia da procura e monitoramento


no incio da invaso de mexilho-dourado
no Rio Paran e no reservatrio de Itaipu
Takeda & Fujita

Figura 11. Distribuio temporal dos valores mdios da densidade (ind.m-2) de invertebrados.

So Miguel (rio Oco) (19 pontos)


Refgio Biolgico de Bela Vista (12 pontos)


As amostragens foram feitas com pegador
de fundo tipo Petersen modificado (0,0345 m2)
e acondicionadas em gales (Fig. 14). Em cada
ponto de coleta, foram realizadas quatro amostragens, sendo trs para anlise biolgica e uma
para anlise sedimentolgica, totalizando mensalmente 252 amostras para a anlise biolgica.

Logo aps a coleta, o material biolgico
foi transportado para margem e lavado em jogo
de peneiras com malhas de abertura 2,0, 1,0 e
0,5 mm (Fig. 15). Os organismos encontrados
nas malhas de 2,0 e 1,0 mm foram retirados e fixados imediatamente em lcool 70. O material
retido na malha de 0,5 mm foi acondicionado
em potes de polietileno em lcool 70, para posterior triagem sob microscpio estereoscpio,
no Laboratrio de Zoobentos do Nupelia.

Figura 12. Distribuio dos valores mdios da densidade


(ind.m-2) de invertebrados nos diferentes estratos.


Os substratos artificiais mostraram ser
muito eficientes para monitorar os mexilhes
dourados.

2.3. Amostragem e distribuio de

Limnoperna fortunei

em zoobentos

214


As amostragens bentnicas foram realizadas nas oito estaes, abrangendo o brao do
tributrio at a proximidade do antigo canal do
Rio Paran, estabelecendo-se diversos pontos,
especialmente prximos s margens at perto
do canal antigo do Rio Paran.

As oito estaes selecionadas nos municpios (Fig. 13) foram:

Guara (Tatur) (4 pontos)

Mercedes (Arroio Guau) (6 pontos)

Marechal Cndido Rondon

(Porto Mendes) (7 pontos)

Entre Rios do Oeste

(rio So Francisco Verdadeiro) (7 pontos)

Santa Helena

(rio So Francisco Falso) (17 pontos)

Missal (rio So Vicente) (12 pontos)

Figura 13. Mapa do reservatrio de Itaipu com os pontos de


coleta de zoobentos.

CAPTULO 18
Seo 4

Tabela I. Coordenadas dos pontos de cada estao de coleta. GR = Guara; AG = Arroio-Guau; PM = Porto Mendes; ER = Entre
Rios; SH = Santa Helena; MS = Missal; SM = So Miguel; RF = Refgio.

Local

Coordenadas S

Coordenadas WO

Local

Coordenadas S

Coordenadas WO

GR1

240638,6

541848,0

MS2

250240,7

542615,6

GR2

240630,6

541842,0

MS3

250249,6

542533,6

GR3

240623,2

541833,6

MS4

250119,9

542528,7

GR4

240619,3

541901,6

MS5

250155,1

542446,6

AG1

242232,9

541551,5

MS6

250132,1

542336,2

AG2

242257,7

541533,9

MS7

250212,1

542344,3

AG3

242250,7

541523,0

MS8

250250,8

542354,6

AG4

242300,7

541520,6

MS9

250324,3

542423,3

AG5

242302,0

541522,4

MS10

250418,0

542312,4

AG6

242303,7

541526,8

MS11

250353,0

542202,0

PM1

242930,4

542008,8

MS12

250338,3

542213,0

PM2

242717,1

541836,3

SM1

251407,6

542712,8

PM3

242847,8

541901,2

SM2

251326,0

542733,6

PM4

242937,4

541902,2

SM3

251232,4

542557,5

PM5

242950,7

541909,5

SM4

251223,4

542359,7

PM6

243012,3

541917,8

SM5

251405,8

542641,6

PM7

242938,8

541849,1

SM6

251447,0

542501,7

ER1

24 4055,5

54 2036

SM7

251328,0

542327,9

ER2

243939,8

541805,9

SM8

251456,0

542346,5

ER3

243949,4

541757,1

SM9

251527,1

542336,6

ER4

244003,3

541749,9

SM10

251508,1

542244,7

ER5

244011,2

541656,3

SM11

251336,9

542208,3

ER6

244006,8

541650,6

SM12

251321,5

542108,5

ER7

244000,9

541638,9

SM13

251239,7

541957,1

SH1

244540,9

542217,5

SM14

251313,0

541927,5

SH2

244559,5

542054,3

SM15

251238,2

541829,1

SH3

244650,9

542118,1

SM16

251220,4

541636,9

SH4

244641,7

542017,8

SM17

251332,5

541538,3

SH5

244720,5

542043,1

SM18

251332,5

541420,4

SH6

244727,2

542053,7

SM19

251357,0

541344,1

SH7

244728,2

542103,4

RF1

252419,1

543351,9

SH9

244759,9

542042,4

RF2

252442,9

543202,7

SH8

244754,1

542032,2

RF3

252458,2

543109,9

SH10

244802,0

542052,4

RF4

252542,8

543039,4

SH11

244839,9

542017,3

RF5

252624,1

542954,3

SH12

244838,5

542003,6

RF6

252656,2

542956,9

SH13

244827,6

541946,4

RF7

252646,4

543021,9

SH14

244922,8

542014,4

RF8

252619,0

543045,3

SH15

245014,1

542028,8

RF9

252532,1

543117,5

SH16

245000,0

542010,7

RF10

252610,1

543327,5

SH17

245012,4

542006,1

RF11

252635,0

543234,3

MS1

250203,2

542654,4

RF12

252642,4

543303,8

215

Experincia da procura e monitoramento


no incio da invaso de mexilho-dourado
no Rio Paran e no reservatrio de Itaipu
Takeda & Fujita

14

15

Figuras 14, 15. 14, Pegador tipo Petersen (modificado); 15, Coleta e lavagem do material bentnico.

Figura 16. Mdia mensal das


densidades de mexilho-dourado em todos os pontos de
coleta ao longo do reservatrio de Itaipu.


No reservatrio de Itaipu, a coleta de
zoobentos mostrou-se muito eficiente para deteco de mexilho-dourado e, principalmente, para analisar melhor as condies e tipo de
substratos utilizados pelos adultos. A maior
densidade mdia de mexilho-dourado foi encontrada no clasto de argila, presente nas regies marginais do reservatrio (Fig. 16).

216

3. Consideraes finais


Para se estabelecer um modelo de monitoramento de mexilho-dourado necessria
uma trama complexa de conhecimentos. Esses
bivalves esto sujeitos a um nmero de diferentes agentes estressores. Esses agentes podem

ser resultados de aes humanas ou simplesmente devido a eventos naturais locais, diferentes do pas de origem da espcie. Portanto,
o mexilho-dourado no est adaptado a essas
situaes, como a conhecida dequada, principalmente a depleo de oxignio dissolvido
na gua, no Pantanal, muitas vezes citadas pela
Oliveira et al. (2006), podendo ser um dos fatores limitante para sua proliferao.

O estresse pode levar a alteraes nas
concentraes de neurotransmissores ou produo de hormnios, afetando o organismo
nos nveis celulares e histolgicos. A esse nvel,
ocorrem mudanas metablicas, tais como, a
osmorregulao e funes imunolgicas, podendo atingir o organismo como um todo. Por

CAPTULO 18
Seo 4

bientes j colonizados como nos reservatrios,


a plancie aluvial do Rio Paran, o Rio Ivinhema, entre outros.

Os mtodos utilizados para anlise da
malacofauna do reservatrio Itaipu, dos anos
2001 a 2002, resultaram em dados inditos sobre o mexilho-dourado, antes nunca pesquisado no Brasil, com a instalao dos substratos
artificiais ao longo do reservatrio e coletas de
zoobentos que mostraram a sua incrvel rapidez
no avano da colonizao (Fig. 17). A pesquisa
com as larvas de mexilho mostrou alguns perodos de picos de reproduo no reservatrio
de Itaipu e a pesquisa de zoobentos mostrou
onde realmente os indivduos de L. fortunei vivem no reservatrio.

A proliferao de L. fortunei deve afetar
outras comunidades do reservatrio de Itaipu,
especialmente as espcies de Bivalvia nativas,
sendo aconselhvel dar continuidade as pesquisas para a obteno de mais dados biolgicos
para poder sugerir um controle natural.


Figura 17. Mapa com a localizao dos substratos e registros
mensais (maio/2001 a agosto/2002) no reservatrio de Itaipu
desde a primeira colonizao de Limnoperna fortunei.

sua vez, os organismos respondem atravs de


mudanas na dinmica do crescimento e reproduo, culminando em alteraes que atingem
toda a populao e, consequentemente, podendo levar a uma extino total da invasora no
bem sucedida. O mexilho-dourado parece ter
superado, por enquanto, todos os obstculos
naturais e antrpicos mantendo-se nos am-

4. Agradecimentos


Itaipu Binacional, pelo financiamento
do projeto; ao NUPELIA, pelo apoio logstico;
pesquisadora Ins Ezcurra de Drago (INALI
Argentina), pelos ensinamentos sobre as larvas
de mexilho-dourado; ao Dr. Jos C. Stevaux,
pelo clculo do gradiente hidrulico e potncia
do fluxo das estaes de coleta jusante do reservatrio; ao motorista e tcnico Celso /UEM;
aos funcionrios da Itaipu Binacional, pelo apoio
e amizade durante as longas e pesadas jornadas
de coletas (mas sempre alegres!) e aos auxiliares
contratados pelo projeto, via UEM.

217

Seo
Moluscos invasores e a
comunidade bentnica

CAPTULO 19
Distribuio espacial do mexilho-dourado
na bacia do mdio Rio Tiet/Jacar,
Estado de So Paulo, Brasil: relao com moluscos
lmnicos, fitoplncton e qualidade da gua
Daniel Pereira
Paulo Eduardo Aydos Bergonci
Cintia Pinheiro dos Santos
Vanessa Gazulha
Maria Cristina Dreher Mansur
Carlos Perez Bergmann
Juliane Vicenzi
Silvio Santos


Ao analisarem a distribuio da fauna
bentnica das represas Ibitinga, Bariri e Barra Bonita do mdio Rio Tiet, no perodo de
novembro de 2002 a agosto de 2003, Suriani
et al. (2007) verificaram que as espcies de moluscos invasores, Melanoides tuberculata (Mller, 1774) e Corbicula fluminea (Mller, 1774),
foram dominantes. Frana et al. (2007) realizaram no mesmo perodo, um levantamento,
semelhante s autoras acima, para as represas
do baixo Tiet, com resultados semelhantes em
relao distribuio e abundncia dos mesmos moluscos invasores. Ambos as publicaes
alertaram tambm sobre a eutrofizao dos reservatrios do trecho baixo e mdio do Tiet,
com altas concentraes de nutrientes (total e
dissolvido).

Em ambos os trabalhos, as autoras no
registraram a presena da espcie invasora Limnoperna fortunei (Dunker, 1857), conhecida
popularmente como o mexilho-dourado. Avelar et al. (2004), registra pela primeira vez o
mexilho-dourado no estado de So Paulo em

novembro de 2002, em uma localidade do Rio


Paranapanema, na confluncia com o Rio Paran, prxima localidade de Rosana (2231S
- 5300W). Darrigran & Mansur (2006) mencionaram que no final de 2004, a espcie foi
encontrada no Rio Tiet, na represa de Barra
Bonita, j prximo capital do estado de So
Paulo. A exata chegada do mexilho-dourado
em Ibitinga no tem registro, porm estima-se ter sido em perodo anterior a esta data,
pois Barra Bonita situa-se mais montante no
mesmo rio. Pareschi et al. (2008) calcularam
a velocidade de invaso do mexilho-dourado
ao longo do alto Rio Paran, desde a chegada
ao reservatrio de Itaipu, em 2001, at 2005,
ano estimado da chegada a Ibitinga/Bariri. Os
autores acreditam que a velocidade de invaso
tenha sido na ordem de 264 km nestes 4 anos.
Tundisi et al. (2008) alertaram sobre a vulnerabilidade da bacia do Rio Tiet com presena do
mexilho-dourado, devido aos inmeros danos
que esta invasora tem produzido aos sistemas
aquticos, alterando canais, tubulaes e estru-

221

Distribuio espacial do mexilho-dourado na bacia do


mdio Rio Tiet/Jacar, Estado de So Paulo, Brasil:
relao com moluscos lmnicos, fitoplncton e qualidade da gua
Pereira et al.

turas, com prejuzos para a sua manuteno,


especialmente em represas.

Os reservatrios no Brasil, especialmente no Estado de So Paulo, so importantes
ecossistemas que foram construdos nos ltimos 40 anos. Alguns destes reservatrios,
principalmente os do sistema em cascata do
Mdio e Baixo Rio Tiet, encontram-se em
estado eutrfico. Floraes de cianobactrias
so frequentemente relacionadas a estas condies eutrficas, o que compromete os usos
mltiplos destes reservatrios, implicando em
riscos sade humana e biota aqutica (Minillo, 2005). Os maiores problemas esto relacionados produo de toxinas. As toxinas das
cianobactrias podem causar intoxicaes em
animais e seres humanos, e at mesmo a morte
pela ingesto de gua contaminada (Carmichael et al., 2001). Diversos estudos demonstram
que estas toxinas afetam as comunidades aquticas (Lampert, 1982; Demott, 1999).

Durante projeto de P & D financiado
pela AES Tiet e executado pela Fundao
Luiz Englert, um diagnstico da distribuio
espacial do mexilho-dourado e dos moluscos
lmnicos associados (nativos e invasores), em
diferentes substratos, revelou algumas relaes
com o fitoplncton, cianobactrias, microcistinas e a qualidade da gua na sub-bacia do mdio Rio Tiet/Jacar, especialmente nos reservatrios de Ibitinga e Bariri, no perodo de 12 a
14 de maio de 2008, em oito estaes de coleta
(Tab. I).

A rea pertence sub-bacia do mdio
Rio Tiet/Jacar, situado no centro do Estado
de So Paulo (entre 4932 4730 longitude

e 2137 2251 de latitude) com uma rea de


drenagem de 11.749 km2 . Este trecho engloba
trs rios principais, o Rio Tiet (em um total
de 150 km da usina hidreltrica (UHE) Barra
Bonita at a UHE da Ibitinga), o Rio Jacar-Guau e o Rio Jacar Pepira. O relevo varivel com a altitude mxima de 800 m. A rea do
Tiet/Jacar localiza-se na Depresso Perifrica
do Estado de So Paulo, onde se encontram os
aquferos Bauru/Serra e Geral/Botucatu. Na regio predominam os solos de areias quartzosas
profundas a moderadas e em menores quantidades o latossolo roxo eutrfico. O clima da
regio, segundo classificao de Koppen, situa-se entre clima tropical mido (de outubro a
maro) e inverno seco (de abril a setembro). A
disponibilidade hdrica anual est na ordem
de 4.400 mm, com um perodo de precipitao mais intenso de outubro a maro (vero)
e um perodo de menor precipitao de abril
a setembro (inverno) (Tundisi et al., 2008).
Segundo CETESB (apud Suriani et al., 2007)
a rea apresenta intensa atividade industrial
com forte presso antrpica.

Para um diagnstico desta natureza diferentes tcnicas so empregadas (Tab. II): coleta
de trs rochas em cada estao de coleta para
a quantificao da abundncia mdia do mexilho-dourado; trs lanamentos (rplicas) de
draga de Petersen (rea: 10 x 10 cm) para coleta
do mexilho-dourado e demais moluscos bentnicos presentes no sedimento, sendo os resultados expressos em densidade mdia (ind./m2),
considerando, em cada estao de coleta. Os
moluscos associados vegetao de macrfitas
aquticas so coletados por meio do exame de

Tabela I. Coordenadas geogrficas das estaes de coleta (E1 a E8) situadas na sub-bacia do mdio Rio Tiet/Jacar (So Paulo,
Brasil).

Estaes de coleta

222

Coordenadas geogrficas

E1

Canal lateral de desgue da eclusa a jusante da UHE Ibitinga


(ltico)

214524,67 S

485938,05 W

E2

UHE Ibitinga prximo ao barramento (lntico)

2145 51,30 S

485919,57 W

E3

Trecho inferior do rio Jacar Guau (ltico)

214928,55 S

484953,13 W

E4

Trecho inferior do rio Jacar Guau sob influncia do lago da


UHE Ibitinga (lntico)

215031,51 S

485701,73 W

E5

Trecho inferior do rio Jacar Pepira sob influncia do reservatrio


(lntico)

215338,17 S

484851,37 W

E6

Incio do reservatrio de Ibitinga (lntico

220101,26 S

485254,14 W

E7

Rio Tiet montante do reservatrio de Ibitinga e jusante de


Bariri (ltico)

220843,16 S

484504,70 W

E8

UHE Bariri prximo ao barramento (lntico)

220415,63 S

484449,49 W

CAPTULO 19
Seo 5

Figura 1. Estaes de coleta (E1 a E8) situadas na sub-bacia do mdio Rio Tiet/
Jacar (So Paulo, Brasil): E1, canal lateral
de desgue da eclusa a jusante da UHE Ibitinga (ltico); E2, reservatrio UHE Ibitinga
prximo ao barramento (lntico); E3, trecho inferior do Rio Jacar Guau (ltico);
E4, trecho inferior do Rio Jacar-Guau
sob influncia do lago da UHE Ibitinga
(lntico); E5, trecho inferior do Rio Jacar
Pepira sob influncia do reservatrio (lntico); E6, no incio do reservatrio de Ibitinga (lntico), E7, Rio Tiet montante do
reservatrio de Ibitinga e jusante de Bariri
(ltico) e, E8, reservatrio de Bariri prximo ao barramento (lntico). Mapa adaptado de Tundisi et al. (2008) por D. Pereira.

razes de macrfitas de acordo com o mtodo


descrito por Volkmer-Ribeiro et al. (1984); coleta de larvas do mexilho-dourado por meio de
trs rplicas de gua filtrada (1000L), em rede
de 30 m, com auxlio de moto bomba. Amostragem do fitoplncton atravs da passagem de
frasco na superfcie da gua. As amostras (trs
rplicas) so acondicionadas em recipientes de
100mL e fixadas com formol a 4%. As anlises qualitativa e quantitativa so realizadas em
Cmara de Sedgewick-Rafter sob microscpio
ptico, com aumento de 200x. Os resultados
so expressos em densidade, atingindo eficincia amostral de 80%, de acordo com a seguinte
frmula (Pappas & Stormer, 1996):

Eficincia = [(n de indivduos - n de
txons) / n de indivduos] x 100

Os txons fitoplanctnicos considerados
como dominantes so aqueles que ocorreram
em densidades acima de 50% da densidade

total da alquota analisada, enquanto os abundantes foram os que ocorreram acima do valor
mdio obtido ao dividir-se a densidade total da
subamostra pelo nmero de txons registrados
na mesma (Lobo & Leighton, 1986).

Alm dos mtodos de amostragem da biota aqutica, a avaliao da qualidade da gua
tambm se faz necessria. Para tal so obtidos
dados de temperatura do ar e da gua, bem
como do oxignio dissolvido e pH. Amostras de
gua tambm so coletadas e preservadas para
a anlise de slidos suspensos totais, turbidez,
condutividade, fsforo total, nitrognio amoniacal e total. Os mtodos de coleta, preservao e anlise de gua esto descritos em APHA
(2004). Para a coleta de gua para a determinao de microcistinas necessrio no mnimo
rplicas atravs da passagem de frasco na superfcie da gua. A determinao das concentraes
de microcistinas se faz atravs do mtodo ELISA
(kit Beacon), que determinada concentrao
total de microcistinas (intra e extracelular).

Tabela II. Plano de amostragem utilizado nas estaes de coleta distribudas na sub-bacia do mdio Rio Tiet/Jacar, estado
de So Paulo, Brasil. Macrfitas aquticas ausentes (ma); substrato rochoso (sr) impediu dragagem.

Plano de amostragem

Amostragem de sedimento (draga de Petersen)*


Amostragem de rochas
Exame de macrfita aqutica (E. crassipes) **
Exame de macrfita aqutica (Poacea) **
Amostragem de larvas de L. fortunei***
Amostragem de fitoplncton/cianobactrias
Amostragem de gua/cianotoxinas

Estaes de coleta
E1
sr
x
ma
ma
x
x
x

E2
sr
x
x
ma
x
x
x

E3
X
X
Ma
X
X
X
X

E4
x
x
x
ma
x
x
x

E5
x
x
x
ma
x
x
x

Unidade
E6
x
x
x
ma
x
x
x

E7
x
x
ma
x
x
x
x

E8
x
x
x
ma
x
x
x

ind.m-2
ind.rocha
ind./100g
ind./100g
ind.m-3
cl/mL
g.L-1

Mtodos de coleta e anlise: *Mansur et al. (2003) e Takeda et al. (2005); **Volkmer-Ribeiro et al. (1984); ***Santos et al. (2005).

223

Distribuio espacial do mexilho-dourado na bacia do


mdio Rio Tiet/Jacar, Estado de So Paulo, Brasil:
relao com moluscos lmnicos, fitoplncton e qualidade da gua
Pereira et al.

224


Para a anlise estatstica dos dados obtidos so realizados diferentes procedimentos: anlise de correlao (Spearmans rho),
com finalidade de verificar relaes espaciais
entre o mexilho-dourado e demais variveis
(moluscos lmnicos, fitoplncton e qualidade
da gua); anlise de varincia (ANOVA, Duncan a posteriori, =0,05), com a finalidade de
verificar variao espacial; anlises de correspondncia cannica (CCA), seguida de teste
de Monte Carlo atravs do programa PC-ORD
(Mccune & Mefford, 1997), com a finalidade
de detectar padres espaciais e relaes com as
variveis ambientais.

No diagnstico em questo se observa a
total dominncia das invasoras L fortunei (Fig.
2), seguida de Melanoides tuberculata, e Corbicula fluminea. Suriani et al. (2007) constatou a
dominncia do gastrpode invasor Melanoides
tuberculata em elevadas densidades, anteriormente introduo de L. fortunei. Atualmente
este gastrpode mantm densidades elevadas
similares s verificadas pelas autoras (op. cit.),
nos anos de 2002 e 2003, porm as densidades
do mexilho-dourado so mais elevadas.

Corbicula fluminea predomina com
maiores densidades nas estaes E5 e E7 (Fig.
2), em densidades bem inferiores a de L. fortunei e M. tuberculata. Suriani et al. (2007)
tambm registraram a presena de C. fluminea em densidades relativamente baixas. Esta
espcie requer substrato arenoso e guas com
elevada saturao de oxignio (Mansur et al.,
1994). Segundo Boltovskoy et al. (1997) este C.
fluminea sensvel poluio orgnica. Com
base nos dados logaritmizados de densidade
mdia de moluscos encontrados no sedimento
de fundo foram verificados alguns padres de
variao espacial da malacofauna. As estaes
de coleta no diferem estatisticamente (ANOVA, Duncan a posteriori, =0,05) quanto s
densidades do txon Pomacea sp.; as estaes
E5 e E7 (maiores densidades) diferem das estaes E3, E6 e E8 (menores) quanto ao txon
Melanoides tuberculata; as estaes de coleta
E5 e E7 (maiores densidades) diferem das demais estaes de coleta (menores) quanto ao
txon C. fluminea; as estaes de coleta E4 e
E8 (maiores densidades) diferem entre si e das
demais das estaes (menores) quanto ao txon
L. fortunei. O diagnstico diverge dos resulta-

dos obtidos por Suriani et al. (2007) que registra Aylacostoma tenuilabris (Bernardi, 1856),
Biomphalaria glabrata (Say, 1818), Biomphalaria intermedia (Paraense & Deslandes, 1962),
Diplodon expansus (Kster, 1853), Physa
cubensis (Pfeiffer, 1839) e Pomacea canaliculata (Lamarck, 1822). No se verifica correlao
significativa entre o mexilho-dourado e os demais moluscos no sedimento.

Os txons de moluscos encontrados nos
talos e razes de macrfitas flutuantes do gnero Eichhornia na bacia do mdio Rio Tiet/

Figura 2. Densidade populacional mdia de moluscos lmnicos


nas estaes de coleta distribudas na sub-bacia do mdio Rio
Tiet/Jacar, estado de So Paulo, Brasil A, no sedimento; B,
densidade em razes de macrfitas aquticas. M. tuberculata
(Mt), Pomacea sp. (Psp), Cochiliopidae (Co), Physa sp. (Ph),
Biomphalaria sp. (Bi), Drepanotrema sp (Dr.), Antillorbis sp.
(An), O. matheroni (Om), Eupera sp. (Eu), Pomacea sp. (Psp), C.
fluminea (Cf) e L. fortunei (Li).

CAPTULO 19
Seo 5

Jacar (Fig. 2B) so tpicos deste tipo de substrato (Volkmer-Ribeiro et al., 1984; Pereira et
al., 2000a, b; Pfeifer & Lopes-Pitoni, 2003;
Ablio, et al., 2006; Arruda et al., 2009). Os
talos (estoles) e as razes do aguap oferecem
substrato, abrigo e disponibilizam alimento
(perifton) aos moluscos raspadores, no caso
os gastrpodes. J os bivalves filtradores, que
vivem na macrfita, devem apresentar os fios
de bisso para sua fixao, como o caso de
Eupera sp. e L. fortunei. Corbicula fluminea
um filtrador que se enterra no sedimento e, por
no apresentar fios de bisso na fase adulta, no
teria condies de utilizar a macrfita como
substrato.

A dominncia da espcie bissada L. fortunei no aguap notria sobre as demais,
em especial montante dos reservatrios (E2,
E4, E5 e E8). L. fortunei tm sido registrado
numa grande variedade de espcies e formas
biolgicas de macrfitas aquticas (Mansur
et al., 2003, 2004b). Em alguns casos, at
colonizando espcies arbreas marginais aos
rios e lagos que no teriam capacidade de
abrigar fauna de macroinvertebrados, como o
caso de dos galhos de sarandi, no Lago Guaba
(RS), oferecendo um novo micro-habitat para
moluscos e crustceos (Mansur et al., 2008c).
importante considerar que a invasora M.
tuberculata dominava a regio (Suriani et al.,
2007), at a chegada do mexilho-dourado,
que no momento o dominante na taxocenose.

Com base nos dados logaritmizados de
densidade mdia, em razes de macrfitas aquticas, os seguintes padres de variao espacial
da malacofauna so verificados: as estaes de
coleta no diferem estatisticamente (ANOVA,
Duncan a posteriori, =0,05) quanto aos txons Melanoides tuberculata, Physa sp., Biomphalaria sp.; Drepanotrema sp., Antillorbis sp.,
Eupera sp. e Cochiliopidae. No entanto, a estao E2 difere das demais por apresentar as
densidades mais elevadas de L. fortunei em raiz
de macrfita aqutica. A estao de coleta E4
(maior densidade) difere das estaes E3, E6,
E7 e E8 (menor) quanto densidade Pomacea sp. verificada correlao positiva entre
o mexilho-dourado e o gastrpode Physa sp.
(r=0,413; p=0,023; Spearmans rho). A relao
entre a populao desta invasora e demais componentes da macrofauna pouco conhecida e

merece ser elucidada em pesquisa destinada ao


tema. Silva et al. (2007) tambm no verificou
qualquer correlao entre as densidades do mexilho-dourado e dos demais moluscos lmnicos associados no aguap (Eichornia crassipes),
em lagos do Rio Paraguai.

A densidade larval mdia de 1,790,74
ind.m-3, variando de zero a 5,33 (Fig. 3). Os
maiores valores de densidade larval (ind.m-3)
ocorrem jusante da UHE Ibitinga (E1) e jusante da UHE Bariri (E7). De todos os locais
amostrados, na estao de coleta situada no
Rio Jacar Pepira (E5) as larvas no so detectadas, porm foi registrada a presena de indivduos adultos neste local.

As estaes E1 e E7 diferem estatisticamente (ANOVA, Duncan a posteriori, =0,05)
das demais estaes, quanto densidade mdia
de larvas logaritmizada. A densidade larval observada no perodo amostrado relativamente
baixa quando comparada de uma maneira geral com resultados obtidos por Santos (2004)
e Santos et al. (2008) para o Lago Guaba no
Rio Grande do Sul e Pestana et al. (2008), no
Rio Paran, junto foz do Rio Iguau. Segundo
Morton (1982), a espcie apresenta pulsos reprodutivos que coincidem mais ou menos com
as temperaturas da gua, mais altas e mais baixas. De acordo com Darrigran et al. (2002), as
baixas temperaturas inibem a liberao de larvas do mexilho-dourado. Boltovskoy & Cataldo (1999) observaram que a densidade larval
no plncton junto ao baixo Rio Paran acontece de setembro a maro e que os pulsos no

225

Figura 3. Densidade mdia, erro padro, mnimo e mximo


(ind.m-3) de larvas de Limnoperna fortunei no plncton (monitoramento), nas estaes de coleta distribudas na sub-bacia
do mdio Rio Tiet/Jacar, estado de So Paulo, Brasil.

Distribuio espacial do mexilho-dourado na bacia do


mdio Rio Tiet/Jacar, Estado de So Paulo, Brasil:
relao com moluscos lmnicos, fitoplncton e qualidade da gua
Pereira et al.

so bem evidentes no vero, mas as temperaturas mais baixas tornam a atividade reprodutiva
descontnua. Na regio amostrada, na poca do
diagnstico, no foi possvel um monitoramento
larval peridico para a verificao dos pulsos de
densidade larval, mas as datas de coleta coincidem com um perodo de temperaturas de outono (ms de maio), mais amenas, o que poderia
justificar a baixa densidade encontrada.

Outros fatores ambientais que poderiam
influenciar na densidade do mexilho seriam o
tipo de substrato e a correnteza. O mexilho-dourado prefere substratos duros e guas bem
oxigenadas, onde costuma se avolumar (Morton,
1982). A maior ocorrncia de larvas nos locais
com maior movimentao das guas (jusantes
dos barramentos Ibitinga e Bariri) confere com
os dados observados por Bergonci et al. (2009)
durante um ano de coletas mensais, que referem
a maior densidade larval encontrada na margem
do canal principal do Rio Jacu em relao ao
cais do porto de Porto Alegre, Delta do Jacu,
Rio Grande do Sul. Os ambientes juntos s estaes E3 (Jacar-Guau), ambiente ltico, e E5
(Jacar Pepira), apresentaram-se compostos por
sedimentos lodosos e pouco consistentes, no
apresentando condies ideais para a fixao e
sobrevivncia do molusco e consequentemente
acarretando baixa produo larval.

A comunidade fitoplanctnica est representada por 43 txons, identificados em nvel

especfico, na sua maioria. Estes txons encontram-se distribudos em 6 classes: Chlorophyceae, Zygnematophyceae, Cyanophyceae, Dinophyceae, Euglenophyceae e Bacillariophyceae
(Tab. V).

Os grupos fitoplanctnicos que apresentam maior riqueza especfica, em ordem decrescente, so Cyanophyta (Cyanophyceae), Heterokontophyta (Bacillariophyceae) e Chlorophyta
(Chlorophyceae) (Fig. 4). Os grupos Dynophyta
(Dinophyceae) e Euglenophyta (Euglenophyceae) tm baixa representatividade em termos de
riqueza, ocorrendo apenas na E4, com 01 espcie cada. De um modo geral, a comunidade fitoplanctnica demonstra baixa riqueza especfica
nas diferentes estaes amostradas.

As cianobactrias apresentam as maiores densidades em todas as estaes de coleta
da sub-bacia do mdio Rio Tiet/Jacar (Figs.
5 e 6). A E1 destaca-se por apresentar densidades muito elevadas em relao s demais
(3738,9 cl.ml-1). As estaes de coleta E2, E4
e E8 apresentam densidades intermedirias.
As densidades mais baixas so registradas nas
estaes 5 (0,2 cl.ml-1) e 6 (1,3 cl.ml-1), sendo a abundncia relativa das cianobactrias
prxima de 100 % na maioria das estaes de
coleta (Fig. 7). Nas estaes E5 e E6, foi registrada maior distribuio de densidades entre
os grupos Cyanophyta, Heterokontophyta e
Chlorophyta, ainda assim, com o predomnio

226
Figura 4. Riqueza especfica dos grupos fitoplanctnicos (n espcies) nas estaes de coleta distribudas na sub-bacia do
mdio Rio Tiet/Jacar, estado de So Paulo, Brasil.

CAPTULO 19
Seo 5

Tabela III. Composio de espcies do fitoplncton/cianobactrias nas estaes de coleta distribudas na sub-bacia do
mdio Rio Tiet/Jacar, estado de So Paulo, Brasil.

E1
CHLOROPHYTA
Chlorophycea

Zygnematophyceae

CYANOPHYTA
Cyanophyceae

DINOPHYTA
Dinophyceae

EUGLENOPHYTA
Euglenophyceae

HETEROKONTOPHYTA
Bacillariophyceae

Chlorella sp.
Kirchneriella lunaris
Monoraphidium sp.
Oedogonium sp.
Pediastrum duplex
Scenedesmus obliquus
Scenedesmus quadricauda
Sphaerocystis sp.
Volvox aureus

Cosmarium contractum
Cosmarium punctulatum
Closterium sp.
Eudorina elegans
Micrasterias sp.
Staurastrum gracile
Staurodesmus sp.

Anabaena cf. crassa


Aphanizomenon cf. gracile
Aphanocapsa cf. incerta
Aphanothece minutissima
Chroococcus sp.
cf. Cylindrospermopsis raciborskii
cf. Gomphosphaerium
cf. Heteroleibleinia
Lyngbya sp.
Microcystis aeruginosa
Microcystis cf. botrys
Microcystis cf. novacekii
Microcystis cf. protocystis
Oscillatoria sp.
Planktothrix sp.
Synechococcus cf. elongatus

Dinoflagelado 1

Phacus sp.

Asterionella formosa
Aulacoseira granulata
Cyclotella sp.
Gomphonema sp.
Melosira varians
Navicula sp.
Nitzschia palea
Pinnularia gibba
Pleurosira laevis
Surirella tenera
Synedra sp.
Tabellaria sp.
Diatomcea 1

E2

E3

E4

E5

E6

E7

E8

x
x
x
x

x
x

x
x

x
x
x

x
x

x
x
x

x
x
x
x

x
x

x
x

x
x
x

x
x

x
x
x

x
x
x
x

x
x
x
x
x
x

x
x
x
x
x
x
x

x
x

x
x

x
x

x
x
x
x
x
x
x
x

227

x
x
x
x
x
x

x
x
x

x
x

x
x

x
x
x
x

x
x
x
x

x
x

x
x

x
x
x

x
x

x
x

Distribuio espacial do mexilho-dourado na bacia do


mdio Rio Tiet/Jacar, Estado de So Paulo, Brasil:
relao com moluscos lmnicos, fitoplncton e qualidade da gua
Pereira et al.

do grupo das cianobactrias. No estado de So


Paulo, desde o final da dcada de 1990, tem sido
constatada a ocorrncia frequente de floraes
de cianobactrias nos reservatrios do Rio Tiet, acompanhadas de considerveis mudanas na
composio e estrutura das comunidades planctnicas (Calijuri et al., 2002; Matsumura-Tundisi et al., 2006). Estudos recentes revelam a dominncia das espcies dos gneros Microcystis e
Anabaena nos primeiros reservatrios do mdio

Tiet e aquelas dos gneros Cylindrospermopsis


e Raphidiopsis nos reservatrios do baixo Rio
Tiet (Takenaka, 2007). Outro estudo, no mdio e baixo Tiet, registrou que as cianofceas
ocorreram em maior frequncia e abundncia
em relao s demais classes fitoplanctnicas,
com a presena de espcies txicas dos gneros
Microcystis, Anabaena, Cylindrospermopsis, Raphidiopsis e Planktothrix em todas as amostras
analisadas (Minillo, 2005).

Figura 5. Densidade absoluta (cl.mL-1) dos grupos fitoplanctnicos nas estaes de coleta distribudas na sub-bacia do mdio
Rio Tiet/Jacar, estado de So Paulo, Brasil.

228
Figura 6. Abundncia relativa (%) dos grupos fitoplanctnicos nas estaes de coleta distribudas na sub-bacia do mdio Rio
Tiet/Jacar, estado de So Paulo, Brasil.

CAPTULO 19
Seo 5


A anlise quali-quantitativa da comunidade fitoplanctnica permite identificar as espcies dominantes e abundantes ocorrentes nos
reservatrios de Ibitinga e Bariri, nas diferentes
estaes de coleta (Fig. 8). As espcies dominantes registradas so Microcystis aeruginosa,
Oscillatoria sp. e Synechococcus cf. elongatus,
todas pertencentes s cianobactrias. A espcie M. aeruginosa a nica espcie dominante
nas estaes de coleta E1, E2, E6, E7 e E8. A
espcie Oscillatoria sp. foi dominante nas estaes de coleta E3 e E4, sendo que nesta ltima,
M. aeruginosa registrada como abundante. E
a estao de coleta E5, teve a presena de S. cf.
elongatus como espcie dominante.

A anlise da variao espacial da comunidade fitoplanctnica permite identificar a
ocorrncia predominante das cianobactrias
nos Reservatrios de Ibitinga e Bariri, tanto em
riqueza, quanto em densidade. A dominncia
das cianobactrias demonstrou o grau de eutrofizao do reservatrio e a possibilidade da
ocorrncia de floraes produtoras de toxinas.
A ocorrncia de floraes est mais relacionada
aos perodos de vero e primavera, ocorrendo
em menores densidades nos perodos de outono e inverno.

Com base na anlise de correlao bivariada (Spearmans rho) so verificadas as
seguintes correlaes significativas entre o
mexilho-dourado e o fitoplncton: densidade

populacional nas macrfitas (recrutas e adultos) versus Microcystis (r=0,522; p=0,026);


versus Chlorophyta (r=0,839; p<0,0001);
versus Cyanophyta (r=0,812; p<0,0001); versus Dynophyta (r=0,536; p=0,022); densidade populacional no bentos (sedimento) versus
Chlorophyta (r=0,490; p=0,024), versus Cyanophyta (r=0,570; p=0,007); Heterokontophyta (r=0,734; p<0,0001); densidade populacional larvas no plncton versus Cyanophyta
(r=0,436; p=0,033); versus Heterokontophyta
(r=0,483; p=0,017).

As relaes entre o fitoplncton e o mexilho-dourado so pouco conhecidas. Este
bivalve filtrador, como qualquer outro bivalve,
utiliza o material em suspenso na gua (particulado orgnico, plncton, etc.), em sua alimentao. No entanto pouco se sabe sobre a
composio de sua dieta e sobre o seu papel
como consumidor na cadeia trfica. Em condies de laboratrio, Silva (2006) observou
que em contato com alimentao adequada
(Chlorella sp., Chlorophyta; Spirulina sp., Cyanophyta; e Scenedesmus sp., Chlorophyta), L.
fortunei pode aumentar sua massa corprea em
at 240% em 75 dias, enquanto que, espcimes
sem alimento podem resistir at 63 dias sem
incremento de peso. Provavelmente, as diferentes fases de vida do mexilho selecionem componentes diferenciados do plncton, quanto ao
tamanho e composio nutricional, em sua ali-

229

Figura 7. Espcies do fitoplncton dominantes/abundantes (abundncia relativa %) nas estaes de coleta distribudas na sub-bacia do mdio Rio Tiet/Jacar, estado de So Paulo, Brasil.

Distribuio espacial do mexilho-dourado na bacia do


mdio Rio Tiet/Jacar, Estado de So Paulo, Brasil:
relao com moluscos lmnicos, fitoplncton e qualidade da gua
Pereira et al.

mentao, de acordo com a disponibilidade no


ambiente e nos micro-habitats.

A Tabela III apresenta o enquadramento
da gua em classes de qualidade conforme CONAMA (2005), resoluo n 357. Os valores
verificados de fsforo total no presente estudo
so comparveis aos valores apresentados por
Thomaz (2006), para o trecho do Rio Tiet entre a UHE Ibitinga e Bariri. De modo geral, a
qualidade da gua pior montante de Ibitinga, Estaes de E4 a E8.

A concentrao de microcistinas na gua
dos reservatrios estudados varia de 0 a 1,8
g.L-1 (Fig. 8) e podem ser consideradas baixas,
visto que a concentrao de cianobactrias no
perodo amostrado tambm foi baixa, no sendo registrado nenhum evento de florao. As
concentraes de microcistinas nas floraes
de cianobactrias nos reservatrios do Tiet podem chegar em torno de 138 g.g-1 de material
algal liofilizado, e seus extratos brutos podem
ser txicos a cladceros e camundongos (Rocha, 2008). Estudo recente no baixo e mdio
Tiet, detectou microcistinas na maioria dos
reservatrios, com concentraes elevadas que
variaram de 2,17 a 150 g.L-1 (Minillo, 2005).
A toxicidade das floraes do Tiet para a biota vem sendo observada atravs de bioensaios
com camundongos e cladceros (Sotero-Santos
et al., 2006; Takenaka et al., 2007). A toxicidade destas floraes para o mexilho-dourado
ainda desconhecida. A cianobactria M. aeruginosa foi a espcie dominante nas estaes de
coleta em que se detectou microcistinas. Esta

espcie de ampla distribuio, e reconhecidamente produtora de microcistinas, sendo


assim a principal responsvel pelas toxinas na
gua dos reservatrios, no perodo amostrado.
uma cianobactria comum nos reservatrios
tropicais eutrficos e frequentemente responsvel pelas floraes, sendo tambm uma indicadora de baixa qualidade da gua.

A estao de coleta 3 teve a cianobactria S. cf. elongatus como dominante. Esta
espcie reconhecida como no produtora
de toxinas, o que justifica o resultado obtido
para esta estao (Fig. 8). J a estao de coleta E5, foi caracterizada pela dominncia de
Oscillatoria sp. Esta cianobactria no produz microcistinas, corroborando o resultado
para esta estao de coleta. A Oscillatoria
produtora de anatoxina-a, uma neurotoxina,
que no foi avaliada no presente estudo.
Estudos no Tiet demonstraram a ocorrncia
de diversas cianotoxinas, principalmente para
as neurotoxinas, com a presena de diferentes
variantes no grupo das toxinas paralticas:
saxitoxinas, neosaxitoxinas e goniautoxinas
(Takenaka, 2007). Desta forma, salienta-se
a importncia de avaliar a concentrao de
neurotoxinas em pesquisas futuras nestes
reservatrios, devido ocorrncia do gnero
como dominante.

Com base na anlise de correlao bivariada (Spearmans rho) foram verificadas as
seguintes correlaes positivas entre o mexilho-dourado e as variveis da qualidade da
gua (Tab. IV): densidade populacional nas

230
Figura 8. Concentrao de microcistinas (g.L-1) nas estaes de coleta distribudas na sub-bacia do mdio Rio Tiet/Jacar,
estado de So Paulo, Brasil.

CAPTULO 19
Seo 5

macrfitas (recrutas e adultos) versus condutividade (r=0,436; p=0,048); versus nitrato


(r=-0,471; p=0,031); versus slidos suspensos
totais (r=-0,543; p=0,011); versus turbidez
(r=0,564; p=0,008); densidade populacional no bentos (recrutas e adultos) versus condutividade (r=0,524; p=0,026); versus pH
(r=0,635; p=0,05); versus turbidez (r=-0,728;
p=0,01); versus temperatura da gua (r=0,532;
p=0023); larvas no plncton versus turbidez
(r=-0,447; p=0,029); versus nitrognio amoniacal (r=-0,525; p=0,008).

O teor de slidos totais suspensos um
fator determinante no processo de filtrao dos
bivalves lmnicos, auxiliando na incorporao
de metais presentes no meio aqutico (Callil &
Junk, 1999). Em parte, as correlaes verificadas entre as densidades do mexilho-dourado
no plncton, macrfitas e bentos (sedimento)
corroboram estudo anterior (Mansur et al.,
2008c) referente ao monitoramento (variao
espacial e temporal) do mexilho-dourado
e variveis ambientais no delta do Rio Jacu,
Rio Grande do Sul, que demonstrou: correlao positiva e significativa para os mexilhes
incrustados em substrato artificial versus condutividade; correlao negativa e significativa
para as larvas de mexilhes no plncton versus nitrognio amoniacal. Cabe ressaltar que
a presente anlise de ordem espacial. O monitoramento continuado desta bacia poderia
explicar melhor a relao entre a dinmica populacional do mexilho-dourado e as variveis
ambientais.

Por meio da CCA (Fig. 9), os eixos 1
(50,7%) e 2 (16,9%) respondem 67,5% da varincia dos dados de densidade larval do mexilho-dourado, fitoplncton, cianobactrias e
cianotoxinas ao longo das estaes de coleta na
bacia do Rio Tiet. Esta ordenao demonstra
um claro gradiente espacial que distingue as estaes de coleta 1 e 2 das demais, assim como
dentre as demais, pode ser verificado a diferenciao das estaes 3 e 4, das estaes de coleta
5, 6, 7 e 8.

As estaes 5 a 8 representam espcies
fitoplanctnicas de ocorrncia exclusiva nestes locais, com baixa densidade e representatividade. Estas estaes localizam-se mais
montante recebendo, portanto, menor carga de
nutrientes. O suprimento de nutrientes, espe-

cialmente o fsforo, fundamental, pois regula


o crescimento do fitoplncton. Nas Estaes de
Coleta 5 e 6, o mexilho-dourado est presente
no bentos, tanto sobre substratos duros, quanto
no aguap. No entanto, a densidade de larvas
foi muito baixa. A qualidade da gua comprometida pela baixa concentrao de oxignio
dissolvido, principalmente na estao 6. As estaes 7 e 8 tm qualidade de gua semelhante,
especialmente baixa concentrao de oxignio
dissolvido e elevada condutividade. Na E7 a
densidade larval elevada. As estaes de coleta 1 e 2 apresentam baixa riqueza fitoplanctnica e densidades mais elevadas, com a dominncia da cianobactria M. aeruginosa. Na E1,
as diatomceas tiveram sua maior representatividade em termos de densidade. Nas Estaes
de coleta 3 e 4 ocorre dominncia da cianobactria Osillatoria sp. Na E4, as clorofceas
tm sua maior representatividade em termos de
densidade. O Teste de Monte Carlo demonstra
correlao alta (Eixo 1, r=0,99 e p=0,01; Eixo
2, r=0,94 e p=0,01) e significativa entre matrizes de densidades de organismos e variveis de
qualidade da gua (variao espacial).

As reas que apresentam maior densidade larval, de recrutas e adultos esto prximas e
montante das represas. O mexilho-dourado
demonstra alta capacidade invasiva e dominncia na rea. Comparando os dados de densidade levantada em perodos anteriores observa-se
que o gastrpode invasor Melanoides tuberculata que predominava em abundncia na rea,
aparentemente ainda no sofreu reduo em
sua populao, porm superado em muitas
vezes pela do mexilho-dourado. No diagnstico apresentado, as amostragens quantitativas
no revelam espcies de bivalves nativos. Um
nico exemplar de Diplodon paulista se encontrava nas margens do reservatrio. O bivalve
invasor C. fluminea, por preferir um substrato
diferente ao do mexilho-dourado, qual seja,
o sedimento arenoso do fundo no qual se enterra, provavelmente no esteja ainda sofrendo
com a presena competitiva do mexilho-dourado. A relao entre as densidades do mexilho (larvas e adultos) e os grandes grupos de
txons que compem o fitoplncton, indicam
possveis e estreitas relaes trficas entre estes
organismos, que atuam nos processos ecolgicos do meio aqutico. Sugere-se para pesquisas

231

Distribuio espacial do mexilho-dourado na bacia do


mdio Rio Tiet/Jacar, Estado de So Paulo, Brasil:
relao com moluscos lmnicos, fitoplncton e qualidade da gua
Pereira et al.

Figura 9. Ordenao (CCA) das estaes de coleta (E1 a E8), com os dados de biota aqutica e qualidade da gua. Chlorella sp.
(sp1); K. lunaris (sp2); Monoraphidium sp. (sp3); Oedogonium sp. (sp4); P. duplex (sp5); S. obliquus (sp6); S. quadricauda (sp7);
Sphaerocystis sp. (sp8); V. aureus (sp9); C. contractum (sp10); C. punctulatum (sp11); Closterium sp. (sp12); E. elegans (sp13);
Micrasterias sp. (sp14); S. gracile (sp15); Staurodesmus sp. (sp16); A. cf. crassa (sp17); A. cf. gracile (sp18); A. cf. incerta (sp19);
A. minutissima (sp20); Chroococcus sp. (sp21); cf. C. raciborskii (sp22); cf. Gomphosphaerium (sp23); cf. Heteroleibleinia (sp24);
Lyngbya sp. (sp25); M. aeruginosa (sp26); M. cf. botrys (sp27); M. cf. novacekii (sp28); M. cf. protocystis (sp29); Oscillatoria
sp.(sp30); Planktothrix sp. (sp31); S. cf. Elongatus (sp32); Dinoflagelado 1 (sp33); Phacus sp. (sp34); A. formosa (sp35); A. granulata (sp36); Cyclotella sp. (sp37); Gomphonema sp. (sp38); M. varians (sp39); Navicula sp. (sp40); N. palea (sp41); P. gibba (sp42);
P. laevis (sp43); S. tenera (sp44); Synedra sp. (sp45); Tabellaria sp. (sp46); Diatomcea 1 (sp47).

232

futuras o estudo da dieta alimentar da invasora, seus mecanismos de filtrao, bem como
as relaes trficas em nvel experimental de
microcosmo. Com exceo das estaes 3 e 5,
tributrios do Rio Tiet, todas as demais apresentam cianobactrias produtoras de microcistinas. Em poca de floraes de cianobactrias,
as toxinas podem tambm conferir risco aos
animais silvestres e domsticos por meio de in-

gesto da gua contaminada. A baixa densidade de larvas do mexilho-dourado na estao


de coleta 8 pode estar relacionada com as concentraes mais elevadas de microcistinas neste
local (1,8 g.L-1), que poderiam estar em nveis
de toxicidade para as larvas do bivalve invasor.
Na poca avaliada (outono) no apresenta florao, como verificada visualmente na estao
anterior, o vero. Aps a diminuio das cia-

CAPTULO 19
Seo 5

nobactrias, os mexilhes recrutaram todos os


substratos naturais da rea. As macrfitas consistem num estoque de mexilhes recrutas com
potencial de incrustao. Fica recomendado o

monitoramento permanente do mexilho-dourado e de cianobactrias no trecho estudado,


com a finalidade de subsidiar o manejo das populaes do invasor e das cianobactrias.

Tabela IV. Qualidade da gua nas estaes de coleta distribudas na sub-bacia do mdio Rio Tiet/Jacar, estado de So Paulo,
Brasil. Classes de qualidade da gua (C1, C2 e C3) conforme resoluo 357 do CONAMA.

Variveis

Estaes de Coleta

Temperatura do ar (C)
Temperatura da gua (C)
Oxignio Dissolvido
pH
Slidos Suspensos Totais (mg/L)

E1

E2

E3

E4

E5

E6

E7

E8

22

18

20

20

25

18

23

23

22

22

22

20

22

21

22

22

6.14
(C1)

6.18
(C1)

6.47
(C1)

4.12
(C3)

3.8
(C3)

3.66
(C3)

4.68
(C3)

3.88
(C3)

7.19
(C1)

7.11
(C1)

7.45
(C1)

6.87
(C1)

6.67
(C1)

7.32
(C1)

7.22
(C1)

7.25
(C1)

24

11

Condutividade

140

156

147

49

35

168

143

173

Turbidez (UTN)

1.58
(C1)

1.75
(C1)

2.00
(C1)

11.58
(C1)

6.08
(C1)

3.66
(C1)

2.22
(C1)

2.96
(C1)

Fsforo total (mg/L)

0.022
(C1)

0.022
(C2)

0.01
(C1)

0.126
(C2)

0.01
(C1)

0.033
(C1)

0.038
(C1)

0.048
(C3)

Nitrognio Amoniacal (mg/L)

0.1

0.2

0.1

0.2

0.63

0.1

0.1

0.1

Nitrognio Total (mg/L)

2.0
(C1)

2.0
(C1)

2.0
(C1)

4.0
(C1)

2.0
(C1)

2.6
(C1)

2.5
(C1)

2.5
(C1)

Enquadramento

(C1)

(C2)

(C1)

(C3)

(C3)

(C3)

(C3)

(C3)

233

CAPTULO 20
Efeito do macrofouling
sobre a comunidade
de invertebrados aquticos
Vera Uhde
Edson V. Massoli Jr.
Claudia T. Callil


Ao longo dos vinte anos de invaso de
Limnoperna fortunei (Dunker, 1857) na Amrica do Sul, muitos esforos tm sido empregados para monitorar a disperso (Pastorino et
al., 1993; Mansur et al., 2003; Darrigran &
Damborenea, 2005; Darrigran et al., 2007;
Oliveira, 2009) e os impactos causados nos diferentes ecossistemas invadidos (Boltovskoy et
al., 2006; Sylvester et al., 2007b; Sardia et al.,
2008; Maral & Callil, 2008 e Darrigran &
Damborenea, 2011).

A magnitude dos impactos do mexilho-dourado no ambiente est relacionada
com o tamanho populacional e a suscetibilidade
do sistema invaso (Hicks, 2004). As densidades so altas no incio da invaso e, com o tempo, vo reduzindo at alcanar um equilbrio
estvel (Mansur et al., 2003). A atividade de
filtrao exercida por L. fortunei afeta diretamente atributos fsicos da coluna dgua como
fluxo (Boltovskoy et al., 2006), transparncia
e penetrao de luz (Sylvester et al., 2005; Boltovskoy et al., 2009b). O sedimento recebe um

aporte de matria orgnica proveniente da atividade de filtrao e deposio de partculas


(Ricciardi et al., 1997; Boltovskoy et al., 2006,
2009b) e os diferentes substratos ocupados por
L. fortunei tornam-se mais heterogneos, atravs da criao de novos micro-habitats intersticiais entre as valvas, possibilitando proteo
contra predadores e maximizao da utilizao
do espao (Sylvester et al., 2007b; Sardia et
al., 2008).

As modificaes fsicas observadas na
coluna dgua, no sedimento e nos substratos
afetam indiretamente as comunidades biolgicas (Darrigran & Damborenea, 2011). Cataldo
& Boltovskoy (2000) relatam que a comunidade de algas pode ser afetada de forma positiva ou negativa. A maior penetrao de luz na
coluna dgua pode promover um aumento na
densidade de populaes fitoplanctnicas e no
crescimento de plantas submersas (Boltovskoy
et al., 2009b). Por outro lado, a atividade de
filtrao de densas populaes de L. fortunei
pode tambm diminuir a quantidade de fito-

235

Efeito do macrofouling sobre a comunidade


de invertebrados aquticos
Uhde et al.

plncton na coluna dgua que pode ser convertido em biomassa ou ainda ser depositado
no substrato por meio das fezes e pseudofezes
(Fig. 1).

A introduo de L. fortunei no Rio Paraguai ocorreu em 1999, atravs da navegao
fluvial, que age como dispersor de adultos e
larvas planctnicas em rios e lagos no Pantanal
(Mansur et al., 2004c; Oliveira et al., 2006).
Por conta da pouca disponibilidade de substratos duros no Pantanal, o mexilho-dourado
utiliza razes e estoles de macrfitas aquticas
para se fixar (Maral & Callil, 2008). A arquitetura e o habitat formado pelas razes das macrfitas aquticas favorecem o crescimento de
perifton (Toft et al., 2003; Poi de Neiff & Neiff,
2006) e aumentam a complexidade estrutural
na regio litornea de lagoas, que abriga os invertebrados nativos e o bioinvasor L. fortunei
(Oliveira et al., 2006).

O interesse em entender o efeito da presena de L. fortunei na estrutura da comunidade de invertebrados, associado a macrfitas
aquticas flutuantes no Pantanal, motivou o
desenvolvimento do estudo de Maral & Callil
(2008) em lagos rasos adjacentes ao Rio Paraguai, MT. Desta maneira, discutiremos os resultados de Maral & Callil (2008) juntamente
com Darrigran et al. (1998a) referentes ao efeito

Figura 1. Fluxograma ilustrando os efeitos de L. fortunei


sobre as comunidades aquticas na coluna dgua e no
sedimento.

236

de L. fortunei sobre a comunidade de invertebrados aquticos. Traaremos um paralelo com


os dados disponveis na literatura para Dreissena polymorpha, uma vez que, as informaes
disponveis para o mexilho-zebra podem ser
utilizadas para prever impactos causados pelo
mexilho-dourado. Embora os mecanismos
impostos por cada espcie sejam similares, o
resultado final dentro da comunidade pode ser
bem diferente, dependendo das restries do
ecossistema e das espcies que compe a comunidade (Boltovskoy et al., 2006).


Interferncia do macrofouling na

comunidade de invertebrados
aquticos
Nematoda

Nematdeos de vida livre so muito
abundantes e diversos nos sistemas aquticos,
alm de estarem presentes em todos os tipos
de habitats lmnicos (Abebe et al., 2008). Em
locais com presena do mexilho-dourado este
grupo beneficiado e aumenta sua densidade,
como observado por Darrigran et al. (1998a)
e Maral & Callil (2008) (Fig. 2A). O mesmo
efeito positivo sobre os nematdeos tambm
pode ser observado em locais invadidos pelo

CAPTULO 20
Seo 5

mexilho-zebra (Dreissena polymorpha) (Zaiko et al., 2009) (Fig. 2A). Este aumento significativo na densidade mdia dos nematdeos
pode estar relacionado maior quantidade de
matria orgnica e bactrias associadas s fezes
e pseudofezes depositadas pelos mexilhes sobre a superfcie do sedimento (Dermott & Kerec, 1997), alm de outros fatores especficos
inerentes a cada local invadido (Radziejewska
et al., 2009).

Annelida
Oligochaeta

A Classe Oligochaeta, juntamente com
as larvas de Chironomidae, so os principais
componentes da fauna de invertebrados, em
diferentes tipos de habitats que compe as comunidades bentnicas em ambientes lnticos e
lticos (Harman, 1982).

No Rio de La Plata, Argentina, a densidade mdia de Oligochaetas aumentou significativamente com a presena de L. fortunei
(Darrigran et al., 1998a), enquanto que em lagoas marginais ao Rio Paraguai nenhum efeito
foi observado, a densidade mdia de Oligochaetas entre locais invadidos no apresentou uma
variao expressiva (Maral & Callil, 2008)
(Fig. 2B). Estudos realizados com Dreissena
polymorpha demonstram relaes positivas
(Atalah et al., 2010; Ricciardi et al., 1997) e
neutras (Zaiko et al., 2009) do mexilho-zebra
com a densidade de Oligochaeta (Fig. 2B).

O efeito positivo do mexilho-dourado
sobre a densidade de Oligochaetas atribudo
biodeposio de nutrientes atravs das fezes e
pseudofezes (Ricciardi et al., 1997). A atividade de filtrao remove grandes quantidades de
matria orgnica particulada da coluna dgua e
as depositam no sedimento, aumentando a fonte de alimentao para Oligochaetas (Sephton
et al., 1980; Gonzalez & Downing, 1999).
Outro fator que contribui para favorecimento
dos Oligochaetas a baixa disponibilidade de
oxignio nos espaos intersticiais das conchas,
devido decomposio bacteriana dos biodepsitos (Darrigran & Damborenea, 2011).

Estudos que demonstraram relaes
neutras entre a presena do invasor e a densidade de Oligochaetas atribuem esse resultado

ao comportamento especfico de cada espcie


(Karatayev et al., 2010). Influncias antropognicas tambm podem afetar a densidade de
Oligochaetas. Nalepa et al. (2003) argumentam que os efeitos do mexilho-zebra nos Oligochaetas so insignificantes em comparao
com os efeitos do nvel de fsforo na gua.
Hirudinea

Hirudinea uma classe representante
do filo Annelida, formada predominantemente
por invertebrados de gua doce, que podem ser
encontrados em todo o mundo (Klemm, 1972).
Nos locais invadidos pelo mexilho-dourado e
mexilho-zebra a densidade mdia dos hirudneos aumenta (Fig. 2C). Esse efeito est correlacionado com o aumento da abundncia de
invertebrados nas agregaes de mexilhes, o
que gera, consequentemente, o aumento da disponibilidade alimentar das espcies carnvoras,
como os hirudineos (Zaiko et al., 2009).

Mollusca
Gastropoda

Os gastrpodes correspondem maior e
mais bem sucedida classe dentro do filo Mollusca, principalmente pela grande variedade de
habitats que ocupam e papis funcionais que
desempenham (Meier-Brook, 1984). Em locais
invadidos por mexilho-dourado foram observados diferentes efeitos sobre a densidade da
classe Gastropoda. Darrigran et al. (1998a), em
estudo realizado no Rio de La Plata, observou
uma relao positiva entre mexilho-dourado e
gastrpodes. J Maral & Callil (2008) no Pantanal, demonstraram uma relao negativa. Em
estudos realizados com o mexilho-zebra, tambm foram registrados efeitos positivos (Horvath et al., 1999; Mrtl & Rothhaupt, 2003) e
negativos (Zaiko et al., 2009) (Fig. 2D).

Os diferentes efeitos nas densidades,
tanto na presena de mexilho-dourado como
para mexilho-zebra, podem estar relacionados com os papis funcionais de cada espcie
de gastrpode. Physella sp. (Pulmonata; Physidae) alimenta-se principalmente como um
raspador, sendo beneficiada com a presena
do mexilho, que estimula o crescimento de

237

Efeito do macrofouling sobre a comunidade


de invertebrados aquticos
Uhde et al.

algas atravs de claridade da gua. Darrigran


et al. (1998a) tambm registraram que algumas
espcies endmicas, como Gundlachia concentrica (Ancylidae) e Chilina fluminea (Chilinidae), que eram abundantes antes da invaso,
diminuiram em nmeros ao longo do tempo,
enquanto Heleobia piscium (Cochiolidae) aumentou em proporo direta com a densidade
de L. fortunei.
Bivalvia

Em relao aos demais bivalves, nas lagoas marginais ao Rio Paraguai invadidas por
L. Fortunei, a densidade apresentou um discreto aumento (Fig. 2E). Em locais invadidos por
Dreissena polymorpha, podemos observar que
ocorreu tanto efeito positivo como negativo
sobre outros bivalves (Fig. 2E). A reduo na
abundncia de bivalves tem sido geralmente registrada (Ward & Ricciardi, 2007; Zaiko et al.,
2009) na presena de mexilhes-zebra. Segundo Karatayev et al. (2007a) os unionoides ligados com mexilho-zebra podem ter dificuldade de enterrar e movimentar a concha atravs
do sedimento ou, ainda, abrirem suas conchas
para a respirao, alimentao e reproduo. A
ligao dos mexilhes pode impedir os Unionoides de abrir suas conchas para a respirao,
alimentao e reproduo.
Crustacea

238


Os microcrustceos planctnicos so representados neste trabalho pelos grupos Amphipoda, Cladocera, Copepoda e Isopoda. A
presena de L. fortunei provocou apenas uma
leve reduo na densidade destes microcrustceos (Fig. 3A), enquanto que, na presena de
Dreissena polymorpha, ocorreu sempre um
efeito positivo, com aumento da densidade
(Mrtl & Rothhaupt, 2003; Zaiko et al., 2009;
Atalah et al., 2010) (Fig. 3A).

A maior complexidade estrutural do habitat, gerada pela presena dos mexilhes, proporciona aos microcrustceos maior chance de
fugir da predao, j que fazem parte da dieta
de vrios outros organismos e, desta forma, aumentam suas densidades (Beekey et al., 2004).
Gonzalez & Downing (1999) argumentam que
Gammarus roeseli (Amphipoda) tambm be-

neficiado pela biodeposio de D. polymorpha,


portanto, o aumento da matria orgnica tambm afeta a densidade destes organismos.
Insecta

A classe Insecta ou Hexapoda, que contm mais de 750.000 espcies descritas o maior
grupo de animais no mundo. Embora sejam essencialmente animais terrestres, os insetos tambm ocupam habitats aquticos, principalmente
na fase imatura (Ruppert & Barnes, 1996).
Chironomidae

As larvas da famlia Chironomidae possuem elevada diversidade e densidade em ecossistemas de gua doce, participando significativamente na composio da biota aqutica
(Callil & Cruz, 2009). Em locais invadidos
pelo mexilho-dourado a densidade de larvas
de Chironomidae no variou (Darrigran et al.,
1998a) ou at sofreu efeito negativo (Maral &
Callil, 2008) (Fig. 3B). Enquanto que na presena do mexilho-zebra o efeito na densidade
de larvas de Chironomidae foi sempre positivo
(Fig. 3B).

O aumento na densidade de larvas de
Chironomidae pode ser determinado pela menor capacidade de forageamento dos peixes,
devido maior complexidade estrutural do
local (Beekey et al., 2004). Assim como os microcrustceos que possuem maior chance de
fugir dos predadores, as larvas de Chironomidae, como Chironomus, tambm encontram refgio entre as conchas e acabam beneficiadas.
Para Botts et al. (1996) e Mrtl & Rothhaupt
(2003) o aumento da densidade pode estar relacionado maior fonte de alimentao gerada
pela biodeposio das fezes e pseudofezes do
mexilho-zebra.

Coleoptera



Os colepteros aquticos ocupam uma
ampla variedade de ambientes aquferos, incluindo lagos, riachos e esturios (Benetti et
al., 1998). Nas lagoas marginais ao Rio Paraguai, invadidas por L. fortunei, a densidade de
colepteros sofreu efeito negativo, diminuindo significativamente (Maral & Callil, 2008)

CAPTULO 20
Seo 5

239

Figura 2. Variao na densidade mdia de invertebrados aquticos em locais invadidos e no invadidos por Limnoperna fortunei e
Dreissena polymorpha. A = Nematoda, B = Oligochaeta, C = Hirudinea, D = Gastropoda, E = Bivalvia. Os nmeros representam
as fontes dos dados: 1 = Darrigran et al. (1998), 2 = Maral & Callil (2008), 3 = Atalah et al. (2010), 4 = Horvath et al. (1999), 5
= Mrtl & Rothhaupt (2003), 6 = Zaiko et al. (2009), 7 = Ricciardi et al. (1997). Os valores de densidade foram logaritmizados
para permitir a comparao entre as fontes de dados.

Efeito do macrofouling sobre a comunidade


de invertebrados aquticos
Uhde et al.

(Fig. 3C). Ao contrrio, a ordem Coleoptera


parece ser beneficiada com a invaso de D.
polymorpha, tanto Horvath et al. (1999) quanto Zaiko et al. (2009) registraram a presena
de colepteros somente depois da presena do
mexilho-zebra (Fig. 3C).

Ephemeroptera



As ninfas de Ephemeroptera habitam
principalmente rios de regies tropicais e
subtropicais (Tundisi & Tundisi, 2008), e so
comumente utilizadas como indicadores ambientais, devido sua exigncia por guas bem
oxigenadas (Callil & Cruz, 2009). Sua densidade mdia no varia com a presena ou ausncia
do bioinvasor L. fortunei (Fig. 3D). Enquanto
que na presena de D. polymorpha, larvas de
Ephemeroptera sofrem efeito positivo, aumentando sua densidade mdia (Fig. 3D).

Ninfas de Ephemeroptera so raspadoras
de superfcie (Tundisi & Tundisi, 2008), desta
maneira, podem ser beneficiadas com a presena do mexilho-zebra, que altera a disponibilidade de nutrientes nos habitats, por deposio
de fezes e pseudofezes (Mrtl & Rothhaupt,
2003). A depurao dos nutrientes de mexilho-zebra tambm pode conseguir estimular
o crescimento de perifton e assim atrair raspadores (Ricciardi et al., 1997).

Trichoptera

240



Larvas de Trichoptera, assim como Ephemeroptera, so utilizadas como indicadoras ambientais, devido as suas exigncias por guas bem
oxigenadas. Uma caracterstica marcante deste
grupo a capacidade de construo de abrigos fixos, casas e tubos (Callil & Cruz, 2009). Na presena de L. fortunei diminuiu sua densidade mdia, sofrendo efeito negativo (Fig. 3E). Enquanto
que na presena de D. polymorpha o efeito foi
sempre positivo, aumentando a densidade mdia
de larvas de Trichoptera (Fig. 3E).

A densidade de larvas de Trichoptera
pode variar dependendo da influncia especfica de cada espcie. Grandes larvas, como
Polycentropodidae, so territoriais e evitam
receber gua previamente filtrada por seus vizinhos, dessa forma, competem com mexilhes
por posies timas no substrato (Ricciardi

et al., 1997). Por outro lado, pequenas larvas


podem ser beneficiadas ao explorar as correntes de filtrao do mexilho-zebra. Larvas
Brachycentrus orientam-se para a abertura anterior e ficam expostas corrente de filtrao
do mexilho-zebra; nesta posio, as larvas so
capazes de fazer a filtrao de particulas de alimentos recebidos (Ricciardi et al., 1997).

Consideraes Finais


A anlise da literatura disponvel sobre
a relao entre L. fortunei e a comunidade de
invertebrados aquticos mostra que os efeitos
podem ser positivos ou negativos dependendo
do grupo taxonmico considerado. A comparao entre os dados de L. fortunei em diferentes regies da Amrica do Sul e Dreissena
polymorpha na Amrica do Norte e Europa,
demonstra padres distintos de efeitos sobre a
comunidade de invertebrados aquticos.

Apesar da irregularidade dos efeitos, observamos um padro de favorecimento para os
grupos Nematoda, Annelida e Chironomidae
atribudo pela maioria dos autores ao incremento de matria orgnica oriunda das fezes e
pseudofezes, bem como o aumento da complexidade estrutural dos substratos causado pela
presena do macrofouling. Tal padro de favorecimento no observado para o estudo realizado por Maral & Callil (2008) em lagoas no
Pantanal.

Os efeitos divergentes observados para
L. fortunei no Pantanal podem estar associados
a fatores como o tempo de invaso, que menor em comparao as demais regies consideradas. Outro diferencial a disponibilidade sazonal das macrfitas aquticas, que constituem
o principal substrato para colonizao. Devido
a essas restries, a populao de mexilho tem
suas densidades limitadas, provavelmente minimizando os impactos sobre as comunidades
nativas.

Contudo, consideramos que a ao de L.
fortunei sobre as comunidades de invertebrados podem ocorrer de maneira muito varivel,
dependendo do comportamento e nicho trfico dos organismos que compe a comunidade, bem como a restries do ambiente para
o desenvolvimento da populao do invasor.
Destacamos ainda a necessidade da realizao

CAPTULO 20
Seo 5

de monitoramento contnuo da invaso de L.


fortunei na bacia do Alto Paraguai, bem como
estudos com delineamentos amostrais que per-

mitam identificar os efeitos especficos desse


invasor sobre diferentes nichos trficos dos sistemas.

241

Figura 3. Variao na densidade mdia de invertebrados aquticos em locais invadidos e no invadidos por Limnoperna fortunei
e Dreissena polymorpha. A = Crustacea, B = Chironomidae, C =Coleoptera, D = Ephemeroptera, E = Trichoptera. Os nmeros
representam as fontes dos dados: 1 = Darrigran et al. (1998), 2 = Maral & Callil (2008), 3 = Atalah et al. (2010), 4 = Horvath
et al. (1999), 5 = Mrtl & Rothhaupt l (2003), 6 = Zaiko et al. (2009), 7 = Ricciardi et al. (1997). Os valores de densidade foram
logaritmizados para permitir a comparao entre as fontes de dados.

CAPTULO 21
Limnoperna fortunei na bacia hidrogrfica do
baixo Rio Jacu: relaes com a comunidade
de macroinvertebrados bentnicos
Simone Caterina Kapusta
Suzana Maria Fagondes de Freitas


A espcie Limnoperna fortunei (Dunker,
1857), mexilho-dourado, introduzida na
Amrica do Sul em 1991 (Pastorino et al.,
1993), pode ser considerada como engenheira
do ecossistema, pois atravs de suas conchas,
dispostas na forma de aglomerados, cria novos
habitats, altera o ambiente natural, provocando o deslocamento de algumas espcies nativas e favorecendo o estabelecimento de outras
(Gutirrez et al., 2003; Darrigran et al., 2003).
Alm dos conhecidos prejuzos economia,
por ser de hbito epifaunal (Darrigran & Ezcurra de Drago, 2000a), estes organismos provocam mudanas na biodiversidade local, competindo por alimento e por espao, sufocando
bivalves nativos e servindo de substrato para algumas espcies de invertebrados (Darrigran et
al., 1998a; Mansur et al., 2008c). No entanto,
poucos so os estudos da sua influncia sobre a
macrofauna bentnica acompanhante (Fig. 1).

Para avaliar a estrutura da macrofauna
bentnica associada aos aglomerados de mexilho-dourado no Rio Jacu foram realizadas 12

campanhas amostrais, com frequncia quinzenal de abril a agosto de 2007 e mais duas campanhas com intervalos de tempo maiores, uma
coleta em outubro de 2007 e outra em janeiro
de 2008. As amostragens foram efetuadas em
uma boia de sinalizao de navegao fluvial,
localizada nas proximidades do lanamento
da gua de resfriamento da Usina Termeltrica
Charqueadas UTCH, no municpio de Charqueadas, RS, Brasil. Para comparaes com a
fauna dos aglomerados, foram obtidas amostras dos sedimentos no entorno da boia. Este
trabalho foi financiado com recursos do P&D
da TRACTEBEL ENERGIA/SUEZ/ANEEL.

Em cada campanha foram obtidas 3
amostras de aglomerados de mexilho-dourado, com um amostrador do tipo raspador.
Cada amostra foi colocada em uma bandeja e
delimitada a rea amostral de 100 cm2 (10 cm x
10 cm). As amostras foram fixadas com formol
10% e encaminhadas para processamento. Os
sedimentos no entorno foram amostrados com
o busca fundo do tipo Petersen modificado

243

Limnoperna fortunei na bacia hidrogrfica do


baixo Rio Jacu: relaes com a comunidade
de macroinvertebrados bentnicos
Kapusta & Freitas

com o esforo de trs pegadas. As amostras obtidas foram lavadas em campo, acondicionadas
em sacos plsticos, etiquetadas, fixadas com
formol 10% e processadas em laboratrio.

Para a anlise dos resultados, considerou-se a densidade mdia de indivduos de L.
fortunei e da macrofauna bentnica, por metro
quadrado (ind/m2), por ms amostrado. Para a
macrofauna associada a L. fortunei tambm foi
considerada a abundncia relativa (AR), sendo os txons classificados como: raros: <1%;
ocasionais: 1% e <10%; comuns: 10% e
<30%; abundante: 30% e <50% e dominante: 50%. Os txons tambm foram categorizados por meio da frequncia de ocorrncia (FO),
como acidental: FO <25%; acessrio: 25%
e <40%; constante/frequente: 40% e <60%
e muito frequente: FO 60%. Anlises de Varincia (ANOVA) unifatoriais foram efetuadas
para testar a significncia da densidade de organismos, transformada por log (x+1), entre

riao temporal da densidade de L. fortunei,


no esturio do Rio de La Plata, Argentina, entre os anos de 1991 a 2001, registraram pico
de 150.000 ind/m2 , em maro de 1995. Belz
(2006) estudando a densidade, recrutamento
e o crescimento de L. fortunei, no reservatrio da Usina Hidreltrica de Itaipu (Paran),
entre dezembro de 2004 a dezembro de 2005,
registrou as maiores densidades nos meses de
temperatura mais elevada (dezembro a maro),
e um declnio da mesma medida que se aproximam os meses mais frios. O autor observou
um crescente incremento na densidade de mexilhes, a partir do ms de agosto. No presente
estudo, ocorreu uma tendncia de aumento de
densidade em agosto, com uma diminuio em
outubro, quando se esperava uma maior densidade. Este declnio na densidade do mexilho-dourado, no ms de outubro, provavelmente
ocorreu devido s condies adversas de pluviosidade e temperatura, registradas neste perodo.

Figura 1. Densidade mdia de L. fortunei


e da macrofauna bentnica (ind/m2)
e desvio padro, por ms amostrado
(maro a outubro de 2007, janeiro de
2008), coletados no Rio Jacu, RS.

244

as campanhas amostrais. Quando a ANOVA


foi significativa, utilizou-se o teste de Tukey,
de comparao de mdias, para identificar as
diferenas. Para estas anlises foi utilizado o
programa Statistica 5.0.

As densidades de mexilho-dourado foram mais elevadas nos meses de maior temperatura (janeiro e maro), conforme j evidenciado por outros estudos (Darrigran et al., 2003;
Belz, 2006). A densidade em maro foi significativamente mais elevada do que a encontrada
de abril a outubro. A densidade nos meses de
junho, julho e outubro foram significativamente menores que as registradas em maro, abril e
janeiro.

Darrigran et al. (2003) analisando a va-


A densidade mdia da macrofauna bentnica em maro foi significativamente mais
elevada do que a encontrada em maio e julho. A
densidade em maio foi significativamente menor do que a de maro, agosto e janeiro (Fig.1).

A maior riqueza taxonmica da macrofauna bentnica, em termos absolutos, foi
observada nos aglomerados de L. fortunei, totalizando 23 famlias, enquanto que nos sedimentos foram registradas 15 famlias (Tab. I).

A dominncia das famlias foi diferenciada entre os substratos coletados no Rio Jacu, conforme pode ser visto nas Figuras 2 e
3. Darrigran et al. (1998a) documentaram mudanas da fauna de substratos no Rio de La Plata ocupados pelo mexilho-dourado, com um

CAPTULO 21
Seo 5

Tabela I. Presena (X) e ausncia (-) de famlias da macrofauna bentnica, associadas aos
aglomerados de L. fortunei e nos sedimentos, Rio Jacu, RS.

aumento significativo na riqueza e abundncia


de invertebrados no-moluscos (Oligochaeta,
Hirudinea, Chironomidae, dentre outros) e a
reduo em diversidade e nmero de espcies
de moluscos nativos.

Naididae foi classificada como dominante nos aglomerados de mexilho, no Rio Jacu,
Chironomidae e Oribatidae como comuns, Baetidae, Leptohyphidae e Cochliopidae como
ocasionais e as demais famlias como raras (Tab.
I). Chironomidae, Baetidae, Leptohyphidae,
Naididae e Oribatidae foram as famlias com

a maior frequncia de ocorrncia nas amostras


(FO 60%), sendo classificadas como muito
frequentes. Mansur et al. (2008c) observaram
a ocorrncia de invertebrados associados aos
macroaglomerados de L. fortunei sobre galhos
de sarandi na Praia do Veludo, Lago Guaba,
RS, e registraram as famlias Cochliopidae
como constante nas amostras e Lithoglyphidae
e Hyallelidae como acessrias, as demais foram
consideradas acidentais.

As diferenas na estrutura da comunidade associada ao mexilho quando comparada

Figura 2. Abundncia relativa das famlias da macrofauna bentnica, acompanhante de L. fortunei.

245

Limnoperna fortunei na bacia hidrogrfica do


baixo Rio Jacu: relaes com a comunidade
de macroinvertebrados bentnicos
Kapusta & Freitas

Figura 3. Abundncia relativa das famlias da macrofauna bentnica, registradas nos sedimentos.

com a comunidade associada ao sedimento de


fundo (Fig.3), caracterizam-se pela maior diversidade de txons da macrofauna associada
ao micro-habitat criado pela populao de L.
fortunei, bem como pela maior oferta de perifton, evidenciada principalmente nos meses mais
quentes. De acordo com Mansur et al. (2008c)
os macroaglomerados provavelmente oferecem
diversos recursos alimentares por meio da produo de pseudofezes, substrato para o perifton, acmulo de detritos e micro-organismos.
Torgan et al. (2009) consideram que a riqueza
de espcies de diatomceas encontrada sobre
as conchas de L. fortunei demonstra que este
molusco pode ser considerado como um habitat favorvel presena de vrias espcies, e

246

isso se deve provavelmente pela localizao dos


aglomerados prximos superfcie da gua, na
zona euftica, pela disponibilizao de nutrientes inorgnicos dissolvidos no prprio meio e
pelo suporte fixao das diatomceas perifticas.

Os resultados encontrados no presente
estudo esto corroborando os estudos acerca da
presena de L. fortunei nos ecossistemas aquticos, concluindo que estes organismos, so capazes de modificar a estrutura da comunidade
bentnica e, por conseguinte alterar a cadeia
trfica (Martin & Darrigran, 1994; Darrigran
et al., 1998a; Darrigran, 2002; Pelichotti et al.,
2002).

Seo
Efeito da filtrao de
bivalves invasores sobre a
comunidade planctnica

CAPTULO 22
O impacto de Limnoperna fortunei
sobre as cianobactrias
Vanessa Gazulha


Desde a invaso de Limnoperna fortunei
(Dunker, 1857) na Amrica do Sul, as pesquisas enfocaram principalmente aspectos relacionados sua distribuio espacial e temporal, ao
ciclo reprodutivo e ao desenvolvimento larval.
Os efeitos da filtrao do mexilho-dourado
na disponibilidade de nutrientes e na estrutura
das comunidades planctnicas ainda so pouco
conhecidos. O mexilho-dourado bastante semelhante ao bivalve invasor na Europa e Amrica do Norte Dreissena polymorpha, conhecido
como mexilho-zebra. Desta forma, bastante
provvel que os impactos ecolgicos que o mexilho-zebra promoveu na Europa e Amrica do
Norte tambm ocorram na Amrica do Sul com
o mexilho-dourado.

O mexilho-zebra tem a capacidade de
alterar a composio e a abundncia das comunidades planctnicas atravs da filtrao seletiva das partculas em suspenso. Alguns estudos
sugerem que a filtrao seletiva de D. polymorpha em ecossistemas com a presena de ciano-

bactrias poderia promover a ocorrncia de


floraes txicas (Vanderploeg et al., 2001).
Entretanto, os estudos a respeito dos efeitos
do mexilho-zebra sobre as densidades de cianobactrias e a ocorrncia de floraes txicas
so contraditrios. Alguns estudos observaram
o declnio das densidades de cianobactrias
(Bastviken et al., 1998, Dionisio-Pires & Van
Donk, 2002), enquanto outros demonstraram
efeito contrrio, onde a filtrao do mexilho-zebra promoveu o aumento das densidades de
cianobactrias (Vanderploeg et al., 2001, Nicholls et al., 2002).

A dominncia de cianobactrias em ecossistemas de gua doce um problema mundial,
especialmente naqueles sujeitos eutrofizao,
devido formao de floraes e produo de
toxinas, conhecidas como cianotoxinas. O tipo
mais comum de intoxicao envolvendo cianobactrias ocasionado pelas hepatotoxinas
(microcistinas e nodularinas), que agem sobre
o citoesqueleto das clulas provocando hemor-

249

O impacto de Limnoperna fortunei


sobre as cianobactrias
Gazulha, V.

ragias. A exposio crnica a doses no letais


de hepatotoxinas pode causar tumores no fgado, e consequentemente, trazer srios danos a
seres humanos e animais (Falconer, 1991; Carmichael, 1992).

O mexilho-dourado invasor na Amrica do Sul h mais de quinze anos, ocorrendo
sempre em densidades massivas que podem superar 140.000 ind m-2 (Darrigran & Mansur,
2006). As taxas de filtrao registradas para
L. fortunei so mais elevadas do que aquelas
registradas para outros bivalves invasores de
gua doce, como D. polymorpha, D. bugensis
e Corbicula fluminea. As elevadas taxas de filtrao do mexilho-dourado associadas s suas
densidades massivas indicam seu grande potencial para alterar a estrutura trfica dos ecossistemas invadidos.

Desta forma, pretende-se abordar o
comportamento alimentar e as taxas de filtrao do mexilho-dourado na presena
de cianobactrias txicas e no-txicas (Microcystis aeruginosa e Planktothrix sp.) e fitoplncton no-txico (Nitzschia palea e Monoraphidium sp.). O presente captulo apresenta
resultados referentes primeira avaliao dos
efeitos de cianobactrias txicas na alimentao e sobrevivncia do mexilho-dourado,
assim como as primeiras estimativas das taxas de filtrao das larvas deste bivalve invasor baseado em Gazulha (2010) e Gazulha et
al. (2012a, b).

250

Taxas de filtrao, ingesto


e produo de pseudofezes


Quando se trata de avaliar as taxas de
filtrao de bivalves importante deixar claro
as variaes existentes, pois fundamental
no momento de comparar resultados de
diferentes estudos. As taxas de filtrao (FR)
ou taxa de clareamento (CR) foram estimada
considerando as partculas capturadas pelo
mexilho. A taxa de ingesto (IR) igual
taxa de filtrao menos a taxa de produo
de pseudofezes (PPR). As pseudofezes so as
partculas filtradas aglomeradas com muco
que so expelidas periodicamente pelo sifo
inalante, isto , partculas filtradas, mas no
ingeridas. FR igual IR somente se no forem
produzidas pseudofezes. As taxas de filtrao

do mexilho-dourado foram estimadas baseadas


na frmula contida em Coughlan (1969).

Anlise das pseudofezes e fezes


Foi desenvolvido um mtodo para estimar precisamente a produo de pseudofezes
pelo mexilho dourado, conforme descrito a
seguir. Durante o curso dos experimentos, o
comportamento de cada exemplar de L. fortunei
foi monitorado sob microscpio estereoscpico
acoplado cmera digital. As pseudofezes e fezes foram capturadas no momento da liberao
com a utilizao de pipetas capilares e fixadas
com Lugol a 1%. As pseudofezes foram desintegradas em equipamento de ultrassom Bandelin
Sonorex RK100H durante 10 min para separar
as clulas do muco sem danific-las. As partculas alimentares foram estimadas em cmara
de contagem de Sedgewick-Rafter para acessar
a taxa de produo de pseudofezes (PPR).

Padro de liberao das


pseudofezes e fezes


O padro de liberao das pseudofezes foi diferenciado entre os tratamentos. As
pseudofezes, no tratamento fitoplncton no-txico (diatomcea Nitzschia), foram liberadas
constantemente, durante toda a durao do
experimento e sempre sob a forma de grandes
aglomerados globulares ou sob a forma de cordes (Fig. 1). No tratamento cianobactria (Microcystis txica e no-txica), as pseudofezes
foram liberadas com menor frequncia, sempre
sob a forma de pequenos aglomerados globulares (Fig. 2). O padro de liberao das fezes
foi o mesmo em todos os tratamentos. As fezes
apresentaram aspecto semelhante a tiras achatadas (formato do intestino de L. fortunei) de
colorao marrom (Fig. 3).
L. fortunei adulto na presena de
M. aeruginosa txica e diatomcea
no-txica N. palea - Short Term
Grazing Experiment (1h)



FR do mexilho-dourado variou de
95,6 a 817,5 mL ind-1 h-1, e o valor mdio
foi de 519,3 mL ind-1 h-1 (Fig. 4). FR em relao massa corporal variou de 2,4 a 24,5

CAPTULO 22
Seo 6

Figura 1. Pseudofezes de L. fortunei no tratamento fitoplncton no-txico (Nitzschia). Da esquerda para a direita: a) pseudofezes sob a forma de grandes aglomerados globulares, b) pseudofezes sob a forma de cordes, c) aglomerado de clulas de
Nitzschia sob a forma de pseudofezes. Sifo inalante (SI), sifo exalante (SE), pseudofezes (Ps).

Figura 2. Pseudofezes de L. fortunei no tratamento cianobactria txica (Microcystis). Da esquerda para a direita: a) pseudofezes sob a forma de pequenos aglomerados globulares, b) aglomerado de clulas de Microcystis sob a forma de pseudofezes.
Sifo inalante (SI), sifo exalante (SE), pseudofezes (Ps).

251
Figura 3. Fezes de L. fortunei. Da esquerda para a direita: a) liberao das fezes sob a forma de tiras achatadas, b) fezes. Sifo
exalante (SE), fezes (F).

mL mgDW-1 h-1, e o valor mdio foi de 10,6


mL mgDW-1 h-1(Fig. 4). FRs de L. fortunei
foram significativamente maiores na presena da Nitzschia no-txica do que nas outras
combinaes alimentares (p<0,05, ANOVA).
Apesar das elevadas FRs sobre a diatomcea
no-txica, o mexilho-dourado rejeitou
mais clulas de Nitzschia como pseudofezes
(p<0,05, ANOVA) e ingeriu mais clulas de
Microcystis (p<0,05, ANOVA).

L. fortunei adulto na presena de


M. aeruginosa txica e diatomcea
no-txica N. palea - Long Term
Grazing Experiment (120h)

IR na presena de Microcystis txica variou
de 31,8 a 54,6 mL ind-1 h-1 e de Microcystis no-txica variou de 36,3 a 62,5 mL ind-1 h-1 (Fig. 5).
No houve diminuio significativa da IR de L. fortunei sob exposio Microcystis txica ao longo

O impacto de Limnoperna fortunei


sobre as cianobactrias
Gazulha, V.

Figura 4. Taxa de Filtrao (FR), Taxa de Ingesto (IR) e Taxa de Produo de Pseudofezes (PPR) de Limnoperna fortunei (mL ind-1
h-1 e mL mgDW-1 h-1). Nitzschia no-txica (N), Microcystis txica (NPLJ-4) e no-txica (NPCD-1), e mistura de Nitzschia+Microcystis
txica (Mix N+NPLJ-4) (smbolo= Mdia, barra= Erro Padro).

Figura 5. Taxa de Ingesto (IR) de Limnoperna fortunei (mL ind-1 h-1). Microcystis txica (NPLJ-4) e no-txica (NPCD-1) (smbolo=
Mdia, barra= Erro Padro).

do experimento de filtrao (p<0,05, ANOVA),


indicando que o mexilho-dourado ingeriu
clulas txicas durante os 5 dias de experimento.
Os mexilhes foram capazes de se alimentar e
sobreviver na presena da cianobactria txica,
sugerindo que L. fortunei apresenta mecanismos
de sobrevivncia diante das cianotoxinas, alm de
evidenciar o seu potencial como vetor para a transferncia das cianotoxinas para os nveis trficos
superiores, aumentando o risco de bioacumulao
nos ecossistemas aquticos.

252

L. fortunei adulto na presena de cianobactrias solitrias (Microcystis), coloniais


(Microcystis) e filamentosas (Planktothrix)



FRs na presena das cianobactrias unicelulares, coloniais e filamentosas foram seme-

lhantes, no entanto, houve uma grande diferena nas IRs e PPRs (p<0,05, ANOVA; Fig. 6).
As clulas solitrias foram amplamente aceitas
como alimento, enquanto que as colnias e filamentos foram expulsos abundantemente nas
pseudofezes. L. fortunei apresentou capacidade
de selecionar partculas alimentares, e desta
forma, promover a dominncia de determinadas espcies do plncton nos ecossistemas
aquticos.

A presena do mexilho-dourado poderia levar a uma reduo de clulas solitrias de
cianobactrias (Microcystis), e favorecer o aumento em densidade de cianobactiras coloniais
(Microcystis) e filamentosas (Planktothrix), e de
diatomceas (Nitzschia). O mexilho-dourado
apresenta potencial para remover clulas txicas de cianobactrias (Microcystis), entretanto,

CAPTULO 22
Seo 6

este potencial ficaria reduzido em eventos de


florao, onde as formas coloniais, preferencialmente rejeitadas por L. fortunei, so predominantes. Neste caso, a presena do bivalve no
ambiente poderia ainda potencializar a ocorrncia da florao via rejeio das cianobactrias coloniais nas pseudofezes.
Taxas de filtrao das larvas de L. fortunei
na presena de Microcystis txica e
no-txica e Monoraphidium no-txico



FR da larva de L. fortunei variou de 9,9
a 44,5 L larva-1 h-1, com o valor mdio de 24,7
L larva-1 h-1 (Fig. 7). As maiores FRs foram

registradas na presena de Monoraphidium


no-txico, com o valor mdio de 28,2 L
larva-1 h-1. As larvas ingeriram Monoraphidium,
assim como Microcystis no-txica e txica
a taxas similares, indicando que no houve
efeito negativo das toxinas de cianobactrias
na filtrao das larvas durante os 4 dias de
experimento (p>0,05, ANOVA).


Sobrevivncia das larvas de L. fortunei


na presena de cianobactrias txicas
e fitoplncton no-txico


Elevada sobrevivncia das larvas foi registrada na presena da alga verde Monoraphidium

Figura 6. Taxa de Filtrao (FR), Taxa de Ingesto (IR), e Taxa de Produo de Pseudofezes (PPR) de L. fortunei (mL ind-1 h-1 e
mL mgDW-1 h-1) na presena de cianobactria filamentosa, colonial e unicelular (smbolo= Mdia, barra= Erro Padro). Florao
natural da filamentosa Planktothrix (NB F), M. aeruginosa colonial (NPCD-1 C), M. aeruginosa unicelular (NPCD-1 S).

253

Figura 7. Taxa de Filtrao (FR) das larvas de Limnoperna fortunei. Monoraphidium no-txico (MONO), Microcystis txica (NPLJ4) Microcystis no-txica (NPCD-1) (smbolo= Mdia, barra= Erro Padro).

O impacto de Limnoperna fortunei


sobre as cianobactrias
Gazulha, V.

Figura 8. Sobrevivncia (%)


das larvas de L. fortunei na
presena de Monoraphidium
no-txico (MONO), Microcystis
no-txica (NPCD-1), Microcystis
txica (NPLJ-4), Seston Natural
(NS), extrato de Microcystis
txica (NPLJ-4 + NS) (smbolo=
Mdia, barra= Erro Padro).

e de seston natural durante todo o experimento


(p<0,05, ANOVA; Fig. 8). Aps quatro dias de
exposio, a sobrevivncia das larvas diminuiu
na presena de Microcystis txica, seguida pelo
extrato de Microcystis txica+seston natural, e
Microcystis no-txica (p <0,05, ANOVA).

As larvas demonstraram maior sensibilidade natureza da partcula em comparao com
os adultos de L. fortunei. As cianobactrias no
tiveram efeito negativo nas taxas de filtrao das
larvas, indicando a incapacidade destas de detectar e evitar as partculas txicas. Entretanto,
ocorreu um aumento significativo da mortalidade larval na presena das cianobactrias txicas e
no-txicas em longo prazo (96h). Estes resultados demonstram que alm da toxicidade da partcula alimentar, a qualidade desta pode ser um
fator importante na seletividade alimentar das
larvas. O predomnio das cianobactrias no ambiente poderia ter como consequncia o aumento
da mortalidade das larvas de L. fortunei.

254

Consideraes finais


No presente estudo, foram abordados
apectos relacionados seletividade alimentar
de L. fortunei na presena de cianobactrias txicas e no-txicas, e fitoplncton no-txico.
Algumas questes foram esclarecidas, entretanto ainda existe uma lacuna no entendimento dos mecanismos de seleo de partculas
do mexilho-dourado, especialmente no que
diz respeito qualidade do alimento, como a
seleo de partculas orgnicas ou inorgnicas, a capacidade de ingesto e a eficincia de
digesto. Alm disso, estudos sobre os efeitos
da filtrao do mexilho-dourado na estrutura trfica dos ecossistemas so raros. A continuidade de estudos desta natureza de grande
importncia no sentido de se compreender a
interao existente entre esta espcie invasora,
o plncton e o bentos nos ecossistemas invadidos.

CAPTULO 23
Os impactos do
mexilho-dourado sobre
a comunidade planctnica
Aline Fachini
Vanessa Gazulha
Catarina da S. Pedrozo


Em bivalves filtradores, como o mexilho-dourado, a captao das partculas em
suspenso na gua ocorre atravs de um sifo
inalante. Os clios das brnquias geram correntes que impulsionam a gua pelo sifo at
chegar cavidade do manto e brnquias. As
partculas slidas so removidas pelos clios
das brnquias e, aquelas selecionadas para
ingesto, so dirigidas at a boca, enquanto
que as partculas indesejveis so envoltas em
muco e eliminadas como pseudofezes por um
canal adjacente ao sifo inalante (Morton,
1973).

Embora a ocorrncia da seleo de partculas alimentares pelos bivalves seja reconhecida, ainda existem importantes questes sobre
os critrios de seleo utilizados (Baker et al.,
2000). Segundo Bernard (1974), a seletividade
pode ser dividida em duas categorias principais: 1) a separao de partculas inorgnicas
das partculas orgnicas, que so geralmente
preferidas em relao s primeiras, e 2) a possvel seleo entre partculas orgnicas, onde

se incluem organismos planctnicos das mais


variadas formas, tamanhos e estruturas.

Denomina-se plncton o conjunto de organismos diminutos (m a poucos mm) que tm
pouco poder delocomooe vivem livremente
na coluna de gua, sendo muitas vezes arrastados
pelas correntezas. Algumas espcies so
fotossintetizantes, constituindo o fitoplncton
(tambm chamado de algas), enquanto outras
so heterotrficas, constituindo o zooplncton.
Encontram-se na base das cadeias alimentares
aquticas, servindo como alimento a diversos
organismos, incluindo bivalves.

Experimentos abordando a seletividade
de bivalves sobre a comunidade fitoplanctnica
so os mais comuns, utilizando principalmente
algumas espcies de algas cultivadas em laboratrio (Berg et al., 1996; Baker et al., 1998;
Gazulha et al., 2012a, b). Poucos so os estudos
sobre a filtrao do plncton natural e, especialmente, sobre o zooplncton. Em laboratrio, Horgan & Mills (1997), Bastviken et al.
(1998), Dionisio-Pires et al. (2004) e Naddafi

255

Os impactos do mexilho-dourado sobre


a comunidade planctnica
Fachini et al.

et al. (2007) realizaram estudos sobre a filtrao do mexilho-zebra (Dreissena polymorpha)


somente com a comunidade fitoplanctnica natural. J Rojas Molina et al. (2010) estudaram
a dieta natural do mexilho-dourado, incluindo fito e zooplncton, analisando o contedo
estomacal de exemplares coletados na plancie
de inundao do Rio Paran. Assim como estes, diversos outros trabalhos tentam elucidar
a relao existente entre a chegada dos bivalves
invasores e as alteraes observadas na densidade e composio da comunidade planctnica
dos ambientes invadidos (Nicholls & Hopkins,
1993; Caraco et al., 1997; Pace et al., 1998;
Smith et al., 1998; Jack & Thorp, 2000; Thorp
& Casper, 2002; Rojas Molina & Paggi, 2008;
David et al., 2009).


Para a realizao dos experimentos em
laboratrio, exemplares de L. fortunei e organismos planctnicos foram coletados no Lago
Guaba em Porto Alegre, RS. Os experimentos consistiam, basicamente, em manter cada
mexilho filtrando ativamente durante 1h em
uma suspenso contendo os organismos planctnicos (104 org. L-1), conforme visualizado na
Figura 1.

Ao final dos experimentos, os organismos
planctnicos presentes no recipiente controle,
no recipiente experimental e nas pseudofezes
coletadas foram identificados, contabilizados
e medidos. A partir disto, estimaram-se quais
espcies foram filtradas, ingeridas ou rejeitadas
pelos mexilhes durante os experimentos, segundo o diagrama descrito na Figura 2.

Figura 1. Recipiente controle, contendo


somente plncton ( esquerda) e recipiente experimental, contendo plncton e um
mexilho ( direita). A pipeta foi utilizada
para a coleta das pseudofezes.

256


Para entendermos os efeitos da filtrao
do mexilho-dourado sobre o plncton importante conhecer quais espcies esto mais suscetveis captura, ingesto ou rejeio. Tanto o
plncton consumido quanto o que rejeitado
nas pseudofezes podem constituir significantes
perdas energticas para a regio pelgica (Horgan & Mills, 1997) em funo das altas taxas de
filtrao registradas para L. fortunei (Sylvester
et al., 2005). A maioria dos estudos foca na filtrao de pequenas partculas fitoplanctnicas,
mas ainda existem questes sobre quais tamanhos e tipos de plncton podem ser retirados da
gua pelos mexilhes (Horgan & Mills, 1997).
Alguns trabalhos (Bastviken et al., 1998; Baker
et al., 1998) salientam a importncia de se analisar as pseudofezes para uma melhor observao dos possveis padres de seletividade, j que
a filtrao dos mexilhes pode se dar em uma
ampla faixa de partculas, mas parte delas ser

rejeitada na cavidade do manto, brnquias e palpos labiais e deslocada da coluna dgua para o
sedimento. Dessa forma, a ausncia da partcula
na suspenso no significa necessariamente que
ela foi utilizada como alimento.

O mecanismo de seleo alimentar em
filtradores controlado por diversos fatores fsicos, qumicos e biolgicos, e muitos estudos tm
revelado que diferenas no tamanho, na forma
e na concentrao de partculas, assim como
suas molculas de superfcie, metablitos e cargas eletrostticas podem influenciar na escolha
(Espinosa et al., 2008). No estudo realizado por
Fachini et al. (2011), cujos resultados principais
sero apresentados a seguir, foram testadas as
capacidades seletivas do mexilho-dourado sobre a forma e o tamanho dos organismos de uma
comunidade planctnica natural, a fim de subsidiar a avaliao dos possveis efeitos sobre sua
estrutura.

CAPTULO 23
Seo 6

Figura 2. Estimativa dos organismos planctnicos filtrados, ingeridos e rejeitados pelo mexilho-dourado atravs dos experimentos.


Uma vez que o objetivo principal dos
experimentos realizados era identificar quais
formas e tamanhos planctnicos foram preferencialmente filtrados, ingeridos ou rejeitados
pelos mexilhes, as espcies registradas nestas
trs situaes foram, ento, agrupadas arbitrariamente de acordo com suas formas segundo
a Tabela I. Imagens de alguns dos organismos
podem ser visualizadas nas Figuras 7 e 8.

Estes mesmos organismos fito e zooplanctnicos foram, aps, categorizados quanto ao tamanho, gerando a distribuio ilustrada
na Tabela II. Deve-se lembrar de que somente
organismos maiores do que 30 m esto presentes em funo da coleta por filtrao em
rede.

Para uma melhor compreenso, os resul-

tados obtidos foram transformados em taxas


de filtrao, de ingesto e de produo de pseudofezes de acordo com frmula proposta por
Coughlan (1969) e em ndices de seletividade
alimentar de acordo com frmula proposta por
Strauss (1979).

As taxas de filtrao do mexilho-dourado sobre a comunidade planctnica natural
durante os experimentos variaram entre 36,8
e 86,4 mL mexilho-1 h-1, com mdia de 61,9
mL mexilho-1 h-1. Estas taxas ficaram abaixo
de algumas taxas j registradas para L. fortunei
em estudos de laboratrio (entre 125 e 350 mL
mexilho-1 h-1, de acordo com Sylvester et al.,
2005; e entre 95,6 e 817,5 mL mexilho-1 h-1,
de acordo com Gazulha et al., 2012a, b), mas o
fato de se utilizar uma comunidade planctnica

Tabela I. Classificao dos organismos planctnicos quanto forma.

FITOPLNCTON

ZOOPLNCTON

Categoria

Categoria

Gnero e/ou Famlia/Ordem

Gnero e/ou Famlia/Ordem

Diatomceas unicelulares (60-550 m)


Pennales, Centrales

Rotferos Brachionidae (90-400 m)


Brachionus, Keratella, Kellicottia, Platyonus

Espinhosas (30-95 m)
Desmodesmus, Kirchneriella, Monactinus, Pediastrum, Scenedesmus, Staurastrum, Tetraedron

Outros Rotferos (100-300 m)


Conochilus, Bdelloidea, Lecane, Lepadella, Trichocerca

Alongadas (350-1050 m)
Closterium, Closteriopsis, Euglena

Cladceros (190-990 m)
Alona, Bosmina, Chydorus, Ceriodaphnia, Diaphanosoma

Filamentosas 1 (150-1200 m)
Aulacoseira, Mougeotia, Planktothryx

Coppodos (400-1850 m)
Calanoida, Cyclopoida

Filamentosas 2 (850-19000 m)
Spyrogyra

Nuplios de Coppodos (100-400 m)


Calanoida, Cyclopoida

Coloniais mucilaginosas (100-700 m)


Aphanocapsa, Microcystis, Volvox, Westella

Protozorios testceos (50-300 m)


Tecamoebas, Ciliophora

257

Os impactos do mexilho-dourado sobre


a comunidade planctnica
Fachini et al.

Tabela II. Classificao dos organismos planctnicos quanto ao tamanho.

Fitoplncton

Diatomceas
unicelulares

< 100 m

100 a 300 m

300 a 600 m

600 a 1000 m

Filamentosas 1

Espinhosas

Alongadas

Coloniais mucilaginosas

x
x

> 1000 m

Zooplncton

Cladceros

Coppodos

Nuplios
Copepoda

Rotferos

Rotferos
Brachionidae

Protozorios testceos

< 100 m

258

Filamentosas 2

100 a 300 m

300 a 600 m

600 a 1000 m

> 1000 m

natural e no somente espcies de algas isoladas deve ser considerado. Segundo Vanderploeg et al. (2009), diferentes taxas de filtrao
tem sido observadas para o mexilho-zebra se
alimentando do seston natural, e estas taxas
seriam consideravelmente mais baixas do que
aquelas observadas em culturas de algas de laboratrio. Portanto, deve-se ter cautela ao extrapolar as taxas obtidas em laboratrio, geralmente sob condies timas, para situaes no
ambiente natural.

Como podemos observar na Figura 3,
uma parcela equivalente dos organismos planctnicos filtrados acabou sendo ingerida e rejeitada pelos mexilhes durante os experimentos, demonstrando que grandes quantidades
de plncton podem ser deslocadas da coluna
dgua para o sedimento sob a forma de pseudofezes (Fig. 4). Embora se tenha observado
que os organismos planctnicos sejam liberados ainda vivos nestas pseudofezes, a viabilidade fica certamente comprometida em meio ao
emaranhado de muco.

Como hiptese principal do estudo realizado, tnhamos que L. fortunei utilizaria
no s fitoplncton, mas tambm zooplncton
como alimento, e que este bivalve selecionaria
os organismos baseado nas formas e tamanhos,
de maneira que os menores e com menos projees seriam preferidos como alimento. Nossos
resultados, a exemplo do registrado por Rojas
Molina et al. (2010), mostraram que o mexilho-dourado foi capaz de se alimentar tanto

de fito quanto de zooplncton e que a seletividade foi positiva para organismos de pequeno
a moderado tamanho e limitada capacidade de
escape, independente de possuir espinhos, pelo
menos na escala observada. Isto indica que o
movimento, alm do tamanho, foi mais importante do que a forma para a seletividade alimentar do mexilho-dourado.

A Figura 5 nos mostra como foi a seleo
alimentar do mexilho-dourado em funo da
forma dos organismos fito e zooplanctnicos.
O ndice apresentado faz uma proporo entre
os itens (categorias) alimentares disponveis
filtrao do mexilho com os itens ingeridos

Figura 3. Taxas de filtrao (TF), produo de pseudofezes


(TPP) e ingesto (TI) do mexilho-dourado sobre a comunidade planctnica natural (barras = mdia EP, p < 0,001).

CAPTULO 23
Seo 6

Figura 4. Limnoperna
fortunei liberando pseudofezes: 4A, pseudofezes sendo liberadas (SI =
Sifo Inalante; Ps = Pseudofezes); 4B, Pseudofezes
contendo algas diatomceas; 4C, Pseudofezes
contendo algas filamentosas; 4D, Pseudofezes
contendo um microcrustceo Cladcero.

pelo bivalve, indicando se o item foi selecionado de forma positiva, negativa ou indiferente.
Observa-se que entre o zooplncton, os grupos
de Rotferos foram consumidos preferencialmente em relao ao grupo dos Coppodos
pelo mexilho. J entre o fitoplncton, o grupo
das Espinhosas e Filamentosas 1 teve preferncia em relao ao grupo das Filamentosas 2.

Quanto ao tamanho dos organismos,
observa-se na Figura 6 que o mexilho apresentou seletividade negativa para as trs maiores
categorias do zooplncton, enquanto que para

o fitoplncton somente a ltima categoria no


foi preferida. Esta diferena se deve, provavelmente, ao fato de os organismos zooplanctnicos maiores terem uma capacidade natatria
que os permite escapar da corrente inalante do
mexilho, sendo, desta forma, inacessveis ao
consumo do bivalve.

Assim, pelos resultados deste estudo,
observou-se que as categorias de forma mais
ingeridas de fitoplncton (Espinhosas e Filamentosas 1) e de zooplncton (Outros rotferos
e Rotferos Brachionidae) tambm pertenciam

259

Figura 5. Seletividade alimentar do mexilho-dourado sobre as diferentes formas de organismos planctnicos. ndices positivos = preferncia; ndices negativos = rejeio ou inacessibilidade. O tamanho das barras indica a intensidade da seleo
(* p<0,05).

Os impactos do mexilho-dourado sobre


a comunidade planctnica
Fachini et al.

Figura 6. Seletividade alimentar do mexilho-dourado sobre os diferentes tamanhos de organismos planctnicos (em m).
ndices positivos = preferncia; ndices negativos = rejeio ou inacessibilidade. O tamanho das barras indica a intensidade da
seleo (*p<0,05).

260

s menores categorias de tamanho. As projees


e espinhos exibidos por alguns destes organismos, nesta escala, parecem no ter tido efeito
contra a filtrao dos mexilhes e o tamanho
dos organismos planctnicos parece ter sido o
determinante para a ingesto. As formas Coloniais, Alongadas e, especialmente, Filamentosas
2, que se enquadravam nas maiores categorias
de tamanho, foram filtradas e ingeridas em menores taxas.

Outro resultado interessante observado
foi o pequeno consumo do grupo Diatomceas,
cujos organismos enquadraram-se nas menores
categorias de tamanho planctnico e estiveram
bastante abundantes no plncton disponibilizado filtrao do mexilho durante os experimentos. Baixas taxas de filtrao de diatomceas tambm foram registradas em outros estudos
no s para L. fortunei, mas tambm para outros bivalves (Cucci et al., 1985; Shummay et al.,
1985; Baker et al., 1998; Bastviken et al., 1998;
Gazulha et al., 2012a, b), indicando que, neste
caso, algum fator alm das dimenses da alga
tambm influenciou no seu baixo consumo.

Mensurar impactos do mexilho-dourado
sobre a comunidade planctnica no ambiente natural difcil em funo do grande nmero de
variveis biticas e abiticas envolvidas e do potencial que este bivalve tem como espcie-engenheira de modificar tanto a estrutura biolgica
quanto fsica do ambiente. Mas alguns estudos no
ambiente natural (Rojas Molina & Paggi, 2008)
indicam a presena do mexilho-dourado como
a grande responsvel pelas alteraes verificadas

na comunidade planctnica, demonstrando que


o investimento em pesquisas sobre o comportamento alimentar do mexilho-dourado pode ser
til em fornecer subsdios para o conhecimento
e avaliao dos impactos deste bivalve invasor.
Nesse sentido, os resultados do estudo aqui apresentado indicam que o L. fortunei, atravs de sua
seletividade alimentar, pode promover o decrscimo na densidade de organismos planctnicos
de menor tamanho tanto do fito quanto do zooplncton, enquanto rejeita o consumo daqueles
organismos maiores ou capazes de evitar a corrente inalante do bivalve. A estrutura da comunidade planctnica pode sofrer alteraes devido a
esta ingesto seletiva do mexilho-dourado e os
impactos podem ser diferenciados em cada ambiente, dependendo, entre outros fatores, da diversidade de organismos planctnicos que compem a comunidade. Esta alterao no plncton,
associada ao incremento de recursos alimentares
no bentos proporcionado pelos mexilhes, acaba
refletindo diretamente sobre o comportamento
alimentar e a estrutura das demais comunidades
biolgicas do sistema.

As informaes sobre as interaes do
L. fortunei com as comunidades biolgicas do
Lago Guaba e, especialmente, com sua comunidade planctnica, ainda so insuficientes
para que se tenha uma dimenso dos impactos
causados pelo mexilho-dourado neste local.
Mas a grande densidade de mexilhes que colonizam este sistema torna cada vez mais necessrios o monitoramento, a pesquisa e o manejo
constantes neste ambiente.

CAPTULO 23
Seo 6

Figura 7. Grupos de Fitoplncton: 1-6) Diatomceas; 7-14) Espinhosas; 15-18) Alongadas; 19-23) Filamentosas 1; 24) Filamentosas 2; 25-27) Coloniais mucilaginosas. Grupos de Zooplncton: 28-30) Coppodos.

261

Figura 8. Grupos de Zooplncton: 31) Nuplio; 32-36) Cladceros; 37-43) Rotferos; 44-50) Rotferos Brachionidae; 51-60) Protozorios testceos.

Seo
Preveno

CAPTULO 24
Aes de EletrobrasFURNAS
na divulgao da Campanha de
Controle do Mexilho-Dourado
Rodrigo De Filippo
Paulo Srgio Formagio
Fernando Antonio Blanco Resende
Marcilia Barbosa Goulart


Em 2001, o bilogo Hlio Martins Fontes Junior, da Itaipu Binacional, apresentou a
uma plateia de pesquisadores e outros convidados, a notcia de que o mexilho-dourado
havia sido encontrado nas paredes internas da
tomada dgua da Usina. Em dez anos, o pequeno molusco havia percorrido mais de mil
quilmetros desde a foz do Rio da Prata at
Itaipu.

O tema foi discutido internamente e o
departamento de meio ambiente de FURNAS
foi convidado a participar da vistoria da captao de gua para o sistema de refrigerao da
subestao de Itaipu, operada por FURNAS. A
empresa tinha uma preocupao inicial: assegurar que a infestao no prejudicasse a refrigerao dos gigantescos transformadores de
voltagem da subestao que transmite a energia
de Itaipu para todo o pas. Descobriu-se que
no havia risco algum devido aos procedimentos operacionais adotados, que no favoreciam
a fixao dos mexilhes, seja nos equipamentos da subestao, seja no sistema de captao.


A partir da, FURNAS constituiu um
grupo de trabalho multidisciplinar, ento composto por bilogos e engenheiros, que participaram de um treinamento promovido pela
biloga da CEMIG, Maria Edith Rolla, em
Belo Horizonte, e tambm no laboratrio da
Diviso de Ecossistemas Aquticos da Itaipu
Binacional, coordenado pela zootecnista Carla Canzi. Nas duas ocasies foram discutidas
tcnicas de monitoramento e identificao de
larvas e adultos. Algumas semanas depois, seus
representantes participaram de um evento para
discutir o combate ao mexilho-dourado na
Amrica do Sul.

Essas atividades iniciais foram marcantes para a definio de uma estratgia de atuao para a empresa. At aquele momento, as
usinas hidreltricas operadas pela empresa estavam distantes das reas infestadas. Em 2003,
o Limnoperna fortunei (Dunker, 1857) j havia
chegado ao Pantanal e ao reservatrio de Ilha
Solteira, formado pelos rios Grande e Paranaba, que formam o Rio Paran. O grupo sentiu

265

Aes de EletrobrasFURNAS na divulgao da


Campanha de Controle do Mexilho-Dourado
De Filippo et al.

266

a necessidade de fazer uma mobilizao interna


e apresentar o problema para as unidades com
maior risco de introduo do bivalve.

Quatro usinas hidreltricas foram definidas como prioritrias para essa atividade
inicial: UHE Itumbiara, situada nos estados de
Minas Gerais e Gois, no Rio Paranaba; UHEs
Marimbondo e Porto Colmbia, nos estados de
Minas Gerais e So Paulo, no Rio Grande; e
APM Manso, no estado do Mato Grosso, no
Rio Manso. Foi elaborada uma apresentao
para os funcionrios das reas de operao e
manuteno, e o treinamento para coleta de
larvas com rede de plncton e instalao de tijolos e outros materiais submersos prximos da
barragem, para a deteco de incrustao dos
moluscos adultos.

A resposta dos tcnicos envolvidos foi
altamente positiva. O grupo de trabalho comeou a receber sugestes de atividades e convites
para fazer a apresentao em eventos internos
e externos.

Ao mesmo tempo, FURNAS se fez representar na Fora Tarefa Nacional para Controle
do L. fortunei (mexilho-dourado), constituda
pelo Ministrio do Meio Ambiente, por meio
da Portaria no 494, de 22 de dezembro de 2003.
Percebeu-se ali que o setor eltrico, a Marinha
e demais envolvidos, articulam-se na busca por
uma ao de controle ao L. fortunei. Merecem
destaque as campanhas de divulgao promovidas pela CESP, coordenadas pelo agrnomo
Andr Luis Mustaf, e as pesquisas financiadas
pela CEMIG.

A CESP gentilmente recebeu o grupo de
FURNAS na UHE Srgio Motta, para mostrar
os procedimentos de manuteno adotados
aps a infestao do mexilho-dourado.

importante destacar aqui a integrao
entre as empresas do setor eltrico. E deve ser
destacado o papel de Itaipu Binacional, que foi
a primeira empresa brasileira a discutir o tema,
em 1997, antes mesmo da chegada do mexilho
no seu reservatrio.

No escritrio central da empresa, o grupo de trabalho viu que era necessrio fazer
algo complementar, ao que j se desenvolvia
no setor. O setor de comunicao foi acionado,
e o debate se ampliou com a participao de
jornalistas e designers. As usinas sob concesso de FURNAS estavam distantes de Itaipu,

de modo que foi decidido o investimento em


aes preventivas. Foram avaliadas as provveis
rotas de embarcaes de pesca esportiva e comercial, e quatro usinas foram definidas como
de maior risco de infestao: Porto Colmbia
e Marimbondo, no Rio Grande; Itumbiara, no
Rio Paranaba; e Manso, no Rio Manso. Essas
usinas foram visitadas e o alerta foi ouvido com
ateno.

Todos os profissionais envolvidos se engajaram de forma entusiasmada na campanha.
Sugestes brotavam de todos os setores visitados. Mesmo distantes do escritrio central, as
unidades regionais se organizaram e multiplicaram a informao. Os convites para eventos
foram inmeros. Era necessrio produzir material e tornar a campanha institucional.

Surgiram o folder, a cartilha com personagens exclusivos, seguida da logomarca como
personagem principal, impressa em bons,
camisetas, cadernos, canetas, cartazes e um
nmero telefnico denominado Disque Mexilho. O conselho diretor da empresa criou
formalmente o Grupo de Controle do Mexilho-dourado, com recursos anuais da ordem
de R$250.000,00. Estava constituda a campanha Mexilho-Dourado: No d carona a
esse Bicho!, cuja pgina pode ser acessada no
endereo: http://www.furnas.com.br/meioambiente_mexilhao2.asp.

O material e as fotos logo despertaram
o interesse da Editora Moderna, que h cinco
anos introduziu o tema no contedo de seu livro Projeto Ararib Cincias, para turmas do
7 ano do Ensino Fundamental.

Vale a pena detalhar um pouco a criao
do Disque Mexilho, pois um exemplo do
compromisso dos profissionais de FURNAS. A
empresa dispe de um servio similar dedicado
a receber avisos de queimada nas proximidades
das linhas de transmisso sob sua concesso.
Foi feita uma apresentao ao grupo de atendentes, seguida de uma discusso sobre como
eles deveriam proceder. Havia um conjunto
de perguntas e respostas j definidas, mas os
atendentes pediram autorizao para fazerem
algumas adaptaes. O resultado foi um fluxograma objetivo que definia se poderia se tratar
de mexilho-dourado, de Corbicula, ou de gastrpodes.

O primeiro evento oficial da campanha

CAPTULO 24
Seo 7

ocorreu em 2005, na UHE Porto Colmbia,


em Planura, MG, que teve a participao do
bilogo Slvio Carlos Santos, da AES-Tiet, que
relatou como a empresa estava lidando com o
problema nos reservatrios do Rio Tiet. Em
seguida foi lanada a campanha idealizada
pelos tcnicos de FURNAS, no encontro dos
pescadores artesanais profissionais, promovido
pela Colnia de Pescadores Z 10 na mesma cidade de Planura, onde foram distribudos aos
presentes camisetas, bons, folders e cartilha
alusivos campanha, e realizada uma palestra.

Da em diante foram vrios os eventos
dos quais o grupo participou, desde seminrios
acadmicos a festas populares locais e tambm
palestra em escolas. Outra medida bem
sucedida foi a parceria com empresas de comercializao de material de pesca, para as
quais foram disponibilizados flderes e cartilhas, acrescentadas ao material adquirido pelos
compradores.

A receptividade era grande e teve alcance
surpreendente, como foi o caso de um pescador, Sr. Francisco, que ligou de Pedrinhas Paulista, na divisa de So Paulo com o Paran, para
o Disque Mexilho. Ele disse que recebera o
folheto juntamente com a mercadoria que comprara numa casa de pesca de Minas Gerais. Fez
questo de elogiar o material e avisava que o L.
fortunei j havia invadido o Rio Paranapanema.

Outro caso pitoresco, foi a apresentao
para multiplicadores das cidades de Planura e
Colmbia dois dias antes do Carnaval de 2006
(Fig. 1). A Banda Eva estava hospedada no mesmo hotel da equipe de FURNAS. Depois de
uma conversa com o empresrio da banda e
da entrega dos kits de bons, camisetas e cadernos a cantora cumpriu sua promessa e, durante o show, gritou pela turma do mexilho-dourado.

Dois eventos foram os mais marcantes da
campanha: a participao na expedio pelo
Rio Paranaba, articulada pelas prefeituras dos
municpios do comit de bacia que se formava;
e no 26 Festival de Pesca de Cceres.

A expedio foi realizada em 2008. O
objetivo principal era fazer um movimento poltico entre as prefeituras para incentivar a adeso ao comit de bacia hidrogrfica que estava
sendo constitudo. A inteno era percorrer o
Rio Paranaba, desde a nascente at sua juno

Figura 1. Multiplicadora de UHE Porto Colmbia, no estado


de So Paulo, durante campanha de divulgao realizada na
cidade.

com o Rio Grande, no reservatrio de Ilha Solteira, com parada em algumas cidades para divulgao do comit. A equipe de FURNAS deu
suporte s medies de qualidade da gua realizadas pelas empresas SANEAGO, de Gois,
e COPASA, de Minas Gerais. Houve tambm
o apoio de profissionais acadmicos e alunos
da Universidade Luterana do Brasil (ULBRA)
da cidade de Itumbiara, com quem FURNAS j
mantinha estreita relao.

FURNAS mobilizou duas embarcaes
para fazerem todo o trajeto, trs automveis e
dezoito funcionrios. A estratgia era montar
a base nos pontos de desembarque para fazer
a desinfeco de todos os barcos, juntamente
com a distribuio de cartilhas, folhetos e adesivos. Todos os funcionrios usavam a camiseta e o bon da campanha, e foram comprados
cinco borrifadores (Fig. 2). Entre os membros
da equipe havia um jornalista responsvel pelos contatos com a imprensa. Ao mesmo tempo
eram feitos contatos com representantes de escolas e das secretarias municipais de educao,
para divulgar o tema e ceder material grfico.

267

Aes de EletrobrasFURNAS na divulgao da


Campanha de Controle do Mexilho-Dourado
De Filippo et al.

268


O material da campanha foi distribudo
para vrias escolas dos trs estados. O contato
com professores e secretrios de educao foi
muito proveitoso (Fig. 3). A cartilha e o folheto
criaram oportunidade para os educadores trabalharem um tema especfico em sala de aula,
diretamente relacionado com o seu ambiente.

Foram realizadas duas entrevistas em rdio, trs entrevistas para TV e distribudos releases para jornais. A campanha de FURNAS foi difundida em pelo menos um site na Internet: http://
www.paragonbrasil.com.br/news.php?id=988.

Cerca de cinco mil cartilhas e folhetos
foram distribudos nos stands montados em
cada parada (Fig. 4). Havia carncia absoluta
de informao sobre o mexilho-dourado em
alguns locais, de modo que o tema ficou permanentemente vinculado campanha realizada pela Empresa.

A participao de FURNAS no 16 Festival
de Pesca de Cceres, no Mato Grosso, originou-se da preocupao com a circulao de embarcaes por todo o estado, devido aos inmeros
festivais de pesca organizados pelos municpios.

Em 2006, o grupo saiu de Minas Gerais
e Rio de Janeiro para divulgar a campanha da
empresa no 26 Festival de Pesca de Cceres
(Fig. 5). A razo dessa participao era a proximidade do local com o Aproveitamento Mltiplo de Manso (APM Manso) sob concesso
da empresa. Para esse festival foi confeccionado um adesivo para as embarcaes. A presena de FURNAS foi to marcante que o stand
da empresa foi visitado por todos (Fig. 6). As
apresentaes eram quase que contnuas. Professores locais solicitavam material para trabalharem o tema em suas escolas.

Aps o evento, a Secretaria de Meio Ambiente do Mato Grosso convidou a empresa
para participar do grupo de trabalho que deveria criar uma estratgia de combate ao mexilho-dourado no estado. O risco da disperso
do mexilho era grande, devido aos inmeros eventos de pesca que ocorrem no estado.
FURNAS colaborou ativamente com o grupo,
do qual participavam as pesquisadoras Maria
Cristina Dreher Mansur e Claudio Tasso Callil.
Dali surgiu a proposta do projeto de pesquisa
que est sintetizado neste livro.

Um segundo desdobramento da participao no municpio de Cceres foi a efetiva
estruturao de um programa de preveno do

Figura 2. Desinfeco de embarcao durante a expedio do


Rio Paranaba, em 2008.

Figura 3. Entrega de cartilhas para professoras do Ensino Fundamental com cartilhas, em Inaciolndia, no estado de Gois.

Figura 4. Movimentao no stand de FURNAS durante a expedio do Rio Paranaba, em 2008.

Figura 5. Abertura de uma etapa de pesca do festival de Cceres, no estado do Mato Grosso.

CAPTULO 24
Seo 7

mexilho-dourado no estado do Mato Grosso.


Em setembro 2007, o grupo foi convidado a
proferir uma palestra para os membros da Secretaria de Meio Ambiente do Mato Grosso do
Sul, acerca das aes tomadas por FURNAS
para impedir a colonizao do mexilho-dourado, pois esse molusco estava sendo levado em
direo regio de Bonito, no Mato Grosso do
Sul, atravs do Rio Miranda.

Em recente viagem ao Rio Teles Pires, na
divisa com Gois, foi documentado o adesivo
referente ao festival de pesca de Paranaba, Fest
Praia, ocorrido em 2009, num barco que foi socorrido devido a uma pane no motor (Fig. 7).

Os livros de administrao exortam as
capacidades de liderana e gerencial como base
para o sucesso de uma atividade ou carreira. A
campanha desenvolvida por FURNAS parece
ter rompido esse paradigma. Quem era o lder?
Fato que no havia liderana porque ela no
era necessria. Todos sabiam exatamente o que
fazer, e estavam livres para tomarem decises.
O que movia o grupo e que o levava a agregar
mais gente em torno dele foram compromisso,
entusiasmo, e capacidade de persuaso.
Foram esses os principais ingredientes que
multiplicaram a informao e fizeram da campanha uma referncia para muitos.

Um grupo heterogneo e disperso por
vrios setores da empresa conseguiu fazer uma
campanha de educao ambiental em cinco
grandes estados brasileiros: So Paulo, Minas
Gerais, Gois, Mato Grosso e Mato Grosso do
Sul. O que deveria exigir um enorme esforo
de coordenao e controle fluiu naturalmente,
evento aps evento.

Parte dos frutos j foi colhida, o mexilho
no foi introduzido nos reservatrios da empresa. A outra parte, os resultados de dois anos de
pesquisa, est sendo apresentada agora.

O grupo sempre acreditou que essa forma de divulgao adotada pela empresa foi a
melhor maneira de difundir a existncia do
mexilho-dourado, sua biologia e os danos que
ele causa ao meio ambiente, pois se conseguiu
que um nmero grande de pessoas tomasse conhecimento de sua existncia, o que pode ter
contribudo para retardar a introduo do molusco no Rio Grande por quase quatro anos.

Todo o trabalho da equipe de FURNAS
culminou com a assinatura de um contrato de
projeto de pesquisa e desenvolvimento com a

Figura 6. Animadores no stand de FURNAS em Cceres, no


estado do Mato Grosso.

269
Figura 7. Adesivo do Fest Praia, no municpio de Paranata, no
estado do Mato Grosso.

Fundao Luiz Englert/UFRGS, denominado


Estudos biolgicos e ambientais como base
preveno e ao controle do mexilho-dourado
L. fortunei (Dunker, 1857), em rios e reservatrios brasileiros objetivando desenvolver
metodologias para o controle biolgico do mexilho-dourado, contribuindo assim para um
controle efetivo desse molusco que tem causado prejuzo ao meio ambiente e as hidreltricas e estaes de tratamento de gua nos locais
onde ele est ocorrendo.

CAPTULO 25
Aes desenvolvidas pelo
Ministrio do Meio Ambiente
2001 a 2011
Vivian Beck Pombo


O Ministrio do Meio Ambiente MMA,
considerando os crescentes impactos negativos
gerados pelas espcies exticas invasoras e as
dificuldades de controle e monitoramento e,
considerando ainda, as fragilidades existentes
para o enfrentamento da introduo de novas
espcies, a vulnerabilidade natural de um pas
de propores continentais e os elevados custos
decorrentes da disperso de espcies exticas
invasoras no Pas, decidiu tratar o tema como
uma de suas prioridades.

A primeira reunio sobre o tema ocorreu em 2001, quando o MMA em parceria
com a Embrapa, realizou, em Braslia, a Reunio de Trabalho sobre Espcies Exticas Invasoras. O evento contou com a participao
dos pases da Amrica do Sul (Argentina, Bolvia, Brasil, Chile, Colmbia, Equador, Guiana
Francesa, Paraguai, Peru, Suriname, Uruguai
e Venezuela) e com a colaborao do Governo
dos Estados Unidos da Amrica e do Programa Global para Espcies Exticas Invasoras
GISP. Entre as recomendaes aprovadas

destacam-se: preveno e controle dos impactos de espcies exticas invasoras sobre os


ecossistemas naturais e sobre a rica biodiversidade da regio; elaborao de diagnsticos
nacionais, pesquisa, capacitao tcnica, fortalecimento institucional, sensibilizao pblica, coordenao de aes e harmonizao
de legislaes; ateno urgente ao problema
de introduo de espcies exticas invasoras
nas diferentes bacias hidrogrficas da regio e
ecossistemas transfronteirios; e coordenao
e cooperao entre os setores agrcolas, florestais, pesqueiros e ambientais nacionais no
tratamento dessa questo.

Atendendo algumas das recomendaes
decorrentes desta reunio internacional, o
MMA vem desenvolvendo aes voltadas preveno das introdues; ao monitoramento; ao
controle/manejo; e erradicao. Estas aes
dizem respeito reviso e desenvolvimento de
normativas relacionadas matria; realizao
de inventrios das espcies exticas ocorrentes
nos diversos ecossistemas brasileiros, inclusive

271

Aes desenvolvidas pelo


Ministrio do Meio Ambiente - 2001 a 2011
Pombo, V. B.

272

no mbito de bacias hidrogrficas; discusses


relativas elaborao de listas oficiais de espcies exticas invasoras em mbito estadual e
nacional; e estmulo abertura de linhas de financiamento para pesquisa no Fundo Nacional
de Meio Ambiente. Parceria Fundo Nacional
do Meio Ambiente FNMA e Projeto de Conservao e Utilizao Sustentvel da Diversidade Biolgica Brasileira PROBio.

Ainda em 2001, o MMA lanou o Edital
FNMA/PROBio 04/2001. A partir desse Edital
foram selecionados nove projetos relacionados
a espcies invasoras presentes no pas que serviram de base para o incio dos trabalhos no
Departamento de Conservao da Biodiversidade, que deu continuidade ao desenvolvimento das aes, a exemplo das descritas a seguir.

Brasileira de Pesquisa Agropecuria Embrapa e com a Fundao para o Desenvolvimento


Cientfico e Tecnolgico em Sade Fiotec
foram executados cinco subprojetos relacionados, respectivamente, s espcies que afetam
o ambiente terrestre, o ambiente marinho, as
guas continentais, os sistemas de produo
(agricultura, pecuria e silvicultura) e a sade
humana.

Os relatrios apresentados aps o levantamento esto em fase de reviso e sistematizao visando publicao de livros especficos
sobre cada um dos temas abordados no levantamento, porm podem ser consultados em sua
verso original no endereo: http://www.mma.
gov.br/sitio/index.php?ido=publicacao.publica
coesPorSecretaria&idEstrutura=14.

Primeiro Informe Nacional


sobre Espcies Exticas Invasoras


Em 2003, o MMA, considerando suas
responsabilidades frente ao tema e diante da
constatao da precariedade de referncias
bibliogrficas e de pesquisas no Brasil relacionadas questo, decidiu realizar o I Informe
Nacional sobre Espcies Exticas Invasoras,
com dois diagnsticos, um sobre as Espcies
Exticas Invasoras Atuais e Potenciais e outro sobre a estrutura existente no pas para
tratar o problema. Os levantamentos abordaram as espcies que afetam os ambientes
terrestres, marinho e de guas continentais,
bem como aquelas que afetam os sistemas de
produo e a sade humana. Como resultado
dessa iniciativa, foram listadas 543 espcies
na condio de exticas invasoras aos diferentes ecossistemas brasileiros, sendo: 176 de
organismos que afetam o ambiente terrestre;
66 que afetam o ambiente marinho; 49 que
afetam as guas continentais; 155 que afetam
os sistemas de produo; e 97 que afetam a
sade humana.

Tal levantamento foi realizado com recursos financeiros do Projeto de Conservao
e Utilizao Sustentvel da Diversidade Biolgica Brasileira PROBio, que firmou convnios com a The Nature Conservancy/Instituto
Hrus, com a Fundao de Estudos e Pesquisas Aquticas Fundespa, com a Fundao
Arthur Bernardes Funarbe, com a Empresa

Fora Tarefa Nacional para o


Controle do Mexilho-Dourado


Por meio da Portaria n 494, de 22 de dezembro de 2003, a Ministra do Meio Ambiente
criou, em carter emergencial, a Fora Tarefa
Nacional para o Controle do Mexilho-dourado FTN, visando o controle do mexilho-dourado. Ao final das atividades do Grupo de
Trabalho relativo Fora Tarefa Nacional foi
elaborado o Plano de Ao Emergencial para
o Controle do Mexilho-Dourado, com detalhes sobre componentes de fiscalizao, capacitao, monitoramento e comunicao que
deveriam ser contemplados com aes para o
controle das populaes j estabelecidas e adequao da legislao para preveno de novas
introdues.

O Relatrio da Fora Tarefa lista as
principais concluses, ou seja: i) o controle e
conteno da disperso do mexilho-dourado
devem-se constituir em tarefas de carter permanente; ii) deve haver restrio nas atividades
de trfego hidrovirio; iii) devem ser ampliadas as aes de fiscalizao de embarcaes de
pequeno porte de pesca e recreio transportadas por via rodoviria; iv) maior controle no
transporte de fauna e flora; e v) desaconselha
a transposio de guas e aconselha um maior
rigor na fiscalizao em relao s navegaes
internacional e de cabotagem.

Aps a finalizao dos trabalhos da
FTN, o MMA entendeu que as informaes

CAPTULO 25
Seo 7

existentes at aquele momento, bem como as


informaes tcnicas sobre o controle do molusco, no eram suficientes para subsidiar a
tomada de decises. A FTN considerou ainda
a necessidade de serem disponibilizadas informaes cientficas sobre a biologia, a ecologia e
o comportamento da espcie Limnoperna fortunei (Dunker, 1857). Assim, entendeu necessrio o desenvolvimento de estudos e pesquisas
voltados identificao de formas de controle
da infestao das guas interiores brasileiras
pelo mexilho-dourado, o desenvolvimento de
tecnologias para mitigao dos seus impactos
sobre os mltiplos usos da gua, a exemplo da
gerao de energia eltrica, captao de gua
para diversos fins, navegao, pesca e aquicultura.

Para a execuo dos estudos fomentados pelo CNPq, foi organizada uma rede de
pesquisa, com a contratao de nove (9) instituies, atuantes na temtica, a seguir discriminadas: a Pontifcia Universidade Catlica
do Rio Grande do Sul PUCRS; a Universidade Estadual de Maring UEM; o Instituto
de Estudos do Mar Almirante Paulo Moreira IEAPM; a Empresa Brasileira de Pesquisa
Agropecuria EMBRAPA Pantanal; a Universidade Federal de Mato Grosso UFMT;
a Universidade Federal do Paran UFPR;
a Pontifcia Universidade Catlica do Rio de
Janeiro PUCRJ; a Universidade Federal de
So Carlos UFSC; o Centro de Pesquisa e
Gesto de Recursos Pesqueiros Continentais
CEPTA IBAMA. A coordenao ficou a cargo
do IEAPM. O estudo acima referido encontra-se
registrado no CNPq sob o Processo de n 507675/
2004.

GT CONAMA para Reviso da


Portaria IBAMA n 145/98


Desde 2005, discute-se, em um Grupo
de Trabalho GT criado no mbito do CONAMA, a elaborao de instrumento normativo,
que estabelea critrios para a introduo, reintroduo e a translocao de organismos vivos
em ambientes aquticos.

Esse GT, designado pela Cmara Tcnica
de Biodiversidade, Fauna e Recursos Pesqueiros tem a incumbncia de elaborar uma minuta
de Resoluo para ser apresentada plenria

da Cmara Tcnica do CONAMA, para deliberao. Tal Resoluo, se aprovada, dever


substituir a Portaria IBAMA n 145, de 29 de
outubro de 1998, em vigor.

I Simpsio Brasileiro sobre


Espcies Exticas Invasoras


No ano de 2005, o MMA e o Instituto
Brasileiro do Meio Ambiente e dos Recursos
Renovveis IBAMA, em parceria com a Fiocruz, a Embrapa, o Instituto Oceanogrfico da
USP IOUSP, Instituto Hrus e a Universidade
de Viosa UFV, realizaram o I Simpsio Brasileiro sobre Espcies Exticas Invasoras, no
perodo de 4 a 7 de outubro, em Braslia, DF.

O Simpsio contou com a presena de sete
pases: frica do Sul, Argentina, Brasil, Estados
Unidos, Jamaica, Nova Zelndia e Portugal. Entre os atores brasileiros, tivemos representao
das cinco regies geopolticas. A abertura do
evento foi presidida pela ento ministra Marina
Silva, que em seu discurso props a criao de
uma Cmara Tcnica Permanente sobre Espcies Exticas Invasoras, no mbito da Comisso
Nacional de Biodiversidade CONABio.

Todo material apresentado no Simpsio
e autorizado pelos autores est disponvel na
pgina do MMA no endereo www.mma.gov.
br/invasoras.

Publicao Espcies Exticas


Invasoras: Situao Brasileira


Por ocasio da realizao da VIII Conferncia das Partes COP8, da Conveno sobre
Diversidade Biolgica, em 2006, o MMA elaborou e publicou um livreto com 24p, denominado Espcies Exticas Invasoras: Situao
Brasileira, com breves informaes das aes
at ento desenvolvidas por este rgo central
da Poltica de Meio Ambiente no Brasil.

Esta publicao (Brasil, 2006) encontra-se disponvel para download no endereo
http://www.mma.gov.br/estruturas/174/_publicacao/174_publicacao17092009113400.pdf

Resoluo CONAMA n 394/07


Em atendimento as recomendaes da
FTN, o MMA participa diretamente da ela-

273

Aes desenvolvidas pelo


Ministrio do Meio Ambiente - 2001 a 2011
Pombo, V. B.

borao de instrumentos normativos para prevenir a introduo, no somente do mexilho-dourado, como tambm, de outras espcies
exticas invasoras.

Nesse contexto, importante ressaltar a
Resoluo CONAMA n 394, de 6 de novembro de 2007, que estabelece os critrios para
a determinao de espcies silvestres a serem
criadas e comercializadas como animais de estimao.

A prtica de adoo de animais de estimao exticos tem sido uma das causas de
introduo e disperso de espcies exticas
potencialmente invasoras, em razo da soltura desses em ambientes naturais, quando seus
proprietrios desistem de sua guarda e os descartam.

Cmara Tcnica Permanente


sobre Espcies Exticas
Invasoras CTPEEI


A CTPEEI um frum especfico para o
debate do tema. Criada pela Deliberao CONABio n 49, de 30 de agosto de 2006, sofreu alterao
em sua composio pela Deliberao n 55, de
21 de outubro de 2008. A CTPEEI foi instalada
em 2008 e desde ento, foram realizadas cinco
reunies, cuja memria e documentos avaliados
esto disponveis no endereo http://www.mma.
gov.br/index.php?ido=conteudo.monta&idEstru
tura=15&idConteudo=7434.

274

Estratgia Nacional sobre


Espcies Exticas Invasoras


Em decorrncia dos trabalhos da
CTPEEI, foi elaborada e aprovada, em outubro
de 2009, no mbito da Comisso Nacional de
Biodiversidade, a Estratgia Nacional sobre Espcies Exticas Invasoras, conforme Resoluo
CONABIO n 5/2009.

A Estratgia Nacional se constitui no primeiro documento aprovado no mbito do Governo Federal que pode orientar as diferentes
esferas do governo no trato das questes relativas s espcies exticas invasoras. Obviamente,
legislaes especficas sero necessrias para
prevenir ou diminuir a introduo e a translocao de exticas invasoras no pas. Ainda, a
Estratgia Nacional representa, um importante

instrumento para a internalizao e implementao no pas do artigo 8 (h) da Conveno sobre Diversidade Biolgica. Da mesma forma, a
Estratgia se traduz em uma efetiva ferramenta
que o pas dispe para a consecuo das determinaes das Decises V/8, VI/23 e IX/4, das
Conferncias das Partes, da CDB.

Informe sobre as Espcies Exticas


Invasoras Marinhas no Brasil


Em dezembro de 2009 foi lanado o primeiro de uma srie de cinco livros que abordaro a situao das espcies exticas invasoras
nos diferentes ambientes (marinho, de guas
continentais e terrestres), sistemas de produo
e sade humana. O primeiro livro est contribuindo com as informaes cientficas bsicas
sobre as espcies exticas marinhas e dever
ser decisivo como subsdio para a tomada de
decises e planejamento das aes necessrias
para o enfrentamento das invases biolgicas
no pas.

Esta publicao encontra-se disponvel
para download no endereo: h t t p : / / w w w.
mma.gov.br/estruturas/174/_publicacao/174_
publicacao16032010050723.pdf

Estratgia Nacional de
Comunicao e Educao
Ambiental - ENCEA


Finalmente, e considerando que as espcies exticas invasoras representam a segunda
maior causa de perda de biodiversidade em nvel mundial, a primeira no mbito das Unidades de Conservao UCs e, considerando ainda que essas UCs representam redutos chaves
para a preservao da diversidade biolgica nos
diferentes biomas brasileiros, o Departamento
de Conservao da Biodiversidade, da Secretaria de Biodiversidade e Florestas, em conjunto com outras secretarias do MMA, elaborou
um documento que est sendo chamado Estratgia Nacional de Comunicao e Educao
Ambiental no mbito do Sistema Nacional de
Unidades de Conservao ENCEA. Tal documento dever definir os princpios, as diretrizes, os objetivos e os mtodos para o fortalecimento e a implementao de atividades de

CAPTULO 25
Seo 7

comunicao e de educao ambiental em UCs,


Corredores Ecolgicos, Mosaicos de UCs, Reservas da Biosfera, e seus entornos, incluindo o
tema espcies exticas invasoras e as invases
biolgicas, finalizada e publicada em dezembro de 2010, disponvel nos endereos: www.
mma.gov.br/ea; encea.blogspot.com e www.
icmbio.gov.br.

Espcies Exticas Invasoras de


guas Continentais no Brasil


Em fase de finalizao, o MMA vem
trabalhando no livro que ir apresentar a compilao dos resultados apresentados em 2005,
no relatrio final do I Informe Nacional sobre
Espcies Exticas Invasoras relativo s guas

continentais, com atualizaes e acrscimo de


informaes.

A publicao ser composta de 11 captulos, trazendo dados sobre as espcies exticas
j presentes no pas, suas situaes populacionais, caractersticas, origem, distribuio geogrfica e outras, dos seguintes grupos taxonmicos: microrganismos; cnidrios; crustceos
e microcrustceos; moluscos; peixes; anfbios
e rpteis e macrfitas.

Este livro tambm ser um marco, uma
vez que temos carncia de informaes cientficas compiladas sobre as espcies exticas de
guas continentais. Sendo, portanto, um importante documento para subsidiar as decises dos
gestores e usurios dos recursos hdricos e de
espcies exticas para produo em larga escala.

275

Seo
Delineamento experimental:
seleo de mtodos de
controle populacional

CAPTULO 26
Planejamento experimental para
a seleo de mtodos de controle
populacional de moluscos invasores
Daniel Pereira
Svio Henrique Calazans Campos
Livia Viana de Godoy Fernandes
Isabel Cristina Padula Paz
Cintia Pinheiro dos Santos
Flavio da Costa Fernandes
Maria Teresa Raya Rodriguez
Alexandre Arenzon
Maria Cristina Dreher Mansur


Quando um cientista elabora uma hiptese de trabalho necessrio que estabelea
critrios que validem de forma irrefutvel se a
mesma vlida ou no, e neste ponto que o
delineamento experimental entra no processo,
visto que experimentos mal projetados ou mal
conduzidos podem levar a concluses errneas.

O delineamento experimental a base
onde est apoiado todo o sistema cientfico,
e consiste no planejamento e conduo de experimentos de modo que seja possvel o recolhimento de dados que possam ser analisados,
usando mtodos estatsticos apropriados e que
conduzam a concluses vlidas e objetivas.

O desenvolvimento e adaptao de tecnologias que promovam o controle populacional de espcies invasoras, com a minimizao
de impacto de subprodutos e metablitos txicos, requerem mtodos cientficos adequados.
Para tal, a correta abordagem experimental requer um planejamento otimizado visando obter
respostas rpidas e precisas quanto eficcia
de mtodos de controle, dosagens adequadas e
suas implicaes ambientais.


As espcies de moluscos invasores lmnicos que tm sido alvo de preocupao quanto aos impactos econmicos so Limnoperna
fortunei (Dunker, 1857), Corbicula largillierti
(Philippi, 1844) e Corbicula fluminea (Mller,
1774). Portanto, a maior parte do conhecimento experimental resulta de projetos de pesquisa
e desenvolvimento no controle destes bivalves.
Desta forma muitos dos exemplos citados neste
captulo se referem a estas espcies, mas podem
ser utilizados como referncia no planejamento
de experimentos que visem testar mtodos de
controle para outras espcies invasoras.

1. Tipos de experimentos


A experimentao do uso de substncias
qumicas, radiaes, ondas sonoras ou at mesmo, inimigos naturais, no controle de moluscos invasores, pode ser realizada de diferentes
formas com diferentes mtodos e tempos de
execuo. O objetivo, o custo e viabilidade so
as caractersticas que costumam limitar os experimentos (Zagatto & Bertoletti, 2006).

279

Planejamento experimental para


a seleo de mtodos de controle
populacional de moluscos invasores
Pereira et al.


Gambetta (2011) define muito bem as
fases de uma pesquisa experimental desde as
fases de laboratrio at a sua aplicao na indstria, como segue:

* Escala de bancada. Os experimentos
conduzidos em laboratrio so geralmente referenciados como em escala de bancada e se
caracterizam pela escala reduzida de uma situao hipoteticamente real. Em linhas gerais
uma boa fase de pesquisa em bancada gera resultados slidos e confiveis que permitem afirmar que a tecnologia promissora.

* Escala piloto. Os estudos em escala
piloto so a soluo adotada para sanar os limitantes encontrados em escala debancada. O
principal entrave utilizao dessas plantas-pilotoso os custos envolvidos no desenvolvimento, montagem e operao de tais unidades.
Esses custos, entretanto, so ordens de grandeza acima dos investimentos na montagem de
uma unidade de bancada, mas muito inferiores aos de uma tentativa frustrada de construir
uma planta industrial com base em premissas
equivocadas ou em informaes obtidas em escala de bancada.

* Escala industrial. A partir do projeto da planta-pilotoe das informaes obtidas
ao longo de sua operao, pode-se iniciar um
projeto de planta industrial, levando em conta
as caractersticas tcnicas e econmicas, que
permitiro construir uma planta industrial
competitiva. O marco final de uma pesquisa
cientfica bem sucedida exatamente quando
essa nova tecnologia adotada em uma planta
industrial de forma que seja competitiva frente
a outros processos e ou produtos e se complete
o ciclo da inovao. Dessa forma, recupera-se
o investimento realizado na pesquisa e no desenvolvimento, garantindo a sustentabilidade
do empreendimento em termos econmicos,
ambientais e sociais.


2. Fases de desenvolvimento
do organismo alvo

280


O planejamento de experimentos com
moluscos invasores lmnicos implica em uma
primeira pergunta: qual fase de desenvolvimento do animal deve ser exposta ao agente
controlador em meu experimento? Os moluscos lmnicos invasores (bivalves e gastrpodes)

apresentam uma fase planctnica, na forma


larval, e, duas fases bentnicas: recruta e adulta. A escolha das fases adequadas para a experimentao deve considerar uma srie de fatores,
dentre eles, a disponibilidade da mesma no ambiente aqutico para coleta. A Tabela I discrimina as vantagens e desvantagens de cada fase
em experimentos de seleo de agentes controladores.

3. Manuteno dos organismos-alvo


em laboratrio


Escolhida a fase a ser testada em um experimento, um novo desafio surge: como manter o organismo vivo em meu laboratrio?

At o momento no foi possvel reproduzir o mexilho-dourado em laboratrio, assim
como as espcies do gnero Corbicula. Desta
forma, os organismos-teste no so reproduzidos, mas apenas mantidos em laboratrio sob
condies adequadas sua sobrevivncia. O
sucesso da manuteno de organismos-alvo em
laboratrio depende de vrias etapas desde sua
coleta, transporte e manuteno para a sobrevida, at o seu uso.

3.1. Coleta do organismo-alvo


A coleta de larvas de L. fortunei feita
diretamente no plncton e as amostras devem
ser transportadas sob refrigerao (ver Captulos 10 e 11). Alguns cuidados devem ser
tomados durante o transporte de indivduos
adultos: no caso de espcies do gnero Corbicula, o ideal coletar os organismos e enrolar
em algodo ou gaze umedecida e acondicion-los em potes plsticos, que so posteriormente colocados em isopor com gelo em escamas.
Desta forma se reduz o metabolismo do animal, que no realizar a filtrao. E no havendo gua no se observa efeitos da degradao da qualidade da mesma sobre os bivalves.
Esta forma de acondicionamento apropriada
para larvas de espcies do gnero Corbicula, que tem curta permanncia no plncton.
Quando o animal desembalado e colocado
em bandeja com gua reconstituda (ver item
4.2.3 deste captulo) acrescida de alimento
com base em algas e rao de peixe, as larvas
so liberadas logo em seguida na bandeja e po-

CAPTULO 26
Seo 8

Tabela I. Vantagens e desvantagens do uso de diferentes fases de desenvolvimento de moluscos invasores em experimentos
visando seleo de mtodos de controle populacional.

Fases

Vantagens

Desvantagens

A coleta facilmente realizada com rede de plncton.

A presena de larvas no plncton pode ser determinada


pela sazonalidade.

a fase inicial do desenvolvimento, desta forma o


controle das larvas inibe a incrustao ou acumulao.
Poder requerer concentraes ou doses letais menos
elevadas.

Indivduos muito pequenos dificultando a avaliao da


letalidade.
Quando grandes volumes de gua so tratados, a seleo e quantificao de organismos so mais difceis.

Larvas
A utilizao de amostras concentradas de plncton nos
experimentos impossibilita a utilizao de um nmero
padro de indivduos gerando muita variabilidade nos
dados.
Difcil manuteno em laboratrio o que implica em
coleta de organismos a cada experimento.
Organismos recrutados em substratos artificiais tem
tamanho mais uniforme do que indivduos recrutados
em substratos naturais.

Recrutas

A presena de recrutas no macrofauna bentnica pode


ser determinada pela sazonalidade.
O recrutamento de organismos incrustantes ocorre em
substratos artificiais num tempo mnimo de exposio
de trs meses.

uma das fases de maior mobilidade, sendo


interessante compreender a ao dos mtodos de
controle nesta fase.

Indivduos muito pequenos dificultando a avaliao da


letalidade.

possvel padronizar o nmero de indivduos nos


testes com facilidade.
Manuteno em laboratrio possvel.
A coleta facilmente realizada manualmente ou por
meio de amostradores e substratos artificiais.

Requer maiores cuidados com manuteno (alimentao, renovao do meio, etc).

Indivduos grandes facilitam a avaliao da letalidade.

Poder requerer concentraes ou doses letais mais


elevadas.

Organismos recrutados em substratos artificiais tem


tamanho mais uniforme do que indivduos recrutados
em substratos naturais.
Adultos

O controle dos adultos inibe a produo larval.


Os organismos podem ser coletados durante todo o
ano.
possvel padronizar o nmero de indivduos nos
testes com facilidade.
Manuteno em laboratrio possvel.

dem ser facilmente removidas com pipeta de


Pasteur. Pouco se conhece sobre a reproduo
destes organismos sendo difcil reproduzi-los
em laboratrio.

Quanto ao mexilho-dourado (L. fortunei), com base no conhecimento de sua capacidade de resistncia ao dessecamento (Montalto
& Drago, 2003), o transporte sem a imerso em
gua oferece uma condio adequada sem per-

das considerveis (Campos, 2009). Transporte


similar ao relatado para os bivalves do gnero
Corbicula tambm podem ser realizados desde
que os aglomerados sejam bem lavados e desmembrados, cuidando-se para no danificar o
p do animal no momento da desagregao. O
transporte em gua possvel, mas requer ateno degradao da qualidade da mesma que
depende do tempo de deslocamento.

281

Planejamento experimental para


a seleo de mtodos de controle
populacional de moluscos invasores
Pereira et al.

3.2. Condies de manuteno


A manuteno do mexilho-dourado em
laboratrio depende do controle da qualidade
da gua, a qual est diretamente relacionada a
alguns parmetros tais como temperatura (2426C), pH (6,5-7,5), oxigenao (Saturado),
acmulo de metablitos (troca de gua).

3.3. Alimentao


As relaes ideais para sustentar uma
populao de mexilhes em funo de volumes de gua no so definitivas. Em seu estudo, Campos (2009) utiliza caixa de gua para
manuteno e aclimatao dos organismos em
laboratrio, alimentando-os com um composto
base de Saccharomyces cerevisae fornecidas
duas vezes ao dia e complementada com as microalgas Ankistrodesmus sp. e Pseudokirchneriella subcapitata

3.4. Cuidados de biossegurana:

o que fazer para o organismo

no fugir do laboratrio?

Quanto biossegurana, deve-se adotar medidas para a manipulao adequada
de agentes biolgicos, qumicos e fsicos para
prevenir acidentes e reduzir riscos inerentes s
atividades desenvolvidas. Tratando-se de um
organismo invasor torna-se necessrio adotar
prticas para a sua conteno dentro do laboratrio, principalmente em reas que tenham
ambientes no invadidos e propcios para que
o mexilho possa se estabelecer (rios, lagos e
lagoas). A adoo de boas prticas laboratoriais essencial para que se evite a disperso de
larvas, juvenis ou mesmo adultos na drenagem
urbana. Algumas prticas recomendadas para
manter um nvel adequado de biossegurana e
evitar a disperso deste organismo para outros
corpos hdricos so listadas a seguir.

282


* Capacitao das pessoas que manipulam os moluscos invasores;

* Controle do acesso ao laboratrio de
experimentos, cultivo/manuteno;

* Limpeza adequada dos estabelecimentos e equipamentos do laboratrio com agentes

(substncia oxidante) minimizando a possibilidade de transporte de larvas e juvenis;



* Uso de EPIs, vidrarias e equipamentos
minimizando a possibilidade de disperso do
organismo para fora da rea controlada do laboratrio;

* Tratar a gua descartada do cultivo,
que deve ser renovada a toda semana, tratar
descartes de resduos, como conchas e animais
mortos, com substncias oxidantes;

* Controlar e tratar efluentes mantendo
um sistema sanitrio diferenciado.

4. Planejando um experimento


O planejamento do experimento comea com a seleo adequada dos indivduos da
espcie-alvo, sua adequada manuteno em
sistema de cultivo, tipo de meio de cultivo, desenho experimental (delineamento), escolha
dos testes estatsticos a anlise de dados, e,
finalmente, a validao dos mtodos com base
em testes ecotoxicolgicos, visando avaliar os
possveis danos ambientais potenciais do tipo
de mtodo de controle populacional sobre a
biota aqutica ou at mesmo sobre operadores
do sistema de controle. A desconsiderao de
qualquer um destes passos pode invalidar os
dados obtidos em um experimento mal planejado.

Figura 1. Sistema de tanques para manuteno de mexilhes


em laboratrio (Caractersticas: 500 Litros; 24-26C; pH: 6,57,5; Oxignio saturado por aerao constante; Circulao de
gua constante; Filtrao em sistema de filtro biolgico e
substituio semanal de um tero do volume dos tanques)
(Campos, 2009).

CAPTULO 26
Seo 8


4.1. Seleo e preparao dos

organismos alvos

Para experimentos com larvas do mexilho-dourado, so geralmente escolhidas larvas vliger de charneira reta e vliger umbonada de acordo com Santos et al. (2005). Para os
experimentos com adultos, dentre os critrios
de seleo, devem ser considerados alm do
tamanho (Fig. 2), caractersticas vitais como
produo de bisso, filtrao e locomoo. Os
organismos que no produzem bisso ou que
apresentam suas conchas abertas sem atividade
filtrante devem ser descartados. No caso de organismos adultos, aconselhvel a limpeza das
conchas com escova de dente para que se removam algas perifticas com potencial de desenvolvimento dentro da unidade experimental.

4.2. Meio de Cultivo


No caso dos organismos aquticos o meio
de cultivo o tipo de gua na qual o mesmo vai
permanecer durante todo o experimento. A qualidade desta gua implica em diferentes interferncias nos resultados finais do experimento.
Portanto a escolha de um determinado meio de
cultivo deve considerar os objetivos do experimento, o tempo de durao do mesmo, a viabilidade tcnica e possveis implicaes da qualidade
do meio sobre o desenvolvimento e manuteno
do organismo alvo e na qualidade dos resultados.

4.2.1. gua bruta


A utilizao da gua bruta em experimentos tem como objetivo avaliar a interferncia da qualidade da gua do local sobre o mtodo de controle (fsico, qumico ou biolgico).
A gua bruta pode ser um meio utilizado em
testes de bancada e estao piloto. Santos, C. P.
(2011) avaliou a ao da luz ultravioleta sobre
larvas do mexilho-dourado em gua bruta em
experimento utilizando estao-piloto, com o
objetivo de avaliar a relao da turbidez com
a eficincia do tratamento. Soares et al. (2009)
utilizaram gua bruta para avaliar a toxicidade
do sulfato de cobre sobre indivduos adultos do
mexilho-dourado em testes de bancada. Os
autores escolheram utilizar gua bruta, devido
presena de slidos suspensos. A presena de

Figura 2. Seleo de tamanho de L. fortunei para experimentos em laboratrio (Fernandes & Coutinho, 2008).

slidos na gua um fator determinante para a


incorporao de metais por organismos filtradores (Callil & Junk, 1999).

4.2.2. gua deionizada


A utilizao da gua deionizada em experimentos busca eliminar a interferncia da
qualidade da gua sobre o mtodo de controle
(fsico, qumico ou biolgico). A gua deionizada pode ser utilizada em testes de bancada e
estao-piloto, onde o tempo de residncia do
fluido nos canos e muito pequeno e o experimento de curto perodo de durao. Santos, C.
P. (2011) avaliou a ao da luz ultravioleta sobre
larvas do mexilho-dourado em gua deionizada, em experimento utilizando estao-piloto,
com o objetivo de eliminar turbidez e aumentar eficincia do tratamento. A desvantagem da
gua deionizada que pode causar desequilbrio
osmtico nos organismos-alvo mais sensveis,
principalmente em experimentos com maior
durao. No entanto, Santos, C. P. (2011) no
detectou diferenas significativas quanto mortalidade entre grupos controle com gua bruta e
gua deionizada em seus experimentos.

4.2.3. gua reconstituda


O uso de gua reconstituda (Fig. 3) em
ensaios com organismos aquticos padro em
ensaios ecotoxicolgicos, pois suas caractersticas fsico-qumicas so mais estveis devido
ao tamponamento. guas podem se reconstitudas a partir de guas brutas ou guas deionizadas. Desta forma as caractersticas qumicas
das guas so ajustadas para aquelas desejadas
no experimento. No caso da reconstituio da
gua a partir da gua deionizada, garantida a
ausncia de matria orgnica, que pode degra-

283

Planejamento experimental para


a seleo de mtodos de controle
populacional de moluscos invasores
Pereira et al.

dar-se e alterar a qualidade da gua. Pereira et


al. (2011b) utilizaram gua reconstituda para a
realizao de testes visando seleo de agentes microbianos no controle de L. fortunei.

4.3. Delineamento

4.3.1. Nmero de indivduos


O nmero de indivduos usados em experimentos necessita ser considerado em funo da variabilidade e representatividade ob-

tida dentro das anlises estatsticas a serem


adotadas. Estudos de experimentos desenhados para clculos de concentrao letal (CL 50)
com o mexilho-dourado geralmente utilizam
um nmero de 10 ou 20 indivduos em todas as
rplicas e de 3 a 5 replicaes das concentraes (Patrcio et al., 2003; Soares et al., 2009;
Campos, 2009). Pereira et al. (2011b) utilizaram 10 indivduos e 5 replicaes para cada
tratamento. Um caminho a ser adotado antes
da definio do delineamento do experimento
realizar experimentos pilotos com 10, 20 ou
30 indivduos e 3 a 5 replicaes das concentraes e escolher o modelo mais otimizado do
experimento com menor variao dos dados.

4.3.2. Repetio


O experimento deve ser repetido no mnimo trs vezes para validao dos resultados,
confirmando que os mesmos so devido ao
agente testado, e no fruto do acaso.

4.3.3. Controle negativo e positivo


fundamental que todo planejamento de
experimento inclua um controle (testemunha)
que seja mantido sobre as mesmas condies
dos organismos-alvo, apenas sem a insero do
composto/organismo a ser avaliado. Esse tipo de
controle tambm chamado controle negativo.
Em ensaios onde j so conhecidos compostos ou
organismos que no apresentem efeitos sobre o
organismo-alvo (efeito neutro), esses so utilizados
nas mesmas condies de todas as rplicas do
ensaio, sendo denominado controle positivo.

4.3.4. Aleatorizao


Impedir que a heterogeneidade de fatores ambientais que ocorrem de forma diferencial no espao possam influenciar os resultados
dos ensaios.

284
Figura 3. Procedimento para a preparao de gua reconstituda.

4.3.5. Condies ambientais da


sala de experimentos


Por se tratar de experimentos com organismos aquticos no necessrio controle da
umidade da sala. A temperatura da sala deve
permanecer entre 21 e 22C. No necessria

CAPTULO 26
Seo 8

a iluminao (fotoperodo), j que as condies


de aplicao em campo, onde as incrustaes
ocorrem muitas vezes em tubulaes e equipamentos, no apresentam luminosidade.

4.3.6. Exemplos de experimentos


So descritos a seguir alguns modelos de
experimentos realizados para selecionar mtodos de controle de moluscos invasores.

4.3.6.1. Controle biolgico: seleo de
agentes microbianos

Um exemplo de experimento, em escala
de bancada, para a avaliao da ao de agentes microbianos e ou produtos formulados sobre indivduos adultos do mexilho-dourado
descrita a seguir (Fig. 4).

4.3.6.2 Controle fsico

Dentre os mtodos de controle fsico so
descritos abaixo, dois exemplos de experimentos, um com ondas ultrassnicas e outro com
luz ultravioleta.

4.3.6.2.1. Ultrassom

Um exemplo de experimento, em escala
de bancada, para a avaliao da ao de ondas

ultrassnicas sobre larvas de L. fortunei e C.


fluminea descrita a seguir (Fig. 5).

4.3.6.2.2. Luz ultravioleta (UV)

Um exemplo de experimento, em escala
piloto, para avaliao da ao germicida de luz
ultravioleta sobre larvas do mexilho-dourado
descrita a seguir (Fig. 6) de acordo com Santos, C. P. (2011).

4.3.6.3. Controle qumico: substncias
moluscidas

Um exemplo de experimento, em escala de bancada, para a avaliao da ao de um
moluscida (sulfato de cobre) sobre indivduos
adultos de L. fortunei descrito a seguir (Fig.
7), de acordo com Soares et al. (2009). O exemplo descrito pode ser adaptado para avaliao
de outras substncias qumicas.

5. Avaliao


A avaliao dos resultados dos experimentos requer, primeiramente, o estabelecimento de critrios de avaliao da mortalidade,
bem como clculos e procedimentos estatsticos adequados para consolidar o experimento
atravs da correta interpretao dos resultados,

285

Figura 4. Procedimento para a preparao de experimento para seleo de agentes microbianos.

Planejamento experimental para


a seleo de mtodos de controle
populacional de moluscos invasores
Pereira et al.

Figura 5. Procedimento para a preparao de experimento para avaliar a atuao de ondas ultrassnicas no controle da populao larval de L. fortunei e C. fluminea.

bem como fornecer subsdios para a tomada de


deciso referente aplicao da tecnologia em
campo.

286

5.1. Critrios de letalidade


Testes de toxicidade realizados com mexilhes, geralmente causam uma grande variabilidade devido capacidade de isolar-se do
meio externo (Cataldo et al., 2002a; Rajagopal et al., 2003), necessitando de uma ateno
maior no momento da definio da condio
de vida do mexilho, aps a sua exposio a
um biocida. Torna-se necessrio, neste perodo, a observao das reaes vitais do mexilho
o qual, muito vezes, permanece em estado de
defesa, mantendo as valvas fechadas. Sendo assim, alguns estudos inserem um perodo (geralmente 48h), aps a exposio, para confirmar
as reaes vitais dos organismos sobreviventes.
Dentro deste perodo consideram a morte do
organismo, ao confirmar sua inrcia, falta de
reao a estmulos (como um toque com basto
de vidro) e, tambm, apresentar valvas abertas

e o manto exposto (Darrigran & Damborenea,


2001; Campos, 2009; Soares et al., 2009).

Santos, C. P. (2011) avalia a mortalidade
de larvas do mexilho-dourado com base nos critrios de mobilidade, aduo valvar e ausncia de
batimentos do estilete cristalino (Tab. II). Soares
et al. (2009) definem alguns critrios, com base
em Morton (1973), para uma avaliao quali-quantitativa do comportamento de L. fortunei
exposto ao sulfato de cobre. Com esses critrios
os autores buscaram no apenas avaliar a mortalidade, mas compreender a ao da substncia
sobre o comportamento do molusco (Tab. II).

5.2. Confirmao da ao letal

de microrganismos

Aps a constatao da morte de um organismo-alvo necessrio confirmar se este foi
morto realmente pelo microrganismo inoculado. Uma maneira clssica o reisolamento do
microrganismo aps a inoculao do organismo-alvo em um meio de cultura apropriado
para o crescimento do microrganismo testado

CAPTULO 26
Seo 8

5.3.1. Mortalidade absoluta (MA)


Nmero absoluto de indivduos mortos
no experimento para cada tratamento (Alves,
1998).

5.3.2. Mortalidade corrigida (MC)


Considera a mortalidade ocorrida no
tratamento-testemunha (sem aplicao do
agente estressor) no clculo. A correo da
mortalidade pode ser feita pelo uso da frmula
de Abbott, como segue abaixo, (Alves, 1998).

Importante destacar que experimentos
com mortalidade maior de 10% no tratamento
controle devem ser excludos e repetidos.


5.3.3. Relao dose-resposta ou

concentrao-resposta

Figura 6. Procedimento para a preparao de experimento


para avaliar a atuao de radiao ultravioleta no controle da
populao larval de L. fortunei e C. fluminea.

(Fig. 9). Esta confirmao tambm pode ser


feita por mtodos moleculares e histolgicos
(Molloy & Mayer, 2007).

5.3. Interpretao de resultados


Em ensaios de avaliao de produtos e/
ou microrganismos para o controle de pragas se
utilizam alguns clculos padres e procedimentos estatsticos que permitem a inferncia sobre
a efetividade dos mesmos sobre a praga-alvo.


Descreve a mudana em efeito sobre um
organismo causado por diferentes nveis de exposio (ou concentraes) a um estressor (que
pode ser qumico, fsico ou biolgico), aps
certo tempo de exposio (Crump et al., 1976).
O termo dose pode ser utilizado quando se
sabe exatamente a quantidade de substncia a
que os organismos foram submetidos, quando
no se conhece a quantidade de agente estressor que atingiu diretamente o organismo-alvo,
o termo correto concentrao (Alves, 1998).
Em experimentos com substncias qumicas,
ondas ultrassnicas e radiaes ultravioleta,
possvel obter a dosagem. J aqueles realizados
com agentes microbianos, apenas a concentrao obtida.

O estudo de dose-resposta e desenvolvimento de modelos de dose-resposta primordial para determinar as doses seguras e
letais das substncias as quais os organismos
so submetidos.

Graficamente, os dados de dose-resposta so demonstrados em uma curva de dose-resposta como um grfico X-Y relacionando a
magnitude do agente de controle (ex.: concentrao de bactrias/ml, dose radiao ultravioleta) resposta dos organismos (no caso, mexilho-dourado). A resposta avaliada como

287

Planejamento experimental para


a seleo de mtodos de controle
populacional de moluscos invasores
Pereira et al.

Figura 7. Procedimento para a preparao de experimento para avaliar a atuao de substncias qumicas no controle da populao adulta de L. fortunei.

288
Figura 8. Mexilhes mortos aps infeco por microrganismo (isolado Bb7B) e reisolamento em placa com meio de cultura.
Fotos: A.S. de Oliveira e D. Pereira.

CAPTULO 26
Seo 8

Tabela II. Indicadores comportamentais e de letalidade para L. fortunei em experimentos: larvas de acordo com Santos, C. P.
(2011) e adultos de acordo com Soares et al. (2009), com base em Morton (1973).

Indicadores

Definio

Larvas
M

Presena de mobilidade (M).

AV

Aduo valvar aps estmulo mecnico.

AB

Ausncia dos batimentos do estilete cristalino aps estmulo mecnico.

Adultos
M

Nmero de indivduos em deslocamento (M) pela superfcie de vidro do aqurio.

IM

Nmero de indivduos ssseis (IM) no aqurio.

Nmero de indivduos com valvas abertas (A).

Nmero de indivduos com valvas fechadas (F).

DA

A densidade de indivduos aglomerados (DA) foi obtida pelo somatrio de indivduos aglomerados
dividido pelo nmero de aglomerados.

PE

Nmero de indivduos com o p exposto (PE).

PR

Nmero de indivduos com o retrado (PR).

SE

Os sifes expostos (SE) indicam filtrao ativa; os sifes so considerados expostos quando ultrapassam
a borda posterior da concha.

SR

Os sifes retrados (SR) indicam filtrao no ativa; os sifes so considerados no expostos quando no
ultrapassam a borda posterior da concha.

RTP

A reao ao toque positiva (RTP) indicada pela movimentao das valvas ou pela retrao do p ou
sifes, por meio do contato com a extremidade de um palito de madeira.

RTN

A reao ao toque negativa (RTN) indicada quando as valvas no se fecham ou o p e sifes no se


retraem por meio do contato com a extremidade de um palito de madeira.

Os indivduos vivos (V) retraem o p e sifes, fechando as valvas, quando tocados com a extremidade de
um palito de madeira; quando as valvas esto fechadas, via dissecao se observa a movimentao das
brnquias ou retrao do p, quando tocados com a extremidade de uma agulha histolgica; os indivduos vivos apresentam uma cor amarela ou marrom intensa.

MO

Os indivduos mortos (MO) no retraem o p e sifes, nem fecham as valvas, quando tocados com a
extremidade de um palito de madeira; quando as valvas esto fechadas, via dissecao no se observa
movimentao das brnquias ou retrao do p, quando tocados com a extremidade de uma agulha
histolgica ou de um bisturi; a cor dos indivduos mortos esbranquiada.

mortalidade, e pode ser expressa em nmeros


absolutos ou como porcentual de indivduos
mortos.

A dose geralmente plotada no eixo X,
enquanto a mortalidade plotada no eixo Y.
O primeiro ponto no grfico onde a resposta
acima de zero (ou acima da resposta do tratamento controle), denominado dose limiar.

A mortalidade tambm varia em funo do
tempo. Sendo assim, estudos preliminares devem
testar diferentes tempos de exposio dependendo do objetivo do experimento e dos agentes de
controle testados. No caso do controle microbiano, a ao txica da bactria evolui com o passar

do tempo, sendo necessrio de 8 a 10 dias para se


verificar uma ao efetiva (Fig. 11).

5.3.4. Concentrao Letal Mdia (CL50)

e Tempo Letal Mdio (TL50)

Anlise estatstica de curvas de dose
resposta pode ser realizada por mtodos de
regresso como Probit e Logit. Alm desta anlise, so calculados as regresses lineares e os
coeficientes de determinao, com base nos dados de mortalidade e concentraes do agente
estressor. Regresso do tipo Probit a mais utilizada para determinao da Concentrao Le-

289

Planejamento experimental para


a seleo de mtodos de controle
populacional de moluscos invasores
Pereira et al.

tal Mdia (CL 50) e Tempo Letal Mdio (TL 50) a


partir das curvas de dose resposta.

Os clculos de concentrao letal (CL)
determinam a quantidade necessria do agente estressor para que ocorra a mortalidade de
50% (CL 50) ou 95% (CL95) da populao ensaiada. Os clculos de tempo letal (TL) determinam o tempo necessrio de exposio do
organismo-alvo ao agente estressor para que
ocorra a mortalidade de 50% (TL 50) ou 95%
(TL95) da populao ensaiada. Devem ser considerados os limites de confiana e a significncia do teste.

A anlise conjunta dos parmetros descritivos de mortalidade absoluta e corrigida,
juntamente com os dados obtidos via regresso de Probit, permite a visualizao de quais
tratamentos e concentraes so mais efetivos
no controle de determinada praga-alvo (Tab.
III).

290

Figura 9. Mortalidade de Limnoperna fortunei exposto a Bacillus thuringiensis sv. Israelensis IIRAC 22 em experimento de
bancada: relao dose-resposta

5.3.5. Anlise de dados


Soares et al. (2009) utilizaram diferentes
abordagens na anlise de dados de mortalidade
e de critrios de letalidade do mexilho-dourado exposto ao sulfato de cobre. Por meio da
anlise de varincia (ANOVA, Dunnet a posteriori), com nvel de significncia de 95%,
compararam tratamentos e controles quanto
mortalidade. Utilizaram anlise multivariada
para avaliar os dados obtidos pelas observaes
do comportamento (com base nos critrios discriminados na Tab. II) do mexilho-dourado
frente exposio ao controlador qumico em
duas etapas: a primeira, anlise de agrupamento (matriz de correlao de Pearson entre variveis; agrupamento pelo mtodo do centroide)
(Fig. 12) e por meio da Anlise de Componentes Principais (ACP) (Fig. 13), com a finalidade
de ordenar e agrupar as variveis que melhor
explicam o comportamento; a segunda, por
meio de anlise de discriminante (AD) (Fig.
14), com a finalidade de discriminar os diferentes tratamentos quanto aos padres de comportamento.

Os autores acima verificaram, por meio
da ACP (Fig. 12), que os componentes 1 e 2
responderam por 55,96% da varincia dos indicadores comportamentais e de letalidade.
O componente 1 (35,05%) apresentou forte

Figura 10. Mortalidade de Limnoperna fortunei exposto a Bacillus thuringiensis sv. Israelensis IIRAC 22 em experimento de
bancada: relao dose-resposta ao longo do tempo.

correlao positiva com o nmero de indivduos com sifes expostos SE (0,935); com o
nmero de indivduos com valvas abertas A
(0,926); com a densidade de indivduos aglomerados DA (0,604) e o nmero de indivduos com reao ao toque positiva RTP (0,573).
Tambm apresentou forte correlao negativa
com o nmero de indivduos com sifes no expostos SNE (-0,935); o nmero de indivduos
com valvas fechadas F(-0,926); com o nmero de indivduos com reao ao toque negativa
RTN (-0,641) e com concentraes de sulfato de cobre utilizadas C (-0,600). O componente 2 (20,91%) apresentou forte correlao
positiva com o nmero de indivduos mortos
MO (0,949); com a temperatura do aqurio
T (0,865) e com o tempo de exposio TE
(0,844). Este componente tambm apresentou
forte correlao negativa com o nmero de in-

CAPTULO 26
Seo 8

divduos vivos V (-0,949). A ACP (Fig. 12)


ordenou os indicadores comportamento e letalidade de L. fortunei em concordncia com
os grupos (G1 a G5) formados por meio da
anlise de agrupamento hierrquico (Fig. 13)
dos mesmos indicadores: G1 (F, SNE, RTN e

os mexilhes apresentaram pouca mobilidade


durante os experimentos. O G5 refere-se os
organismos vivos. A avaliao comportamental do mexilho durante os experimentos permitiu definir parmetros de comportamento
para o entendimento do efeito moluscida da

Tabela III. Mortalidade corrigida de L. fortunei e concentrao letal (CL50) de duas variedades de B. thuringiensis. Experimentos de bancada realizados por Pereira et al. (2011b).

Tratamento

Mortalidade corrigida (%)

CL50

B. thuringiensis sv. israelensis IRAC22


(107 cl./ml)

72

7,6 x 106 cl/mL

B. thuringiensis sv. kurtaski HD-1


(107 cl./ml)

62,5

8,65 x 106 cl/mL

C); G2 (MO, T e TE); G3 (nmero de indivduos com o p retrado PNE, nmero de


indivduos com o p exposto PE, nmero de
indivduos ssseis IMV e o nmero de indivduos em deslocamento MV); G4 (RTP,
DA, A e SE) e G5 (V). O G1 reuniu as variveis
que indicaram filtrao inativa e altas concentraes de sulfato de cobre. Ao contrrio do
G1, o G4 reuniu variveis que indicaram filtrao ativa e a formao de aglomerados. O
G2 reuniu variveis que indicaram a mortalidade ao longo do tempo associada ao aumento da temperatura nos aqurios. O G3 reuniu
variveis relacionadas mobilidade, que no
contriburam para a descrio dos padres de
comportamento dos organismos testes, pois

substncia testada. Os organismos quando expostos reagiram imediatamente fechando as


valvas. Aps alguns minutos abriam as valvas
e iniciavam novamente a atividade de filtrao de forma pouco intensa, como pode ser
observado por meio do nvel de exposio dos
sifes. No entanto, com o passar do tempo de
exposio, o efeito das concentraes sobre
os moluscos inibiu a atividade de filtrao e
a mobilidade dos mexilhes. A anlise multivariada demonstrou claramente a distino
entre grupos de filtrao ativa e inativa. Aps
a exposio ao cobre os mexilhes diminuram a atividade de filtrao, a mobilidade e
a reao ao toque, demonstrando um estado
letrgico. Outros indivduos mantiveram as

291
Figura 11. Anlise multivariada dos
indicadores comportamentais e de
letalidade de Limnoperna fortunei:
agrupamento hierrquico (mtodo
do centroide) com base em matriz de
correlao (Pearson) entre os indicadores comportamentais e de letalidade (grupos 1 e 2: G1 e G2) (Fonte:
Soares et al., 2009).

Planejamento experimental para


a seleo de mtodos de controle
populacional de moluscos invasores
Pereira et al.

Figura 12. Anlise multivariada dos


indicadores comportamentais e de
letalidade de Limnoperna fortunei.
As variveis agrupadas no dendograma ilustrado na figura anterior
apresentam a mesma relao na ordenao obtida por anlise de componentes principais (ACP). (grupos
1 a 4 do dendograma, G1 a G4) dos
indicadores de letalidade. (Fonte: Soares et al., 2009).

Figura 13. Ordenao (anlise de discriminante cannica) dos tratamentos e controles quanto aos indicadores de comportamento e letalidade
de Limnoperna fortunei. (Fonte: Soares et al., 2009).

292

valvas fechadas. Esse comportamento indicou


provavelmente um mecanismo de reao do
bivalve diante da sinalizao da presena de
uma substncia de elevada toxicidade.

Por meio da AD (Fig. 14), as funes 1 e
2 responderam 94,8% da varincia dos tratamentos quanto aos indicadores comportamen-

tais e de letalidade. A funo 1 (67,8%) apresentou forte correlao positiva com a varivel
discriminante RTN (0,464) e negativa com A
(-0,600). A funo 2 (27,0%) apresentou forte
correlao positiva com a varivel discriminante RTP (0,488) e negativa com TE (-0,331).
Com base nesta anlise foi possvel diferenciar

CAPTULO 26
Seo 8

as observaes referentes ao controle (sem adio de sulfato de cobre) do tratamento 4,872


mg L-1, e estes dos demais tratamentos (9,135
mg L-1 e 15,225 mg L-1). A avaliao proposta por meio de indicadores de comportamento
e letalidade do mexilho-dourado, durante
os testes de toxicidade consistiu num complemento eficiente da avaliao da toxicidade do
sulfato de cobre ao mexilho-dourado e pode
ser adaptada em experimentos com outras
substncias que causam efeitos diferenciados
sobre a fisiologia e comportamento das espcies alvos. Tambm pode ser adaptada aos
experimentos realizados com outras espcies
de bivalves. Critrios especficos a espcies de
gastrpodes devem ser desenvolvidos ou e/ou
adaptados.

5.4. Avaliao ecotoxicolgica


Duas abordagens ecotoxicolgicas finalizam a avaliao e seleo de mtodos de
controle populacional de moluscos invasores:
uma, a avaliao da toxicidade do meio (gua)
no qual aplicado o tratamento; outra, a avaliao ecotoxicolgica da substncia moluscida
ou do produto formulado.

5.4.1. Avaliao ecotoxicolgica

da gua tratada

Visa verificar se a presena de subprodutos ou metablitos no meio tratado confere toxicidade a organismos representantes da
biota aqutica. Santos, C. P. (2011) avaliou a
toxicidade de gua submetida radiao ultravioleta, para o controle de larvas do mexilho-dourado, por meio de ensaios ecotoxicolgicos
crnicos com organismos-teste de trs nveis
trficos (Pimephales promelas, Ceriodaphnia
dubia e Pseudokirchneriella subcapitata).


5.4.2. Avaliao ecotoxicolgica de

substncias moluscidas ou

produto formulado

Visa verificar se a substncia moluscida
ou produtos formulados apresentam toxicidade s espcies no-alvo. Vrias espcies de
organismos-teste no-alvo podem ser utilizadas aqui, incluindo espcies exticas e nativas.
A maioria das espcies utilizadas como organismos-teste no Brasil hoje, extica, mas os
mtodos para utiliz-las so padronizados pela
ABNT, o que garante uma maior confiabilidade e repetibilidade dos resultados.

Seria interessante padronizar testes ecotoxicolgicos com espcies de bivalves nativos,
mas muitas dificuldades podem ser encontradas neste sentido. Um fato a se considerar
que os bivalves nativos, em sua maioria, no
so facilmente criados em laboratrio e seus
aspectos reprodutivos so muito pouco conhecidos. No caso do mexilho-dourado, a escolha
de um organismo-teste no alvo filogeneticamente relacionado se torna impossvel, uma
vez que as demais espcies da famlia Mytilidae
so todas marinhas. Quanto aos corbiculdeos,
a padronizao de testes com espcies do gnero
Cyanocyclas pode ser uma alternativa, mas requer estudos prvios sobre a criao e reproduo desta espcie em laboratrio. A busca de indicadores representantes das famlias Hyriidae
e Mycetopodiade tambm se torna uma tarefa
difcil, pois muitas das espcies utilizam peixes em seu desenvolvimento larval parasitrio.
Alm disso, muitas espcies destas duas ltimas
famlias apresentam populaes reduzidas ou
enquadradas em alguma categoria de ameaa de
extino. Uma alternativa seria padronizar testes com espcies da famlia Sphaeriidae que so
mais abundantes, no apresentam ciclo parasitrio e apresentam ampla distribuio no Brasil.

293

Seo
Controle populacional
de bivalves invasores:
mtodos qumicos

CAPTULO 27
Controle Qumico:
conceitos bsicos
Maria Teresa Raya Rodriguez


As pesquisas e o uso prtico de agentes
qumicos constituem-se nas primeiras tentativas para o controle populacional de bivalves invasores. As razes para tanto esto associadas
facilidade de sua aplicao e a experincias
j conhecidas da ao desses agentes qumicos
como agentes desinfetantes e bactericidas no
tratamento de guas para os mais diversos usos
pelo homem.

Desta forma, natural que encontremos
na literatura avaliaes para o controle de bivalves com substncias qumicas j amplamente
utilizadas para o controle de outras espcies.
Via de regra, a aplicao de agentes qumicos
apresenta aspectos operacionais extremamente
simples, pois o agente est disponvel no mercado a custos relativamente baixos, a distribuio
do produto no corpo dgua muitas vezes pode
ser direta ou, quando muito, exigir a simples
dissoluo e diluio antes dessa distribuio
e, s vezes, no requer equipamentos especiais
para a distribuio no corpo dgua ou, quando
muito, simples dosadores.


Entretanto, o uso desses agentes qumicos vem encontrando restries na medida em
que pesquisas so desenvolvidas sobre os efeitos negativos sobre outras espcies e sobre o
meio ambiente como um todo.

Estas pesquisas, sobre efeitos indesejveis dos agentes qumicos em guas superficiais, tm promovido alteraes nas legislaes
ambientais, limitando o lanamento de produtos qumicos em guas superficiais. Assim,
as doses dos agentes qumicos permitidas pela
legislao, podem estar aqum das doses necessrias para o controle eficaz da populao de
bivalves.

Cabe salientar que os agentes qumicos
usualmente utilizados no controle populacional de bivalves so classificados como substncias txicas.

Em termos legais, devemos sempre consultar os rgos de regulao e fiscalizao do
meio ambiente e solicitar a devida autorizao
ou licena ambiental para a aplicao de agentes qumicos nos corpos dgua, sob pena de

297

Controle Qumico:
conceitos bsicos
Rodriguez M. T. R.

estarmos cometendo um ato ilcito enquadrado


como crime ambiental.

Vrias famlias de agentes qumicos tm
sido empregadas para o controle populacional
pretendido. Entre eles podemos citar substncias oxidantes e sais, tais como, cloro e seus derivados (dixido de cloro, cloroaminas e cido
hipoclordrico), compostos de bromo, oznio,
perxido de hidrognio, permanganato de potssio, nitrato de amnia e sulfato de cobre.

As tintas anti-incrustantes tm sido tradicionalmente aplicadas para a proteo de
cascos de embarcaes martimas com a finalidade de inibir a fixao e o desenvolvimento
de organismos, pela liberao de um biocida
misturado tinta.

Estes biocidas como o TBTO (xido de
estanho tributil, um xido de organoestnicos),
tm sido utilizados com sucesso para a preveno da incrustao de bivalves. Entretanto, estes compostos qumicos so substncias txicas
que levaram alguns pases a proibir seu uso.

Atualmente, as pesquisas vm sendo desenvolvidas com o intuito de produzir tintas
anti-incrustantes base de silicone, substncia
no txica, que impede ou diminui consideravelmente a fora de fixao para os bivalves.
Tintas a base de zinco tambm parecem muito
promissoras.

Assim, as pesquisas com tintas anti-incrustantes devem considerar, alm da eficcia
como proteo incrustao em superfcies, a
minimizao dos impactos ambientais para os
ambientes aquticos.

To importante quanto escolha do
agente qumico a ser utilizado, a forma como
o mesmo deve ser distribudo no corpo dgua.
Esta distribuio est associada ao pretendida. Basicamente temos duas situaes:

a) Ao Corretiva- so usadas depois dos
bivalves invasores terem se estabelecido no corpo dgua.

298


b) Ao Preventiva- so utilizadas para
que os bivalves invasores no se estabeleam no
corpo dgua que se pretende proteger.


Exemplo de ao corretiva a aplicao
do agente qumico nos momentos em que os
bivalves adultos esto mais vulnerveis, situao que ocorre logo aps o perodo de desova;
os mais jovens so mais susceptveis ao do
agente qumico.

Em se tratando de ao preventiva, temos trs estratgias a serem consideradas na
aplicao do agente qumico, a saber:

* Ao intermitente aplicado a intervalos de tempo (por exemplo, a cada 6 horas) com
o intuito de destruir os bivalves nas primeiras
fases de vida, situao em que se encontram
mais vulnerveis.

* Ao semicontnua aplicado a intervalos regulares de tempo, por exemplo, de 15
minutos, com o intuito de prejudicar que os bivalves realizem a filtragem fechando a concha.
Ao reabri-la, aps 15 a 30 minutos, ficam submetidos nova carga do agente qumico.

* Ao contnua aplicada ininterruptamente com o propsito de proteger sistemas de
alta segurana, onde a ocorrncia de qualquer tipo
de incrustao no pode ser tolerada.

Visa causar a mortalidade de espcies
adultas, prejudicar a reproduo e destruir as
espcies jovens.

Devemos em nossas avaliaes, com o
uso de agentes qumicos, para o controle populacional de bivalves, levar em considerao
a relao causa (ao do agente qumico) e
efeito (sobre os organismos). A causa sempre
ser funo da dose a que o organismo ficou
submetido. A dose, por sua vez, funo da
concentrao do agente qumico e do tempo de
exposio do organismo.

Para sistemas fechados (estticos) o clculo
da dose relativamente simples porque a concentrao do agente qumico e o tempo de exposio
do organismo so dados fceis de serem obtidos.
Para sistemas abertos (com fluxo), entretanto, o
clculo da dose tornar-se mais complexo, pois
exige o conhecimento da dinmica do processo.

CAPTULO 28
Microencapsulados
Svio Henrique Calazans Campos
Flavio da Costa Fernandes

Introduo


O desenvolvimento de tcnicas inovadoras, produtos, mtodos e substncias alternativas, para o controle de organismos invasores
(bioincrustaes) no mundo esto sendo impulsionando pela busca por maior eficincia com
baixo custo, associado a um baixo impacto ambiental e operacional. Neste contexto, biocidas
microencapsulados foram propostos em estudos realizados pela universidade de Cambridge-UK e atualmente so comercializados.

Microcpsulas so utilizadas em diferentes
atividades tecnolgicas (tintas, txteis, eletrnicas
etc.) sendo mais empregadas na indstria alimentcia e farmacolgica. As razes para o encapsulamento so incontveis, e para o uso no controle
de mexilhes, ele serve para direcionar a entrega de substncias, isolar e controlar a dissoluo
de biocidas evitando a degradao do princpio
ativo. As microcpsulas propostas para o controle de mexilhes so produzidas como pequenas
partculas (3-800 m) que contm compostos
ativos (20-30%) revestidos por uma cobertura

ou proteo, geralmente um invlucro nutritivo


ou atrativo (alginatos, protenas, lipdeos etc.)
(Fig. 1). Os microencapsulados testados contra
o mexilho-dourado no Brasil foram partculas
microscpicas com tamanhos variados (entre
10-500 m) feitas de uma mistura de goma,
leo e cera que recobrem biocidas do tipo
cloreto de potssio e ou compostos de aminas
(Fig. 2) (Campos, 2009) tendo sido produzidos
de forma experimental e atualmente, a sua
produo est estabilizada e sendo oferecida
de forma comercial (BioBullet.com) (Quadro
1). O revestimento externo de cido graxo e o
ncleo txico para mexilhes so inofensivos
para os seres humanos. A toxicidade para
outros animais aquticos depender das
concentraes ministradas, as quais geralmente
esto bem acima das utilizadas contra os
mexilhes. As substncias que compem os
microencapsulados utilizados so aprovadas
para a utilizao em tratamento de gua potvel
na Europa (cloreto de potssio e compostos de
amnia quartenria).

Os mtodos qumicos comuns (substn-

299

Microencapsulados
Calazans C. & Fernandes

Figura 1. A ideia de encapsulamento de biocida para o controle de mexilhes. A - representao de biocida encapsulado; B - fotografia de endoscpio, biocida microencapsulado
sendo transportado pelas brnquias de um mexilho-zebra
vivo (crditos: Dr. Paul Elliot, Universidade de Cambridge-UK).
Microcpsulas similares foram utilizadas em testes com o
Mexilho-Dourado.

Figura 2. Foto de microcpsulas de KCl utilizadas em experimentos com Limnoperna fortunei (adaptado de Campos,
2009).

cias dissolvidas na gua) provocam a reao de


defesa natural dos mexilhes, os quais fecham
suas conchas por at 3 semanas resistindo s
dosagens do biocida (Cataldo et al., 2002,
Mansur et al., 2003). Esta capacidade de proteo dos mexilhes sobre os biocidas dissolvidos
amplificam o risco de dano ambiental, principalmente sobre os organismos no-alvo, alm
do alto custo com dosagens contnuas para a
remoo dos organismos. Desta forma, os microencapsulados tornam-se uma alternativa s
substncias dissolvidas, as quais so amplamente utilizadas com um alto custo ambiental
e baixa eficincia contra mexilhes (bivalves
filtradores).

Ao considerarmos que os mexilhes so
filtradores tpicos (retiram seu alimento do
material suspenso na gua), o uso de biocidas
microencapsulados surge como uma soluo
sedutora, na qual possibilita diminuir o volume do biocida utilizado. Desta forma, ao filtrar
as partculas suspensas na gua, os mexilhes
concentram no estmago a dose especfica do
biocida que seria dispersado (Aldridge et al.,
2006). Esta estratgia de dosagem aumenta a
aceitabilidade do mexilho diminuindo a sua
reao de defesa (fechamento das conchas)
intensificando o efeito do biocida ministrado
(Costa, 2008).

Inicialmente, a inveno dos microencapsulados manteve-se focada no controle do
mexilho-zebra (Dreissena polymorpha), o qual
rapidamente se tornou uma das maiores pestes
ecolgicas e ambientais (Costa et al., 2008).
Atualmente a proposta dos desenvolvedores
do produto a de integrar uma estratgia de
tratamento com um plano de controle de do-

Quadro 1. Usos propostos pelo fabricante para o uso dos microencapsulados disponibilizados:

Atividade

300

Aplicaes

Controle para usinas hidreltricas

Manuteno de limpeza em sistemas de refrigerao e fluxo de


gua;

Tratamento de guas industriais

Tratamento ao longo de tubulaes, sistemas de transporte e


armazenamento de guas;

Controle para fbricas de papel

Manuteno em sistemas de guas evitando entupimentos;

Transporte Martimo e Petroleiro

Remoo e ou controle de bioincrustao e gua de lastro;

Agropecuria

Limpeza de canais e dispersores e Irrigao;

Fazendas de cultivo de camares

Remoo de animais filtradores;

Incremento de Cultivos

Enriquecimento da alimentao com dosagens de vitaminas;

Fonte: www.biobullet.com

CAPTULO 28
Seo 9

sagens e de monitoramento para o controle da


infestao, no qual o uso de microcpsulas com
biocidas tem se mostrado ser uma alternativa
para controlar o mexilho-zebra, com eficincia e menor dano ambiental em instalaes de
tratamento de gua (Aldridge et al., 2006).

Estudos realizados com o mexilho-zebra na Europa verificaram que a concentrao
de biocida necessria para matar 50% dos organismos em testes decresceu de 210 para 107
mg/L ao encapsular o biocida (Costa, 2008)
onde 1g/L do microencapsulado correspondia
300 mg/L de KCl. Testes com uma formulao de amnia quaternria DB-45 encapsulada (poliDADMAC), em bioensaios semiestticos, ofereceu clara evidncia do seu potencial.
Onde, o composto foi mais efetivo contra o
mexilho-zebra do que sua condio original
no encapsulada (Costa, 2008). Nestes bioensaios, o produto particulado reduziu em trs
vezes a quantidade de princpio ativo requerido para causar 90% de mortalidade em 12h de
tratamento.

Resultados com Mexilho-Dourado


Em estudo com o mexilho-dourado
no Brasil, Calazans C. et al. (prelo 2012) realizaram testes de toxicidade para a determinao da concentrao letal dos organismos
expostos (CL50%) em sistemas semiestticos
(com troca de gua) para avaliar o potencial
das microcpsulas (Campos, 2009). Neste estudo, verificou-se os efeitos da mortalidade
do L. fortunei exposto cloreto de potssio

e compostos quaternrios de amnia dissolvidos (poliDADMAC) e microencapsulados.


Dentre as substncias estudadas, o KCl foi o
menos txico, em ambas as formas, dissolvida (CL50=3.445 mg.L -1) e microencapsuladas
(CL50=2.737 mg.L -1), sendo que a forma microencapsulada foi mais eficiente, com uma
CL50 25% menor e uma menor variabilidade
da resposta dos mexilhes. Ao termos em conta que a quantidade de substncia ativa (KCl)
do produto de 30% do peso total do microencapsulado, percebemos o efeito potencializador do encapsulamento. Desta forma, o KCl
microencapsulado apresentou uma concentrao letal (CL50) de 821 mg.L -1 o que representou ser 4 vezes maior que a toxicidade comparada com o KCl dissolvido. Os compostos
quaternrios de amnia DB-45 exibiram uma
CL50 em 48h de 315 mg.L -1. No entanto, ao
considerarmos que somente 20% o biocida, a
toxicidade real estimada passa para (CL50) 63
mg.L -1. Estes valores indicam toxicidade 8.6
vezes maior do que o KCl microencapsulado,
mesmo apresentando uma variabilidade maior
das mortalidades entre as concentraes de 25
a 200 mg.L -1. Ao considerarmos o intuito de
remover os organismos, os resultados apresentaram a menor concentrao de efeito observado (CEO=100% mortalidade) em torno de
500 mg.L -1 do produto (Fig. 3 e Tab. I).

301

Figura 3. A- Cloreto de potssio dissolvido; B- KCl microencapsulado; C-polyDADMAC microencapsulado (Reproduzido de Calazans C. et al., prelo 2012).

Microencapsulados
Calazans C. & Fernandes

Tabela I. Valores de concentraes letais CL50-48h, das concentraes de efeito no-observado (CENO) e menor concentrao com efeito observvel (CEO), previstos com a regresso Probit, com intervalos de confiana
de 95%, para cada produto qumico testado contra Limnoperna fortunei em teste de toxicidade semiesttico.
(Reproduzido de Calazans C. et al., prelo 2012).

Produto

CL50-48h
(mg.L-1)

-95.0%CL

+95.0%CL

N [n]

CENO

CEO

315,3

287,1

343,6

8 [13]

25

500

KCl-m

2.737,0

2.650,2

2.823,9

6 [10]

250

6000

KCl dissolvido

poliDADMAC-m

3.444,9

3.367,2

3.522,5

2 [9]

10

2000

KCl-m-ft*

3 [4]

90

1000

poliDADMAC-m-ft*

3 [1]

90

90

m = microencapsulado; CL = Concentrao Letal, CENO = Concentrao de efeito no observado; CEO = Concentrao de efeito Observado.
* No tratamento em tubos com fluxo contnuo o nmero de testes e a mortalidade no foram suficientes para
prever a LC-50.
N significa a partir do nmero de experimentos independentes e n para o nmero de concentraes testadas.
O LC50 estimado baseado no peso total da microcpsula, que so 30% e 20% de produto ativo para
PolyDADMAC e KCl, respectivamente.


Os microencapsulados tambm foram
avaliados em um sistema de fluxo contnuo
(Campos, 2009). Considerando-os como testes
piloto, tais resultados assinalam sobre o comportamento destes compostos em um sistema
dinmico. Os experimentos com KCl apresentaram uma relao dose-dependente atingindo
15% de mortalidade em 6h. Enquanto que o
composto de amina causaram pelo menos 40%
de mortalidade em trs experimentos tambm
de 6h com concentrao de 90 mg.L -1. O uso
deste produto para tratamento em sistemas
condutores de gua necessita de uma dinmica
de dosagem contnua o que deve ser associada
ao uso de um dispositivo misturador/dosador
(Calazans C. et al., prelo 2012).

Concluso

302



Testes realizados com o mexilho-zebra
e tambm com o mexilho-dourado demonstram que o uso de microencapsulado provou
ser eficaz, alcanando 100% de mortalidade
em laboratrio com uma baixa variabilidade
de resposta em relao s substncias qumicas dissolvidas (Calazans C. et al., prelo 2012).
Tais resultados estimulam a expectativa em um
produto altamente eficiente. Os benefcios proporcionados por biocidas encapsulados podem
oferecer vantagens econmicas e operacionais,
bem como benefcios ambientais em funo
de considerar os hbitos dos mexilhes. Esta
tcnica oferece como vantagem; A proteo do
principio ativo at o seu momento de reao; A
possibilidade da dosagem especfica necessria
para o controle do mexilho acompanhada de
uma diminuio das emisses no efluente; A

possibilidade selecionar os diferentes filtradores (organismos alvo e no alvo) atravs da diferenciao do tamanho das partculas as quais
eles se alimentam. Em contrapartida, esta tcnica oferece ao somente sobre os organismos
adultos os quais conseguem ingerir as cpsulas;
Em tratamentos de guas de resfriamento necessrio muito material, o que o torna pouco
competitivo em relao aos biocidas estabelecidos no mercado (ex. cloro) (Polman & Janssen-Mommen, 2011). Desta forma, ainda existe a
necessidade de melhorar a tecnologia para ampliar a desempenho da formulao do moluscicida em condies reais de densidade de mexilhes, qualidade de gua e hidrodinamismos,
alm de tornar esta tcnica ainda mais accessvel comercialmente. Em um estudo solicitado
pelo governo espanhol, o mtodo de controle
dos microencapsulados no foi classificado
como a melhor tcnica disponvel justamente
em funo das necessidades de aprimoramento
das capacidades de reteno das micropartculas. Por outro lado, a Agncia Ambiental do
Reino Unido j deliberou a descarga (de at 10
mg/l), dos compostos de amnia quaternria
(princpio ativo com maior eficincia das microcpsulas) na gua potvel, como tambm em
efluentes, neste ltimo, estuda-se a associao
de dosagens de bentonita para torn-los inofensivos (Polman & Janssen-Mommen, 2011). No
Brasil ainda no h nenhuma deliberao para
uso deste produto em larga escala. Certamente
a continuidade da busca, no uso e no desenvolvimento de produtos inovadores ir promover a
conquista de produtos altamente efetivos para
o controle de bioincrustao em sistemas de
guas.

CAPTULO 29
Formas de Cloro
Livia Viana de Godoy Fernandes
Svio Henrique Calazans Campos
Flavio da Costa Fernandes


H diversas substncias qumicas, orgnicas ou inorgnicas, que possuem o tomo de
cloro em sua composio. Isto confere a essas
substncias propriedades oxidantes, permitindo seu uso como desinfetante em geral, para
tratamento de gua e como alvejante. Exemplos
de compostos clorados para desinfeco so:
cloro molecular (Cl2), hipoclorito de clcio,
hipoclorito de sdio (NaClO), dicloroisocianurato de sdio (dicloro), tricloroisocianurato
de sdio (tricloro) e dixido de cloro (ClO2),
entre outros. Alguns desses produtos foram
estudados para uso como biocida, neste caso,
moluscocida. A seguir podemos acompanhar
um pouco dessa histria.

O NaClO (gua sanitria), o dicloro e
tricloro liberam cido hipocloroso (HClO)
quando em contato com a gua. Neste caso, o
dicloro e o tricloro, alm do HClO, formam
isocianurato de sdio (Fig. 1). O HClO o
princpio ativo. Ele que capaz de interagir
quimicamente com a matria orgnica existente na gua, oxidando e consumindo a matria

orgnica e matando os organismos. Sua eficincia como biocida dependente do pH da gua a


ser tratada. Quanto a isso, o dicloro e o tricloro so capazes de manter sua eficincia numa
faixa de pH um pouco maior do que o NaClO
(Fernandes, 2009).

Em meio aquoso, o NaClO se dissocia
gerando um equilbrio de um cido fraco, como
pode se observar nas equaes apresentadas na
Figura 1.

O dicloro e o tricloro funcionam como
armazenadores de HClO, liberando-o lentamente. Cada molcula de dicloro libera duas
molculas de HClO. O tricloro, trs. Os cloros
orgnicos so muito utilizados para tratamento
de piscina, pois mantm o nvel de cloro baixo
e constante, at o prximo tratamento, geralmente, 24h depois. Caso seja usado o NaClO
na piscina, ou em qualquer outro meio aquoso,
o HClO ser liberado totalmente, atingindo altas concentraes inicialmente e, com o passar
do tempo, decaindo at zero. O HClO voltil
e facilmente perdido para a atmosfera. Outra

303

Formas de Cloro
Fernandes et al.

Figura 1. Equilbrio qumico formado com a reao do dicloroisocianurato de sdio com gua.

caracterstica vantajosa do dicloro, que sua


soluo a 1% possui um pH de 6,0 8,0, enquanto o pH do NaClO varia de 11,0 12,0
(custico) e o tricloro apresenta, 2,7-2,9 (cido)
(Macdo, 2004). O dicloro menos corrosivo
ao meio (tubulaes e equipamentos). A grande
vantagem do uso do NaClO est no custo, o
que faz seu uso mais frequente na prtica.

O ClO2 um gs esverdeado. O princpio
ativo, neste caso, a prpria molcula de ClO2 ,
pelo seu efeito oxidante. Sua eficincia como
biocida pouco afetada pelo pH do meio. Por
se apresentar no estado gasoso temperatura
ambiente, deve ser produzido no local do seu
uso. H no mercado a opo do ClO2 estabilizado em forma lquida, que com a adio do
ativador libera a molcula de ClO2 no local e na
hora do uso (Macdo, 2004, Almeida, 2007).

Uma substncia qumica para ser usada
como biocida deve apresentar o mnimo de
toxicidade ao ecossistema, assim como os subprodutos oriundos da sua utilizao. Reaes
de clorao da gua envolvendo o HClO (uso
do NaClO, dicloro e tricloro) geram subprodutos txicos aos humanos e ao meio ambiente,
representados, principalmente, pelos trialometanos (THMs):

304


O dicloro e o tricloro so pouco txicos,
assim como seus subprodutos, os isocianuratos
(Clasen & Edmondson, 2006; Hammond et
al., 1986). O ClO2 , assim como seus subprodutos gerados com a clorao da gua, clorito e

clorato, podem ser nocivos para a sade humana (WHO, 2008).



A Legislao Brasileira possui a Resoluo n 357, de maro de 2005 do CONAMA
para definio da concentrao limite de certas
substncias em efluentes. Esta Legislao regulamenta o limite de 1 mg/L (ou 1000 g/L)
de clorofrmio, tetracloreto de carbono, tricloroetano e diclorometano para efluentes (todos
esses tambm subprodutos txicos da clorao
da gua). Porm, no contempla concentrao
limite de cloro livre, assim como para clorito,
clorato e ClO2 .

Um conceito importante de se ter em
mente o de cloro livre. As concentraes dos
produtos clorados, geralmente, so apresentadas em funo do cloro livre e no do produto em si. A quantificao de cloro livre estar
em funo da molcula do cloro (Cl2), ou seja,
relaciona quanto de HClO est disponvel no
meio. Isto significa que o HClO pode ser liberado por diferentes equilbrios qumicos, seja
a partir do ClO - ou das molculas de cloros
orgnicos, como dicloro e tricloro, que servem
como armazenadores. Os mtodos de determinao de cloro livre fornecem a concentrao
do produto em funo de cloro livre e no do
produto em si. O mtodo mais importante para
quantificao de cloro livre o mtodo colorimtrico DPD (Clesceri et al., 1995).

Vamos ver agora alguns trabalhos sobre
o uso dessas substncias cloradas como moluscocidas. Campos (2009) determinou a CL50
(concentrao letal para 50% dos organismos
testados) do NaClO, do dicloro e do ClO2
(forma lquida estabilizada da empresa Beraca, Dix50) para o L. fortunei (Tab. I). Nesta
Tabela, tambm esto expostos resultados no
publicados anteriormente, de experimentos

CAPTULO 29
Seo 9

Tabela I. CL 50 de diferentes biocidas clorados.

Biocida

Dicloro

NaClO

ClO2

Tricloro

CL50 (mg/L)

108,96

0,53

13,99

105,69

com o tricloro. O experimento com tricloro foi


feito apenas uma vez e por isso deve ser observado com mais cautela do que os outros. A
metodologia utilizada nos testes de ecotoxicidade pode ser encontrada em Campos (2009).
Estes testes so semiestticos, com perodo de
exposio dos mexilhes aos biocidas de 48h,
com 3 rplicas e 20 organismos em cada uma.
Os clculos de CL50 foram realizados com o
auxlio de softwares especficos, PROBITOS
1.5 e Trimmed Spearman-Karber (TSK) 1.5.
As CL50 esto em funo da concentrao do
produto (no de cloro livre).

Na Figura 2, temos um exemplo de como
ocorre a mortalidade do mexilho-dourado
frente ao biocida. Neste caso, o biocida usado
foi o dicloro, porm comportamento similar
foi observado com os demais biocidas clorados. Nota-se que h uma grande variabilidade
da mortalidade que pode ser visualizada pelos
grandes desvios-padro. Em determinada faixa de concentrao, essa variabilidade ainda
maior. No caso do dicloro, essa faixa crtica de
concentrao foi cerca de 10 a 150 mg/L. Abaixo dessa faixa a mortalidade no chega a 10%
e, acima, mantm-se nos 100%. Essa variabilidade encontrada, principalmente nessa faixa crtica, devida capacidade do mexilho
de se fechar em ambiente adverso. Ao perceber que h uma ameaa qumica dissolvida na
gua, o mexilho fecha a concha e para de filtrar. Desta forma, o mexilho se isola por um
tempo do ambiente externo. Aps determinado
tempo, o mexilho se abre e volta a filtrar. Se
o ambiente estiver adequado, ele se restabelece.
Se no, ele morre pela ao do biocida ou por
inanio, por parar de filtrar. Justamente por
essa capacidade de se fechar e se isolar do ambiente externo que ocorre tanta variabilidade
de mortalidade.

Ao transformar as CL50 que esto em
mg/L em mol/L, podemos comparar os biocidas em funo do nmero de molculas de
HClO. Por exemplo, a CL 50 do dicloro 109
mg/L, isto equivale a 0,0004 mol/L. Como

Figura 2. Mortalidade do L. fortunei em diferentes concentraes de dicloro (Campos, 2009).

cada molcula de dicloro libera duas de HClO,


nesta concentrao de 0,0004 mol/L de dicloro, 0,0008 mol/L de HClO seriam geradas no
meio. A CL 50 do NaClO encontrada foi 0,53
mg/L. O que corresponde a 0,000007 mol/L de
NaClO, que equivale mesma quantidade de
HClO. Ou seja, quando usamos NaClO como
fonte de HClO, precisamos de uma quantidade cerca de 100 vezes menor de HClO como
biocida do que quando este HClO est acoplado ao dicloro. Pode-se supor que a caracterstica do dicloro de liberar o HClO aos poucos,
como um armazenador, no to eficiente e
interessante como moluscocida, uma vez que o
mexilho ganha tempo e se fecha. Neste caso,
o NaClO age de forma mais agressiva por atacar com todas suas molculas de HClO livres
no meio. O mexilho sofre dano mesmo antes
de se fechar.

Resultados encontrados por outros autores tambm indicam que o mexilho sensvel
a baixas concentraes de hipoclorito. Cataldo
et al. (2002a) encontraram uma CL50 = 5,5
mg/L e Morton (1977) controlavam a reinfestao do mexilho-dourado em instalaes
de hidroeltricas com 0,5 mg/L de cloro ativo. Porm, inicialmente, altas concentraes
de cloro (200 mg/L) foram utilizadas durante
vrios dias, at semanas e depois doses reduzidas (1,0 mg/L) foram usadas para remoo
da populao do molusco. Portanto, como se
observa tambm em outros trabalhos (Doherty et al., 1986; Belanger et al., 1985; ONeill,
1997 citado em Cataldo, et al., 2002a), os

305

Formas de Cloro
Fernandes et al.

tratamentos de curto perodo de tempo de contato com cloro no afetam os moluscos, provavelmente pela capacidade dos mexilhes em
detectar o elemento txico na gua e fechar
fortemente suas valvas. Rajagopal et al. (2003)
concluram que com uma dose constante de 1
mg/L de hipoclorito por 588 a 1104 h possvel obter 100% de mortalidade dos adultos de
Dreissena polimorpha, Mytilopsis leucophaeta e
Mytilus edulis. Cataldo et al. (2002a) tambm
encontraram muita resistncia para combater o
mexilho-dourado em aplicaes industriais,
com uma concentrao de 5 mg/L a 15C, sendo aplicada por mais de um ms para matar
a metade dos animais expostos, obtendo contudo, uma mortalidade maior com o aumento
da temperatura, demonstrando que a temperatura influencia no efeito letal do hipoclorito.
Os tratamentos de longa durao ressaltam a
possibilidade de que os mexilhes esto sendo
controlados por inanio causada pelo fechamento das conchas e no por ao direta do
biocida, que em baixas concentraes j teriam
eficincia para a preveno do assentamento de
larvas.

O caminho trilhado at aqui mostra a diferena do efeito dos biocidas clorados frente
mortalidade do mexilho-dourado para clculo de CL50. O passo seguinte seria a busca por
concentraes ideais dos biocidas para serem
usados nas tubulaes para se minimizar as
bioincrustaes. Na prtica, concentraes baixas e frequentes, contnuas ou no, devem ser
avaliadas. Mder Netto (2011) fez experimentos com o dicloro em tubulaes de hidreltricas e mediu seu efeito sobre a bioincrustao

306

do mexilho-dourado (alm da corroso da tubulao) ao longo de 12 meses. A concentrao


usada no experimento foi de 1 ppm (dentro da
tubulao) durante 8 h/dia. No dcimo ms, a
densidade da bioincrustao foi suficiente para
prejudicar o perfeito funcionamento de filtros
e trocadores de calor de usinas hidreltricas.
Ainda assim este resultado foi bom comparado
ao experimento controle: aps 12 meses, a bioincrustao no experimento controle era mais
de cinco vezes maior do que no experimento
com o uso do dicloro.

evidente que os assuntos envolvendo
a clorao da gua so extensos e complexos.
Estudos nessa rea ainda so deficientes e devem
ser desenvolvidos, pois so muitas as questes
no respondidas. No presente captulo, abordouse de forma geral e simples este assunto. Para
estudos mais aprofundados, recomenda-se a
leitura das referncias citadas seria um bom
comeo. Resumidamente, a escolha da substncia
usada para minimizar a bioincrustao deve levar
em conta as seguintes questes:

* a especificidade do efeito biocida sobre
o organismo alvo e sua baixa toxicidade ao ambiente;

* o tempo de contato do biocida com a
massa de gua. Por exemplo, o NaClO melhor
para tempos curtos de reao, como o caso do
controle de bioincrustao em tubulaes, e o
dicloro melhor para tempos longos de reao,
como no tratamento de guas represadas;

* o pH da gua a ser tratada;

* o efeito oxidante do biocida frente ao
tipo de material que constitui a tubulao ou a
superfcie que vai ser tratada.

CAPTULO 30
Sulfato de Cobre
Daniel Pereira
Mriam de Freitas Soares


O Sulfato de Cobre (II) ou Sulfato Cprico (CuSO4) um sal obtido pela reao entre
minerais oxidados de cobre e cido sulfrico.
Este sal existe sob algumas formas, que se diferem por seu grau de hidratao. A forma pentahidratada (CuSO4.5H2O) apresenta-se na
forma de um sal azul brilhante (Fig. 1).

O sulfato de cobre um produto comumente utilizado como fungicida, bactericida,
inseticida, moluscida e herbicida em atividades
agrcolas, mas seus efeitos sobre a biota aqutica podem causar drsticas redues nas populaes de macroinvertebrados (EPA, 1986;
Doudoroff & Katz, 1953).

A presena de cobre em concentraes
superiores a 5 mg.l-1 torna a gua para consumo
humano impalatvel (Branco, 1986).

O cobre disponvel do meio aqutico
facilmente incorporado pelos moluscos herbvoros, detritvoros, filtradores (Bendati, 2000;
Pip, 1990; Villar et al., 1999), mas quando altas concentraes esto disponveis, o metal
pode causar a morte destes organismos. Na-

turalmente, o mexilho-dourado, assim como


outros bivalves lmnicos, acumula o metal cobre nos seus tecidos (Tab. I). Segundo Sylvester et al. (2005), L. fortunei tem capacidade de
filtrao muito elevada, quando comparado
aos demais bivalves lmnicos, provvel razo
da elevada concentrao de cobre nos tecidos
desta invasora. Os bivalves lmnicos, inclusive
L. fortunei, so utilizados como monitores ambientais. Mas quando metais esto presentes
em elevadas concentraes no meio aqutico,
conferem efeito txico sobre estes organismos,
podendo causar a morte.

O sulfato de cobre foi amplamente utilizado como moluscida no controle de planorbdeos (Reddy et al., 2004), ampulardeos (Wada,
2004) e outros gastrpodes terrestres (Amusan
et al., 2002) e, tambm, para o mexilho-zebra
(Dreissena polymorpha) (Waller et al., 1993).

Para o controle de mexilho-dourado
no Rio Grande do Sul (Brasil), especialmente
na bacia do Lago Guaba, o sulfato de cobre
foi utilizado por captadoras de gua (Colares

307

Sulfato de Cobre
Pereira & Soares

Figura 1. Sulfato de cobre pentahidratado comercial

308

et al., 2002a). No entanto, nenhum estudo foi


realizado no sentido de dimensionar o impacto
deste tratamento ao ecossistema, considerando
a formao de subprodutos.

Soares et al. (2009) verificaram que a
Concentrao Efetiva para causar a mortalidade de 50% (CE50) e 95% (CE95) da populao
do mexilho-dourado, em experimentos de
laboratrio (limite de confiana 95%) realizado com a adio de sulfato de cobre (mg L -1)
em gua bruta foi de 8,48 (6,69, limite inferior; 10,42, superior) e 19,08 (15,58 e 25,43)
respectivamente. Os autores verificaram que
90,8% da mortalidade da populao podem
ser explicada pelas concentraes de sulfato
de cobre r2 = 0,908) (Fig. 2). Tambm verificaram que os organismos, quando expostos
ao sulfato de cobre, reagiram imediatamente
fechando as valvas. Aps alguns minutos abriram as mesmas e iniciaram novamente a atividade de filtrao de forma pouco intensa,
como pode ser observado por meio do nvel de
exposio dos sifes. No entanto, com o passar do tempo de exposio, o efeito das concentraes sobre os moluscos inibiram a atividade de filtrao, mobilidade dos mexilhes e
a reao ao toque, demonstrando um estado
de letargia. Em concentraes mais elevadas
os indivduos mantiveram as valvas fechadas.
Esse comportamento indicou provavelmente
um mecanismo de reao do bivalve diante da
sinalizao da presena de uma substncia de
elevada toxicidade.

A Tabela II apresenta a comparao entre os valores das concentraes letais (CL 50)
destinadas ao controle de L. fortunei e outros
moluscos lmnicos nativos e invasores.

Agentes genotxicos (como os compostos de cobre) podem provocar mutaes nas
clulas, com formao de tumores, que podem causar efeitos letais ou subletais em um
organismo (Arnaiz, 1997). Villela et al. (2006)

verificaram danos celulares significativos na


hemolinfa de L. fortunei aps 48h de exposio ao sulfato de cobre, em concentraes igual
ou superior a 3,75 mg L 1. Tambm verificaram alteraes nos valores do ndice de danos
no DNA, em concentraes igual ou superior
a 7,5 mg L 1. Soares et al. (2009) verificaram
mortalidade de organismos expostos ao sulfato
de cobre em concentraes superiores a 6,69
mg L-1, concentrao muito prxima faixa de
concentraes na qual se verifica efeitos mutagnicos nesta espcie quando exposta ao sulfato de cobre.

A concentrao efetiva de sulfato de cobre de 8,48 mg L-1 (equivalente a 1,23 mg L-1 de
cobre), necessria para causar a mortalidade de
50% da populao do mexilho-dourado, em
testes de bancada (Soares et al., 2009), foi superior ao padro permitido para o lanamento
de efluentes lquidos (0,5 mg L-1 de cobre) em
guas superficiais segundo resoluo n 128 do
CONSEMA (2006) e ao padro para guas de
classe 3 (0,013 mg L -1 de cobre) segundo resoluo n 357 do CONAMA (2005).

As concentraes letais verificadas por
Soares et al. (2009) foram superiores quelas
indicadas por Colares et al. (2002b) no controle do mexilho-dourado em captadoras de
gua para abastecimento da cidade de Porto
Alegre (0,5 a 2,0 mg L-1 de sulfato de cobre)
pelo Departamento Municipal de guas e Esgotos. Mas cabe ressaltar que testes de bancada
e de campo diferem.

O clculo da concentrao de um moluscida a ser aplicado em uma captadora deve

Figura 2. Equaes de regresso e coeficientes de determinao obtidos por diagrama de disperso dos valores de mortalidade (N) do mexilho-dourado, L. fortunei, sob diferentes
concentraes de sulfato de cobre (48 h de exposio).

CAPTULO 30
Seo 9

Tabela I. Concentraes de cobre em tecidos de bivalves lmnicos.

Espcie

Concentrao (mg kg-1)

Autor

Limnoperna fortunei (Dunker, 1857)

27,5602,406 (20,360-40,700)

Soares et al. (2009)

Limnoperna fortunei

12,05 e 42,0

Villar et al. (1999)

Cyanocyclas limosa (Maton, 1811)

7,03 e 28,39

Bendati, 2000

Mytella falcata (Orbigny, 1846)

7,301,80

Carvalho et al. (2000)

Anodonta grandis Say, 1829

45,303,10

Pip (1990)

Tabela II. Concentrao letal (CL50) de sulfato de cobre para causar a mortalidade 50% da populao em diferentes espcies de
moluscos lmnicos e respectivos tempos de exposio (TE).

Espcie
CL50 (mg L-1)

TE

Autor

Limnoperna fortunei (Dunker, 1857)

8,48

48 h

Soares et al. (2009)

Corbicula manilensis (Mller, 1774)

0.1

84 h

Orme e Kegley (2006)

Biomphalaria alexandrina (Ehrenberg, 1831)

0.005

8h

Orme e Kegley (2006)

Lymnaea natalensis Krauss, 1848

0.8

24 h

Orme e Kegley (2006)

Pomacea canaliculata (Lamarck, 1822)

0.003

8h

Orme e Kegley (2006)

Melanoides tuberculata (Mller, 1774)

0.1 a 0.2

24 h

Orme e Kegley (2006)

Mytilus galloprovincialis (Lamarck, 1819)

2.5

48 h

Barosa et al. (2003)

considerar a vazo e a diluio da substncia


moluscida (Souza, 1995). Alm disso, o modo
de aplicao do controlador qumico (intermitente, contnuo ou semicontnuo) deve ser considerado no dimensionamento do tratamento
(Darrigran & Damborenea, 2006b).

A aplicao do sulfato de cobre como
controlador qumico em sistemas abertos, sem

posterior tratamento da gua para a remoo de


resduos de cobre e sem a devida remoo e acondicionamento dos mexilhes mortos em aterros
sanitrios, causaria a contaminao dos corpos
hdricos e de toda a sua biodiversidade por meio
da cadeia trfica. As dosagens so elevadas e podem resultar em resduos superiores aos padres
estabelecidos pela legislao ambiental.

309

CAPTULO 31
Outros compostos
Svio Henrique Calazans Campos
Livia Viana de Godoy Fernandes
Flavio da Costa Fernandes


A busca pelo melhor produto para o controle do Limnoperna fortunei (Dunker, 1857)
estende-se sobre outras substncias de uso comum, na tentativa de mitigar os efeitos da incrustao sobre os sistemas e instalaes. Desta
forma, uma variedade de substncias est sendo testada e avaliada dentro de diferentes abordagens e estratgias de controle. Ainda no se
obteve a substncia perfeita para controle do
mexilho e, certamente, esta no seria a expectativa ou pretenso. No entanto, encontrar e ou
desenvolver o uso de substncias, considerando
suas principais caractersticas, oferece a possibilidade de traar a melhor estratgia de controle para as diferentes condies, sistemas e
instalaes. Estratgias estas que visem reduzir
os riscos laborais e ambientais nos tratamentos,
como tambm diminuir os custos com as dosagens dos produtos.

Nos captulos anteriores, acompanhamos
os estudos desenvolvidos nesta rea para determinados produtos especficos. Neste captulo, iremos
abordar algumas outras substncias com potencial

biocida que tambm foram testadas para controle


do mexilho-dourado. A tabela a seguir contm os
nomes dos produtos que tambm foram avaliados
para controle do L. fortunei.

Os diferentes produtos possuem suas
peculiaridades e seus efeitos sobre o mexilho-dourado atuando de diferentes formas, sendo
eles coagulantes, disruptores osmtico e alteradores de pH (Tab. 1). Os resultados e os efeitos encontrados para estas substncias esto
descritos separadamente de acordo com cada
produto. Em relao aos sais, biologicamente
os organismos necessitam controlar a quantidade de gua e de minerais em suas clulas.
Este controle, chamado de osmorregulao,
afetado pela concentrao de sais do meio externo e possuem restries para o controle de
mudanas extremas das concentraes. Sendo
assim, a aplicao de um choque osmtico em
organismos de gua doce induz morte celular
acarretando a morte do organismo. Esta tcnica
pode auxiliar em determinadas circunstncias,
porm, existe o inconveniente de seu uso

311

Outros compostos
Calazans C. et al.

Tabela 1. Produtos testados contra o mexilho-dourado.

Produtos

Caractersticas*

Uso*

Como efluente*

Cloreto de Potssio (KCl)

Sal slido branco cristalino


nas condies normais;

Uso medicinal para reposio Causa srias alteraes em


de sais como tambm como ambientes de gua doce.
injeo letal; aplicaes cientficas; processamento de
comida no uso domstico;
Fertilizante; Provoca choque
osmtico celular;

Cloreto de Sdio (NaCl)

Sal slido branco cristalino


nas condies normais; Popular sal de cozinha.

Uso domstico; Uso Industrial na produo de hidrxido de sdio, cloro, hidrognio e de forma indireta na
produo de acido clordrico
por eletrlise de sua soluo
aquosa.

Causa srias alteraes em


ambientes de gua doce.

Menadiona Bissulfito de nico- Colorao creme cristalino,


tinamida (MNB) - Kavist
moderadamente solvel em
gua.

Forma sinttica do precursor


da menadiona, precursores
da vitamina K3 (envolvida no
processo de coagulao do
sangue) muito usada como
suplemento alimentar de
animais, por ser uma forma
solvel em gua.

Moderadamente txico aos


sistemas aquticos.

MXD-100

Composto de amnia quaternria, extrato de plantas


e taninos. Capacidade de
combinar-se com protenas e
polissacardeos.

Produto ativo usado em outras finalidades como para


proteger materiais contra o
ataque de insetos, fungos ou
de bactrias em residncias

Biodegradvel. Sem efeitos


conhecidos sobre o ambiente aqutico do local de descarte.

Hidrxido de Sdio (NaOH)

Composto slido, branco, e


custico. Provoca queimaduras graves. Popular soda
custica

Comumente usado em solues bem diludas para desinfeco em geral, domstica,


industrial etc. Sua soluo
possui pH bsico, aumento
do pH; Consumo de matria
orgnica.

Altera o pH do corpo receptor podendo gerar mortandade de organismos em contato


direto.

*Dados obtidos junto aos fabricantes e em ficha tcnica dos produtos (FISPQ e MSDS).

em instalaes em virtude do aumento da


corroso (Polman & Janssen-Mommen, 2011),
sem contar que em determinados ambientes o
descarte de gua salgada pode representar um
impacto ambiental severo.

312

Cloreto de potssio (KCl)


O cloreto de potssio sabidamente um
moluscocida que oferece uma seletividade desejada sobre mexilhes em relao aos outros
organismos do ecossistema. No entanto, para
obterem os mesmos efeitos, diferentes estudos
encontraram variaes na ordem de grandeza
(CL50 de 138 mg.L-1 a 5.500 mg.L-1) para a concentrao do biocida contra o mexilho-zebra
(Fisher et al., 1991; Waller et al