Gene 320 Sequence project.

Part I.

What is the name of the locus that contains your assigned DNA sequence?
DQ352471

What is the most likely species of origin? How did you reach this conclusion?
Ovis Aries; Based off of the fact that when the sequence was analyzed the top hits
for genes were all variants of a gene coding for Ovis Aries.

On what chromosome of the above species and at what coordinates is this

sequence found? Please specify which genome assembly you are using.
Chromosome 15 LOC101105437 using NCBI

Is your sequence a member of a gene family? How do you know?

Yes, the sequence is part of a larger gene family in that it codes for HBBB which is
Hemoglobin Beta Chain Subunit. In the larger perspective it is part of a conserved
gene known as Hemoglobin Beta like Superfamily.

Is your sequence on the sense or template stand?

The sequence is a template strand.

How many exons are in your gene sequence?

3

Identify the locations and motifs for each of the following:

Promotor(s)

19 ATAAA TATA_Signal

Initiation codon

101 ATG Methionine Start Codon

Termination codon

1562 TAA Stop Codon

Polyadenylation signal

1612 AAAAATT Polyadenylation Signal

Does your sequence contain a recognizable Kozak consensus sequence? If your

answer is yes, what is the consensus sequence? If your answer is no, are there

other translation initiation sequences? What are they and where?

Yes, The consensus sequence is AXXXATGc which is at the start of the coding
region for the protein at gene 101.
Part II.

Identify the intron-exon boundaries and splice sites. Are the splice sites intact
as expected from the reference assembly?

Exons are from DNA #56-187, 316-537, 1436-1664; From the reference assembly all the
splice sites are intact.

Derive the mRNA for this sequence.

AUGCUGACUGCUGAGGAGAAGGCUGCCGUCACCGGCUUCUGGGGCAAGGUGAAAGUGGAUG
AAGUUGGUGCUGAGGCCCUGGGCAGGCUGCUGGUUGUCUACCCCUGGACUCAGAGGUUCUUU
GAGCACUUUGGGGACUUGUCCAAUGCUGAUGCUGUUAUGAACAACCCUAAGGUGAAGGCCCA
UGGCAAGAAGGUGCUAGACUCCUUUAGUAACGGCAUGAAGCAUCUCGAUGACCUCAAGGGCA
CCUUUGCUCAGCUGAGUGAGCUGCACUGUGAUAAGCUGCACGUGGAUCCUGAGAACUUCAGG
CUCCUGGGCAACGUGCUGGUGGUUGUGCUGGCUCGCCACCAUGGCAAUGAAUUCACCCCGGU
GCUGCAGGCUGACUUUCAGAAGGUGGUGGCUGGUGUUGCCAAUGCCCUGGCCCACAAAUAUC
AC

How many SNPs have been identified in this sequence?

There are three SNPs within the overall sequence all of which are in a non-coding region.

Is this gene under purifying or diversifying selection? Show calculation.

The gene is under purifying selection due to the fact that it's Ka/Ks value is 1.4132 and is
therefore going under positive selection.

Do orthologous genes occur in other species of animals? All species of animals?

Yes due to the fact that the gene codes for HBBB it is a conserved gene within multiple
species if not all. Globins are heme proteins, which bind and transport oxygen. This
family summarizes a diverse set of homologous protein domains, including: (1) tetrameric
vertebrate hemoglobins, which are the major protein component of erythrocytes and
transport oxygen in the bloodstream, (2) microorganismal flavohemoglobins, which are
linked to C-terminal FAD-dependend reductase domains, (3) homodimeric bacterial
hemoglobins, such as from Vitreoscilla, (4) plant leghemoglobins (symbiotic hemoglobins,
involved in nitrogen metabolism in plant rhizomes), (5) plant non-symbiotic
hexacoordinate globins and hexacoordinate globins from bacteria and animals, such as
neuroglobin, (6) invertebrate hemoglobins, which may occur in tandem-repeat
arrangements, and (7) monomeric myoglobins found in animal muscle tissue. ( MarchlerBauer A et al. (2013), "CDD: conserved domains and protein three-dimensional structure.", Nucleic Acids
Res. 41(D1):D384-52.)

Construct a phylogenetic tree for all members of the gene family.

Construct a phylogenetic tree for the orthologous sequences using one

representative species of cartilaginous fish, bony fish, amphibian, reptile, bird
and mammals (eutherian and marsupial). Please identify each species that you
choose.

Cartilaginous fish - Callorhinchus milii (taxid:7868), Bony Fish - Gadus morhua

(taxid:8049), Amphibian - Xenopus tropicalis group (taxid:8363), Repile Chrysemys picta
bellii, Bird - Falco peregrinus (taxid:8954), Eutherian Myotis Lucifugus (taxid:9606),
Marsupial - Monodelphis domestica (taxid:13616) [Callorhinchus milli and Gadus morhua
were not relevant enough to be included]

Part III.
1. Translate the mRNA sequence from Part II.
2. Would this sequence encode a functional protein? Explain you answer.
3. Speculate as to the phenotype and genetic condition likely to arise in an
individual
homozygous for this sequence.
4. Briefly describe an approach one might use to correct this genetic defect.