Você está na página 1de 323

T.

A. BROWN

Professor of Biomolecular Archaeology,

Department of Biomolecular Scences,


UMISI Manchester, UK

CLONAGEM
/\
GENICA
E ANALISE

DE DNA

Uma introduo
4a Edio

Tiaduo:
Henrique Bunselmeyer Ferreira
Bilogo, Universidade Federal do Rio Grande do Sul (UFRGS).
Mestre em Gentica, UFRGS.
Doutor em Gentica e Biologia Molecular, UFRGS.
Ps-Doutorado no Albert Einstein coltege of Medicine, Nova Iorque, EUA.
Professor adjunto IV do Departamento de Biologia Molecular e Biotecnologia, uFRGS.

orientador do Programa de Ps-Graduao em Biologia celular

Molecular, UFRGS.

Pesquisador associado do Centro de Biotecnologia, UFRGS.

Luciane Maria Pereira Passaglia


Biloga. UFRGS.
Doutora em Gentica e Biologia Molecular, UFRGS.
Ps-Doutorada na Universidade da Califmia, Berkeley, EUA.
Professora adjunta IV do Departamento de Gentica, UFRGS.
orientadora do Programa de Ps-Graduao em Gentica e Biotogia Molecular, UFRGS.
Pesquisadora associada do centro de Biotecnologia, UFRGS, na reade Fixao
Biolgica do Nitrognio, e do Departamento de Gentica, UFRGS, nas ireas de
Gentica Molecular de Microrganismos e Gentica e Biotecnologia vegetal.

2003

Sumrio

1a Edio

do DNA recombi-

Parte

ias sobre esses as-

Princpios Bsicos da Clonagem Gnica e da


Anlise de DNA...

For parte do leitor de um estudanto A em Biologia.


os termos noe reforar o texel.

1
2
3
4
5
6
7
8
9

r anos de bioqumip'ara alguns pesqui-

nmero de bilocionagem gnica potexto poder serrecombinante, para

i
,
,I

excelentes livrosito considervel pes

livros-texto
s. quej tiveram alesses

fornecer. Minha

o livro de Old e

projeto seguisse o
\ottingham, e com
: todos os effos e
a maior parte

s-

Por que a Clonagem Gnica e aAnlise de DNA So Importantes............... 13

Veculos pata a Clonagem Gnica: Plasmdeos

e Bacterifagos ............. ...... 25

Vivas..........
Manipulao de DNA Purificado...........
Introduo de DNA em Clulas Vivas .........
Vetores de Clonagem para E. coli.............
Vetores de Clonagem para Eucariotos ..............
Como Obter um Clone de um Gene Especfico...........
A Reao em Cadeia da Polimerase...............
Purificao de DNA

Partir de Clulas

.................. 39
.................. 63
............ 95
............. 115

.....I3-9
............. 165
....... 187

I
,,

t
devo agradecer avr

.... 11

Parle2

Aplicaes da Clonagem Gnica e da Anlise de


DNA na Pesquisa

*
10

certa ou a frase ade-

11
ry

12

.203

Gene
Estudando a Expresso e a Funo dos Genes..
Estudando Genomas

....205

Estudando aLocalizao e a Estrutura do

.....225

........253

T. A. Brown

:.:f \^-F!

t!

':-r::-.:!-':::.:.--i:i::::l::orit:l::trt:a\::-li)ilia,'::l:i:.',:r:.:::!tt:\'
m"un mu anb erp m1-3su LqTuq m : .*'"ro, o,.rq *qp:q apn,J 1c o :nb e u:1-eu-orsrq ssou Ep oeienmuo-- e a a:o-r :nb:od
sfllm r[T ;ru a5-;NJ u- trF trf 'Lcm o roro r zFru"r r:nu m. ?]lo-r l-,.l-aF J :!'w :n o otrro anb r "c:1'o-remq m lL ruE:p
rc xmh o *F'dng.sJd:u:[
ro ? ilL-'rq;E oE\ LIEF5 ':(Ja uou o zra\ Eol rti( L':-qutu\..-o-\L::'{-ni n:s o on:nb \Tt" :r
:q EWi ;

II

IE

o
rl

*i

10

SuMRto

Parte 3

Aplicaes da Clonagem Gnica e da Anlise de


DNA na

13

Produo de Protenas a partir de Genes

t4 Clonagem
15

Biotecnologia........

Clonados
Gnica e Anlise de DNA na Medicina

..2ls
..................277

...................2gg

Clonagem Gnica e Anlise de DNA naAgricultura................................... 319

I6 Clonagem Gnica e Anlise

de DNA na Cincia

Glossrrio
ndice

Forense

........ 335

....................

.......347

............367

'::::r1nor rrrd ocinri: J^il oru .rl3 :nb ttcl o :.rc1os oqlg o t.ltd :ur:u atur 1i
i.:lf:r:J:r:irnrl-aruo--1 lrr.ftf,u!-rJsrreieuos::t:oPL{netlopu?n,.'ossrnoursuuuanberolrog'oqlg'?rPoJlnoun::duasualsel4i'oroq:
Jp srp g w'^oq: uau anb rrp uaa'tsJl oqlfq un e sru'f,oJ ? opuq rrqll:q apod 1os o anb erp uaa'zr:olsrq rssou tp otSrnurluo: r 9 a:ol anb:o6
opuus uJ f,o,\ 9s'sss: ouor serp ug opunu op roreu r'rpn8e rzalsrr Bun 1lo^ :J ze;s:p as rapur anb o opnl anb erp uaa'o:unq un eru rr:8ap

a:

anb o opnl atuada: ap g'rr:uasnr ens

ef,orl3 opqes op of,uFs 'lep

uou

o zrp ?JoJ 9 os o'lqueurv'of,sriu?f,1 'Ied nas o oes anb stlp

uL,

t!
.
IE

n
a

*F

c
z
9

PARTE

PRINCIPIOS BASICOS DA
CLONAGEM GNICA E DA
ANALISE DE DNA

....277

L................ .... zes

L
t

... 3re
.... 33s

l--................ .... 367


I
i

r..i(a:Ilf

\[t-

'o:srrtrer3 r.rei

',r:::qno: r:;r1 ocill] Ja?t oru :l: :nb rrd o :-r1os oqlg o r;rrC ;ro::sa aru y
'oq[g'?p oJlno un a:duas ual s?W o]oql
; f::orlru I cnuuuo-r ouro: ':rci{r:rrr:d suaSnros::t{ sop urn etPi opuLn}
,.'ossr noursua au uenb a:ol rog
p srp w'J^oq: uau:nb rrp uea'tsr] oqlrq un stu'uoJ el opurl Jrqprq apodlos o anb erp uaa'euglsrq essou ep og5rnurluo: r a a:ol anb:o4
'opnus uJ aJo os'sss ouof, serp ug'opunu op rowu e'epn8e ezalsrrl Bun Btlo
zrgsep as rapue anb o opnt anb rrp uJ'o)Jnq un erl er:8ap
ua anb

o opnt aguada: ap g'tr:uasn Bns r eJoq3 op?q?s op orJuls o'lp

uou

o zrp ef,oJ el os o'trrlueuryo:sr:ue:g'red

nas o ogs anb sap

ue1,,

'
L
G

It
a

Cnprulo

Por Que a Clonagem Gnica e a

Anlise de DNA So lmPortantes

O desenvolvimento inicial da gentica' I 3


O advento da clonagem gnica e da reao em cadeia
da polmerase, 14
O que clonagem gnica?. I 5

a clonagem gnica e a PCR so to


importantes, l6
Como encontrar o seu caminho ao longo deste livro,

Pol que

22

OquePCR?,16

Em meados do sculo XIX, Gregor Mendel formulou um conjunto de regras para explicar a
herana de caractersticas biolgicas, as quais assumiam' basicamente, que cada propriedade
treredirria de um organismo controlada por um fator, chamado de gene, que uma partcula fsica presente em algum local na clula. A redescoberta das leis de Mendel, em 1900, marcou o nascimento da gentica, a cincia que busca o entendimento do que so esses genes e
de como eles funcionam exatamente.

1.1 O desenvolvimento inicial da gentica


Em seus primeiros 30 anos de vida, a nova cincia cresceu a uma velocidade espantosa. A
idia de que os genes residem em cromossomos foi proposta porW. Sutton' em i903' e fecebeu suporte experimental de T. H. Morgan, em 1910. Morgan e colaboradores desenvolveram,
ento, as tcnicas paa mapeamento gnico, e, at I922,j haviam produzido uma anlise
abrangente das posies relativas de mais de 2.000 genes nos quatro cromossomos da moscadas-frutas, a Drosophila melanogaster.
Apesar do brilhantismo desses estudos genticos clssicos, no houve um real entendimento da natwezamolecular do gene at a dcada de 1940. De fato, apenas aps os experimentos de Avery, Macleod e Mccarty, em 1944, e de Hershey e chase, em 1952, algum passou a acreditar que o cido desoxirribonuclico (DNA) era o material gentico: at ento, era
geralmente aceito que as protenas constituam os genes. A descoberta da funo do DNA foi
um grande estmulo para a pesquisa gentica, e muitos bilogos famosos (Delbrck, Chargaff,

IE

.
'l::or1uo: uetl or{ru;l

Jr3: ou l

:nb ttr

o a,it1o: oqly o r::rd

malr:: atul

1-

anb erp u:1'tsrft oqlrrq un s?u'rloJ eI opurJnql:q apod 1os o anb zrp ruaa'rtrglsrq essou ep ot5tnurluo: t a ::ol enbrod
"p
.oppuJs
aJ JJo gs.sss ouoJ srrp ug.opunu op Jorru r'epn8e ezatsrll ?un tlo^ g'zgsap as reput anb o opnt anb erp uJ oseJnq un ?JIa el:8ap
aa anb o opn1 atuader ap g.er:uasn? ns eJorf, op?qgs op orJurs o'lp uou o zlp tfoJ tl Ios o'f,quv'otrsltruerJ'red nes o ots anb selp uaa,,
p

w..\oq: ueu

IE

IE

o
a

14

T. A. Bnowr.r

13

Crick e Monod estavam entre os mais influentes) contriburam para a segunda grande era da
gentica. Em 14 anos - de 1952 a1966 a estrutura do DNA foi elucidada, o cdigo gentico decifrado e os processos de transcrio e de traduo descritos.

O qut
!\$

rlt

1.2 O advento da clonagem gnica e da reao em


cadeia da polimerase

Esses anos de atividade e descoberta foram seguidos por um peodo de calmaria, um anticlmax, no qual parecia, para alguns bilogos moleculares (como a nova gerao de geneticistas
se autodenominava), que havia poucos aspectos de importncia fundamental ainda no-esclarecidos. Na verdade, havia uma frustrao em funo de as tcnicas experimentais disponveis
no final da dcada de 1960 no serem suficientemente sofisticadas para permitir o estudo dos
genes com maiores detalhes.

Depois, nos anos de l91I a 1913, a pesquisa gentica foi novamente acelerada por uma revoluo na biologia experimental, conforme descrito na poca. Uma metodologia completamente nova comeou a ser desenvolvida, viabilizando o planejamento e a realizaq se no
com failidade, pelo menos com sucesso, de experimentos previamente impossveis. Tais mtodos, chamados de tecnologia de DNA recombinante ou de engenharia gentica, com base essencialmente no processo de clonagem gnica, abriram uma nova grande era para a gentica, conduzindo a rpidas e eficientes tcnicas de seqenciamento de DNA, as quais permitiram que as estruturas de genes individuais fossem determinadas. Isso culminou, na dcada de 1990, com os projetos de seqenciamento massivo de genomas, incluindo o projeto humano, que foi completado em 2000. A partir da, foram desenvolvidos procedimentos para o
estudo da regulao de genes individuais, o que permitiu que os bilogos moleculares entendessem como aberraes na regulao gnica podem resultar em doenas humanas, como o
cncer. Essas tcnicas geraram a biotecnologia moderna, que coloca os genes em funcionamento para a produo de protenas e de outros compostos necessrios medicina e aos processos industriais.
Durante a dcada de 1980, quando o entusiasmo gerado pela revoluo da clonagem gnica estava no seu auge, parecia quase impossvel imaginar que estava prestes a surgir mais
um processo igualmente inovador e revolucionrio. De acordo com o folclore do DNA, Kary
Mullis inventou a reao em cadeia da polimerase (PCR) durante uma viagem de carro a
longo da costa da Califrnia, em uma noite de 1985. A sua idia genial foi a concepo de
uma tcnica relativamente simples, que funciona como um complemento perfeito para a clonagem gnica. A PCR tornou mais fceis muitas das tcnicas que antes, apesar de possveis,
eram de difcil execuo, quando dependendo apenas da clonagem gnica. Ela estendeu o alcance da anlise de DNA e fez com que a biologia molecular encontrasse novas aplicaes,
inclusive em reas fora do seu campo tradicional, de medicina, agricultura e biotecnologia. A
ecologia molecular, a arqueologia biomolecular e a cincia forense de DNA so apenas trs
das novas disciplinas que surgiram como uma conseqncia direta da inveno da pCR, e os
bilogos moleculares esto buscando novas maneiras de utilizar o DNA para responder questes sobre a evoluo humana e o impacto de mudanas ambientais na biosfera. Trinta nos
aps a revoluo da clonagem gnica, ainda estamos andando em uma montanha-russa,
sem
previso de final para a excitao provocada por ela.

ilro@s

[lsl

i;r'.::fll \-f!-

'o-rsr:rurr1 r-rci

r!
',r;:orluor trrti oeli:t J:\:l ()u .rl3 .rnb rt.l o o:qos oqlq o urd :l:r:s: :rru y
ruol\:u : .!iln()- r)ruor ':EiDUr,rd suaSn:osrrtl sop r1 rtr,l opurnl; ,.'ossr noursua eu uanb elol roJ 'oql5 '?Ip Jlno un arduas ual sEW of,oqj
ap fip w:roq: ueu:nb erp uaa'tsrJt oqlrlq un sru'?]oJ I opur1:eqp:q apod 1os o anb erp uaa er:gtsrq msou rp oe5rnunuo: r a a:ol anb:od
'oPnus uJ 3f,o^ os'sass ouof, serp ug'opunu op Jorru e'epn8e ezatsrJl ?un ?lo
![ ze;sap as raput anb o opnl anb erp uJ oJ?f,nq un erra err8ap
;

ua anb

o opru atuad:: ep g'er:uasn ?ns ? eJor{r op?qgs op oJurs o'elp

uou

o zrp rfoJ gl Ios o'Jquury'otrsrfurJC'rd nas o oes anb serp ruea,,

t!
L
G

o
a

*,: o
6

Ct-onncev GNtcA

E Ar'rlrse oe

15

DNA

1.3 O que clonagem gnica?

Erande era da

cdigo gentiAs etapas bsicas de um experimento de clonagem gnica so descritas a seguir (Figura 1.1).

(1)

Um fragmento de DNA, contendo o gene a ser clonado, inserido em uma molcula de


DNA, chamada de vetor, para produzir uma quimera ou molcula de DNA recombinante.

um anticlde geneticistas

Construo de uma molcula de


DNA recombinante
1

no-escladisponveis
o estudo dos

por uma re-

completase nao

eis. Tais m-

.,,"["*
de DNA

comba-

rf:'*i*"o*

era para a geas quais per-

na dcao projeto hu-

para o
lares enten-

Transporte para o interior da


clula hospedeira

Bactria

como o
em funcionae aos pro-

3 Multiplicao da molcula
de DNA recombinante

clonagem ga surgir mais

Bactria portadora
da molcula de

oo

DNA recombinante

_OO

doDNA, Kary

O^

de carro ao
r:ncepo de
ro

para a clo-

4 Diviso da

de possveis,
estendeu o al-

clula
hospedeira

aplicaes,
apenas trs

o
o'

OO

oo

6(

5 Numerosas divises

da PCR, e os

celulares
resultando
em-7)um clone

)noer ques-

Trinta anos

/
I
I

sem

Figura

Colnias bacterianas
crescendo em meio slido

1.1

As etapas bsicas da clonagem gnica.

oriF:J

xv

'o:st:rUe:; r::ed

IE

'-r:::r1uo:

lroilitl I :nuuuo- oulol

L:re

d odl"l J^l o?u Jl

inb r:d

o :.rqos oqlg o r:r:d

;l.r:ls: erx y

strcirur-r.J su;Snrol:ci :op Lrnr rtlq oputn|.. oss noursu u uanb e:ol rog oqlll'prp oJlno un ::duas ua1 st141.o:oq:
anb zrp uaa'lsrrt oq1rrqun a stu'rro; ?I opul f,eqprq apod 1os o anb erp ual.rrrgtsrq essou ep or5rnuquo: e e atol anb:o4
'opnus uJ ef,o
9s'sJss3 ouof, stq) ug opunu op roreu e'epn8t ezalsrJt run Bllo^ :J'ze;sap :s rapue anb o opnl anb etp uJ'of,?f,nq un eJtl err8ap
ua anb o opru atuada: ap g tr:uesn Bns E rfoqf, opeqes op orf,u[s o 'Ip uou o zrp BfoJ BI Ios o'tr{uuy'of,srf,u?JJ 'r?d nas o oes anb serp ruaa,,
;f

p rrp J

w'^oq: uau

'
L
G
t,l

M:

o
z
o

16

T. A. Bnowru

(2)

O vetor funciona como um veculo que transporta o gene para o interior de uma clula
hospedeira, a qual , em geral, uma bactria, embora outros tipos de clulas vivas possam tambm ser utilizados.
No interior da clula hospedeira, o vetor multiplica-se, produzindo numerosas cpias
idnticas no apenas de si prprio, mas tambm do gene que ele carega.
Quando a clula hospedeira se divide, cpias da molcula de DNA recombinante so
passadas prognie, na qual o vetor replica-se novamente.
Depois de um grande nmero de divises celulares, produzida uma colnia, ou clone,
de clulas hospedeiras idnticas. Cada clula do clone contm uma ou mais cpias da
molcula de DNA recombinante; diz-se, ento, que o gene carregado pela molcula de
DNA recombinante est clonado.

(3)
(4)

(s)

1.4 O que PCR?


A reao em cadeia da polimerase muito diferente da clonagem gnica. Em vez de utilizar
uma srie de manipulaes envolvendo clulas vivas, a PCR executada em um nico tubo
de ensaio, a partir da mistura de DNA com um conjunto de reagentes e da sua colocao em
um termociclador, um equipamento que permite que a mistura seja incubada em uma srie de
temperaturas que so variadas de uma maneira pr-programada. As etapas bsicas de um experimento de PCR so as seguintes (Figura 1.2):

(1)
(2)

A mistura aquecida a94"C, temperatura na qual as pontes de hidrognio, que mantm


unidas as duas cadeias da molcula de DNA de fita dupla, so rompidas, causando a
desnaturao da molcula.
A mistura resfriada a 50 a 60'C. As duas fitas de cada molcula poderiam reunir-se a
essa temperatura, mas a maioria no o faz porque a mistura contm um grande excesso

depequenasmolculasdeDNA,chamadasdeoligonuclffi

(3)

anelam com as molculas de DNA em posies especficas.


A temperatura elevada at 74oC,,con_s_ideradg-qrlq4!a&_4 atividade da DNA-polime.ase
mistura. p;"ndo"-;; mais sobr DN'timi;

a"ffiqffi-"na

ses na pgina 67. Neste estgio, tudo o que precisamos para entender o processo que,
durante essa etapa da PCR, a DNA-polimerase de Taqliga-se a uma extremidade de ca-

da iniciador e sintetiza novas fitas de DNA, complementares s molculas de DNA.


molde. Agora, temos quatro fitas de DNA, em vez das duas com as quais iniciamos a

(4)

reao.

A temperatura

novamente elevada at94"C.As molculas de DNA de fta dupla, cada


uma das quais consistindo em uma fita da molcula original e uma nova fita de DNA,
desnaturam, gerando fitas simples. Isso inicia um segundo ciclo de desnaturao-anelamento-sntese, ao final do qual existem oito fitas de DNA. Com a repetio do ciclo por
,..
| 25 vezes, a molcula de fita dupla com a qual iniciamos convertida em mais de 50 mii ttrOes de novas molculas de DNA de fita dupla, cada uma delas uma cpia da regio da
{ molcula inicial delimitada pelos stios de anelamento dos dois iniciadores.

1.5 Por que a clonagem gnica e a PcR so to importantes


A clonagem gnica

Frguna
e a PCR so procedimentos relativamente simples

(Figuras 1.1 e 1.2). Por


que, ento, elas so consideradas de tanta importncia na biologia? Isso se explica principal-

ns eapas hsi

darea@ em

ohe da @inre

1j!iTf \rt-

'o:sr,rrrelJ

t:ril

';;:e rluo: rred odrurl r ?t o?u lJ ;rb rcd o orqos oqlg o utd .u:::rs: cru: y
'oq[g'erp oJ]no un arduas ual s?W oroqJ
i r:f orirl- : rnuuuo-. ouro:'srrrr:ur-d suf,aflrosrrd sop uir rif,} opu?n|
,.'ossr noursua au uanb a:ol roJ
p Erp J seut oq: uau anb erp ua1'tsrt or{lrJq un seu'roJ ?l opuq rrqg:q apod 1os o enb np uaa zt:gtsrq essou tp oeSenunuo: e e elol anbrod
'opuuszJJro^os'sssouof,serpug'opunuopf,oreue'epntrzalsrJl?unBllo gzrgsapasrapueenboopntanbrrpuJo:?f,nqunef,rlerrSap
ua anb o opu aluadar ap g'zr:uasnr sns r rJorlJ op?qgs op oJue[s o'Ip uou o zrp aoJ el Ios o'Jr{wuy'o:snuerg'rcd nas o oes anb serp u:a,,

'
L
G

It
a

*5
a

CLorunoeu Grurcn e ANLrsE oe DNA

o interior de uma clula


s de lulas vivas pos-

3',

5',

3',

3',

5',

5',

3',

17

DNA-molde

indo numerosas cpias

e ciuTega.

DNA recombinante so

Desnaturao do
DNA-molde - 94'C

uma colnia, ou clone,


uma ou mais cpias da
pela molcula de

2
Em vez de utilizar
em um nico tubo
ufun

Anelamento dos
oligonucleotdeos iniciadores
- 50-60"c

sua colocao em
em uma srie de
hsicas de um ex-

3',

5'.

ttt
5' \'--lniciadores ^\

5'

T--f-

5',

3
reun-se

3',

Sntese de novo
DNA - 74.C

EXCCSSO

3',

foiciadores, que

5',

llllltttttrrrrr
5',

.J

3'

& fita dupla,

5'

5',

3',

3',

5',

cada

fita de DNA,
do ciclo por
nrais de 50 miia da regio da

5',

3'

5',

5',

Figura 1.2

l.l e 1.2). Por

As etapas bsicas
da reao em cadeia da polimerase.

principal-

?_:.rrli:l

3',

\t.

4 Repetio do ciclo 25-30 vezes

'o:struc-r; tred

G
'-r:::tluo:r

wr^oq: uau

oqlrq un

L::rd

odlsit J

at o?rl 3[3 -]nb rrd o c,rty-rs oq15 o r:r:d :,r::rsa

ual

:rxr

errglsrq rssou ep oeenuquo: e : a:ol anbro4


opeues uJ tro^ gs'sss ouoJ srp ug opunu op Joreu r'epn8e ezalsut eun Btlo !J ze;sap as rapur anb o opnl enb erp uJ'of,anq un ?f,rl er:8ap
ue anb o opnt atu:d:: ap g'er:uasn ns ?Joqtr op?qgs op ortru?rs o'elp uou o zrp eroJ g Ios o'Jqueuryois3ueJ{'rd nes o oes anb srrp ua1,,
p ep

anb ap uaa'lsrf,l

s?u'Bf,oJ ? opuq

r?qyrq apod

1os

o anb erp

ItG
a

**,
G

18

T. A. Bnowr'r

mente porque elas permitem a obteno de uma mostra pura de um gene individual, separado de todos os outros genes da clula.

dual- d
conjun

gene d

1.5.1 lsolamento de genes por clonagem

e SUaS

Na
acap

Para entender exatamente como a clonagem pode produzir uma amostra pura de um gene,
considere o experimento bsico da Figura 1.1, mas desenhado de maneira um pouco diferente (Figura 1.3). Nesse exemplo, o fragmento de DNA a ser clonado um dos membros de uma
mistura de muitos fragmentos diferentes, cada um dos quais portador de um gene diferente
ou de parte de um gene diferente. Na realidade, essa mistura poderia ser todo o complemento
gentico de um organismo - de um humano, por exemplo. Cada um desses fragmentos inserido em uma molcula de vetor distinta, para produzir uma famflia de molculas de DNA
recombinante, uma das quais portadora do gene de interesse. Geralmente, apenas uma molcula de DNA recombinante transportada para o interior de uma clula hospedeira indivi-

clones
que c0

sanim
gura l.

ox7
oo

Frasmentosde DNA

"/

(
\---,/ )

Vetores

construeo de molculas

\e

Oru recombinantes

Cada recombinante
carrega um
fragmento dierente

/
lntroduo em bactrias

Plaqueamento

ooo
Cada colnia contm mltiplas
cpias de apenas uma molcula
de DNA recombinante

iloriF:l \-H\

Figura 1.3
A clonagem permite que
fragmentos de DNA individuais sejam puriicados.

Figur
O proden

sd(

'o:srruu3 e:rd

..

IE
';;:e :1uo:

r::et odrt ?: oNU ala .rnb rtci o :;qos oqlg o t-rtc{ .r,r;r:sa oru:

rrlolirq r Enuuuo-. ouro:'scdr:rrr-rd su:6nrosr.rd sop uir tir, oplrnf ,.'ossr noursua au uanb a:ol toJ 'oq1g'elp orlno un a:dues ual s?W of,orlj
Jpsrpgw'J oq:tuauanbr4ruaa'tsrtoqlrqruns?u'?JoJeiopuq:rqpqapodlosoanberpua;'er:gtsrqrssoutpor5tnurtuo:r9a:olanb:o4
'opuus zJ lo gs'sJss ouo: serp ug opunu op f,oreu r'epne rzalsrr eun Btlo [ zegsap :s rapue enb o opnl anb erp uJ'otr?Jnq un eJrl tr:8ap
:

ua anb

o opnt atuada: ap

g'a:uasnr

Ens E uorlJ

oprqrs op orruls o'p uou o zrp efoJ elos o']{u?urv'otrsrf,u?JJ'Ied n:s o

ops anb strp

uaa,,

IE

G
U

:e

ffi.5
I

i:g

Ct-orueeeu GNtcA E Aruuse oe DNA

individual, separa-

dual, de modo que cada clone contm mltiplas cpias de apenas uma molcula, embora o
conjunto final de clones possa conter muitas molculas de DNA recombinante diferentes. O
gene de interesse est agora separado de todos os outros genes presentes na mistura original
e suas caractersticas especficas podem ser estudadas detalhadamente.
Na prtica, a chave para o sucesso ou o fracasso de um experimento de clonagem gnica
a capacidade de identificar um determinado clone de interesse em meio aos muitos outros
clones diferentes que so obtidos. Se considerarmos o genoma da bactria Escherichia coli,
que contm pouco mais de 4.000 genes diferentes, poderamos, em princpio, considerar desanimadora a tarefa de encontrar um determinado gene dentre todos os clones possveis (Figura 1.4). O problema torna-se ainda mais assustador se lembrarmos que as bactrias so or-

pura de um gene,
ira um pouco diferendos membros de uma
de um gene diferente
todo o complemento
fragmentos inde molculas de DNA
, apenas uma mola hospedeira indivi-

Uma poro muito

rPE pequena do genoma


de E. coli

trpD

trN
trpB
trpA

\
O gene a ser
clonado

I
9
k

=t

unav

&--rry!
tpE

gsP

A-.

trpD

o
trpA

Figura 1.4
O problema da
seleo.

sejam purificados.

srorlPl

xuv

19

Como podemos selecionar


ou identificar apenas um gene?

'orsouug errd

G
ra:oquo:

r:.rcil

odul?: a

rl

o?u .r13 :nb lzd o o;qos oqqg o

r*d au:sa

arur y
s?W'oJor{)

;Erro,rill s?nuuuo: ouro:'srzdr:uxd suaSmos;ar sop Mn elpJ opu?n|1.;ossr noursua auruanb elol rog'oqlll'Erp oJno un::duas uet
Jp srp mb^oq: uau anb erp uaa'tsrn oqlrJqrun s?ru'?JoJ gl opurr reqp:q apod 1os o anb erp ua; er:91srq essou rp oe5rnuquo: e a a:ol anb:o4

'oprluszq;ro^os'sssouoJserpug'opunuopJoreue'epnrezalsrl?un?llo

ll'ztysapasrapueanboopntenberpueaore:nqunuuer:8ap

era enb o opnl aluadar ep g'er:uasn? ?ns r ior{f, op?q?s op or:uIs o'Ip ruou o zrp BJoJ gI Ios o '3Jr{rnuv'oJsr:uerJ'r?d

nes o oes anb serp ruaa,,

IE

IE

rt

20

T.A.BRowN

ganismos relativamente simples e que o genoma humano contm aproximadamente 10 vezes


mais genes. Contudo, conforme explicado no Captulo 8, vrrias estratgias diferentes podem
ser utilizadas para assegurar a obteno do gene correto ao final de um experimento de clonagem. Algumas dessas estratgias envolvem modificaes do procedimento bsico de clonagem, de modo a determinar que somente clulas contendo a molcula de DNA recombinante
desejada possam dividir-se, fazendo com que o clone de interesse seja automaticamente selecionado. Outros mtodos envolvem tcnicas que viabilizam a identificao do clone a pair

cleotden

de uma mistura de muitos clones diferentes.


Depois da sua clonagem, praticamente no existem limites pra as informaes que podem ser obtidas a respeito da estrutura ou da expresso de um gene. A disponibilidade de material clonado estimulou o desenvolvimento de mtodos analticos para o estudo de genes,
com a introduo constante de novas tcnicas. Os mtodos para o estudo da estrutura e da ex-

(r)

ofiia

tas

memo&

tmatfo
Umr
de

rmg

ainda

nr

EN
frN

ft

(F

presso de um gene clonado so descritos nos Captulos 10 e 11, respectivamente.

(?JH

1.5.2 Isolamento de genes Por PCR

FC

A reao em cadeia da polimerase tambm pode ser utilizada para a obteno de uma amostra pura de um gene. Isso ocorre porque a regio da molcula de DNA de partida que copiada durante a PCR o segmento delimitado pelas posies de anelamento dos dois oligonu-

ctt
s

Eo

Ack
ca

fran

Frexer
.det."n

trpE

q[Ecrdg

fd isoh

trpD

cmobs

tr

E-

Alr

de groc

trpB

ryk

mmial

$Qts

ftrrl-

aro'f

Inffidos
gwllam

Reao em cadeia
da polimerase

Lllmr

DIIIA&

ewe&l
o em
gEnl OE

mime
ft mnm
&{azo
dtir,furl I

rmml

Figura 1.5

x vrios milhes

lsolamento de genes por PCR.

'::::rpro:

cd o ::r1os oqlg o r:vd aru:sr aru y


ir:J![ r Enuuuo,r ouro: 'sr:dr:rrr-rd su:5:losr:d sop [rn E]ieJ opun],, ossr noursuo au uanb a:ol ro{ oql5'rrp oJrno un ::duas ua1 s?W'oJorll
Jp Brp sm'^og: uau anb erp uraa.lsrrt oqllq un 9 s?u,rroJ g opuqrnlprq apodlos o anb rrp uaa.errgtsrq essou p o5enuquo: r a a:ol anb:o4
'opnus zJ ?tro^ 9s'sss ouof, s?rp u opunu op roreu r'epn8e zalsrrt ?un etlo !J'zeJsap as rapur anb o opnl enb erp ua;'orernq un r:rl er:8ap
ua anb o opru aluadar ep g'a:uasnr ?ns e ?Joqf, op?qes op ortru[s o'lp uou o zp ?]oJ EI los o'3rlueuryo3sr3u?f,J'ed nas o oes anb sIp uL,
L:,rrcl

ocirit

3t

olu

[3 Jnb

'
L

G
U

Clotueev
.10

Grurcn e ANLtsE D

DNA

21

cleotdeos iniciadores. Se os iniciadores anelam de ambos os lados do gene de interesse, muitas cpias do mesmo sero sintetizadas (Figura 1.5). O resultado o mesmo de um experimento de clonagem gnica, mas o problema de seleo no existe, pois o gene desejado automaticamente "selecionado", em conseqncia das posies de anelamento dos iniciadores.
Um experimento de PCR pode ser completado em poucas horas, ao passo que a obteno
de um gene por clonagem pode levar semanas ou meses. Por que, ent, a clonagem gnica
ainda uilizada? Isso se deve a duas limitaes da pCR:

vezes

diferentes podem
de clona-

ml bsico de clonaD\A recombnante


:,maticamente seler do clone a partir

(l)

que poilidade de ma! estudo de genes,


'J, estrutura e da exrmente.

(2)
:o de uma amosque copia-

urtida

r dos dois oligonu-

Para que os iniciadores posicionem-se corretamente, em ambos os lados do gene de interesse, as seqncias desses stios de anelamento devem ser conhecidas. fcit sintetizar um iniciador com uma seqncia predeterminada (ver p. 1g0), mas se as seqncias
dos stios de anelamento so desconhecidas, impossvel a produo de iniciadores ade-

quados. Isso significa que a PCR s pode ser utilizada para isolar genesj previamente
estudados - o que deve ser feito por clonagem.
H um limite para a extenso de seqncias de DNA, as quais podem ser copiadas por
PCR. Cinco quilobases (kb) podem ser copiadas com relativa facitidade e pode-se lidar
com segmentos de at 40 kb com atilizao de tcnicas especializadas. Entretanto, tais
segmentos so mais curtos do que a extenso de muitos genes, especialmente aqueles de
humanos ou de outros vertebrados. Se necessria uma verso intacta de um gene longo, a clonagem deve ser utilizada.

A clonagem gnica , portanto, a nica maneira de isolar genes longos ou genes que nunca foram estudados anteriormente. Mas a PCR ainda possui muitas aplicaes imprtantes.
Por exempl_o, I4e-g$_o_que_g..qg$lcia de q,p_ggng seja descoqhecida, ainda pode sei possvel
adetgrminao de sgqgp.q-gla-s_.g2ropriadas para um par de iniciadreg, 9m us no qu
nheld.q99tre,,9.geqtiQry.iggggggeqe eqq!y,91_qtte g{Lqm grgatilgg qlt"ryl. um
lene que
foi isolado e seqenciado a partir de, digamos, aunaongo"ii",'l.trto, ser utilizado
como base para projetar um par de iniciadores pra o isolamento do gene humano equivalente.

Alm disso, existem muitas aplicaes nas quais necessrio o isolamento ou a deteco
de genes cujas seqncias j so conhecidas. uma pCR de genes de globina humanos, por
exemplo, ilizada em testes para verificao da presena de mutaes que podem causar a
anemia hemoltica chamada talassemia. A projeo de iniciadores adequados para essa pCR
fcil, pois as seqncias dos genes de globina humanos so conhecidui. RpOr a pCR, as cpias dos genes so seqenciadas ou estudadas de alguma outra maneira para determinar
se alguma mutao talassmica est presente.
Uma outra aplicao clnica da PCR envolve a utilizao de iniciadores especficos para o
DNA de um vrus patognico. Um resultado positivo indica que uma amostra contm o vrus
e que a pessoa que a forneceu deve ser tratada para evitar o estabelecimento da
doena. A reao em cadeia da polimerase exrremamente se-nsvrel: png_g_g{-tgg-e1q-_cui$-4$_o-p.g
de C.e,e4q

seia -qs4.+!!-*de-.s-d-""tfues_de*_D']jss'_q_qg-b;p".-,]--olcuta de DNA na


mt"q191a rniqlll. rltq.pig{t"ifi-q"-a"que
t|.c"!ig? -c-gpaz dedetectar vrus ns estgios mais iniciais
de uma infeco, arlm.qllan$o.as tranceJa r"Ctro no t utu-nto. su gno.
sensibilidade faz com que a PCR tabm possa ser utilizada com DNA proveniente de amostras
de medicina legal, como cabelo ou manchas de sangue secas, ou at mesmo de ossos de pessoas
mortas h bastante tempo (Captulo 16).

Figura 1.5
lsolamento de genes por PCR.

r.':::f \{Y

'r)-:tlu?-i:l 'lr(l

IE
'.r;r;r1tlr: rrer octt-J 3af,1ou il3 Jnb ird o:;qos oqlg
p Erp w:\oq:

ur:d:,r.r:rsr::ri y

uau anb erp uaa'lsrrt oqluq un e seu'uoJ gl opuq:rqp:q apod 1os o :nb rrp ue1'euotsrq rssou rp oe5enurluo: r e a:ol anb:od
'oPuues uJ Jo^ os'sss ouoJ sEIp ug'opunu op roreu e'epn8e ezalstJl ?un
lo iJ'zrgsap as rapur anb o opnt anb erp uaa.o:r:nq un r:n eu8ap
ua anb o opru aluad:r ap E-rr:uasnB ens ? ef,oqtr opqs op orJuIrs o 'lap uou o zp eloJ ?l
los o.Jrlueuv.of sJuef,J,rrd nes o ots anb s"p *".1^,

IE

o
a

*:

z
o
@

20

22

T. A. Bnowlr

1.6 como encontrar o seu caminho ao rongo deste Iivro

gamsr

mais

T. A. Bnowrrr

uti
gem..
gem'
ser

A rea

Este livro explica como a clonagem gnica, a pcR e outras tcnicas de anlise de
executadas e descreve as aplicaes dessas tcnicas na biologia moderna. As apli
cobertas nas segunda e terceira partes do livro. A Parte2 descreve como genes e ge
estudados, enquanto a Parte 3 considera as diversas aplicaes da clonagem gnica e
na biotecnologia, na medicina, na agricultura e na cincia forense.
Na Parte 1, abordamos os princpios bsicos. A maioria dos nove captulos
clonagem gnica, pois essa tcnica mais complicada que a pcR. euando voc ti
dido como realizadauma clonagem, jterentendido muitos dos princpios bsicos
todologia de anlise do DNA. No captulo 2, tratamos do componente central de um
mento de clonagem - o veculo - que transporta o.gene para o interior de uma clula
deira e responsvel pela sua replicao. Para funcionar como um veculo de c
molcula de DNA deve ser capaz de entrar em uma clula hospedeira e, uma vez no
da mesma, deve replicar-se para produzir mltiplas cpias de si mesma. Dois tipos
culas de DNA que ocoem naturalmente satisfazem essas exigncias:

tra pu
da du

(1)

Plasmdeos, que so pequenos crculos de DNA encontrados em bactrias e em

(2)

outros organismos. os plasmdeos podem replicar-se independentemente do


mo da clula hospedeira.
cromossomos virais, em especial os cromossomos de bacterifagos, que so
infectam especificamente bactrias. Durante a infeco, a molcula de DNA
rifago injetada na clua hospedeira, onde ir replicar-se.

desejr

ciona
de un
s

terial
com

press

1.5.2 lsolar

o captulo 3 descreve como o DNA purificado a partir de clulas vivas - tanto


que ser clonado quanto o DNA do vetor - e o captulo 4 cobre as vrias tcnicas
nipulao em laboratrio de molculas de DNA purificadas. Existem muitas tcnicas
so, mas duas so particularmente importantes para a clonagem gnica. A primeira
gem de um vetor em um ponto especfico e a segunda, a sua reparao, de modo a i
gene no veculo previamente clivado (Figura 1.1). Essas e outras tcnicas de manipu
DNA foram desenvolvidas como subprodutos de pesquisa bsica sobre a sntese e a
o de DNA em clulas vivas, sendo que a maioria delas faz uso de enzimas puri
jas propriedades e modo como so utilizadas em estudos envolvendo DNA so
Captulo 4.
Depois de uma molcula de DNA recombinante ter sido construda, ela deve ser
clula hospedeira, de modo que a replicao possa acontecer. o transporte para o inter
lula hospedeira faz uso de processos naturais para a incorporao de molculas de D
midial ou viral, os quais, assim como o modo como eles so utilizados na clonagem g,
descritos no captulo 5. Nos captulos 6 e 7, so apresentados os tipos mais importan
tores de clonagem e discutidas as suas utilizaes. Para concluir a cobertura da clon
nica, tratamos, no Captulo 8, do problema da seleo (Figura 1.4), antes de
Captulo 9, a uma descrio mais detalhada da PCR e das tcnicas relacionadas a ela

:-j

'\ >: ri

:'.lJ

i,l'!j

':;:rrlrro:

r;rr1 oc{ur:t f,,\31 otu

f,13

Jrrb trrl

l lrlor

or11rq

t.ttcl:,r:::s: ettrt y

ftu'-\oq: uau anb erp u:1 lsrtrt oq[]q un e s?ru'eroJ el opuq reql:q epod yos o enb erp uaa trrglsrq essou tp ot5tnurluo: t a acol anbro6
opuus z,J ro-\ os'sss ouof, srrp ug'opumu op rorru r'rpn8r rz:tsrrt ?un ttlo :J'ze3sap as rapur enb o opnt anb trp uI ofernq [n f,Il er:8ap
a: :nb o opn: :ru:d:: ap E tr:uasnE ns eroqf, opeqgs op of,uIs o'lp auo o zrp loJ l Ios o ':lqu?uv otrsllutrJ 'Ied nas o oes anb s?IP uJ!,
ap rrp

llnmrlllt,
llllhru

i$nnuurrn:,
Lrulilltlilti

llllrruurLrdurn
lLt1ffiltiliilrrrL

<

Dr

dem

tc*i

t!
t
'
L

G
UI

*t:

o
2
9

iililtlilllilij

'ltlrurmnrunr
ihttut

Cnprurc 2
Veculos para a Clonagem Gnica:
Plasm deos e Bacterifagos

Plasmdeos. 25

Bacterifagos, 30

Para ser capaz de afuar como um veculo para a clonagem gnica necessrio que uma molcula de DNA apresente virias caractersticas. Ainda mais importante que tena capacidade
de replicar-se no

interior da clula hospedeira, de modo que numerosas cpias da moicula de


e passadas s clulas-filhas. Um veculo de clonagem tambm deve ser relativamete pequeno, preferencialmente com um tamanho inferior a
10 kb, pois grandes molculas tendem a quebrar-se durante a purificao e so mais dificeis
de ser manipuladas. Dois tipos de molculas de DNA que satisfazem esses critrios podem ser

DNA recombinante pobsam-se*qroduzidas

encontrados em clulas bacterianas: plasmdeos e cromossomos bacterianos. Embora os plasmdeos sejam utilizados com mais freqncia como vetores de clonagem, dois dos mais importantes tipos de vetor em uso atualmente so derivados de bacterifagos.

Plasmdeos
Garactersticas bsicas dos plasmdeos
Plasmdeos so molculas de DNA circulares que tm uma existncia independente na clula bacteriana (Figura 2.1). Os plasmdeos quase sempre so portadores de um ou mais genes,
que, com freqncia, so responsveis por caractersticas teis apresentadas pela
bactri hospedeira. Por exemplo, a capacidade de sobreviver em concentraes normalmente txicas
de
antibiticos, como cloranfenicol ou ampicilina, muitas vezes devida presena na bactria
de um plasmdeo portador de genes de resistncia a antibitico. Em laboratrio, a resistncia
a antibitico freqentemente utilizada como um marcador selecionvel paa
assegurar que
as bactrias em cultura contm um determinado plasmdeo (Figura2.2).

urotrF:[

ruv

'o:srrurr;

ert;d

G
::::quo:r

r::ecl oc{rt

J ;t orr :13 ab

rtd o arqos oqlg o txd a,r:r:s:

:ru y

rtrosq p Enunuo: ouro: 'srcdnur-rd suaisrros::d sop urn elE_l opu:n|1.,.ossr nounua aur uanb ero,t rog .oq1g."rp orra *.lld*",
-.r ,"ry.-oq,
PZIP sru'^oq: uau enb erp uaa'lsrll oqlrJq un g su'Er.lt
opurr:eqprq apodlos o anb rrp uea'euorsrq essou ep otSenuDuo: r a a:ol anb:o4
'opqus zJo^ os'sas ourotr sep ug.opunu op Joreur e,rpn8e9l ezelsrJl Eun
?lo^ A.zJsap es rapue anb o opnr enb rlp uaJ.orerrq *o ,r^ ,rr[
aa enb o opru elueda: ap g'er:uasn ens ? BJoqf, op?qrs op orJulrs o'lp uou o zrP ?rcJ
o'arrqr"rry.o:sr:uag,rud
i

911o,

nas o oes anb wrp uraa,,

L
r!

rt

26

T.

A. Bnowru

frtuo

srDlI

nr-Efi

Plasmdeos

nepi

rocoo

Plasmdeos

nfunr1

rt4mcr

Figura 2.1
Cromossomo bacteriano

Plasm deos: elementos genti-

@ffir

cos independentes encontrados em clulas bacterianas.

CUECNrc

E&NmlI
Eisdce$r

Tlgor
-

Otmanlnr

Ftudm
mhoid
(TftlaLl)

Resistncia ampicilina

Resistncia tetraciclina

o
o oox
O \-i
O

Clulas de E. coli,

6., algumas contendo RP4


@Ctutas com o plasmdeo

OCtutas sem o ptasmdeo

Figura2.2

-_,,.7t,
Meio de
multiplicao
normal
sem antibitico

Meio de multiplicao
+ 50 pg/ml

tetraciclina
I
I

Todas as clulas
capazes de

Somente clulas contendo


RP4 podem multiplicar-se

multiplicar-se

erorrp:l

O uso de resistncia a antibitico como um marcador selecionvel para um plasmdeo. O


plasmdeo RP4 (no topo) portador de genes de resistncia
ampicilina, tetraciclina e canamicina. Somente as clulas
de E coli que contm RP4 (ou
um plasmdeo aparentado) so
capazes de sobreviver e multiplicar-se em um meio com
quantidades txicas de um ou
mais desses antibiticos.

nln23
EffiS
ttslrm
ffio
Gbil

)
Xuv | 'o:sr:uer3 e.rrcl
G

jEriott Enuuuo: orro:'srzdr:ur,rd

suaerros-rar{ sop rtr r:t.ir-}

':c:cquo:r urtl odu!t 3at o! l .nb nd o ::cps oqlg o ur:d u:::s: :rru y
opu?n},.'ossr noursua au uanb a:ol rog'oq[g'erp o]lno m a:dures ural sW.oroq3

uaa'lsrrl oIprq un e sru'BroJ ?l opuq reqprq apod 1os o anb rrp uaa'errgrrrg
og".rrrro, . .ro rrrod
"rror "p
ouotr srD ugopun op Jorcu e'epnBe ezalsrt En w)o g'zglsap as.rtpue anb o opnl anb grp sal'otetng "un u.u euelt
aa anb o opnl aluada: ap g'enuasne ens ? eroqJ opeqs op ortruIs o 'lp ruou o zrp eJoJ 9l Ios o 'lquBuy'o:sr:uerg 'red nas o oes anb serp ruaa,,
.p

9-*'*oqr

"gp
'orj'ilB
zg eJo

uau

gs'sss

anb rrp

IE

$
ttt

Croruaeeu GNlcA

Aurtse oe

DNA

27

o
ra a produo de suas cpias, enquanto alguns dos plasmdeos maiores so portadores de genes que codificam enzimas especiais, as quais so especficas para a replicao plasmidial.
Alguns poucos tipos de plasmdeos so tambm capazes de replicar-se a partir da ry3 in
sero no cromossomo bacteriano (Figura 2.3b). Tais plasmdeotegratFouffisoirios

aol@

por
R

elementos gentiencontraclulas bacterianas.

ndepnilnt mgho tmb


rnossorn'd bacirifago3, que sero descritos

mais detalhadamente quando forem considerados (p. 31 ).

2;Nz Tamanho e nmero de cPias


O tamanho e o nmero de cpias de um plasmdeo so importantes sobretudo no que diz respeito clonagem. J foi mencionada a relevncia do tamanho do plasmdeo e afirmado ser um
tamanho inferior a l0 kb desejvel para um vetor de clonagem. O tamanho dos plasmdeos
(Iabela 2.1) vana entre aproximadamente 1,0 kb, para os menores, at mais de 250 kb, para

(a)Plasmdeono-integrativosmdeos

ffilW
o

o-

,
Cromossomo bacteriano

(b) Epissomo
Cromossomo bacteriano

a antibitiselecioplasrndeo. O
{no topo) porde resistncia

nrmarcador

eacaas clulas
RP4 (ou

sao
e multicom
de um ou

)-O
@@
Cromossomo Portador
do plasmdeo integrado

Plasmdeo

,u,"^o""rrr\

/\

Figura 2.3
Estratgias
de replicao
de (a) um
plasmdeo
no-integrativo e de (b)
um epissomo.

.- z

IE

,
r:rd rrsllsf, Jtll V

oqlrq un 3 sru'eroJ ? opurT rtqprq apod 1os o anb rrp uaa er:91srq tssou ep og5tnurluo: t a a:ol anb:od
.opous zJ f,o gs,ssse ouof, serp u opunu op rowu e'epn8t ezatsrrt Eun ?tlo
:J'zegsap :s reput anb o opnl anb ap uI'of,?f,nq un ?rn er:8ap
aa anb o pnr aruadar ap g a:uasne Ens e eJoqtr oprqrs op orJu[Is o'lp uou o zrp ?troJ 9l los o ']equeuv oJsrf,utrg 'Ied nes o ots enb sEIp ueJ,,

rt

'-r-rf,3rtror

,p rrn t

o-.1-q: uau

anb erp uaa'tsrJl

l:rd ocitur.l il:l oru

r1o

:nb ltrl

o o;qos ot115 o

*g'i

28

A. Bnowlr

Tabela 2.1 Tamanhos de plasmdeos representativos

Plasmdeo

Tamanho
Extenso de
nucleotdeos (kb)

Massa molecular

(MDa)

Organismo

lilffirglci
odhnkh

pUCS

2,1

1,8

ColEl
RP4

6,4
54

4,2
36

Pseudomonas e outros

95

63

E. coli

TOL

rt7

78

Pseudomonas putida

pTiAch5

213

142

A g ro b ac t e rium

E. coli
E. coli

fim.ttl

A$cf

lraf

ummmfi"rrt

tumefac

Mrlegrb n
ie

,ffiXra-l

ns

ih@Enti

llfhmceff

rffitr
ffiria- n

os maiores, de modo que apenas poucos deles so teis para

autilizao em clonagem. Entretanto, conforme descrito no Captulo 7, plasmdeos maiores podem, sob alumas circunstncias, ser adaptados para a clonagem.
a
O nmero de cpias refere-se ao nmero d-molculas de um determinado plasmdeo que
so encontradas normalmente em uma clula bacteriana individual. Os fatores que controlam o
nmero de cpias no so bem-compreendidos, mas sabe-se que cada plasmdeo possui um valor caracterstico, que pode ser de apenas um (em especial para as molculas grandes) ou igual
ou maior do que 50. Via de regra, um vetor de clonagem til deve esta.r presente na clula em
mltiplas cpias, para que grandes quandades da molcula de DNA recombinante possm ser
obtidas.

@mfirmtnd
@uffiGWE*
rrlllEnF pe

'ffi@Err

'el

A classifir

trcr$[iqa cl

2.1.3 Conjugao e compatibilidade

ffiffis

Os plasmdeos so divididos em dois g*po!.onlugativos e no-conjugativos. Os plasmdeos conjugativos so arcceizados pela capacidade de promover a conilgao sexual entre clulas bacterianas (Figura 2.4),umprocesso que pode resultar na propagao do plasmdeo conjugativo de uma clula para todas as outras clulas de uma cultura bacteriana. A conjugao e a transferncia do plasmdeo so controladas por um conjunto de genes de transferncia, ou tra, que esto presentes em plasmdeos conjugativos, mas ausentes no tipo noconjugativo. Um plasmdeo no-conjugativo pode, contudo, sob algumas circunstncias, ser
co-transferido juntamente com um plasmdeo conjugativo, quando ambos esto presentes na
mesma clula.

lt

ll Ph

jus
!) Ph
resis

or
pop
tltx

Vrios tipos difererltes de plasmdeos podem ser encontrados em uma mesma clula ao
mesmo tempo, inclue mais de um plasmdeo conjugativo diferente. De fato, sabe-se que
clulas de E. coli podem conter simultaneamente at sete plasmdeos diferentes. para serem
capazes de coexistir na mesma clula, os plasmdeos diferentes devem ser compatveis. Se

i
ii

n4s-

tfr
l{l

dois plasmdeos so incompatveis, ento um ou outro ser rapidamente perdido pela clula. Diferentes tipos de plasmdeo podem, portanto, ser classificados dentro de iferentes
grupos de incompatibilidade, com base na possibilidade ou no de coexistirem na mesma
clula. Os plasmdeos de um mesmo grupo de incompatibilidade so freqentemente similares entre si quanto a vrios aspectos. A base da incompatibilidade no bem-compreendida, mas acredita-se que eventos que ocoffem durante a replicao so os responsveis pe1o fenmeno.

I
t
I
I

I'

Classific

l5l

Cotr
Plas

tnu
Ptrn

pbfl

tas d

2.15

Plasmdc

O fam de(

','

qrs ela ta
7to o

_
r.rorrf y >rv

-..,''

',,'., , '.r,'.,

o
2

G
'-r:::rluo: rrcd ocft.r:l ^Jl olu Jla inb rrd o :;qos

oq13 o r;rrd

:,r.r::sl aru

ep ep e sstu ' oq: uau enb rrp ua; elslr oqIJq un s?u'BroJ
9l opu- leqyrq apod 1os o anb erp
'opus zJ ro^ os'sssa ouotr srrp ug.opunu
op rorrur e,epn8r ezatsrJt ?un lo

ao enb o opnl aluadar

ap

g'tr:uasnt

?ns 3 ?Jorp opqts op orf,urs

uaa er:grsrq essou rp oernurluo: r a a:o,r anbro4


:[.ze;sap :s repunb o opl ..b rrp *ea.o:ernq urn r:n er:5ap

o'lp uou o zp rrog

"11o,

o..Dqreurv.o3sJw.rJ,red

nas o

on anb selp uL,

rt

*5

Ct-oruncev Gurcn e ANLtsE oe

Clula doadora

DNA

29

Clula receptora

ganismo

Figura2.4
coli
coli
ydomonas e outros

nli

domonas putida

fucreium

tumefaciens

o em clonagem. Entre_
l $ob algumas circunstn_
rnunado pasmdeo que
tuores que controlam o
possui um va-

Transerncia de plasmdeo entre


clulas bacterianas por conjugao. As clulas doadora e receptora fixam-se uma outra por
uma mbria, um apndice oco
presente na supedcie da clula
doadora. Uma cpia do plasm
deo , ento, passada paraaclula receptora. Acredita-se que a
transerncia ocorra atravs da
fmbria, mas isso ainda no oi
comprovado. A transerncia por
J
outros meios (por exemplo, dire- i
tamente pelas paredes celulares !
das bactrias) permanece sendo
,
uma possibitidade.

Plasmdeo conjugativo

las grandes) ou igual


u'esente na clula em
binante possm ser

2,1.4 Classificao dos plasmdeos


A classificao mais til dos plasmdeos de ocorrncia natural baseada na principal caracterstica codificg!3leleqggng!{lasmidiais. os cinco principais ripos de plasmdeo,
de acordo com essa classificao, so

_s"rtlos. Os plasm_

sexual en-

(l)

o do plasm-

:ucteriana. A con_
*genes de trans_
s no tipo no_

re

(2)

irrostncias, ser
presentes na
rmsna
ii,uru,r"

clula ao
sabe-se que
Para serem

') (3)

pela cludiferentes
na mesma

slml-

Plasmdebs de fertilidade ou "F' crregam apenas genes trae no possuem qualquer


outra caractestica alm da capacidadei promoverem a transferncia plasmidial conjugativa. Exemplo: plasmdeo F de E. coli.
Plasmdeos de resistncia ou "R" caegam genes que conferem bactria hospedeira
resistncia a um ou mais agentes antibacterianos, como o cloranfenicol, a
ampicilina ou
o mercrio. Plasmdeos R so muito importantes para a microbiologia cnca, pois
a
propagao dos mesmos em populaes naturais pode ter srias conseqncias
no tratamento de infeces bacterianas. Exemplo: Rp4, comumente encontr do em pseudomo_
^-ocorre_ndg rambm em muiras o uie;
"ry.ryas
Plasmites-eol codificam tiinas. poti:inas-q m.ram outras bacrrias. Exemolo
Exemplo:

ColEl
(4)
(s)

osiegte:-

de E. coli.

Plasmdeos degradativos permitem que a bactria hospedeira metabolize


molculas incomuns, como o tolueno e o cido saliclico. Exemplo: ToL de pseudomonas putida.
Plasmdeos de virulncia conferem patogenicidade bactria hospedeira.
Exemplo:

plasmdeos Ti

de

Agrobacterium tumefociens,que induzem

to-or",

tas dicotiledneas.

de galha em

plan-

nels pe-

2.1-5 Plasmdeos em outros organismos que no bactrias


O fato de os plasmdeos serem bastante comuns em bactrias no implica, de
maneira alguma,
que eles tambm o sejam em outros organismos. O plasmdeo eucaritico
mais bem caracterizado o crculo de 2 pm, que ocoe em muitas linhagens da levedura
Saccharomyces cerevi-

IE

if::''r]:-!.::::rLro-oliior's.r.r,ur-rts,e.ruos'rlserprunrrr.lopurnf;]:i:::lr:l*tff;:'":;'iulfJ;i:'ji::;r"r:
su:aoq: uau anb erp uaa lslr oqll]q un t"*'".-1^91 opt.r1*qprq
apodlos o anb erp uaa.rr:grsrq essou ep or5rnurruo: t a
9
'oPlus nJ JJo-\ os'sess ouof,
e:ol anb:od
s'rp uA.opunu op ror"g.r"3r.p ., ,.prrt op.r ..b
un rru.r8ap
ae :nb o opru aluada: ap g'er:uasne Ens t ef,oqtr op"q", "."p.3" "r.lrr, "*. "rio^
"rp,ra1.o:rrnq
op orr"1* o'ayap aurouo zrp r.j
o,...qr?uv.ofsrJurf,J,red
Jp Erp

"11o,

nas o ors anb selp uq1 ..

'
L
G

o
a

*i

30

T. A. Bnowrrr

A descoberta do plasmdeo de 2 1tm teve um impacto bastante positivo, pois permitiu a


construo de vetores para a clonagem de genes utilizando esse organismo de grande importncia industrial como hospedeiro (p. 140). Contudo, a busca de plasmdeos em outros eucariotos
(como, por exemplo, fungos filamentosos, vegetais e animais) mostrou-se infrutfera, suspeitando-se que muitos organismos superiores simplesmente no abrigam plasmdeos no interior de
suas clulas.
siae.

2.2

Bacterifagos

2.2.1 Caractersticas bsicas dos bacteriagos

Os dois tipos prit


estrutua de agos: (i
e cauda (por exe

Bacterifagos ou fagos, como so comumente conhecidos, so vrus que infectam especificamente bactrias. Como todoyos vrus, os fagos possuem uma estrutura bastante simples. Eles
consistem merarente e-ma molcula de DNA (ou, ocasionalmente, de cido ribonuclico
IRNAI) portadora de alguns genes, inclusive vrios para a replicao do fago, envolvida por
uma cobertura protetora ou capsdeo, formada por molculas proticas (Figura 2.5).
O padro geral de infeco, que o mesmo para todos os tipos de fago, um processo de
trs etapas (Figura 2.6).

(1)
(2)

(3)
I

{b) filamentoso (po,r

A partcula do fago fixa-se na superfcie externa da bactria e injeta o seu cromossomo


de DNA no interior da clula.
A molcula de DNA do fago replicada, leralmente por enzimas especficas, codificapor genes do seu prprio cromossomo.
Outros genes do fago dirigem a sntese dos componentes proticos do capsdeo
partculas virais so montadas e liberadas da bactria.
das

novas

Com alguns tipos virais, todo o ciclo de infeco completado de forma muito rpida,
possivelmente em menos de 20 minutos. Esse tipo de infeco rpida chamado de ciclo ltico, pois a liberao das novas paqtculas virais est associada lise da clula bacteriana. O aspecto mais caraterstico de umficlo de infeco ltico oo Ua sntese das protenas do
capsdeo ocorer imediatamente aps a replicao do DNA do fago, cujas molculas nunca
so maltidas em uma condio estvel na clula hospedeira.

I
i
I

2.2.2 Fagos lisognicos


Diferentemente de um ciclo ltico, a infeco lisognica caracteizada pela reteno da molcula de DNA do fago na bactria hospedeira, possivelmente ao longo de muitos milhares de divises celulares. Com muitos fagos lisognicos, o DNA viral inserido no genoma bacteriano,
de uma maneira similar insero epissmica (Figura 2.3b). Aforma integrada do DNA do fago (chamada de profago) quiescente e a bactria portadora (referida como um lisgeno) , em
geral, fisiologicamente indistinguvel de uma clula no-infectada. Entretanto, o profago acaba
sendo liberado do genoma da bactria hospedeira e o fago reverte para o modo ltico, lisando a
clula. O ciclo de infeco O" l"-Ua. (I),rlq&gg lirgJgqqslpic!, q lqoJg$_qe_ryegra21_
Um nmero limitado de fagos lisognicos segue um ciclo de infeco diferente. Quanclo
M13 ou um fago aparentado a ele infecta E. coli, novas partculas virais so continuamente
montadas e liberadas da clula. O DNA de Ml3 no integrado no genoma bacteriano e no se
torna quiescente. Com esses fagos, a lise celular nunca ocoffe e a bactria infectada pode continuar a crescer e a dividir-se, embora a uma velocidade menor do que a de clulas no-infectadas. A Fgura 2.8 mostra o ciclo de infeco de Ml3.

ri(\rI:l

\y

'o..r'.'u".t,

Fgura 2

O padro geral de i
bcao de uma clu
bacteriana por u
bacteiag

L'r,'a

IE
'-r::oririo:

il .rnb ttd o lqos ot11g o t:r:d :,ur:sr azur tr


; r: joljrrl r Erunllo- ouio: 'sietl:ur-rd su:5aros;rr sop urn et1:,y opu:n)., oss noursu u uanb a:ol rog or{Ig'trp oflno un a:duas uet se141'oroq:
p srp J ffi'^oq: uau anb erp uaa'tsrrt orlrJq un s?u'?JoJ gl opu{reqp:q apod 1os o anb zrp u:1'er:otsrq tssou ep ot5enuguo: e a a:ol anb:o4
'opnus uJ Jo^ os'soss ourof, sBrp ug'opunu op Jomu e'rpn-8e ezatsrJt ?un ?lIo g'ze3sep as rapue anb o opnt anb erp uJ'o3ef,nq un Jrl er:8ap
aa :nb o opru aluadu ap g'rt:uasn? Bns r eJorlf, opeqgs op oiuals o'alp ruou o zlp ef,o; 9l Ios o 'alqueuv'of,slf,uef,C 'Ed nes o ots anb sap uaa,,
rrecl ocirs:rt 3:\a] orr

IE

o
a

Cr-orueceu Guca e ANLtsE oe

DNA

positivo, pois permitiu a


de grande importnem outros eucariotos

infrutfera, suspeitanno interior de

Molculas
de protena
(capsdeo)

Figura 2.5

Molcula de DNA

(ls dois tipos principais de

infectam especificabastante simples. Eles


de cido ribonuclico
do fago, envolvida por
(Figura 2.5).
fago, um processo de

ffrrra

de agos: (a) cabea


(por exemplo, l,) e
,ffi flamentoso (por exemplo,
M13).

.- ccilrda

(a) Cabea e

cauda

(b) Fitamentoso

o seu cromossomo
especficas, codifica-

Partcula do fago
DNA

do capsdeo e novas

de forma muito rpida,


chamado de ciclo lti-

O ago ixa-se bactria


e injeta o seu DNA

bacteriana. O astese das protenas do

cujas molculas nunca

pela reteno da mol-

muitos milhares de dino genoma bacteriano,


do DNA do fa-

componentes
do

umlisgeno) , em

capsdeo

3
I

Os componentes do capsdeo so sintetizados,


novas partculas so montadas e liberadas

o profago acaba

modo ltico, lisando a


na

Figura 2.6

2.7.

Opdro geral de inlhode uma clula

diferente.

is so continuamente

bacteriana por um

bacteriano e no se
ia infectada pode contide clulas no-infecta-

oriFf

l(lv

bacteriago.

'o:souer3 r:ec
IE

'-rr:;rJuo:
;trfo, rsq

?nuuuo: ouro:'stednur-rd suauuosr:d soF rrrn e.p; opu?n).,

aP srP s?rrr'^oqr tuau anb erp

uaa'tslr oq1rrqun seu'ef,oJ

ossr noursua

ap

g'tnuesne

ocini:t

et

olu

l f,nb rttl o c;qos oq15 o

r:rrJ:,r;::sa

ens ? ?Jor{J op?q?s op onuTrs

azur

au uanb a:ol ro{ oqlg '?rp oJlno urn a:duas ual sBW'oJor{J

a:ol anb:o4
!J'zeJsapasrapuzanboopnlenberpuaa'o:anqunerler:8ap
o'lp uou o zrp eroJ gl los o 'trr{ueulr'otrsrtru?J{'red nes o oes enb serp uaa,,

?l opuT Jeqp:q epod 1os o enb rrp uea'errgtrsrq essou ep orSenurluoc e 9

'opluszqttro^c'ssouolsepug'opunuoproeur'epn8eezalsr:teunello
ua enb o optu eluadar

e:ecl

'
L
G

o
a

31

32

. A. Bnowlt
Apesar de haver uma variedade muito grande de bacterifagos, somente e M13 chegaram
a desempenhar papis importantes como vetores de clonagem. As propriedades desses dois fagos sero agora consideradas com maiores detalhes.

I
I

.A n,ljr,
,dirr**:'-

\,

Organizao gnica na molcula de DNA de

flq

llbfitulr&.

'cudus

ts f,c
F:gu

lrtrTars.l

?',

gf:i3 ;' i

O l, um exemplo tpico de fago de cabea e cauda (Figura 2.5a). O DNA est contido na estrutura polidrica da cabea e a cauda serve para fixar o fago superfcie bacteriana e injetar
o DNA na clula (Figura2.1).

Uma partcula do fago


fixa-se a uma clula de
E. coli e injeta o seu DNA

-{

de " circulariza

DNA de

Cromossomo bacteriano

/\

Diviso celular

\_
Fr$e Zg
ffiii,iurrMtM

nitsae':

Mrnercfu3r
rirri'

:?

lnduo:
O DNA de desliga-se do
cromossomo bacteriano

Novas partculas do fago sd


produzidas (ver etapas 2 e 3

da Fig.2.6)

Gs'
.

::il \\'

Ftgul

i
O ciclo de ineco lisognica do bacteriago 1".

Ji3 Jnb

re

d o ::qos or11ll o

urd ;r:::rs.. :rut y

: su'-\oq: ueu anb erp ual otsrJt or{lrf,q un sBu'ero.1 e[ opurT Jeqp:q apod 1os o anb erp ua1'er:glsrq rssou ep oe5enuquo: e a elol enb;o4
oprluas ze_ JJo-\ os'sss ouof, srrp ug'opunu op Jorru e'epn8e ezalsrJl ?un tIo^ zt;sap as repur anb o opnt enb trp uaa o:z:nq un un er:8ap
e:e anb o opn: atu:d:: :p E rr:uasn ns rroqf, opqgs op oJuaps o'Iep uou o zrp uoJ rl Ios o'elquelV'otrsnueq'rrd nas o ors anb s?lp u{,,

pgr3rri"a.!

acs

ag

r,"enmcs de

u:rlcdu;t J l oru

uE's

nm ftLrr"nces

p Erp

!E..ltco

rIr0ffir,."arl* as D35

igura2.7

'o...r..rir'.r1 , rlc

',Lr:-.oruo:

nnwopr

'
L
IE

o
a

*s1

o
6

Cronneenit Gnrcn e Aruuse oe

somenteeMl3chegaram

A molcula

de

DNA

DNA

33

de ", que tem um tamanho de 49 kb, vem sendo extensivamente es-

ropriedades desses dois fa-

tudATiEhfu-d'fi 6sq*ri-en6i*;a"m.Emconseqncia

O DNA est contido na es-

disso, as posies e as identidades da maioria dos genes da molcula de DNA de l, soionhecidas (Figura 2.9).Uma caracterstica do mapa gentico de que os genes relacionados em
termos de funo esto agrupados em regies especficas do genoma. Por exemplo, todos os
genes que codificam componentes do capsdeo esto agrupados no tero esquerdo da molcu-

perffcie bacteriana e injetar

Fago M13

Fmbria--

DNA de

M1 3

O fago M13 fixa-se a uma


fmbria de uma clula de
E. coli e injeta o seu DNA

Ml3

Novos fagos
so continuamente

do DNA de Mt3

,r.ffi"
\enlicaeo

tt

o o" m

::iJ#ff":iii"U%

O clclo de ineco
do bacterifago
M13.

2.7
de infeco lisognido bacteriago ),.

Figura 2.9
O mapa gentico de ,
mostrando as posies
dos genes importantes e
as unes dos agrupamentos de genes.

o 2 4 6 810

12 14 16

M13

de M13

o..u,,ll'i.l:;"."-^

\:ll,i3crescer

1820222426?83032343638404244464849kb

:_iLtil:J

"go.

,m#
/

ffi

\...Figura 2.8

u;

\lv

IE

art;rsr ::ur y

'
L

p arp sru 'a oqr uau anb erp uaa.lsrrt orl1uq un 9 s?u,ero; ?l opuq reqp:q apod 1os o anb erp uaa.rr:glsrq essou ep orSenu4uo: r a a:ol anb;o4
'oPDu$ zJ lo os'sss ouof, s?Ip ug opunu op forru r'epn8e rzalsut eun Btlo
!J'ze3sap as rapur anb o opnl anb rrp ual'otrJnq un ?Jrl er:Sep
na :nb o optu aluada: ap g'trtuasm Bns e ?f,oqJ op?q9s op ortruls o'lp uou o zp eJoJ Ios o']queruy'ofsrfu?:{'red nes o ors anb srlp uJL,

UI

'::::r1rro:r

L:,rrci

ociltJl

oJt u

ilo .lnb rrii

<t

ottlos or11g o :-lrd

IE

#*
'o

34

T. A. Bnowlr

la e os genes que controlam a integrao do profago no genoma do hospedeiro esto agrupados na sua regio central. O agrupamento de genes relacionados extremamente importante
paa o controle da expresso do genoma de , pois ele permite que os genes sejam ativados ou
inativados em grupo, e no individualmente. O agrupamento tambm importante pata a
construo de vetores de clonagem derivados de , (descritos no Captulo 6).

As ormas linear e circular do DNA de

?u

Uma segunda caracterstica de , relevante para a construo de vetores de clonagem, a conformao da molcula de DNA. A molcula mostrada na Figura 2.9 ltnear, com duas extremidades livres, e representa o DNA presente na estrutura da cabea do fago. Essa molcula linear consiste em duas fitas de DNA complementares, com bases pareadas de acordo com as
regras de \atson-Crick (isto , DNA de fita dupla). Entretanto, em.cada extremidade da
molcula existe um segmento curto, de 12 nucleotdeos, no qual o DNA de fita simples (Figura 2.10a). As duas fitas simples so complementaes e, portanto, capazes de parear suas bases entre si para formar uma molcula circular totalmente de fita dupla (Figura 2.10b).
ttade'
Fitas simples complementares so, com freqncia, referidas como extremidades

(
I
J
I
I

sivastt ou extremidades coesivas, porque o pareamento de bases entre elas pode unir as duas
extremidades de uma molcula de DNA (ou as extremidades de duas molculas de DNA diferentes). As extremidades coesivas de 1" so chamadas de stios cos e tm duas funes distintas durante o ciclo de infeco de ,. Primeiramente, elas permitem que a molcula de DNA
linear injetada na clula seja circularizada, o que um pr-requisito para a insero no genoma bacteriano (Figura 2.7).
A segunda funo dos stios cos um pouco diferente e necessria depois que o profago
foi removido do genoma hospedeiro. Nesse estgio, produzido um grande nmero de novas
molculas de DNA de l" pelo mecanismo de replicao por crculo rolante (Figura 2.10c), no
qual uma fita de DNA contnua "rolada paraforc" da molcula-molde. O resultado um catenano, que consiste em uma srie de genomas lineares de unidos pelos seus stios cos, cuja funo agoraatuar como seqncias de reconhecimento pra uma endonuclease, que cliva o catenano nos stios cos, produzindo genomas de l" individuais. Essa endonuclease, que
o produto do gene da molcula de DNA de , cria as extremidades coesivas de fita simples,
alm de agir em conjunto com outras protenas pa.ra empacotar cada genoma de em uma estrutura de cabea do fago.
Como se ver no Captu\6. os processos de clivagem e empacotamento reconhecem apenas os stios cos e as seqncis imediatamente adjacentes a eles. A mudana da estrutura das
regies internas degenoma de , por exemplo, pela insero de novos genes, no tem efeito
sobre esses eventos, desde que o tamanho total do genoma de l, no seja demasiadamente alterado.

M13: um fago filamentoso


um exemplo de fago filamentoso (Figura 2.5b) epossui uma estrutura completamente
distinta daquela de . Ademais, a molcula de DNA de M13 muito menor do que o genoma
de , com uma extenso de 6.407 nucleotdeos. Ela circular e tem a caracterstica incomum
de consistir inteiramente em DNA de fita simples.

M13

Frgur

Asbr
siyas
na

br

orts

cto

o
2

'-n::t1rn:

w',\oq: u:u

rrecl ociurJl oal u 13 nb r;d o :lqos oqyq o

urd ut:rs: :rrrr y

anb erp uaa.lsrrl orlTrrq un sru.eJoJ gl opuqrrqprq apod 1os o anb rrp ual.errglsrq rssou rp or5enurluo: e a a:ol anbro4
'opuuas uJ f,o^ os'Fsse ouof, serp u opunu op roreu r'epn8r zalsrrt ?un etlo
u'ze;sap as rapur anb o opnl snb erp uI'oJfnq un eJrl err8ap
u::nb o opru etuadar:p g'rr:uasna ?ns ? uorJ oprqts op ortrulrs o'lp uou o zrp eloJ l Ios o'ir{ueu\r'o:sriutf,J'red nes o oes anb sBIp uJ,,
Jp BTp

t
'

L
G

o
a

*5o

ht

Croneeeu Grurcn e ANLtsE oe

hospedeiro esto agruPa extremamente imPortante


os genes sejam ativados ou

(a) A orma linea da molcula de DNA de

35

Extremidade coesiva esquerda

Extremidade coesiva direita

importante para a
6).

DNA

CCCGCCGCTGGA

::::-

GGGCGGCGACCT

(b) A orma circular da molcula de DNA de l"

declonagem,acon2.9 linear, com duas extredo fago. Essa molcula lipareadas de acordo com as

em cada extremidade da
o DNA de fita simPles (Ficapazes de parear suas badupla (Figura 2.10b).
ttade'
como extremidades
entre elas pode unir as duas
duas molculas de DNA dicos e tm duas funes disque a molcula de DNA
para a insero no genodepois que o profago
um grande nmero de novas
rolante (Figura 2.10c), no
. O resultado um capelos seus stios cos, cuuma endonuclease, que cli. Essa endonuclease, que
coesivas de fita simples
u-u
genoma de l,

"-

"rl

mento reconhecem ape-

A mudana da estrutura das

novos genes, no tem efeito


no seja demasiadamente al-

(c) Replicao e empacotamento do DNA de

cos

O catenano
rola para fora
da molcula
de DNA de l.

cos

qT
l"'
I

A endonuclease
codiicada pelo
gene A cliva o
catenano nos

stios cos

o HH
o o'
H

Componentes proticos
do capsdeo

Novas partculas de
agos so montadas

uma estrutura comPletamente

muito menor do que o genoma


e tem a caractestica incomum

e"lril-nTrf

x{!-

Figura 2.10
As ormas linear e circular do DNA de . (a) A forma linear, mostrando as extremidades
coesivas esquerda e direita. (b) O pareamento de bases entre as extremidades coesivas resulta
na forma circular da molcula. (c) A replicao por crculo rolante produz um
catenano de
novas molculas de DNA linear de , que so empacotadas individualmente nas
cabeas
do fago medida que novas partculas de so montadas.

-o-utirr:l er:ii
G

'-rr:;r1to:
;

trec{ ocru.l ?t oxu la nb trt{ o :rqos oqlq o r:L:d

:,r:::sl crur y

ruo!I{ E nu!u!- o[ro] 'qdIf,tIud su:SRros:.rcl sop uin rtle,] opuxn.)., ossr noursua au uanb a:ol roJ or{ig '?rp oJtno un e:duas ua1 sEW.o]oql
zp sw:Nqr uau anb np uaa'elsJl oqprq un s?u'BroJ gl opurT Jeql:q apod 1os o anb rrp uaa rr:glsrq essou ep or5enurluo: e a e:ol anb:o4

JP

'oPuuszgJ.fo^c's3ssouof,ffpuA'opunuoptroreue'epn8ezalsr:tBunllo
u: anb o opm eluadu:p E'muasnt ens B ef,oqf op?q?s op orJurs o'Ip uou

!J'zeJsapasrapuranboopnlanberpuraa'o:unqunerner:8a1t
o zrp eJoJ ?l los o'lqu?uy'o:sr:ue:g'red nas o ors anb serp uaa,,

'
L

G
U

36

T.A. BRowN

O tamanho menor da molcula de Ml3 implica possuir espao paa um nmero menor de
genes do que o genoma de . Isso possvel porque o capsdeo de M13 construdo a partir
de mltiplas cpias de apenas trs protenas (requerendo apenas trs genes), ao passo que a
sntese da estrutura de cabea e cauda de l, envolve mais de 15 protenas diferentes. Alm disso, Ml3 segue um ciclo de infeco mais simples que o de e no necessita de genes para a
insero no genoma do hospedeiro.
A injeo de uma molcula de DNA de M13 em uma clula de E. coli ocoe atravs da
frmbria, a estrutura que conecta duas clulas durante a conjugao sexual (Figura2.4).Uma
vez no interior da clula, a molcula de fita simples atua como molde para a sntese de uma
fita complementar, resultando em uma molcula de fita dupla normal (Figura 2.11a). Essa
molcula no inserida no genoma bacteriano, sendo, emvez disso, replicada at que mais de
100 cpias estejam presentes na clula (Figura 2.1 1b). Quando abactna se divide, cada clula-filha recebe cpias do genoma do fago, que continua a replicar-se, mantendo, assim, o
seu nmero total por clula. Conforme mostrado na Figura 2.11c, novas partculas do fago so
continuamente montadas e liberadas, com aproximadamente 1.000 novos fagos sendo produzidos a cada gerao de uma clula infectada.

As vantagens de Ml3 como um veculo de clonagem

f
Jt

V,arios aspectos tornam M13 atraente como base para um veculo de clonagem. Seu genoma
menor do que 10 kb, um tamanho bem dentro da faixa ideal para um vetor em potencial.
Al- do que, a forma replicativa (RF) de fita dupla comporta-se de maneira bastante simi-

lar a um plasmdeo e pode ser tratada como tal para propsitos experimentais. Ela preparada facilmente a partir de uma cultura de clulas de E. coli infectadas (p. 59-60) e pode ser

**iiff

i:|,ffil::T tg;t 1ll, gene

s clonado s em

um veror derivado de M 1 3 pode

--

rem ser obtidos na forma de DNA de fita simples. Verses de fita simples de genes clonados j
so teis para virias tcnicas, especialmente para seqenciamento de DNA e mutagnese ir
,'
vitro (p.212 e243). A utilizao de um vetor derivado de M13 uma maneira fcil e confi- i
)
vel para a obteno de DNA de fita simples para esse tipo de trabalho.

2.2.3 Vrus como veculos de clonagem para


outros organismos

(cl

A maioria dos organismos vivos infectada por vrus e, por isso, natural que haja um
grande interesse na possibilidade de que vrus possam ser utilizados como veculos de clonagem para organismos superiores. Isso especialmente importante quando lembramos que
plasmdeos no so comumente encontrados em oulros organismos. que no bactrias e leveduras (p. 31).
De fato, os vrus possuem um potencial considervel como vetores de clonagem para alguns tipos de aplicao com clulas de animais. Os vrus de mamferos, como o simian virus 40 (SV40), os adenovrus e os retrovrus, alm dos baculovrus, de insetos, so aqueles que receberam mais ateno at agora. Esses vrus so discutidos com maior profundidade no Captulo 7.

Figura

O ciclo r
rem. (a)

replicati
Molcnl
montag

IE
T

NOJECI JJOA
V

EI

Jols I q tp elrd 3nb tu

IE

t,

*t:

z
o

Croruncev Gurcn p Arurrse oe

um nmero menor de

13construdoapartir
genes), ao passo que a
diferentes. Alm disnecessita de genes para a

(a) lnjeo de DNA de


ita simples na clula

DNA

37

A partcula de
M13 injeta seu
DNA na clula

hospedeira, seguida
pela sntese da
segunda ita

DNA de fita
simples

E. coli ocorre atravs da


sexual (Figura 2.4). U ma
para a sntese de uma
(Figura 2.11a). Essa
icada at que mais de

ria se divide, cadac-se, mantendo, assim, o


partculas do fago so
fagos sendo produ-

DNA de fita dupla:


lorma replicativa (RF)

(b) Replicao da RF
para produzir novas

clonagem. Seu genoma


um vetor em potencial.

molculas de ita dupla

7^\

oxo

maneira bastante simiimentais. Ela prepara-

(p. 59-60) e pode ser


derivado de Ml3 pode]
ples de genes clonados
DNA e mutagnese in /{
maneira fcil e confr-)

\\/^/

A RF replica pelo mecanismo de crculo rolante


para produzir DNA de ita simples linear
(c) Produo contnua
de agos M13

maduros
natural que haja um

% -##

DNA circularizado

como veculos de cloquando lembramos que


que no bactrias e lede clonagem para alros. como o srmtan vb
, de insetos, so aque-

Partculas maduras do fago

com maior profundiFigura 2.11

O ciclo de ineco de M13, mostrando os dierentes tipos de replicao do DNA que ocorrem. (a) Aps a infeco, a molcula de DNA de ita simples de M13 convertida na forma
replicativa (RF) de fita dupla. (b) A RF replica para produzir mltiplas cpias de si prpria. (c)
Molculas de ita simples so sintetizadas por replicao por crculo rolante e utilizadas na
montagem de novas partculas de M13.

::
::.=
IE

d eroA ztrgrslq p elred anb r$E

IE

G
U

:.::::':::r:

Cnprulo 3
uma descrio deta-

Dubuque. [Uma boa in-

Purificao de DNA a Partir de Clulas Vivas

Preparao de DNA celular total, 39

Preparao de DNA de bacterifagos, 55

Preparao de DNA plasmidial, 47

/ A engenharia gentica demanda, em diferentes momentos, a preparao de pelo menos trs tiI pos distintos de DNA. Primeiramente, um DNA celular total, muitas vezes necessrio como
\ ura fonte de material a partir do qual so obtidos os genes a serem clonados. O DNA celular
I total pode ser aquele conseguido a partir de uma cultura de clulas bacterianas, vegetais ou
,l animais ou de qualquer outro tipo

\
I
I
I
\

de organismo em estudo.
O segundo tipo um DNA plasmidial puro, cuja preparao d-se a partir de uma cultura
bacteriana, seguindo as mesmas etapas bsicas que a purificao do DNA celular total, com a
diferena crucial de que, em algum estgio, o DNA plasmidial deve ser separado do componente principal de DNA cromospmico tambm presente na clula.
Finalmente, PNA de fago breciso se um veculo de clonagem derivado de bacterifago
for utilizado. DNA de fago em geral preparado a partir de partculas virais e no a partir de
clulas infectadas, de modo que inexiste problema associado contaminao com DNA bacteriano. Entretanto, so imprescindveis tcnicas espeliais para a remoo do capsdeo viral.
Uma exceo a forma replicativa de fita dupla Oe Mt:, a qual prep arada apartir de clulas de E coli, damesma maneira que um plasmdeo bactenanor/

Preparao de DNA celular total


Os fundamentos da preparao de DNA so mais facilmente compreendidos se for considerado primeiramente o tipo mais simples de procedimento de purificao, utilizado quando todo

o complemento de DNA de uma clula bacteriana necessrio. As modificaes que se impem para a preparao de DNA de plasmdeos e de fagos podem, ento, ser descritas mais
tarde.

NOJd e30 AE

TJ

ols I q ep 3lrd 3nb ru

t!
,
t!
L
G

o
a

40

T. A. Bnowlr

O procedimento paa a preparao de DNA total a partir de uma cultura de clulas bacterianas pode ser dividido em quatro estgios (Figura 3.1).

(1)
(2)
(3)

As clulas bacterianas so cultivadas e depois recuperadas da cultura e concentradas.


As clulas so rompidas para liberar seu contedo.

(4)

nitrr

fato

ao

sad

rl

Este extrato celular tratado para a remoo de todos os seus componentes, exceto o

DNA.

A soluo

indr

) conl
\ extr

de DNA resultante concentrada.

lida,

3.1.1 Multiplicao bacteriana em cultura e recuperao


das clulas cultivadas

trat(
ade

A maioria

das bactrias pode ser multiplicada sem maiores dificuldades em um meio lquido
(caldo de cultura). O meio de cultura deve prover uma mistura eqirilibrada dos nutrientes essenciais, ein concentraes que permitiro o desenvolvimento e a diviso eficiente das bactrias. Os dois meios de cultura tpicos so detalhados na Tabela 3.1 .
M9 um exemplo de meio definido, no qual todos os componentes so conhecidos. Esse
meio contm uma mistura de nutrientes inorgnicos para prover elementos essenciais, como

com
uma

Tab

Mei
Mei

As bactrias so cultivadas em
meio de cultura e recuperadas
por centriugao

As clulas so recuperadas
do meio e rompidas para gerar
um extrato celular

-9'-

-:'t"f

/\fl
/\
/--:--

Centriugao

= --(.-:___:J

\Extrato

Cultura bacteriana

celular

di
send
quad

uma

-R
tt

tos.

tt

L]
lt ',tl

\:-r'---DNA

as/n

sldac

Dfi

puro

lume

ODNA
concentrado

Velor

O DNA puriicado a

patir do extrato celular

do dr
tria:

pensi

Figura 3.1
As etapas bsicas para a preparao de DNA celular total a partir de uma cultura bacteriana.

IE

in oJSd 330,\

r9lslq ?p alrd enb ru

IE

rt

Croruncev Guce e ANLtsE

de clulas bacte-

concentradas.
exceto o

:n um meio lquido
dos nutrientes eseficiente das bact-

io conhecidos. Esse
os essenciais, como

DNA

41

nitrognio, magnsio e clcio' alm de glicose, como fonte


de carbono e energia. Na prtica,
fatores de crescimento adicionais, como elementos-trao e vitaminas,
devem ser adicionados
ao M9 para que ele seja capaz de sustentar o desenvolvimento
bacteriano. A definio precisa dos elementos necessrios depende da espcie a ser
cultivada.
O segundo meio descrito na Tabela 3.1, o de Luria-Bertani (LB),
um pouco diferente,
ou complexo, o que significa que a identidade e a quuiaud" precisas
.' indefinido
dos seus
componentes so desconhecidas. Isso ocorre porque dois dos
seus ingredientes, a triptona e o
. extrato de levedura, so misturas complexas, de compostos qumicos desconhecidos.
Na realidade, a triptona supre as bactrias com aminocido e pequenos peptdeos,
enquanto o ex_
trato de levedura (uma preparao seca de clulas ae levdura puui-.nt.
alg".iJury *p."
a demanda por iritrognio, acares e nutrientes orgnicos
e inorgnicos. Meios complicados
como o LB no necessitam de suplementao adiciorial e sustentam
o desenvolvimento de
uma ampla gama de espcies bacterianas.

Tabela 3.1 A composio de dois meios tpicos para o cultivo de


clulas bacterianas

Meio
Meio M9

LB (meio de Luria-Bertani)

-(fato

DE

Componente

g/l de meio

NarHPO.

6,0

NH2PO4

3,0

NaCl

0,5

NH4Ct

1,0

MgSO,

0,5

Glicose
CaCl.,
Triptona
Extrato de levedura

2,0
0,015
5

NaCl

10

10

celular

Meios definidos devem ser utilizados quando as bactrias


tm de ser cultivadas sob condies precisamente controladas. Isso, contudo, no necessrio
quando as bactrias esto
sendo cultivadas simplesmente como uma fonte de DNA
no
u- meio completo ade_
quado. Em meio LB, a 37"c e.coT
", por"uro,
proporcionada
agiiaao
a 150 a 250 rpm em
uma plataforma rotatria. clulas de raeo
coti dividem-se
*o" o-u u", a cada 20 minu\
tos, at que a cultura atinja uma densidade mxima de"aproximadam*,"_k_:-^^l-_d*;r";
las/ml. o aumenro do n-mero de clul-as na culrura. po$g. ^gr

ioo

I*,ffi;i
'i;i'r.i,piiln"ur"
DO corresponde a aproximadamente
0,g x lOe
'

10nf-tgr+.g.g p_e. l.p_ lpituta .da den_compripento de onda, uma unidade; de-:'
i
.

clulas/ml.

Pra

'

aprtrife"ffiititelili;fffiilffim

esrar concentradas no menor volume possvel. Por isso' as clulas da cultura so sedimentadas
por centrif'ugao (Figura 3.3).
velocidades de centrifugao moderadas so suficientes para
r"di-"nt- as bactrias no fundo de um tubo de centfuga, o que permite que o meio
de cultura seja removido. Assim, bactrias oriundas de 1.000 ml de uma cultura cm densidade
celular -*i-u podem ser ressuspensas em um volume de l0 ml ou menos.

cultura bacteriana.

-'r70-red JJOA e{-{ols

,v
.,

q Yp rlred 3nb ur

*,=

t
8l
( [f*\ I
\t \\ ..\
rl

Clorunceu GHtca e ANLlsE oe

DNA

43

em uma

ptica (DO). (a)


passa luz de um
da cultura medi- -log,o (intensidade
. em um espectroa partir de uma
cr.rlturas com densida-

Figura 3.3
Sedimentao de bactrias por centrif ugao.

quais a lise celular causada pela exposio a agentes qumicos que afetam a integridade das
baneiras celulares. Os mtodos qumicos so mais comumente utilizados quando as clulas
bacterianas devem ser liSadas visando preparao de DNA.
A lise qumica via de regra envolve um agente que ataca a parede celular e um outro que
rompe a membrana da clula (Figura 3.4a). Os agentes qumicos a serem utilizados dependem
da
da espcie de bactria envolvida. PanE. col e organismos aparentados, o enfraquecimento
(EDTA)
uma
ou
etilenodiamina
pared celular , em geral, feito com lisozima, tetracetato de
iombinao de ambos. A lisozima uma enzima que est presente na clara do ovo e em secre-

por sua vez, envol-

coli, aprpia parede


Todas essas barreiras
ididas em mtodos fntodos qumicos, nos

xtulffi

.z

mmmmmrnur4 rruou'd

G
:luf,si 3n V

.z
IE
L

*-"::{:::::":"":Hll:nas o ots anb strp ual,,

It
a

o.iill:t :-\.al (ru :1e :tlh itJ o :rqus

c'q1t1

o t'lr:d

::--:::--:.:,- ::rl
,rosmu:r;r;-:rr'r::-:::--::f,-ossrnous:auuanbetro^tol'oqllI'?rp""""l-::|^t::t:^:i::i
;*[ -*

**atql

p mmm

ffiffi

Eopourqprqapodlos

rtprrst

u:"r-

o anb

*".;'-J*p

;;1" ;;;J;

trpuaa'tr:glqqes

ory

;'rrru'urv'of,
*;l ;r "r";"p''b

slruerg'nd

IE

*ia,a

44

T. A. Bnowlr

polimricos que conferem


es como algnmae a saliva, sendo capaz de digerir os compostos
ngidez parede celular. O EDTA, por sua vez, remove ons de magnsio essenciais preservao da estrutura global do envoltrio celular, alm de, tambm, inibir enzimas celulares capazes de degradar DNA. Sob certas condies, o enfraquecimento da parede celular com lisozima e EDTA suficiente para romper as clulas bacterianas, mas, em geral, um detergente, como o dodecilsulfato de sdio (SDS), tambm adicionado. Detergentes auxiliam no processo
de lise removendo molculas de lipdeos, o que provoca o rompimento das membranas celula-

A
ra de

cido
lentat
cas

fi

lada I
com l

res.

Depois de as clulas terem sido lisadas, a etapa final da preparao do extrato a remoo
dos resduos celulares insolveis. Componentes como fraes da parede celular parcialmente
digeridas podem ser sedimentados por centrifugao (Figura 3.4b), deixando o extrato celular como um sobrenadante razoavelmente limpo.

3.1.3 Purificao de DNA a partir de um extrato celular


Alm do DNA, um extrato celular bacteriano contm'quantidades significativas de protenas
e RNA. Para deixar o DNA em uma forma pura, vrios procedimentos podem ser utilizados
Figura 3.5
Remoo de
contaminantes proticos
por eldrao
com enol.

na remoo desses contaminantes.

(a) Lise das clulas

Er
com
probk

Rompimento da parede celular


Rompimento da
membrana celular

mas ir
ns m

_-_

?---l-

-- l^

Extrato cel

la

moa

Polip'r

--\D

AI
vidas

nir

cleasr

81"4 Conct

(b) Centriugao para remoo dos resduos celulares

Com

no nt

l :l

5Jilil:1'

centriugao.

l---- I '--

es d
o dc

DNA' RNA' Protenas

Or
Na pn

Nalr
cidos

tado

Resduos celulares

sr

celent,

luo
Figura 3.4
Preparao de um extrato celular: (a) lise das clulas e (b) centrifugao do extrato celular
para remoo de resduos insolveis.

LE

Ior-r4E]rorElC

Til[i

. :z

G
'::--+:iio: r,rrd odrut 31rl oru .i nb rt. o :.tqos oqlg o urd :l::rs: otut y
ss;6ffas;:'i i:r -:r i:a: : l::r r -.'os nomsua au uanb afo^ ol 'oq[g'?Ip o:lno un arduas u] sBW'oloqtr
M @qmFrq r wruJ g[ op,rrrl rtqgrq apod 1os o anb erp u:1'er:91m4 essou ep or5enuuuo: t a a:ol anb:od
utpnsr u:rm zun E{o.\ f 'zejsp s lapw anb o opnt anb erp uea'o:anq un an er:8ap
ryrryr rp^

uory

oGqtr p o!ru3q-s o'aIP

:ou

o zrp EoJ El los o

'leqmuv'of,srJwrJ

'red nas o oes anb seIP

uL,

,
IE

t!

It
a

*r
.q

srrreti

CLoruneetr Gnrcn e Aruuse oe

:,:[imricos que conferem

io essenciais preservaenzimas celulares capa-

celular com lisoztgeral. um detergente, col;es auxiliam no processo


: rlas membranas celula:e.arede

DNA

45

A maneira-padro de desproteinizar um extrato celular adicionar fenol ou uma mistura de fenol e clorofrmio 1:1. Tais solventes orgnicos precipitam protenas, mas deixam
os
cidos nuclicos (DNA e RNA) em soluo aquosa. Assim, se o eitrato celular misturado
lentamente com o solvente e as fases so separadas por centrifugao, as molculas proticas ltcam na interface entre as camadas aquosa e orgnica, na forma de uma massa coagulada branca (Figura 3.5). A soluo aquosa de cidos nuclicos pode ento ser removida
com uma pipeta.

doextratoaremoo
Ftr:de celular parcialmente
. Jeirando o extrato celuFase aquosa
(DNA + RNA)
lnterface
(protenas
coaguladas)

-.-------------

slsnificativas de protenas
ros podem ser utilizados
Fgura 3.5
Hernoo de
ounaminan-

hs proticos
por extrao
corn enol.

____\

-_

:-_I

,-+

Extrato celular

Fenol
Extrato celular

Mistura com
fenol

Separao das ases


por centrifugao

Em alguns extratos celulares, o contedo protico to grande que uma nica extrao
com fenol mostra-se insuficiente para purificar completamente os cidos nuclicos. Esse
problema poderia ser resolvido pela realizao de vrias extraes sucessivas com fenol,
mas isso no desejvel, pois cada etapa de mistura e de centrifugao resulta em quebras
nas molculas de DNA. A soluo , ento, tratar o extrato celular com uma protease,
como a pronase ou a proteinase K, antes da extrao com fenol. Essas enzimas quebram os
polipeptdeos em unidades menores, as quais so mais facilmente removidas pelo fenol.
Algumas molculas de RNA, especialmente de RNA-mensageiro (mnN), so removidas pelo tratamento com fenol, mas a maioria permanece com o DNA na soluo aquosa.
A nica maneira eficiente de remover o RNA trata a preparao com a enzima ribonuclease, que degrada rapidamente tais molculas em suas subunidades ribonucleotdicas.

S.1.4 Concentrao de amostras de DNA

NA, protenas

i
I

Fes
I

lrifugao do extrato celular

com freqncia, uma preparao bem-sucedida resulta em uma soluo densa de DNA, que
no necessita de qualquer concentrao adicional. Entretanto, s vezes, so
obtidas solues diludas, sendo, ento, importante considerar mtodos para o aumento da concentrao do DNA.
O mtodo de concentrao utilizado iom mais freqncia a precipitao com etanol.
Na presena de sal (estritamente falando, ctions monovalenter, .o-o os ons de sdio
[Na-]) e a uma temperatura de -20'C ou menos, o etanol absoluto precipita com eficincia
cidos nuclicos polimricos. com uma soluo densa de DNA, o etanol pode
ser deposi_

tado sobre a amostra, provocando a precipitao das molculas na interfa..


U- truqul excelente consiste em empurrar um basto de vidro pelo etanol para que ele
mergulhe na soluo de DNA. Quando o basto removido, as molculas de DNA aderem a ele podem
e
ser retiradas da soluo na forma de uma longa fibra (Figura 3.6a). Alternativamenre,
s o eta-

*sl

,:
: nn:.FJ.r ,i;.ir::*::: rr,::.::-.
m mffi upm}.[.::ssr rrluq rm: *tro,l EI opuqnqprq apod los o a.b erp uaa'orrril
o":".rrtro, e r rro^ ,.brr4
"rror "p
LMliff* mmmJ 5@ mf omnIE oP loro e'zpn8e ezarsut Bun rtlo^
'ze;sap as rapur anb o opnl anb erp u:a.o:e:nq un an err3afi
m'dal:g tr'mmosmm r uog- oP"q op oDuJIs o'JIp Juou o zrp ero; rl
Ios o'trr{uruv.o:sr:uerg,red nas o ors anb srrp rr"a,,
r

..,,..5,,'";'ii:*;ff;:t;'.:,ilf.:",i;::ff::.:'1,':il,.r:

IE

o
a

46

T. A. Bnowlr

A mul
sar de as

Basto de vidro

de DNA

Soluo de DNA
concentrada

DNA precipitado
coletado por
centriugao

Figura 3.6

tes em hir

Coleta do DNA por precipitao com etanol.


(a) Etanol absoluto
depositado sobre uma
soluo concentrada
de DNA. As fibras de
DNA podem ser recuperadas com um basto de vidro. (b) Para
solues menos concentradas, o etanol
adicionado (em uma
proporo de 2,5 volumes de etanol absolulo
para 1 volume de soluo de DNA) e o DNA
precipitado coletado
por centriugao.

rompirner

rianas r-ia
ta clulas
de parede
do com al
rede celul

Lma

nentq!i!

uma ex.tr8

cm_-d[i
tm qan
no ser su
te specto

mordos

u*m dc

(CTABt-r

nado a rrrr
boidrarospois- colet

nol misturado com uma soluo de DNA diluda, o precipitado pode ser coletado por centrifugao (Figura 3.6b) e depois novamente dissolvido em um volume adequado de gua. A
precipitao com etanol tem a vantagem adicional de deixar cadeias curtas e componentes
monomricos de cidos nuclicos em soluo. Assim, nesse estgio, ribonucleotdeos produzidos por tratamento com ribonuclease so perdidos.

complero
o RNA po
Um se

sui duas p
dissolr,e tr

3.1.5 Medio da concentrao do DNA


crucial conhecer exatamente quanto do DNA est presente em uma soluo quando da execuo de um experimento de clonagem gnica. Felizmente, a concentrao de uma soluo de
DNA pode ser precisamente medida pela espectrofotometria de absorbncia de ultraviolet (UV). A quantidade de radiao IfV absorvida por uma soluo de DNA diretamente proporcional quantidade de DNA na amostra. Via de regra, a absorbncia medida a260 nme,
nesse comprimento de onda, uma absorbncia (Aruo) de 1,0 corresponde a 50 pg de DNA de
fita dupla por ml.
A absorbncia de ultravioleta tambm pode ser utilizada para a verificao da pureza de
uma preparao de DNA. Com uma amostra pura de DNA, arazo das absorbncias a 260 nm
e a 280 nm (Aruo/Arro) 1,8. Razes menores que 1,8 indicam que a preparao est contaminada com protenas ou com fenol.

3.1.6 Preparao de DNA celular total de outros organismos


que no bactrias

5er

utiliz

presena (
_-8ar.

pen

qumiss5

lular. mes

care na cc
lica e re:
\-

rnente por

., Euanirlina

molculas

t2

Preparaq
.+prific'a

Bactrias no so os nicos organismos cujo DNA pdde ser necessrrio. DNA celular total de,
por exemplo, plantas ou animais pode ser fundamental se o objetivo do projeto de engenharia
gentica for a clonagem de genes de tais organismos. Embora as etapas bsicas da purificao
de DNA sejam as mesmas para qualquer organismo, a introduo de algumas modificaes
pode ser exigida em decomncia das caractersticas especiais das clulas que esto sendo utilizadas.

t!
'-r:::tiuo:r trrd ocltrtal J l olu Jli rtb rcd o ::qos oqltl o urd ;rat:rsl arnt y
rrruil: -ir.:flJf,:tr;1i11s'r;.:j;..;rrinr:luopurn|.;os$nou$uuuanberolrog'oq[g'?IpoJlnounerduasua]s2141'o:oq:
fubrr4, mrn1-ax-n oqlrq tm 9 su'soJ gl opurlr?rilrrq apod 1os o enb ?Ip uJ'ttf,otslq ?ssou ep otSenurluo: t a a:ol anb:o4
Lmxw Lionmcr- sp u:I -opm op roro r'epn8e ezatsrJl ?un etlo !J'ze;s:p as rapw :nb o opnl anb erp u3l'otrunq un eiln rr:8ep
rudm:ry' g-m:uasrc rur EoqJ opeqrs op ortruIs o'lp uou o zrp ef,oJgIos o 'lqu?uryorsrf,uttrg'red n:s o oes anb srrp uaa,,

p@

IE

t!

o
a

lal ilg rrma


lquido- x
cnraro d

piao c-o

qdeos e a

Cr-oruncev Grurcn e ANLrsE DE

As ibras de

ItA podem ser recu:eradas com um bas-

5o de vidro. (b) Para


solues menos con:entradas, o etanol
:dicionado (em uma
:rcporo de 2,5 volu-es de etanol absoluto
:ara 1 volume de solu:o de DNA) e o DNA
:recipitado coletado
:,:,r centriugao.

:er coletado por cen-

:'Jrtas e componentes
r :n:,nucleotdeos produ-

i{t.ico quando da exe-

r de uma soluo de
de ultraviole
diretamente
pro'\
;i' s :edida a 260 nm e,
-t 50 pg de DNA de

a:ao da pureza de
ubs.rrbncias a 260 nm
;o est contami-

47

A multiplicao das clulas em meio lquido pode, muitas vezes, no ser adequada, apesar de as culturas de clulas vegetais e animais estarem se tornando cadavez mais importanes em biologia. Entretanto, as principais modificaes so, em geral, exigidas na etapa de
nompimento das clulas. Os agentes qumicos utilizados para o rompimento de clulas bacte-

3.6
do DNA por precom etanol.
absoluto
sobre uma

adequado de gua.

DNA

rianas via de regra no funcionam com outros organismos: a lisozima, por exemplo, no afeta clulas vegetais. H enzimas degradantes especficas disponveis para a maioria dos tipos
de parede celular, mas, muitas vezes, tcnicas fsicas, como a triturao do material congelado com almofariz e gral, so mais eficientes. Clulas animais, por sua vez, r,o possuem parede celular e podem ser lisadas por um simples tratamento com detergente.
Uma outra considerao impgrt4nte diz respeito ao contedo bioqumico das clulas a
partiids qqAiq_q PNe gs!4 $endo _extrado. Na maioria das bactrias, os principais compoq911e9 b-!og{mi,c-g-q p_{e_sgllgq ell,um extrato celular so pqot_9in4q, DNA e RNA, de modo que
uma extrao com fenol e/ou um tratamento com protease, qe_ullo pql3,Igfno{o_ {o RNA
tu*t-.ncom rlbonladarmmostra d;DNCp*". E tr"t-t"J"
^ "l"l'
tm quantidaaesfiitlii-tie ioJ"mptnts bioqumicos, esses tratamentos podem
no ser suficientes para liberar DNA puro. Tecidos vegetais so particularmente difceis nesre aspecto, pois mg-ip.9*y9_ze_s_g59it9{q1_g-rqndgs ggantidqdes de carboidratos, que no so redeve ser utilizada.
movidos por qx-trg{g
-c_gq.le_19!_P*ol-t!p-o.933*4b-oldggem $jerryti,va
Um dos mtodos disponveis usa um detergente chamado brometo de cetiltrimetilamnio
{CTAB), que forma um complexo insolvel com cidos nuclicos. Quando o CTAB adicionado a um extrato celular vegetal, o complexo cido nuclico-CTAB precipita, deixando carboidratos, protenas e outros contaminantes no sobrenadante (Figura 3.7). O precipitado ,depois. coletado por centrifugao e ressuspenso em NaCl (cloreto de sdio) lM, que desfaz o
complexo. Os cidos nuclicos podem ento ser concentrados por precipitao com etanol e
o RNA pode ser removido por tratamento com ribonuclease.
Um segundo mtodo envolve um composto denominado tiocianato de guanidina, que possui duas propriedades que o tornam til para a purificao de DNA. Primeiro, ele desnafura e
dissolve todos os compostos bioqumicos que no so cidos nuclicos, podendo, portanto,
ser utilizado para liberar DNA de virtualmente qualquer tipo de tecido. Em segundo lugar, na
presena de tiocianto de guanidina, o DNA liga-se fortemente a partculas de slica (Figura
-1.$s). permitindo que o DNA seja facilmente recuperado da mistura de outros compostos bioqumicos desnaturados. Uma das possibilidades a adio de slica diretamente ao extrato celular. mas mais conveniente que seja utilizada uma coluna cromatogrfica. A sflica colocada na coluna e o extrato celular, ento, adicionado a ela (Figura 3.8b). O DNA liga-se slica e retido na coluna, enquanto os compostos bioqumicos desnaturados passam diretamente por ela. Depois da lavagem dos ltimos contaminantes com a soluo de tiocianato de"
_suanidina, o DNA recuperado pela adio de gua, que desestabiliza as interaes entre as molculas de DNA e a slica.

3-2 Preparao de DNA plasmidial


lN-{

,\ purificao de plasmdeos a partir


celular total de,

rreto de engenharia
da purifi cao
Fnas modifi cae s
,Jre esto sendo uti-

rr',,usicas
"!lLt

de uma cultura bacteriana envolve a mesma estratgia gepreparao


DNA
ral de uma
de
total. As clulas contendo plasmdeos so cultivadas em meio
por
lquido, sedimentadas
centrifugao e rompidas para a preparao do extrato celular. O
-rtrato desproteinizado, o RNA removido e o DNA provavelmente concentrado por precipitao com etanol. Entretanto, existe uma importante distino entre a purificao de plasmdeos e a de DNA celular total. Em uma preparao de plasmdeos sempre necessrio se-

,F:

,:

.
i :j, ,,;:;"1*:;j":l:#.:1i:,:':?iJ:::;:
opuqrrquqpodloso:nbrrpueaerf,otsrEssouepoe5enuguo:eea:olanbro4

l:milmhrr ro-I:rrcrquJ:-::ro-rro-IEI
tlq0il, r 'inwt ilru I itrr:r Ef lcLr= L1r lomu t'e1nr ez:tsrfl run ello^ E
5N'Ld:

qF!@ tiluiuI;ru *F

EE--lrr

r-5 r

lo:- opeq

op ottruFs o 'Jp uou o zrp

r:pur anb o opnl anb erp uJ oJ?Jnq un ef,rl err8ap


rrJ tl los o 'f,equruv'oJsr:ue:g'ftd nas o ors anb serp uea,,

zrJsap as

ItG
a

*:

48

T.

A. Bnowlr

CTAB

\Complexo

cido

Extrato celular
Complexo cido
nuclico-CTAB precipitado

DNA

puro

Precipitao

i?[,itli'3;",

<--

ribonuclease

Figura 3.7
O mtodo do CAB para puriicao de DNA de vegetais.
parr o DNA plasmidial da grande quantidade de DNA cromossmico bacteriano que tambm
est presente nas clulas.
,\
A separao de ambos os tipos de DNA pode ser bastante difcil, embora essencial se os
plasmdeos
sero utilizados como veculos de clonagem. Mesmo a presena de quantidades
t.',
.. r:
mnimas de DNA bacteriano contaminante em um experimento de clonagem pode levar a resultados indesejveis. Felizmente, h vrios mtodos disponveis para a remoo de DNA
,\"
bacteriano durante a purificao de plasmdeos e o uso dos citados mtodos, individualmente
ou combinados, pode resultar no isolamento de DNA plasmidial bastante puro.
"J
z
":,'\ ,
Os mtodos so bseados nas vrias diferenas fsicas existentes entre o DNA plasmidial
I
e o bacteriano, sendo a mais bvia o tamanho. Os maiores plasmdeos possuem apenas 87o do
tamanho do cromossomo de E coli e amaiona deles muito menor do que isso. Tcnicas ca"t
pazes de separar molculas de DNA pequenas de rrolculas de DNA grandes deveriam, porl! tanto, ser capazes de purificar plasmdeos eficientemente.
Alm de diferirem no tamanho, plasmdeos e DNA bacteriano tambm diferem quanto
sua conformao. Quando aplicado a um polmero, como o DNA, o termo conformao refere-se configurao espacial total da molcula, com as duas conformaes mais simples
sendo a linear e a circular. Os plasmdeos e o cromossomo bacteriano so circulares, mas, du-

o,l.

3'\\':'

r-l

10'ntiE]@f".,jl.j

lir:lfi|qi

flrll:l

..

'::-.:rilro:

t-rrcl odtul .\) o?u JIJ "nb

ltd

o o;qos or1lg o

urcl

:l:::s: :tul y

.mdr,n;j .:t!:ru-.:; j i.; .::: i::-l ,ai:E:. oss nousu uuanb a:ol rog oqlg'Brp ollno um e:duas ual st141'o:oq:
rfficry, 1.;qml ory:qm 9 wu'a-1g oprq *qptq rpod 1os o anb rrp ue.L errolsrq tssou ?p oe5znurluo: t e a:ol anbro4
ronmrffqldlltunopro*"'"pa"zlsreunt1o
'ze3spsIJpu?anboopruanbtrpuJ'o3?Jnqunerntrr8ap

'ruir:

JW,lmJuiEmmr mqtr op"q6

op oDualrs o.lp uo o zlp loJ 9l los o'3qu?uvoJsr:uag'rzd nas o ots anb serp ruaa,,

'
L
G

t,
a

*:

o
z
g
6

Figur
Purifir
tiociar

coluni

Clorunceu GNrcA

E ANLrsE

oe DNA

49

(a) Ligao do DNA a partculas de slica

/r-:x @-'t=

Partculas de slica

-'@ .@'
\

\6\y

Molculas de DNA

(b) Purificao de DNA por coluna de cromatograia

Extrato celular

Partculas
de slica

+ffi

Agua

W}

ul

bacteriano que tambm

difcil, embora essencial

se os

a presena de quantidades

de clonagem pode levar a reis para a remoo de DNA

Compostos
bioqumicos
desnaturados

mtodos. individualmente
bastante puro.
entre o DNA plasmidial
possuem apenas 87o do
do que isso. Tcnicas caDNA grandes deveriam, por-

l,l
H

-_ ti-"i-.-/
\:-7

DNA
Descarte
i

Figura 3.8
Purificao de DNA pelo mtodo do tiocianato de guanidina e da slica. (a) Na presena do
tiocianato de guanidina, o DNA liga-se a partculas de slica. (b) O DNA puriicado em uma
ooluna crornatogrf ica.

tambm diferem quanto


A, o termo conformao reconformaes mais simples
no so circulares, mas, du-

IE
o?u la .lnb cd o o:qos oqlg o :;ud lursr orur y
rrrd odrul
rm: mihrmld miru!i !{l iin r:g,t oprnn}..'os$ nonff ru unb"^t
a:ol rog oqlg'etp ortno un a:dus u3l sery'oJo{f
ffirpmq:m-ooryqrm szu?ro;yloprqnq1uq apod 1os o anb ap uI'?rrotsrq?ssouep oe5znurtuo: r a a:olanb:o4
-1p-.sq1rs3

rqlnpslmoprow

JDg-EJryrt lnr r cloqJ

opeqgs

e?pn8e rzatsut erlm etlo^ A zr;sap es rapue anb o opnl anb ap uaa'orernqun an er:8ap
op oouIs o'lp uou o zrp roJ el los o rf,Jrlu?uy'o]sr:urtg'rcd nas o ogs anb serp uaa,,

t!
L

o
a

50

T. A. Bnowrrr

rante a preparao do extrato celular, o cromossomo sempre quebrado e gera fragmentos


lineares. Um mtodo para separao de molculas circulares de lineares resultar, pr1anto,
em
plasmdeos puros.

:e.

Bm

r,l

1r{

Fl

^E:1i{

;ttl"'t

3.2.1 Separao com base no tamanho


Em geral, o fracionamento por tamanho executado no estgio de preparao do extrato
celular. Se as clulas so lisadas sob condies cuidadosamente controlads, ocorre apenas uma
quantidade mnima de quebra do DNA cromossmico. Os fragmentos de DNA resultantes
so
ainda muito grandes - muito maiores que os plasmdeos e podem ser removidos, juntamente com os resduos celulares, por centrifugao. Esse processo tambm facilitado pelo fato
de que o cromossomo bacteriano est fisicamente fixado ao envoltrio celular, de modo que
os fragmentos cromossmicos sedimentam com os resduos celulares se essa interao n

rompida.
O rompimento das clulas deve, portanto, ser executado de maneira bastante branda para
impedir a quebra generalizada do DNA bacteriano. Paru E. coli e espcies aparentadas a ela.
a lise controlada executada conforme mostiado na Figura 3.9. o tratamento com EDTA
e lisozima feito na presena de sacarose, o que impede que as clulas rompam-se imediatamen-

ilir

,Ufittr

Slll:.

ruLl

-ii,ufillt

iltfi ltff'lto:

illlutllf

-.rmmu

&,fuS]!

llJ{l

tIuxlLijul

;lr

,*,tt!tLf:*ringr,ffro

r,lii!ffiiirf,$ e

t,e e

SWt
4rilf$
tllf

tiitmli

trt

rrrit

ihdldurmuln

forulurrrnur, i&f

,ufu'nmam"dUr
uClLir:q,:tliiu

tuCiuu

Cromossomo bacteriano

Eseroplasto

uLlm

'llhf

;p'lirlt,tu1Nrmrirdurur
11|ti(rrtElI]jlflEl!1tl,

Lisozima
+ EDTA

if,

utt[

'Itrrill,iitlr

-llnnlllrr,lll4n|l,
mtnrmmrudii

...........................".............'...*

Sacarose 25%

td

rrt;|ltr 4l:

Plasmdeos

Membrana

.'/

celular intacta
Parede celular
rompida
I

rriton x-t oo

t
Plasmdeos

Lisado

clariicado

Grandes
fragmentos
de DNA

+Centriugao

lmtttittuttllr,

o
o2 ab
\ ^,.

IV
.aa

.^ /'

/-

llllr

lnffi

rrfl

ttilttum"rfiMilim'

riiilrrlllffiirriillMll

'
i

o-\

uultl,fl 1

Extrato celular
Resduos celulares

Preparao
de um lisado
clarificado.

ltrr

:: ::.:.:::i-io:.rirrlop,{rr,,.,r.r"'"1r,,:'.'ri:.jj,::1:il::lrJiffin:'i.::;'j;'l#;:;:

ur'lll ollluq un r $u'croJ e opuq rrqir:q apod 1os o anb rrp ua1'orrii1"*o.,
oe5enunuo: e a a:olnb:o4
F-r : fL--a qT! uf .opunlu op lornu e,epn-Br ezetsrJt un ?tlo^ g.zeSsap :s rapur anb o opnl anb "p
erp uJ.of,ernq un ?nl e,rap
-EDusn?
lw,;: :: I
Ens e Elo]] op?qs op orluars o ,lp ruou o zp troj ?
os o,lqu?uv.of,st:ue:g,rrd nes o ors :nb srrp rraa,,
gr

rrp

rt

uLl

nur| utl[, r||l{ulut

r::-.1

IE

tttjmr

Figura 3.9

r'm; ::i

illliillil

'tfln1Imdirxtrudllui

unmnr

*s1

llirrltttluru

Dlrl
{trr

:;

i$MnlillrM

illlntnluttu,,idlffulir

rrtttrrrrnt{ttttu

\-_

dim*rnn

CLorunoev GNrcA

r quebrado e gera fragmentos li: Lineares resultar, portanto, em

DNA

51

gradadas, que retm uma membrana citoplasmticaintacta. A lise celular , ento, induzida
pela adio de um detergente no-inico, como o Triton X-100 (detergentes inicos, como o
SDS, causam quebras cromossmicas). Esse mtodo provoca poucas quebras no DNA bacteriano, de modo que a centrifugao resulta em um lisado clariicado, consistindo quase que
inteiramente em DNA plasmidial.
Contudo, um lisado clarificado ainda conter, invariavelmente, algum DNA cromossmico. Ademais, se os prprios plasmdeos so molculas grandes, eles tambm podem sedimentar juntamente com os resduos celulares. Assim, o fracionamento por tamanho raramente
suficiente por si s, devendo-se considerar modos alternativos para a remoo dos contaminantes de DNA bacteriano.

\22

b maneira bastante branda para

fr

oe

te. Em vez disso, so formados esferoplastos, clulas com paredes celulares parcialmente de-

;io de preparao do extrato cecontroladas, ocoe apenas uma


lmentos de DNA resultantes so
Ddem ser removidos, juntamenn tambm facilitado pelo fato
rur otrio celulaq de modo que
clulares se essa interao no

E ANLrsE

Separao com base na conormao


Antes de se considerar como as diferenas conformacionais entre plasmdeos e DNA bacteriano podem ser utilizadas para separar os dois tipos de DNA, deve ser analisada mais detathadamente a estrutura geral do DNA plasmidial. No estritamente correto dizer que plasmdeos tm conformao circular, pois crculos de DNA de fita dupla podem, na realidade,
adotar duas configuraes alternativas bastante distintas. A maioria dos plasmdeos existe na
clula como molculas superenroladas (Figura 3.10a). O superenrolamento ocore porque a
hlice dupla do DNA plasmidial parcialmente desenrolada durante o processo de replicao
plasmidial por enzimas chamadas de topoisomerases (p. 70). A conformao superenrolada
somente pode ser mantida se ambas as fitas polinucleotdicas estiverem intactas, da o nome
mais tcnico de DNA circular covalentemente fechado (ccc, do ingls covalently closedcircular). Se uma das fitas polinucleotdicas quebrada, a hlice dupla retorna ao seu estado

e espcies aparentadas a ela,

O tratamento com EDTA e li- a-r rompam-se imediatamen-

normal relaxado e o plasmdeo adota a sua conformao alternativa, denominada de circular

aberta (oc, do inglsopen-circular) (Figura 3.10b).

- Corte

Figura 3.10
conformaes de DNA de ita dupla circular:
lmlt srnerenrolado - ambas as itas esto intactas;
'h l roular aberto - uma ou ambas as fitas possuem uma quebra.

lMurms

Figura 3.9
Preparao
de um lisado
clarificado.

(a)

Superenrolado

(b) Circular aberto

O superenrolamento importante na preparao de plasmdeos porque molculas superenroladas podem ser facilmente separadas de DNA no-superenrolado. Dois mtodos diferentes so comumente utilizados, os quais tm capacidade de purificar DNA plasmidial a partir de extratos celulares brufos, embora, naprica, sejam obtidos resultados melhores quando um lisado clarificado primeiramente preparado.

Desnaturao alcalina
A base dessa tcnica a existncia de uma estreita faixa de pH na qual DNA no-superenrolado desnaturado, enquanto plasmdeos superenrolados no o so. Se, com a adio de hi-

IE
x.rrrsr orul g
.- : r :: ::: :::.:ri; .ossrnoursuaauuanba:o^roc'oqg'rlporlnounarduasuslsBl/^{ oJorlf
@
Xumr .r cr: r :tsrr rc- n: !u'ro_J pl opurl rsqlrrq apod 1os o anb erp uI ?rrgtsr{ essou ep oe5rnurluo: r a a:ol anbro4
rr$r; r im: l flr J-rc::---u p ronu e 'tpnr eztsl:] Eun ello^ E ZBJsp s rpur nb o opnr anb erp uJ of,rrnq un ?rrl rr:8ap
lndil ;r : m-Es:x ms f, Ei.q-- otlEqe\ op of,uFs o'JIJp uou o zrp rloJ gl Ios o 'atquuy oJsrf,ur:g 'rcd nas o os anb stlp uaa,,
:.---:lJrrl-r r.rril odu:.l:atrl ouu.lil rnb rrd o:.rr1os

or11r1

o urc

IE

rt

#g:

z
9

52

T.A.Bnowru

drxido de sdio a um extrato celular ou a um lisado clarificado, o pH ajustado para l2,O a


12,5, aspontes de hidrognio do DNA no-superenrolado so rompidas, o que causa o desenrolamento da hlice dupla e a separao das duas cadeias polinucleotdicas (Figura 3.1 1). Se,

cula form

depois disso, adicionado cido, essas fitas de DNA bacteriano desnaturado reagregam-se em
uma massa desorganizada. A rede insolvel formada pode, ento, ser sedimentada por centrifugao, deixando o DNA plasmidial puro no sobrenadante.

de flutuaq
forma um

de de flun
de a densr

sidade po
ao tratm

Adem

(EtBr)

4z-

DNA linear

-+:ffi\
*r"
/
/

pH 12,0

a 12,5

PIasmdeos
suPerenrolados

pc

O bromet

5V

centes. pr

mento res
near. O D
de desenr
da densid

-t{3

apenas a

DNA linear de
fita simples

formam

pondente
A cen
mtodo u
cado sul
separado

,,0

io,

RNA pru
Centrifugao

s9 o tubo
plasmidia
do dotub

/a

Plasmdeos
superenrolados

Sedimento de

sde

q
de DNA linear

DNA linear

bq
\
\

Figura 3-

DNApla

Puriicao de
plasmdeos pelo
mtodo de desnaturao alca-

gura 3.14
t pronto

lina.

Uma vantagem adicional desse procedimento que, sob certas circunstncias (especificamente, lise celular por SDS e neutralizao com acetato de sdio), a maioria das protenas e
do RNA tambm se torna insolvel e pode ser removida pela etapa de centrifugao. A extranecessrios se o mo com fenol e o tratamento com ribonuclease podem, portanto, no ser
todo de desnaturao alcalina utilizado.

Centriugao em gradiente de densidade de brometo de


etdeo-cloreto de csio
Essa uma verso especializada da tcnica mais geral de equilbrio ou centrifugao em
gradiente de densidade. Um gradiente de densidade produzido pela centrifugao de
uma soluo de cloreto de csio (CsCl) a uma velcidade muito elevada (Figura 3.12a). O
gradiente formado porque a fora centrfuga elevada puxa os ons de csio e de cloreto em
direo ao fundo do tubo. A migrao dos ons no tubo contrabalanada por difuso, de
modo a levar ao estabelecimento de um gradiente, com as maiores densidades de CsCl em

direo ao fundo.
Macromolculas presentes na soluo de CsCl quando ela centrifugada formam bandas
em pontos distintos do gradiente (Figura 3.12b). O ponto exato onde uma determinada mol-

rt
Ir
t
!r
II

I
z
o

=q

Centriugao em,
dade de cloreto
diente de densidac
do por centriuga@r
(b) Separao d
RNA em um gradi

"Tmdiasquesooseupai,Francisco.manhece,osoliforadizonomedele,osilnciodosbadochoraasuaausncia.Ederepentetudooqueera
alegria viram buraco.Tem dia que tudo o que andei se desfaz.E volta um tristeza aguda, a maior do mundo.Em dias como esses,s voc faz sentido,
Poique voc a continuao da nossa histria.Tem dia que o sol pode brilhar Lindo l fora,mas um brilho triste.Tem dia que nem chove,mas dia de
nrc esi:reve para r: ilho sobrc o pai qur' elr'no tele tentpo par;r corirecer'

(
o
para Francisco,

I AII-X Ediro.a
I

Cloruneeu Gr,rrca

lo. o pH ajustado para 12,0 a


ompidas, o que causa o desen-

ucleotdicas (Figura 3.11). Se,


,

desnaturado reagregam-se em

io. ser sedimentada por centri-

Figura 3.11
Puriicao de
plasmdeos pelo
mtodo de desnaturao alca-

E ANLtsE

oe

DNA

cula forma uma banda depende da sua densidade de flutuao; o DNA possui uma densidade de flutuao de aproximadamente r,7 glcm3 e, portanto, migra at o ponto do gradiente
onde a densidade do cscl de l,i g/cm3. As molculas protics, po, ,uu vez,
t,mdensidades
de flutuao muito mais baixas e, por isso, flutuam no topo do gradiente, enquanto o RNA
forma um sedimento no fundo do tubo (Figura 312b).4 centrifugao em gradientes de densidade pode, pois, separar DNA, RNA e protenas e uma alternativa extrao com fenol
e
ao tratamento com ribonuclease para a purificao de DNA.
Ademais, a centrifugao em gradientes de densidade na presena de brometo de etdeo
(EtBr) pode ser utilizadapwa separar DNA superenrolado de molculas no-superenroladas.
O brometo de etdeo liga-se a molculas de DNA intercalando-se entre pares de bases adjacentes, provocando um desenrolamento parcial da hlice dupla (Figura 3.13). Esse desenrolamento resulta em um decrscimo na densidade de flutuao de at0,125 glcm3 paraDNA linear. O DNA superenrolado, por sua vez, por no ter extremidades livres, tem uma liberdade
de desenrolamento muito restrita e liga-se a uma quantidade limitada de EtBr. O decrscimo
da densidade de flutuao de uma molcula superenrolada , assim, muito menor, chegando
apenas a aproximadamente 0,085 g/cm3. Em conseqncia disso, molculas superenroladas
formam uma banda em um gradiente de EtBr-CsCl em uma posio diferente daquela coespondente a DNA linear e circular aberto (Figura3.l4a).
A centrifugao em um gradiente de densidade de brometo de etdeo-cloreto de csio um
mtodo muito eficiente para a obteno de DNA plasmidial puro.
Quando um lisado clarificado submetido a esse procedimento, os plasmdeos formam bandas em um ponto distinto,
separado do DNA bacteriano linear, com as protenas flutuando no topo do graiente e com
o
RNA precipitado no fundo. A posio das bandas de DNA pode ser visualizada iluminandose o tubo com radiao ultravioleta, que faz com que o EtBr ligado ao DNA
fluoresa. o DNA
plasmidial puro removido por aspirao, utilizando-se uma seringa cuja agulha perfura o lado do tubo na altura correspondente amosa a ser coletada (Figura :.i+U;. O EtBr ligado
ao
DNA plasmidial extrado com n-butanol (Figura 3.14c) e o CsCl, removido por dilise (Figura 3.14d). A preparao plasmidial resultante praticamente IOOVo pura e o plasmdeo
est pronto para ser utilizado como um veculo de clonagem

lina.

Protena

rtas circunstncias (especifi ca-

dio). a maioria das protenas e


hpa de centrifugao. A extra-

1,60

o. no ser necessrios se o m-

6c

e brometo de

Aumento da
concentrao
de CsCI

riores densidades de

CsCl em

centrifugada formam bandas


r onde uma determinada mol

;t+

z
o

$o

1,65

t,zo

E
,

<_

t.zs

'

oo

Figura 3.12
Oenhifugao em gradiente de densi@de de cloreto de csio. (a) Um gra,diemte de densidade de CsCl produzi,u por centrifugao a alta velocidade.
rib) Separao de protenas, DNA e
Hfi,lA em um gradiente de densidade.

1,80

RNA
(a)

(b)

"Temdiasquesooseupai,Francisco.manhece,osollforadizonomedele,osilnciodosbadochoraasuaausncia.Ederepentetudooqueera

o
lr

alegria vira um buraco.Tem dia que tudo o que andei se desfaz. E volt um tristeza guda, a maior do mundo.Em dias como esses, s voc lz senrido.
Porque voc a continuao da nossa histria.Tm dia que o sol pode brilhar lindo 1 fora,mas um brilho triste.Tm dia que nem chove,mas dia de

o
tt
(

ll

uilbrio ou centrifugao em
duzido pela centrifugao de
to elevada (Figura 3.I2a). O
s ons de csio e de cloreto em
ntrabalanada por difuso, de

:lic

53

escri:r.c p:rn o lho sohrc o 1:: qur clr'no teve lclrrpc

p:rr i:r:lltlcrl.

q,

Francisr:o.

AX

Editur.,

DNA

54

T.A.Bnowru

Estrutura qumica do
brometo de etdeo

Molcula de
EtBr intercalada

)s,+

Figura 3.13
+

EtBr

3,4 A
Arcabouo
de acar-osato

>3,4
Par de bases

Hlice dupla
de DNA normal

Desenrolamento parcial da hlice dupla do


DNA por intercalao
de EtBr entre pares
de bases adjacentes.
A molcula de DNA
normal, mostrada
esquerda, parcialmente desenrolada
ao incorporar quatro
molculas de EtBr, resultando na estrutura
"esticada", direita.

ftgnl

murnftrna@e0

ffihrmriffilp,or
ilmMosnmngnd

|uffiffi

ffir.@

3.2.3 Amplificao de plasmdeos


A preparao de DNA plasmidial pode

ser dificultada pelo fato de que os plasmdeos representam apenas uma pequena poro do DNA total de uma clula bacteriana. O rendimento de
uma preparao de DNA plasmidial a partir de uma cultura bacteriana pode, portanto, ser de-

tI

Plqnr
Afro

Mu

cepcionantemente baixo. A amplificao plasmidial uma das maneiras de aumentar esse

rendimento.
A amplificao tem por objetivo aumentar o nmero de cpias de um plasmdeo. Alguns
plasmdeos multicpia (aqueles com um nmero de cpias de 20 ou mais) guardam a propriedade til de serem capves de replicar na ausncia de snteseprotica. Isso contrasta com
o cromossomo bacteriano principal, que incapaz de replicar sob tais condies. Essa propriedade pode ser utilizada durante a multiplicao das bactrias em cultura para purificao
de DNA plasmidial. Depois que uma densidade celular satisfatria foi atingida, um inibidor
de sntese protica (por exemplo, cloranfenicol) accionado cultura, que, por sua vez, ento incubada adicionalmente por mais 12 horas. Durante esse perodo, as molculas do plasmdeo continuam a replicar, apesar da replicao cromossmica e da diviso celular terem sido bloqueadas (Figura 3.15). O resultado que um nmero de cpias de plasmdeo de vrios
milhares pode ser atingido. A amplificao , pois, um meio muito eficiente de aumentar o
rendimento de preparaes de plasmdeos multicpia.

tt
o
rt

o
-t
(
o

"Tmdiasquesooseupai,Francisco.Amanhece,osollforadizonomedele,osilnciodosbadochoraasuaausncia.Ederepentetudooqueera
alegria vira um buraco.Tem dia que tudo o que andei se desfaz.E volt uma trsteza guda, a maior do mundo.Em dias como esses, s voc faz sentido.
Porque voc a continuao da nossa histria.Tm dia que o sol pode brilhar lindo 1 fora,mas um brilho triste.Tm dia que nem chove,ms dia de
choro. Mas tem sempre um outro dia, lho. Foi voc quem me ensinou isso." Quenclo titr irrl dos pcrsongcnr lriNril3s. cono c<>lrinua l hrrrrir:
rre escrer.c p:tra o flho sobrc o pai qrie ce no tcvc terrrpo prrr conhei:er.

ffir(@
t'

ffiem
ffi

Cr-ounceu GNrcA

E Aruuse oE

DNA

55

Protenas

DNA linear

eoc ---_*
---------------{>

DNA
superenrolado

._l

Remoo do DNA
superenrolado
com uma seringa

RNA

Desenrolamento parcial da hlice dupla do


DNA por intercalao
de EtBr entre pares
de bases adjacentes.
A molcula de DNA
normal, mostrada
esquerda, parcialmente desenrolada
ao incorporar quatro
molculas de EtBr, resultando na estrutura
"esticada", direita.

p de que os plasmdeos repre! bacteriana. O rendimento de


p;*u pode. portanto. ser de-

(b) Remoo da banda de DNA

(a) Um gradiente de
densidade de EtBr-CsGl

Figura 3.13

,
I

Mistura com n-butanol e


agitao, repouso para
separao das ases

Tampo

Figura 3.14
Furificao de DNA
qmrncmidial por centriffiuqao em gradien-

til

de densidade de
EtBr-CsCl.

Soluo
de DNA
em tubo
de dilise
Difuso do

EtBr na ase
orgnica

DNA na ase
aquosa

para o tampo

(c) Extrao do EtBr


com rFbutanol

(d) Remoo do CsCl

por dilise

Preparao de DNA de bacteriagos

maneiras de aumentar esse

A diferena fundamental entre a purificao de DNA de fagos e preparaes de DNA celular


total ou DNA plasmidial que, para fagos, o material de partida normalmente no um ex-

plasmdeo. Alguns
fpias de um

trato celular. Isso ocorre porque as partculas de bacterifagos podem ser obtidas em grande
nmero a partir do meio extracelular de uma cultura bacteriana infectada. Quando uma des-

las

20 ou mais) guardam a proprotica. Isso contrasta com


rsob tais condies. Essa proem cultura para purificao

lb

o (

ria foi atingida, um inibidor


fculrura, que, por sua vez,

odo,

o ol

en-

e da diviso

$a

3.15

,ffiffifha@o de

Plasmdeos mulicpia
(nmero de cpias de 20+)

%3.3s-

?tt)\t " o

as molculas do plas-

celular terem sicpias de plasmdeo de virios


muito eficiente de aumentar o

----------------

lncubao na
presena de
cloranenicol

DNA
bacteriano

ooXo-c
ta!-JY

Plasmdeos presentes em um
nmero de cpias de 1.000++

Mbsmdeos.

It
g
rl
I

;r*

o
z

g
II
(
g

"Tem dias que

so o seu pai, Francisco.Amanhece, o sol l fora diz o nome dele, o silncio do sbado chora a sua ausncia.E de repente tudo o que era
alegria vira um buraco.Tm dia que tudo o que andei se desfaz.E volta uma tristeza aguda, a maior do mundo. Em dias como esses, s voc faz sentido.
Porque voc a continuo d nossa histria.Tm dia que o sol pode brilharLindo l fora,mas um brilho triste.Tm dia que nem chove,mas dia de
choro.Mas tem sempre um outro dia,fi1ho.Foi voc quem me ensinou isso." Quanilo l1ta urrr clos p.'rsonrgcnr prncipais,corro corrinrra: hirr<iri.r?
*e cscrcr.c prra o filho sobrc o p: qrie e1c no teve tcrrrpc p:rr conl:ci:cr.

56

T. A. Bnowrrr

culturas centrifugada, as bactrias so sedimentadas, deixando as partculas de fago em


suspenso (Figura 3.16). As partculas de fago so ento coletadas da suspenso e o seu DNA
extrado por uma simples etapa de desproteinizao para remoo do capsdeo viral.
Esse processo geral bem mais direto que o procedimento utilizado para preparar DNA

grad(

rer.

celular total ou plasmidial. Apesar disso, uma purificao bem-sucedida de quantidades significativas de DNA de fago est sujeita a diversos percalos. A principal difculdade, especialmente com ,, a multiplicao de clulas infectadas em cultura de uma maneira tal que o ttulo de fagos extracelulares (o nmero de partculas de fago por ml de cultura) seja suficientemente alto. Em termos prticos, o ttulo mximo que pode ser razoavelmente esperado para
l, de 1010 por ml; ainda assim, 1010 partculas de ), rendero somente 500 ng de DNA. Grandes volumes de cultura, na faixa de 500 a 1.000 ml, so, portanto, necessrios se quantidades

de-

er

sas

mudi

a pro

substanciais de DNA de l, devem ser obtidas.

3.3.1 Cultivos bacterianos visando obteno de altos ttulos de l,


No h problemas maiores em cultivar bactrias em grandes volumes (culturas bacterianas de
50 ou mais so comuns em biotecnologia), mas a obteno de um ttulo mximo de fagos requer certas habilidades. O fago l" que ocorre naturalmente lisognico (p. 31) e uma cultura infectada consiste principalmente em clulas portadoras do profago integrado no DNA bacteriano (Figura 2.7). O ttulo de exffacelular extremamente baixo sob tais circunstncias.
Para a obteno de um alto rendimento de l, extracelular, a cultura deve ser induzida, a fim
de que todas as bactrias entrem na fase ltica do ciclo de infeco, o que resulta na moe celular e na liberao de partculas de 1, no meio. O controle da induo , normalmente, muito dificil, mas a maioria das linhagens de de laboratrio portadora de uma mutao termossensvel (ts) no gene cI, o qual um dos responsveis pela manuteno do fago no seu estado inte-

\-r. a\
^??

Cultura inectada

??O|(bactrias+
a^'' fagos extracelulares)
q,t

it

? ?.
?.trt,?i suspenso de agos
,? ? ?

lffir@,u
Figura 3.16

S"Oir"r,to de bactrias

rtffi,db",Ntr't

Preparao de uma suspenso


de agos a partir de uma cultura
de bactrias infectadas.

o
o
rl

q.

g
I!
(
g

"Temdiasquesooseupai,Francisco.Amanhece,osollforadizonomedele,osilnciodosbadochoraasuaausncia.Ederepentetudooqueera
alegria vira um buraco.Tn dia que tudo o que andei se desfaz.E volt uma tristeza aguda, a maior do mundo.Em dias como esses,s voc faz senrido.
Porque voc a continuao da nossa histria.Tem dia que o sol pode brilhar lindo i fora,mas um brilho triste.Tem dia que nem chove,mas dia de
choro.Mas tem sempre um outro dia,frlho. Foi voc quemme ensinou isso." Quando ilta urr r:los persona*ens principais, cor:ro continua; histna7
A ntc escrcve plrr o filho sobre o pri que ee no telc rcrrpo par:r conhecer.

ffiM

Cr-orunoeu Gt'ttcn

ANLtsE oe

DNA

grado. Se inativado por uma mutao, o gene cI no funciona mais corretamente, o que leva a
mudana para a fase ltica do ciclo de infeco.
Na mutao clls, o gene cI funcional a 30oC, temperatura na qual a lisogenia pode ocorrer. Porm, a 42"C, o produto do gene clls no funciona adequadamente e a lisogenia no pode, ento, ser mantida. Uma cultura de E. coli infectada com l, clls pode, assim, ser induzida
a produzir fagos extracelulares pela transferncia de 30"c para 42"c (Figura3.l1).

rando as partculas de fago em


das da suspenso e o seu DNA
noo do capsdeo viral.
o utilizado para preparar DNA
n-sucedida de quantidades sig-

principal dificuldade, especial-

ra de uma maneira tal que o tor ml de cultura) seja suficien-

razoavelmente esperado para


Dmente 500 ng de DNA. Grannto. necessrios se quantidades
Profago .

altos ttulos de

?r,

30.c

olumes (culturas bacterianas de


e um tulo mximo de fagos rergnico (p. 31) e uma cultura inrgo integrado no DNA bacteriao sob tais circunstncias.

cultura deve ser induzida,

po,

_---------------

Sem induo

fim

o que resulta na morte celu-

ryo , normalmente, muito

difi-

rde uma mutao termossensno do fago no seu estado inte-

1",..
lnduo

Genoma de liberado

r-i."

""tut",

(
\.-a^,r
Figura 3.17

3.16

ffi4ao
tu

It
g
I

qt
Io
z

-t
qr

de um lisgeno

Novas partculas de fago l,

ds por transerncia

de 30'C Para42'C.

o de uma suspenso
s a partir de uma cultura
rias inectadas.

57

"Tmdiasquesooseupai,Francsco.Amanhece,osollforadizonomedele,osilnciodosbadochoraasuaausncia.Ederepentetudooqueera
alegria vira um buraco.Tm dia que tudo o que andei se desfaz.E volt um tristez aguda, a maior do mundo.Em dias como esses, s voc faz sentido
Porque voc a continuaco da nossa histria.Tem dia que o sol pode brilhar lindo 1 fora, mas um brilho triste.Tem dia que nem chove,mas dra de
A ne cscrevc pirra o filro sobrc

pa qLre e1e nO levc lelnpo

prrr i:onheclr.

58

T. A. Bnowr.r

3.3.2 Preparao de fago

?r,

t,33

no-lisognico

Embora a maioria das linhagens de seja lisognica, muitos vetores de clonagem derivados
desse fago so modificados, por delees de cI e de outros genes, a fim de que a lisogeniajamais ocorra. Tais fagos so incapazes de se integrarem no genoma bacteriano e podem infectar clulas apenas pelo ciclo ltico (p. 31).
Com esses fagos, a chave para a obteno de um alto ttulo reside na maneira pela qual as
clulas so cultivadas, sendo sobremaneira importante o estgio no qual as clulas so infectadas pela adio de partculas virais. Se os fagos so adicionados antes de as clulas estarem
se dividindo na velocidade mxima, todas elas so lisadas rapidamente, resultando em um
baixo ttulo (Figura 3.18a). Por outro lado, se os fagos so adicionados quando a densidade
celular muito alta, ento a cultura jamais ser completamente lisada e, novamente, o ttulo
de fago ser baixo (Figura 3.18b). A situao ideal quando o estgio da cultura e o tamanho
do inculo do fago so equilibrados de modo que as clulas continuem a multiplicar-se, mas
que todas elas acabem sendo infectadas e lisadas (Figura 3.18c). Como pode ser imaginado,
habilidade e experincia so necessrias paa ajustar o processo at a perfeio.

Coleta de

Os resnm&
intactal por

l,asfagor

pra5 mlu
Aspt

wlaidadcs

porunc
dE

de

sal iltr

fuup

sotl"idoenr

tg./l nrmcaE
Aespui

D'{Apd
rxrtliie,E

qlldia&r

studsp
slheeq

(a) A densidade da cultura muito baixa

oo
oo

z
a

tJ

165r-nl

pfrrg

t'

?i
Adico do

@el;

lnculo de "

.a

aoo

r,ri""
o
)i
-

br[rd

f puffi

Todas as clulas
so rapidamente
lisadas = baixo ttulo de fago

Bactria

Amrirrd

Fot
,eflim&g
rou:d
|Nfi,fu

(b) A densidade da cultura muito alta

aO

'?'

"'#

&'irZ,?"
:,2+7zZ"
'oo oe?
o o o ??'

A cultura nunca completamente


lisada = baixo ttulo de ago

(c) A densidade da cultura correta

Oe

ooo"i"
oo

?l

Figura 3.18

i!''-'dl+,
A cultura continua a desenvolver-se,
mas as clulas acabam sendb
lisadas = alto ttulo de fago

o
o
rl

o
I!
(
o

Situaes que podem


ocorrer quando se
busca o equilbrio
correto entre o estgio da cultura e o tamanho do inculo para a preparao de
uma amostra de um
ago no-lisognico.

so o seu pai, Francisco.Amanhece, o sol 1 fora diz o nome dele,o silncio do sbado chora a sua ausncia.E de repente tudo o que era
alegria vira um buraco.Tem dia que tudo o que andei se desfaz.E volta um tristeza guda,a maior do mundo.Em dias como esses,s voc fz sentido.
Porque voc a continuao da nossa histria.Tm dia que o so1 pode brilharlindo l fora,mas um brilho triste.Tem dia que nem chove,mx dia de
choro.Mas tem sempre um outro dia, lho. Foi voc quem me ensinou isso." Quendo felta unr dol persor:agens priucip:is, corrto continua a histria?
rne escreve para o {lho sobre o pai que ee no tere ten:po parl cor:hecer.

"Tem dias que

p:ira Fr:rncisr:o.

ARX Pditor.

En,lt
fr"dmEn

Cloruneev GNrcA

tjtir
fim de que

a lisogenia

ja-

bacteriano e podem infecreside na maneira pela qual as


no qual as clulas so infecantes de as clulas estarem
. resultando em um
ionados quando a densidade
lisada e, novamente, o ttulo
estgio da cultura e o tamanho

tiluem
r.

a multiplicar-se, mas
Como pode ser imaginado,

59

Ar.rlrsr oe DNA

Coleta de fagos a partir de uma cultura infectada


Os restos das clulas bacterianas lisadas, juntamente com quaisquer clulas que perrnanecerim
intactas, podem ser removidos de uma cultura infectada por centrifugao, deixando as partculas do fago em suspenso (Figura 3.16). O problema agoru a reduo do volume da suspenso
para 5 ml ou menos, um volume manipulvel para a extrao de DNA.
As partculas do fago so to pequenas que s podem ser sedimentadas por centrifugao a
velocidades muito elevadas. Por isso, a coleta dos fagos geralmente feita por precipitao com
polietileno-glicol (PEG). O PEG um composto polimrico de cadeia longa que, na presena

de clonagem derivados
.a

de sal, absorve gua e, por isso, faz com que estruturas macromoleculares, como as partculas

precipitem. O material precipitado pode, ento, ser coletado por centrifugao e redissolvido em um volume adequadamente pequeno (Figura 3.19).

de fago,

r"4 Purificao de DNA a partir de partculas

de fago lv

A desproteinizao do precipitado de PEG redissolvido ,

at a perfeio.

DNA puro do fago, mas, em geral, os fagos l"

s vezes,

suficiente para a extrao de

so submetidos a uma etapa de purificao

inter-

mediria. Essa etapa necessria porque o precipitado de PEG pode conter tambm uma certa
quantidade de resduos bacterianos, possivelmente incluindo o indesejvel DNA celular. possvel separar esses contaminantes das partculas de , por centrifugao em um gradiente de densidade de CsCl. A banda das partculas de l, em um gradiente de CsCl forma-se em uma densidade de 1,45-1,50 g/cm3 6igura 3.20) e pode ser coletada do gradiente como descrito anteriormente para bandas de DNA (p. 54 e Figura 3. 14). A remoo do CsCl por dirlise resulta em uma
preparao pura de fagos, a partir da qual o DNA pode ser extrado com fenol ou por tratamento com protease, para a digesto do envoltrio protico do fago.

Ls

A purificao do DNA de Ml3 causa alguns problemas


A maioria das diferenas entre os ciclos de infeco de Ml3 e l" representa uma vantagem
para o bilogo molecular que deseja preparar DNA de Ml3. Primeiramente, a forma replicativa de fita dupla de M13 (p. 34 e 36), que se comporta como um plasmdeo de alto nmero de cpias, facilmente purificada por procedimentos-padro para a preparao de
DNA plasmidial. Um extrato celular preparado a partir de clulas infectadas com Ml3,

r?r8U

q&
Adio
de PEG
+ NaCl

Figura 3.18
Situaes que podem

?.
a

ocorrer quando se
busca o equilbrio
correto entre o estgio da cultura e o tamanho do inculo para a preparao de
uma amostra de um
fago no-lisognico.

lta

Do
ata

t'

It
qt
rl

;r+

z
o

!,
II
(
!,

Figura 3.19
Coleta de partculas
de fago por precipitaao com polietileno-

Suspenso
de agos

tr

+({
w"

:s)
Partculas de
fago precipitadas

Sedimento de
partculas de ago
+ resduos celulares

glicol(PEG).

"Temdiasquesooseupai,Francisco.Amanhece,osollforadizonomedele,os1nciodosbadochoraasuaausncia.Ederepenterudooqueera
alegria vira um buraco.Tem dia que tudo o que andei se desfaz.E volt uma tristez eguda, a maior do mundo. Em dias como esses,s voc faz sentido.
Porque voc a concinuao da nossa hstria.Tm dia que o sol pode brilhar hndo l fora,mas um brilho triste.Tm dia que nem chove,mas dia de
choro.Mas tem sempre um outro dia,filho. Foi voc quem me ensinou isso." Quar,lo ialta rur dos personrecnr priur:p:s.colro cortnua;r histrie?
rre cscrevc pau o ilho sobrc o pai q*r'c1c nic lcve tdnrpo prrr r:onlte:cr.

r:rrr lirrncisro

Al X F,torr

60

T.

A. Bnowr.r

1,35
1,40
1,45
Partculas
de fago l.
1,50
1,55
1,60
Densidade
de CsCl
(g/cms)

Figura 3.20
Purificao de partculas de ago l,
por centriugao em gradiente de
densidade de CsCl.

sendo a forma replicativa separada do DNA bacteriano, por exemplo, por centrifugao em
gradiente de densidade de EtBr-CsCl.
Entretanto, a forma de fita simples do genoma de M13, contida nas partculas extracelulares do fago, freqentemente necessria. Nesse aspecto, a grande vantagem em relao
a l, vem do fato de que altos ttulos de M13 so mais facilmente obtidos. Como as clulas
infectadas secretam continuamente partculas de Ml3 para o meio (Figura 2.8), sem a ocorrncia de lise, um alto ttulo de M13 obtido simplesmente pela manuteno da cultura infectada at que seja alcanada uma.alta densidade celular. De fato, ttulos de 1012 por ml ou
maiores so obtidos com facilidade, sem o emprego de qualquer truque especial. Ttulos altos como esses implicam que quantidades significativas de DNA de M13 de fita simples podem ser preparadas a partir de volumes pequenos de cultura - 5 ml ou menos. Alm disso,
como as clulas infectadas no so lisadas, no h problemas de contaminao da suspenso de fagos com resduos celulares. Conseqentemente, a etapa de centrifugao em gradiente de densidade de CsCl, necessria para a preparao de fago 1,, raramente utilizada
com Ml3.
Em resumo, a preparao de DNA de M13 de fita simples envolve o cultivo em pequeno volume das bactrias infectadas, centrifugao para sedimentao das clulas bacterianas, precipitao das partculas de fago com PEG, extrao com fenol para remoo do envoltrio protico do fago e precipitao com etanol para concentrao do DNA resultante
(Figura 3.21).

Figun
Prepa

Leit
Birnboi
iVlrl

Boom-

(19

494

Clewell

fol
Marnu
cul
Radloff

sd

cr{

Rogers.

mi
Yamam
.

tati

7y
Z,fu-

Ct-onneeu GNrcA

(a) Cultura
de clulas

inectadas

(b)

Centriugao

para remoo
das clulas

E ANLrsE oe

DNA

61

(c) Adio de PEG


suspenso de

agos, centriugao

+w.."u
*

Lz,l

Clulas

de agos

M13

Fag

sedimentadas

nas partculas extracegrande vantagem em relao

obtidos. Como as clulas


(Figura 2.8), sem a ocormanuteno da cultura infato, ttulos de 1012 por ml ou
truque especial. Ttulos alde Ml3 de fita simples po5 ml ou menos. Alm disso,
de contaminao da suspende centrifugao em grafago 1", raramente utilizada
i

b envolve o cultivo em pequeinentao das clulas bacteriabm fenol para remoo do enhcentrao do DNA resultante

tr

por centrifugao em

(g) Ressuspenso
do DNA de M13 em
um pequeno volume

M1

()

ffi
I I

M13D
I 3DNA

N-._
[-

p'o
Protna

Wr.not

3DNA

Remoo
aquosa,

de
para

(e) Adio

da ase

enol

adio de

remoo do
capsdeo protico

etanol,
centriugao

(d) Ressuspenso
do ago em tampo

Figura 3.21
Preparao de DNA de M13 a partir de uma cultura bacteriana inectada.

Leituras adicionais
Birnboim, H.C. & Doly, J. (1979) A rapid alkaliae extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Research, 7 ,1513-23. [Um mtodo para a preparao de DNA plasmidial.]
Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim van Dillen, P. M. E. & van der Noordaa, J.
(1990) Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiotogy, 28,
495-503. [O mtodo de tiocianato de guanidina e slica para a purificao de DNA.]
Clewell, D.B. (1972) Nature of ColEl plasmid replicationin Escherichia coli inthe presence of chloramphenicol.
Journal of Bacteriology, ll0, 66'1-76. [A base biolgica da amplificao de plasmdeos.]

Marmur,J.(1961)Aprocedurefortheisolationofdeoxyribonucleicacidfrommicroorganisms.
I

Journalof MoIecular Biology, 3, 208- 1 8. [Preparao de DN celular total.]


Radloff, R., Bauer, W. & Vinograd, J. (1967) A dye-buoyant-density method for the detection and isolation of closed-circular duplex DNA. Proceedings of the National Academy of Sciences of the USA, 57,1514-21. [A descrio original da centrifugao em gradiente de densidade contendo brometo de etdio.l
Rogers, S.O. & Bendich, A.J. (1985) Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Molecular Biology, 5,69-76. [O mtodo de CTAB.]
Yamamoto, K.R., Alberts, B.M., Benzinger, R., Lawhome, L. & Trieber, G. (1970) Rapid bacteriophage sedimentation in the presence of polyethylene glycol and its application to large scale virus preparation. l4rology, 40,
.
734-44.lPrcprao de,pNA de .1
Zinder, N.D. & Boeke, J.D. (1982) The filamentous phage (Ff) as vectors for recombinant DNA. Gene, 19, l-10.
[Mtodos para a multiplicao e a preparao de DNA de fagos.]

Cnpru

to 4

Manipulao de DNA Purificado

A gama de enzimas para a manipulao de DNA, 64


Enzimas para a clivagem de DNA: endonucleases de
restrio, 7 I

Ligao: unindo molculas de DNA, 86

Depois de amostras de DNA puras terem sido preparadas, a etapa seguinte em um experimento de clonagem gnica a construo da molcula de DNA recombinante (Figura 1.1). para
produzir essa molcula recombinante, tanto o vetor como o DNA a ser clonado devem ser clivados em pontos especficos e unidos de uma maneira controlada. A clivagem e a unio so
dois exemplos de tcnicas de manipulao do DNA, uma grande variedade das quais vem sendo desenvolvida nos ltimos anos. Alm de serem clivadas e reunidas, as molculas de DNA
podem ser encurtadas, estendidas, copiadas em RNA e em novas molculas de DNA e modificadas pela adio ou remoo de grupos qumicos especficos. Essas manipulaes, que podem, sem exceo, ser realizadas em tubos de ensaio, constituem a fundao no apenas para
a clonagem gnica, mas tambm para estudos bsicos sobre a bioqumica do DNA, a estrutura dos genes e o controle da expresso gnica.
Quase todas as tcnicas de manipulao do DNA utilizam enzimas purificadas. No interior da clula, tais enzimas paicipam de processos essenciais, como a replicao e a transcrio do DNA, a destruio de DNA estranho ou indesejvel (por exemplo, o DNA de um vrus
invasor), a reparao de DNA mutado e a recombinao entre diferentes molculas de DNA.
Depois da purificao a partir de extratos celulares, muitas dessas enzimas podem ser persuadidas a executar suas reaes naturais, ou algo relacionado a elas, sob condies artificiais.
Embora essas reaes enzimticas sejam freqentemente diretas, a maioria dlas impossvel de executar por mtodos qumicos tradicionais. As enzimas purificadas so, portanto, cruciais para a engenharia gentica, fato que levou ao surgimento de um ramo industrial importante, a partir da preparao, dacaracenzao e da comercializao das mesmas. Fornecedores comerciais de enzimas altamente purificadas prestam um servio essencial ao
bilogo molecular.

64

T. A. Bnowru

As manipulaes de clivagem e de unio que constituem a base da clonagem gnica so


executadas por enzimas chamadas endonucleases de restrio (para clivagem) e ligases (para a unio). A maior parte deste captulo tratar dos diferentes modos de utilizao desses dois
tipos de enzima. Primeiramente, porm, deve ser considerada toda a gama de enzimas para a
manipulao do DNA, para ver exatamente quais os tipos de reaes que podem ser executadas. Muitas dessas enzimas sero mencionadas em captulos posteriores, quando da descrio
de procedimentos que fazem uso delas.

4.1 A gama de enzimas para a manipulao de DNA


As enzimas para a manipulao do DNA podem ser agrupadas em cinco grandes classes, dependendo do tipo de reao que catalisam:

(1)

Nucleases so enzimas que clivam, encurtam e degradam molculas de cidos nucli-

(2)
(3)
(4)
(5)

Ligases unem molculas de cidos nuclicos.


Polimerases fazem cpias de molculas.
Enzimas modiicadoras removem ou adicionam grupos qumicos.
Topoisomerases introduzem ou removem superenrolamentos de DNA circular covalen-

cos.

temente fechado.
Antes de ver detalhadamente cada uma dessas classes de enzima, dois aspectos devem ser
salientados. O primeiro que, embora a maioria das enzimas possa ser designada para uma
classe especfica, algumas apresentam atividades mltiplas, abrangendo duas ou mais classes.
Mais importante ainda que muitas polimerases combinam suas capacidades de produzir novas molculas de DNA com uma atividade degradativa (isto , de nuclease) de DNA associa-

fre

da.

Em segundo lugar, deve ser observado que, assim como existem as enzimas para a manipulao de DNA, h muitas enzimas similares conhecidas que so capazes de agir sobre o
RNA. A ribonuclease utilizada paa remover RNA contaminante de preparaes de DNA (p.
45) um exemplo desse tipo de enzima. Embora algumas enzimas de manipulao de RNA
tenham aplicaes na clonagem gnica e sejam mencionadas em captulos posteriores, o enfoque, em geral, estar restrito quelas enzimas com atuao sobre DNA.

nugesr

ruBfrG
nr,k
milrdh4,q
mrffic
umdffid
lh&blil
|ffinfu

m[offesr

4.1.1 Nucleases
Nucleases degradam molculas de DNA quebrando as ligaes fosfodister que unem nucleotdeos adjacentes em uma fita de DNA. Existem dois tipos diferentes de nuclease (Figura 4.1):

(1)
(2)

Exonucleases removem um nucleotdeo de cada vez, a pafiir da extremidade de uma


molcula de DNA.
Endonucleases so capazes de quebrar ligaes fosfodister no interior da molcula de

DNA.
A principal distino entre

mfu

gr

pu
as diferentes endonucleases reside no

nmero de htas que so

degradadas quando uma molcula de fita dupla atacada. A enzima chamada 8a131 (purificada a partir da bactria Alteromonas espejiana) um exemplo de exonuclease que remove

dt
m

]om'crri

Clotlneev GNtcA

E ANLtsE

oe

DNA

65

I a base da clonagem gnrca so

(para clivagem) e ligases (patmodos de utilizao desses dois

(a) Uma exonuclease

toda a gama de enzimas para a


rreaes que podem ser executa-

Clivagem

posteriores, quando da descrio

Nucleotdeo
Ligao fosfodister

Clivagem

de DNA

Ponte de hidrognio

D'
-o-

hs em cinco grandes classes, de-

qog?999999gg99po-o

hur molculas de cidos nucli-

:q-O-@3-O
m qumicos.
rrcntos de DNA circular covalen-

(b) Uma endonuclease

enzima, dois aspectos devem ser


as possa ser designada para uma

Srangendo duas ou mais classes.


has capacidades de produzir no, de nuclease) de DNA associabxistem as enzimas para a manifuue so capazes de agir sobre o
wrte de preparaes de DNA (p.
nzimas de manipulao de RNA
h em captulos posteriores, o enb sobre DNA.

ls

Figura 4.1

reaes catalisadas
dois tipos diferentes
de nuclease. (a) Uma
mruclease, que remove
mdeotdeos a partir da
nidade de uma moFctila de DNA. (b) Uma
iaonuclease, que que-

tha fgaes osodister


:

+
.@

..

..@
-@-

internas.

kx fosfodister que unem nucleode nuclease {Figura 4. I ):


ftrentes
r

ia partir da extremidade de uma

nucleotdeos a partir de ambas as fitas de uma molcula de fita dupla (Figura 4.2a). euanto
maior for o tempo de ao da Bal31 sobre um grupo de molculas de DNA, mais curtos sero

pster no interior da molcula de

os fragmentos de DNA resultantes. J outras enzimas, como a exonuclease III de E coli, degradam apenas uma das fitas da molcula de fita dupla, deixando DNA de fita simples como

bside no nmero de fitas que so


Lenzima chamada Bal3l (purifi-

rylo de exonuclease que remove

produto (Figura 4.2b).


critrio pode ser utilizado para classihcar endonucleases. A endonuclease S I (do fwgo Aspers oryzae) cliva apenas fitas simples (Figura 4.3a), enquanto a desoxirribonuclease I (DNase I), a
preparada a partir de pncrEas bovino, cliva tanto molculas de fita simples como de fita dupla (Fi-

66

T. A. Bnowr.r

(a) Bal3l

Ud+o.+O..rcr1c

opo4+q

Fi$
srca@sca
das por dibre
pcdeendonu
pl *dease S

(b) Exonuclease lll

5'

3',
rttttt

3',

ftapenas

5',

tasimples, in

ebras defit

Ces em mol

Frdonaile

fadr.pla-(b,

Figura4.2

-@

.Cr.

As reaes catalisadas pelos diferentes tipos de exonuclease. (a) Bal31 , que remove nucleotdeos a partir de ambas as

itas de uma molcula de ita dupla. (b) Exonuclease lll, que


remove nucleotdeos somente a partir da extremidade 3'(ver
p. 91 para a descrio das dierenas entre as extremidades
3'e 5'de um polinucleotdeo).

rrlrrl

C. +-O-GO+O+

I, que divr

l{A

de fita

Ebdefita

iffiffmendornr

clesiq qu
IIiIA de fita

nEapenas(

fiitneoffirb
gura 4.3b). A DNase I considerada inespecfica porque ataca o DNA em qualquer ligao fosfodister
interna; o resultado final da ao prolongada da DNase I , portanto, uma mistura de mononucleotdeos
e oligonucleotdeos muito curtos. Por outro lado, o grupo especial de enzimas chamadas de endonucleases de restrio cliva DNA de fita dupla somente em um nmero limitado de stios de reconhecimento
especficos (Figura 4.3c). Tais enzimas, extremamente importantes, so descritas em detalhe na pgina

71.

dnris
deDI\

tffl.l| lim
DNA.

4.1.2 Ligases

molde

Na clula, a funo das ligases reparafquebras ("descontinuidades") em fitas individuais,


que surgem em molculas de DNA de fita dupla durante a replicao do DNA, por exemplo.
As DNA-ligases da maioria dos organismos podem igualmente unir dois fragmentos indivi-

-,-:

r---

:*+::!:-

.'+-:-i--!!:==.::

-+1

F
v

I
.

h
F
F

i=%___-

n s{]

gresp

pine

Cr-orunceu GNrcA E ANLrsE DE

DNA

67

(a) Nuclease 31
Uma quebra

(D

(ii)

..@

...*

-@

<++o-e

I
I

I
I

.@-@

.@

..@

+ +J{+

I
I

=*4.@..F

(b) DNase

(D

(ii)

."@

9annffi

-@
I

Figura 4.3

fficaes catalisabpordierentes tiendonuclease.


S1, que
apenas DNA de
inclusive
as de ita simpsem molculas

mrninantemente
illadupla. (b) DNatipos de exonucleadeos a partir de ambas as
(b) Exonuclease lll, que
a partir da extremidade 3'(ver
entre as extremidades

I
I

..@..@

rrtrrrll
..@...@

I
I

o+..

.*-G-.@..
-FG-...@

..F+..F..@

rrt

(c) Uma endonuclease de restrio

l" que cliva tanto

mAde ita simples


mrnb de ita dupla.
endonuclease
que cliva
ll{A de ita dupla,

msapenas em um

limitado de s
tios.
qualquer ligao fosfodister
mistura de mononucleotdeos
chamadas de endonucleade stios de reconhecimento
itas em detalhe na pgina

") em fitas individuais,


do DNA, por exemplo.
unir dois fragmentos indivi-

F
F

duais de DNA de fita dupla (Figura 4.4). O papel dessas enzimas na construo de molculas
de DNA recombinantes descrito na pgina 84.

Polimerases
DNA-polimerases so enzimas que sintetizam uma nova fita de DNA, complementa a um
molde de DNA ou RNA preexistente (Figura 4.5a). A maioria das polimerases pode funcionr somente se o molde possui uma regio de fita dupla, que atua com um iniciador (do ingls primer) para reao de polimerizao.
Quaffo tipos de DNA-polimerase so utilizados rotineiramente na engenharia gentica. O
primeiro a DNA-polimerase I, geralmente obtida de E. coli. Essa enzima liga-se a uma re-

68

T.

A. Bnowr'r

(a) Reparo de descontinuidade


Uma descontinuidade

I oNn-tig"r"

(b) Unio de duas molculas

..@.@
rlrrlrrrl

-@O..@

o*o-"n"."

Figura 4.4
As duas reaes catalisadas pela DNA-ligase. (a)
Reparo de uma descontinuidade - uma ligao
osodister altante em uma das itas de uma
molcula de ita dupla. (b) Unio de duas molculas.

gio curta de fita simples (ou quebra) em uma molcula de DNA de fita dupla e, ento, sintetizauma fta completamente nova, degradando a fita preexistente medida que prossegue
na sua atividade (Figura 4.5b). A DNA-polimerase I , portanto, um exemplo de enzima com
atividade dupla - polimerizao e degradao de DNA.
De fato, as atividades de polimerase e de nuclease da DNA-polimerase I so controladas
por diferentes partes da molcula da enzima. A atividade de nuclease est contida nos primeiros 323 aminocidos do polipeptdeo, de modo que a remoo desse segmento d origem a
uma enzima modificada, a qual retm a funo de polimerase, mas incapaz de degradar
DNA. Essa enzima modificada, chamada de fragmento de Klenow, pode ainda sintetizar
uma fita de DNA complementar a um molde de fita simples, mas, como no possui atividade
de nuc!959, incapaz de continuar a sntese depois de a quebra ter sido preenchida (Figura
4.5c). Vrrias outras enzimas - polimerases naturais e verses modificadas possuem propriedades similares s do fragmento de Klenow. A principal aplicao do fragmento de Klenow e

Figura
As rea

sintet
bras, n

dessas polimerases relacionadas a ele no seqenciamento de DNA (p.2I2).


A DNA-polimerase de Taq,utllizada na reao em cadeia da polimerase (PCR) (Figura
1.2), ' a enzima DNA-polimerase I da bactria Thermus aquaticus. Esse organismo vive em
fontes termais e muitas de suas enzimas, inclusive a DNA-polirnerase de Taq, so termoestveis, o que significa que so resistentes desnaturao por tratamento trmico. essa a carac-

testica especial da DNA-polimerase de Taq que a torna adequada para a pCR, pois, se no
fosse termoestvel, ela seria inativada quando a temperatura da reao elevada a 94"C para
desnaturar o DNA.
O tipo final de DNA-polimerase importante para a engenharia gentica a transcriptase
reversa, uma enzima envolvida na replicao de virios tipos de vrus. A transcriptase reversa
nica por utilizar RNA como molde, emqez de DNA (Figura 4.5d). A capacidade que essa
enzima tem de sintetizar uma fita de DNA complementar a um molde de RNA fundamental
para a tcnica denominada clonagem de DNA complementar (cDNA) (p.112-fi9.
7,

F
;
F

:
:

t
F
E

dftJa qr

quebr

tl.tl

Enzim
Exister

de gn4

(1) r

Crorueeeu GNrcA

E ANLrsE oe

DNA

69

(a) A reao bsica

s',

5_

3',

-A-T-G-C-A-A-T-G-C-A-T,/
_- --^5'
Molde lniciador 3'

---->

A_T_G_C-A-A_T-G-C_A_T_

3',

- t - a - c - g - t - t - a - c-c-T-A3',

5',

Nova ita sintetizada

(b) DNA-polimerase

- A-T-G-C-A-A-T-G-C-A-TG-T_A_
-T_A_C-G
Uma quebra

-A-T-G-C-A-A-T-G-C-A-T-

- t - a - c - g - t -t - a- c -G-T-A-

N ucleotdeos preexistentes
so substitudos

-/-

-_
catalisadas pela DNA-ligase.
de - uma ligao
em uma das fitas de uma
. (b) Unio de duas mol

----->

(c) O fragmento de Klenow

-f-T-9-9-A-A-r-G-9-l-T-T-A-C-G

G_T-A-

_____>

-A-T-G-C-A-A-T-G-C-A-Tt - - a - C-G-T-A-T-A-C-G,

nucleotdeos /
preexistentes
no so substitudos

Os

DNA de fita dupla e, ento,


istente medida que
um exemplo de enzima

\\

Somente a quebra
preenchida

(d) Transcriptase eversa

-A-u-c-c-A-A-u-c-g-l-y- -/-l-y-g-g-l-l-y-g-g-f-yt
v6-T-A-

-polimerase

I so controlartes
est contida nos primeidesse segmento d origem a

/
/**o\

. mas incapaz de degrada


Klenow, pode ainda sintetiza

Molde de

RNA

l'/-t-a-c-g-t-t-a-c-c-T-A\
Nova ita

de DNA

as. como no possui atividade

ter sido preenchida (Figua


do fragmento de Klenow e

DNA (p.212).
da polimerase (PCR) (Figura
. Esse

organismo vive em

de Taq, so termoest-

Figura 4.5
As reaes catalisadas por DNA-polimerases. (a) A reao bsica: uma nova ita de DNA
sintetizada na direo de 5'para 3'. (b) DNA-polimerase l, que inicialmente preenche quebras, mas, depois, continua a sintetizar uma nova ita, degradando a fita preexistente medida que prossegue na sua atividade. (c) O fragmento de Klenow, que somente preenche
quebras. (d) Transcriptase reversa, que utiliza um molde de RNA.

trmico.essaacaracpara a PCR, pois, se no


reao elevada a 94.C para
gentica a transcriptase
vrus. A transcriptase reversa
-1.5d). A capacidade que essa
molde de RNA fundamental

) @. 172-174t.

Enzimas modificadoras de DNA


Existem inmeras enzimas que modificam molculas de DNA pela adio ou pela remoo
de grupos qumicos especficos. As mais importantes so as seguintes:

(1)

Fosfatase alcalina (de E. coli, de tecido intestinal de vitelo ou de camaro irtico), que
remove o grupo fosfato presente na extremidade 5' de uma molcula de DNA (Figura
4.6a).

70

T. A. Bnowrl

(2)

Polinucleotdeo-quinase (de E. coli infectada com fago T4), que tem o efeito inverso
da fosfatase alcalina, adicionando grupos fosfato s extremidades

(3)

5'livres (Figura 4.6b).

Desoxinucleotidil-transferase terminal (de tecido tmico de vitelo), que adiciona um


ou mais desoxirribonucleotdeos s extremidades 3'de uma molcula de DNA (Figura
4.6c).

4.2 Enz

den

Ar

pft

4.1.5 Topoisomerases

tru

sI
se

molculas de DNA plasmidial) pela introduo ou remoo de superenrolamentos (p. 50-51).


Embora as topoisomerases sejam importantes para o estudo da replicao do DNA, ainda no
foi encontrada uma utilidade efetiva para elas na engenharia gentica.

rar

classe final de enzimas para a manipulao de DNA a das topoisomerases, as quais so


capazes de modificar a conformao de DNA circular fechado covalentemente (por exemplo,

.cli
ten

es[

4.7
qu(

des

(a) Fosatase alcalina

'-ott"-o,o,o-o--d OH

HO

OH

HO.

OH

\#
ry{@q

rrlr

Po

(b) Polinucleotdeo-quinase
HO

W
P+oo-.q.

HO

"w

'-o"P

oH
rtttt

P..+o-o44q
HO'

OH

Figura 4.6
As reaes catalisadas por enzimas modiicadoras de DNA.
(a) Fosatase alcalina, que remove gru-

'PO

pos S'-osfato. (b) Po-

linucleotdeo-quina-

(c) Desoxinucleotidil-transerase terminal


(i)

s',
..@\

(ii)

s',
,.?fl999ng{F.F{F.F.F{>{){F_
J3' 3@tt,*
iarrrtll!

s',
-...@{4O-F

3'J
3',JJ

1+

se, que acrescenta


grupos S'-osao. (c)

5'
@

afaAfa9o+

s',

Desoxinucleotidiltranserase terminal,

que acrescenta desoxirribonucleotdeos


s extremidades 3'
de polinucleotdeos
em molculas (i) de
ita simples ou (ii) de
ita dupla.

Frgrr

fi,nessilar

ofiiqens pre

mnnnanirula
IilD{A ern um r

;mnbdec

sen s

F
:
;:

CLoruecev GNtcA

go T4), que tem o efeito inverso


remidades 5'livres (Figura 4.6b).
nico de vitelo), que adiciona um
; uma molcula de DNA (Figura

hs topoisomerases,

E Ar.rlrse

oe

DNA

Enimas para a clivagem de DNA: endonucleases

de restrio

A clonagem gnica exige que as molculas de DNA sejam clivadas de uma maneira
muito
prwisa e reproduvel. Isso ilustrado pela maneira pela qual o vetor clivado
durante a consruo de uma molcula de DNA recombinante (Figura 4.7a). Cadamolcula
do vetor deve
ser clivada em uma nica posio, para abrir o crculo de modo que
novo DNA possa ser inserido: uma molcula clivada mais de uma vez ser quebrada em ois ou mais
fragmentos se1mn'ados e no ser til como vetor de clonagem. Ademais, cada molcula.de vetor deve ser
ulivada exatamente na mesma posio do crculo como ficar claro a partir
de captulos posuiores. a clivagem aleatria no adequada. Deve ficar bem-explicitado que
um tipo muito

as quais so

b covalentemente (por exemplo,


le superenrolamentos (p. 50-51).
la replicao do DNA, ainda no
gentica.

cspecial de nuclease necessrio para executar essa manipulao.


Freqentemente, tambm necessrio clivar o DNA que est para ser clonado (Figura
4-Tb). Para tanto, h duas razes. Primeira, se o objetivo for a clongem
de um nico gne,
que pode consistir em apenas 2 ou 3 kb de DNA, ele deve ser separado por
clivagem das grandes (muitas vezes maiores que 80 kb) molculas de DNA prouzidas pelo
uso das tcnicas

I
I

I
I

(a) Molculas de vetor

I
I

a-\cvasem
c\J
\-/Cs

11

+
\,
^

risura +.e

I
I
I
i I
I
I
I
I
s'{osato. (c)
I Otunos
Desoxinucleotidils,
I
r I transerase terminal,
acrescenta desoI que
xirribonucleotdeos
I s extremidades
3'
* || de
polinucleotdeos
motcutas (i)de
| ita
"r
simptes
| fita dupla. ou (ii) de
As reaes catalisaoas por enzimas moOificaOoras de DNA.
(a) Fosatase atcatin", que remove grupo" S'{osfato. (b) Polinucleotdeo-quinase, que acrescenta

/-
()

,,--_,\.

(
\-/

Cada molcula de vetor deve ser clivada uma


as cr ivasens devem

:::??"'"::as

(b) A molcula de DNA que contm o gne a ser clonado


Gene

,%

r\_--{
\
,

.....................*

,lffi,rmressidade de

idlluryens precisas

<.--\

A,/

Stios de clivagem

\<

rnmmranipulao de

[MilAem um expede clonagem gnica.

nmimpnto

5-

Figura 4.7

Grande molcula de DNA

Fragmentos pequenos
o suficiente para serem

clonados

72

T.

A. Bnowr.r

preparativas descritas no Captulo 3. Segunda, grandes molculas de DNA podem ter de ser
quebradas simplesmente visando produo de fragmentos suficientemente pequenos para
serem cilegados pelo vetor. A maioria dos vetores de clonagem exibe uma preferncia por
fragmentos de DNA dentro de uma determinada faixa de tamanho; vetores baseados em M13,
por exemplo, so muito ineficientes para a clonagem de molculas de DNA com uma extenso maior que 3 kb.
Endonucleases de restrio purificadas permitem que o bilogo molecular clive molculas de DNA da maneira precisa e reprodutvel, necessria para a clonagem gnica. A descoberta dessas enzimas, que deu o Prmio Nobel para W. Arber, H. Smith e D. Nathans, em
1978, foi um dos marcos fundamentais no desenvolvimento da engenharia gentica.

4-2.1 A descoberta e a funo das endonucleases de restrio


A observao inicial que levou descoberta das endonucleases de restrio ocorreu no incio da
dcada de 1950, quando foi demonstrado que algumas linhagens bacterianas eram imunes infeco por bacterifagos, um fenmeno chamado de restrio controlada pelo hospedeiro.
O mecanismo de restrio no muito complicado, embora tenham sido necessirios 20
anos para que ele fosse completamente compreendido. A restrio ocorre porque abactria
produz uma enzima que degrada o DNA do fago antes que ele tenha tempo de replicar-se e de
dirigir a sntese de novas partculas virais (Figura 4.8a). O DNA da prpria bactria, cuja destruio seria obviamente letal, fica protegido do ataque por ser portador de grupos metila adicionais, os quais bloqueiam a ao degradativa da enzima (Figura 4.gb).
Essas enzimas degradativas so denominadas endonucleases de restrio e so sintetizadas por muitas, ou talvez por todas, espcies de bactria; mais de 1.200 enzimas de restrio
diferentes j foram caracterizadas al agora. So reconhecidas trs classes diferentes de endonucleases de restrio, cada uma delas distinguida por um modo um pouco diferente de ao.
As enzimas dos tipos I e III so bastante complexas e tm aplicao limitada na engenharia
gentica. As endonucleases de restrio do tipo II, por outro lado, so as enzimas de clivagem
de grande importncia para a clonagem gnica.

Figur
Afuro de umi
nudease de rr

ao em uma c

4-2-2 Endonucleases de restrio do tipo ll clivam o DNA em


seqncias n ucleotd icas especicas

ffieriana: (a) o

A caractestica principal

das endonucleases de restrio d tipo II (que, de agora em di4nte,


sero chamadas apenas de endonucleases de restrio) que cada uma delas reconhece e cli-

va uma seqncia especfica em uma molcula de DNA. Uma determinada enzima cliva o
DNA apenas na seqncia de reconhecimento, deixando qualquer outra seqncia intocada.
Por exemplo, a endonuclease de restrio chamada PvaI (isolada de Proteis vulgaris) cliva
DNA apenas no hexanucleotdeo CGATCG. J uma segunda ettzimada mesma ba cina, chamada de PvuII, cliva em um hexanucleotdeo diferente, neste caso CAGCTG.
Muitas endonucleases de restrio reconhecem stios-alvo hexanucleotdicos, mas outras
clivam seqncias de quatro, cinco ou at oito nucleotdeos. Sau3A (de Staphytococcus aureus linhagem 3A) reconhece GATC e AluI (de Arthrobacter luteus) cliva em AGCT. Exisrem
tambm exemplos de endonucleases de restrio com seqncias de reconhecimento degeneradas, o que significa que elas clivam o DNA em qualquer membro de uma famlia de stios
relacionados - Hinfl (de Haemophilus influenzae linhagem R), por exemplo, reconhece
GANTC, de modo que cliva em GAATC, GATTC, GAGTC e GACTC.
As seqncias de restrio para alguras das endonucleases de restrio mais freqentemente utilizadas esto listadas na Tabela 4.1.

do ago clir
mas (b) o DNA

teriano nc

42.3 Extrer
A natu
import
clivam
sultant
exemp

Enr

rauml

tenar
fs, est

determ
em cad

pois o

:<

Ct-oruncev Guca e ANLtsE oe

de DNA podem ter de ser


nte pequenos para

DNA

73

(a) Restrio do DNA do ago

uma preferncia por

rrtores baseados em M13,


de DNA com uma extenmolecular clive molcugnica. A descoSmith e D. Nathans, em

restrio
Endonucleases de restrio
ligam-se ao DNA do fago

ocoeu no incio da
eram rmunes a ln-

pelo hospedeiro.
tenharn sido necessrios 20

(b) O DNA bacteriano no clivado

ocorre porque a bactria


tempo de replicar-se e de
da prpria bactria, cuja desde grupos metila adi-

4.8b).
de restrio e so sintetiza-

1.200 enzimas de restrio


classes diferentes de endoum pouco diferente de ao.
limitada na engenharia
so as enzimas de clivagem

DNA em
tr (que, de agora em diante,

Figura 4.8

frno de uma ende restri1o em uma clula


briana: (a) o DNA
tb ago clivado,
ms (b) o DNA bacteriano no o .

uma delas reconhece e cli-

determinada enzima cliva o


ouffa seqncia intocada
de Proteus vulgaris) clivaima da mesma bactria, chaCAGCTG.
mas outras
A, (de Staphylococcus

au-

) clivaemAGCT. Existem
de reconhecimento degenede uma famlia de stios

&), po.

exemplo, reconhee

GACTC.
de restrio mais freqente-

F
t
I

Extremidades cegas e coesivas


A natureza exata da clivagem produzida por uma endonuclegse de restrio

de considervel

importncia no projeto de um experimento de clonagem. Mitas endonucleases de restrio


clivam simplesmente as duas fitas no meig da seqncia de reconhecimento (Figura 4.9a), resultando em uma extremidade cega (do ingl,s blunt end ou flush end). PvuII e AluI so

exemplos de enzimas que geram extremidades cegas.


Entretanto, um grande nmero de endonucleases de restrio cliva o DNA de uma maneira um pouco diferente. Com essas enzimas, as duas itas de DNA no so clivadas exatamente na mesma posio. Em vez disso, a clivagem ocoe de maneira desencontrada nas duas fitas, estando os stios de clivagem geralmente separados por dois a quatro nucleotdeos, o que
determina que os fragmentos de DNA resultantes possuam pequenas projees de fita simples
em cada extremidade (Figura 4.9b). Tais extremidades so chamadas de adesivas ou coesivas,
pois o pareamento de bases entre elas pode reunir os fragmentos da molcula de DNA (lem-

74

T.A.Bnowr

Tabela 4.1 As seqncias de reconhecimento para algumas das endonucleases de restrio


mais freqentemente utilizadas

Enzima

Organismo

EcoR.I

Escherichia coli

BamHI

B ac

BgIII

Bacillus globigii

PvuI
PvUII

illus

amy lo liquefac i en s

HindIII

Proteus vulgaris
Proteus vulgaris
H ae mo p hi lus influe nzae

HinfT

H ae mo p hi lu

Sau3A

NotI

Staphylococcus aureus
Arthrobacter luteus
Thermus aquaticus
Haemophlus aegyptius
N o cardia otitidis - c aviarum

sfr

S t re ptomy c e s

AluI
TaqI

HaeIII

Ro

s influe nzae R,

fimb riatus

Seqncia de
reconhecimentou

Extremidade

GAATTC
GGATCC
AGATCT
CGATCG
CAGCTG
AAGCTT
GANTC
GATC
AGCT
TCGA
GGCC
GCGGCCGC

Coesiva
Coesiva
Coesiva
Coesiva
Cega
Coesiva

GGCCNNNNNGGCC

cega ou coesiva

Coesiva
Coesiva
Cega
Coesiva
Cega
Coesiva
Coesiva

A seqncia mostrada corresponde de uma das fitas, representada na direo de 5' para 3'. Note que
quase todas as seqncias de reconhecimento so palndromos: quando as duas fitas so consideradas,
elas so lidas da mesma maneira em ambas as direes. Por exemplo:
"

Er

5'_GAATTC_3'
EcoRl

||lt

3'-CTTAAG-5'

bre que extremidades coesivas foram vistas napgina 33, durante a descrio da replicao
do fago l,). Uma caracterstica importante dessas endonucleases de restrio que enzimas
com diferentes seqncias de reconhecimento podem produzir as mesmas extremidades coesivas. BamHI (com a seqncia de reconhecimento GGATCC) e BgIII (AGATCT) so exemplos disso - ambas produzem extremidades coesivas GATC (Figura 4.9c). Amesma extremi-

dade coesiva tambm produzida por Sau3A, que reconhece somente o tetranucleotdeo
GATC. Fragmentos de DNA produzidos por clivagem com qualquer uma dessas enzimas podein ser ligados uns aos outros, pois cada um deles portador de uma extremidade coesiva
complementar.

4.2.4 A freqncia de seqncias de reconhecimento em uma


molcula de DNA
O nmero de seqncias de reconhecimento para uma determinada endonuclease de restrio
em uma molcula de DNA de tamanho conhecido pode ser calculado matematicamente. Urm
seqncia tetranucleotdica (por exemplo, GATC) deve ocorrer uma vez a cada 4a = 256 nw
cleotdeos, e uma seqncia hexanucleotdica (por exemplo, GGATCC) uma vez a cada 46
=
4.096 nucleotdeos. Esses clculos assumem que os nucleotdeos esto ordenados de maneira aleatria e que os quatro nucleotdeos diferentes esto presentes nas mesmas proporee
(isto , um contedo de GC = 507o). Na prtica, nenhuma dessas suposies completamer
te vlida. Por exemplo, a molcula de DNA de ),, com 49 kb, deveria conter
te 12 stios prra uma endonuclease de restrio com uma seqncia de reconhecimento

iQfiloa

rffi

tffimcl

&,q:r

drn

tud

m(
drul
frthdl

,u

rp
mru

Crorunoev Gntcn e ANLlsE oe

DNA

75

(a) Produo de extremidades cegas

-N-N-A-G-C-T-N-N-

AIr^t

-N-N_ T-C_G_A-N-N-

_N-N-A_G

C_T-N_N-

-N-r$--b

c----

Extremidades cegas

'N'= A, G, C ou T

(b) Produo de extremidades coesivas

-N-NG-A-A-T-T-C-tt$-+ ecoRl -N-N-G A-A-T-T-C-N-N-

-N-N-C-T-T-A-A-G-{--N- -N-N-C-T-T-A-A\

\\

G-N-N-

Extremidades coesivas

(c) As mesmas extemidades coesivas produzidas


por dierentes endonucleases de estrio'

de 5'para 3'. Note que


fitas so consideradas,

Figura 4.9

filclernidades

Pro-

rnftlas por clivagem


bDilA com dieren-

a descrio da rePlicao
restrio que enzimas

Mmrnas extremidades coeffiSm (AGATCT) so exem{.9c). A mesma extremi$iffnente o tetranucleotdeo


uma dessas enzimas Po'
uma extremidade coesiva

em uma
endonuclease de restrio
matematicamente. Uma
uma vez a cada 4a = 256 nuuma vez a cada 46 =
s esto ordenados de mane
nas mesmas proporoes
suposies comPletamen'eria conter aProximadamencia de reconhecimento hexa-

(a) Uma excega produp/ri.(b) Uma


rnmilade coesiva
por EcoRl.
npsmas extrecoesivas pro-

rudas por Bam{l,

ftillle

_N_N_G

Bam*l

Bgttt

SauSA

-*-ru-c- c-T-A-c

G_A_T_C-C_N_NG-N_N-

-N_N_A

G_A_T-C-T_N-N-

IN_N_N

G_A-T_C_N-N-N_

---i- c-r-A-c

---

-N--N- c-r-A-c

---

SauBA.

nucleotdica. Na realidade, tais stios de reconhecimento ocorrem com uma freqncia menor
(por exemplo, seis para BglII, cinco pata BamHI e apenas dois para SalI), um reflexo do fato
de que o contedo de GC de bem meror do que 50Vo (Figura4.10a).
Alm disso, os stios de restrio em geral no esto distribudos uniformemente ao longo
de uma molcula de DNA. Se eles estivessem, uma digesto com uma determinada endonuclease de restrio geraria fragmentos com tamanhos aproximadamente iguais. A Figura 4.10b
nostra os fragmentos produzidos pela clivagem do DNA de l, com BgtII, BamHI e SalI' Em
sada caso, existe uma considervel variao nos tamanhos dos fragmentos, indicando que os
nucleotdeos no esto ordenados aleatoriamente no DNA de .
A lio a ser tilada da Figura 4.10 que, embora a matemtica possa dar uma idia de
quantos stios de rstriao so esperados para uma molcula de DNA, somente uma anlise
experimental capazde mostrar o quadro real. Deve-se, portanto, ir adiante para considerarsa como as endonucleases de

restrio so utilizadas em laboratrio'

76

T.A.Bnowru

caso deven
4.1 la). So

(a) Stios de clivagem no DNA de

Obvian
tida de um

antes de se
da para pm

das endoru

podem vari

dio [NaCl],

po [I exiger
te redutor,
damental q

I
I

egnt- 6 stios

tas de NaC

eamHl -5stios

bm poden

srn-2stios

ocorTa em

A coml
estemum

o miso

(b) Tamanhos dos ragmentos

da reao s

j presente

A endo
Bgill

enzima d
modo que

22010
13286

qentemen
para a cl'z

r------- 2392

-651
n 415

Bg+ tS
Oltin

r60

ses de res
exigncias
como aDti

Bamt'l.l
16841

----.---...-..--7233
r--------------- 677O
t-----"---'---- 6527
|_-.....--5626

de resri
da enzima-

|------------5505

Depois

DNA prod

Sa/l

32745
1

5258

499

destmda d

DNA que'

"matar" es

outrs ul

(EDTA) (q
Figura 4.10
Restrio da molcula de DNA de ,. (a) As posies das seqncias de reconhecimento para Bgtll, Baml e Sa/. (b) Os ragmentos produzidos por clivagem com cada uma dessas
endonucleases de restrio; os nmeros correspondem aos tamanhos dos ragmentos, em
pares de bases.

4.1le).

|t!6 Analisam

Uma diges

das posi

4.2.5 Executando uma digesto de restrio no laboratrio


Por exemplo, ser considerado como digerir uma amostra de DNA de l" (em uma concentrao de 125 pg/ml) com BglII.
Primeiramente, toda a quantidade de DNA necessiria deve ser pipetada em um tubo de ensaio. A quantidade de DNA que ser restringida depende da natureza do experimento; neste

ft

F
t,'

I
-L

i.

gnal (Figu
gem gnic:
nho dos fra

@e serer

lculas de I
nores, de n

Clouncev GNrcA
caso devem ser ingeridos 2 trtg de DNA de 1,, que esto contidos em 16
4.lla). So, portanto, necessrias micropipetas bastante precisas.

E ANLrsE oe

pl

DNA

77

da amostra (Figura

Obviamente, o outro componente principal da reao ser a endonuclease de restrio, obtida de um fornecedor comercial como uma soluo pura e de concentrao conhecida. Mas,
antes de se adicionar a endonuclease de restrio, a soluo contendo o DNA deve ser ajustada para prover as condies corretas pra assegurar a atividade mxima da enzima. A maioria
das endonucleases de restrio funciona adequadamente em pH 7 ,4, mas diferentes enzimas
podem variar nas suas exigncias quanto fora inica (geralmente suprida por cloreto de sdio [NaCl]) e concentrao de magnsio (Mg*2) (todas as endonucleases de restrio de tipo II exigem Mg*z para o seu funcionamento). tambm recomendvel a adio de um agente redutor, como o ditiotreitol (DTT), que estabiliza a enz;rmae evita a sua inativao. fundamental que as condies corretas sejam proporcionadas enzima - concentraes incorretas de NaCl ou Mg*'no somente reduzem a atividade da endonuclease de restrio, mas tambm podem causar alteraes na sua especificidade, fazendo com que a clivagem do DNA
ocora em outras seqncias de reconhecimento, no-usuais.
A composio de um tampo adequado para BgIII mostrada na Tabela 4.2. Esse tampo
est em uma concentrao 10 vezes maior do que a de trabalho e diludo quando da sua adio mistura da reao. No exemplo apresentado, um volume final adequado para a mistura
da reao seria de 20 pl, se forem adicionados 2 pl de tampo de Bgill l0 x aos 16 pl de DNA
j presentes (Figura 4.1 lb).
A endonuclease de restrio pode agora ser adicionada. Por conveno, uma unidade de
enzima definida como a quantidade necessria para clivar 1 pg de DNA em uma hora, de
modo que sero necessrias 2 unidades de BglII para clivar 21tg de DNA de u. BgIII freqentemente obtida em uma concentrao de 4 unidades/pl, de modo que 0,5 pl suficiente
para a clivagem do DNA. Os ingredientes finais na mistura da reao so, portanto, 0,5 pl de
BgIII + 1,5 pl de gua, determinando um volume final de 20 p.l (Figura 4.11c).
O ltimo fator a ser considerado a temperatura de incubao. A maioria das endonucleases de restrio, inclusive Bg1II, funciona melhor a3'7"C, mas algumas poucas enzimas tm
exigncias diferentes. TaqI, por exemplo, uma enzima de restrio de Thermus aquaticus e,
como a DNA-polimerase de Tgq, possui uma temperatura de trabalho mais elevada. Digestes
de restrio comTaql devem ser incubadas a 65'C para que seja obtida a atividade mxima
da enzima.

Depois de uma hora, a restrio deve ser completa (Figura 4.1 1d). Se os fragmentos de

DNA produzidos pela restrio destinam-se a experimentos de clonagem, a enzima deve ser
destruda de alguma maneira, para que no possa digerir acidentalmente outras molculas de

DNA que venham a ser adicionadas em um estgio posterior. Existem vrias maneiras de
"matar" essa enzima. Para muitas, uma breve incubao a 70'c suficiente, enquanto para
outras utilizada uma extrao com fenol ou a adio de cido etilenodiaminotetractico
(EDTA) (que se liga a ons Mg*2, impedindo a ao da endonuclease de restrio) (Figura
4.1 1e).

de reconhecimento pacom cada uma dessas


dos ragmentos, em

iA de l, (em uma concentrapipetada em um tubo de endo experimento; neste

Analisando o resultado de uma clivagem de restrio


Uma digesto de restrio resulta em vrios fragmentos de DNA, cujos tamanhos dependem
das posies exatas das seqncias de reconhecimento para a endonuclease na molcula original (Figura 4.10). Para que as endonucleases de restrio possam ser utilizadas em clonagem gnica, obviamente necessrio um mtodo para a determinao do nmero e do tamanho dos fragmentos de DNA gerados por elas. A ocorrncia ou no da clivagem da molcula
pode ser evidenciada com facilidade a partir do teste de viscosidade da soluo. Grandes molculas de DNA resultam em uma soluo mais viscosa do que uma contendo molculas menores, de modo que a clivagem est associada a um decrscimo na viscosidade. A resoluo

78

T. A. Bnowr.r

mea
(a)

Adio de 2 pl
de tampo de

(b)

\_

2 pg de DNA
de (16 rrl)

pl

de Bglll + 1 ,5

trrl

deH2O

Bglll

---------->

Adio de 0,5

tr

de dife

ffi

..-.......>

ll

Ent
forese
de rtm:
las de

DNA

L_l
I

Nal

sar scp

37'c pot th

tr

V----.-

DNA de ctivado
W
,/
I I -/diode renot ou EDTA
ou quecimento a70 C por 15 min
I I

Tabela 4.2 Um tampo lOx adequado para

Concentrao (mM)

Tris-HCl, pH7,4

500

MgCl,

100

NaCl
Ditiotreitol

500

Figura 4.11
Execuo de uma digesto de restrio em laboratrio (ver texto para detalhes).

restrio de DNA com BglII

Componente

lculas

I
/lncubao a
(d)

(e)

meflIa

(c)

10

do nmero e do tamanho dos produtos de clivagem , contudo, mais difcil. De fato, por muitos anos esse foi um dos aspectos mais tediosos dos experimentos envolvendo DNA. Tais pru
blemas acabaram sendo resolvidos no incio da dcada de 1970, quando foi desenvolvidaa
tcnica da eletroforese em gel.

Separao de molculas por eletroforese em gel


Molculas de DNA, assim como protenas e muitos outros compostos biolgicos, so
doras de uma carga eltrica, negativa no caso do DNA. Conseqentemente, quando
las de DNA so colocadas em um crmpo eltrico, elas migram em direo ao plo posi

(Figura4.l2a). A velocidade de migrao de uma molcula depende de dois fatores:

a sua

Croruneeu GNrcn e ANLrsE oe DNA

79

ma e a sua razo entre carga e massa. Infelizmente, a maioria das molculas de DNA possui a
mesma forma e todas tm razes bastante similares entre carga e massa. Portanto, fragmentos
de diferentes tamanhos no podem ser separados por procedimentos-padro de eletroforese.

Entretanto, o tamanho da molcula de DNA passa a ser um fator considervel se a eletroforese for executada em um gel. Um gel, que via de regra feito de agarose, de acrilamida ou
de uma mistura de ambas, constitui uma rede complexa de poros, atravs da qual as molculas de DNA devem passar para atingir o eletrodo positivo. Quanto menor for a molcula de
DNA, mais rapidamente ela pode migrar pelo gel. Portanto, a eletroforese em gel separa molculas de DNA de acordo com seus tamanhos (Figura 4.12b).
Na prtica, a composio do gel determina os tamanhos das molculas de DNA que podem
ser separadas. Um gel de agarose O,SVo com 0,5 cm de espessura, que possui poros relativa-

(a) Eletroorese-padro

Tampo

DNA

r,"uo,o,"."

Figura 4.11

Execuo de uma digesto de restrio em laboratrio (ver texto para detalhes).

O DNA migra em direo

com BglII

ao nodo, mas a separao


por classes de tamanho
incipiente

(b) Eletroorese em gel

Tampo
A amostra de DNA aplicada
em uma analeta formada no prprio gel

mais difci. De fato, por murenvolvendo DNA. Tais pro'


quando foi desenvolvida a

postos biolgicos, so porta


nte, quando molcuem direo ao plo positivo
de dois fatores: a sua for-

Figura 4.12
eleoorese-pad ro no sede DNA de tamaniliredierentes, enquanto (b) a
eletroorese em gel o faz.

O DNA separa-se em bandas correspondentes


a fragmentos de diferentes tamanhos
Meno

80

T.A.Bnowru

Auto-ra

mente grandes, pode ser usado para molculas na faixa de tamanho qntre 1 e 30 kb, permitindo, por exemplo, a clara distino entre molculas de 10 e l2kb. No outro extremo da escala,
um gel de poliacrilamida 4OVo muito delgado (0,3 mm), com poros extremamente pequenos,
pode ser utilizado paa separr molculas de DNA muito menores, na faixa de 1 a 300 pb, permitindo a distino de molculas cujas extenses diferem em apenas um nico nucleotdeo.

Uma da

DNA,

lizadas i
teco r

Aar

Visualizando molculas de DNA em um gel

trofores

Colorao

de ser vi

A maneira mais fcil

O DNA

de visualizar os resultados de um experimento de eletroforese em gel

j
a sua colorao com um composto que torne o DNA visvel. O brometo de etdeo (EtBr),
descrito na pgina 53 como um meio para a visualizao de DNA em gradientes de cloreto de
csio (CsCl), tambm rotineiramente utilizado na colorao de DNA em gis de agarose e
poliacrilamida (Figura 4.13). Bandas mostrando as posies das diferentes classes de tamanho de fragmentos de DNA so claramente visveis sob irradiao ultravioleta aps colorao

Umi

dores dt
essa ma

lation)

<

AT:

com EtBr, desde que esteja presente DNA suficiente. Infelizmente, esse procedimento bastante perigoso, pois o brometo de etdeo um agente mutagnico potente e a radiao ultravioleta utilizada para visualizar o DNA pode causar queimaduras severas. Por essa razo, corantes no-mutagnicos, que coram o DNA de verde ou azul e no requerem irradiao ultravioleta para visualizao dos resultados, so agora utilizados em muitos laboratrios.

maior

quando
limerase

Canaletas para as amostras

Gel de agarose
Suporte plstico

transparente para UV

lncubao em soluo de
EtBr 0,5 pg/ml por 15 min

Bandas de DNA
fluorescentes,

Figura 4.13
Visualizao de
bandas de DNA em

UV

um gel de agarose
por colorao com
brometo de etdeo e
irradiao ultravioleta (UV).

Figura

da autr

dfrlgtda para vis

tro

D,lA rne

umlgd de agar

Cr-oruecrv GNrcA

eltre 1 e 30 kb, permitinNo outro extremo da escala,


extremamente pequenos,
na faixa de 1 a 300 pb, perum nico nucleotdeo.

de eletroforese em gel
O brometo de etdeo (EtBr), j
A em gradientes de cloreto de
de DNA em gis de agarose e
diferentes classes de tama-

E ANLrsE oe

Uma das desvantagens da colorao o limite da sua sensibilidade. Se menos de l0 ng de


DNA, aproximadamente, esto presentes em cada banda, improvvel que elas sejam visualizadas aps a colorao. Para pequenas quantidades de DNA, necessrio um mtodo de deteco mais sensvel.
A auto-radiografia a resposta paa essa demanda. Se o DNA for marcado antes da eletroforese, pela incorporao de um marcador radioativo nas molculas individuais, ele pode ser visualizado a partir da colocao de um filme fotogrfico sensvel a raios X sobre o gel.
O DNA radioativo expe o filme, revelando o padro de bandas (Figura 4.14).
Uma molcula de DNA via de regra marcada pela incorporao de nucleotdeos portadores de um istopo radioativo do fsforo, o "P lFigura 4.15a). Existem vrios mtodos para
essa marcao, sendo os dois mais populares a translao de quebras (do ingls nicktrans-

lation) e o preenchimento de extremidades.


A translao de quebras (nick translation) refere-se

atividade da DNA-polimerase I (p. 68).

A maioria das amostras de DNA purificado contm algumas molculas quebradas, mesmo
quando apreparao foi feita da maneira mais cuidadosa possvel. Isso significa que a DNA-polimerase I pode ligar-se ao DNA e catalisar a reao de substituio de fita (Figura 4.5b). Tal rea-

lco potente e a radiao ultraseveras. Por essa razo, cono requerem irradiao ultraem muitos laboratrios.

Placa de vidro
Gel de agarose secado
em forno

ru

Colocao de um filme
sensvel a raios X
sobre o gel

Exposio por 12 a 1 00 horas,


revelao do ilme

Figura 4.13
Visualizao de
bandas de DNA em

*
:

81

Auto-radiografa de DNA marcado radioativamente

ultravioleta aps colorao


te, esse procedimento bas-

um gel de agarose
por colorao com
brometo de etdeo e
irradiao ultravioleta (UV).

DNA

Figura 4.14
da auto-ra-

rgnfia

para visuali-

de DNA marcaem
un gel de agarose.

Auto-radiograia

82

T.A.Bnowru

o requer um suprimento de nucleodeos: se um deles estiver marcado radioativamente, a molcula de DNA tambm se tornar marcada (Figura 4.15b).

12.7 Estimath

A translao de quebras pode ser utilizadapara marca qualquer molcula de DNA, mas,
sob certas circunstncias, ela tambm pode causar a clivagem do DNA. O preenchimento de
extremidades um mtodo mais brando, que raramente provoca a quebra do DNA, mas que,
infelizmente, s pode ser utilizado para marcar molculas que possuem extremidades coesivas. A enzimautilizada o fragmento de Klenow (p. 68), que "preenche" uma extremidade
coesiva sintetizando a fita complementar (Figura 4.15c). Assim como na translao de quebras, se a reao de preenchimento de extremidades for executada na presena de nucleotdeos marcados, o prprio DNA ficar marcado.
Tanto a translao de quebras quanto o preenchimento de extremidades viabili zam a marcao do DNA em um grau tal que mesmo quantidades mnimas podem ser detectadas em gel
por auto-radiografia. At 2 ng de DNA por banda podem ser visualizadas sob condies
ideais.

A eletrofo

grando mi
de tamanh

trio, pol

nados os

O mtr
grao col

D=a_H.
na qual D

das condi
Em gel

timativa dr
fragmento

executad
cadores de
nhos varia
dos fragmr
gesto exp

(a) [0-3'zP]dATP

NH,

t-

)-c-c\*
Hi/
ll
t-c--nl"t

o- o- o-

.-f--f-o"-o-?r, -o
t.," \l
o o/o
c'H

[il1dns

nas

serexecuta

H-C

,,p,^aio(o lt8;i'

,112."8

Mapeame
uma mol(
At agora-

mentos de
na anIiee

(b) Marcao portranslao de quebras (nicktranstationl

^'*

*-Pt
4 1 /
Quebras

DNA Pot

+"p-dArp

(nicks)

sies rela
quando rrm
colTetunetr
ra .t.l 7).

Umas
meiramentr

marcadas

Figura 4.15
Marcao radioativa: (a)
estrutu ra do cr-32P-trios-

\"{\4
Extremidade coesiva
de

EcoRl

f
\

Extremidade
marcada

der"er

jg

tame

de digrr

(c) Marcao por preenchimento de extremidades

--**jrK,r'

trio
195,

ato de desoxiadenosina
11a-3'ze1oRre;, (b) marcao do DNA por
translao de quebras
(nick translation), e (c)
marcao do DNA por
preenchimento de extremidades.

motempo-.
[65 x5 gnzir
tirlansnte- i

de rcao q

guneetrzir
A cory

restrio. sc
te resoll"ida

de um nrirrr
qinis so- ri

zima no te

Cr-oruaoEu

radioativamente, a mo-

E ANLtsE

oe

DNA

83

4.2.7 Estimativa do tamanho de molculas de DNA


A eletroforese em gel separa molculas de DNA de diferentes tamanhos, com

r molcula de DNA, mas,


DNA. O preenchimento de
a quebra do DNA, mas que,

as menores migrando maiores distncias em direo ao eletrodo positivo. Se diversos fragmentos


de DNA
de tamanhos variados estiverem presentes (o resultado bem-sucedido de um digesto
de restrio, por exemplo), ento uma srie de bandas aparecerno gel. Como podem ser determinados os tamanhos desses fragmentos?
O mtodo mais preciso ltlliza arelao matemtica que correlaciona a velocidade de migrao com o peso molecular. A frmula relevante :

m extremidades coesiuma extremidade

como na translao de quena presena de nucleot-

viabilizam

Gucn

D=a-b(logL/t),

marpodem ser detectadas em gel


visualizadas sob condies
a

naqualDadistnciapercorrida,Mopesomolecular eaebsoconstantesquedependem
das condies de eletroforese.
Em geral, utilizada uma maneira muito mais simples, embora menos precisa, para a estimativa dos tamanhos de fragmentos de DNA. Uma digesto de restrio-padro,
[ue inclui
fragmentos de tamanhos conhecidos, usualmente includa em cada eletroforese em gel que
executada. Produtos de restrio de DNA de l, so muitas vezes assim utilizados, como
marcadores de tamanho. Por exemplo, HindIII cliva o DNA de em oito fragmentos, com tama-

nhos variando entre 125 pb, para o menor, e mais de 23 kb, parco maior. Como os tamanhos
dos fragmentos nessa reao de digesto so conhecidos, os tamanhos dos fragmentos na digesto experimental podem ser estimados a partir da comparao das posies relativas

'

das
bandas nas duas trilhas do gel (Figura 4.16). Embora de preciso limitada, sse mtodo pode
ser executado com apenas 57o de eno, o que satisfatrio na maioria dos casos.

tuLg Mapeamento das posies de dierentes stios de restrio em


uma molcula de DNA

At agora, consideramos como podem ser determinados o nmero e os tamanhos dos fragmentos de DNA produzidos por clivagem com endonucleases de restrio. A prxima etafa
na anlise de restrio a construo de um mapa mostrando, na molcula oe oNR,
as po-

Figura 4.15
Marcao radioativa: (a)
estrutu ra do cr-32P-trifosfato de desoxiadenosina
([s-3'zP]dATP), (b) marcao do DNA por
translao de quebras
(nick translation), e (c)
marcao do DNA por
preenchimento de extremidades.

sies relativas das seqncias de reconhecimento de diversas enzimas diferentes.


Somente
quando um mapa de restrio est disponvel que as endonucleases de restrio podem
ser
corretamente selecionadas para uma determinada manipulao de clivagem a executar (Figura 4.17).
Uma srie de digestes de restrio deve ser executada para a construo de um mapa. primeiramente, o nmero e o tamanho dos fragmentos produzidos por uma endonuclease
de restrio devem ser determinados por eletroforese em gel seguida de comparao com marcadores de tamanho (Figura 4.18). Essa informao deve, ento, ser suplementada
por uma srie
de digestes duplas, nas quais o DNA clivado por duas endonucases de restrio
ao mesmo tempo. A execuo de uma clivagem dupla pode ser possvel em uma nica etapa,
se ambas as enzimas tiverem exigncias similares quanto a pH, concentrao de Mg*2,
eti.Alternativamente, as duas digestes podem ser executadas uma aps a outra, ajustando-se
a mistura
de reao aps a primeira digesto para suprir um conjunto diferente de
condies para a segunda enzima.
A comparao de resultados de digestes simples e duplas permite que muitos stios de
restrio, se no todos, sejam mapeados (Figura 4. l g). As ambigidades pdem
ser geralmen_
te resolvidas por digesto parcial, executada sob condies que resultam apenas
na clivagem
de um nmero limitado de stios de restrio em qualquer mlcula de DNA.
Digestes larciais so, via de regra, conseguidas pela reduo do perodo de incubao, de moo qu" u
zima no tenha tempo suficiente para clivar todos os stios de restriat, ou pela incubao"na

84

T.

A. Bnowr.r

(a) Estimativa grosseia por visualizao direta

Hilll
1"

(b) Estimativa grica precisa

Amostra
desconhecida

10
-o
!

7,5

23130ob---941 6
6557

1r-2---

4361

2322
2027

oc
z.s
P
c

_cerca de 5.000 pb
_cerca de 3.200 pb

Fo 012345

_cerca de 2.000 pb

3---

Distncia migrada (cm)


564

Figura 4.16
Estimativa dos tamanhos de fragmentos de DNA em um gel de agarose. (a) Uma estimativa grosseira
do tamanho dos fragmentos pode ser obtida a partir da vualizao direta. (b) Uma mediJmais precisa do tamanho dos fragmentos conseguida utilizando-se as mobilidades de ragmentol
de -Hr'ndlll
para a construo de uma curva de calibragem; os tamanhos de ragmentos
desconhecidos podem,
ento, ser determinados a partir das distncias que migraram.

geneB geneC

.geneD

Mapa {entico
Mapa de restrio

legnr

I san

laamHr

Para obteno do gene B, digerir com

P''-

Bgl

g--_e_
rN;
\
_-

Figura 4.17
Para obteno do gene D, digerir com BamHl + Sa/l

AAB
---*,
ffi

:
F

n.---42.,c, ^

,-il.

,s*Z)

t*--'

Utilizao de um mapa de restrio para


deinir as endonucleases de restrio
que devem ser utilizadas para a obteno de ragmentos
contendo genes individuais.

Figura 4.1
Uapearne
e

l(prttta

Cronnceu GNtcA

E ANLtsE oe

DNA

85

Digestes simples e duplas


Tamanhos (kb)

Nmero de fragmentos

Enzima
Xbal

xhd

Kpnl

Xbal + Xhd

3
3

Xbal + Kpnl

24,O;24,5
15,0; 33,5
1 ,5; 17,0; 30,0
9,0; 15,0; 24,5
1,5; 6,0; '17,O;24,0

Goncluses:

012345
Distncia migrada (cm)

(1) Como o DNA de , linear, o nmero de stios de restrio para cada


enzima Xbal 1, Xhol 1 e KPnl 2.
(2) Os stios de Xbal e Xhol podem ser mapeados:

Xbal

ragmentos de Xbal
ragmentos de Xhd
fragmentos de Xhd

Uma estimativa grosseira


(b) Uma medio mais prede fragmentos de l,-Hr'ndlll
desconhecidos podem,

A nica possibilidade :

,9,0,
, 15,0

Xhol

15,0

15,0

24,5

33,5

Xbal
24,5

9,0

(3) Todos os stios de Kpnl esto no ragmento de 24,5 kb de Xbal, pois


o fragmento de 24,0 kb fica intacto aps a digesto dupla com

XbalKpnl.A ordem dos fragmentos de Kpnl somente pode ser


determinada por digesto parcial.
Digesto pacial
Tamanhos dos ragmentos (kb)

Enzima
Kpnl

condies limitantes

,5; 17,O; 18,5; 30,0; 31 ,5; 48,5

Concluses:
(1) Fragmento de 48,5 kb = l, no-clivado.
(2) Os fragrnentos de 1 ,5; 17,0 e 30,0 kb so produtos de digesto completa'
(3) Os fragmentos de 18,5 e 31 ,5 kb so produtos de digesto parcial'
Kpnls
O mapa de Kpnl deve ser:

30,0

Figura 4.17
Utilizao de um mapa de restrio para
deinir as endonucleases de restrio
que devem ser utilizadas para a obteno de ragmentos
contendo genes individuais.

Xhol
Portanto, o mapa completo :
15,0

1,5

Xbal

9,0 6,0

17,O

Kpnls
1,5 17,0

Figura 4.18
Mapeamento de restrio. Este exemplo mostra como as posies dos stios de Xbal, Xhol
podem ser determinadas.

e Kpnl na molcula de DNA de

86

T.A. BRowN

uma temperatura baixa (por exemplo , a 4" C em vez de a 37 " C) , o que limita a atividade da en-

zima.
O resultado de uma digesto parcial um padro complexo de bandas em um gel de eletroforese. Fragmentos adicionais, com diferentes tamanhos, so visualizados juntamente com
os fragmentos-padro, produzidos por digesto total. Os fragmentos adicionais correspondem
a molculas que incluem dois fragmentos de restrio adjacentes, separados por um stio que
no foi clivado. Os seus tamanhos indicam quais fragmentos de restrio da digesto completa esto prximos um ao outro na molcula no-clivada (Figura 4.18).

4.3 Ligao: unindo molculas de DNA


A etapa final na construo de uma molcula de DNA recombinante a unio da molcula do
vetor com o DNA a ser clonado (Figura 4.19). Esse processo chamado de ligao e a enzima que catalisa a reao denominada de DNAJigase.

t[ao: a etapa

moler

4.3.1 O modo de ao da DNA-ligase


Todas as clulas vivas produzem DNA-ligases, mas aenzimautilizada em engenharia gentica geralmente a purificada de bactrias E. coli que foram infectadas com fago T4. Na clu-

la, essa enzima executa uma funo muito importante, reparando quaisquer descontinuidades
que venham a surgir em uma das fitas de uma molcula de fita dupla (Figura 4.4a). Uma descontinuidade simplesmente uma posio na qual uma ligao fosfodister entre nucleotdeos adjacentes est faltando (note a diferena em relao a uma quebra fnick],naqual um ou
mais nucleotdeos esto ausentes). Embora as descontinuidades possam surgir em decorrncia de quebras aleatrias de molculas de DNA celular, elas tambm surgem como um resultado natural de processos como a replicao e a recombinao do DNA. Portanto, as ligases
desempenham funes vitais na clula.
Em tubo de ensaio, DNAigases purificadas, alm de repararem descontinuidades de fitas simples, tambm podem unir molculas de DNA individuais ou as duas extremidades de
uma mesma molcula. A reao qumica envolvida na ligao de duas molculas exatamente a mesma que ocorre na reparao de descontinuidades, exceto pelo fato de que duas ligaes fosfodister devem ser estabelecidas, uma para cada fita (Figura 4.20a).

4.3.2 Extremidades coesivas aumentam a eficincia da ligao


A reao de ligao da Figura 4.20a mostra

a unio de dois fragmentos com extremidades cegas. Embora essa reao possa ser executada em tubo de ensaio, ela no muito eficiente. Isso ocoffe porque a ligase incapaz de "segurar" a molcula a ser ligada e, por isso, tem que

esperar que as extremidades sejam posicionadas lado a lado por associao casual. Se possvel, ligaes de extremidades cegas devem ser executadas cory altas concentraes de DNA,
a fim de aumentar as chances de encontro correto entre as extremidades das molculas.
Por outro lado, a ligao de extremidades coesivas complementares muito mais eficiente. Isso ocolre porque extremidades coesivas compatveis podem parear suas bases entre si por
pontes de hidrognio (Figura 4.20b), formando uma estrutura relativamente estvel, sobre a
qual a enzima pode atuar. Se as ligaes fosfodister no forem sintetizadas rapidamente, as
extremidades coesivas separam-se de novo. Tais estruturas com bases pareadas, embora transitrias, realmente aumentam a eficincia de ligao, pois estendem o tempo durante o qual
as extremidades esto em contato uma com a outra.

Figur
reag
ffigao catalisadr

ffifrrentes

ffilA-ligase: (a) |

mrrrlasdee
ffiescegase

(l

qpode olGllas

tenitades

cor

Cronncev Grurcn e ANLtsE oe

DNA

o que limita a atividade da en-

+B L

de bandas em um gel de ele-

visualizados juntamente com


adicionais correspondem

cene

separados por um stio que

restrio da digesto comple-

Vetor

4.18).

a unio da molcula do
chamado de ligao e aenzi-

lLil#o:

DNA-lisase

O--""""

Figura 4.19
a etapa final na construo de uma
molcula de DNA recombinante.

em engenharia genticom fago T4. Na cluquaisquer descontinuidades


(Figura 4.4a). Uma des-

DNA a ser
clonado

Molcula de DNA
recombinante

(a) Ligao de extremidades cegas

-.oF{rcrcl-o
I

tr
-ffi

fosfodister entre nucleot-

re
llr

}-+--a-

quebra fnickl,naqual um ou
possm surgir em decorrnsurgem como um resuldo DNA. Portanto, as ligases
(b) Ligao de extremidades coesivas

descontinuidades de fiou as duas extremidades de


duas molculas exatamenpelo fato de que duas liga4.20a).

-o-o-o
lllirtt

-.@(H

da ligao

.+
Descontinuidades

com extremidades ceeta no rnuito ef,ciente. Isigada e, por isso, tem que
associao casual. Se possaltas concentraes de DNA"
das molculas.
muito mais eficienparear suas bases entre si por
nte estvel, sobre a
sintetizadas rapidamente, as
bases pareadas, embora trano tempo durante o qual

Estrutura transitria mantida


por pareamnto de bapes

Figura 4.20
reaes de
catalisadas pela
: (a) ligao
de extremiffis cegas e (b) ligafDde molculas de exemidades coesivas.

A DNA-ligase sela as
descontinuidades

87

88

T. A. Bnowlr

4.3.3 colocando extremidades coesivas em uma molcula de


extremidades cegas
Pelas razes detalhadas na seo anterior, extremidades coesivas compatveis so desejveis
em molculas de DNA a serem ligadas em um experimento de clonagem gnica. Muits ve-

zes, tais extremidades coesivas podem ser obtidas a partir da digesto tanto do vetor quanto
do DNA a ser clonado com a mesma endonuclease de restrio, ou com diferentes enzimas
que produzem a mesma extremidade coesiva, embora isso nem sempre seja possvel. co-

mum ocoffer, por exemplo, que

a molcula do vetor tenha extremidades coesivas, mas que os


fragmentos de DNA a serem clonados tenham extremidades cegas. Nessas circunstnciai, trs
mtodos alternativos podem ser utilizados para colocar as extremidades coesivas corretas nos
fragmentos de DNA.

Oligonucleotdeos de ligao
O primeiro desses mtodos envolve o uso de oligonucleotdeos de ligao (/izfters). Esses
oligonucleotdeos so pequenos pedaos de DNA de fita dupla, de seqncia nucleotdica conhecida, que so sintetizados em tubo de ensaio. Um oligonucleotdeo de ligao tpico
mostrado na Figura 4.2la.Ele possui extremidades cegas, mas contm um stio de restrio,
para BamHl no exemplo mostrado. A DNA-ligas e capaz de ligar tais oligonucleotdeos s
extremidades de molculas de DNA maiores, tambm cegas. Apesar de ser uma ligao de extremidades cegas, possvel executa essa reao em particular de maneira bastante eficiente,
pois oligonucleotdeos sintticos, como os de ligao, so passveis de produo em grandes
quantidades e adicionados mistura de ligao em uma concentrao elevada.
Mais de um oligonucleotdeo ir ligar-se a cada extremidade da molcula de DNA, produzindo a estrutura em cadeia mostrada na Figura4.2lb.Mas a digesto com BamHI cliva as cadeias nas seqncias de reconhecimento, produzindo um grande nmero de oligonucleotdeos
clivados e o fragmento de DNA original, agora portador de extremidades coesivas de BamHI.
Esse fragmento modifcado est pronto para ligao em um vetor de clonagem clivado com
BamHL

Figura 4

Cligonucleotdeos
fuao (linkers) e t
rrril:as; (a) a eStn
mfpie de um oligo
deotdeo de liga
{b) a ligao de oli
nucleotdeos a u
nnnnlcula de extremi
des ceg

Adaptadores
H um problema em potencial na utilizao de oligonucleotdeos adaptadores. Considere o
que iria acontecer se a molcula de extremidades cegas mostrada na Figura 4.21b contivesse
uma ou mais seqncias de reconhecimento de BamHI. Se esse fosse o caso, a etapa de restrio necessiriapara a clivagem dos oligonucleotdeos de ligao e produo das extremidades
coesivas tambm clivaria a molcula de extremidades cegas (Figura 4.22). Osfragmentos resultantes teriam as extremidades coesivas coffetas, mas isso no compensaria o pioblema gerado pela quebra em dois pedaos do gene contido no fragmento de extremidads cegas.
O segundo mtodo para ligar extremidades coesivas a uma molcula de extremidades cegas foi idealizado para evitar esse problema. Os adaptadores tambm so oligonucleotdeos
sintticos curtos. Mas, ao contririo dos oligonucleotdeos de ligaio, eles so sintetizados
de
maneira a j possurem uma extremidade coesiva (Figura 4.23a). Obviamente, a idia ligar
a
extremidade cega do adaptador s extremidades cegas do fragmento para aproduo de
,
uma
nova molcula com extremidades coesivas. O mtodo pode parecer simples, mas, na prtica,
ele leva ao surgimento de novos problemas. As exemidades coesivas de molculas individuais
do adaptador podem parear suas bases entre si, formando dmeros (Figura 4.23b), o que faz
com que a nova molcula de DNA continue tendo extremidades cegas (Figura 4.23c).As
extremidades coesivas poderiam ser recriadas pela digesto com uma endonuclease de restrio,
mas isso iria eliminar a vantagem primrria da utilizao de adaptadores.

lllm possvel probl

uuIzao de oligont

Compare esa
sutado desejad
Ba'rrl, como r

@-

Cr-oruneeu GNrcA E ANusE oe

(a)

Um oligonucleotdeo de ligao

DNA

tpico

c-G -A- T-G-G-A-T- C- C-A-T- C-G

tlttrlllllttlr

compatveis so desej veis


de clonagem gnica. Muitas vedigesto tanto do vetor quanto
ou com diferentes enzimas
nem sempre seja possvel. co'

G-C-r- A--c

{;

A-G -G

{-A-G-c

Stio de BamHl

(b) A utilizao de oligonucleotdeos de ligao


Molcula de

coeslvas, mas que os


Nessas circunstncias, trs
coesivas corretas nos

extremidades cegas

a9"

n/

Oligonucleotdeos
de ligao

DNA-ligase

de Iigao (finfters). Esses


de seqncia nucleotdica code ligao tpico
mas contm um stio de restrio,

de ligar tais oligonucleotdeos s


Apesar de ser uma ligao de exde maneira bastante eficiente,
passveis de produo em grandes

damolcula de DNA, produadigesto comBamHI cliva as canmero de oligonucleodeos


extremidades coesivas de BamHL
vetor de clonagem clivado com

Figura 4.21

/ "'^r,
BamHl

de

(nkers) e sua
(a) a estrutude um oligonude ligao e
fgao de oligo-

t*t.

ia^de coesivade BamHl

- -'1\
Oligonucleotdeos
de ligao clivados

de extremidades cegas.

adaptadores. Considere o
na Figura 4.21b contivesse
esse fosse o caso, a etapa de resrie

produo das extremidades

(Figwa4.22). Os fragmentos reno compensaria o problema gede extremidades cegas.


uma molcula de extremidades cetambm so oligonucleotdeos
de ligao, eles so sintetizados de
4-23a). Obviamente, aidia ligara
fragmento, para a produo de uma
parecer simples, mas, na prticq
coesivas de molculas individuais
dmeros (Figura 4.23b), o que faz
idades cegas (Figura 4.23c). As excom uma endonuclease de restrio,

BamHl

--ttt--

Figura4.22
possvel problema decorrente da
de oligonucleotdeos de ligaGompare esta situao com o regado desejado da restrio com
Berrifll, como mostrado na Figura
4.21b.

-E-

--

-at--

-- --

--

Clivagens devidas a
stios de EamHl internos

--E-

89

90

T. A. Bnowlr

(a) Um adaptador tpico

G_A-T-C_C-C_G-G

ttlt
c-c_c_c

Extremidade coesiva de Bam9l

(b) Adaptadores podem ligar-se uns aos outros

-A-T-C-C-C-c-G
lttt

G-G-C-C-C-T-A-

Figura 4.23

G-G-C-C

(c) A nova molcula de DNA ainda possui extremidades cegas

E_ \_

6_-

Adaptadores

oj

DNA-risase

Os adaptadores ligam-se
uns aos outros

Os adaptadores e o
problema potencial
decorrente de seu
uso. (a) Adaptador tpico. (b) Dois adaptadores podem ligar-se
um ao outro para produzir uma molcula
similar a um oligonucleotdeo de ligao,
de modo que (c) aps
a ligao de adaptadores a molculas de
extremidades cegas,
elas ainda apresentam esse tipo de extremidade, necessitando, portanto, de
uma etapa de restrio.

A resposta para esse problema est na estrutura qumica precisa das extremidades da molcula adaptadora. Normalmente, as duas extremidades de uma fita polinucleotdica so quimicamente distintas, um fato que se torna claro a partir do exame
da estrutura polimrica do DNA (Figura 4.24a). Uma das extremidades, chamada"uidudoro
de 5'-terminal, portaora de um grupo fosfato (5'-P); a outra, a 3'-terminal, possui um grupo hidroxila (:'-ou).
Na
hlice dupla, as duas fitas so antiparalelas (Figura4.24b), de modo que cada extremidade
de
uma molcula de fita dupla consiste em um terminal 5'-P e um terminal 3'-OH. A ligao
normalmente acontece entre as extremidades 5'-p e 3'-OH (Figura 4.24c).
As molculas adaptadoras so sintetizadas de modo que a extremidade cega a mesma
de
um DNA "natural", mas a extremidade coesiva diferente. O terminal 3'-OH da
extremidade
coesiva o usual, mas o terminal 5'-P modificado; ele no possui o grupo fosfato,
sendo, na
verdade, um terminal 5'-oH (Figura 4.25a).4 DNA-ligase incapaid" fo.-u.
uma ligao
fosfodister entre extremidades 5'-oH e 3'-oH. o resultado disso que, embora
,errp..
ocoffa o pareamento de bases entre as extremidades coesivas de molculas adaptadoras,
eisa

associao nunca estabilizada por ligao (Figura 4.25b).


os adaptadores podem, portanto, ser ligados a uma molcula de DNA, mas no uns aos
outros. Depois da ligao dos adaptadores, os terminais 5'-OH anormais so convertidos

forma 5'-P natural por tratamento com a enzimapolinucleotdeo-quinase (p. 70), originando
um fragmento de extremidade coesiva que pode ser inserido em um vetor adequado.

Ftgura

mcrao enfe c
5e 3'de um
nudeoti

Produ
cauda h(
Atcnicad

dagem radi

DrIA de er
as subunid:

Da 'rn ex

Cloruncev Grurcn e Aruuse oe

o-

mostrando a distino
qumica entre os
terminais 5'-P e 3'-OH

O-P:O

Figura 4.23
Os adaptadores e o
problema potencial
decorrente de seu
uso. (a) Adaptador t
pico. (b) Dois adaptadores podem ligar-se
um ao outro para produzir uma molcula
similar a um oligonucleotdeo de ligao,
de modo que (c) aps
a ligao de adaptadores a molculas de
extremidades cegas,
elas ainda apresentam esse tipo de extremidade, necessitando, portanto, de
uma etapa de restri-

-o-eo
o

(b) Na hlice dupla, as itas polinucleotdicas


so antiparalelas

s',

ertremidade cega a mesma de


terminal 3'-OH da extremidade
possui o grupo fosfato, sendo, na
incapaz de formar uma ligao
disso que, embora semprc
de molculas adaptadoras, essa

de DNA, mas no uns aos


{H anormais so convertidos
inase (p. 70), originando
em um vetor adequado.

Base

OH
3',

3'

"D K
3',

s',

(c) A ligao acontece entre teminais


5'-P e 3'-OH
E.
r....@e

D'

3'-o-o-o-o-o- 5'

de S'-terminal, portado-

t"".
",

"'ma fita polinucleotdica so quitrame cuidadoso da estrutura po-

4.24c).

\ cF.o__._a."

precisa das extremidades da mo-

terminal 3'-OH. A ligao nor-

-O-P:O

o.

um grupo hidroxila (3'-OH). Na


modo que cada extremidade de

91

(a) A estrutura de uma


ita polinucleotdica

?,

Um
nucleotdeo

DNA

Figura4.24
entre os ter5'e 3'de um polinucleotdeo.

5'

-@o-r@
tttttr

^,{rcrCrGr:n}r}:f,iJC

3'
o.-tH_ -,

Produo de extremidades coesivas por sntese de


cauda homopolimrica
A tcnica de sntese de cauda homopolimrica (homopolymer tailing) representa uma abordagem radicalmente diferente para a produo de extremidades coesivas em uma molcula de

DNA de extremidades cegas. Um homopolmero simplesmente um polmero no qual todas


as subunidades so iguais. Uma fita de DNA feita inteiramente de, digamos, desoxiguanosina um exemplo de homopolmero, que chamado de polidesoxiguanosina ou poli(dG).

vel o sut
rimento r
combina
que com

(a) A estutura precisa de um adaptado

to-o-o-r-c-c-c-c
,/
termin

-oto'

-----Po
Ho-

-OH modificado

Figura 4.25
O uso de adaptadores: (a) A estrutura
real de um adaptador, mostrando o
terminal 5'-OH modiicado. (b) Converso das extremidades cegas em coesivas pela ligao de
adaptadores.

A sntese de uma cauda envolve a enzima desoxinucleotidil-transferase terminal (p. 70),


que adiciona uma srie de nucleotdeos s extremidades 3'-OH de uma molcula de DNA de
fita dupla. Se essa reao executada na presena de apenas um desoxirribonucleotdeo,
produzida uma cauda homopolimrica (Figura 4.26a).
bvio que, para ser possvel a ligao de duas molculas adicionadas de cauda, os homopolmeros devem ser complementares. Freqentemente, caudas de polidesoxicitosina (politdcl) so ligadas ao vetor e de poli(dG) so ligadas ao DNA a ser clonado. Quando as molculas de DNA so misturadas, ocoe o pareamento de bases entre as duas caudas (Figura
4.26b).
Na prtica, as caudas de poli(dG) e poli(dC) em geral no so exatamente do mesmo tamanho, alm de as molculas recombinantes com bases pareadas resultantes apresentarem
quebras e descontinuidades (Figura 4.26c). A reparao dessas molculas , portanto, um processo de duas etapas, que utiliza a polimerase de Klenow para preenchimento das quebras, seguida da ao da DNAJigase, para a sntese das ligaes fosfodister faltantes. Nem sempre
necessrio que a reao de reparao seja executada em tubo de ensaio. Se as caudas homopolimricas complementares forem mais longas do que 20 nucleotdeos, so formadas associaes por pareamento de bases bastante estveis. Uma molcula de DNA recombinante
mantida unida por pareamento de base, mas no completamente ligada, muitas vezes est-

Figura,
gi[nlese de caude
mmpolimrica (c

wmertailind,

se

de uma cz
llrunopolimrica

onsfuo de
mdorla de DNI

mmtnnte a part
um wtor e de ul

Gbde

DNA, an

dhirnados de ca
e {c) repara

mrmmlrlade DN

ourtnante. dC

5'-lribsfato de 2
soxicit

Cr-ounoeu GNrcA

E ANLrsE

oe

DNA

93

vel o suficientepara ser introduzida em uma clula hospedeira, no estgio seguinte do experimento de clonagem (Figura 1.1). Uma vez no interior da hospedeira, a molcula de DNA recombinante poder ser reparada pela DNA-polimerase e pela DNA-ligase da prpria lula,
que completaro a construo iniciada em tubo de ensaio.

(b) Ligao de caudas homopolimricas


Figura 4.25
O uso de adaptadores: (a) A estrutura
real de um adaptador, mostrando o

G
G

G
G

terminal 5'-OH modiicado. (b) Converso das extremidades cegas em coesF


vas pela ligao de
adaptadores.

-c^
-c:c^
Vetor

\----.

caudas de poli(dC)

lnserto d DNA

caudas de poli(dG)

-C6

clc

terminal (p.70),
uma molcula de DNA de
desoxirribonucleotdeo,

Molcula de DNA recombinante

Figura 4.26

(c) As etapas de reparao

0uebra

de cauda hoionadas de cauda, os hode polidesoxicitosina (poser clonado. Quando as moas duas caudas (Figura
exatamente do mesmo taresultantes apresentarem
las , portanto, um pre
das quebras, sefaltantes. Nem sempru
ensaio. Se as caudas homodeos, so formadas
de DNA

ligada, muitas vezes est

ilmpdimrica (homa

pfuner

tailing): (a)
de uma cauda

lliunopolimrica, (b)

--'---r----r-----T--f-G-G-G-G /

./"
Descontinuidade

;---c-c-c
"

r---r l-rT-----

II

ustruo de uma
rrqrla de DNA rea partir de

A polimerase de Klenow
repara a quebra

umretor e de um inde DNA, ambos


de cauda,
e (c) reparao da
tmrlade DNA reunrninante. dCTP =
i.ilosfato de 2'-desoxicitidina.

r-r--r-r--rG-G
-G-G -G -G-G
rrrrrf_c_c_c_c_c_c

\"""""

Agase repaa as
descontinuidades

94

T.

A. Bnowr.r

Leituras adicionais
Brown, T.A. (1998) Molecular Biology Labfar. Volume I: Recombinant DNA, 2nd edn. Academic press,
London.
[Contm detalhes a respeito de todos os tipos de enzimas utilizadas na manipulao de DNA e RNA.]
Jacobsen, H., Klenow, H. & Overgaard-Hansen, K. (1974) The N-terminal amino acid sequences
of DNA polymeraselfromEscherichiacoliandofthelargeandsmallfragmentsobtainedbyalimitedproteolysis.
EuropeanJournal of Biochemistry, 45, 623-7 . [Produo do fragmento de Klenow da DNA-polimerase I.]
Lobban, P. & Kaiser, A.D . (1973) Enzymatic end-to-end joining of DNA molecules. Joumal of Molecular Biology.,
79, 453-71. [Ligao.]

McDonell, M.W., Simon, M.N. & Studier, F.W. (1977) Analysis of restriction fragments of T7 DNA and determination of molecular weights by electrophoresis in neutral and alkaline gels. Journal of Molecular Biotogy, Il0,
1

19-46. [Um exemplo inicial do uso da eletroforese em gel de agarose na anlise dos tamanhos de fragmentos

de restrio.l

REBASE: wwwneb.com/rebase/rebase.html [Uma listagem abrangente de todas

as endonucleases de restrio conhecidas e dos respectivos stios de reconhecimento.]


Rosten, R.J., Lau, L.F., Bahl, C.P., Narang, N.A. & Wu, R. (1979) Synthetic adaptors for cloning DNA. Methods

in Enzymology, 68, 98-109.


Smith' H.O. & Wilcox, K.W. (1970) A restriction enzyme from Haemophilus influenTae. Journal of Molecular Bioptg;.
51, 379-91. [uma das primeiras descries completas de uma endonuclease de restrio.]

t\s
cu}
tro(

pan
n5

con

der

mitt
rre{

sEl

c,op

pr
zes

DN.

mili
tap

bink

i
nig,

$ar c

hm

DTLJ

Cnprulo 5
;2nd edn. Academic press, London.
ipulao de DNA

RNA.I

acid sequences of DNA polymerar limited proteolysis. European Jour-

lntroduo de DNA em Clulas Vivas

[-polimerase I.]
ales. Journal of Molecular Biotogy,
iagments

olTT DNA

and determina-

Iournal of Molecular Biology,

Talir"

ll0,

do, tamanhos de fragmentos

hs as endonucleases de restrio co-

{upto., for

v4te

clo.ning DNA. Methods

Joumal of Molecular Biology,

;de restrio.]

Transformao: a incorporao de DNA por clulas


Identificao de recombinantes,

Introduo de DNA de fagos em clulas bacterianas,


105

bacterianas, 98

l0l

Identificao de fagos recombinantes, I 09


Transformao de clulas no-bacterianas, I

l0

As manipulaes descritas no Captulo 4 permitem que o bilogo molecular crie novas molculas de DNA recombinante. A etapa seguinte em um experimento de clonagem gnica a introduo dessas molculas em clulas vivas, geralmente bactrias, que ento multiplicam-se
para produzir clones (Figura 1.1). Estritamente falando, a palavra "clonagem" refere-se apenas aos estgios finais do processo e no propriamente construo da molcula de DNA recombinante.
A clonagem serve a dois propsitos principais. Primeiramente, ela permite que um grande nmero de molculas de DNA recombinante seja produzido a partir de uma quantidade limitada de material de partida. No incio, podem estar disponveis apenas uns poucos nanogramas de DNA recombinante, mas cada bactria que incorpora um plasmdeo divide-se subseqentemente vrias vezes para produzir uma colnia, na qual cada clula contm mltiplas
cpias da molcula. Virios microgramas de DNA recombinante podem, via de regra, ser preparados a pair de uma nica colnia bacteriana, o que representa um aumento de 1.000 vezes sobre a quantidade inicial (Figura 5.1). Se a colnia uirllizada no como uma fonte de
DNA, mas como um inculo para uma cultura lquida, as clulas resultantes podem fornecer
miligramas de DNA, um aumento de um milho de vezes no rendimento. Dessa maneira, a
etapa de clonagem capaz de suprir as grandes quantidades de DNA necessrias para estudos
biolgico-moleculares da estrutura e da expresso gnicas (Captulos 10 e 11).
A segunda funo importante da clonagem pode ser descrita como de purificao. As manipulaes que resultam em uma molcula de DNA recombinante apenas raramente podem
ser controladas ao ponto de no permitirem que qualquer outra molcula de DNA esteja tambm presente no final do processo. A mistura de ligao pode conter, alm da molcula de
DNA recombinante, uma quantidade varivel dos seguintes componentes (Figura 5.2a):

96

T.A.Bnown

oo

oOO

o-o_o

ooE

Uma nica clula contendo


mltiplas pias de uma
molcula de DNA recombinante

Permite a obteno
de vrias pg de DNA

recombinante

lnoculao em 500 ml de
meio lquido, incubao

por

horas

Permite a obteno de

._.2

vrias mg de DNA

Figura 5.1

recombinante

A clonagem capazde
gerar grandes quantidades de DNA recombinante.

(1)
(2)
(3)

Molculas de vetor que no foram ligadas.


Fragmentos de DNA que no foram ligados.
Molculas do vetor que foram recircularizadas sem a insero de qualquer DNA (vetor

(4)

Molculas de DNA recombinante portadoras de fragmentos de DNA inseridos incor-

"autoligado").
retamente.

Molculas no-ligadas raramente causam algum problema, pois, mesmo que sejam incorporadas por clulas bacterianas, somente sob circunstncias excepcionais sero replicadas.
muito mais provvel que esses pedaos de DNA sejam degradados por enzimas da bactria
hospedeira. Por outro lado, molculas de vetor autoligadas e Blasmdeos recombinantes incorretos so replicados de maneira to eficiente quanto a molcula desejada (Figura 5.2b). Mesmo assim, a purificao da molcula desejada ainda pode ser conseguida por meio da clonagem, pois extremamente incomum que qualquer clula incorpore mais de uma molcula de
DNA. Cada clula d origem a uma nica colnia, de modo que cada um dos clones resultantes consiste em clulas que contm a mesma molcula. claro que colnias diferentes contm molculas diferentes: algumas guardam a molcula de DNA recombinante desejada, outras possuem diferentes molculas recombinantes e outras, ainda, contm o vetor autoligado.
O problema passa a ser, portanto, a identificao das colnias com plasmdeos recombinantes
corretos.

Figura

A clona
dierents

Cr-orunceu GNrcA

E ANLrsE DE

DNA

97

(a) Os produtos da ligao

Fragmentos de

\ T*o
u

\_-/
/--\
ti
\_-_. \_-,

Molculas de vetor

no-lisados

autoligadas

L Vo"""
,--Gene

Molculas de vetor

A molcula de DNA

i,r-.-rh^

li::','"'"""-^
"incorretas"

recombinante
desejada

ao
\-
\----i

(b) Todas as molculas circulares sero clonadas

Figura 5.1
A clonagem capaz de
gerar grandes quantidades de DNA recombinante.

Clula contendo
o vetor autoligado

Clula contendo uma


molcula de DNA
recombinante "inconeta"

Clula contendo a
molcula desejada

de qualquer DNA (vetor

de DNA

I
I

I
pois, mesmo que sejam incorionais sero replicadas.
por enzimas da bactria
recombinantes incordesejada (Figura 5.2b). Mesconseguida por meio da clonamais de uma molcula de
cada um dos clones resultanque colnias diferentes conrecombinante desejada, ou, contm o vetor autoligado.
plasmdeos recombinantes

/
Clone do vetor autoligado

\
O clone desejado

\
Clone de uma
molcula "incorreta"

Figura 5.2
A clonagem anloga a um processo de purificao. A partir de uma mistura de molculas
diferentes, podem ser obtidos clones contendo cpias de apenas uma molcula.

98

T.A. Bnowru

Este captulo trata da maneira pela qual vetores plasmidiais e virais e molculas recombinantes deles derivadas so introduzidos em clulas bacterianas. Ao longo do captulo, fican
evidente que a seleo de colnias contendo molculas recombinantes em meio a colnias
com o vetor autoligado relativamente simples. O mais difcil a distino entre clones com
a molcula de

DNA recombinante correta

e todos os demais clones recombinantes, que ser

tratada no Captulo 8.

Itl2

Prepara
Assim co
fuadamen
do foi obs
lada capu

mM de clr

5.1 Trasormao: a incorporao de DNA por


clulas bacterianas
A maioria das espcies de bactria capaz de incorporar molculas de DNA a partir do meio
no qual elas se multiplicam. Muitas vezes, uma molcula de DNA incorporada dessa maneira degradada, mas, ocasionalmene, ela capaz de sobreviver e replicar-se na clula hospedeira. Isso acontece sobretudo se a molcula de DNA for um plasmdeo com uma origem de
replicao reconhecida pelo hospedeiro.
A incorporao e a manuteno estvel de um plasmdeo em geral detectada a partir da
anlise da expresso de genes nele contidos (p. 25).Por exemplo, clulas de E. coti'so normalmente sensveis aos efeitos inibitrios da multiplicao proporcionados pelos antibiticos
ampicilina e tetraciclina. Entretanto, clulas que contm o plasmdeo pBR322 (p. 116-l l7)"
um dos primeiros vetores de clonagem a serem desenvolvidos, ainda na dcada de 1970, so
resistentes a tais antibiticos. Isso ocorrb porque pBR322 portador de alguns genes espec
ficos: um gene que codifica uma p-lactamase, enzima que modifica a ampicilina para
forma no-txica para abactna, e um conjunto de genes que codificam enzimas que
xificam a tetraciclina. A entrada de pBR322 nas clulas de E. coli pode ser detectada
as bactrias so transformadas de sensveis ampicilina e tetraciclina(amp'tet') em resi
tes a esses antibiticos (ampotet*).
Em anos mais recentes, o termo transformao foi estendido e passou a incluir a incrporao de qualquer molcula de DNA por qualquer tipo de clula, independentemente de eri
sa incorporao resultar ou no em uma alterao detectvel na clula e no importando se t
clula envolvida de uma bactria, de um fungo, de um animal ou de um vegetal.

cloreto de

Ainda

deterrnina
responsv
ja qual for

corpora
exterior
efetiva mc
breve elev
que trmi(

Seleo

A transfor

cuidadosar
Possa gera

de todas as

pe+rcnatr

te. Esse lt

5.1.1 Nem todas as espcies de bactria incorporam DNA


com a mesma eficincia
Na natureza, a transformao provavelmente no um processo importante para a
de material gentico por pate das bactrias. Um reflexo disso que, em laboratrio, somerF.
te algumas poucas espcies (especialmente membros dos gneros Bacillus e
podem ser transformadas com facilidade. Um estudo cuidadoso desses organismos
que eles possuem mecanismos sofisticados para ligao do DNA s clulas e para a
rao do mesmo.

A maioria das espcies de bactria, inclusive E. coli, incorpora apenas quantidades li


tadas de DNA sob circunstncias normais. Para transformar tais espcies eficientemente,
bactrias devem passar por alguma forma de tratamento fisico e/ou qumico que aumente
suas capacidades de captao de DNA. Clulas submetidas a esse tratamento so ditas
petentes.
Figura

aoDNAei

pot

bacterian

competente

Croruncev GNrcA

e virais e molculas recombiAo longo do captulo, ficar


em meio a colnias

sl.2

recombinantes, que ser

Preparao de clulas de E. colicompetentes

A transformao

de clulas competentes um processo ineficiente, mesmo quando elas so


cuidadosamente preparadas. Embora 1 ng do vetor plasmidial chamado puC8 (p. I I 8- I 19)
possa gerar de I .000 a I 0.000 transformantes, isso representa a incorporao de apenas 0,0 I 7o
de todas as molculas disponveis. Ademais, 10.000 transformantes representam apenas uma
pequena proporo do nmero total de clulas que esto presentes em uma cultura competente. Esse ltimo fato implica a necessidade de encontrar alguma maneira para distinguir-se en-

ificam enzimas que desto-

@e

ser detectada porque


(amp' tet') em resisten-

incluir

99

6.1.3 Seleo de clulas transormadas

na dcada de 1970, so
de alguns genes especa ampicilina para uma

e passou a

DNA

cloreto de rubdio, tambm sejam eficientes.


Ainda no se sabe exatamente por que esse tratamento funciona. Possivelmente, o CaCl,
determina a precipitao do DNA sobre a superfcie externa das clulas ou, talvez, o sal seja
responsvel por algum tipo de alterao na parede celular que favorea a ligao ao DNA. Seja qual for o caso, a incubao em CaCl, afeta apenas a ligao ao DNA e no a sua efetiva incorporao pela clula. Quando DNA adicionado a clulas tratadas, pernanece ligado ao
exterior das mesmas, no sendo transportado para o citoplasma nesse estgio (Figura 5.3). A
efetiva movimentao do DNA para o interior das clulas competentes estimulada por uma
breve elevao da temperatura para 42'C. Mais uma vez, o porqu da efetividade desse choque trmico pernanece desconhecido

de DNA a partir do meio


incorporada dessa maneireplicar-se na clula hospecom uma origem de

mla

oe

Assim como muitos dos avanos na tecnologia de DNA recombinante, o desenvolvimento


fundamental em relao transformao tambm ocorreu no incio da dcada de 1970, quando foi observado que clulas de E. coli que haviam sido incubadas em uma soluo de sal gelada captavam DNA de forma mais eficiente do que clulas no-tratadas. Uma soluo de 50
mM de cloreto de clcio (CaClr) usada tradicionalmente, embora outros sais, em especial o

o distino entre clones com

leral detectada a partir da


clulas de E. coli so norionados pelos antibiticos
deo pBR322 (p. 116-117),

E ANLtsE

a incor-

independentemente de ese no importando se a


Plasmdeo ligado
ao exterior da clula

DNA

Bactria normal

mportante para a obteno


. em laboratrio, somenBacillus e Streptococcus)
,lesses organismos revelou
rs clulas e para a incorpoapenas quantidades limies@ies eficientemente, as

Clula competente

Plasm deo transportado


para o interior da clula

qumico que aumente as


tratamento so ditas comFigura 5.3
Aligao ao DNA e a

ua

incorporao por

uuna clula bacteriana

competente.

Clula transormada

100

T. A. Bnowlr

tre uma clula que incorporou um plasmdeo dos muitos milhares de clulas que no foram

as

transformadas.

resistnc

A resposta para o problema ailizao de um marcador de seleo presente no plasmdeo. Um marcador de seleo simplesmente um gene que confere uma nova caracterstica
clula transformada, que no ocorre em uma bactria no-transformada. Um bom exemplo de
marcador de seleo o gene de resistncia ampicilina de pBR322. Aps um experimento
de transformao com pBR322, somente aquelas clulas que incorporaam o plasmdeo so
o*p*t"f e capazes de formar colnias em um meio de gar que contm ampicilina ou tetraciclina (Figura 5.4); no-transformantes, que ainda so ampstets, no produzem colnias no
meio seletivo. Clulas transformantes e no-transformantes so, portanto, facilmente distinguidas umas das outras.
A maioria dos vetores de clonagem carrega pelo menos um gene que confere resistncia a
antibitico s clulas hospedeiras, com a seleo de transformantes sendo feita por plaqueamento em meio de gar que contm o antibitico relevante. Tenha em mente, contudo, que a
resistncia ao antibitico no devida meramente presena do plasmdeo nas clulas transformadas. O gene de resistncia no plasmdeo tambm deve ser expressado para sintetizao
da enzima que destoxifica o antibitico. A expresso do gene de resistncia comea imediatamente aps a transformao, mas leva alguns minutos at que a clula contenha uma quantidade de enzima suficiente para ser capaz de suportar os efeitos txicos do antibitico. Por
essa razo, as bactrias transformadas no devem ser plaqueadas em meio seletivo imediatamente aps o tratamento por choque trmico. Em primeiro lugar, elas devem ser colocadas em
um pequeno volume de meio lquido, na ausncia de antibitico, e incubadas por um cuo peodo. A replicao plasmidial e a expresso podem ento ser iniciadas, de modo que, quando

clula

W ldentifir
O plaqut

formant(

tas por cr

tor autol
to de Dr

combin:

inativadr
da inatir

pBR322

t21

Seleo

deumg

O pBR3l

tura do r
exemplo
sistncia

adiciona

tetracicl

DNA ins
ampicilir

Clula de

Clula de E. coli normal


(sem plasmdeos)

No
sobrevive

E. coli

contendo
plasmdeos
pBR322

Sobrevive e produz
uma colnia

Fi,

Epessao enotpi

Aga contendo 40 pg/ml de ampicilina,


15 pg/ml de tetraciclina ou uma combinao de ambas

Figura 5.4
Seleo de clulas que contm
plasmdeos
pBR322 por plaqueamento em
meio de gar contendo ampicilina
e/ou tetraciclina.

37"C
mnailes do plaqu
iermrrta a taxa de

ihrmuaao a

urcia das transfu


mntndoseletirrc, p
Mrias tiveram te
nnffiara sntese c
mms de resistrrci

Clorurceu Grurcn e Arulrse oe DNA


de clulas que no foram

101

as clulas forem plaqueadas e encontrarem o antibitico, elas j tero sintetizado enzimas de


resistncia suficientes para poder sobreviver (Figura 5.5).

seleo presente no plasm-

uma nova caracterstica


Um bom exemplo de
22. Aps um experimento
orporaram o plasmdeo so
contm ampicilina ou tetraci. no produzem colnias no

portanto, facilmente distinEene que confere resistncia a

tes sendo feita por plaquea-

em mente, contudo, que a


plasmdeo nas clulas transerpressado para sintetizao
resistncia comea imediaa clula contenha uma quantxicos do antibitico. Por
em meio seletivo imediataelas devem ser colocadas em
e incubadas por um curto peiadas, de modo que, quando

.2 Identificao de recombinantes
O plaqueamento em um meio seletivo permite a distino entre transformantes e no-transformantes. O problema seguinte determinar quais das colnias transformantes so compostas por clulas que contm molculas de DNA recombinante e quais contm molculas de vetor autoligadas (Figura 5.2). Na maioria dos vetores de clonagem, a insero de um fragmento de DNA no plasmdeo destri a integridade de um dos genes presentes na molcula. Os recombinantes podem, portanto, ser identificados porque a caractestica codificada pelo gene
inativado no mais apresentada pelas clulas hospedeiras (Figura 5.6). Os princpios gerais
da inativao por insero so ilustrados por um experimento de clonagem tpico usando
pBR322 como vetor.

1 Seleo de recombinantes com pBR322: inativao por insero


de um gene de resistncia a antibitico
O pBR322 possui vrios stios de restrio nicos, os quais podem ser utilizados para a abertura do vetor antes da insero de um novo fragmento de DNA (Figura 5.7a). BamHI, por
exemplo, cliva pBR322 em apenas uma posio, no agrupamento de genes que codifica a resistncia tetraciclina. Uma molcula de pBR322 recombinante, que carega um segmento
adicional de DNA no stio de BamHI (Figura 5.7b), no mais capaz de conferir resistncia
tetraciclina para a clula hospedeira, pois um dos genes necessrios foi interrompido pelo
DNA inserido. Clulas com essa molcula de pBR322 recombinante ainda so resistentes
ampicilina, mas so sensveis tetraciclina ampRtef).

Protena de resistncia
a antibitico
Plasmdeo

lmediatamente aps
a transormao

Figura 5.4
Seleo de clulas que contm
plasmdeos
pBR322 por plaqueamento em
meio de gar contendo ampicilina
e/ou tetraciclina.

Figura 5.S
Eryresso enotpica. U ma
hnao a37'C por t hom antes do plaqueamento

rflrrenta a taxa de sobrevirncia das transformantes


um rneio seletivo, porque as
lMrias tiveram tempo pamhiciar a sntese das enzimas de resistncia a antibitico.

Aps incubao a
37"C por t hora

1O2

T.A.Bnowru

(a) Molcula de veto normal

--_____-------

Produto do gene

Gene-alvo para
inativao por insero

(b) Molcula de vetor recombinante


Figura 5.6
lnativao por insero. (a)

A molcula de vetor no-recombinante normal porta-

______________-,

Gene-alvo interrompido

Sem o produto
do gene

dora de um gene cujo produto conere uma caracterstica selecionvel ou identificvel clula hospedeira. (b) Esse gene inativado quando novo DNA inserido no vetor; em conseqncia disso, o hospedeiro recombinante no apresenta a caracterstica relevante.

Oretor de clonagem

llha

normal do vetor

lh recombinante cont

adicional de DNA i
Para um rna
de pBR3

fufiI\.

t;,n

2 A inativai
resistncii

A seleo de recombinantes de pBR322 executada da seguinte maneira. Aps a transformao; as clulas so plaqueadas em meio com ampicilina e incubadas at que apaream s
colnias (Figura 5.8a). Todas essas colnias so transformantes (lembre-se de que clulas
no-transformadas so a^pt e no produzem colnia no meio seletivo), mas somente umas
poucas contm molculas de pBR322 recombinantes: a maioria tem o plasmdeo normal, autoligado. Para identificao dos recombinantes, as colnias so plaqueadas em rplica em
meio de gar que contm tetraciclina (Figura 5.8b). Aps a incubao, algumas das colnias
originais desenvolvem-se novamente, enquanto outras, no (Figgra 5.8c). Aquelas que se desenvolvem consistem em clulas portadoras do pBR322 normal, sem insero de DNA, e,
portanto, de um agrupamento funcional de genes de resistncia tetraciclina (amp*tet*;. As
colnias que no se desenvolvem em gar com tetraciclina so recombinante s (amp*tets); como a posio delas nas placas conhecida, possvel a recuperao de amostras para estudos
adicionais a partir da placa original de gar com ampicilina.

A inativao

veniente par
plasmidiais u
tador do gen
enzima p-gal

lacZ, coma
dase (Figura

A p-galar

mais galactor
mo de E. coli
um segmento
sidase (Figur
abrigam um I
Um exper
com ampicilir
lactosidase. C

Croruncev GNtcA

E ANLtsE

oe

DNA lGl

(a) A molcula normal do vetor


Gene de
resistncia
ampicilina
Agrupamento
de genes de
resistncia
tetraciclina

ampRte4
(b) Uma molcula de pBR322 recombinante

Novo DNA inserido


no stio de BarnHl

Figura 5.6
lnativao por insero. (a)
A molcula de vetor no-recombinante normal portadora de um gene cujo produto conere uma caracterstica selecionvel ou identificvel clula hospedeira. (b) Esse gene inativado quando novo DNA inserido no vetor; em conseqncia disso, o hospedeiro recombinante no apresenta a caracterstica relevante.

Figura 5.7
O vetor de clonagem pBR322: (a) a moScr.rla normal do vetor e (b) uma molcur recombinante contndo um segmento
adicional de DNA inserido no stio de
Barrl{l. Para um mapa mais detalhado
de pBR322, ver Figura 6.1.

ampqteF

W22 A inativao por insero nem sempre envolve


resistncia a antibitico
inte maneira. Aps a transforincubadas at que apaream as
(lembre-se de que clulas
io seletivo.y. mas somente umas
ia tem o plasmdeo normal, ausao plaqueadas em rplica em
bao, algumas das colnias
5.8c). Aquelas que se desem insero de DNA, e,
a tetraciclina (amp*tef;. As

recombinante s Tamp* t ett 7 ; code amostras para estudos

A inativao por insero de uma resistncia a antibitico constitui-se em uma maneira conveniente para a identificao de recombinantes. Apesar disso, vrios vetores de clonagem
plasmidiais utilizam um sistema diferente. Um dos exemplos pUCS (Figura 5.9a), que portador do gene de resistncia ampicilina e de um gene chamado lacZ' , que codihca parte da
enzima B-galactosidase. A clonagem com pUC8 envolve a inativao por insero do gene
lacZ' , com os recombinantes sendo identificados pela incapacidade de sintetizar
B-galactosidase (Figura 5.9b).

A B-galactosidase uma das vriap enzimas envolvidas na quebra de lactose em glicose


mais galactose. Ela normalmente codificada pelo gene lacZ, que est situado no cromossomo de E coli. Algtmas linhagens de E. coli possuem um gene lacZmodifiado, que no tem
um segmento denominado lacZ' , que codifica a poro chamada de peptdeo u da
B-galactosidase (Figura 5.10a). Esses mutantes so capazes de sintetizar a enzima somente quando
abrigam um plasmdeo, como pUC8, que portador do segmento lacZ'faltante do gene.
Um experimento de clonagem com pUCl8 envolve a seleo de transformantes em gar
com ampicilina, seguida pela identificao de recombinantes com base na atividade de p-galactosidase. Clulas portadoras de um plasmdeo pUCS normal so ampR e cap.ves de sinte-

104

T.A. Bnowr

(a) Colnias em meio com ampicilina

(b) Plaqueamento em rplica

I
I
Superfcie
de toque

Blocode
madeira

I
I

1..r.,r.'...1

'

de

WM
meio
ampicilina

Colnias em
com

,/

.l

I
1r...r..r......1

-f-\---

toque I

Ctutasaderidas
ao bloco

rncunaao

Meio com
tetraciclina

Colias tetB

de clonagem
de vetor non
mrcula recombiar
I]llll]r| segmento adiciona
serido no stio de
|l]lepas mais detalhad
ver Figur
@ ueor

(c) Colnias

amfteF

desenvolvem-se em meio com tetraciclina

Posio de recombinante ampqte

lnrmltcrrla

No-recombina nles am pR tef

tem uma cq

Figura 5.8
Seleo de recombinantes de pBR322 por inativao por insero do gene de resistncia
tetraciclina. {a) As clulas so plaqueadas em gar com ampicilina: todas as transormantes
produzem colnias. (b) As colnias so plaqueadas em rplica em meio com tetraciclina. (c)
As colnias que se desenvolvem em meio com tetraciclina so amp'tef e, portanto, no-recombinantes. Recombinantes (ampBtef) no se desenvolvem, mas suas posies na placa
de ampicilina so conhecidas.

tizar B-galactosidase (Figura 5.9a); recombinantes tambm

so ampR, mas so incapazes de

produzir B-galactosidase (Figura 5.9b).


A identificao da presena ou da ausncia da p-galactosidase de fato bastante fcil. Em
vez de realizat um ensaio para a deteco da quebra de lactose em glicose e galactose, executado um teste para a deteco de uma reao um pouco diferente, tambm catalisada pela
enzima. Essa reao envolve um anlogo da lactose, chamado X-gal (5-bromo-4-cloro-3-indolil-B-D-galactopiranosdeo), o qual degradado pela p-galactosidase em um produto que

sdeo,IPTG
tes, formadr

binantes, cot

cas. Esse sis

E3 lntrodu

Existem doi:
da com um r

o e empr

["3.1 Transeci
Esse process

um fago em

Cr-ounoev GNtcA

E ANLrsE

oe

DNA

105

(a) pUCB
Gene de
resistncia
ampicilina

amf ftgat'
(b) Uma molcula de pUCB recombinante

Figura 5.9
O vetor de clonagem pUCS: (a) a
nrm*cula de vetor normal, (b) uma
nnolcula recombinante contendo
un segmento adicional de DNA inserido no stio de BamHl.Para
mapas mais detalhados de pUC8,
ver Figuras 6.3 e 6.4.

do gene de resistncia
todas as transormantes
rneio com tetraciclina. (c)
t=tef e, portanto, no-resuas posies na placa

, mas so incapazes de
fato bastante fcil. Em
gicose e galactose, exe. tambm catalisada pela

de

(5-bromo-4-cloro-3-inem um produto que

ampR

pgaf

tem uma cor azul-escuro. Se X-gal (mais um indutor da enzima, como o isopropiltiogalactosdeo, IPTG) for adicionado ao gar juntamente com ampicilina, as colnias no-recombinates, formadas por clulas que sintetizam B-galactosidase, tero cor.azlul, enquanto as recombinantes, com o gene lacZ' intenompido e incapazes de produzir B-galactosidase, sero brancas. Esse sistema, chamado de seleo Lac, est resumido na Figura 5.10b.

5.3 lntroduo de DNA de fagos em clulas bacterianas


Existem dois mtodos diferentes pelos quais uma molcula de DNA recombinante construda com um vetor derivado de fago pode ser introduzida em uma clula bacteriana: transfeco e empacotamento in vitro.

5.3.1 Transeco
Esse processo equivalente transformao, com a diferena de que o DNA envolvido o de
um fago em vez do de um plasmdeo. Assim como com um plasmdeo, o DNA de fago puri-

106

T. A. Bnowrl

No segundo sil
(a) A uno

do gene tacz'
E. coli

lacZ'-

mutao em um 91
uma das linhagens
linhagens capaz
to do gene mutado
tos de todas as ou

+pUC8

oQo

Molculas

)
incompletas
pUCS

Fragmento da p-galactosidase codiicado pelo gene bacteriano


Fragmenlo da B-galactosidase codificado pelo gene plasmidial
Molcula de P-galactosidase completa

(b) Seleo de recombinantes de pUCB

'+ X-gal + IPTG


Colnia azul = no-recombinante
Colnia branca = recombinante

colnias

azuis

mistura de empacc

./9oQ

= p-galactosidase sintetizada
X-gal-+ produto azul

Colnias brancas = p-galactosidase no-sintetizada


X-gal-+ sem produto azul

culturas celulares-

Molculas

de B-galactosidase
completas

Figura 5.10
A base terica da inativao por insero
do gene lacZ'presente em pUC8. (a) Os
genes bacteriano e
plasmidial complementam-se um ao outro para produzirem
uma molcula de pgalactosidase uncional. (b)Os recombinantes so selecionados a partir do plaqueamento em gar
contendo X-gal e
IPTG.

ficado ou uma molcula de fago recombinante misturado com clulas de E. coli competentes, com a incorporao do DNA induzida por choque trmico.

5.3.2 Empacotamento in vitro


A transfeco com molculas de DNA de l, no um processo muito eficiente quando comparada com a infeco de uma cultura de clulas com partculas de fago l, maduras. Seria,
portanto, til se molculas de l" recombinantes pudessem ser empacotadas na estrutura de cabea e cauda de l, em um tubo de ensaio.

Isso pode parecer difcil, mas, na realidade. um processo de execuo relativamente


simples. O empacotamento exige diversas protenas codificadas pelo genoma de 1,, mas elas
podem ser preparadas em uma alta concentrao a partir de clulas infectadas com linhagens
defectivas de fago 1,, com a possibilidade de utilizarem-se dois sistemas diferentes. Com o
sistema de linhagem nica, o fago l, defectivo portador de uma mutao nos stios cos, de
modo que eles no so reconhecidos pela nuclease que normalmente liva os catenanos de
durante a replicao do fago (p. 33-3a). Portanto, o fago defectivo incapaz de replicar-se,
embora ele dirija a sntese de todas as protenas neessrias ao empacotamento. As protenas
acumulam-se na bactria e so purificadas a partir de culturas de E. coli infectadas com o l,
mutado, podendo ser utilizadas para o empacotamento in vitro de molculas de l, recombinantes (Figura 5. I 1a).

Figura 5.11
Empacotamento in viro. (a) Sntese das
protenas do capsdeo
de i, pela linhagem de
E coli SMR10, que
portadora de um ago
que possui stios cos
ffictivos. (b) Sntese
conjuntos incompletos de protenas de
capsdeo de l. pelas linhagens de E. coli
EflB2688 e 8H82690.
(c) Uma mistura de lisados celulares prov
ioonjunto completo de
potenas de capsdeo
@pode empacotar molculas de DNA de l"
em tubo de ensaio.

Crorunceu Gwtcn e Arulrse oe

DNA

107

No segundo sistema, duas linhagens defectivas de l, so necessirias,


ambas portando uma
mutao em um gene que codifica um dos componentes
do envoltrio protico do fago: em
uma das linhagens, a mutao no gene D e, na ut,a,
no gene E (Figura 2.9). Nenhuma das
linhagens capaz de completar um ciclo de infeco
em E. cori,pois, na ausncia do produ_
to do gene mutado, a estrutura completa do capsdeo
no pode ser montada. Assim, os produ_
tos de todas as outras protenas do envoltri acumuram-se
na clula (Figura 5.1rb). uma
mistura de empacotamento pode, portanto, ser preparada pela
combinao de lisados de duas
culturas celulares, uma infectada com a linhagem e o

e a outra infetaoa com a linhagem

Figura 5.10
A base terica da inativao por insero

(a) Um sistema de mpacotamento de linhagem


nica

dogene lacZ'presen-

Protenas de
acumulam-se
na clula

DNA de l.

te em pUC8. (a) Os
genes bacteriano e
plasmidial complementam-se um ao outro para produzirem
uma molcula de Bgalactosidase uncional. (b) Os recombinantes so selecionados a partir do plaqueamento em gar
contendo X-gal e

E coli SMR10 _ o DNA


de possui stios cos deectivos
(b) Um sistema de empacotamento de duas linhagens

IPTG.

Figura 5.11
Empacotamenlo in vi-

E. coliBHB26SA
deectivo para a
sntese da protena E (a)

E. coliBHB2690
defectivo para a
sntese da protena D @

ro. (a) Sntese das

eficiente quando comfago maduras. Seria,


na estrutura de ca-

relativamente
genoma de 1,, mas elas
com linhagens
s diferentes. Com o
nos stios cos, de
cliva os catenanos de
incapaz de replicar-se,
.

As protenas

coli infectadas com o


las de l, recombi-

Futenas do capsdeo

I pela linhagem

de
E ooli SMR10, que
potadora de um ago
gue possui stios cos
rbctivos. (b) Sntese
conjuntos incompletos de protenas de
oapsdeo de pelas linhagens de E. coli
E-182688 e 8H82690.
{c) Uma mistura de lisados celulares prov
omnjunto completo de
Fotenas de capsdeo
epode empacotar molculas de DNA de .
em tubo de ensaio.

(c) Empacotamento in vitro

cos
I cos
I cos
I cos
r
Oo

o-_t +o
+C
\+ + c
o.-. j *
+

Catenanos de DNA de

Protenas de de SMRIO
ou de uma mistura de
BHB2688 + BHB2690

"o

o
H

H
'

Partcutas de fago
contendo molculas
de DNA empacotadas

108

T.A. BRowN
-.

A mistura contm, ento, todos os componentes necessrios para o empacotamento de


molculas de l" recombinantes em partculas de fago maduras (Figura 5.11c).
Com qualquer um dos dois sistemas, as molculas empacotadas so introduzidas em clulas de E coll simplesmente pela adio dos fagos montados cultura bacteriana. A partir da
ocorre o processo infectivo normal de 1".
E

5.3.3 A ineco por fago visualizada como placas em


um meio de gar
O estgio final do ciclo infectivo do fago a lise celular (p. 3l). Se as clulas infectadas so
espalhadas em um meio de gar slido imediatamente aps a adio do fago, ou imediatamente aps a transfeco com DNA viral, a lise celular pode ser visualizada na forma de placas
sobre um tapete de bactrias (Figura 5.12a). Cada placa tmazona de clareamento, produzida medida que os fagos lisam as clulas, infectam bactrias vizinhas que acabam sendo lisadas e assim por diante (Figura5.l2b).
Tanto l, como M13 formam placas. Com , tais placas so verdadeiras, eis que produzidas
por lise celular. Com M13, por outro lado, elas se apresentam um pouco diferentes, pois esse
fago no lisa as clulas hospedeiras (p.32). Em vez disso, Ml3 causa um decrscimo na velocidade de multiplicao das clulas infectadas, que suficiente para produzir uma zona de

clareamento rel
zonas mais clan
O resultado
l, ou de M13 .
derivada de ru
las virais idntir
combinantes.

5.4 Identiica
H diversas ma
guintes.

5.4.1 Inativao p
utilizado col

Todos os vetorc
dos de ,, so p

inativa a sntesr
recombinantes

contendo fagos
5.13a).
(a) Placas em um tapete de bactrias

5.4,2 lnativao p

Vrios tipos de
ne cI (posio !

Tapete formado pela

alterao na mc
tes com o gene
aparente para u

multiplicao conluent de bactrias

Uma placa - uma zona de


clareamento

5.4.3 Seleo utili

O fago l, nornu
grada de um fq
com o profago
que a insero <

(b) Placas lticas


Tapete de bactrias

//
.,,',jilt
. t'&,,u"" - todas as bactrias oram
.;on'ij':
"''iiilir,",iii'.{kl.i;
i-'.r..; i,.:1. +.

:"*:',,::X,i"n""

(c) Placas de M13

As placas contm bactrias


de multiplicao lenta
+ partculas do fago M13

combinantes
Figura 5.12
Placas de bacteriago.
(a) A aparncia das placas em
um tapete de bactrias. (b) Placas produzidas por um ago que
lisa a clula hospedeira (por
exemplo, l. no ciclo de infeco
ltico); as placas contm clulas
lisadas e muitas partculas de
ago. (c) Placas produzidas por
M13; essas placas contm bactrias de multiplicao lenta e
muitas partculas de ago M13.

ir

hospedeiras em
formam placas,

r[4.4 Seleo con

O sistema de er
de inserir na esl

la menor que 3,
deleo de gral
de modo que t
partculas virais
o tamanho total
tores, somente I

Crorunoeu Grurcn e ANLrsE

DE

DNA

109

clareamento relativo em um tapete bacteriano. Embora no sejam placas verdadeiras, essas


zonas mais claras so visualmente idnticas a placas de fago normais (Figura 5.12c).
O resultado final de um experimento de clonagem gnica utilizando um vetor derivado de
ou de Ml3 , portanto, uma placa de gar coberta com placas de fagos. Cada placa de fago
derivada de uma clula individual transfectada ou infectada, que contm, portanto, partculas virais idnticas. Tais partculas podem ou conter molculas de vetor autoligadas ou ser re-

paa o empacotamento de
5.1 1c).

introduzidas em clubacteriana. A partir da

so

combinantes.

Se as clulas infectadas so

do fago. ou imediatamen-

'uadana

5.4 Identificao de agos recombinantes

forma de placas
produzi-

H diversas maneiras para distinguir placas recombinantes. As mais importantes so as se-

de clareamento.

que acabam sendo

guintes.

li-

iras, eis que produzidas


pouco diferentes, pois esse
ausa um decrscimo na vepara produzir uma zona de

rn4.1 lnativao por insero de um gene lacZ'presente no fago


utilizado como vetor
Todos os vetores de clonagem derivados de Ml3 (p. l2l-122), alm de vrios vetores derivados de i,, so portadores de uma cpia do gene lacZ'. A insero de novo DNA nesse gene
inatiya a sntese de B-galactosidase, exatamente como acontece com o plasmdeo pUCS. Os
recombinantes so identificados por plaqueamento das clulas em gar com X-gal: placas
contendo fagos normais so azuis, enquanto placas recombinantes so incolores (Figura
5. I 3a).

t 4.2 lnativao

por insero do gene c{ de l,

Virios tipos de vetores de clonagem derivados de l, possuem stios de restrio nicos no gene cI (posio 38 no mapa da Figura 2.9). A inativao por insero desse gene provoca uma
alterao na morfologia das placas. As placas normais so "turvas", enquanto as recombinantes com o gene cI interrompido so "claras" (Figura 5.13b). A diferena entre elas bastante
aparente para um olho treinado.

n4.3 Seleo utilizando o fentipo Spi


,
5.12
de bacteriago.
aparncia das placas em
tpete de bactrias. (b) plaproduzidas por um ago que
a clula hospedeira (por
l, no ciclo de ineco
as placas contm clulas
e muitas partculas de
(c) Placas produzidas por
; essas placas contm bacde multiplicao lenta e
partculas de ago M13.

O fago l" normalmente no pode infectar clulas de E. coli que j possuem uma forma integrada de um fago aparentado chamado P2.Diz-se, por isso, que l, Spi- (sensvel inibio
com o profago P2). Alguns vetores de clonagem derivados de l, foram projetados de modo
que a insero de um novo DNA cause uma mudana de Spi* para Spi-, permitindo que os recombinantes infectem clulas portadoras de profagos P2. Tais clulas so utilizadas como
hospedeiras em experimentos de clonagem com esses vetores; assim, somente recombinantes
formam placas, pois s eles so Spi (Figura 5.13c).

f.4.4 Seleo com base no tamanho'do genoma de l,


O sistema de empacotamento de , que monta as partculas virais maduras, somente capaz
de inserir na estrutura da cabea molculas com tamanho entre 37 e 52kb. Qualquer molcula menor que 37 kb no empacotada. Muitos vetores derivados de foram construdos pela
deleo de grandes segmentos da molcula de DNA que compe o genoma do fago (p. 130),
de modo que tm um tamanho inferior a 37 kb. Esses vetores s podem ser empacotados em
partculas virais maduras depois de o DNA adicional ter sido inserido neles, fazendo com que
o tamanho total do genoma seja maior do que 37 kb (Figura 5.13d). Portanto, com esses vetores, somente os fagos recombinantes podem ser replicados.

espcies bi
porao de

(a) lnativao por insero do gene tacZ,

Saccharon,

mais sohst

gar+X-gal +IPTG

5.5.1 Transforn

Placa clara = recombinante

Para a mai,

Placa azul = norecombinante

celular. Cl
te transforn

cio (Figura

de celular.
fungos e ve

(b) lnativao por insero do gene l,cl

gura 5.14b

Placa clara = recombinante

ainda pode
clulas so
ria de poror
na clula. A
gradativas r

Placa turva = norecombinante

Em conr

cos para a ir

(c) Seleo utilizando o entipo Spi

pipeta muitr
transformac

Profago P2

seqenteme

volve o bon

Somente um fago
recombinante capaz
de inectar a clula

culas de our
rados sobre
chamada de

l, no-recombinante

5.5.2 Transform

a clula

Para animai

(d) Seleo com base no tamanho do genoma de l.

sim, um org

partir de cl
mento de pr

Stios cos

|#--r-r--rr-t
amanho correto

para empacotamento

'

/t\

t t

gramneas.

Catenanodel,

Muito pequeno
para ser empacotado

transformad
Figura 5.13
Estratgias para a
seleo de agos recombinantes.

esse DNA cl
7.13b). Anin
que a obten

lizada com r
do oviduto,

(p. l6l_162)

5.5 Transormao de clulas no-bacterianas


Mtodos para a introduo de DNA em leveduras, fungos, animais e vegetais tambm so necessrios, se tais organismos devem ser utilizados como hospedeiros para a clonagem gnica.
Em termos gerais, a incubao das clulas em soluo de sal s eficiente para umas poucas

Croruncev Grurcn e Aruuse oe

DNA

111

espcies bacterianas, embora um tratamento com cloreto ou acetato de ltio aumente a incorporao de DNA por clulas de levedura e seja freqentemente utilizado na transformao de

Saccharomyces cerevisiae.Para a maioria dos organismos superiores, entretanto, mtodos


mais sofsticados so necessrios.

55.1 Transformao de clulas individuais


Para a maioria dos organismos, a principal barreira para a incorporao de DNA a parede
celular. Clulas animais em cultura, que em geral no possuem parede celular, so facilmente transformadas, sobretudo se o DNA for precipitado na superficie celular com fosfato de clcio (Figura 5.14a). Para outros tipos de clulas, a resposta muitas vezes a remoo da parede celular. H enzimas disponveis que degradam paredes celulares de clulas de leveduras,
fungos e vegetais e, sob condies adequadas, podem ser obtidos protoplastos intactos (Figura 5.14b), os quais, via de regra, incorporam DNA com facilidade, mas a transformao
ainda pode ser estimulada por tcnicas especiais, como a eletroporao. Na eletroporao, as
clulas so submetidas a um pulso eltrico curto, que, acredita-se, induz a formao transitria de poros na membrana celular, pelos quais as molculas de DNA so capazes de penetrar
na clula. Aps a transformao, os protoplastos so lavados para a remoo das enzimas degradativas e a parede celular espontaneamente reconstituda.
Em contraste com os sistemas de transformao descritos at agora, h dois mtodos fsicos irara a introduo de DNA em clulas. O primeiro deles a microinjeo, que utiliza uma
pipeta muito fina para injetar molculas de DNA diretamente nos ncleos das clulas a serem
transformadas (Figura 5.15a). A tcnica foi inicialmente aplicada a clulas animais, mas subseqentemente aplicada tambm, com sucesso, em clulas vegetais. Um segundo mtodo envolve o bombardeamento das clulas com microprojteis de alta velocidade, em geral paculas de ouro ou tungstnio, que foram recobertas com DNA. Esses microprojteis so disparados sobre as clulas por uma pistola de partculas (Figura 5.15b). A tcnica incomum
chamada de biobalstica e j foi utilizada com diversos tipos diferentes de clula.

t5.2

Transormao de organismos inteiros


Para animais e plantas, o produto final desejado pode no ser uma clula transformada, mas,
sim, um organismo transformado. Plantas podem ser regeneradas com relativa facilidade a
partir de clulas em cultura, embora tenham sido encontrados problemas paa o desenvolvimento de procedimentos de regenerao para espcies de monocotiledneas, como cereais e

Figura 5.13
Estratgias para a
seleo de agos recombinantes.

gramneas. Uma nica clula vegetal transformada pode, portanto, dar origem a uma planta
transformada, que ser portadora do DNA clonado em cada uma de suas clulas e transmitir

DNA clonado a sua prognie, depois da florao e da produo de sementes (ver Figura
7.13b). Animais, claro, no podem ser regenerados a partir de clulas em cultura, de modo
que a obteno de animais transformados exige uma abordagem mais sutil. Uma tcnica utiesse

lizada com mamferos, como os camundongos, baseada na remoo de vulos fecundados


do oviduto, que so microinjetados com DNA e reimplantados no trato reprodutivo da me

(p.161-162).

e vegetais tambm so neiros para a clonagem gnica.


efiiente para umas poucas

T. A. BRowN

Leituras adici

a) Precipitao de DNA sobe clulas animais

Calvin, N.M.

_ _-__-

of

Soluo de fosfato de clcio

gq.-

Bacteir

Capecchi, M.R
cells. Cell,
Cohen, S.N., C

DNA precipitado sobre a


superfcie das clulas

formation

69,2tt0-1

Monocamada de clulas animais

Hammer, R.E.,

jection. Na

(b) Transormao de protoplastos vgetais

*
Clula

vegetal

#
I

da

-*y_

da parede celular
Protoplasto

Hegeneraao

planta

Clula vegetal
transormada

Planta
transformada

Figura 5.14

Hohn, B. & Mr
dings of th
Klein, T.M., W
into living
Mandel, M. & l
154-62. tT

Estratgias para a
introduo de novo
DNA em clulas animais e vegetais.

(a) Microinjeo

(b) Transormao com microprojteis

Microprojteis
Pino de disparo

-n

Clulas-alvo

^a
Carga

clulas-alvo
bomoarceaoas

::Sl

:i[$ "ot

microprojteis

Figura 5.15
Dois mtodos sicos
para a introduo de
DNA em clulas.

-----=:-

Ct-oruacer,a Grurcn e ANLtsE oe

DNA 1 l3

ras adicionais
calvin, N.M. & Hanawalt, PC. (1988) High effrciency transformation of bacterial cells by
electrop oration. Journal
of B ac t e rio lo gy, 17 0, 27 96-g0l.
Capecchi, M.R. (1980) High efficiency transformation by direct microinjection
of DNA into cultured mammalian
cells. C e I l, 22,47 9 -88.
Cohen, S'N., Chang, A.VY', Hsu,L. et al. (1972) Nonchromosomal antibiotic resistance
in bacteria: genetic transformation of Escherichia cali by R-factor DNA. Proceedings of the National Academy of
Sciences of the IJSA,
69,2ll0-14. [Transformao de uma bactria com um plasmdeo.]

Hammer,R.E.,Pursel,V.G.,Rexroad,C.E. etal.(L981)Productionoftransgenicrabbits,sheepandpigsbymicroinjection. N ature, 315, 680-83.

Hohn,B'&Murray,K.(Lg77)PackagingrecombinantDNAmoleculesintobacteriophageparticles
invitro.proceedingsoftheNationalAcademyof SciencesoftheUSA,T4,3259-63.[Empacotamento invitro.]
Klein' T'M', Wolf, E.D., Wu, R. & Sanford, J.C. (1987) High velocity microprojectiles for delivering
nucleic acids
into living cells. Nature, 327,70-73. [Biobalstica.]
Mandel, M. & Higa' A. (1970) Calcium-dependent bacteriophage DNA infecion. Journal
of Molecular Biotogy, 53,

Figura 5.14
Estratgias para a
introduo de novo
DNA em clulas animais e vegetais.

Figura 5.15
Dois mtodos fsicos
para a introduo de
DNA em clulas.

54-62. [Transfeco.]

Cnprulo 6
Vetores de Clonagem para E. coli

Vetores de clonagem baseados em plasmdeos de E.

coli.

l5

Vetores de clonagem baseados no bacterifago M I 3,

l, e outros vetores de alta capacidade permitem que


bibliotecas genmicas sejam construdas, 136
Vetores para outras bactrias, I 37

122

Vetors de clonagem baseados no bacterifago ,

t29

As tcnicas experimentais bsicas envolvidas na clonagem gnica j foram descritas. Os Captulos 3,4 e 5 mostraram como o DNA pode ser purificado de extratos celulares, como molculas de DNA recombinantes podem ser construdas em um tubo de ensaio, como molculas de DNA podem ser reintroduzidas em clulas vivas e como clones recombinantes podem
ser distinguidos. Agora deve-se olhar mais atentamente paa o vetor de clonagem propriamente dito, a fm de analisar a variedade de vetores disponveis para o biologista molecular e para entender as propriedades e utilizaes de cada tipo individual.
A maior variedade de vetores de clonagem que existe para a utilizao de E. coli como
organismo hospedeiro. Isso no surpreendente, tendo em vista o papel central que essa bac-

tria tem exercido na pesquisa bsica nos ltimos 50 anos. A imensa riqueza de informaes
existente a respeito da microbiologia, bioqumica e gentica de E. coli signihca que, virtualmente, todos os estudos fundamentais de estrutura e funo gnica foram realizados tendo essa bactria como organismo experimental. Recentemente, a clonagem gnica e a pesquisa biolgica molecular tm se tornado mutualmente sinergsticas - avanos na clonagem gnica tm
atuado como estmulo para a pesquisa, enquanto as necessidades da pesquisa tm acelerado o

desenvolvimento de novos e mais sofisticados vetores de clonagem.


Neste captulo, sero descritos os tips mais importantes de vetores de clonagem para E.
coli e desacadas as utilizaes especficas das molculas representativas. No Captulo 7, os
vetores de clonagem para leveduras, fungos, plantas e animais sero considerados.

t 1 vetores de clonagem

baseados em plasmdeos de E. coti

Os vetores de clonagem mais simples e os mais amplamente utilizados na clonagem gnica


so aqueles baseados em plasmdeos bacterianos pequenos. Um grande nmero de vetores
plasmidiais diferentes est disponvel para auilizao em E. coli,muitos obtidos de fornecedores comerciais. Eles combinam a facilidade de purificao com propriedades desejveis,

116

T.

A. Bnown

tais como alta eficincia de tfansformao, marcadores convenientes para a seleo de transformantes e recombinantes e a capacidade para clonagem de pedaos de DNA razoavelmente grandes (at cerca de 8 kb). A maioria dos experimentos de clonagem gnica de "rotina" faz
uso de um ou outro desses vetores plasmidiais.
Um dos primeiros vetores a ser desenvolvido - e ainda um dos mais populares hoje em
dia - o pBR322, o qual foi introduzido no Captulo 5 para ilustrar os princpios gerais da seleo na transformao e a identificao dos recombinantes (p. 98). Este estudo de vetores
plasmidiais de E. coli ser iniciado a partir de uma viso mais aproximada do pBR322.

6.1.1 A nomenclatura dos vetores de clonagem plasmidiais


O nome "pBR322" obedece s regras gerais para a nomenclatura de vetores:

.
.
c

Um mapa de pB
nes de resistn
(er1, a origem

"p" indica que ele realmente um plasmdeo.


"BR" identifica o laboratrio no qual o vetor foi originalmente construdo (BR conesponde a Bolvar e Rodrigues, pesquisadores que desenvolveram o pBR322).
"322" distingue esse plasmdeo de outros desenvolvidos no mesmo laboratrio (existem
tambni plasmdeos chamados pBR325, pBR327, pBR328, etc.).

6.1.2 As propriedades teis do pBR322


O mapa gentico e fsico do pBR322 (Figura 6.1) fornece uma indicao darazo pela qual
esse plasmdeo tem se tornado um vetor de clonagem to popular.
A primeira caracterstica til do pBR322 o seu tamanho. No Captulo 2 foi determinado
que um vetor de clonagem deve ter um tamanho menor do que 10 kb para evitar problemas,
tais como a quebra do DNA durante a purificao. O pBR322 possui 4.363 pb, o que significa que no somente o prprio vetor pode ser purificado com facilidade, mas tambm o podem
as molculas de DNA recombinantes construdas apartir dele. Mesmo com 6 kb de DNA adicionais, uma molcula de pBR322 recombinante ainda apresenta um tamanho manipulvel.
A segunda caracterstica do pBR322 que, conforme descrito no Captulo 5, ele contm
dois grupos de genes para resistncia a antibiticos. Tanto resistncia ampicilina quanto
tetraciclina podem ser utilizadas como marcas de seleo para clulas contendo o plasmdeo,
e cada gene marcador contm stios de restrio nicos, que podem ser utilizados em experimentos de clonagem. A insero de um DNA novo em um pBR322 que tenha sido clivado
com Psfl, PvuIou ScaI inativa o gene que confere resistncia ampicilina (o*po),e inseres
utilizando qualquer uma das oito endonucleases (principalmente BamHI e HindIII) inativam
a resistncia tetraciclina. Essa grande variedade de stios de restrio, que pode ser utilizada para a inativao por insero, confirma que o pBR322 pode ser utilizado para clonar fragmentos de DNA com qualquer um dos virios tipos de extremidades coesivas.
Uma terceira vantagem do pBR322 que ele apresenta um nmero de cpias relativamente alto. Geralmente existem cerca de 15 molculas presentes em uma clula de E. coli ransformada, mas esse nmero pode ser aumentado, para at 1 .00 a 3.000, pela amplificao do
plasmdeo na presena de um inibidor da sntese protica, tal como cloranfenicol (p. 54). Uma
cultura de E. coli, portanto, fornece um bom rendimento de molculas de pBR322 recombi-

Flgu

nantes.

6.1.3 O pedigreedo pBR322


A extraordinria convenincia do pBR322 como um vetor de clonagem no apareceu ao acaso' O plasmdeo foi, na verdade, planejado de modo que se possibilita construo final ter
essas propriedades desejveis.

As linhas gerais do esquema utilizado para construir o pBR322


so mostradas na Figura 6.2a. Conforme pode ser observado, sua construo foi um trabalho

o oeag

@:(a)as
q,aes

envo
na constru

ffie(b)t

orrn

das orbe
p8l

CLoruncrv GNrcA

para a seleo de transde DNA razoavelmengnica de "rotina" faz

E ANLtsE DE

EcoRl

DNA

117

Hird,lll

dos mais populares hoje em


os princpios gerais da se-

98). Este estudo de vetores

proximada do pBR322.
Figura 6.1
Lfm mapa de pBR322 mostrando as posies dos gems de resistncia ampicilina (amp\ e tetraciclina

(e, a origem de replicao (ori) e alguns dos stios


de restrio mais imPortantes.

construdo (BR corres'eram o pBR322).


mesmo laboratrio (existem
(a) Construo de pBR322

[/v

No Captulo 2 foi determinado


e l0 kb para evitar problemas,
poss 4.363 pb, o que signifidrdade, mas tambm o podem

Fragmento
recrrcuranzaoo

\ R6_5 /
Ecolt* \.--/

*'l-<

rn /
l/
/=.-<

EcoRt. {PSC101)
Fragmento de EcoRl
EcoRl.

ttr,r

u1,\

trlesmo com 6 kb de DNA adium tamanho manipulvel.


no Captulo 5, ele contm
istncia ampicilina quanto
ulas contendo o plasmdeo,
ser utilizados em experi22 que tenha sido clivado
*mpicilina (o*p*), e inseres

dentro do tio de

Tn33\

,'r"/--\'".

\--l-{*t""

BamHI e HindIII) inativam

de cpias relativamenuma clula de E. coli ransa 3.000, pela amplificao do

construo foi um trabalho

a
-::

// ./

w
/-\

.\--/

;.- EcoRl\9{
'

@
tef

uors ragmenos
ligados

tef

ee,
ori

cloranfenicol (p. 54). Uma


las de pBR322 recombi-

no apareceu ao aca construo final ter


para construir o pBR322

EcoRl

ampR

restrio, que pode ser utilizaser utilizado para clonar frag-

ibilita

*7--\_

z\

indicao darazo pela qual

(b) As origens de pBR322

Figura 6.2
O pedigree de
pBR322: (a) as manipulaes envolvidas
na construo de
pBR322 e (b) um resumo das origens de
pBR322.

T. A. Bnowr'r

irduo que exigiu a utilizao hbil e muito bem feita das tcnicas de manipulao do DNA descritas no Captulo 4. Um resumo dos resultados de tais manipulaes fomecido na Figura 6.2b,
a partir da qual pode ser observado que o pBR322, de fato, compreende DNA derivado de trs
plasmdeos naturalmente existentes. O gene ampR estoriginalmente presente no plasmdeo
Rl, um plasmdeo tpico de resistncia a antibiticos, que encontrado em populaes naturais de E. coli (p.29). O gene tetR derryado de R6-5, um segundo plasmdeo de resistncia a
antibiticos. A origem de replicao de pBR322, a qual comanda a multiplicao do vetor nas
clulas hospedeiras, original de pMB l, que bastante relacionado ao plasmdeo produtor de

(2) A dele

pBR32
transfe
ca, evit
nante t

molecr
popula

sua m
so acor
te peril

colicilina ColEl (p. 29).

6.1.4 Outros vetores plasmidiais tpicos para E. coli


O pBR322.foi desenvolvido no final da dcada de l9lo, e o primeiro trabalho cientfico descrevendo sua utilizao foi publicado em 19'.''...Desde ento, muitos outros vetores de clonagem plasmidiais foram construdos, a maioria derivada de pBR322, por meio de manipulaes semelhantes quelas resumidas na Figura 6.2a. No haveria sentido em tentar descrever
todos esses vetores, principalmente porque muitos so variaes de um mesmo tema. Trs
exemplos adicionais sero suficientes para ilustrar as caractersticas mais importantes apresentadas pela ampla variedade de vetores de clonagem plasmidiais disponvel atualmente para os engenheiros genticos.

pBR327: um plasmdeo com alto nmero de cpias


O pBR327 (Figura 6.3a) foi construdo pela remoo de um segmento de 1.089 pb de
pni:ZZ. Essa deleo manteve os genes o*p* e tef intactos, mas alterou as capacidades replicativas e conjugativas do plasmdeo resultante. Como resultado, pBR327 difere de pBR322
de duas maneiras importantes:

na-se importante, pois, com a existncia de


mais cpias de um gene clonado, maior a probabilidade de que o efeito do gene clonado nas
clulas hospedeiras seja detectado. O pBR327,
com seu alto nmero de cpias, , portanto, a
melhor opo para esse tipo de trabalho do que
pBR322.

pUCB

Esse vetor fc
da inativa<

6.3b) deriv

neam. A se
contm mais
pados em un
O pUCS
lares vetores
na constru
de replica

mesmo anter
nado, obtido
tes.

(1) O pBR327 apresenta um nmero de cpias superior ao pBR322, estando presente com
cerca de 30 a 40 molculas por clula de E. coli. Isso no de grande relevncia quando a preocupao o rendimento do plasmdeo, uma vez que ambos os plasmdeos podem
(a) pBR327
ser amplificados para um nmero de cpias superior a 1.000. No entanto, o nmero de cpias
EcoRl Hr'ndlll
Scal
superior de pBR327 em clulas normais torna
Pvul
esse vetor mais adequado. caso o objetivo do
experimento seja o estudo das funo do gene
clonado. Nesses casos, a dosagem gnica tor-

(b)

pUCS: um

segund

um processo

lina

X-gal

cedimento el
para o outro
na metade
A terceiri
o qual permi
mos, EcoRl
pulaes adi,
ra 6.4a). Out
cem uma fle
nados (Figru
mo que os a!

um membro

corresponder
de DNA ou i

procediment

pGEM3Z:

/"*A
t
2.t5'r pD

O pGEM3Z

lacZ',

, ))

ori /acz7Agrupamento de stios


\ \7(ver Figura 6.4a)

este

mente do me

Figura 6.3
Dois vetores de clonagem plasmidiais de E
coli.

CroNeoeM Gr.rrcr e Anuse

manipulao do DNA des fomecido na Figura 6.2b,


DNA derivado de trs
presente no plasmdeo
em populaes nafuplasmdeo de resistncia a
a multiplicao do vetor nas
ao plasmdeo produtor de

trabalho cientfico des[os outros vetores de clona312. por meio de manipularentido em tentar descrever
de um mesmo tema. Trs
cas mals rmportantes apredisponvel atualmente pa-

segmento de 1.089 pb de
alterou as capacidades re-

pBR327 difere de pBR322

or

DNA

19

(2) A deleo tambm

eliminou a capacidade conjugativa de pBR322, transformando


pBR327 em um plasmdeo no-conjugativo, que no capaz de comandar a sua prpria
transferncia para outras clulas de E. coli. Isso importante para a conteno biotgica, evitando a possibilidade de que uma molcula de um plasmdeo pBR327 recombinante escape de um tubo de ensaio e colonize bactrias do intestino de um biologista
molecular descuidado. Em contraste, pBR322 poderia, teoricamente, ser passado para
populaes naturais de E. coli por conjugao, embora, de fato, pBR322 tambm possua meios de proteo (apesar de menos sofisticados) para minimizar as chances de isso acontecer. O pBR327 , portanto, prefervel, caso o gene clonado seja potencialmente perigoso na ocorrncia de um acidente.

pUGS: um plasmdeo de seleo Lac


Esse vetor foi mencionado no Captulo 5, quando a identificao de recombinantes por meio
da inativao por insero do gene da B-galactosidase foi descrira (p. 10a). O pUCS (Figura

6.3b) derivado de pBR322, embora somente a origem de replicao e o gene amp* permanem. A seqncia de nucleotdeos do gene amp* foimodificada, de tal forma que ela no
contm mais os stios de restrio nicos; todos aqueles stios de clonagem esto agora agrupados em um segmento curto do gene lacZ'presente no pUC8.
O pUC8 possui trs vantagens importantes, que o levaram a se torna um dos mais populares vetores de clonagem para E. coli. A primeira delas casual: as manipulaes envolvidas
na construo do pUCS foram acompanhadas por uma mutao inesperada, dentro da origem
de replicao, que resultou no plasmdeo apresentando um nmero de cpias de 500 a 700,
mesmo antes da amplificao, o que tem um efeito significativo no rendimento do DNA clonado, obtido a partir de clulas de E. coli transformadas com plasmdeos pUC8 recombinantes.

estando presente com


de grande relevncia quan-

o rendimento do plasmambos os plasmdeos podem


pam um nmero de cpias suentanto, o nmero de cpias

l7 em clulas normais torna


dequado, caso o objetivo do
o estudo das funo do gene
cusos, a dosagem gnica

tor-

pois, com a existncia

de

gene clonado, maior a proo efeito do gene clonado nas


seja detecrado. o pBR327,

ro de cpias, , portanto, a
tipo de trabalho do que

esse

A segunda vantagem que a identificao de clulas recombinantes pode ser realizada em


um processo de uma nica etapa, por meio do plaqueamento em meio gar contendo ampicilina e X-gal (p. 105). Com ambos. pBR322 e pBR327, a seleo de recombinantes um procedimento em duas etapas, necessitando de placas-rplicas, de um meio com um antibitico
para o outro (p. 103). Um experimento de clonagem com pUC8 pode, portanto, ser realizado
na metade do tempo necessrio para com pBR322 ou pBR327.
A terceira vantagem de pUC8 est relacionada com o agrupamento dos stios de restrio,
o qual permite que um fragrnento de DNA com duas extremidades.coesivas diferentes (digamos, -EcoRI em uma extremidade e BamHI na outra) seja clonado sem a utilizao de manipulaes adicionais, tais como a ligao de uma molcula de ligao (do ingls linker) (Figura 6.4a). Outros vetores pUC carregam combinaes diferentes de stios de restrio e fornecem uma flexibilidade ainda maior para os tipos de fragmentos de DNA que podem ser clonados (Figura 6.4b). Ademais, o agrupamento de stios de restrio em tais vetores o mesmo que os agrupmentos nas sries de vetores M I 3 equivalentes (p. I25). O DNA clonado em
um membro de uma srie pUC pode, portanto, ser transferido diretamente para o seu M13mp
correspondente, de tal forma que este pode ser analisado por intermdio de seqenciamento
de DNA ou mutagnese in vitro (Figura 6.4c; ver pginas 2ll e 244 para a descrio desses
procedimentos).

I
J

i
l
I

b clonagem plasmidiais de E

pGEM3Z: transcrio in vitro do DNA clonado


o pGEM3Z (Figura 6.5a) muito semelhante a um vetor puc:
lacZ',

ele contm os genes amp* e

ltimo contendo um agmpamento de stios de restrio, alm de ser quase exatamente do mesmo tamanho. A diferena que o pGBM3Zpossui dois pedaos de DNA extras,
ese

12O

T.

A. Bnowr,r

RNA-pol

(a) Stios de restrio em pUCB

fragment
zado con
que objet

sntese dr

Hitlll

Os pr

Psll

cias-pa
especf
limerase

Sali, Accl, Hirrcll


BamHl

Smal, Xmal

li com ur
para utili

EcoRl

(lembre-

do que or

I a21tgr

(b) Stios de restrio em pUCIB

padro

dr

Hindlll
Sphl
Psfl

puc18

Sa, Accl, Hincll


Xbal
BamHl

Smal, Xmal
Kpnl
EcoRl

(c)Transerncia de um ragmento de DNA de pUCS para Mt3mp8


pUCS recombinante

BamHl
DNA novo

(:_1'

Clivagem

com EanrHl
e EcoRl

EcoRl

Stios de restrio

com BamHl e EcoRl

\ \

Figura 6.4
Os plasmdeos pUC. (a)
O agrupamento de s
tios de restrio no int+
rior do gene lacZ'de
pUC8. (b) O agrupamento de stios de restrio em pUC18. (c)
Transerncia de um
fragmento de DNA de
pUCS para M13mp8.

Figul
pGEM3z. (a) Ma

(b) Sntese de

itmuf,fo. R =

cada um atuando como stio de reconhecimento para a ligao de uma


enzima RNA-polimerase. Essas duas seqncias promotoras situam-se em cada um dos lados
do ug*p-"nto
dos stios de restrio utilizados para a introduo de um DNA novo em uma
molcula de
pGEl3Z.Isso significa que, se uma molcul a de pGBM3Zrecombinante for misturada
com

agrupa

stios de restri

M,

ra EcoRl, Sac{,
Smal, BanrHl,

Sat, Acd, Hircll,

Sphl e H

--=.-

Ct-oruncev Grurcn e ANLrsE oe DNA

121

RNA-polimerase purificada em um tubo de ensaio, a transcrio ocorrer e cpias de RNA do


fragmento clonado sero sintetizadas (Figura 6.5b). O RNA que produzido poder ser utilizado como uma sonda de hibridizao (p. 174), ou poder ser necessrio para experimentos
que objetivam o estudo do processamento de RNA (por exemplo, a remoo de ntrons) ou
sntese de protenas.

Os promotores presentes no pGEM3Z e nos demais vetores desse tipo no so seqncias-padro reconhecidas pela RNA-polimerase de E. coli.Ao contririo, um dos promotores
especfico para a RNA-polimerase codificada pelo bacterifago T7 e o outro pela RNA-polimerase do fago SP6. Essas RNA-polimerases so sintetizadas durante a infeco de E. co/i com um ou outro fago e so responsveis pela transcrio dos genes do fago. Sua escolha
para utilizao na transcrio in vitro deve-se ao fato de essas enzimas serem muito ativas
(lembre-se de que um ciclo ltico de infeco inteiro leva somente 20 minutos [30], de modo que os genes do fago devem ser transcritos muito rapidamente) e capazes de sintetizar de
I a21tg de RNA por minuto, substancialmente mais do que pode ser produzido pela enzimapadro de E. coli.

(a) pGEM3Z

Promotor de T7

Promotor de SP6

(b) Sntese de RNA rn viro

Promotor de T7

Figura 6.4
Os plasmdeos pUC. (a)
O agrupamento de stios de restrio no int+
rior do gene lacZ'de
pUC8. (b) O agrupamento de stios de restrio em pUC18. (c)
Transerncia de um
ragmento de DNA de
pUCS para M13mp8.

de uma enzima RNA-polime-

dos lados do agrupamento


novo em uma molcula de
inante for misturada com

Figura 6.5
pGEM3Z. (a) Mapa do
ffi. (b) Sntese de RNA
rflmufo. R = agrupamento
istios de restrio para EcoRl, Sacl, Kpnl,
*d" Smal, BamHl, Xbal,
&t, Accl, Hirrcll, Psl|,
Sphl

Transcritos de RNA

e Hidlll.

--

t.z vel(.,r' qg ur(rrrageilr uateau(,st

rr(J

uaulerr(,rag(,

A exigncia mais importante para qualquer vetor de clonagem

tut

tr,

que ele possua uma manelra

de se replicar em uma clula hospedeira. Para vetores plasmidiais, essa necessidade fcil de
satisfazer, uma vez que seqncias de DNA relativamente curtas so capazes de atuar como
origens de replicao plasmidial, e a maioria das enzimas necessrias para a replicao, se no
todas, fornecida pela clula hospedeira. Manipulaes elaboradas, tais como aquelas que resultaram no pBR322 (Figura 6.2a), so, portanto, possveis, contanto que a construo final
tenha uma origem de replicao intacta e funcional.
Com bacterifagos, tais como Ml3, a situao em relao replicao mais complexa.
Molculas de fago, em geral, contm vrios genes essenciais replicao, incluindo aqueles
que codificam componentes do capsdeo protico do fago e enzimas replicativas especficas
para o DNA do fago. Alterao ou deleo de qualquer um desses genes ir impedir ou destruir a capacidade replicativa da molcula resultante. Existe, pois, uma liberdade muito menor paa se modificar molculas de DNA de fago, e, via de regra, os vetores de clonagem de
fago so apenas levemente diferentes das molculas parentais.
Os p'roblemas na construo de um vetor de clonagem de fago so ilustrados considerando M13. O genoma normal de M13 possui 6,4 kb de comprimento, a maioria ocupada por l0
genes extremamente compactados (Figura 6.6), cada um essencial para a replicao do fago.

H somente uma nica seqncia intergnica, de 507 nucleotdeos, dentro da qual novas molculas de DNA podem ser inseridas, sem causar a intemrpo de um desses genes, e, na verdade, essa regio inclui a origem de replicao, que ela prpria deve permanecer intacta. Claramente, h apenas um limitado espao para modificao no genoma de Ml3.
No entanto, ser relembrado que a maior atrao de M13 a oportunidade que ele oferece de obteno de verses de fita simples do DNA clonado (p. 36).Tal caracterstica tem afuado como estmulo para o desenvolvimento de vetores de clonagem M13.

6.2.1 Desenvolvimento do vetor de clonagem M13mp2


foi a introduo do gene lacT
dentro da seqncia intergnica. Isso originou Ml3mpl, o qual forma placas azuis em meio
gar com X-gal (Figura 6.7a).
M13mpl no tem qualquer stio nico de restrio no gene lacZ'.Ele contm, no entanto,
o hexanucleotdeo GGATTC prximo ao incio do gene. Uma nica substituio de nucleo-

Figura 6.7
@wstruo de (a)

M13mp1, e (b)
a partir dc
ggmna de M13 dc
li:o selvagem,

O primeiro passo na construo de um vetor de clonagem M13

deo o tral

utilizandc

possui un

de cido
M13mp2

Ml3n
coesil
tinguidos
des

Hl3mp7

O prxim,
adicionais
deo curt<

tios de res
clonagem
6.8b). um

lI
Figura 6.6
O genoma de M13, mostrando as posies dos genes I ao

PsrI).

te o gene I
de uma en

Cr-oruneev Grurcn e Aruusr oe

DNA

123

(a) Construo de M13mp1

ele possua uma maneira


essa necessidade

fcil

de

,uz*-\,

so capazes de atuar como

para a replicao, se no
tais como aquelas que reque a construo final

Clivagem,
ligao

M13mp1

M13

replicao mais complexa-

lacZ'

(b) Construo de M13mp2

incluindo aqueles
imas replicativas especfi cas
senes ir impedir ou desi:s.- uma liberdade muito meos vetores de clonagem de

Mutagnese
in vitro
............................*

EcoRl

on

lacz

M'l3mp2

M13mp1

o ilustrados consideranmaioria ocupada por 10


para
a replicao do fago.
ia
dentro da qual novas moum desses genes, e, na ver'e pernanecer intacta. Cla.a

crportunidade que ele oferer. Tal caractestica tem atua-

foi a introduo do

gene

met - thr-met - ile - thr - asp - ser -AG ACC ATG ATT ACG GAT TCA-

emM13mp1

- thr -met - ile - thr - asn - ser -ATG ACC ATG AT-r ACG AAT TCA-

emM13mp2

Figura 6.7
Gonstruo de (a)
M13mp1, e (b)
fil&np2, a partir do
gEnoma de M13 do
tipo selvagem.

met

;n1;edogenelacZ,

lpii6 dogenelacZ'

EcoRl

lacT

tbrma placas azuis em meio


Z'. Ele contm, no entanto,
substituio de nucleo-

deo o transformar em GAATTC, o qual um stio para EcoRI. Essa alterao foi realizada
utilizando-se mutagnese in vitro (p.2aD, resultando no Ml3mp2 (Figura 6.7b). M13mp2
possui um gene lacZ'levemente alterado (o sexto cdon agora especifica asparagina, emvez
de cido asprtico), mas a enzima B-galactosidase produzida pelas clulas infectadas com
M13mp2 ainda perfeitamente funcional.
Ml3mp2 o vetor de clonagem M13 mais simples. Fragmentos de DNA com extremidades coesivas de EcoRI podem ser inseridos no stio de clonagem, sendo os recombinantes distinguidos como placas claras em meio gar com X-gal.

M13mp7: stios de clonagem simtricos


O prximo passo no desenvolvimento de vetores M13 foi a introduo de stios de restrio
adicionais dentro do gene lacZ', obtido pela sntese em um tubo de ensaio de um oligonucleotdeo curto, chamado de stio de policlonagem (polylinker), qle consiste em uma srie de stios de restrio que possui extremidades coesivas de EcoRI (Figura 6.8a). Esse stio de policlonagem foi inserido dentro daquele de EcoRI de Ml3mp2, originando M13mp7 (Figura
6.8b), um vetor mais complexo, com quatro stios de clonagem possveis (EcoRI, BamH\ Sail e PstI). O stio de policlonagem foi projetado de tal forma que ele no interrompe totalmente o gene lacZ'; urna fase de leitura mantida por intermdio do stio de policlonagem, alm
de uma enzima B-galactosidase funcional, a qual, ainda que alterada, produzida.
as posies dos genes I ao X.

124

T. A. Bnowlr

(a) O stio de policlonagem

AATTC

CCCGG

GGGGC

ATC C GTC G AC CTG

CTAG G C AG CT G G AC

EcoRl

C
G

AG GTC G AC G G ATC C G G G G
TC

AG CTG

EcoRl

Sall
Accl
Hincll

Sall
Accl
Hincll

(b) Construo de Ml3mp7

Figura 6.8
Stios de
restrico

EcoRl,
ligao

rL/rv
M13mp2

Stio de
policlonagem

CTAG G C C C CTTAA

M13mp7

Construo de
M13mp7: (a) o stio
de policlonagem e
(b) sua insero no
stio de EcoRl de
M13mp2. Note que
os stios de restrio
para Sa/l so tambm reconhecidos
por Acd

e Hircll.
Figura 6.9
Clonagem com
ffil3np7 (ver o texto
para detalhes).

Quando o M13mp7 digerido talto com EcoRI, BamHI ou SaII, uma parte ou todo o stio de policlonagem excisado (Figura 6.9a). Na ligao, na presena de um DNA novo, um
de trs eventos pode ocorrer (Figura 6.9b).

(1)
(2)
(3)

DNA novo

inserido.
O stio de policlonagem reinserido.
O vetor se religa, sem insero.

A insero de um DNA novo quase que invariavelmente impede a produo de B-galactosidase, de forma que as placas recombinantes so claras em meio gar com X-gal (Figu
6.9c). Alternativamente, se o stio de policlonagem reinserido, e o M13mp7 original novamente formado, ento ocorrer a formao de placas azuis. Porm, o que acontecer se o vetor se religar, nem com um DNA novo e nem com o stio de policlonagem inserido? Mais urna
vez, o projeto do stio de policlonagem entra em ao. No importa qual o stio de restrio
utilizado, a auto-ligao resulta em um gene lacZ'funcional (Figura 6.9c), originando placas
azuis. A seleo , portanto, inequvoca: somente fagos Ml3mpT recombinantes daro origem
placas claras.
Uma grande vantagem de M13mp7, com seus stios de clonagem simtricos, que o DNA
inserido tanto no stio de BamHI, SalI ou PsrI pode ser excisado da molcula recombinante
utilizando-se EcoRI (Figura 6.10). Pouqussimos vetores permitem que um DNA clonado seja to facilmente recuperado.
a

6.2.3 Vetores Ml3 mais complexos


Ml3 mais sofisticados possuem stios de policlonagem mais complexos inseridos
no gene lacZ'.lJmexemplo o Ml3mp8 (Figura 6.11a), o qual o correspondente do plasOs vetores

mdeo pUC8 (t
sua capacida&
Uma segun
possui o mestr
clonado em M
M13mp9, estar

ciamento de D
extremidade
6.11d). Somen
ciamento; se o
ser seqencia
o no vetor gi
mitir que a se
Outros pan
semelhantes ac
de restrio dil

Vetores hbl

Embora os vetr
nes clonados, r
to de DNA qur
mo o tamanho
dos. Para soluc

---------15

CLoruncev GNrcA

(a) Clivagem de Ml3mpz

Anuse oe

DNA

125

odo ou parte do stio de policlonagem

Stio de policlonagem
EcoRl,

ou Sa/l

/\/..
(b) Religao com novos
produtos de DNA passveis

Figura 6.8

Construo de
M13mp7: (a) o stio
de policlonagem e
(b) sua insero no
stio de EcoRl de
M13mp2. Note que
os stios de restrio
para Sa so tambm reconhecidos
por Accl e Hirrcll.

Novos insertos de

(c) Colorao das placas em meio

DNA: /'l

gar com X-gal

tabZ'lnterrompido

*Sem p-gal *Placa

clara

Stio de policlonagem reinserido:

lacz. rcslaurade

-*Placa

azul

lacZ'reslaurado

*p-gal *placa

azul

B_gal

Stio de policlonagem reinserido:

Figura 6.9
Clonagem com
1[ltl3rnp7 (ver o texto
para detalhes).

SalI, uma parte ou todo o sde um DNA novo, um

produo de p-galacto-

meio gar com X-gal (Figura


e o M13mp7 original novam, o que acontecer se o veiclonasem inserido? Mais uma
qual o stio de restrio
6.9c), originando placas
recombinantes daro origem
'7

simtricos,queoDNA
da molcula recombinante
que um DNA clonado se-

mais complexos inseridos


o correspondente do plas-

mdeo pUCS (p. 119). Assim como no vetor plasmidial, uma vantagem do M13mp8 est na
sua capacidade. de receber fragmentos de DNA com duas extremidades coesivas diferentes.
Uma segunda caracterstica fornecida pelo vetor gmeo M13mp9 (Figura 6.1 1b), o qual
possui o mesmo stio de policlonagem, mas na orientao inversa. Um fragmento de DNA
clonado em M13mp8, se excisado por meio de uma restrio dupla, e, ento, inserido em
Ml3mp9, estar, agora, na sua orientao inversa (Figura 6.11c). Isso importante no seqenciamento de DNA (p. 211), durante o qual a seqncia de nucleotdeos lida a partir de uma
extremidade do stio de policlonagem para o interior do fragmento de DNA inserido (Figura
6.11d). Somente cerca de 600 nucleotdeos podem ser lidos em um experimento de seqenciamento; se o DNA inserido mais longo que isso, uma das extremidades do fragmento no
ser seqenciada. Uma alternativa virar o fragmento ao contririo, por sua exciso e reinsero no vetor gmeo. Um experimento de seqenciamento de DNA com esse novo clone permitir que a seqncia de nucleotdeos da outra extremidade do fragmento seja determinada.
Outros pares de vetores M13 tambm esto disponveis. Ml3mp10/l 1 e M13mp18/19 so
semelhantes ao M13mp8/9, mas possuem stios de policlonagem diferentes e, portanto, stios
de restrio diferentes.

Vetores hbridos plasmdeo-M1 3


Embora os vetores M13 sejam muito teis para a produo de verses de fita simples dos genes clonados, eles tm uma desvantagem. Existe uma limitao prra o tamanho do fragmento de DNA que pode ser clonado em um vetor M13, com 1.500 pb, em geral, sendo tido como o tamanho mximo, embora fragmentos de at 3 kb tenham sido ocasionalmente clonados. Para solucionar esse problema, inmeros vetores novos (fagomdeos, do ingls phage-

126

T.A.Bnowru

,^"-^
Extremidades de
Sau3A (GATC)

Clivagem com BamHl


(extremidades GATC)

Ligao,
clonagem

1 Stios de BamHl no
so restaurados

t/,,4t\, \
\ stios oara SauSA
Fragmento de \
/
\
Satt3A
i

2 M13 possui muitos

/ \
3 Portanto, recuperao
do fragmento por clivagem
com EcoRl

a,,u"n"m com EcoRt

I \<*
/\

Extremidades
coesivas
de EcoRl

9\
,/

clivagem oo u",o.

Figura 6.10
Recuperao de um DNA
clonado a partir de uma
molcula de M13mp7 recombinante por meio da
clivagem dos stios mais
externos do stio de policlonagem.

mids) forandesenvolvidos pela combinao de uma pae do genoma de M13 com o DNA do
plasmdeo.
Um exemplo fornecido pelo pEMBL8 (Figura 6.12a), construdo pela transferncia para pUCS de um fragmento de 1.300 pb do genoma de Ml3. Esse pedao de DNA de Ml3 contm a seqncia-sinal reconhecida pelas enzimas que convertem a molcula de Ml3 de fita
dupla normal em DNA de fita simples, antes da secreo de novas partculas de fago. Essa seqncia-sinal ainda funcional, mesmo que separada do restante do genoma de Ml3, de forma que molculas de pEMBLS so tambm convertidas em DNA de fita simples e secretadas
como partculas de fago defectivas (Figura 6.12b). necessrio qe as clulas de E coli ltilizadas como hospedeiras em um experimento de clonagem co{r pEMBL8 sejam subseqentemente infectadas com um M13 normal para atuar como um fago auxiliar (do ingls helper
phage), fornecendo as enzimas replicativas necessrias e as protenas do capsdeo do fago. O
pEMBL8, sendo derivado de pUC8, possui os stios de policlonagem no interior do gene
lacZ' , de forma que placas recombinantes podem ser identificadas da maneira padro em meio
gar contendo X-gal. Com pEMBLS, verses de fita simples dos fragmentos de DNA clonados de at 10 kb de tamanho podem ser obtidas, aumentando significativamente a amplitude
do sistema de clonagem de M13.

Figura 6.11

ll13mp8 e M13mpg.

Li

L.

Crorueeera Grurcr e ANLtsE oe

DNA

(a) O stio de policlonagem de M13mp8/9

AAT TCCCGGGGATCCGTCGACCTGCAGCC A

cGG

in ccc ieocie i rcon


I

EcoRl

Hindlll

Sa/l

Smal
Xmal

Accl
Hincll

(b) A orientao do stio de policlonagem

aHindlll

,_ff<.''"t

EcoRl

Hindl

. EcoRl

-y_,r

(c)Transerncia de DNA de M13mp8 para M13mpg

EcoRl

Hind|,t

Hindtlt

Hindlll
I

d
n

N
R

Figura 6.10

Clivagem

Recuperao de um DNA
clonado a partir de uma
molcula de M13mp7 recombinante por meio da
clivagem dos stios mais
eernos do stio de policlonagem.

Ml3 com

o DNA do

do pela transferncia pade DNA de Ml3 cona molcula de M13 de fita

partculas de fago. Essa sedo genoma de M13, de forde fita simples e secretadas
que as clulas de E coliutipEMBLS sejam subseqenauxiliar (do ingls helper
do capsdeo do fago. O

m no interior do gene
da maneira padro em meio
fragmentos de DNA clonaificativamente a amplitude

t{

Ligao

P
I

EcoRl

(d) Seqenciamento de DNA utilizando M13mp8 e Ml3mp9

*-.-/,r'

,/
de

h1

Fsl

M13mpB \
recombinante

Sequncia de DNA

,R
recombinante

127

128

T. A. Bnowlr

6.3 Vetores d
Dois proble

(a) pEMBLS

pudessem s
Fragmento de DNA

(1)

de M13

Amol

prese

maior
3.997 pb

partcr

um fn
gura 6

ampR

Agrupamento de stios
(ver Figura 6.4a)

(2)

O gen

mento

lizada

de um

(b) Converso de pEMBLB em DNA de ita simples


Regio de

Ml3

muito
6.13U

zz>, Prohena de rePlicao

aetns
A protena de M13
replica pEMBLS em
DNA de fita simples

pEMBLS de fita dupla

Figura

/\
tt
\./
\__./
/ ^ \/
\. / \_/

Molculas de pEMBLS
de fita simples

Figura 6.12
Partculas de "fago"
de pEMBLB

pEMBLS: um vetor hbrido plasmdeo-M13


que pode ser convertF
do em DNA de ita
simples.

6.11

,!s dois problemas qu


llreram que ser resoM
s antes que os veto
rcs de clonagem de,
Fdessem ser desen
rolvidos. (a) A limita
o do tamanho esta
bebdda pelo genom
,L, devido necessi
dade de empacot-l
m interior da cabe
ago. (b) O DNAd
L possui mltiplos si
de reconhecimentt
paa quase todas a
de res
trio

CrorunGeu Grurcn e ANLtsE oe

Vetores de clonagem baseados no bacteriago

DNA

129

Dois problemas tiveram de ser solucionados antes que os vetores de clonagem baseados em
pudessem se desenvolver:
(1)

(2)

A molcula de DNA de l, pode ser aumentada em tamanho em somente cerca de 5vo,rcpresentando a adio de apenas 3 kb de DNA novo. Se o tamanho total da molcula for
maior que 52 kb, ela no poder ser empacotada dentro da estrutura da cabea de l, e
partculas de fago infectivas no sero formadas. Isso limita severamente o tamanho de
um fragmento de DNA que pode ser inserido em um vetor l, que no foi modificado (Figura 6.13a).
o genoma de l, to grande que ele possui mais do que uma seqncia de reconhecimento para virtualmente cada endonuclease de restrio. A restrio no poderia ser utilizadapara clivar a molcula de l" normal em uma forma que ela iria permitir a insero
de um DNA novo, pois a molcula seria clivada em vrios pedaos pequenos, os quais,
muito improvavelmente, iriam restaurar um genoma de l, vivel aps religao (Figura
6.1 3b).

(a) A limitao de tamanho


Possvel recombinante

Genoma normal de l"

>52kb

49 kb

\
t\
I Novo DNA > 3
I

kb

X
Figura 6.13

Figura 6.12
pEMBLS: um vetor h
brido plasmdeo-M13
que pode ser convertido em DNA de ita
simples.

l,

dois problemas que


que ser resolviantes que os vetoms de clonagem de l,
pdessem ser desenrolvidos. (a) A limita@ do tamanho estaHecida pelo genoma
1" devido necessidade de empacot-lo
nn interior da cabea
bfago. (b) O DNA de
fl, possui mltiplos s
de reconhecimento
para quase todas as
de restrio.

Muito grande para


ser empacotado

Empacotamento

(b) Mltiplos stios de restrio

,2,3,4,5,6,

EcoRl

k*,
' PU

g
Cl
tgt

Retisao

Mistura complexa

de molculas

uul(-laltts, rur )urPtllullt qu ur[41 allllPla valt


clonagem de l, se desenvolvesse, com sua utilizao principal sendo a clonagem de grandes
pedaos de DNA, desde 5 a25kb, muito extensos pra manipulao em vetores plasmidiais

ou

h,m

suam

Ml3.

6.3.1 Segmentos do genoma de


sua viabilidade

)',

poucas
tios par

podem ser deletados sem preiuzos a

eventua
ra EcoI

A maneira que impulsionou o desenvolvimento dos vetores de clonagem de l, foi fornecida


pela descoberta de que um grande segmento na regio central da molcula de DNA de l, pode ser removido sem prejudicar a capacidade do fago de infectar clulas de E. coli. A remoo de toda ou de parte dessa regio no-essencial, entre as posies 20 e35 do mapa mostrado na Figura 2.9, diminui o tamanho da molcula de l, resultante para at cerca de 15 kb. Isso significa que at 18 kb de um DNA novo podem agora ser adicionados, antes que o ponto
de clivagem para o empacotamento seja alcanado (Figura 6.14).
A regio "no-essencial" de fato contm a maioria dos genes envolvidos na integrao e
exciso do profago de l, do cromossomo de E. coli. Um genoma de l, deletado , portanto"
no-lisognico e pode seguir somente o ciclo ltico de infeco. Isso , por si s, desejvel pa.
ra um vetor de clonagem, uma vez que a induo no necessria antes que as placas sejern
formadas (p. 58).

3.3

Vetorer

Uma ve
plos sti
diferent
a serem

E.

:O2EE

Componentes
do

capsdeo

b2

o.EO.E
oooc$ (
rr

r(

E6i

fi g
H,B g
gE
E
E .E
t

Figura 6.14
O mapa gentico de 1", mostrando a posio da regio no-essencial que pode
ser deletada sem prejuzos capacida&
do ago de seguir o ciclo ltico de infeco.

6.3.2 A seleo natural pode ser utilizada para o isolamento de l,


modiicados que no possuem determinados stios de restrio
Mesmo um genoma de deletado, com a sua regio no-essencial removida, possui mlt
stios de reconhecimento para a maioria das endonucleases de restrio. Trata-se de um
blema freqentemente encontrado quando um vetor novo est sendo desenvolvido. Se
te um ou dois stios necessitam ser removidos, ento atcniea de mutagnese in vitro (p.
pode ser utilizada. Por exemplo, um stio para EcoRI, GAATTC, poderia ser modificado
ra GGAITC, que no reconhecido pela enzima. No entanto, a mutagnese invitro estaya
sua infncia quando os primeiros vetores de l, se desenvolveram, e, mesmo nos dias de
ela no seria uma maneira eficiente para a modificao de mais que uns poucos stios em
nica molcula.

<

o de
DNA d

Figura 6.15

ilzando-se a se-

llfto natural para


to de fal" que no pos-

stios de res-

tiiPo Para EcoRl.

Cloruncev Grurcn e Anuse oe

variedade de vetores dc
sendo a clonagem de grandes
em vetores plasmidiais

sem preiuzos a
clonagem de foi fornecida
molcula de DNA de poclulas de E. coli. A remo20 e35 do mapa mostraparaat cerca de 15 kb. Isantes que o ponto

DNA

Em vez disso, a seleo natural foi utilizada paa fornecer linhagens de l" que no possuam os stios indesejados. A seleo natural pode ser posta em funcionamento pela unlizao de uma linhagem hospedeira de E. coli que produz EcoRI. A maioria das molculas de
DNA de que invadem a clula destruda por essa endonuclease de restrio, mas umas
poucas iro resistir e produziro placas. Esses sero fagos mutantes, nos quais um ou mais stiospara EcoRI foram espontaneamente perdidos (Figura 6.15). Virios ciclos de infeco iro,
eventualmente, resultar em molculas de que no possuem todos ou a maioria dos stios para EcoRI.

83,3 Vetores de insero

e substituio

Uma vez que os problemas apresentados pela dificuldade de empacotamento e pelos mltiplos stios de restrio foram resolvidos, o caminho estava aberto para o desenvolvimento de
diferentes tipos de vetores de clonagem baseados em 1,. As primeiras duas classes de vetores
a serem produzidas foram os vetores de l, de insero e de substituio (ou troca).

envolvidos na integrao e
de deletado , poanto,
lsso , por si s, desejvel paia antes que as placas sejam
5 stios para EcoRl

,..-t

'4ll\DNA de l, normat

I ttlll

r
\

\
infeco de clulas de E.coli
produtoras de EcoRl

de 1,, mostrando a poio no-essencial que pode


sem prejuzos capacidade
seguir o ciclo ltico de inec-

de

Placa formada
Por fago

mutante

Somente 3 stios

"..-J:T'
Muito poucas placas

?u

stios de restrio
Repetio da ineco
com o fago mutante

removida, possui mltiplos


e restrio. Trata-se de um prosendo desenvolvido. Se somende mutagnese invitro (p.244)

poderia ser modificado pa-

Figura 6.15

mutagnese invitro estava na


, e, mesmo nos dias de hoje,
que uns poucos stios em uma

llliNizando-se a seleo natural para


oisolamento de fagm l, que no possram stios de resio para EcoRl.

,
a

t-F

131

Sem stios

rt'
Mais algumas
placas

oara Eco9l

Segupda linhagem
de fago mutante

132

A. Bnowlr

Vetores de insero

dess:

Em um vetor de insero (Figura 6.16a), um fragmento grande da regio no-essencial foi removido e os dois braos ligados um ao outro. Um vetor de insero possui ao menos um nico stio de restrio, dentro do qual um DNA novo pode ser inserido. O tamanho do fragmento de DNA que um vetor individualmente pode carrear depender, claro, da extenso da deleo de sua regio no-essencial. Dois vetores de insero populares so:

l,gt10 (Figura 6.16b), que pode caffear at cerca de 8 kb de um DNA novo, inserido em
um nico stio de EcoRI, localizado no interior do gene cI. A inativao por insero
desse gene resulta em recombinantes que so distinguidos como placas claras, emvez
de placas turvas (p. 109).

LZ^PI (Figura 6.16c), com o qual inseres de at 10 kb de DNA no interior de qualquer um dos seis stios de restrio dentro do stio de policlonagem iro inativar o gene
lacZ'presente no vetor. Os recombinantes originam placas claras, em vez de placas
azuis, em meio gar com X-gal.
Vetores de substituio
Um vetor de , de substituio possui dois stios de reconhecimento para a endonuclease de
restrio utilizada para a clonagem. Tais stios flanqueiam um segmento de DNA que substitudo pelo DNA a ser clonado (Figura 6.I7a). Freqentemente, o fragmento substituvel (ou
fragmento stuffer, no jargo de clonagem) carrega stios de restrio adicionais que podem
ser utilizados para cliv-lo em pedaos pequenos, de forma que a sua prpria reinsero du-

fer,

l,GE

kb (p
liclor
most
mais

NNh

menl
tanto
que (
po st

6.3.4 Experime
ou substi
Um experi

um vetor F
ligada e as

rante um experimento de clonagem bastante improvvel. Os vetores de substituio so, em


geral, projetados para carear pedaos de DNA maiores do que os que os vetores de insero
podem suportar. A seleo dos recombinantes , freqentemente, com base no tamanho, uma
vez que os vetores no-recombinantes so muito pequenos pra serem empacotados nas cabeas do fago (p. 109).
Dois velores de substituio populares so:

EMBL4 (Figura 6.17b),

que pode carrear at20kb de DNA inserido pela substituio


de um segmento flanqueado por pres dos stios de EcoRI, BamHIe SalI (qualquer uma

(a) Construo de um vetor de l, de insero


DNA de normat (49

kb)

- |*

clivagem'

rigao

y1,.',::r"

Figura 6.17

(35-40kb)

tlfrfiores de de
nstituio. (a)

Regio
no-essencial

(b)

l.sr10

LTrj-+oxo
Deleo

(c) rzAPil

'

7 '-\
lacZ'

'41 kb
Deleo

Figura 6.16
Vetores de l, de insero. P = stio de policlonagem no gene
lacZ'de l.ZAPll, contendo stios de restrio nicos para Sad,
Notl, Xbal, Spel, Eco
Rle Xhol.

lDbnagem com
um vetor de l,
zubstituio.
{b) Clonagem
oom i.EMBL4.
(c) A estrutura
de },GEM11,
mmnslrando a orffirn dos stios
restrio nos
dcs stios de
policlonagem.

b
b

t
i

dem
nho.

===: -r

Cr-oueerv GNtcA

no-essencial foi repossui ao menos um niO tamanho do fragmen claro, da extenso da desao:

DNA novo, inserido em

inativao Por insero

rcLno

placas claras, em vez

DNA no interior de qualiro inativar o gene


claras, emYez de Placas

E ANLlsE oe

DNA

133

dessas trs endonucleases de restrio pode ser utilizadapararemover o fragmento stufpofer, deforma que fragmentos de DNA com uma vaiedade de extremidades coesivas
no
tamapode
basear-se
de
"EMBL4
recombinantes
dos
A
seleo
dem ser clonados).

nho, ou pode utilizar o gentipo Spi (p. 109).


2,,GEM11 e ?r,GEM12 (Figura 6.1'7c), cada um dos quais possui uma capacidade de 23
kb (prxima ao mximo terico), com o fragmento stuffer flanqueado por stios de policlonagem que contm sete stios de restrio diferentes. Os stios de policlonagem
mostram-Se levemente diferenteS nesses dois vetores, mas' em ambos os casos, os stios
mais externos so para a enzima de restrio S7I, a qual reconhece a seqncia GGCCNNNNNGGCC. Essa seqncia muito rara e improvvel de estar presente no fragmento de DNA que foi clonado. A restrio do vetor recombinante com SfI pode, portanto, ser utilizada para excisar o fragmento clonado, com uma grande probabilidade de
que o fragmento seja recuperado intacto. Como com }"EMBL4, o tamanho ou o fentipo Spi podem ser utilizados para a seleo dos recombnantes'

n3.4 Experimentos de clonagem com vetores de ?r, de insero


ou substituio
para a endonuclease de
de DNA que subso fngmento substituvel (ou
!o adicionais que Podem
a sua prpria reinsero du-

Um experimento de clonagem com um vetor de l" pode seguir as mesmas etapas como com
um vetr plasrnidial - as molculas de " so clivadas, o DNA novo adicionado, a mistura
ligada e as molculas resultantes utilizadas para transfectar uma linhagem de E. coli hospe-

de substituio so, em
os que os vetores de insero
com base no tamanho. uma
empacotados nas cabe-

(a) Clonagem com um vetor de

de substituio
Clivagem,
ligao

t------T-------rJ
Fragmento
stuffer

inserido pela substituio


BamHIe SalI (qualquer uma

v77V77'

L--Y,J

DNA novo

(b) ).EMBL4
EcoRl, BamHl,
Sa/l ou uma
combinao

RBS

Figura 6.17

ffiores de ), de

Figura 6.16

lb
bao

Vetores de l, de insero. P = stio de Policlonagem no gene


IacZ'de l,ZAPll, contendo stios de restrio nicos Para Sac{,
Notl, Xbal, Spel, Eco
Rle Xhol.

B=

0onagem com
un vetor de l.
substituio.

S = Sail

ffi___)

\\

DNA novo,
de at 23 kb

R = EcoRl

urbstituio. (a)

{b) Clonagem
oom EMBL4.
[p) A estrutura
de GEM11,
nmtrando a orffin dos stios
restrio nos
dois stios de
policlonagem.

SBR

BamHl

(c) }"GEMI1

SfiI - Sacl - Xhol -

Bam\l - Avrll- EcoRl


Xbal

Eco?l

"rr\

- Avrl Baml - Xhol Sacl- Sfll

%:

.:

134

T. A. Bnowr.r

deira competente (Figura 6.18a). Esse tipo de experimento necessita que o vetor esteja na sua
forma circular, com os stios cos ligados entre si por meio de pontes de hidrognio.
Embora bastante satisfatrio para muitos propsitos, um procedimento baseado em transfeco no particularmente eficiente. Um nmero mais elevado de recombinantes ser obtido se um ou dois refinamentos forem introduzidos. O primeiro auttlizao da forma linear
do vetor. Quando a forma linear do vetor digerida com a endonuclease de restrio apropriada, os braos direito e esquerdo so liberados como fragmentos separados. Uma molcula recombinante pode ser construda misturando-se o DNA a ser clonado com os braos do vetor
(Figura 6. 1 Sb). A ligao resulta em vrios rearranjos moleculares, incluindo catenanos constitudos de brao esquerdo-DNA-brao direito, repetidos muitas vezes (Figura 6.18b). Se o
DNA inserido possui o tamanho correto, ento os stios cos, que separam essas estruturas, estaro a uma distncia correta um do outro para o empacotameno in vitro (p. 101). Os fagos
recombinantes so, portanto, produzidos em um tubo de ensaio e podem ser utilizados para
infectar uma cultura de E. coli. Essa estratgia, em especial a utilizao do empacotamento ln
vitro, restlta em um grande nmero de placas recombinantes.

(a) Clonagem com um DNA de

( );* (
\cos'

Vetor de l. de insero
forma

circular

protico do

\cos

_-_-

Transfeco de

DNA

Molcula recombinante

E. coti

(b) Clonagem com um DNA de l" linear

,orflEcoe

e*t^t"*"

Braos

d"

@.."nF{\

,ra'%,"
DNA

novo

Ligao

'..--%_q

i^\
^ \,

? ? ?------./

,/ //L

lnfeco de E. coli

Figura 6.18

cos

recombinantes

ll=
I

Mistura do empacotamenlo in vitro

Dierentes estratgias de clonagem


com um vetor de 1".
(a) Utilizando-se a
orma circular de l.
como um plasm
deo. (b) Utilizandose os braos esquerdo e direito do
genoma de 1,, alm
do empacotamento
in vitro, para a obteno de um nmero maior de placas recombinantes.

ootamento ra
lcula que cr
Um cosu
tambm nect

'Fr*"

,.---.---',:!coat

\__-/

O ltimo e o
entre uma n
trada no fato

circular

."o*, U

./---\
/\

6.3.5 Fragmentc
utilizande

Figura 6.19
lm cosmdeo tpico

ea maneira como
dts utilizado para
ndonagem de ragrmttos de DNA longos.

Ct-ouoeu
que o vetor esteja na sua
de hidrognio.
imento baseado em trans-

recombinantes ser obtia utilizafie da forma linear


de restrio apropria-

Uma molcula recom os braos do vetor


incluindo catenanos consvezes (Figura 6.18b). Se o
essas estruturas, es-

Grurcn e ANLtsE oe

DNA

135

53.5 Fragmentos muito grandes de DNA podem ser clonados


utilizando-se um cosmdeo
O ltimo e o mais sofisticado tipo de vetor baseado em l" o cosmdeo, o qual um hbrido
entre uma molcula de DNA de fago e uma de plasmdeo bacteriano, com sua estratgia centrada no fato de que enzimas que empacotam a molcula de DNA de l, dentro do capsdeo
protico do fago necessitam somente dos stios cos parafuncionar (p. 3a).4 reao de empaGotamento in vitro funciona no somente com genomas de 1,, mas tambm com qualquer molcula que cilegue stios cos separados por um DNA de 37 a 52kb.
Um cosmdeo basicamente um plasmdeo que carega um stio cos (Figura 6.19a). Ele
tambm necessita de uma marca de seleo, tal como o gene que confere resistncia ampi-

in vitro (p. 101). Os fagos


e podem ser utilizados para
do empacotamento in

(a) Um cosmdeo tpico

BamHl

(b) Clonagem com pJBB

BamHl
BamHl

Clivagem
com BamHl

cos

lo-t

BamHl
ampH
-=l

la-l

pJBB linear
pJBB

u:rn,

Figura 6.18
Dierentes estratgias de clonagem
com um vetor de 1".
(a) Utilizando-se a
orma circular de l"
como um plasm
deo. (b) Utilizandose os braos esquerdo e direito do
genoma de , alm
do empacotamento
in vitro, para a obteno de um nmero maior de placas recombinantes.

circular

Bam*r

/--=-

BamHr

DNA novo

(r^"
"r,
Empacotamento

invitro
Figura 6.19
lllin cosmdeo tpico
e a maneira como
de utilizado para
sdonagem de ragfiEtos de DNA longos.

3:l#:.15

"*-

'h-%

,2"

??

Partcuraso"'\
::J:i::;$:Js3[:lil;:.,",

lnfeco de E.

coli -t--__

/ I

Meio com ampicilina

b
:==1.*iryrr

136

T.

A. Bnowrrr

cilina, alm de uma origem de replicao plasmidial, rmayezque os cosmdeos no


todos os genes de e, portanto, no produzem placas. Ao contririo, colnias so
meio seletivo, exatamente como com um vetor plasmidial.
um experimento de clonagem com um cosmdeo realizado como segue (Figura 6.1
O cosmdeo aberto em seu nico stio de restrio e novos fragmentos de DNA so in
dos. Tais fragmentos so normalmente produzidos pela digesto parca7 com uma endonucl*
se de restrio, uma vez que a digesto total quase que invariavelmente resulta em fragmentos que so muito pequenos para serem clonados em um cosmdeo. A ligao realizadade
forma que os catenanos so formados. Com a condio de que o inserto de DNA possua o tamanho correto, o empacotameno in vitro cliva os stios cos e coloca os cosmdeos recombinantes dentro das partculas de fago maduras. Esses fagos so, ento, utilizados para infectar uma cultura de E. coli, apesar, claro, de que placas no sero formadas. Em vez disso, as
clulas infectadas so plaqueadas em um meio seletivo e colnias resistentes ao antibitico
iro aparecer. Todas as colnias sero recombinantes, j que cosmdeos lineares no-recombinantes so muito pequenos para serem empacotados dentro das cabeas de .

&zironrn
&procura
[ma soh

insertos de I
dos nos cror
somes), os q

lativamente
plasmidiais
reduzindo o

tros vetores
vantagem. e
de capsdeo

clonar fragr
nam as cara
dos de Pl (
dade de at

6.4

outros vetores de alta capacidade permitem que


bibliotecas genmicas sejam construdas

O principal uso de todos os vetores baseados em a clonagem de fragmentos de DNA muito grandes pira serem suportados por vetores plasmidiais ou M13. Um vetor de substituio,
tal como EMBL4, pode carrear at20kb de DNA novo, enquanto alguns cosmdeos podem
sustentar fragmentos de at 40 kb. Isso confronta com o tamanho mximo do inserto de cerca
de 8 kb para a maioria dos plasmdeos e menor do que 3 kb para os vetores Ml3.
A capacidade para clonar fragmentos de DNA to extensos significa que bibliotecas genmicas podem ser produzidas. Uma biblioteca genmica um conjunto de clones recombinantes que contm todo o DNA presente em um organismo individual. Uma biblioteca genmica de E. coli, por exemplo, contm todos os genes de E. coli, de forma que qualquer gene
desejado pode ser retirado da biblioteca e estudado. Bibliotecas genmicas podem ser mantidas por muitos anos, alm de multiplicadas, de maneira que cpias podem ser enviadas de um
grupo de pesquisa para outro.
A grande questo quantos clones so necessrios para uma biblioteca genmica? A resposta pode ser calculada com a frmula:

6.5 Vetores p
Vetores de

incluindo

plasmdeos

pla faixa dr
Uns poucos
ses vetores
lizaes.

Tabela 6.1
organismos

ln(l- p)

r"r-9
\

na qual

b)

o nmero de clones que so necessrios, P a probabilidade de um gene qualquer


estarpresente, a o tamanho mdio dos fragmentos deDNA inseridos no vetor, ebotama-

nho total do genoma. A Tabela 6.1 mostra o nmero de clones necessrio para bibliotecas genmicas em uma variedade de organismos, construdas utilizandtr um vetor de substituio de
l" ou um cosmdeo.
No , de forma alguma, impossvel obterem-se vrias centenas de milhares de clones, e
os mtodos utilizados para identificar um clone carregando um gene desejado (Captulo 8) podem ser adaptados para lidar com nmeros to grandes, de maneira que bibliotecas genmicas om esses tamanhos no so, em absoluto, impraticveis. No entanto, maneiras para se re-

Espcies

E. coli
Saccharom,

Drosophila

Anoz
Homem
Sapo
" Calculado

'Fragmenros
'Fragmentos

CLoruneev Gucn e ANLrsE oe

DNA

137

os cosmdeos no possuem

duzir o nmero de clones necessrio para uma biblioteca genmica esto continuamente sen-

colnias so formadas em

do procuradas.
Uma soluo est no desenvolvimento de novos vetores de clonagem, capazes de suportar
insertos de DNA longos. Durante os ltimos anos, os progressos nessa rea foram centralizados nos cromossomos artificiais bacterianos (BACs, do ingls bacterial artificial chromosomes), os quais so vetores modernos baseados no plasmdeo F (p. 29). O plasmdeo F relativamente grande e os vetores dele derivados tm uma capacidade maior do que os vetores
plasmidiais normais. Os BACs podem sustentar insertos de DNA de at 300 kb de tamanho,
reduzindo o tamanho de uma biblioteca genmica humana para somente 30.000 clones. Outros vetores de alta capacidade foram construdos a partir do bacterifago Pl, o qual possui a
vantagem, em relao a , de ser capaz de comprimir 110 kb de DNA dentro da sua estrutura
de capsdeo. Vetores do tipo cosmdeos, baseados em P1, foram projetados e utilizados para
clonar fragmentos de DNA variando em tamanho desde 15 at I00 kb. Os vetores que combinam as caractersticas de vetores de Pl e BACs, chamados cromossomos artificiais derivados de Pl (PACs, do ingls PI-derived artificial chromosomes), tambm possuem a capacidade de at 300 kb.

como segue (Figura 6.19b).


de DNA so inseriial com uma endonuclearesulta em fragmen. A ligao realizada de
inserto de DNA possua o taos cosmdeos recombiento, utilizados para infecformadas. Em vez disso, as
ias resistentes ao antibitico
deos lineares no-recomcabeas de

1".

6.5 Vetores para outras bactrias


fragmentos de DNA mui. {Jm vetor de substituio,
alguns cosmdeos podem
mximo do inserto de cerca
os vetores Ml3.
ignifica que bibliotecas ge.
conjunto de clones recombi-

Vetores de clonagem tambm foram desenvolvidos para vrias outras espcies de bactrias,
incluindo Streptomyces, Bacillus e Pseudomonas. Alguns desses vetore\ so baseados em
plasmdeos especficos para o organismo hospedeiro, enquanto outros so iriasmdeos de ampla faixa de hospedeiro, capazes de replicar em uma variedade de hospedeiros bacterianos.
Uns poucos so derivados de bacterifagos especficos para esses organismos. A maioria desses vetores muito semelhante aos vetores de E. coli em termos de objetivos gerais e de utilizaes.

idual. Uma biblioteca genG


forma que qualquer gene
genmicas podem ser mantid,e

podem ser enviadas de um

Tabela 6.L Nmero de clones necessrio para bibliotecas genmicas em uma variedade de
organismos

biblioteca genmica? A resNmero de clones'

idade de um gene qualquer


idos no vetor, e b o amassrio para bibliotecas geum vetor de substituio de
de milhares de clones, e
desejado (Captulo 8 I poa que bibliotecas genmientanto, maneiras paa se re-

Tamanho do
genoma (pb)

Fragmentos

Espcies

de 17 kb

Fragmentos
de 3-5 kb'

E. coli

4,6

x IO6
1,8 x 107

820

4to

3.225

1.500

1,2

10.000

100.000

49.000

Homem

x 108
x 108
3,2x l}e

21.500

5,7

564.000

274.000

Sapo

2,3

4.053.000

1.969.000

S accharomy c e

ce

rev

isiae

Dros ophila me lanogaster

Arroz

l01o

" Calculado para uma probabilidade (P) de 957o de que um gene qualquer estar presente na biblioteca.
'Fragmentos adequados paa um vetor de substituio, tal como }"EMBL4.
'Fragmentos adequados para um cosmdeo.

CLoruneev Gucn e ANLrsE oe

DNA

137

os cosmdeos no possuem

duzir o nmero de clones necessrio para uma biblioteca genmica esto continuamente sen-

colnias so formadas em

do procuradas.
Uma soluo est no desenvolvimento de novos vetores de clonagem, capazes de suportar
insertos de DNA longos. Durante os ltimos anos, os progressos nessa rea foram centralizados nos cromossomos artificiais bacterianos (BACs, do ingls bacterial artificial chromosomes), os quais so vetores modernos baseados no plasmdeo F (p. 29). O plasmdeo F relativamente grande e os vetores dele derivados tm uma capacidade maior do que os vetores
plasmidiais normais. Os BACs podem sustentar insertos de DNA de at 300 kb de tamanho,
reduzindo o tamanho de uma biblioteca genmica humana para somente 30.000 clones. Outros vetores de alta capacidade foram construdos a partir do bacterifago Pl, o qual possui a
vantagem, em relao a , de ser capaz de comprimir 110 kb de DNA dentro da sua estrutura
de capsdeo. Vetores do tipo cosmdeos, baseados em P1, foram projetados e utilizados para
clonar fragmentos de DNA variando em tamanho desde 15 at I00 kb. Os vetores que combinam as caractersticas de vetores de Pl e BACs, chamados cromossomos artificiais derivados de Pl (PACs, do ingls PI-derived artificial chromosomes), tambm possuem a capacidade de at 300 kb.

como segue (Figura 6.19b).


de DNA so inseriial com uma endonuclearesulta em fragmen. A ligao realizada de
inserto de DNA possua o taos cosmdeos recombiento, utilizados para infecformadas. Em vez disso, as
ias resistentes ao antibitico
deos lineares no-recomcabeas de

1".

6.5 Vetores para outras bactrias


fragmentos de DNA mui. {Jm vetor de substituio,
alguns cosmdeos podem
mximo do inserto de cerca
os vetores Ml3.
ignifica que bibliotecas ge.
conjunto de clones recombi-

Vetores de clonagem tambm foram desenvolvidos para vrias outras espcies de bactrias,
incluindo Streptomyces, Bacillus e Pseudomonas. Alguns desses vetore\ so baseados em
plasmdeos especficos para o organismo hospedeiro, enquanto outros so iriasmdeos de ampla faixa de hospedeiro, capazes de replicar em uma variedade de hospedeiros bacterianos.
Uns poucos so derivados de bacterifagos especficos para esses organismos. A maioria desses vetores muito semelhante aos vetores de E. coli em termos de objetivos gerais e de utilizaes.

idual. Uma biblioteca genG


forma que qualquer gene
genmicas podem ser mantid,e

podem ser enviadas de um

Tabela 6.L Nmero de clones necessrio para bibliotecas genmicas em uma variedade de
organismos

biblioteca genmica? A resNmero de clones'

idade de um gene qualquer


idos no vetor, e b o amassrio para bibliotecas geum vetor de substituio de
de milhares de clones, e
desejado (Captulo 8 I poa que bibliotecas genmientanto, maneiras paa se re-

Tamanho do
genoma (pb)

Fragmentos

Espcies

de 17 kb

Fragmentos
de 3-5 kb'

E. coli

4,6

x IO6
1,8 x 107

820

4to

3.225

1.500

1,2

10.000

100.000

49.000

Homem

x 108
x 108
3,2x l}e

21.500

5,7

564.000

274.000

Sapo

2,3

4.053.000

1.969.000

S accharomy c e

ce

rev

isiae

Dros ophila me lanogaster

Arroz

l01o

" Calculado para uma probabilidade (P) de 957o de que um gene qualquer estar presente na biblioteca.
'Fragmentos adequados paa um vetor de substituio, tal como }"EMBL4.
'Fragmentos adequados para um cosmdeo.

Cnpruto 7

ion of new cloning vectors. IL


is packageable in vitro in

Vetores de Clonagem para Eucariotos

75.4242-6.
plasmids. Nucleic Acids
vectors carrying polylinker

propagation of large human


t 1984) Eftctent in

vitro

ning a bacteriophage SP6


clonado em um plasmdeo do

in single-stranded
-78. [Vetores Ml3.]
300 kilobase-pair fragments of
the National Academy of Sc
and recoveru of DNA
Sciences of the USA, 87,103-7Yectors and host strains:

Vetores para leveduras e outros ngos, I 39


Vetores de clonagem para pantas superiores, 148

Vetores defuragem para animais, 157

A maioria dos experimentos de clonagem realizada tendo como organismo hospedeiro E


coli, e a maior variedade dos vetores de clonagem que est disponvel para esse organismo.
particularmente popular quando o objetivo do experimento de clonagem estudar
as caractesticas bsicas da biologia molecular, tais como a estrutura e a funo do gene. No
entanto, sob certas circunstncias, pode se tornar desejvel autilizao de um hospedeiro diferente para um experimento de clonagem. Isso especialmente verdadeiro em biotecnologia
(Captulo 13), na qual o objetivo pode no ser o estudo de um gene, mas a utilizao da clonagem para controlar ou melhorar a sntese de um produto metablico importante (por exemplo, um hormnio, tal como a insulina) ou para modificar as propriedades de um organismo
(por exemplo, introduzir a resistncia a herbicida em uma planta cultivvel). Devemos, portanto, considerar os vetores de clonagem para organismos diferentes de E. coli.

A E. coli

Vetores para leveduras e outros fungos


A levedura Saccharomyces cerevisiae um dos organismos mais importantes

na biotecnologia.

Assim como seu papel na fabricao de cerveja e na produo de po, a levedura tem sido utilizada como hospedeiro para a produo de importantes compostos farmacuticos, a partir de genes clonados (p.29I). O desenvolvimento de vetores de clonagem para levedura foi grandemente estimulado pela descoberta de um plasmdeo presente na maioria das linhagens de S. cerevisiae (Figrxa 7.1). O plasmdeo de 2 ytn, como ele chamado, constitui-se em um dentre uma
quantidade bastante limitada de plasmdeos encontrados em clulas eucariticas.

14O

T.A. Bnown

FLP

Figura 7.1
O plasmdeo de 2 pm de levedura. REP| e REP2 esttu
envolvidos na replicao do plasmdeo, e FLPcodifica
uma protena que pode converter a orma A do plasm
deo (mostrada aqui) para a orma B, na qual a ordem
dos genes oi reorganizada pela recombinao intrarnolecular. A uno de D no exatamente conhecida.

7.1.1 Marcas de seleo para o plasmdeo de 2 Frm


O plasmdeo de 2 pm , de fato, uma excelente base para um vetor de clonagem. Ele
kb de tamanho, o que ideal para um vetor, e existe na clua de levedura em nmero de
pias entre 70 e 200. A replicao utriliza a origem de replicao do plasm, rias enzir
fornecidas pela clula hospedeira, alm das protenas codificadas pelos g6nes REPl e Rl
presentes no plasmdeo
No entanto, tudo no perfeitamente direto na utilizao do plasmdeo de 2 pm como
vetor de clonagem. Primeiro, existe a questo da marca de seleo. Alguns vetores de
gem para levedura contm genes que conferem resistncia a inibidores, tais como me
to e cobre, mas a maioria dos vetores populares faz uso de um tipo radicalmente diferente
sistema de seleo. Na prtica, um gene de levedura normal utilizado, geralmente um
que codifica uma enzima envolvida na biossntese de aminocidos. um exemplo o
LEU2, que codifica B-isopropil-malato-desidrogenase, uma das enzimas envolvidas na
verso de cido pivico a leucina.
A fim de llizar LEU2 como marca de seleo, um tipo especial de organismo
ro necessrio. o hospedeiro deve ser um mutante auxotrfico, que possui um gene
no-funcional. Tal levedura leu2- incapaz de sintetizar leucina e pode sobreviver some
esse aminocido for fornecido como um nutriente no meio de crescimento (Figura 7.2a). A
leo possvel porque os transformantes contm um plasmdeo que carrega uma c
gene LEU2, e, assim, so capazes de crescimento na ausncia do aminocido. Em um
mento de clonagem, as clulas so espalhadas em meio mnimo (ao qual no foi adici
qualquer aminocido). Somente clulas transformadas so capazes de sobreviver e formar
lnias (Figura7.2bt.

72
o

[.8.t2

l[Ia

@se
!m

epissmico

7.'|..2 Vetores baseados no plasmdeo de 2 pm: plasmdeos


epissm icos para levedura
os vetores derivados do plasmdeo de 2 pm so chamados de plasmdeos epissmicos
levedura (YEps, do ingls yeast episomal plasmids).Alguns yEps contm o plasmdeo
pm inteiro, outros incluem somente a sua origem de replicao. um exemplo desse lti
po YEpl3 tFigura 7.3;.

OYEpl3

apr

Primirc. ele u
tde

replicao de

ra de pBR322. e

Crorunev GNrcA

E ANLrsE oE

DNA

141

(a) Levedura leu2-

REP| e REP2 esto


e.FLP codiica

atorm{A do plasm

O meio deve conter


leucina

B, na Qgal a ordem
Cromossomos - ausncia
do gene LEU2

recombina]o intrame

(b) Utilizando LEU2 como uma marca de seleo

Transormar levedura

Frgiura7.2
de clonagem. Ele poss
lel'edura em nmero de

plasmdeo, virias enzi


pelosgenes REP| e

gle

r@mo Uma

de se-

em um
.

^\ -\

LEU2

Somente clulas transformadas


podem sobreviver

Vetor - carrega
o gene LEU2 correlo

de 2 pm como
Alguns vetores de

Meio mnimo

sem leucina

radicalmente diferente
izado, geralmente um
. Um exemplo o
imas envolvidas na

que possul um gene


sobreviver somente
imento (Figura 7 .2a). A
que cilega uma cpia
ninocido. Em um exor
(ao qual no foi adic
de sobreviver e formar

@e

contm o plasmdeo dc
exemplo desse ltimo

10,7

kb

ori

DNAdepBR322
DNA de 2

- t/'

zz

pLm

DNA do cromossomo

de levedura

Figura 7.3
epissmico de levedura, YEp13.

OYEp13 apresenta vrias caractesticas gerais dos vetores de clonagem para levedura.
Primeiro, ele um vetor de transferncia (do ingls shuttle vector). Assim como a origem
de replicao de 2 pm e o gene de seleo LEU2, o YEp13 tambm possui a seqncia inteira de pBR322, e pode, portanto, replicar e ser selecionado tanto em levedura qtanto em E. co-

142

T. A. Bnowlr

Ii,1g1tvrias linhas de raciocnio subjacentes utilizao de vetores de transferncia. Uma


dessas que pode ser difcil recuperar a molcula de DNA recombinante de uma colnia de
levedura transformada. Isso no um grande problema com YEps, os quais esto presentes

em clulas de levedura primeiramente como plasmdeos, mas com outros vetores para levedura, que podem integrar-se em um dos cromossomos da levedura (p. 1a3), a purificao pode ser impossvel. Isso uma desvantagem porque, em muitos experimentos de clonagem, a
purificao do DNA recombinante essencial para identificao da construo correta por intermdio, por exemplo, do seqenciamento do DNA.
O procedimento-padro para clonagem em levedura , portanto, realizar o experimento de
clonagem inicial com E coli e selecionar recombinantes nesse organismo. Os plasmdeos recombinantes podem, ento, ser purificados, caracterizados, e a molcula correta introduzida
na levedura (Figura 7.4).

a definio

vetor como

no DNA cror
entre o gene
do plasmdo
permanecer
ja excisado r

7.1.4 Outros tiP

Alm dosY

destacando-t

(1)

7.1.9 UmYEp pode se inserir no DNA cromossmico da levedura

Plasm

ba
YIp5
orotidi
so

A palavra "epissmico" indica que umYEp pode replicar como um plasmdeo independentq
mas tambm implica que a integrao em um dos cromossomos da levedura podqocorrer (ver

sinttir
mente
j que

breviv

Molculas de YEpl3 recombinantes

o oc

(2)
O recombinante

Plasm

so ca
seqr

desejado \

origen

cluind
7.6b) t

TRPl

Vetor religado
Meio com ampicilina

Extrair o DNA de vrios clones,


identiicar a molcula correta

Transformar levedura

Levedura recombinante

Meio mnimo
sern leucina

ltrcombinao entre
LEU2plasmidial e d

sorno pode integrar


!D{A cromossmico t
ra Aps a integraF
duas cpias do
m$malmente uma t
a outE

Figura 7.4
Clonagem com um vetor de transerncia

E colr-levedura, tal comoYEpl3'

Cr-orunceu

Fm outros vetores para lt


1., tp. t+S), a purificao
de clonagem,

reahzar o experimento
Os plasmdeos
ula correta i

levedura

e ANLtsE oe

DNA

143

a definio de "epissomo" na pgina 27). Aintegrao ocorre porque o gene carregado pelo
vetor como marca de seleo extremamente homlogo verso mutante do gene presente
no DNA cromossmico da levedura. ComYEpl3, por exemplo, a recombinao pode ocoffer
entre o gene LEU2 do plasmdeo e o gene LEU2 mutante da levedura, resultando na insero

llores de transferncia. U
inbinante de uma colnia
fos, os quais esto

construo correta por

Glrcr

do plasmdeo inteiro em um dos cromossomos da levedura (Figura 7.5). O plasmdeo pode


permanecer integrado, ou um evento de recombinao mais tardio pode fazer com que ele seja excisado novamente.

Outros tipos de vetores de clonagem para levedura


Alm dos YEps, h vrios outros tipos de vetores de clonagem utilizados com S. cerevisae,
destacando-se os segunites

(1)

plasmdeo i
levedura pode ocorrer (

(2)

Plasmdeos integrativos para levedura (YIps, do ingls yeast integrcttive plasmids)


so basicamente plasmdeos bacterianos que contm um gene de levedura. Um exemplo
YIp5, que pBR322 com um gene URA3 inserido (Figura 7.6a). Esse gene codifica
orotidina-5'-fosfato-decarboxilase (uma enzima que cataisp um dos passos da rota biossinttica para nucleotdeos de pirimidina) e utllizadolmo marca de seleo exatamente da mesma maneira como LEU2. UmYIp no pode replicar como um plasmdeo,
j que ele no possui qualquer pedao do plasmdeo de 2 pm, e, em vez disso, a sua sobrevivncia depende da sua integrao no DNA cromossmico da levedura. A integrao ocorre exatamente conforme descrito para umYEP (Figura 7.5).
Plasmdeos replicativos para levedura (YRps, do ingls yeast replicative plasmids)
so capazes de multiplicarem-se como plasmdeos independentes, pois possuem uma
seqncia de DNA cromossmico que inclui uma origem de replicao. Sabe-se que as
origens de replicao esto localizadas muito prximas a vrios genes de levedura, incluindo um ou dois que podem ser utilizados como marcas de seleo. YRpT (Figura
L6b) um exemplo de um plasmdeo replicativo, composto de pBR322, alm do gene
TRPI de levedura. Esse gene, que est envolvido na biossntese do triptofano, localiza-

Meio com ampicilina

YEpl3

\r-euz

f,
\
Figura 7.5
entre os genes
plasmidial e do cromoswno pode integrar YEp13 no
cromossmico da leveduRAps a integrao existem
las cpias do gene LEUZ
uma funcional e
a outra, mutada.

LEU2

muado

Recombinao

LEU2
--u'>>t&

LEU2

t--J
DNA plasmidial

da levedura

144

T.A. Bnowu

clonado, j
do produt,
Ento,
combinan
cromosso
binantes c
quando as

(a)Ylp5
URAs

YEp

apre:

plasmder

ltimos

ar

ge que as

em cultur

)
(b)YRp7

7,1.5 Cromost
de longc

O ltimo
cial de le
nova pir
bsica so

TRPl

nentes fu

Oc

(1)

dos

(2)
Figura 7.6
UmYlp e umYRP.

Doi

sri
cro:

(3)

As
ca

seadjacenteorigemdereplicaodocromossomo.ofragmentodeDNAdelevedura
presente emYRpT contm tanto TRP| quanto a origem'
de vetor para levedura o
Trs fatores devem ser considerados na deciso de qual tipo
o primeiro desses a fre'
clonagem.
mais adequado para um determinado experimento de
passveis de serern
de
transformantes
qncia e transformao, uma medid do nmero
elevada
transformao
de
obtidos por micrograma de DNA plasmidial. uma freqncia
pouco
existe
se
ou
imprescindvel,
necessria se um nmero grande e recombinantes
entre
fornecendo
elevada,
mais
DNA inicial. YEps possue a freqncia de transformao
produtivos'
bastante
so
tambm
10.000 e 100.000 clulas transformadas por pg. YRps
rende menos que 1'000
dando entre 1.000 e 10.000 transformantes por pg, mas umYIp
especiais seprocedimentos
que
transformantes por pg, quase que somente 1 a 10, a menos
necessidada
o
fato
reflete
YIp
jam utilizador. Uuiiu ireqtincia de transformao de um
uma cem
retido
ser
possa
vetor
de da ocorrncia do raro evnto de integrao, antes que o

lula de levedura.

cpias: 2O a50 e 5 a lOQ


Ademais, YEps e YRps tambm apresentam o maio. nmero de
apenas uma cpia por
com
presente
urt., um Yp est usualmente
respectivamente. Em
"ont
a partir do gene
protena
da
clula. Tais nmeros so important*t i" o objetivo a obteno

Uma

de que o:

combina

artificial.
vrias ce

tihcial,

Ct-onneeu Gr.ircn e AnusE oe

DNA

145

clonado, j que com um maior nmero de cpias do gene, maior ser o rendimento esperado
do produto protico.
Ento, por que algum haveria de desejar utilizar um YIp? Porque os YIps produzem recombinantes muito estveis, uma vez que a perda de um YIp que tenha se integrado em um
cromossomo ocolTe somente em uma freqncia extremamente baixa. Por outro lado, recombinantes de YRp so muito instveis, com os plasmdeos tendendo a reunir-se na clula-me
quando as clulas-filha brotam, de forma que estas so no-recombinantes; recombinantes de
YEp apresentam os mesmos problemas, embora um melhor entendimento sobre a biologia do
plasmdeo de 2 trtm tenha permitido que YEps mais estveis tenham sido desenvolvidos nos
ltimos anos. Apesar disso, umYlp o vetor de escolha se a necessidade do experimento exige que as clulas recombinantes de levedura devam reter o gene clonado por longos perodos
em cultura.

7.1,5 Gromossomos artificiais podem serruilizados para a clonagem


de longos pedaos de DNA em levera
O ltimo tipo de vetor de clonagem para levedura a ser considerado o cromossomo artiicial de levedura (YAC, do ingTs yeast artifical chromosome), uma abordagem totalmente
nova pra a clonagem gnica. O desenvolvimento dos YACs foi um subproduto da pesquisa
bsica sobre a estrutura dos cromossomos eucariticos, trabalho que identificou os componentes fundamentais de um cromossomo como sendo (Figura 7.7):

(1)
(2)

(3)

to de DNA de levedure

de vetor para levedura o

0 primeiro

desses a fre'
tes passveis de serem

de transformao elevada
ildvel, ou se existe pouco
elevada, fornecendo entre
so bastante produtivos,

O centrmero, o qual necessrio para os cromossomos serem corretamente distribudos para as clulas-filhas durante a diviso celular.
Dois telmeros, as estruturas nas extremidades de um cromossomo, as quais so necessrias para as extremidades serem replicadas corretamente, alm de impedirem que o
cromossomo seja degradado por exonucleases.
As origens de replicao, que so posies ao longo do cromossomo, nas quais a replicao do DNA inicia. similares origem de replicao de um plamdeo.

Uma vez que a estrutura do cromossomo tenha sido assim definida, surgiu a possibilidade
de que os componentes individuais pudessem ser isolados por meio de tcnicas de DNA recombinante e, depois, reunidos novamente em um tubo de ensaio, criando um cromossomo
artificial. Como as molculas de DNA presentes nos cromossomos naturais de levedura tm
vrias centenas de quilobases de comprimento, tornou-se possvel, com um cromossomo artificial, a clonagem de pedaos de DNA bastante extensos.

Telmero

rende menos que 1.0fi!


procedimentos especiais sereflete o fato da necessidapossa ser retido em uma cPosies das

de cpias: 2O a5O e 5 a 108


com apenas uma cpia pm
da protena a partir do genc

origens de replicao

Figura7.7
Estrutura do cromossomo.

Telmero

146

T. A. Bnowlr

A estrutura e a utilizao de um vetorYAC


Vrios vetores YAC foram desenvolvidos, mas cada um construdo seguindo as mesmas linhas,
com pYAC3 constituindo-se em um exemplo tpico (Figura 7.8a). primeira vista, pYAC3 no
se paece muito com um cromossomo artificial, mas, com uma avaliao mais cuidadosa, suas
caractersticas nicas tomam-se aparcntes. O pYAC3 essencialmente um plasmdeo pBR322.
no qual uma certa quantidade de genes de levedura foi inserida. Dois desses genes, UR3 e
TRPl,i,haviam sido descobertos como marcas de seleo paraYIp5 eYRp7, respectivamente. Como emYRpT, o fragmento de DNA que contm TRPI tambm contm uma origem de
replicao, mas, em pYAC3, esse fragmento foi prolongado ainda mais para incluir a seqncia chamada CEN4, a qual contm o DNA da regio do centrmero do cromossomo 4. O fragmento ZrRPl-oigem-CEN4, portanto, contm dois dos trs componentes do cromossomo arti-

hcial.
O terceiro componente, os telmeros, fornecido pelas duas seqncias chama$as I'L.
Essas no so por si prprias seqncias telomricas completas, mas, uma vez no inQrior do
ricleo da levedura, atuam como seqncias de disseminao, sobre as quais os telmdos po-

dem ser con


mencionada
o experimer

estrat(

mente cliva
mentos. O fi
qncia ZEI

des cegas (5

TACGTA),

o de proto
de S. cerevi

ura3,que
Os transfom

nimo, no qu
so capazes

to, contendo

crescer em n

to de DNA r
qual realiz
lnias vermr

(a) pYAC3

Aplicac
SUP4

O estmulo i
levedura, os
mento dos c
meiose. Tais
te a propaga

11,4 kb

utilizados cc
mento em ul

que 100 kb d
muito alm r
(p. 136), ma
abriram um I
anteriorment
nante. Uma
de que, sob i
ros, permitit
mente encr
Os cromr

BamP'l

(b) A estratgia de clonagem com pYAC3

Clivaoem com
Baml + SnaBl

\
e--w-J
Brao
BamHl

esquerdo

BamHl

I r

Brao direito

nmicas. k
ra os vetorer

Ligao com um inserto


de DNA com extremidades cegas

UBAS

TEL TRPlori-CEN

|-WZ

I r_D

DNA inserido

TEL

uma bibliote

Figura 7.8

lizados para

UmvetorYACeamaneia

at 1.400 kb
humana pari
mas de instal
dos pela recc

como ele utilizado para a


clonagem de pedaos de
DNA extensos.

Ct-ouneeu Grurce e ANLtsE oE DNA

r:eguindo as mesmas linhas"


\ primeira vista, pYAC3 no
iao mais cuidadosa, suas
te um plasmdeo pBR32f
Dois desses genes, UR3 e

il1p5 e YRp7, respectivamencontm uma origem de


mais para incluir a seqndo cromossomo 4. O fragdo cromossomo art!
seqncias chamadas ZEL
ms, uma vez no interior do
as quais o1:elrneros po-

147

dem ser construdos. Isso tudo deixa somente uma outra parte de pYAC3 que no foi ainda
mencionada: SUP4, que a marca de seleo, dentro da qual o DNA novo inserido durante
o experimento de clonagem.
A estratgia de clonagem com pYAC3 como se segue (Figura 7.8b). O vetor primeiramente clivado com uma combinao de BamHI e SnaBI, cortando a molcula em trs fragmentos. O fragmento de BamHI removido, deixando dois braos, cada um ligado a uma sqncia TEL e a um stio de SnaBI. O DNA a ser clonado, o qual dever possuir extremidades cegas (SnaBI uma enzima que produz extremidades cegas, reconhecendo a seqncia
TACGTA), ligado entre os dois braos, produzindo o cromossomo artificial. A transformao de protoplastos (p. 110) , ento, utilizada para introduzir o cromossomo artificial dentro
de S. cerevisiae. Alinhagem de levedura utilizada um duplo mutante auxorrco, trpl
ura3- , que convertido a trpl' ura' pelas duas marcas de seleo do cromossomo artificial.
Os transformantes so, portanto, selecionados por intermdio do plaqueamento em meio mnimo, no qual sdt1e19 as clulas contendo o cromossomo artificial corretamente construdo
so capazes de crescer. Qualquer clula transformada com um cromossomo artificial incorreto, contendo dois braos esquerdos ou dois direitos, emyez de um de cada, no ser capaz de
crescer em meio mnimo, pois uma das marcas de seleo estar ausente. A presena do inserto de DNA no vetor pode ser conferida pelo teste para a inativao por insero de SUP4, o
qual realizado por um simples teste de colorao: colnias brancas so recombinantes, colnias vermelhas no o so.

Aplicaes para os vetoresYAC

Figura 7.8
Um vetorYAC e a
como ele utilizado para
clonagem de pedaos de
DNA extensos.

O estmulo inicial para o desenvolvimento de cromossomos artificiais veio de geneticistas de


levedura, os quais desejavam utiliz-los para estudar vrios aspectos da estrutura e comportamento dos cromossomos, por exemplo, examinar a segregao dos cromossomos durante a
meiose. Tais experimentos determiniram que os cromossomos artificiais so estveis durante a propagao em clulas de levedura e sugeriram a possibilidade de que eles poderiam ser
utilizados como vetorgs para genes muito extensos paa serem clonados como um nico fragmento em um vetor para E. coli. Diversos genes importantes de mamferos so maiores do
que 100 kb de comprimento (por exemplo, o gene para fibrose cstica humano possui 250 kb),
muito alm da capacidade de todos e dos mais sofisticados sistemas de clonagem em E. coli
(p. 136), mas bem dentro do alcance de um vetorYAC. Os cromossomos artificiais, portanto,
abriram um caminho para os estudos das funes e maneiras de expresso de genes,que eram,
anteriormente, considerados impossveis de analisar por meio de tcnicas de DNA recombinante. Uma nova dimenso desses experimentos foi recentemente fornecida pela descoberta
de que, sob algumas circunstncias, os YACs podem ser propagados em clulas de mamferos, permitindo que a anlise funcional seja realizada no organismo no qual o gene normalmente encontrado.
Os cromossomos artificiais so igualmente importantes na produo de bibliotecas genmicas. Lembre-se de que, com fragmentos de 300 kb, o tamanho mximo do inserto para os vetores de E. coli de maior capacidade, cerca de 30.000 clones so necessrios para
uma biblioteca genmica humana (p. 1 37). No entanto, vetores YAC so rotineiramente utilizados para clonar fragmentos de 600 kb, e tipos especiais so capazes de suportar DNA de
at 1.400 kb de extenso, estes ltimos diminuindo o tamanho de uma biblioteca genmica
humana para somente 6.500 clones. Infelizmente, esses "mega-YACs" apresentam problemas de instabilidade do inserto, pois os DNA clonados algumas vezes tornam-se rearranjados pela recombinao intramolecular. Entretanto, YACs tm sido de enorme valor pelo for-

l,

rl

148

T. A. Bnowlr

necimento de extensos pedaos de DNA clonado, que so utilizados, em larga escala, em


projetos de seqenciamento de DNA.

7.1.6 Vetores para outras leveduras e fungos


Vetores de clonagem para outras espcies de levedura e fungos so necessrios pra estudos
bsicos da biologia molecular desses organismos e para estender as possveis utilizaes de
leveduras e fungos na biotecnologia. Plasmdeos epissmicos baseados no plasmdeo de 2 pm
de S. cerevisiae so capazes de replicar em alguns poucos outros tipos de leveduras, mas a extenso no ampla o suficiente pra os vetores de 2 pm serem de utilidade geral. Em qualquer
caso, as necessidades da biotecnologia so mais bem satisfeitas pelos plasmdeos integrativoq
equivalentes aosYlps, uma vez que eles fornecem recombinantes estveis que podem ser multiplicados por perodos longos em biorreatores (p.277). Vetores integrativos eficientes esto
agora disponveis para um certo nrpero de espcies, incluindo leveduras, tais como Pichia
pastoris e Kluveromyces lqctis, aln{ dgs fungos filamentosos Aspergillus nidulans e Neurospora crassa.

7.2 Vetores de clonagem para plantas superiores


Os vetores de clonagem para plantas superiores foram desenvolvidos na dcada de 1980 e a
sua utilizao originou as culturas geneticamente modificadas (GM, do ingls geneticallt
modified crops), que esto em evidncia atualmente. As modificaes genticas das plantas
cultivveis e de outras plantas sero examinadas no Captulo 15. Aqui sero vistos os vetores
de clonagem e como so utilizados.
Trs tipos de sistemas de vetores tm sido empregados, com uma graduao variada de sucesso, com plantas superiores:

(1)
(2)
(3)

Vetores baseados nos plasmdeos que o'correm naturalmente em Agrobacterium.


Transferncia gnica direta utilizando diversos tipos de DNA plasmidial.
Vetores baseados nos vrus de plantas.

7.2.1 Agrobacterium tumefaciens: o menor engenheiro gentico


da natureza
Embora nenhum plasmdeo de ocorrncia natural seja conhecido em plantas superiores, um
plasmdeo bacteriano, o plasmdeo Ti de Agrobacterium tumefaciens, de grande importncia.
O A. tumefaciens w microrganismo do solo, que carsa a doena do tumor de galhe
(crown gall disease) em muitas espcies de plantas dicotiledneas. A doena do tumor de galha ocorre quando um ferimento no caule permite s bacterias A. tumefaciens invadirem a
planta. Aps a infeco, as bactrias induzem uma proliferao cancerosa do tecido do caule
na regio do tumor (Figura 7.9).
A capacidade para induzir a doena do tumor de galha est associada com a presena do
plasmdeo Ti (indutor de tumor, do ingls tumor inducing) dentro das clulas bacterianas. Esse um plasmdeo grande (com mais de 200 kb) que contm numerosos genes envolvidos no
processo infectivo (Figura 7.10a). Uma caracterstica extraordiniria do plasmdeo Ti que,
aps a induo, parte da molcula integrada no DNA cromossmico da planta (Figurrr
7.10b). Esse segmento, chamado T-DNA, possui entre 15 e 30 kb de tamanho, dependendo da

Figura 7.9
A doena do tumor

de galha.

linhagem. Ele t

lhas como par


plasmdeo Th
tal, alm de sel
Tais genes taml
bactrias utiliz:
te programa as

Utilizando o
clula vegd
Muito rapidarn

vos genes no in
nes dentro do l

cromossmico
porque o grand

O principal
de em um plasr
a

insero de

(1)

A estrat

DNA

no

Cloneoev Grurcn e ANLrsE oe

DNA

149

zados, em larga escala, em


Planta saudvel

so necessrios para estudofi

r as possveis utilizaes dc
no plasmdeo de 2 pm
ripos de leveduras, mas a exutilidade geral. Em qualquer
pelos plasmdeos integrativoc,
esveis que podem ser mulintegrativos efi cientes esto
leveduras, tais como
nidulans e Ne

vidos na dcada de 1980


(GM, do ingls

Bactria invade
o erimento

Agrobactria

Divises celulares
rpidas-tumor de galha

de galha
e

genticas das
.

Aqui sero vistos os ve

Figura 7.9

ftdoena do tumor
uma graduao variada de

de galha.

em Agrobacterium.
.A plasmidial.

linhagem. Ele mantido de uma forma estvel na clula da planta e transmitido s clulas-filhas como pae integrante dos cromossomos. Porm, a caracterstica mais extraordinria do
plasmdeo Ti que o T-DNA contm oito ou mais genes que so expressados na clula vegetal, alm de serem responsveis pelas propriedades cancergenas das clulas transformadas.

gentico

Tais genes tambm comandam a sntese de compostos incomuns, chamados de opinas, que as
bactrias utilizam como nutrientes (Figura 7.10c). Em resumo, o A. tumefaciens geneticamente programa as clulas da planta pila seu prprio benefcio.

em plantas superiores,
, de grande i
a doena do tumor de
A doena do tumor de
A. tumefocierzs invadirem
cancerosa do tecido do
associada com a presena
das clulas bacterianas.

genes envolvidor

do plasmdeo Ti

ico da planta

de tamanho, depende

Utilizando o plasmdeoTi para introduzir novos genes em uma


clula vegetal
Muito rapidamente foi percebido que o.plasmdeo Ti poderia ser utilizado para introduzir novos genes no interior de clulas vegetais. Tudo que seria necessrio seria inserir os novos genes dentro do T-DNA e, ento, abaciriarealizaria o trabalho rduo de integr-los no DNA
cromossmico da planta. Na prtica, isso demonstrou ser uma proposta enganosa, sobretudo
porque o grande tamanho do plasmdeo Ti dificulta a manipulao da molcula.
O principal problema , obviamente, que um stio de restrio nico uma impossibilidade em um plasmdeo de 200 kb de tamanho. Estratgias modernas foram desenvolvidas para
a insero de um DNA novo dentro do plasmdeo Ti. Duas so, em geral, utilizadas:

(1)

A estratgia dos vetores binrios (Figura 7.1 l) est baseada na observao de que o TDNA no necessita estar fisicamente ligado ao restante do plasmdeo. Um sistema de

150

T.A. Bnown

(a) Um plasmdeoTi
T-DNA (oncogenes)

Regio de
virulncia

Figura 7.11
Regio de especificidade ao hospedeiro

-/l

A estratgia
sentes na r
rido para o I
no plasmde

(b) lntegrao doT-DNA no genoma da planta

dois p

do pla

getais
suem
Recombinao

DNA cromossmico
da planta

r-o-------r

-DNA integrado

bastar
nicas-

(2)

estr

basear

na por

que, s

de intr

tanto,

duzi

combi
ta lev:

(c) Expresso dos genes doT-DNA

nOSS(

T-DNA

DNA da planta

Produr
Se bactria

Figura 7.10

uma planta
lulas do tur
mente, de p
vo gene em
Existem
tura de clu

O plasmdeo Ti e sua integrao no DNA cromossmico da planta, aps a infeco com .


tumefaciens.

ma maneira

Rpida diviso
celular

Sntese de opinas

getais e pro

Croruncev GNrcA

E ANLrs

oe DNA

151

Stio de restrio
nico

Regio de

virulncia
Regio de
especificidade
ao hospedeiro

Plasmdeo A

-170 kb

O
Plasmdeo B

-20

kb

Figura 7.11
ao hospedeiro

A estratgia do vetor binrio. Os plasmdeos A e B complementam um ao outro quando presentes na mesma clula de A. tumeaciens. O T-DNA carregado pelo plasmdeo B transferido para o DNA cromossmico da planta p,!as protenas codiicadas pelos genes presentes
/ '',
no plasmdeo A.
dois plasmdeos, com o T-DNA em uma molcula relativamente pequena, e o restante
do plasmdeo na forma normal, da mesma forma eficiente para transformar clulas vegetais. De fato, algumas linhagens de A. tumefaciens, e agrobactrias relacionadas, possuem sistemas naturais de plasmdeos binrios. O plasmdeo do T-DNA pequeno o
bastante para possuir um stio de restrio nico e ser manipulado utilizando-se de tcnicas-padro.

cromossomrco

(2)

A estratgia da co-integrao (Figura 7.12) ttrliza um plasmdeo inteiramente novo,


baseado no pBR322 ou um vetor pma E. coli semelhante, porm contendo uma pequena poro do T-DNA. A homologia entre a nova molcula e o plasmdeo Ti pressupe
que, se ambos esto presentes na mesma clula de A. tumefaciens, a recombinao pode integrar o plasmdeo pBR dentro da regio do T-DNA. O gene a ser clonado , por-

tanto, inserido dentro de um stio de restrio nico do pequeno plasmdeo pBR, introduzido em clulas de A. tumefaciens qtte contm um plasmdeo Ti, e o processo de recombinao natural permite a integrao do novo gene no T-DNA. A infeco da planta leva insero do novo gene, juntamente com o restante do T-DNA, dentro dos cromossomos da clula vegetal.
da planta

F,
:
I
i

aps a infeco com .

Produo de plantas transormadas com o plasmdeoTi


Se bactrias A. tumefacien. que contm um plasmdeo Ti modificado so introduzidas em
uma planta pela maneira natural, por infeco de um ferimento no caule, ento somente as clulas do tumor de galha resultante iro possuir o gene clonado (Figura 7.13a).Isso , obviamente, de pouco valor para o biotecnologista. Ao contririo, uma maneira de introduzir o novo gene em cada uma das clulas da planta necessria.
Existem vrias solues, a mais simples sendo infectar no a planta madura, mas uma cultura de clulas vegetais ou protoplastos (p. I l0) em meio lquido (Figura 7.13b). Clulas vegetais e protoplastos, cujas paredes celulares foram reconstrudas, podem ser tratados da mesma maneira que microrganismos: por exemplo, eles podem ser plaqueados em um meio sele-

152

T.A.Bnowru

a fim de isolarem-se transformantes. Uma planta madura, regenerada a partir de


transformadas, ir conter o gene clonado em todas as clulas e ir passar o gene clonado
a sua descendncia.
No entanto, a regenerao de uma planta transformada pode ocorrer somente se o vetor
"desarmado",
foi
de forma que as clulas transformadas no apresentam as propriedades
cergenas. O desarmamento possvel porque os genes cancergenos, todos os quais se si
no T-DNA, no so necessrios para o processo infeccioso; a infectividade controlada,
cipalmente, pela regio de virulncia do plasmdeo Ti. De fato, a nica parte do plasmdeo
que est envolvida na infeco so duas seqncias repetidas, de 25 pb, encontradas nas
midades esquerda e direita da regio integrada no DNA da planta. Qualquer DNA
tre essas duas seqncias repetidas ser atado como "T:DNA" e transferido para a planta.
na-se, portanto, possvel remover todos os genes cancergenos de um T-DNA normal e
tu-los com um conjunto inteiramente novo de genes, sem prejuzos ao processo infecciosoNumerosos vetores de clonagem com Ti desarmados esto disponveis atualmente,
exemplo tpico sendo o vetor binrio pBIN19 (Figura 7.14). As et{gmidades esquerda e
reita do T-DNA presentes nesse vetor flanqueiarrruma cpia do {en\lacZ', contendo
rosos stios de clonagem, e um gene para resistncia canamicina, que funciona aps a

tivo,

igua7"13
(b
po

Plasmdeo pequeno
tipo pBR

&

Especificidade ao

\reg

hospedeiro

Fragmento
do T-DNA

s(>

rnor de

'1/=3

'-\
Gene a ser

-zl

'frblTransncr-

una su$
lanbdas
dadata
fans-

I
Plasmdeo
Ti normal

Recombinao

clonado

5nadas-

Virulncia

Gene novo

(a) lnum eri-

_*

Figura7.12
Plasmdeo Ti recombinante

A estratgia

co-integrao

tirbde

paonbre red

Cr-oruncev GNtcA E AruusE oE DNA

pair de clulas
pssar o gene clonado para

re_qenerada a

(a) A ineco de um erimento por . tumeaciens ecombinante

ocorrer somente se o vetor Ti


tam as propriedades can-.
todos os quais se situem
ividade controlada, prina nica parte do plasmdeo fi
5 pb, encontradas nas extreQualquer DNA colocado entransferido para a planta. Torum T-DNA normal e substi
ao processo infeccioso.
disponveis atualmente, nn
extremidades esquerda e digene lacZ', contendo numeque funciona aps a inte-

)]=-

)
Aplicao da bactria

Gene clonado somente est


presente no tumor de galha

fecombinante
(b) Transomao de clulas vegetais em cultura
lnoculao com
A. tumefacens
recombinante

Bactria

@'

Clula
vegetal

Plaqueamento
em meio slido

Clulas vegetais
em suspenso
Calos transormados

Figura 7.13
Transormao de
vegetais por

A-tumeaciensrerwnbinante. (a) ln-

Transerncia para
meio com equilbrio
de hormnios de
crescimento dierentes

Formao de galhos

@o

de um ericlulas vegellds transormadas


presentes soiilrEnte no tumor de
gta. (b) Transorde uma suscelular: todas
culas da planta
so transormadas.

,un," no

*,o

q
NZ
77777-7
Planta transformada

Stios de restrio
Repetio
esquerda

Figura7.12
A estratgia da
co-integrao.

<-''.-1

Figura7.14
iluetor binrio de Ti, pBlN19

. l1s11q

= erl

que conere resistncia canamicina.

Repetio direita

154

T. A. Bnowr.r

grao das seqncias do vetor dentro do cromossomo da planta. Como com o vetor de transferncia de levedura (p. 1a0), as manipulaes iniciais, que resultam na insero do gene a ser
clonado em pBIN19, so realizadas em E coli, amolcula de pBIN19 recombinante correta
, ento, transferida para A. tumefaciens e, depois, para a planta. As clulas vegetais transformadas so selecionadas por plaqueamento em meio gar contendo canamicina.

que ele di
h necessidar

De fato, a int
mossomo da

A transfer

O plasmdeo Ri

mente um pla
leo apropri

Durante os anos, surgiu tambm o interesse no desenvolvimento de vetores de clonagem para plantas baseados no plasmdeo Ri de Agrobacterium rhzogenes. Os plasmdeos Ri e Ti
tm muitas semelhanas, a diferena principal sendo que a transferncia do T-DNA de um
plasmdeo Ri para a planta no resulta em um tumor de galha, mas na doena daraiz cabeluda, caractenzada por uma proliferao massiva de um sistem?radicular altamente ramificado. A possibilidade de crescimento de razes transformadas e\r uma densidade elevada em
cultura lquida tem sido explorada pelos biotecnologistas como uma potencial maneira de ob'
terem-se quantidades elevadas de protenas, a partir de genes clonados em plantas (p.296).

clonado forar
plasmidial pa

Limitaes de clonagem com os plasmdeos de Agrobacterium


As plantas superiores so divididas em duas amplas categorias, as monocotiledneas e as
dicotiledneas. Vrios fatores foram combinados para facilitar a clonagem de genes em dicotiledneas, tais como o tomate, o tabaco, abatata, a ervilha e o feijo, porm muito mais
complicada a obteno dos mesmos resultados com as monocotiledneas. Isso tem sido
frustrante, pois estas incluem o centeio, a cevada, o artoz e o milho, as quais so as plantas

podem ser reg


sivelmente m
Um mtor

leno-glicol,

cr

DNA sobre a
7.16a). Ospn

ra 7.16b) ou c
tas com DNA

Aps o tn
que estimula

meio seletivo
quais plantas

Agrobacteriui

cultivveis mais importantes e, portanto, o alvo mais desejado para projetos de engenharia
genica.

A principal dificuldade resulta do fato de que, na natuteza, A. tumefaciens

A. rhizoge-

nes infectam somente plantas dicotiledneas; as monocotiledneas esto excludas da faixa


de hospedeiros naturais. Durante algum tempo acreditou-se que essa barreira natural era in-

supervel e que as monocotiledneas eram totalmente resistentes transformao com vetores Ti e Ri, mas, finalmente, tcnicas artificiais pararcahzar a transferncia do T-DNA foram
desenvolvidas. Isso, porm, no o final da histria. A transformao com um vetor de Agru>
bacterium normalmente envolve a regenerao de uma planta intacta, a partir de culturas de
protoplastos, clulas ou calos transformados. A facilidade com a qual uma planta pode ser

regenerada depende bastante da espcie em particular envolvida e, mais uma vez, as plantas
mais difceis so as monocotiledneas. Tentativas para solucionar esse problema tm centralizado a utilizao da biobalstica - o bombardeamento com microprojteis (p. 111) - para
introduzir o DNA plasmidial diretamente no interior de embries vegetais. Embora esse seja um processo de transformao bastante violento, ele no aparenta ser to danoso pra os
embries, os quais ainda continuam seu programa de desenvolvimento normal para produzir
plantas adultas. A estratgia tem sido bem-sucedida com o milho e diversas outras monocotiledneas importantes.

7.2.2 Clonagem gnica em plantas pela transerncia direta de genes


A biobalstica mascara a necessidade de utlTizar Agrobacterium como maneira de transferir o
DNA para dentro das clulas vegetais. A transferncia gnica direta entra no processo urn
passo frente e dispensa, em geral, o plasmdeo Ti.

A transferncia gnica direta est baseada na observao, primeiramente realizada em


1984, de que um plasmdeo bacteriano supertorcido, embora incapaz de replicar em uma clula vegetal por si prprio, pode tomar-se integrado, por meio de recombinao, em um cro
mossomo da planta. O evento de recombinao pouco entendido, mas praticamente certo

Figura Z.

furserncia gnica dire

Cloneorv
Como com o vetor de
m na insero do gene a
pBINl9 recombinante
As clulas vegetais

de vetores de clonagem
. Os plasmdeos Ri e

flerncia do T-DNA de
mas na doena

daraiz

radicular altamente rami


uma densidade elevada
uma potencial maneira de

emplantas (p.296)-

Agrobacterium
as monocotiledneas e
a clonagem de genes em
e o feijo, porm muito

iledneas. Isso tem si

ilho,

as quais so as pl
para projetos de en

GNtcA E Ar'rlrse oe

DNA

que ele diferente da integrao de um vetor de levedura no cromossomo (p. 143), pois no
h necessidade de uma regio de homologia entre o plasmdeo bacteriano e o DNA da planta.
De fato, a integrao parece ocoler aleatoriamente em qualquer posio em qualquer cromossomo da planta (Figura 7.15).
A transferncia gnica direta, portanto, faz uso de DNA plasmidial supertorcido, possivelmente um plasmdeo bacteriano simples, tal como pBR322, dentro do qual uma marca de seleo apropriada (por exemplo, o gene que confere resistncia canamicina) e o gene a ser
clonado foram inseridos. A biobalstica freqentemente utilizada para introduzir o DNA
plasmidial para dentro de embries vegetais, mas, se as espcies que esto sendo modificadas
podem ser regeneradas a partir de protoplastos ou clulas nicas, ento outras estratgias, possivelmente mais eficientes que a biobalstica, so possveis.
Um mtodo envolve a ressd,qpenso dos protoplastos em uma soluo viscosa de polietileno-glicol, composto polimrico)-negativamente carregado, que utilizado para precipitar o
DNA sobre as superfcies dos protoplastos e para induzir a entrada por endocitose (Figura
7 .l6a). Os protoplastos tambm podem ser fusionados com lipossomos contendo DNA (Figura7 .l6b) ou clulas intactas podem ser vigorosamente agitadas com agulhas de slica cobertas com DNA, as quais perfuram a parede celular e transferem o DNA para o interior.
Aps o tratamento, os protoplastos so deixados durante alguns dias em uma soluo
que estimula a regenerao das paredes celulares. As clulas, ento, so espalhadas sobre
meio seletivo para identificar transformantes e para fornecer culturas de calos, a partir das
quais plantas intactas podem desenvolver-se (exatamente como descrito para o sistema com
A g ro b act e rium, Figlur a 7. 1 3b).

A. tume.faciens e A. rhi
esto excludas da
essa barreira natural era i
transformao com
com um vetor deg
tacta, a partir de culturas
a qual uma planta pode
e. mais uma vez, as pla
esse problema tm ce
roprojteis (p. 111) vegetais. Embora esse
nta ser to danoso para
imento normal para produzi
e diversas outras

Transformao de
protoplastos vegetais

-.-*
o$ts-

pBR322

supertorcido

Recombinao
no-homloga

direta de genes
como maneira de transferir
direta entra no processo urn

primeiramente realizada en
apaz de replicar em uma crecombinao, em um cr<>
mas praticamente certo

155

Figura 7.15

'lfianserncia gnica

di

reta.

Gene novo inserido


no DNA da planla

156

T. A. Bnowrl
a

do DNA viral sobre

(a) Precipitao de DNA

.
Protoplastos vgetais

DNA
)
)

ria os vrus por toda


O potencial dos'
rios anos, mas sem !
vrus de plantas pos
como possveis vetc
mais difceis de real

riores so conhecidi

condies ideais par

Caulimovrus cr

Embora um dos pri-r


ano de 1984, tenhau
nabo, duas dificuldar
(b) Fuso com lipossomos contendo DNA

A primeira foi
la necessidade de en
regies no-essencia

Protoplasto vegetal

K,
---/
o/
DNA

fca muito limitada- I


blema por meio da u
gomdeos (p. 125). t
da couve-flor (CaM
senciais, o que sienil
prio, comandar a inft
genoma de CavfV n
tor de clonagem seja
Essa abordagem
a extremamente lin
tos de clonagem a so
polhos e couves-flori
tica como fontes de;
so utilizados para a
plasmdeo Ti ou pela

\/

Lipossomos

,a
DNA transferido
para o ncleo

zJ

\J

Lipossomo usionado

Figura 7.16
Transerncia gnica direta por meio de (a) precipitao de DNA na superfcie dos protoplastos,
e (b) uso de protoplastes com lipossomos contendo DNA.

Geminivrus cor

E sobre os geminivl
cluem plantas, tais o
para essas e outras n
tos de dificuldades.

7-2-3 Tentativas para utilizar vrus de plantas como vetores


de clonagem
Verses modificadas dos bacterifagos l, e

Mi3 so vetores de clonagem importantes para E.


maioria das planras est sujeit infeio viral, poderiam, dessa forma, os vrus ser utilizados para clonar genes em plantas? Em caso positivo,
eles
poderiam ser muito mais convenientes para utilizao do que outros tipos de vetres, porque,
com muitos vrus, seria possvel a transformao ser obtida simplesmente por meio Oa ffcao
coli (Captrilo 6). Considerando que

alguns geminivrus
adicional que tenha
quisas nos ltimos e
enontrar aplicaes
cente, previsto para

[3

Vetores de clol

Esforos considerr

clonagem gnica en
sntese de protena

Crounorv

Grurcn e ANLtsE oe

DNA

157

t:

do DNA viral sobre a superfcie de uma folha. O processo de infeco natural, ento, espalharia os vrus por toda a planta.

O potencial dos vrus de plantas como vetores de clonagem vem sendo explorado h vrios anos, mas sem grande sucesso at o momento. Um problema que a grande maioria dos
vrus de plantas possui genomas no de DNA, mas de RNA. Vrus de RNA no so to teis
como possveis vetores de clonagem, pois as manipulaes com RNA so particularmente
mais difceis de realizar. Somente duas classes de vrus de DNA que infectam plantas superiores so conhecidas, os caulimovrus e os geminivrus, mas nenhuma dessas apresenta
condies ideais para a clonagem gnica.

Caulimovrus como vetores

Figura 7.16
Transferncia gnica direta por meio de (a) precipitao de DNA na sw
perf cie dos protoplastos"
e (b) uso de protoplastos com lipossomos corr
tendo DNA.

vetores
rclonagem importantes para

sujeita infeco viral,


lantas? Em caso positivo,
.tros tipos de vetores,
lesmente por meio da f
!
i

Embora um dos primeiros experimentos bem-sucedidos de modificao gentica de plantas, no


ano de 1984, tenha utilizado um vetor de caulimovrus para clonar um novo gene em plantas de
nabo, duas dificuldades gerais com esses vrus limitaram sua utilidade.
A primeira foi que o tamanho total do genoma de um caulimovrus , como , controlado pela necessidade de empacot-lo no interior de seu capsdeo protico. Mesmo aps a deleo de
regies no-essenciais do genoma do vrus, a capacidade para crega um DNA inserido ainda
fica muito limitada. Pesquisas recentes tm mostrado que pode ser possvel solucionar esse problema por meio da utilizao da estratgia do vrus auxiliar, semelhante s utilizadas com os fagomdeos (p. 125). Nessa estratgia, o vetor de clonagem o genoma de um vrus do mosaico
da couve-flor (CaMV, do ingls cauliflower mosaic virus) que no possui vrios dos genes essenciais, o que significa que ele pode carregar um gene longo inserido, mas no pode, ele prprio, comandar a infeco. As plantas so inoculadas com o DNA do vetor, juntamente com um
genoma de CaMV normal. O genoma viral normal forrece os genes necessrios para que o vetor de clonagem seja empacotado pelas protenas virais e espalhado por toda a planta.
Essa abordagem tem um potencial considervel, mas no resolve o segundo problema, que
a extremamente limitada faixa de hospedeiros dos caulimovrus. Isso restringe os experimentos de clonagem a somente umas poucas plantas, principalmente brssicas, tais como nabos, repolhos e couves-flores. Os caulimovrus tm, entretanto, sido importantes na engenharia gentica como fontes de promotores extremamente ativos que funcionam em todas as plantas e que
so utilizados para a obteno da expresso de genes introduzidos por meio da clonagem com o
plasmdeo Ti ou pela transferncia gnica direta.

Geminivrus como vetores


E sobre os geminivrus? So eles interessantes sobretudo porque seus hospedeiros naturais incluem plantas, tais como o milho e o centeio, e eles poderiam, portanto, ser vetores potenciais
para essas e outras monocotiledneas. Mas os geminivrus apresentam seus prprios conjuntos de dificuldades, sendo um dos problemas que, durante o ciclo de infeco, os genomas de
alguns geminivrus sofrem rearranjos e delees, os quais iriam embaralhar qualquer DNA
adicional que tenha sido inserido, uma desvantagem bvia para um vetor de clonagem. Pesquisas nos ltimos anos tm focalizado tais problemas e os geminivrus esto comeando a
encontrar aplicaes especializadas na clonagem em plantas, com um papel importante e crescente, previsto para o futuro.

Vetores de clonagem para animais


Esforos considerveis foram aplicados no desenvolvimento de sistemas de vetores para a
clonagem gnica em clulas animais. Esses vetores so necessrios na biotecnologia para a
sntese de protenas recombinantes a partir de genes que no so expressos corretamente

158

A. Bnowr

quando clonados emE. coli ou levedura (Captulo l3), alm de mtodos para clonagem
em
humanos, que esto sendo procurados por biologistas moleculares clnicos, na tentativa de desenvolver tcnicas para a terapia gnica (p. 31a), na qual uma doena tratadapor meio
dr
introduo de um gene clonado dentro do paciente.
O aspecto clnico sugere que a maior ateno tem sido direcionada aos sistemas de clonagem para mamferos, mas progressos importantes tambm foram obtidos com insetos. A clo.
nagem em insetos interessante, pois utiliza um tipo de vetor completamente novo, o qrrrl
ainda no havia sido encontrado. Iremos, portanto, examinar os vetores para insetos, antes de
frnalizat o captulo com uma viso geral dos mtodos de clonagem utilizados com mamferm"

7.3.1 Vetores de clonagem para insetos


A mosca-das-frutas, Drosophila melanogaster, foi, e ainda , um dos mais importantes org&
nismos-modelo usados pelos bilogos. Seu potencial foi primeiramente reconhecido pelo famoso geneticista Thomas Hunt Morgan, que, em 1910, comeou arealizar cruzamentos genticos entre moscas-das-frutas com coloraes de olhos diferentes e outras caractersticas hereditrias. Tais experimentos conduziram a tcnicas, ainda utilizadas atualmente, para o mapeamento de insetos e outros animais.
Mais recentemente, a descoberta de que os genes de seleo hometica de Drosophila
os genes que determinam a identidade das estruturas corporais da mosca so intimamentc
relacionados aos genes equivalentes em mamferos fez com que a D. melanogasterfosse utilizada como um modelo para o estudo dos processos de desenvolvimento humano. A importncia da mosca-das-frutas na biologia moderna torna imperativo que vetores para a clonagenr
gnica nesse organismo estejam disponveis.

Elementos P como vetores de clonagem para Drosophita


O desenvolvimento de vetores de clonagem p ara Drosophila tem seguido um caminho diferenutilizado com bactrias, levedura, plantas e mamferos. Nenhum plasmdeo coecido em Drosophila e, embora a mosca-das-frutas seja, como todos os organismos, suscetvel
te daquele

infeco por vrus, esses no tm sido empregados como base paa vetores de clonagem.
Ao
contrrio, a clonagem em Drosophila uttlizaum transposon, chamado de elemento p.
Transposons so comuns em todos os tipos de organismos. Eles so pedaos curtos de
DNA (usualmente menores que l0 kb de comprimento), que podem se movir dsuma posio
para outra no cromossomo de uma clula. Os elementos P, os quais so um de virios
tipos de
transposons de Drosophila, possuem 2,9 kb de comprimento e contm trs genes flanqueados
por seqncias curtas, invertidas e repetidas em ambos os lados do elemento (Figura7.l7a)Os genes codificam a transposase, a enzima qu e realizao processo de transposi, e
as repeties invertidas formam as seqncias de reconhecimento, que permitem que a enzima identihque as duas extremidades do transposon inserido.
Assim como se movem de um stio para outro dentro de um nico cromossomo, os elementos P tambm podem saltar entre cromossomos, ou entre um plasmdeo que caega
um

elemento P e um dos cromossomos da mosca (Figura 7.|7b).Esse ltimo evento a chave para a utllizao dos elementos P como vetores de clonagem. O vetor um plasmdeo que
cop
tm dois elementos P, um dos quais contm o stio de insero para o DNA que ir ser
clonado. A insero de um DNA novo dentro desse elemento P resulta na intemrpao
de seu gene
da transposase, de maneira que tal elemento torna-se inativo. O segundo elernento
R presente no plasmdeo, , portanto, aquele que possui a verso intacta do gene da transposas".
A
"ondio ideal que esse elemento P no deva ser transferido para os cromossomo s de Drosophila, de forma que ele tem suas "asas coadas": suas repeties invertidas so removidas; as-

Figura7.17

Clonagem em I
Transposio *
trutura de um vt
de clonagem (R
um gene da trar
"asas cortadas'

sim, a transposa
clonado foi inset
frutas. A transpo
elemento P mod
ocorfe dentro do

Crouacev Gnrcr e Aruuse oe

mtodos para clonagem


clnicos, na tentativa de
tratada por meio

Genes

um caminho

/ \ ---
f"":-----'-7-'1 F.r:------]

r-:

Repeties terminais invertidas

(b) A transposio de um elemento P

ransposio

-.,'

/-\

hometica de Drosophila
mosca - so inti
D. melanoga,r/er fosse
imento humano. A i
vetores para a c

159

(a) A estrutura de um elemento P

aos sistemas de
obtidos com insetos. A
pletamente novo, o
para insetos, antes
utilizados com mami

dos mais importantes


reconhecido pelo
arealizar cruzamentos
e outras caractesticas
atualmente, para o

DNA

/
\

--'t

Elemento P inserido em
um cromossomo da mosca

--/

Elemento P carregado
pelo plasmdeo

(c) A estrutura de um vetor de clonagem de elemento p

-F'enhum plas mdeo conlrc-

os organismos, suscetvel
vetores de clonagem. Ao
de elemento P.

Eles so pedaos curtos de


se mover de uma posio

so um de virios tipos de
trs genes flanqueadul

do elemento (Figura l.lla).


de transposio, e as repe=
que a enzima idenuruco cromossomo, os ele_
rplasmdeo que carega um
ltimo evento a chave pa um plasmdeo que cono DNA que ir ser clona-

na rntem;po de seu gene


elemento P, presengene da transposase. A con-

comossomo s de D ro s ophidas so removidas; as-

Elemeno com "asas cortadas"

R/
-----_|r-l---'-]l---------'.]''

,,\/ ^
'

Repeties

invertidas

-'.
DNA pasmidial

Figura7.17
Clonagem em Drosophila com um vetor de elemento P. (a) Estrutura de um elemento p. (b)
Transposio de um elemento P de um.plasmdeo para um cromossomo da mosca. (c) Estrutura de um vetor de clonagem de elemento P. O elemento P esquerda contm um stio
de clonagem (R) que interrompe seu gene da transposase. O elemento p direita possui
um gene da transposase intacto, mas no pode transpor a si mesmo, porque ele tem suas
"asas cortadas" - ele no possui suas repeties terminais invertidas.

sim, a transposase no o reconhece como um elemento P legtimo. lJma vez que o gene a ser
clonado foi inserido no vetor, o DNA plasmidial microinjetado em embries da mosca-dasfrutas. A transposase fornecida pelo elemento P de asas cortadas comanda a transferncia do
elemento P modificado para o interior de um dos cromossomos da mosca-das-frutas. Se isso
ocorre dentro do ncleo de uma linhagem germinativa, ento a mosca adulta, que se desenvol-

160

. A. Bnowlr
ver a partir do embrio, ir conter cpias do gene clonado em todas as suas clulas. A c
gem com o elemento P foi primeiramente desenvolvida na dcada de 1980 e tem fornec
inmeras contribuies importantes para a genticade Drosophila.

Vetores de clonagem baseados em vrus de insetos


Embora os vetores virais no tenham sido desenvolvidos para a clonagem gnica em
de vrus, o baculovrus, tem desempenhado um papel importante na c
gnica com outros insetos. A principal utilizao dos vetores de baculovrus est na prod
de protena recombinante, assunto ao qual iremos retornar quando considerarmos esse
no Captulo 13.

phila,umtipo

7.3.2 Clonagem em mamferos


At o momento, a clonagem gnica em mamferos

realizada devido a uma dentre as trs

zes seguintes:

(1)
(2)

(3)

Para a obteno de um gene-nocaute, que uma tcnicrrnportante, utilizada para


xiliar na determinao da funo de um gene no-ider{tificado (p. 268). Esses exp
mentos so normalmente realizados com roedores, com o camundongo, por exeml
Para a produo de protena recombinante em uma cultura de clulas de mamfero,
mo em uma tcnica relacionada de cultivo (pharmng), a qual envolve a modific

gentica de um animal defazenda, de forma que ele sintetize uma protena


como um produto farmacutico, freqentemente em seu leite (p.29D.
Na terapia gnica, na qual clulas humanas so modificadas a fim de tratar uma
a (p. 315).

Vetores de clonagem para mameros


Durante muitos anos, imaginou-se que os vrus provariam ser a chave para a clonagem
mamferos. Essa expectativa foi apenas parcialmente concretizada. O primeiro experi
de clonagem envolvendo clulas de mamferos foi realizado em 1919, com um vetor
no vrus 40 do macaco (SV40, do ingls simian virus 40). Esse vrus capaz de infectar
rias espcies de mamferos, realizando um ciclo ltico em alguns hospedeiros e um ciclo
gnico em outros. O genoma possui 5,2 kb de tamanho (Figura 7.18a), contendo dois
tos de genes, os genes "iniciais", expressados bem no incio do ciclo de infeco e que
ficam protenas envolvidas na replicao do DNA viral, e os "tardios", que codificam as
tenas do capsdeo viral. SV40 apresenta os mesmos problemas que " e os caulimovrus
plantas, que o limite restrito de empacotamento de uma quantidade de DNA novo que
ser inserida no genoma. A clonagem com SV40 envolve, portanto, a substituio de um
mais dos genes existentes pelo DNA a ser clonado. No experimento original, um segmento
regio gnica tardia foi substitudo (Figura 7.18b), mas a substituio de um gene inicial
bm uma opo.
Com os anos, desde 1919, inmeros outros tipos de vrus foram utilizados para clonar
nes em mamferos. Os adenovrus permitem que fragmentos mais extensos de DNA sej
clonados, dos que so possveis com um vetor SV40, embora eles sejam mais difceis de
nipular, devido aos genomas serem maiores. Os papilomarus, os quais tambm apresen
uma capacidade relativamente alta para o DNA a ser inserido, apresentam a vantagem i
tante de permitir que uma linhagem celular estvel seja obtida.
Muitos vrus de mamferos destroem suas clulas hospedeiras logo aps a infeco,
forma que truques especiais so necessrios, caso esses vrus sejam utilizados para qu
finalidade que no sejam experimentos de transformao de curta durao. Os papi

Figun

S/40 e um exemplo

uizao como um ve
nagem. Para clonar
m da p-globina de coe
fragmento de restri
tfidlll a BamHlfoidel
(resultando em SVG
substitudo com o ge

c{

bovinos (BP
ciclo de infer
multicpia cr
lula de camu
lular. Vetores

plicao tantr
duo de pro
At o mor
de genes em

qual se reto

Clonagem

Uma das raze


em clulas de
era a maneira

Embora se

tre

rianos, ou c1

Croraeeu GNrcA

todas as suas clulas. A c


ada de 1980 e tem f

Aruuse oe DNA

161

(a) O genoma de SV40

la.

Hndll
a clonagem gnica em
papel importante na
baculovrus est na

Genes tardios
(protenas do capsdeo)

considerarmos esse

Genes iniciais
(replicao viral)

devido a uma dentre as trs

importante, utilizada para


(p. 268). Esses
o camundongo, por e
de clulas de mamfero.
a qual envolve a modi
ize uma protena i

leite (p. 294)


a

fim de tratar uma

a chave para a clonagem

O primeiro experi
1919, com um vetor
r rus capaz de inflectar
hospedeiros e um ciclo li
7. l8a), contendo dois coni

ciclo de infeco e que


ios", que codificam as
que l, e os caulimovrus
idade de DNA novo que
to, a substituio de um
original, um segmento
io de um gene inicial

utilizados para clonar


mais extensos de DNA sei
eles sejam mais difceis de
f
b. os quais tambm apresel
apresentam a vantagem imp
b
h[ileirus togo aps a infeco,
I sejam utilizados para qualq
hrta durao. Os papiloma

(b) SVGT-sqm o gene da B-globina de coetho inserido

Gene da B-globina de coelho

Figura 7.18
e um exemplo de sua
como um vetor de
. Para clonar o geda p-globina de coelho, o

ftagmento de restrio de
a BamHl foideletado
{resultando em SVGT-5) e
sstitudo com o gene do
coelho.

bovinos (BPV), que causam verrugas no gado, so particularmente atraentes, devido ao seu
ciclo de infeco incomum em clulas de camundongo, adquirindo a frma de um plasmdeo
multicpia com cerca de 100 molculas presentes por clula. Ele no provoca a morte da clula de camundongo, sendo molculas de BPV passadas para as clulas-filhas na diviso celular. Vetores de transferncia consistindo em seqncias de BPV e pBR322, e capazes de replicao tanto em clulas de camundongo quanto bacterianas, tm sido utilizados paa a produo de protenas recombinantes em linhagens celulares de camundongo.
At o momento, os retrovrus so os vetores mais comumente utilizados para a clonagem
de genes em clulas de mamferos. Suas aplicaes mais importantes esto na terapia gnica,
qual se retornar quando esse tpico for discutido (p. 315).

Clonagem gnica sem um vetor


Uma das razes pelas quais os vetores virais no tm se tornado comuns na clonagem gnica
em clulas de mamferos foi a descoberta, no incio da dcada de 1990, de que a microinjeo
era a maneira mais eficiente de transferir genes novos para o interior de clulas de mamferos.
Embora se trate de um procedimento difcil de realizar, a microinjeo de plasmdeos bacterianos, ou cpias de DNA lineares de genes, dentro do ncleo de clulas de mamferos resul-

162

T.A.BRowN

ta na insero do

um arran"
DNA nos cromossomos, possivelmente como cpias mltiplas em

geralmente visto coda cabea para a cauda (Figura 7.19). Tal procedimento
de que o
possibilidade
a
pois evita
mo mais satisfatrio Ao que a utilizao de um vetor viral,
outro'
DNA viral infecte as clulas e provoque defeitos de um tipo ou de
gene clonado em todas as
um
de
cpias
possua
269),que
o
nocautea
@'
Um camundongo
vulo fertilizado, o qual , subseqentesuas clulas, pode ser gerado por microinjeo de um
implantado em uma me ado'
mente, cultivado invitropo, u.l.iu, divises celulares e, depois,
embriognica (ES, do ingl's embryonic stem celll

leituras adicio

jo seqencial,

tiva. Alternativamente, ua clula-tronco


inicial e, ao contrrio da maioria
pode ser utilizada. Essas so obtidas a partir de um embrio
que seus modelos de desenvolvimendas clulas de mamferos, so totipotentes, significando
mesmas podem formar muitas er
to no foram predeterminados e as clulas descendentes das
a clula F'S devolvida paa um
truturas distintas no camundongo adulto. Aps a microinjeo,
resultante uma quirnera"
embrio, o qual implantado . umu -aeOodva. O camundongo

porque o embrio qrr


compreendendo uma mistura de clulas modificadas e no-modificadas,
normais' que contribuem'
recebe a clula ES tambm contm uma certa quantidade (?ulas
juntamente com a clula ES, para formar o camundongo a\utto'
""-""fil,1,1"^:lt:^t;
aps permitir que a qso obtidos
cos, que contm o gene clonao em todas as suas clulas,
de vulos com o gelrB
mera se reproduza, uma vez que alguns descendentes iro originar-se
clonado.

Anderson, C. (19!

da utilizao
Bevan, M. (1984)
Brisson, N., Pasd
gene in plant

caulimovrur
Broach, J.R. (198
Burke, D.T., Carl
tificial chron

Chilton, M.D. (l!


mdeo Ti.l
Evans, M.J., Cn

370-'74.rc,

Gram, F.L. (19


Hamer, D.H. & I
281, 35-40.

Hansen, G. &Wt
Monaco, A.P. &
Biotechnolo,
Nadolska-Orc21'l
technique
Parent, S.A.

&

eta

Yeast,l,8!
!

Paszkowski, J..

Mltiplas cPias do DNA clonado

((l\\

Rubin, G.M. &

ce, 218,348

Timmermans, M

nml

Reviett

Viaplana, R., Tu
virus replac

Figura 7'19
-r^,.r^a
incarir{a como um arranlo sequ"rencial em uma mG
^ranaac inseridas
uniptas cpias de molculas clonadas
lcula de DNA cromossmico.

estratgia d

Cnprulo 8
Como Obter um Clone
de um Gene Especfico

\e
O problema da seleo, I 65
Seleo dreta. 167

ldentificao de um clone a partir de uma biblioteca


genrnica. 169
Mtodos para identificao do clone. 1 74

Nos captulos anteriores foi examinada a metodologia bsica utilizadapara clonar genes e foram avaliados os vrios tipos de vetores que so usados com bactrias, leveduras, plantas e
animais. Agora, deve-se observar os mtodos disponveis para obteno de um clone de um
gene individual e especfico. Esse o ponto ctico de um experimento de clonagem gnica;
o sucesso ou o fracasso geralmente dependem do fato de a estratgia aplicada permitir ou no
que clones do gene desejado possam ser selecionados diretamente ou, de modo alternativo, diferenciados de outros recombinantes. Uma vez que tal problema tenha sido resolvido e que
um clone tenha sido obtido, o bilogo molecular est capacitado afazer uso de uma ampla variedade de diferentes tcnicas que extrairo informaes sobre s gene. As tcnicas mais importantes sero descritas nos Captulos l0 e 1 l.

O problema da seleo
O problema enfrentado pelo bilogo inolecular que deseja obter um clone de um gene nico
e especfico foi ilustrado na Figura 1.4. Mesmo os organismos mais simples, como E. col,
contm milhares de genes e a clivagem do DNA celular total produz no apenas o fragmento
que contm o gene desejado, mas, tambm, muitos outros fragmentos, que so portadores de
todos os outros genes (Figura 8.la). Durante a reao de ligao no h seleo de um fragmento individual: inmeras molculas diferentes de DNA recombinante so produzidas, todas contendo diferentes pores de DNA (Figura 8.1b). Conseqentemente, uma variedade de
clones recombinantes obtida aps a transformao e o plaqueamento (Figura 8.lc). De algum modo, o clone correto deve ser identifcado.

166

T. A. Bnowlr

(a) Clivagem de uma molcula de DNA extensa

EcoRl

-_-*
{

Muitos

Hnfi,'"'
O gene a ser

_r
a-

?.----

clonado

(b) As molculas de DNA recombinantes

lnsero no vetor

resultants

(c) Todas

produziro colnias

Figura 8.1
O problema da seleo.

ts

estratgias btfu

rndas para obter u


aleo direta. (b)
nante desejado

8.1.1 Existem duas estratgias bsicas para a obteno do


clone desejado
Embora existam muitos procedimentos diferentes, pelos quais o clone desejado pode ser
tido, todos correspondem a variaes de dois temas bsicos.

(1)
(2)

!.2

Selet

ob

Seleo direta do gene desejado (Figura 8.2a), o que significa que o experimento de
clonagem projetado de tal modo que os nicos clones obtidos so clones do gene pre
curado. Quase invariavelmente, a seleo ocore na etapa de plaqueamento.
Identificao do clone a partir de uma biblioteca genmica (Figura 8.2b), o que requer um experimento de clonagem inicial, que servir como "ferramenta", fornecendo
uma biblioteca de clones que representam todos os genes presentes na clula, ou a maiu
ria deles, seguida da anlise dos clones individuais para identificar qual o clone coreto-

Em termos gerais, a seleo direta o mtodo preferido, uma vez que rpida e em geral
no-ambgua. Entretanto, deve-se notar que ela no aplicvel a todos os genes. As tcnicas
para a identificao dos clones so, assim, muito importantes, especialmente porque bibliotecas genmicas completas de diversos organismos esto agora disponveis.

Para poc

com ga

cas col
la de DIt

Oex
tncia a
que conl
DS Qu

e suHon
mentos (
Paa

de um vr
tes mol

tncia

CrorureEu Grurcn e ANLrsE oe DNA

167

(a) Seleo direta

OO

>_

P
t-

\
X

Apenas o recombinante
correto Pode sobreviver

(b) ldentiicao do clone

i
i

.aaaa
aaaaaaa
a.aaaaa

Uma biblioteca
de clones

aaaaaaa

Figura 8.2
Figura 8.1
O problema da
leo.

ffs estratgias bsicas que podem ser utilipara obter um determinado clone. (a)
direta. (b) ldentiicao do recombinante desejado a partir de uma biblioteca
de clones.

a a

Clone coreto

Seleo direta
desejado pode ser

que o experimento
so clones do gene

ueamento.

(Figura 8.2b), o que

"ferramenta", fl
na clula, ou a

car qual o clone

1".,

qrr" rpida e em

Jtoaos os genes. As

piahente
fu,onveis.

t<

porque bit

Para poder selecionar um gene clonado necessrio plaquear os transformantes em um meio


com gar onde apenas os recombinantes desejados, e nenhum outro, possam crescer. As nicas colnias obtidas sero, portanto, aquelas formadas pelas as clulas que contm a molcula de DNA recombinante desejada.
O exemplo mais simples de seleo direta ocorre quando o gene desejado especifica resistncia a um antibitico. Como exemplo, consideraremos um experimento para clonar o gene
que confere resistncia canamicina, a partir do plasmdeo R6-5. Esse plasmdeo contm genes que

conferem resistncia

quatro antibiticos: canamicina, cloranfenicol, estreptomicina

e sulfonamida. O gene que confere resistncia canamicina localiza-se em um dos 13 fragmentos de EcoRI (Figura 8.3a).
Para clonar esse gene, os fragmentos EcoRI do R6-5 devem ser inseridos no stio de EcoRI
de um vetor como pBR322. A mistura de ligao compreender muitas cpias das 13 diferentes molculas de DNA recombinantes, um grupo das quais portando o gene que confere resis-

tncia canamicina (Figura 8.3b).

168

T. A. Bnowlr

A inativao por insero no pode ser usada para selecionar recombinantes quando o stio de EcoRI do pBR322 utilizado. Isso se deve ao fato de esse stio no estar localizado noa
genes que conferem resistncia tanto ampicilina quanto tetraciclina desse plasmdeo (Figura 6.1). Porm, tal fato insignificante para a clonagem do gene que confere resistncia
canamicina, pois, nesse caso, o gene clonado pode ser usado como uma marca de seleo. Os
transformantes so plaqueados em meio gar com canamicina, no qual as nias clulas capazes de sobreviver e produzir colnias so aquelas recombinantes que contm o gene que
confere resistncia canamicina clonado (Figura 8.3c).

&2.1 A recuperao

De fato, a seleo d
nes que conferem n
se uso de linhagens
Como exemplo.
gene codifica a enz
essencial triptofanc
nal, chamada de r
de crescimento. E

Essa E coli mu
total primeiramer
ria. O processamen

(a) Plasmdeo R6-5

produz numeross
uma cpia intacta c

/l

kant\

Stios

-t
EcoRl \

---.--.1T]
LJ
'1
rrLJ\

EcoRl

de=

-..+

---

t---'-a

obtido a partir da li
A mistura de li
trpA- (Figtra8.4b)

-\

13 ragmentos

dierentes

Ligao no stio de
EcoRl do pBR322

(b) A ligao origina 13 molculas de


DNA recombinantes dierentes

o
o
\

capaz de comandr

realizada pelo plaq


suplemento adicior
trficos no podem
binantes que contr

O emprego e as

Embora a recupra
nes, duas limitae

(1)
(2)

Transormao de
E co, plaqueamento

Uma linhager
Um meio on<

A tcnica de rs
ticas, pois os clone
descitaparao trp
linhagens auxotrf
cuperao do marc

Ademais, muta

XX

seleo de alguns g

(c) Mas apenas uma possibilita o crescimento


em meio gar com canamicina

Meio contendo
50 pg/ml de canamicina

uns poucos tero.


binantes so no-ar

Apenas o recombinante que


contm o gene kanR pode sobreviver

Figura 8.3
Seleo direta para o gene que confere resistncia canamicina clonado de R6-5 (kana).

tre enzimas equila


exgena funcione t
deiro para o tipo s

ldentificao l
biblioteca ge

Embora a recupera
utilizada e existem
do. Diversos mutar

Clonacev Gnrca e ANLrsE oe

recombinantes quando o
stio no estar localizado
iclina desse plasmdeo
gene que confere resistnci
uma marca de seleo.
no qual as nicas clulas
tes que contm o gene

.J
t-)

lsfragmentos

DNA

169

A recuperao do marcador ampria o emprego da seleo direta


De fato, a seleo direta seria muito limitada se somente pudesse ser utilizada para clonar genes que conferem resistncia a antibiticos. Felizmente, aicnicapode ser ampliada
fazendose uso de linhagens mutantes de E. coti como hospedeiras para a transformao.
Como exemplo, consideraremos um experimento para clonar o gene trpA de E. coli.Esse
gene codifica a enzima triptofano sintase, a qual est envolvida na biossntese do aminocido
essencial triptofano. Uma linhagem mutante de E. coli, que possui um gene trpAno-fincional, chamada de trpA- e capaz de sobreviver apenas se o triptofano for adicionado ao meio
de crescimento. E. coli trpA- ,portanto, outro exemplo de auxotrofia (p. 140).
Essa -E coli mrante pode ser utilizada para clonar a verso correta do gene r4p. O DNA

total primeiramente purificado a partir de uma linhagem normal (tipo selvagem) da bactria. O processamento com uma endonuclease de restrio, seguido pela ligao em um vetor,
produz nu}rosas molculas de DNA recombinantes, uma das quais pode, com sorte, conter
uma cpia intacta do gene trpA (Figura 8.4a). Trata-se, claro, do gene funcional, j que foi
obtido a partir da linhagem de tipo selvagem.
A mistura de ligao , ento, usada para transformar as clulas auxotrficas de E. coli
trpA (Figura 8'4b). A grande maioria dos transformantes que resulta ser auxotrfca, mas
uns poucos tero, agora, a cpia correta do gene trpA, onginada do plasmdeo. Tais recombinantes so no-auxotrficos - eles no necessitam mais do triptofano, pois o gene clonado
capaz de comandar a produo da triptofano sintase (Figura 8.4c). A seleo direta , assim,
realizada pelo plaqueamento dos transformantes em meio mnimo, o qual carece de qualquer
suplemento adicional e, particularmente, no possui triptofano (Figura 8.4d). Mutantes auxotrficos no podem crescer em meio mnimo, logo, as nicas colnias a aparecer sero recombinantes que contm o gene trpAclonado.

o emprego e as limitaes da tcnica de recuperao do marcador


Embora a recuperao de um marcador possa ser usada para obtermos clones de muitos genes, duas limitaes so impostas a essa tcnica.

(1)
(2)

ransformao de

colr, plaqueamento

uma linhagem mutante deve estar disponvel para o gene em questo.


um meio onde apenas o tipo selvagem possa sobreviver necessrio.

A tcnica de recuperao aplicvel maioria dos genes que codifica enzimas biossintticas, pois os clones desses genes podem ser selecionados em meios mnimos da maneira j
descrita para o trpA. Entretanto, a tcnica no est limitada a E. coli,nem somente a bactrias;
inhagens auxotrficas de leveduras e fungos filamentosos esto tambm disponveis, e
a recuperao do marcador tem sido usada para selecionar genes clonados em tais organismos.
Ademais, mutantes auxotrficos de E. coli podem ser utilizados como hospedeiros para a
seleo de alguns genes de outros organismos. Com freqncia, h similaridade
suficiente entre enzimas equivalentes de diferentes bactrias, ou mesmo de leveduras, para que
a enzima
exgena funcione em E' coli, de modo que o gene clonado sejacapazde transformar
o hospedeiro para o tipo selvagem.

ldentiicao de um clone a partir de uma


biblioteca genmica
clonado de R6-S (kanR1.

Embora a recuperao do marcador seja uma tcnica poderosa, no sempre que ela pode
ser
utilizada e existem muitos genes importantes que no podem ser selecionados por esie mtodo. Diversos mutantes bacterianos no so auxotrficos, de modo que as inhagens mutantes

17O

T. A. Bnowrl

(a) Construo do pBR322 recombinante

oo
trpA

ligao

(b)Transormao de

coti

trpA- a/

"trDA-

trpANo-

rcombinante
t
I

Recombinantes

--=-

(c) O gene do plasmdeo


expressado

ptolena trpA

(d) Plaqueamento em
meio mnimo

trpA+

@
/

or"nu"recombinantes
trpe* podem sobreviver

I ..<

Figura 8.4
Seleo direta para o
gene trpA clonado em
uma linhagem trpA- de
E. coli.

e de tipo selvagem no podem ser distinguidas pelo plaqueamento em meio mnimo ou em


qualquer outro meio especial. Alm disso, nem a recuperao do marcador, nem qualquer outro mtodo de seleo direta de muita utilidade no fornecimento de bactrias complementadas por clones contendo genes de organismos mais desenvolvidos (isto , animais e plantas),
pois, nesses casos, as diferenas so geralmente to grandes que as enzimas exgenas no
funcionariam na clula bacteriana.

Uma estratgia alternativa deve, portanto, ser considerada. Isso ocorre quando um grand
nmero de clones diferentes obtido e aquele que se deseja , de alguma forma, identificado-

8.3.1 Bibliotecas genmicas


Antes de se observarem os mtodos utilizados para identihcar clones individuais, deve ser considerada a biblioteca propriimente dita. Uma biblioteca genmica (p.136) uma coleo de clones em nmero apaentemente suflciente para conter cada gene presente em um determinado organismo. Bibliotecas genmicas so preparadas pela purificao do DNA total da clula, ao qual
se segue um processo parcial de restrio, resultando em fragmentos que podem ser clonados
em um vetor adequado (Figura 8.5), geralmente um vetor de l" de substituio, um cosmdeo oq
possivelmente, um cromossomo artificial de levedura (YAC, do ingls yeasr artificial chromo-

Figura 8.5
Freparao de uma biUioteca genmica em
um vetor cosmidial.

some), um cro
ou um vetor P

Para bact

nmicacompl

mais, entretn
clone deseja
blioteca, espu

maisl ulililal

E.3.2 Nem todos

Uma caracter
viduais. Um g
celulares - cI
de genes, mas

outros so sile

O fato de
qualquer pode
o DNA. mas

Cuorunceu Grurcr e ANLtsE oe DNA

171

DNA celular total

,4usde -35"not
kb
---1-------rr

Ligao no cosmdio

I
I

Empacotamenlo in vitro,
infeco de E. col

,/-1--\

/'-' . - >a,/,
/:..'...'x
....,'.'l
\.'....:'l
\ ..'.
.'

Figura 8.4
Seleo direta para o
gene trpA clonado em
uma linhagem trpA'&
E. coli.

em melo mlnlmo ou
marcador, nem qualquer
de bactrias comp
(isto , animais e p
as enzimas exgenas
ocorre quando um
alguma forma, identifi

Figura 8.5
de uma bigenmica em
un vetor cosmidial.

colnias

./

+ outras ptacas
de Petri = biblioteca genmica

some),um cromossomo artificial bacteriano (BAC, do ingls bacterial artificial chromosome)


ou um vetor Pl.
Para bactrias, leveduras e fungos, o nmero de clones necessrios para uma biblioteca genmica completa no to grande que no possa ser manejado (Tabela 6.1). Para plantas e ani-

mais, enffetanto, uma biblioteca completa possuiria tantos clones diferentes, que identificar o
clone desejado provar-se-ia uma tarefa gigantesca. Para tais organismos, um segundo tipo de biblioteca, especfica no para todo o organismo, mas para um determinado tipo celular, seria de
maior utilidade.

Nem todos os genes so expressados no mesmo momento


individuais, deve ser
(p. 136) uma coleo de
te

emum determinado

DNA total

da clula. ao

que podem ser clona

ituio, um cosmdeo
yeast artificial

Uma caracterstica da maioria dos organismos multicelulares a especializao de clulas individuais. Um ser humano, por exemplo, constitudo por um grande nmero de diferentes pos
celulares - clulas cerebrais, sangneas, hepticas, etc. Cada clula contm o mesmo contedo
de genes, mas, nos diferentes tipos celulares, grupos distintos de genes so ativados, enquanto
outros so silenciados (Figura 8.6).
O fato de que, relativamente, apenas poucos genes so manifestados em um tipo celular
qualquer pode ser utilizado na preparao de uma biblioteca, se o material a ser clonado no for
o DNA, mas o RNA mensageiro (mRNA). Apenas aqueles genes que estiverem sendo expres-

4i
I

Cr-orunceu GNrcA

E ANLrsE

oe

DNA

173

cialmente degradado, por tratamento com a ribonuclease H (RNase) (Figura 8.7b). Os fragmentos remanescentes de RNA servem, ento, como iniciadores (p. 68) para a DNA-polimerase I, a qual sintetiza a segunda fita de cDNA (Figura 8.7c), resultando em um fragmento de
DNA de fita dupla que pode ser ligado a um vetor e clonado (Figura 8.7d).

(a) Snteqe$ primeira ita

mRNA

AAAAA

Cauda de
Poli(A)

Anelamento de

oligo(d)

um

lT

lnlclaclor

iniciador

Transcriptasereversa

RNA
T-n-l-t-,rT-n-T-Tl

\I
/

./

iH

DNA

(b) Degradao do RNA

,/RNase H

,/

Fragmentos de RNA

(c) Sntese da
segunda ita

8.6
dierentes so expresem tipos celulares db

r-1.]-r

DNA-poll

Fragmentos

de RNA atuam
como iniciadores

DNA

\
T-T-I-T-T-FTT--TTTT
cDNA de fita dupla

AAAA

rrr

Unio das extremidades

coesivas, ligao

(d) Ligao em um vetor

material iniciadot os
de genes da clula.
til se o gene desej
Por exemplo, o gene da
no trigo, expressado em

.-

cDNA

-olvimento. Em tais
se pudssemos clonar o
lones especficos para g
(e) Transormao

Figura 8.7
llm esquema pos-

de clonagem. Entretanto,

(cDNA, do

(p 68), que sintetiza uma


(Figura 8.7a). Uma
la hbrida pode ser

rd

Clones de
cDNA

para a clonado cDNA (ver

detalhes).
poliadeno=
olip(dT) = olimidina.

= Clones da
gliadina

172

T. A. Bnowr'r

cialmente

Clula do tipo A

mentos ren
rase I, a qu

DNA de fit

u"n"..ir.o"Joo.

mRNA

--

proena

Clula do tipo B

Genes silenciados

.--------*

\ mRNA

mRNA

-_

protena

Figura 8.6
protena

Genes dierentes so exprs


sados em tipos celulares dib'
rentes.

sados so transcritos em mRNA. Logo, se o mRNA for usado como material iniciador, os
nes resultantes compreendero apenas uma seleo do nmero total de genes da clula.

Um mtodo de clonagem que utilize mRNA seria particularmente til se o gene desej
fosse expressado em altos nveis em um tipo celular individual. Por exemplo, o gene da
dina, uma das protenas nutricionais mais importantes presentes no trigo, expressado em
nvel muito elevado nas clulas das sementes de trigo em desenvolvimento. Em tais cl
mais de 307o do mRNA total especificam gliadina. Obviamente, se pudssemos clonar o
NA das sementes de trigo, iramos obter um grande nmero de clones especficos para
na.

8.3.3 O mRNA pode ser clonado como DNA complementar


O RNA mensageiro no pode, ele prprio, ser ligado a um vetor de clonagem.
mRNA pode ser convertido em DNA pela sntese do DNA complementar (cDNA, do i
complementary DNA).
A chave para esse mtodo a enzima transcriptase reversa (p. 68), que sintetiza uma
polinucleotdica de DNA complementar a uma fita de RNA existente (Figura 8.7a). Uma
que a fita de cDNA tenha sido sintetizada, o membro RNA da molcula hbrida pode ser

Frgura &7

pc.

peraa donacDl.lA (ver


dfralhes)"

=pdiadenc

= oli-

Crouoev

GNrcA E ANLrsE DE

DNA

173

cialmente degradado, por tratamento com a ribonuclease H (RNase) (Figura 8.7b). Os fragmentos remarescentes de RNA servem, ento, como iniciadores (p. 68) para a DNA-polimerase I, a qual sintetiza a segunda fita de cDNA (Figura 8.7c), resultando em um fragmento de
DNA de fita dupla que pode ser ligado a um vetor e clonado (Figura 8.7d).

(a) Sntese da primeira fita

5'
mRNA

3'

Cauda de
Poli(A)

n*r"r*r,tio" rr
oligo(dT) iniciador

.##
\ \
lnlclador
I

Transcriptasereversa

RNA

/I

AAAAA
l--t--l--t--l--lm
u...J....J....J....l.-.4]-TfTI
DNA

(b) Degradao do RNA

/ ,/

,/

RNase H

Fragmentos de RNA

.T ..'l

r-r-rr

(c) Sntese da
segunda ita

,/

Ij

Fragmentos

de RNA atuam
como iniciadores

L.",.
pres dierentes so

exprr

DNA-pol

DNA

fdos em tipos celulares d

T-fT-'l-T-l-T-fT-fTTT"l-

Fn"r

cDNA de ita

I
I

!rc
pl de genes da clula.
pnte til se o gene desej

por exemplo. o gene da g

fo

dupla

AAAAA

rrrrr

Unio das extremidades


coesivas, ligao

(d) Ligao em um vetor

material iniciador, os,

trigo.

lr

CDNA

-.

expressado em

loluimento. Em tais clu


[se pudssemos clonar o

fones especficos para gii


l

(e) Transformao

frentar
bde clonagem.
pmentar (cDNA, do
b. 68), que sinteriza uma
bnte (Figura 8.7a). Uma
nlcula hbrida pode ser

Figura 8.7
esquema posufuel para a clona-

do cDNA (ver
para detalhes).
= poliadenooligo(dT) = oligodesoxitimidina.

Clones de
cDNA

174

T. A. Bnowlr

Os clones de cDNA resultantes so representativos do mRNA presente na preparao


a pair das sementes de trigo, a biblioteca de cDNA
suiria uma grande proporo de clones representando o mRNA da gliadina (Figura 8.7e).

ginal. No caso do mRNA preparado

tros clones tambm estaro presentes, mas localizar o cDNA da gliadina clonado um
cesso muito mais fcil do que identificar o gene equivalente a partir da biblioteca
completa do trigo.

8.4 Mtodos para identiicao do clone


Uma vez que uma biblioteca adequada tenha sido preparada, virios procedimentos podem
empregados na tentativa de identificar o clone desejado. Embora uns poucos desses
mentos sejam baseados na deteco do produto de traduo do gene clonado, , via de
mais fcil identificar diretamente a molcula de DNA recombinante correta, o que pode
realizado por meio da importante tcnica de sondagem por hibridizao.

Fr

8.4.1 Fitas complementares de cido nuclico hibridizam-se entre si


Quaisquer duas molculas de cido nuclico de fita nica tm o potencial de formar pares de
base uma com a outra. Para a maioria dos pares de molculas, as estruturas hbridas resultan
tes so instveis. pois somente um pequeno nmero de ligaes individuais entre as fitas for-

mado (Figura 8.8a). Entretanto, se os polinucleotdeos forem complementares, um extenso


pareamento de bases pode ocorrer para formar uma molcula de fita dupla estvel (Figura
8.8b). Isso pode ocorrer no apenas entre molculas de DNA de fta simples para formar unre
hlice dupla de DNA, mas tambm entre molculas de RNA de fita simples e entre combinaes de fitas de DNA e de RNA (Figura 8.8c).
A hibridizao de cidos nuclicos pode ser utilizada para identificar um determinado
clone recombinante se uma sonda de DNA ou RNA, complementar ao gene desejado, estiver
disponvel. A natureza exata da sonda ser discutida posteriormente neste captulo. Primeiro"
deve ser considerada a tcnica propriamente dita.

@plementars
hbrido DNA@mo o que
ftrrnado entre

eseu

ra 8.9

mole

8.4.2 Sondagem por hibridizao para colnias e placas


A sondagem por hibridizao pode

nfsn:dizao
ilirilllnlico. (a) Un
o,e hbrida insl
nmnda entre dua
M{A no-homol
tlm hbrido es
mado entre d

gadas

identificar molculas de DNA recombinantes tanto em colnias de bactrias quanto em placas de bacterifagos. Graas s tcnicas inovadoras, desenvolvidas no final da dcada de 1970, no necessrio purifcar cada molcrrh
recombinante. Um mtodo de sondagem in situ, ao contririo, utilizado.
Primeiro, as colnias ou placas so transferidas para uma membrana de nitrocelulose m
nilon (Figura 8.9a) e, ento, so tratadas para remover todo o material contaminante, deixando apenas o DNA (Figura 8.9b). Geralmente, esse tratamento tambm resulta na

ser usada para

das molculas de DNA, de modo que as pontes de hidrognio entre as htas individuais na
lice dupla so quebradas. Tais molculas de fita simples podem, ento, ser firmemente li
membrana por um curto perodo a 80'C, se uma membrana de nitrocelulose estiver

utilizada, ou pela radiao ultravioleta, se for usada a membrana de nilon. As molculas


nam-se aderidas membrana por meio de suas estruturas acar-fosfato, de modo que as b*
ses ficam livres para parear com as molcuas de cido nuclico complementares.
A sonda deve agora ser marcada, desnaturada por aquecimento e aplicada membrana
uma soluo de reagentes qumicos que promovam a hibridizao dos cidos nuclicos (Fi

lation

o a
atir"id

ligad.
por ar

o
te

&r

r0 acl

Ilutrci
guais

o
rea

cham

sgr&

Cr-oruaoeur Grurcn e ANLrsE oe

Iesente na preparao

(a) Um hbrido instvel

fliadina (Figura 8.7e). Oufiadina clonado um pro"


lir da biblioteca genmica

rprocedimentos podem
ns poucos desses procedii
E clonado, , via de regra,
le correta, o que pode sc

lzao.

nm-se entre si
de formar pares

&

Itruturas hbridas resultaniyiduais entre as fitas fa-

lplementares, um exteNo
.fita dupla estvel (Fi
lsimples para formar
lsimples e entre combinr

bntificar um dete
iao gene desejado,
D

175

rbiblioteca de cDNA pos-

kncial

DNA

(b) Um hbrido estvel

Figura 8.8
Hibridizao de cido
nrclico. (a) Uma molqlla hbrida instvel forflmnda entre duas itas de
[D].lA no-homlogas. (b)
Um hbrido estvel ormado entre duas itas
ournplementares. (c) Um
hbrido DNA-RNA, tal
como o que pode ser
rbrmado entre um gene
e seu transcrito.

Pequenas regies no-complementares


no afetam a estabilidade geral

(c) Um hbrido DNA-RNA

neste captulo. Pri

ls
rlas de DNA recombinan!s. Graas s tcnicas inob purificar sds mql{ula
hado.
brana de nitrocelulose ut
[ial contaminante, deixanim resulta na desnatura@
*as fitas individuais na h6
b, ser firmemente ligadro
ilrocelulose estiver sendo,
rnilon. As molculas tg'cf,ato, de modo que as bamplementares.
; aplicada membrana em
m cidos nuclicos (Figu-

ra 8.9c). Aps um peodo para permitir que a hibridizao acontea, o filtro lavado para remover as sondas que no se ligaram, seco e ento so detectadas as posies das sondas ligadas (Figura 8.9d).
Tradicionalmente, a sonda marcada com um nucleotdeo radioativo, tanto por nick translation quanto por preenchimento das extremidades (p. 81), ou, alternativamente, por iniciao aleatria (random priming) (Figtra 8.10), uma tcnica que resulta em uma sonda com
atividade bem mais elevada e, portanto, capaz de detectar quantidades bem menores de DNA
ligadas membrana. Com esses mtodos, a posio do sinal de hibridizao determinada
por auto-radiografia.
Os mtodos de marcao radioativa, porm, esto comeando a entrar em desuso, em parte devido aos riscos qre trazem ao pesquisador e em parte devido aos problemas associados
ao acondicionamento dos resduos radioativos. A sonda de hibridizao pode, portanto, ser
marcada de uma maneira no-radioativa. Diversos mtodos tm sido desenvolvidos, dois dos
quais so ilustrados na Figura 8.1 l.

O primeiro faz uso de nucleotdeos desoxiuri.dina trifosfato (dUTP) modificados pela


reao com a biotina, uma molcula orgnica que possui alta afinidade por uma protena
chamada avidina. Aps a hibridizao, as posies das sondas biotinizadas e ligadas podem
ser determinadas pela lavagem com avidina, associada a um marcador fluorescente (Figura

176

T.A.Bnowru

(a)Transerncia das colnias paa nitocelulose ou nilon


Membrana de
nitrocelulose/nilon
--!'--

"---l--------l_-!
l---:-:::Jl

\/\/

Bactrias aderidas
membrana

(b) Degradao das clulas'e puriicao do DNA


DNA

Bactrias

rcari+
Protease

Bases
no-Pareadas

/I\

}*tY;rr
DNA e ligado
pela estrutura

acar-osfato

\\

sooc

\ Pot z ou
noras
)

inadiao
ultravioleta

DNA ligado
membrana

Figura 8.10
Marcao do DNA Por
iniciao ale alria ( ran&m priming). A mistura
@ hexmeros randomidos (oligonucleotdeos
lfiptamricos de seqncla randomizada) suicientemente complexa
para incluir, pelo menos,
@umas molculas que
possam parear com a
dNTP = 2'-desoxi-

Filme de raio X

(c) Sonda com o DNA marcado

*^* .?-l. lavaoem


.ffi
,/ ')l,,w,Y\ " -'%r,,,v-f
APlicao
/
\
Ligao
de raio X
Ligao noespecfica esPecica

ffi

do ilme

(d) A auto-radiograia esultante

nmrrieotdeo 5'{rifosato.
Hibridizao positiva

Figura 8.9
A hibridizao em
colnias com uma
sonda marcada radioativamente.

cada
8.11a). Esse mtodo to sensvel quanto a sondagemradioativae est se tornando
mais popular.
no-ra
O msmo tambm verdadeiro para o segundo mtodo de hibridizao com sonda
sil
rbano
de
peroxidase
a
enzima
com

complexada
DNA
dioativa, no qual a sonda de
lum
degradar
em
enzimtica
habilidade
pela
peroxi.dase)
detecada
(horserudish
e

x
tre
fi
com a emisso de quimioluminescncia (Figura 8.11b). O sinal pode ser registrado em

fotogrfico normal de maneira anloga auto-radiografia'

Exemplos do uso;

obviamente, o sucesso (
determinado clone recot

possa ser usada como so

cia do gene clonado. Se

menteocasoseoobjr

ser utilizado como sond


Na prtica, a nature,
gene desejado. Sero co

(1)

Aquela na qual o 1
tir do qual uma bil

Cr-onneeu Grutcn e Ar.trtse oe

DNA

1TI

Sonda de DNA
de fita dupla

Desnatu rao pelo aquecimento

DNA de fita simples

Adio de hexmeros randomizados


de oligonucleotdeos

LJJ

rs formam
Alguns; hexmeros
h
pares de bases

.P

Figura 8.10
Marcao do DNA Por
riciao alealria (ranMn priming). A mistura
hexmeros randomidos (oligonucleotdeos
Itsamricos de seqnc randomizada) suicientemente complexa
pra incluir, pelo menos,
rlgumas molculas que
possam parear com a
dNTP = 2'-desoxinnrcleotdeo 5'-triosato.

Figura 8.9
A hibridizao em
colnias com uma
sonda marcada radioativamente.

va e est se tornando cada

hibridizao com sonda no-ra


peroxidase de rbano silve
imtica em degradar lumino(
pode ser registrado em filrrr

\
\

Adio da polimerase de
Klenow + dNTPs,
um dos quais est marcado

DNA marcado

Exemplos do uso prtico da sondagem por hibridizao


Obviamente, o sucesso da hibridizao em colnia ou placa como meio para identificar-se um
determinado clone recombinante depende da disponibilidade de uma molcula de DNA que
possa ser usada como sonda. Essa sonda deve compartilhar, pelo menos, uma parte da seqncia do gene clonado. Se o gene propriamente dito no estiver disponvel (o que presumivelmente o caso se o objetivo do experimento for fornecer um clone dele), ento, o que pode
ser utilizado como sonda?
Na prtica, a natueza da sonda determinada pela informao disponvel a respeito do
gene desejado. Sero consideradas trs possibilidades.

(1)

Aquela na qual o gene desejado expressado em altos nveis em um tipo celular,


tir do qual uma biblioteca de clones de cDNA tenha sido preparada.

par-

178

A. Bnowlr

l'

Sondagem por
(a) Marcao com um nucleotdeo biotinizado

Sondade

DNA /
./

Conforme descrito

ra a obteno de un
determinado tipo ce
em desenvolvimen

durP-biotina

{\(

gene da gliadina (F

\ -\=\
preenchimento das
extremidades ou
Nick

A identificao

transtation,

iniciao aleatria

Hibridizao

diferentes clones us
da biblioteca seja d
gliadina e analisado
lamento do produto

,%

l{><->

BBBB
+-{-r!
,r>

.-/

nados clones de cDl


teca (Figura 8.12). L
te purificada, nu(

---\

Sondas de oligr
tenham sido ca

,/r*x**
a um marcador
fluorescente

Freqentemente, o
detalhamento. Em p

7-7-7rr-7-7-7-77-2-777-7
^t<r>

(b) Marcao com a peroxidase de rbano silvestre

Peroxidase de rbano silvestre


+ glutaraldedo
__.t\_\

HP

HP -/

H>--'-''

./

\
\

Hibridizaeo

\
HP HP

<,r{r\

,.'/
-,-

.O}<"

777-7777-777-7'7-7-

Adio de luminol

Figura 8.11
Dois mtodos para a m-

cao no-radioativa das


sondas de DNA.
!

i1

(2)

(3)

I
t
I

t
i
F

Aquela na qual a seqncia de aminocidos da protena codificada pelo gene


ta ou parcialmente conhecida.
Aquela na qual o gene membro de uma famlia de genes relacionados.

Figu
Sondagem em uma bibliotec
identiicar um clone ahtr

Clotnenr GNtcA

E ANLtsE

oe

DNA

179

Sondagem por abundncia para analisar uma biblioteca de cDNA


Conforme descrito neste captulo, uma biblioteca de cDNA , com freqncia, preparada para a obteno de up clone de um gene expressado em um nvel relativamente elevado em um
determinado tipo
\elular. No exemplo da biblioteca de cDNA, a partir das sementes de trigo
em desenvolvimentb/uma grande proporo dos clones cpia dos transcritos de mRNA do
gene da gliadina (Figura 8.7e).
A identificao dos clones da gliadina simplesmente um caso de utilizao de determinados clones de cDNA, a partir da biblioteca, para sondar todos os demais membros da biblioteca (Figura 8.12). Um clone selecionado aleatoriamente e a molcula de DNA recombinante purificada, marcada e utilizada para sondar os clones remanescentes. Isso repetido com
diferentes clones usados como sondas at que um que hibridize com uma grande proporo
da biblioteca seja obtido. Esse cDNA abundante considerado como um possvel clone da
gliadina e analisado mais detalhadamente (por exemplo, por seqenciamento do DNA e iso
lamento do produto de traduo), a fim de confirmar a identihcao.

Sondas de oligonucleotdeos para genes cuios produtos de traduo


tenham sido caracterizados
Freqentemente, o gene a ser clonado codifica uma protena que j foi estudada com algum
detalhamento. Em particular, a seqncia de aminocidos da protena deve ter sido determi-

sonda

Figura 8.

/
/\

,0,,0,'"nr\
em colnia \

Biblioteca
de clones

sonda B

Dois mtodos para a marcao no-radioativa das


sondas de DNA.

ada pelo gene

relacionados.

Auto-radiografias

Figura 8.12
Sondagem em uma biblioteca para
identiicar um clone abundante.

Sonda A =
Clone pouco
abundante

Sonda B =
Clone muito
abundante

180

T. A. Bnowlr

nada utilizando tcnicas de seqenciamento disponveis h mais de 40 anos. Se a seqncia


de aminocidos conhecida, ento pospvel utilizar o cdigo gentico para deduzir a seqncia nucleotdica do gene relevante.
sempre aproximada, pois somente
Qssl deduo
metionina e triptofano podem ser associados de maneira no-ambgua s trincas de cdons;
todos os outros aminocidos so codificados por, pelo menos, dois cdons cada. Contudo, na
maioria dos casos, os diferentes cdons paa um aminocido individual so relacionados. Alanina, por exemplo, codificada por GCA, GCT, GCG e GCC, logo, dois dos trs nucleotdeos
da trinca que codifica a alanina podem ser deduzidos com certeza.
Como um exemplo para esclrecer como tais dedues so feitas, considere a citocromo
c,.uma protena que desempenha um papel importante na cadeia respiratria de todos os organismos aerbicos. A protena citocromo c de levedura foi seqenciada em 1963, com o resultado mostrado na Figura 8. 13. Essa seqncia contm um segmento, iniciando no aminocido 59, com a seqncia Trp-AspGlu-Asn-Asn-Met. O cdigo gentico determina que esse hexapeptdeo codificado por TGG-GA-GA-AA-AA-ATG. Embora isso represente um total de 16 seqncias diferentes possveis, 14 dos 18 nucleotdeos podem ser deduzidos com certeza.
Oligonucleotdeos com cerca de 50 nucleotdeos de extenso podem ser facilmente sintetizados em laboratrio (Figura 8.14). Assim, uma sonda de oligonucleotdeos poderia ser
construda de acordo com a seqncia nucleotdica deduzida e tal sonda sei.acapaz de identificar o gene que codifica a protena em questo. No exemplo da citocromo c de levedura, mi
16 oligonucleotdeos possveis, que podem codificar Trp-Asp-Glu-Asn-Asn-Meq seriam
sintetizados, separados ou em conjunto, e ento utilizados para sondar uma biblioteca genmica ou de cDNA de levedura (Figura 8.15). Um dos oligonucleotdeos da sonda ter a seqncia correta para essa regio do gene da citocromo c e o seu sinal de hibridizao indicar quais clones so poadores desse gene.
O resultado pode ser verificado por meio de uma segunda sondagem com uma mistura
de oligonucleotdeos cujas seqncias so deduzidas a partir de um segmento diferente de
protena citocromo c (Figura 8.15). Entretanto, o segmento da protena empregado para dedtzir a seqncia de nucleotdeos deve ser escolhido com cuidado: o hexapeptdeo
Ser-Glu-Tyr-Leu-Thr-Asn, que segue imediatamente o primeiro hexapeptdeo escolhido.
poderia ser codificado por milhares de seqncias diferentes de l8 nucleotdeos, claramente uma opo inadequada para uma sonda sinttica.

Sondas heterlogas permitem que genes relacionados


seiam identiicados
Geralmente, uma considervel similaridade entre nucleotdeos vista quando dois genes
mesma protena, mas de organismos diferentes, so comparados, o que reflete a
da estrutura dos genes durante a evoluo. Com freqncia, dois genes de organismos rel

Figura I

n esquema sin

lib

da sntesr

olgonucleot
Osgrupama
ligade

rerridades

pevinem rea
nemononude

os

indivirJu

Corn um cont
mr{adOSO lg

iuilltgtb o qua

so rer
ufras,

@em

;dkinadc

nrc
mmrffiotdeos, ut

ctlipnud
15

GLY_SER-ALA_LYS- LYS-GLY.ALA_THR_ LEU_ PHE_ LYS_THR_ARG-CYS_GLU 30


LEU- CYS- HIS-THR.VAL-GLU- LYS_ GLY _GLY_ PRO_ HIS- LYS _VAL_GLY_ PBO45

PHE-GLY-ARG-HIS -SER-GLY_GLN-ALA-GLN *GLY60


TYH - SER -TYR -THR_ASP-ALA_ASN _ IL _ LYS_ LYS_ ASN - VAL_LEU.TRP_ASP_
ASN_LEU_HIS_GLY_

ILE _

GLU ASN ASN_T,4ET_SER-GLU.TYR-LEU-THR-ASN-PRO-LYS_LYS_TYR_ILEPRO- GLY_THR

_ LYS

- IVET-ALA-PHE *GLY.GLY _LEU _ LYS_ LYS. GLU

ARG.ASN -ASP- LEU _ IL _HR -YR _LEU - LYS _LYS_ALA_CYS _GLU

75
90

- LYS-ASP-

103

Figura 8.13
A seqncia de aminocidos da
citocromo c de levedura. O hexapeptdeo que est destacado em
vermelho utilizado para ilustrar
como uma seqncia nucleotdicar
pode ser deduzida, a partir de
uma seqncia de aminocidos.

crcsone

narlos:
rm gt

imint
estrutu

Ct-onnoev Grurcn e ANLrsE oe

DNA

181

ris de 40 anos. Se a seq

gentico para deduzir a sepre aproximada. pois so


prbgua s trincas de cr
lilois cdons cada. Contudo,

ilividual

so relacionados.
bgo, dois dos trs

-.-

5'

61$sPs 5'Protesido

Suporte

tigaaodoprimeiro

de

nucleotdeo ao suporte

\
/
slica {

r{}

Y.a.

bfeitas, considere a citocro


lia respiratria de todos os
fiienciada em 1963, com o
hrnento. iniciando no amin

flr*!v:':eil":n""'

I
J
^
'
-fr;o*o
I--,4\ v;\.
,lRemocoda

-/l::

fgo gentico determina que


Embora isso repres
Lcleotdeos podem ser dedr

lerc.

\!-,/

\,/

Cond.ensao

f@Ot

'*n*Jnucreotdeo

seri

3'

da
/-\
.Jlproteo5' o\1/'
I

,l Remoco

sondar uma biblioteca gen.


deos da sonda ter a se-

sinal de hibridizao i
sondagem com uma mi
um segmento diferente
na empregado para

cuidado: o hexapept
iro hexapeptdeo escolhi
I8

nucleotdeos, claram

pnados

vista quando dois genes


reflete a cons

ps. o que

! g.n.r

de organismos

Fa 8.13

da proteo 3

aat---/

podem ser facimente s


poderia
sonda seria capaz de i
citocromo c de levedura-

Asn-Asn-MeL

/'--\
-t-j-|
3'

/r

A\o
-*""; _t)-o
",

Figura 8.14
[n esquema simplilfuado da sntese de

5'

Remoo da

Proteo3'

olgonucleotdeos.
Os grupamentos
ligados s
emidades 3'e 5'
prwinem reaes
runbe mononucleot
deos individuais.
Com um controle
widadoso do monento no qual as
sao remov1as, podem ser
dcionados monom:.rdeotdeos, um a
ao oligonucleot
em crescimento.

r@
Nucteotdeo

Suporte de slica

Continua at o

comprimento
desejado - ento,
clivado do suporte

Grupamento protetor 5', por exemplo, dimetoxi-tritil

Grupamento protetor 3', por exemplo, dimetilJosforamidita

lncia de aminocidos da

omo c de levedura. O hexaHeo que est destacado em

Hho utilizado para ilustrar

I uma seqncia nucleotdica


ser deduzida, a partir de
seqncia de aminocidos.

nados so suficientemente similares paa que uma sonda de fita simples, preparada a partir de

um gene, forme um hbrido estvel com o segundo gene. Embora as duas molculas no sejam inteiramente complementares, pares de bases suficientes so formados para produzir uma
estrutura estvel (Figura 8.16a).

182

T. A. Bnowlr

bndizarn2
Oligonucleotdeos sintticos,
marcados nas
udues

extremidades
'[tr

nes (Figura

de nucleot

complexo

;:;

lia multig

bros poden

\..:.:'./
por -:- '-z

8.4.4 Mtodos
traduo

Sondagem
hibridizao em colnia

\ /

ffiz

--6.h

..t

,/

B,,rf:ff""J,,*."

\\\

--

3J'3"JJ:::::

As sondas

il3:fl'ffl

terminado r
com as mo
10.000 recr
investigada

Auto-radiograia

uma sonda
nam impos

Provvel clone da
citocromo c

tgia difere

Sinal no-especfico?
Nova sondagem com um segundo
oligonucleotdeo deduzido

Figura 8.15
O uso de um oligoldentiicao definitiva do
clone da citocromo c

nucleotdeo sinttico, marcado na extremidade, para


identiicao de um
clone do gene da
citocromo c de levedura.

As sondas heterlogas fazem uso da hibridizao entre seqncias relacionadas para e


identificao dos clones. Por exemplo, o gene da citocromo c de levedura, identifcado na seo anterior por sondas de oligonucleotdeos, poderia ser utilizado como sonda de hibridizao para identificar genes de citocromo c em bibliotecas de clones de outros organismos. Ume
sonda preparada a partir do gene de levedura no seria inteiramente complementar ao gene dc
Neurospora crassa, mas um pareamento de bases suficiente deveria ocorrer para que um hbrido fosse formado e detectado por auto-radiografia (Figura 8.16b). As condies experimentais seriam modificadas de modo que a estrutura heterloga no fosse desestabilizada c
perdida antes da auto-radiografia.
As sondas heterlogas tambm podem identificar genes relacionados no mesmo organismo. Se o clone de cDNA da gliadina do trigo, identihcado anteriormente no captulo por meio
da sondagem por abundncia, for utilizado na sondagem de uma biblioteca genmica, ele hi-

;Mas

Figura 8-16
heterlogas.

CLoruncev Grurcn e ANLrsE oe

DNA

1&l

bidizar no somente com seu prprio gene, mas tambm com uma variedade

de outros genes (Figura 8.16c). Todos eles relacionam-se ao cDNA da gliadina, mas possuem seqncias
de nucleotdeos levemente diferentes. Isso ocorre porque as gliadinas do trigo formam um
complexo grupo de protenas relacionadas que so codificadas pelos membros de uma famlia multignica. Uma vez que um gene da famflia tenha sido clonado, todos os demais membros podem ser isolados pela sondagem heterloga.

Mtodos de identificao baseados na deteco do produto de


traduo do gene clonado
As sondas de hibridizao so, geralmente, o mtodo preferido para a identificao de um determinado recombinante a partir de uma biblioteca de clones. A tcnica de fcil execuo e,
com as modificaes introduzidas nos ltimos anos, pode ser usada para analisar mais de
10.000 recombinantes por experimento, permitindo que grandes bibliotecas genmicas sejam
investigadas em um tempo razoavelmente curto. Entretanto, as necessidades para obteno de
uma sonda que seja, no mnimo, parcialmente complementar ao gene desejado s vezes tornam impossvel utilizar a hibridizao para identificar os clones. Nessas ocasies, uma estratgia diferente torna-se necessria.

(a) Um hbrido entre duas itas de DNA relacionadas

Pareamento de bases suiciente


para ormar uma estrutura estvel

Figura 8.15
O uso de um oligonucleotdeo sintli"
co, marcado na extremidade, para
identiicao de
clone do gene da
citocromo c de le'
vedura.

(b) Sondas heterlogas entre espcies


Gene da citocromo c
de levedura marcado
(

"\h.

Provvel clone
da ciocromo c
de Neurospora
Biblioteca genmica
do DNA de Neurospora

seqncias relacionadas para


c de levedura, identificado na

(c) Sondas heterlogas dentro de uma mesma espcie

ilizado como sonda de hibri


clones de outros organismos.
complementar ao gene
deveria ocoffer paa que um
8.16b). As condies ex
no fosse desestabilizada
relacionados rto mesmo
nte no captulo por
uma biblioteca genmica, ele

z-\

/a

l3

:-1

cDNA da gliadina
marcado
.\

. o r

tt7
\.t."1.
\i__2,

Figura 8.16
heterlogas.

) ("

:.'j'. "(
.

'

x.J

Biblioteca genmica do trigo

Membros da
amlia multignica
da gliadina

184

T. A. Bnowlr

Utiliza
colnias

A principal alternativa hibridizao com sondas a sondagem imunolgica (screening


immunological). A diferena est no fato de que, enquanto por meio das sondas de hibridizao o prprio fragmento de DNA clonado diretamente identificado, um mtodo imunolgico detecta a protena codificada pelo gene clonado. Logo, as tcnicas imunolgicas pressu-

Existem v
duo diret
feridas a ut

pem que o gene clonado esteja sendo expressado para que a protena esteja sendo sintetizada e que a mesma protena no esteja normalmente presente nas clulas hospedeiras.

tendo o ant
brana pode
tena bacte

Os anticorpos so necessrios para os mtodos imunolgicos


de deteco

(Figura 8.1
tadas por z

purificada de uma protena for injetada na corrente sangnea de um coelho"


o sistema imune do animal responde por meio da sntese de anticorpos que se ligam e ajudam
a degradar a molcula estranha (Figura 8.17a). Essa uma verso do mecanismo de defesa natural que os animais utilizam para lidar com invases bacterianas, virais e de outros agentes
infecciosos.
Uma vez que a protena injetada no coelho, os nveis de anticorpos presentes em sua corrente sangnea pernanecem suficientemente elevados pelos prximos dias para que quantidades substanciais sejam purifcadas. No necessirio matar o coelho, pois apenas 10 n dc
sangue fornecem uma quantidade razovel de anticorpos (Figura 8.17b). Esse anticorpo purificado liga-se somente protena que fora originalmente injetada no animal.
Se uma amostra

nescente P

(a) Anticorpos ligam-se s molculas exgenas

o,\

-?

Molcula exgena,
J
Por exemolo, Protena
p
F-'-=- Anticorpos
I

Figura 8.1t
lllizao de um an

(b) Puriicao dos anticorpos

Remoo de
10 ml de sangue

-l
Coelho inletado com
a protena exgena

Sangue

Anicorpo
puriicado

Figura 8.17
Anticorpos. (a) Os anticorpos na corrente
sangnea ligam-se a
molculas exgenas e
ajudam a degrad-las(b) Anticorpos purificados podem ser obtidos de um pequeno
volume de sangue retirado de um coelho
injetado com a prote
na exgena.

tborpo purifica

pra

detectar Prote
ffils em colnias re
combinantes. En
wda protena mat
cada A, o PrP
mticorpo pode se
rnarcado ou, alter
mrdi/amente, um s
gundo anticorP
rmrcado que se I
glrn esPeciicament
@ primeiro anticol
p pode ser usa

(
m

imunolgica,(scret

io das sondas de hibri


um mtodo im

imunolgicas
esteja sendo si
clulas hospedeiras.

imunolgicos
sangnea de um

que se ligam e aj
do mecanismo de defesa
virais e de outros

Cloruncera GNrcA E ANLrsE DE

DNA

Utilizao de um anticorpo puriicado para detectar protenas em


coln ias recombinantes
Existem vrias verses da sondagem imunolgica, mas o mtodo mais utilizado uma reproduo direta da sondagem por hibridizao em colnias. As colnias recombinantes so transferidas a uma membrana de polivinil, as clulas so lisadas e adicionada uma soluo contendo o anticorpo especfico (Figura 8.18a). O prprio anticorpo pode ser marcado ou a membrana pode ser subseqentemente lavada com uma soluo de protena A marcada, uma protena bacteriana que se liga especificamente s imunoglobulinas que constituem os anticorpos
(Figura 8.1 8b). A marcao pode ser radioativa, caso no qual as colnias marcadas so detectadas por auto-radiografia, ou no-radioativa, quando um sinal fluorescente ou quimioluminescente pode ser utilizado.

presentes em sua
mos dias para que

(a) Sondagem imunolgica

coelho, pois apenas 10 ml


8.17b). Esse anticorpo
no animal.

Colnias
Lise das clulas
(clorormio)

/\

Tt>>_7

ZHz'

Membrana

\noiao de anticopos

especficos

,/

Anticorpos ligam-se s clulas Iisadas


protena clonada
( contendo a

llr.[

z-+H--z
Protena A liga-se
ao anticorpo

,/

,,/

aatao da protena A
marcada com 1125

Figura 8.18
de um an-

Figura 8.17
Anticorpos. (a) Os
ticorpos na corrente
sangnea ligam-sea
molculas
ajudam a
(b) Anticorpos puriF
cados podem ser
dos de um pequeno
volume de sangue re
tirado de um coelho
injetado com a
na exgena.

185

?il?

zffi

mrpo puriicado
detectar prote
ern colnias recornbinantes. Em

(b) A auto-radiograia resultante

da protena marcada A, o prprio


rricorpo pode ser
nmarcado ou, altergundo anticorpo
mnnrcado que se liespecificamente
primeiro anticorp pode ser usado.

Srnal positivo = recombinante


sintetiza a protena clonada

186

T. A. Bnowr.r

O problema da expresso gnica


A sondagem imunolgica depende do fato de o gene clonado estar sendo expressado, de modo que o produto protico traduzido esteja presente nas clulas recombinantes. Entretanto, como ser discutido em maiores detalhes no Captulo 13, um gene de um determinado organismo geralmente no expressado em um organismo diferente. Em particular, bastante improvvel que um gene clonado de um animal ou planta (com exceo dos genes dos cloroplastos)
seja expressado em clulas de E. coli. Esse problema pode ser contornado empregando-se um
tipo especial de vetor, chamado de vetor de expresso (p.279), destinado especificamente a
promover a expresso do gene clonado em um hospedeiro bacteriano. A sondagem imunol
gica de colnias de E. coli recombinantes, contendo genes animais clonados em vetores de expresso, tem, de fato, sido muito til para a obteno de genes de virios hormnios importantes.

Leituras adicionais
Benton, W.D. & Davis, R.W. (1977) Screening ,gt recombinant clones by hybridization to single plaques in sinrScience, 196, I 80-82.
Dyson, N.J. & Brown, T.A. (2001) Immobilization of riucleic acids and hybridization analysis. ln'. Essential Moleculs
Biology: A Practical Approach, Yol.2 (ed. T.A. Brown), 2nd edn. In press.IRL Press at Oxford University Press.
Oxford.
Feinberg, A.P. & Vogelstein, B. (1983) A technique for labelling DNA restriction fragments to high specific activity.
Analytical Biochemistry, 132,6-13. [Marcao com iniciadores aleatrios (random priming).f
Grunstein, M. & Hogness, D.S. (1975) Colony hybridization: a method for the isolation of c'loned cDNAs that co*'
tain a specihc gene. Proceedings of the National Academy of sciences of the usA, 72, 3961-5.
Gubler, U. & Hoffman, B.J. (1983) A simple and very efficient method for generating cDNA libraries. Ganc"
2s,263-9Thorpe, G.H.G., Kricka, L.J., Moseley, S.B. & Whitehead, T.P (1985) Phenols as enhancers of the chemiluminesceil
horseradish peroxidase-luminol-hydrogen peroxide reaction: application in luminescence-monitored enzym
immunoassays. Ctinical Chemistry,3l, 1335-41. [Descreve o princpio do mtodo de marcao no-radioatirt-l
Young, R.A. & Davis, R.W. (1983) Efficient isolation of genes by using antibody probes. Proceedings of the Nati*
nalAcademy ofSciences ofthe USA,80,

ll94-8.

A reao em
187

PCR em deta

Como resu

bsicos da
como a an

DNA_DN
da princip:
gls

polym

que uma cl

tas vezes p
mas que p(
Este ca
se entenda
vante, segl

volvidos p

A reao
A reao

umamol
desde que

extremidar

cleotdeos
dupla (Fig
sntese de
Via de

ticus. Con

Cnprulo 9

sendo expressado, de

recombinantes. Entretanto,
de um determinado
particular, bastante i

A Reao em Cadeia da Polimerase

dos genes dos clorop

contornado empregando- se
)- destinado especifica
iano. A sondagem i
clonados em vetores de
vrios hormnios im

to single plaques in
analysis. ln: Es s ential
IRL Press at Oxford University

A reao em cadeia da polimerase em linhas gerais,


187

fragments to high specific


r

Problemas com a freqncia de erro da DNApolimerase de Taq,200

PCR em deLalhes, 190

random priming).1

i:olation of cloned cDNAs that

usA.72.396t-s.
generating cDNA libraries,
a-s

enhancers of the chemi

in luminescence-monitored
metodo de marcao noprobes. P roc e edin g s of the

Como resultado dos ltimos sete captulos, tornaram-se familiares no apenas os princpios
bsicos da clonagem de genes, mas, tambm, as tcnicas fundamentais da biologia molecular,
como a anlise por restrio, a eletroforese em gel, a marcao do DNA e a hibridizao
DNA-DNA. Para completar o estudo bsico de anlise do DNA, retomada, agora, a segunda principal tcnica para o estudo dos genes, a reao em cadeia da polimerase (PCR, do ingls polymerase chan reaction). A PCR uma tcnica muito simples: tudo o que acontece
que uma curta regio de uma molcula de DNA, um nico gene, por exemplo, copiada muitas vezes por uma enzima DNA-polimerase (Figura 1.2). Esse parece ser um exerccio trivial,
mas que possui mltiplas aplicaes em pesquisas genticas e em amplas reas da biologia.
Este captulo inicia com uma viso geral sobre a reao em cadeia da polimerase, para que
se entenda exatamente qual o seu alcance. Posteriormente, ser abordada a metodologia relevante, seguindo os passos envolvidos na PCR e os mtodos especiais que vm sendo desenvolvidos para o estudo dos fragmentos de DNA amplificados que so obtidos.

1 A reao em cadeia da polimerase em Iinhas gerais


A reao em cadeia da polimerase resulta na amplificao seletiva de uma regio escolhida de
uma molcula de DNA. Qualquer regio de qualquer molcula de DNA pode ser selecionada,
desde que as seqncias nas extremidades dessa regio sejam conhecidas. As seqncias das
extremidades devem ser conhecidas porque, pararealizar uma PCR, dois pequenos oligonucleotdeos devem hibridizar com a molcula de DNA, um com cada uma das htas da hlice
dupla (Figura 9.1). Esses oligonucleotdeos, que atuam como iniciadores para as reaes de
sntese de DNA, delimitam a regio que ser amplificada.
Via de regra, a amplificao realizadapela enzima DNA-polimerase I de Thermus aqua-

ticus. Conforme mencionado na pgina 68, esse organismo vive em ambientes quentes e mui-

188

T.A. Bnown

3'

5'

5'

5',

3',

Adio dos oligonucleotdeos


iniciadores
3'

5'

3'
Regio a ser ampliicada

Figura 9.1
Hibridizao dos oligonucleotdeos i
com o DNA-molde no
incio de uma PCR.

tas das suas enzimas, incluindo a polimerase de Taq, so termoestveis, o que significa
tncia desnaturao pelo calor. Como se tornar evidente a seguir, a termoestabilidade

polimerase de Taq essencial para a metodologia da PCR.


Para iniciar uma amplificao por PCR, a enzima adicionada ao DNA-molde
aos iniciadores e incubada, para que sintetize as novas fitas complementares (Figura 9.2a
mistura ento aquecida a94"C, para que as fitas recm-sintetizadas separem-se do
(Figura 9.2b) e, posteriormente resfriadas, permitam que mais iniciadores hibridizem
suas respectivas posies, incluindo aquelas das novas fitas sintetizadas. A polimerase de
que, diferentemente da maioria dos tipos de DNA-polimerases, no inativada pelo
agorarealiza uma segunda rodada de sntese de DNA (Figura 9.2c). O ciclo
bridizao-sntese repetido, geralmente 25 a3o vezes, resultando, ao final, na sntese de
tenas de milhes de cpias do fragmenro de DNA amplificado (Figura 9.2d).
Ao trmino de uma PCR, uma amostra da mistura de reao geralmente aniisada
eletroforese em gel de agarose; DNA suficiente foi produzido para que o fragmento
cado seja visvel como uma banda discreta aps a colorao com brometo de etdio
9.2e). A prpria anlise pode fornecer informaes teis a respeito da regio de DNA que

Figura

92

ffi,mea@o em ca-

dhiada polimera-

lTPs =2'4effiosiatos.

amplifica
de bacter
mo o seq

CLoruncev Grurcn e ANLrsE oe DNA

3'
ffi

189

5'

5'

3',

,5'

@
5',

3'

(a) Adio da DNA-potimerase

de lag+dNTPs

ffi

t--,--,-.,--,--,--,--,--,.-,--,--,--,a
Sntese da ita nova

:rrrrrrrr
/

-rFl?|ll,,

(b) Desnaturao

(c) Segundo ciclo de sntese

Figura 9.1
Hibridizao dos oligo
nucleotdeos inici
com o DNA-molde no
incio de uma PCR.

(d) Demais ciclos

is, o que signifca


seguir, a termoestabilidade

(e) Visualizao do produto

Produto da PCR

ao DNA-molde

(Figura 9
separem-se do
iniciadores hibridizem
A polimerase de
no inativada pelo
9.2c). O ciclo desnatu
ao final, na sntese de
(Figura 9.2d).
geralmente analisada
para que o fragmento
com brometo de etdio (
ito da regio de DNA que

Figura 9.2
A reao em caia da polimera-

lTPs =2'-de-

ACMULO EXPONENCIAL
DE FRAGMENOS AMPLIFICADOS

,/\
Marcadores

Gel de agarose

de tamanho

APOS 30 CICLOS:
228 = 268.435.456 FRAGMENTOS

trifosatos.

amplificada ou, alternativamente, o produto da PCR pode ser ligado a um vetor plasmidial ou
de bacterifago, clonado pelo mtodo normal e examinado por meio de tcnicas-padro, como o seqenciamento de DNA.

190

T.A. BRowN

9.2 PCR em detalhes


Embora experimentos com PCR sejam de muito fcil execuo, necessrio um planej:
to cuidadoso, caso espere-se que os resultados tenham algum valor. As seqncias dos i
dores so crticas para o sucesso do experimento, assim como a preciso das te
lizadas nos estgios de aquecimento e resfriamento do ciclo da reao. H tambm a i
tante questo sobre o que pode ser feito com as molculas de DNA amplificadas, uma vez
tidas.

9.2.1 Determinao dos oligonucleotdeos iniciadores para uma pcR


os iniciadores so a chave do sucesso ou da falha de um experimento de pcR. Se forem
jetados corretamente, o experimento resulta na amplificao de um nico fragmento de
correspondente regio-alvo da molcula-molde. Se os iniciadores forem projetados de
do incorreto, o experimento fracassar, possivelmente porque a amplificao no
possivelmente porque um fragmento errado, ou mais de um fragmento, ser amplificado
gura 9.3). Obviamente, grande parte do planejamento deve ser destinada determinao
iniciadores.
Desenvolver as seqncias apropriadas para os iniciadores no um problema: elas
corresponder s seqncias das extremidades da regio-alvo da molcula-molde. Cada ini
dor deve ser complementar (mas no idntico) sua fita-molde para que a hibridizao
ocoffer, e as extremidades 3' dos iniciadores que hibridizaram devem apontar uma em dire
..

(Figura 9.4r. o fragmento de DNA a ser amplificado no dev ter mais do que ct
i outra
de 3 kb de extenso e, idealmente, inferior a 1 kb. Fragmentos de mais de l0 kb podem
I

Figura

9,

de in'lciadon
para ampli
da u"glot
ftfi.nrano. Os xot
sao mostra

fecfi

ntrons, con
melrpulos aberto

m,

amplificad

ciente a a

ficao de

Marcadores
de tamanho

especiaisO ptin
pequenosindesejadr

um experi

dos, na ter

rios fragm
esses

inici

tios possr

Isso signil
nico e es

Figura 9.3
Os resultados das PCRs com iniciadores bem e pobremente planejados. A linha 1 mostra
um nico fragmento amplificado do tamanho esperado, resultante de um experimento bem
realizado. Na linha 2, no h produto de ampliicao, sugerindo que um ou ambos os iniciadores oram incapazes de hibridizar com o DNA-molde. As linhas 3 e 4 mostram, respectiva
mente, um produto de amplificao de tamanho incorreto e uma mistura de produtos (o pro
duto certo mais dois produtos errados);ambos os resultados devem-se hibridizao'de urn
ou dos dois iniciadores em stios que no os alvos da molcula de DNA-molde.

O que
9.4, fosser
acada4t'genoma h

stio de hi
ria, portar
Por qu
o comp

iniciadort

mero de n

CLonnceu GNrcA

Aruuse oe

DNA

191

Gene da o1-globina humano


necessrio um
.

As seqncias dos ini

reao. H tambm a i
amplificadas, uma vez
...G

para uma PCR


de PCR. Se forem
nico fragmento de
forem projetados de
amplificao no ocorren,
nto, ser amplificado
inada determinao

um problema: elas
cula-molde. Cada inici
Fra que a hibridizao
apontar uma em di
deve ter mais do que
de mais de l0 kb podem

lnejados. A linha 1 mostra


le de um experimento bem
b que um ou ambos os inicia.

ls 3 e 4 mostram, respectirra

mistura de produtos (o pro


hem-se hibridizao de
de DNA-molde.

roo nn

iso das temperaturas

TG TC

GA GTC TC TCT TGGG

5',

5'
Figura 9.4
par de iniciadores
para amplifio gene da a,-globimB humano. Os xons
so mostrados
rmn retngulos fechas, os ntrons, como
retngulos abertos.

TGG..
J

...C A C A G A C T C A G A G A G A A C C C A C C...

...A

TGGGGGCACCAGAA AC

TA T T T... 5'

3',

..,T

@
ACCC

CC GTGG TC T T TGAA TA 4A...3,

amplihcados por tcnicas-padro de PCR, porm, quanto mais longo o fragmento, menos eficiente a amplificao e mais difcil torna-se a obteno de resultados consistentes. A amplificao de fragmentos muito extensos - com cerca de 40 kb - possvel, mas requer mtodos
especiais.
O primeiro ponto importante a ser definido o tamanho dos iniciadores. Se forem muito
pequenos, podem hibridizar com stios que no os alvos e originar produtos de amplificao
indesejados. Para ilustrar essa questo, imagine que o DNA humano total seja utilizado em
um experimento de PCR com um par de iniciadores de 8 nucleotdeos de extenso (chamados, na terminologia do PCR, de "8-mers"). O resultado provvel seria a amplificao de vrios fragmentos diferentes. Isso acontece porque se espera que ocorram stios de ligao para
esses iniciadores, em mdia, a cada 48 = 65.536 pb, originando, aproximadamente, 46.000 stios possveis na seqncia de nucleotdos de 3.000.000 kb que constitui o genoma humano.
Isso signica que seria muito incomum que um par de iniciadores de S-mers originasse um
nico e especfico produto de amplificao para o DNA humano (Figura 9.5a).
O que aconteceria se os iniciadores de 17 nucleotdeos de extenso, mostrados na Figura
9.4, fossem utilizados? A freqncia esperada para uma seqncia de 17 nucleotdeos de I
a cada 411 = 17 .179.869 .184 pb. Esse tamanho cerca de cinco vezes maior que a extenso do
genoma humano, logo se esperaria que um iniciador de 17 nucleotdeos tivesse somente um
stio de hibridizao no DNA humano total. Um par de iniciadores de l7 nucleotdeos deveria, portanto, originar um produto de amplificao nico e especfico (Figura 9.5b).
Por que simplesmente no se desenvolvem iniciadores to longos quanto possvel? Porque
o comprimento do iniciador influencia o ritmo no qual ele se hibridiza com o DNA-molde;
iniciadores longos hibridizam em um ritmo mais lento. A eficincia da PCR, medida pelo nmero de molculas amplificadas produzidas durante o experimento, , conseqentemente, re-

il

192

T. A. Bnowlr

(a) PCR de DNA humano com iniciadoes de 8


nucleotdeos de extenso

Stios de hibridizao

/l
\
,/
l\
r_
J
\

3'1

kb

5'

vanos pares 0e rntcladores podem


originar produtos de ampliicao

(b) PCR de DNA humano com iniciadores de 17


nucleotdeos de extenso

3',

5'

Apenas o ragmento desejado


ampliicado

Figura 9.5
O comprimento dos iniciadores
crtico para a especiicidade da
PCR.

duzida se os iniciadores forem muito longos, pois a hibridizao completa com as molculm
do molde no pode ocorrer no tempo permitido durante o ciclo da reao. Na prtica, inicia.
dores de mais de 30 nucleotdeos de extenso so raramente utilizados.

g.2.2 Estabelecimento das temperaturas corretas a serem utilizadas


Durante cada ciclo de uma PCR, a mistura de reao submetida

trs temperaturas (Figura

e.6):

(1)

A temperatura de desnaturao, geralmente 94'c,

a qual quebra os pares de bases e libera as fitas nicas de DNA para atuarem como moldes na prxima rodada da sntese de

DNA.
(2)
(3)

A temperatura

de hibridizao ou de anelamento, na qual os iniciadores aderem-se ao,s


moldes.
A temperatura de extenso, na qual ocorre a sntese do DNA. comumente determinada em74"C,logo abaixo da temperatura tima para a DNA-polimerase de Taq.

A temperatura de anelamento a mais importante, pois pode afetar a especificidade da


reao. A hibridizao DNA-DNA um fenmeno dependente da temperatura. Se a temperatura for muito elevada, nenhuma hibridizao ocorrer e, ao contrrio, os iniciado.", o,
moldes permanecero dissociados (Figura 9.7a).Entretanto, se a temperatura for muito "bai-

Figun

perfil de temPen
tpico para uma t

lltm

xa, hbridor
dos - so e

mento apn

dos perfeit,
reamento f
aumenta si
no os alvt
A temp
entre o inir
dos incom

peratura

de.AZ.
se ("derret

mitir que

brido com
rm, mais

T^ = (4x

na qual [G
mero de nr

CLorunceu GNrcA

E Ar.rr-rse

oE

DNA

193

Desnaturao
(1 min)

()

I
I

670

Extenso
(2 min)

oE

.(l)

9-5

dos iniciadores
para a especiicidade da

completa com as
da reao. Na prtica, in

serem utilizadas
a trs temperaturas (Fi

quebra os paes de bases e


prxima rodada da sntese
os iniciadores aderem-se

A. E comumente dete
-polimerase de Taq.

afetar a especificidade
da temperatura. Se a

contririo, os iniciadores e
a temperatura for muito bai-

llm perfil de

Figura 9.tr
temperatura

tpico para uma PCR.

xa, hbridos incoretos - aqueles em que nem todos os pares de bases so corretamente formados - so estveis (Figura 9.7b). Caso isso acontea, os ciilculos prvios a respeito do compri-

mento apropriado dos iniciadores tornam-se irrelevantes, pois presumia-se que apenas hbridos perfeitos entre iniciadores e moldes fossem apazes de ser formados. Se os erros de pareamento forem tolerados, o nmero de potenciais stios de hibridizao para cada iniciador
aumenta significativamente e h maior tendncia de que a amplifico ocorra em stios que
no os alvos da molcula-molde.
A temperatura ideal de anelamento deve ser baixa o suficiente para permitir a hibridizao
entre o iniciador e o molde, mas alta tambm o suficiente para prevenir a formao de hbridos incorretos (Figura 9.7c). Essa temperatura pode ser estimada pela determinao da temperatura de fuso ou T-(do ingls melting temperature) do hbrido entre o iniciador e o molde. A Z- a temperatura na qual os hbridos com as bases corretamente pareadas dissociamse ("derretem"): uma temperatura
!3C abaixo dessa deve ser baixa o suficiente para permitir que os hbridos corretos formem-se, porm igualmente muito elevada para que um hbrido com um nico erro seja estvel. A Z. pode ser determinada de forma experimental, porm, maicomumente, calulada a partii a frmula simples (Figura 9.8):

T^ = (4x [G +

C\ + (2x

[ + fl)"C,

naqual[G+QonmerodenucleotdeosGeCnaseqnciadoiniciadorelA+Tfonmero de nucleotdeos A e T.

194

T.A.Bnown

Portail
clculo da
da. Note-s

(a)Temperatura de anelamento muito elevada

tenham

lniciadores e moldes
permanecem dissociados

4
a

^-attt

I-

iniciador

Aps a P

A reao e
perimento
recer irtfor

tudos dess
nagem gr
variedade
tcnicas v

(b)Temperatura de anelamento muito baixa

at----"-'''fr
B

-R...--,'"
\

\
__ FTl'Tl

Hibridizao incorreta
nem todos os pares

(1) Eletr
(2) Clor
(3) Seqi

As dut

de bases corretos
foram ormados

tulo 10, qr

Eletroo

Conforme

rif,rcados I
(c) Temperatura de

Umabanc
d etdio r
hibridiza

anelamento coeta

,-----(tt-"'ta

Figura 9.7
A temperatura exer@

um importante eeito
sobre a hibridizao
dos iniciadores com o
DNA-molde.

A iniciao ocorre
apenas nos stiosalvo desejados

nais estivt

Emall

se um exl
Por exeml

determina

restrio,
anlise d,
restrictiot
nmicos (

Alterr
Seqncia do

iniciador: 5' AGACTCAGAGAGAACCC

4Gs

3'

se o

5Cs 7As 1T

I,=(4x9)

DNA

gura 9.9).

profiling',

Em al
diagrstir

+(2xB)

= 36 + 16

identifica

= 52oC

Realizar I
rm uma

Figura 9-8
Clculo da

I,de

um iniciador.

muitasF(
zida pela

Crouecev Grurcn e ANLtsE oe

DNA

195

Portanto, a temperatura de anelamento para um experimento de PCR determinada pelo


clculo daT^para cada iniciador, utilizando-se uma temperatura I a2"C inferior encontrada. Note-se que isso significa que os dois iniciadores devem ser determinados de modo que
tenham s idnticas. Se no for esse o caso, a temperatura de anelamento apropriada para um
iniciador pode ser muito elevada ou muito baixa para o outro membro do par.

Aps a PCR: estudo dos produtos da PGR


A reao em cadeia

da polimerase geralmente o ponto de partida para longas sries de experipentos, nas quais o produto de amplificao estudado de vrias maneiras, a fim de oferecer informao a respeito da molcula de DNA que atuou como molde original. Muitos estudos desse tipo encontram-se nas partes 2 e 3, quando so examinadas as aplicaes da clonagem gnica e das anlises de DNA nas pesquisas e na biotecnologia. Embora uma ampla

variedade de procedimentos tenha sido desenvolvida para o estudo dos produtos da PCR, trs
tcnicas so particularmente importantes.

(1)
(2)
(3)

*\

Eletroforese em gel dos produtos da PCR.


lonagem dos produtos da PCR.
Seqenciamento dos produtos da

PCR.

As duas primeiras tcnicas so descritas neste captulo. A terceira ser adiada a o Cap-

tulo 10, quando sero abordados todos os aspectos do seqenciamento de DNA.

Eletroorese em gel dos produtos da PCR

Figura 9.7
A temperatura
um importante efeib
sobre a hibridizao
dos iniciadores com
DNA-molde.

b
h 7-de um iniciador.

Conforme indicado na Figura 9.2, os resultados da maioria dos experimentos de PCR so verificados fazendo-se migrar uma poro da mistura de reao amplificada em gel de agarose.
Uma banda representativa do DNA amplificado deve ser visvel aps colorao com brometo
d etdio ou, se a produo de DNA for baixa, o produto pode ser detectado pelo mtodo de
hibridizao de Southern (p. 201). Se a banda esperada estiver ausente ou se bandas adicionais estiverem presentes, algum erro ocorreu e o experimento deve ser repetido.
Em alguns casos, a eletroforese em gel de agarose utilizada no apenas para determinar
se um experimento de PCR funcionou, mas tambm para oferecer informaes adicionais.
Por exemplo, a presena de stios de restrio na regio amplificada do DNA-molde pode ser
determinada por intermdio do processamento do produto da PCR com uma endonuclease de
restrio, antes de fazer a amostra migrar no gel de agarose (Figura 9.9). Fsse um tipo de
anlise de polimorfismos de comprimento de fragmentos de restrio (RFLP, do ingls
restriction fragment length polymorphism) e importante tanto na construo de mapas genmicos (p.262) quanto no estudo de doenas genticas (p. 311).
Alternativamente, o tamanho exato do produto da PCR pode ser utilizado para estabelecer
se o DNA-molde contm alguma mutao de insero ou deleo na regio amplificada (Figura 9.9). As mutaes de comprimento desse tipo formam a base do perfl do DNA (DN
proftling), uma tcnica central na cincia forense (Captulo 16).
Em alguns experimentos, a simples presena ou ausncia do produto da PCR tem carter
diagnstico: por exemplo, quando a PCR utllizada como um procedimento de seleo para
identificar um gene desejado em uma biblioteca genmica ou de DNA complementar (cDNA).
Realizar PCRs com cada clone em uma bibliotea genmica parece ser uma tarefa tediosa, porm uma das vantagens da PCR que experimentos individuais so rapidamente montados e
muitas PCRs podem ser executadas paralelamente. A carga de trabalho tambm pode ser reduzidapela sondagem combinatria, um exemplo da qual mostrado na Figura 9.10.

196

A. Bnowlr

.L-

t,

O-\-

'+\

PCR

--.

\
PCR

\
Clivagem

.L/

Figura 9.9
A eletroorese err
gel do produto da
PCR pode
informaes sobru
a molcula de
DNA-molde. As F

nhasle2mostram, respectiva-

t-

f-

Marcadores de tamanho

mente, um
de PCR no-clirra
do e um prodo
clivado com ura
enzima que cliva
no stio R. A
mostra o
obtido quando o
DNA-molde corr
tm uma inser@
na regio ampli
cada.

Clonagem dos produtos da PCR


Algumas aplicaes necessitam que, aps

a PCR, os produtos resultantes sejam ligados a


vetor e examinados por qualquer um dos mtodos-padro utilizados nos estudos de c
do DNA. Isso pode parecer fcil, entretanto h complicaes.
O primeiro problema diz respeito s extremidades dos produtos da PCR. Ao se exarni
a Figura 9.2, possvel pensar que os fragmentos amplificados por PCR possuam
des cegas. Se assim fosse, eles poderiam ser inseridos em um vetor de clonagem por li
cega entre as extremidades ou, de modo alternativo, os produtos da PCR poderiam receber
tremidades coesivas pela unio com molculas de ligao ou adaptadores (p. 88). Infel
te, a situao no to simples. A DNA-polimerase de Thq tende a acrescentar um
deo adicional, em geral uma adenosina, extremidade de cada fita que ela sintetiza. Isso
nifica que um produto de PCR de fita dupla no possui extremidades cegas e, ao contrri
maioria das terminaes 3'possui um nico nucleotdeo sobressalente (Figura 9.11). Os
cleotdeos sobressalentes poderiam ser removidos pelo tratamento com uma enzima
clease, resultando produtos de PCR com extremidades cegas verdadeiras, porm essa
uma conduta poplar, pois difcil de impedir que a exonuclease se torne hiperativa e
outros danos s extremidades das molculas.
Uma soluo utilizar um vetor de clonagem especial, que contenha timidinas (T)
salentes e que, conseqentemente, possa ser ligado ao produto da PCR (Figura 9. 1 2). En
ral, tais vetores so preparados segundo a restrio de um vetor-padro em um stio de
nao cego e depois tratado com a DNA-polimerase de Taq, somente na presena de 2'
xitimidina 5'trifosfato (dTTP). Nenhum iniciador est presente, de modo que tudo que a
limerase pode fazer adicionar um nucleotdeo T s extremidades 3' da molcula cega do

&
, .-tt
I

Figura 9-10

A sondagem cr
nes sondada
naes de don

positivo(s) seia
plaa2, na linh
deduzir que exi
o no arr
resultados pci
srias se existir

Brown, T. A. (1

Clorunceu GNrcA

,",/

Figura 9.9
A eletroorese em
gel do produto da
PCR pode
inormaes sobre
a molcula de
DNA-molde. As lF

-?.-i.*-*-*-*-#.F,F*?

,-t':-,'" ,:";: :':-:r -,t ,,'" :i,r:t


{+;''' t*

7 ,,*t 1,,"-;t.r,^ ;"r- ,-;.*

r*} ,$1 {}}. *t9.ige.6 :;w;;.n'l


: ; ::. w. :.

{*e

nhasle2mos-

oe

DNA

197

Mistura,
PCR

.t
-1' "' ,//
/

Repetida para todas as linhas em


todas as 10 placas = 80 PCRs

tram, respectiva'
mente, um
de PCR
do e um produb
clivado com ufiar
enzima que cliva
no stio R. A
mostra o
obtido quando o
DNA-molde corr'
tm uma inser@
na regio amplifr.
cada.

E ANLrsE

Mistura, PCR

Repetida para todas as colunas em


todas as 10 placas = 120 PCRS
Mistura com cavidades A1 de todas as outras

placas, PCR

resultantes sejam ligados a


nos estudos de
da PCR. Ao se e
por PCR possum
vetor de clonagem por
da PCR poderiam
adaptadores (p. 88).
lende a acrescentar um nuc
fita que ela sintetiza. Isso
s cegas e, ao
ente (Figura 9.11). Os
com uma enzlma
verdadeiras, porm essa
se

torne hiperativa

contenha timidinas (T)


da PCR (Figura 9.12). Em
-padro em um stio de
somente na presena de 2'
de modo que tudo que a
3' da molcula cega do

Repetida para todas as cavidades


= 96 PCRs
Total de PCRS = 296

Figura 9.10
A sondagem combinatria de clones em placas de microtitulao. Uma biblioteca de 960 clones sondada por uma srie de PCRs, cada uma com uma combinao de clones. As combi-

naes de clones com resultados positivos permitem que a(s) cavidade(s) contendo clone(s)
positivo(s) seja(m) identiicada(s). Por exemplo, se PCRs positivas so obtidas na linha A da
placa 2, na linha D da placa 6, na coluna 7 da placa 2 e na coluna 9 da placa 6, ento se pode
deduzir que existam clones positivos nas cavidades A7 da placa 2 e D9 da placa 6. Essa deduo no ambgua e pode ser feita sem que se realizem as PCRs nas cavidades (que teriam
resultados positivos para as cavidades A7 e D9). As PCRs das cavidades somente so necessrias se existirem dois clones positivos na mesma placa. (Reproduzida com permisso de
Brown, T. A. (1999) Genomes. BIOS Scientific Publishers, Oxord.)

198

T. A. Bnowrl

eficientemente
3'

5',

AGAC TC AGA..............,,.......,...AAC T T A TT T A
lllllllll
ttttttltt
A TC TGAG TC T........,.,......,.........T TGA A T A AA
q,'

Figura 9.11

limitada qut

sentes no DNI
tenso da extn
zar com a mol

Polinucleotdeos sintetizados pela


DNA-polimerase de laq geralmente
possuem uma adenosina extra nas
suas terminaes 3'.

PCR que poss,

Produto da PCR

Vetor com
a cauda de T

Figura 9.13
Obteno de um
produto de PCR
@n uma extremidade coesiva Pelo uso
um iniciador cuia
seqncia inclui um
stio de restrio.

Figura 9.12
Utilizao de um vetor especial com uma
cauda de T para clonar um produto de
PCR.

tor, resultando em um vetor com uma cauda de I na qual os produtos da PCR podem ser inseridos.
Uma segunda soluo desenvolver iniciadores que possuam stios de restrio. Depois
da PCR, os produtos so tratados com uma endonuclease de restrio que, ao clivar cada molcula na seqncia iniciadora, gera fragmentos com extremidades coesivas, que podem ser

Fi
PCF
de
iniciador
Um
de restrio Present
extenso na extrel

Cloruneeu GNrcA

sintetizados pela
de ag geralmente
adenosina extra nas

E ANLrsE DE

DNA

199

eficientemente ligados em um vetor de clonagem padro (Figura 9.13). Essa abordagem no


limitada quelas circunstncias nas quais os iniciadores transpem os stios de restrio presentes no DNA-molde. Pelo contrrio, o stio de restrio pode ser includo em uma curta extenso da extremidade 5'de cada iniciador (Figura 9.14). Essas extenses no podem hibridizar com a molcula-molde, porm so copiadas durante a PCR, resultando em produtos de
PCR que possuem os stios de restrio terminais.

Seqncia do iniciador

5',

CTCTGGATCCAGATATG

3',

Produto resultante da PCR


A T G.....
CAGAT
C TCT G G ATC
I I I
r r r rl
ll
I tt
trr
AGAGAC C TA G GT CT A T A C.,,..
I

A extra

Figura 9.13

(Dteno de um
GATCCAGATATG,..,
llllllll
GTCTATAC,,,.

produto de PCR
extremidaiva pelo uso
iniciador cuja
ia inclui um
sb de restrio.

um vetor especial com


clonar um produto de

Extremidade
. coesiva

DNA-molde

3' ...GTG TC TGAG TC TC TCT TGGGTGG..

Irrililtll

da PCR podem

Figura 9.14
stios de restrio.
io que, ao clivar cade
s coesivas, que podeu

a-

lniciador

liador de PCR com stio


nestrio presente em uma

,r#nso na extremidade 5'

5'

200

T. A. BRowN

9.3 Problemas com a reqncia de erro da DNApolimerase de fag


Todas as DNA-polimerases cometem erros durante a sntese do DNA, ocasionalmente
rindo um nucleotdeo incorreto na fita de DNA em crescimento. A maioria das poli
entretanto, capaz de corrigir tais erros, retornando a eles e ressintetizando a seqncia
reta. Essa propriedade conhecida como uma funo de " leitura de reviso" e est na
dncia da polimerase possuir uma atividade de exonuclease no sentido 3'para 5' (p. 6a).
A DNA-polimerase de Taqparece no possuir a atividade de leitura de reviso e, como sultado, incapaz de corrigir seus eros. Isso significa que o DNA sintetizado pela DNA
limerase de Taq nem sempre uma cpia acurada do DNA-molde. O ndice de erro tem
estimado em I para cada 9.000 nucleotdeos de DNA sintetizados, o que pode paecer q
insignificante, mas que se traduz em 1 erro a cada 300 pb para os produtos da PCR
aps 30 ciclos. Isso porque a PCR envolve cpias feitas de cpias das cpias, de modo que
erros induzidos pela polimerase gradualmente se acumulam e os fragmentos produzidos ao
nal de uma PCR contm cpias dos erros iniciais, alm de quaisquer outros novos erros i
duzidos durante a rodada final de sntese.
Para muitas aplicaes, esse alto ndice de erro no representa um problema. Em parti
lar, o seqenciamento direto de um produto de PCR (p.216) providencia a seqncia
do molde, mesmo que os produtos da PCR contenham os erros introduzidos pela DNAmerase deTaq.Isso ocorre porque os eros so distribudos aleatoriamente, logo, para
molcula que possua um ero em um nucleotdeo em uma determinada posio, haver
tas molculas com a seqncia correta. Nesse contexto, a freqncia de erro , de fato, insi

nificante.
lsso no acontece se os produtos da PCR forem clonados. Cada clone resultante
mltiplas cpias de um nico fragmento amplihcado, logo o DNA clonado no possui,
sariamente, a mesma seqncia da molcula-molde original utilizada na PCR (Figura 9.1
Tal possibilidade gera uma incerteza para todos experimentos realizados com produtos
PCR clonados e determina que, sempre que possvel, o DNA amplificado deva ser
diretamente em vez de ser clonado.

Figura 9.15
Areqncia elevada de erro da DNApolimerase de Taq
lffina-se importante
,qpiando os produtos
rlas PCRs so clonados.

Leituras adicio

Marchuk, D., Dn
for direct clc
Rychlik, W., Spe
invitro. Nuc
Saiki, R.K., Gelf
table DNA p

CLorunceu Grurcn e Atuse oe DNA

NA.
Produtos de fita dupla
da PCR

DNA, ocasionalmente

-"------*t-rigao

A maioria

das
rintetizando a seqncia
de reviso" e est na de

'f-->'-

--j"-

hentido 3' paras' (p. 6a).

'/ -*.-

um

em (
vetor \
\

\
/

/
\---"

1</(\

ileirura de reviso e. comorE


5intetizado pela DNA-p
O ndice de erro rem si
o
fos. que pode parecer qrnr
produtos da PCR obri
fos
das
cpias. de modo quec
fs
Fagmentos produzidos ao fi
!
fiuer outros novos erros intu
I

[A

Errosemposies /
aleatrias/\\/

p.

\\---l

I \---l
Motcutas de DNA
recombinantes

,*"/

problema. Em particil
lra um
pvidencia a seqncia corrct
pnroduzidos pela DNA-po
ptoriamente. Iogo, para cail
pinada posio. haver mli

pcia

Ae

O--a\

eno . de fato. insQ

Fada clone resultante cont


fAclonado no possui. nec
lizada na PCR (Figura 9.1
I

realizados com produtos

deva ser estud:


foplificado

I
:

Figura 9.15
A reqncia eleva-

da de erro da DNApolimerase de Taq


bna-se importante
rando os produtos
das PCRs so clonados.

Um clone nico contm


mltiplas cpias da mesma
molcula
todas com os mesmos erros

ras adicionais
Marchuk, D., Drumm, M., Saulino, A. & Collins, F.S. (1991) Construction of T:vectors, a rapid and general system
for direct cloning of unmodihed PCR products. Nucleic Acids Research, lg, I t 54.
Rychlik, W, Spencer, WJ. & Rhoads, R.E. (1990) Optimization of the annealing temperature for DNA amplification
in vitro. Nucleic Acids Research, 18, 6409- 12.
Saiki' R.K., Gelfand, D.H., Stoffel, S. er ai. (1988) Primer-diected enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239,487-91. [A primeira descrio de PCR utilizando polim erase de Taq.]

PARTE2

APLTCAOES DA CLONAGEM
GNICA E DA ANALISE DE DNA
NA PESQUISA

l,

r!

Cnprulo 10
Estudando a Localizao e a
Estrutura do Gene

Como estudar a localizao de um gene, 205

Seqenciamento de DNA: revelando a estrutur de


um gene, 2l I

A Parte I deste livro mostrou como um experimento de clonagem habilmente realizado ou


uma reao em cadeia da polimerase (PCR) podem fornecer uma amostra pura de um gene individual, ou qualquer outra seqncia de DNA, separada dos demais genes e seqncias de
DNA da clula. Agora, a ateno volta-se para as maneiras como a clonagem, a PCR e outras
tcnicas de anlise do DNA so utilizadas para estudar os genes. Sero considerados trs aspectos da pesquisa na biologia molecular:

(1)
(2)
(3)

As tcnicas utilizadas para estudar a localizao e a estrutura de um gene (este Cap-

tulo).
os mtodos utilizados para estudar

a expresso e funo de um gene (captulo l l).


As vrias tcnicas coletivamente chamadas de genmicas e ps-genmicas (captu-

lo

12).

1 Como estudar a localizao de um gene


Vrias tcnicas esto disponveis para determinar alocalizao de um gene em uma molcula de DNA. A natureza precisa do procedimento utilizado depende do tamanho da molcula
de DNA envolvida, com as tcnicas aplicveis para molculas pequenas, tais como verses
normais e recombinantes de plasmdeos e cromossomos de fagos, sendo diferentes daquelas
utilizadas para alocalizao de um gene em molculas de DNA extensas, pertencentes aos
cromossomos eucariticos.

l
I

--u

ilt

206

T. A. Bnowlr

10.1.1 Localizando a posio de um gene em uma molcula


de DNA pequena
Considere novamente o exemplo da seleo direta utilizado no Captulo 8, o qual resultou m
gene que confere resistncia canamicina, originado de R6-5, sendo clonado como um fragmento de EcoRI portado pelo pBR322 (p. 167). Agora que o clone est disponvel, seria bastante til determinar-se em qual, dentre os 13 fragmentos de EcoRI de R6-5, o gene est lo"
calizado, uma vez que essa informao permitiria que o gene fosse colocado no mapa de rer
trio de R6-5 e posicionado em relao aos outros genes desse plasmdeo.
Primeiramente, uma clivagem de restrio de R6-5 com EcoRI deve ser separada pm
uma eletroforese em gel de agarose, de forma que os fragmentos individuais possam s
identificados (Figura 10.1a). Um desses fragmentos o mesmo que aquele inserido na nx)lcula de pBR322 recombinante, a qual contm o gene que confere resistncia canam

cina. O propsito , portanto, marcar a molcula recombinante e utiliz-la como sonda ut


reao de clivagem, o que pode ser obtido enquanto os fragmentos de restrio ainda exrto contidos no gel da eletroforese, mas os resultados no so normalmente muito bomi,
uma vez que a matriz do gel produz uma quantidade grande de sinais de hibridizao da
fundo inespecficos, que mascaram o sinal de hibridizao especfico. Ao contrrio, es
bandas de DNA do gel de agarose so transferidas para uma membrana de nilon ou nitocelulose, fornecendo um ambiente muito mais "limpo" para o experimento de hibridizero.

A transferncia das bandas de DNA de um gel de agarose para uma membrana utiliza
tcnica aperfeioada eml975 por E. M. Southern e referida como transferncia de
(ott Southern-blot). A membrana colocada sobre o gel e um tampo forado a passar
vs dele, carregando o DNA do gel para a membrana, na qual o DNA ligado. Aparelhos
fisticados podem ser adquiridos para auxiliar esse processo, mas muitos biologistas
lares preferem um dispositivo caseiro, que inclui uma grande quantidade de papis-toalhe
habilidades de equilbrio considerveis (Figura 10.1b). O mesmo mtodo pode tambm
utilizado para a transferncia de molculas de RNA (transferncia de "northern") ou
tenas (transferncia de "western' '). At o momento, ningum sugeriu uma transferncia
eastern" .
A transferncia de Southern resulta em uma membrana que contm uma rplica das
das de DNA do gel de agaose. Se a sonda marcada ento aplicada, a hibridizao ocorre
uma auto-radiografia (ou um sistema de deteco equivalente para uma sonda no-radioati
revela qual fragmento de restrio contm o gene clonado (Figura l0.lc). Assim poss
posicionar-se o gene que confere resistncia canamicina no mapa de restrio de R6-5
gura 10.1d).
A transferncia de Southern e a hibridizao podem ser utilizadas paralocalizar a
o de um gene clonado, ou um isolado por meio de PCR, dentro de uma molcula de
qualquer, da qual um mapa de restrio foi obtido. Note que essa molcula de DNA
ria ser, ela mesma, um plasmdeo ou fago recombinante, com a hibridizao de Sou
utilizada para determinar a posio exata de um gene no fragmento clonado. Isso i
tante, pois, com freqncia, o fragmento de DNA clonado relativamente extenso
exemplo, 40 kb para um vetor cosmidial), enquanto o gene de interesse, presente em
ma parte do fragmento clonado, pode possuir menos que 1 kb de tamanho. Tambm o
mento clonado pode caregar inmeros genes, alm daquele em estudo. As estratgias
critas no Captulo 8 para a identificao de um clone a partir de uma biblioteca genmi
podem, pois, ser seguidas por uma anlise de Southern da molcula de DNA recomb
para localizar a posio exata, dentro do fragmento clonado, do gene que est sendo
rado (Figura 10.2).
"

Figura 10.1
A hibridizao de
Southern.

1.2 Localizando
de DNA exte

A hibridizao d

do para a molcu
a maioria dos plr

Cr-oruaceu Gnrcn

ANLrsE oe

DNA

2O7

Dlcula
(a) Eletroorese do DNA de R6-5 clivado com EcoRl
8, o qual resu
pdo clonado como um
e est disponvel, seria
R.I de R6-5, o gene est

btulo

E colocado no mapa de

plasmdeo.

taRI deve ser separada


los individuais possam
lpe aquele inserido na
ere resistncia
,e utilizla como sonda
htos de restrio ainda
normalmente muito
c sinais de hibridizao

(b) Transerncia de Southern

pecfico. Ao contrrio,
inbrana de nilon ou ni

Papis-toalha
Membrana de nilon
--- ou nitrocelulose

---1--:---

=E-El-f-t,E=

-';e"t

experimento de hi
Suporte

furna membrana utiliza

hansferncia de
poforadoapassar
h*a e UgaOo. Aparelhos

(c) Resultado da sondagem por hibridizao

huitos biologistas

m
r

htiaaAe de papis
bmtodo pode tambm

fude"northern")

|l lll
<sitivo-rasmento6

ou

igeriu uma

htm uma rplica

Ha

(d) Posicionamento do ragmento no mapa de restrio de R6-5

das

hibridizao

luma sonda

h
p

lll llll

l0.lc). Assim

a-

Fragmeno 6 = posio

o";"" n".-

de restrio de R6-5

---

ladas para localizar a

ldr u-u

Stios de EcoRl

molcula de

h molcula de DNA
lhibridizao de
hto clonado. Isso i
blativamente extenso

Figura 10.1
A hibridizao de
Southern.

Lteresse, presente em

ltamanho. Tambm o
bstudo. As estratgias

I uma biblioteca
nrla de DNA recombi
Bene que est sendo

1.2 Localizando a posio de um gene em uma molcula


de DNA extensa
A hibridizao de Southern possvel somente se um mapa de restrio pode ser determinado para a molcula de DNA em estudo. Isso significa que o procedimento apropriado para
a maioria dos plasmdeos, bacterifagos e vrus, mas no pode ser utilizado paralocalTzar

208

T. A. Bnowlr

rede de poros
tamanho podr
gressivamen
que 50 kb n

Molcula de DNA recombinante


est o gene?

- onde

As limitar
mais complic
mais bem il
gls orthogor
longo do con
res de eletrod

ra 10.4a). O r
reo continu

Hibridizao
de Southern

Uma vez r
lculas de D
nos reta (Figr
DNA deve se
pois uma mol
mitindo que r
menso adicir

VETOR

Fragmento de restrio

contendo o gene

Figura 10.2
A hibridizao de Southern
ser utilizada para localizar a po.
sio de um gene clonado em
uma molcula de DNA recomt*.
nante.

o mapeamento de restrio torna-se muito


do com molculas com mais de 250 kb de tamanho, conforne pode ser notado se for
a Figura 4.18. Esse exemplo de mapeamento de restrio bastante direto, uma vez qu
molcula de l, no muito extensa. Imagine o quanto a anlise seria mais complexa se
tisse uma quantidade de stios de restrio cinco vezes maior. Outras tcnicas devem,
to, ser utilizadas para localizar as posies de genes eucariticos nas molculas de DNA
genes em molculas de DNA extensas.

mossmico.

Separando cromossomos por meio da eletroorese em gel


A primeira questo a formular : qual cromossomo contm o gene de interesse? para
organismos isso pode ser respondido segundo um tipo especial de hibridizao de Sou
envolvendo, em vez de fragmentos de restrio, molculas de DNA cromossmico i
separadas por um tipo inovador de eletroforese em gel.
Na eletroforese em gel convencional, conforme descrita na pgina 78, o campo eltrico
t orientado junto com o comprimento do gel e as molculas de DNA migram em um linha
ta em direo ao plo positivo (Figura 10.3a). Molculas com tamanhos diferentes podem
separadas devido s suas velocidades diferentes, com as quais elas so capazes de migrar

Figura 10.3
em gel
agarose convene suas limitaes.

CLouceu

GNrcA E Ar.rr-rse oe

DNA

209

rede de poros que compe o gel. No entanto, somente molculas dentro de uma certa faixa de
tamanho podem ser assim separadas, pois a diferena na velocidade de migrao torna-se progressivamente menor para molculas maiores (Figura 10.3b). Na prtica, molculas maiores do
que 50 kb no podem ser eficientemente resolvidas por eletroforese em gel padro.
As limitaes da eletroforese em gel-padro podem ser resolvidas se um cmpo eltrico
mais complicado utilizado. Virios sistemas diferentes foram desenvolvidos, mas o princpio
mais bem ilustrado pela eletroferese em gel de campo pulsado ortogonal (OFAGE, do ingln orthogonalfield alternation gel electrophoresls). Em vez de ser aplicado diretamente ao
longo do comprimento do gel, o campo eltrico, nesse experimento, alterna-se entre dois pares de eletrodos, cada um ajustado em um ngulo de 45" em relao extenso do gel (Figura10.4a). O resultado um campo pulsado, com as molculas de DNA no gel trocando de direo continuamente, de acordo com os pulsos.
Uma vez que os dois campos alternam de uma maneira regular, o movimento final das molculas de DNA no gel ainda de uma extremidade para a outra, em uma linha mais ou menos reta (Figura 10.4a). No entanto, em cada troca na direo do campo, cada molcula de
DNA deve ser realinhada por 90', antes que a sua migrao continue. Esse o ponto-chave,
pois uma molcula pequena pode realinhar-se de forma mais rpida do que uma extensa, permitindo que a molcula curta progrida em direo base do gel mais rapidamente. Essa dimenso adicional aumenta o poder de resoluo do gel um tanto drasticamente, de forma que

(a) Eletrofores em gel de agarose convencional

Jura 1O.2

fbridizao de Southern

[ilizada para localizar

[-,-

po de um gene clonado em
p molcula de DNA

Fe

//

//

mroracao Il

-----E--

foo torna-se muito


lpode ser notado se for
lstante direto, uma vez
p seria mais complexa se
hrtras tcnicas devem,
Ds nas molculas de DNA

(b) A inluncia do comprimento do DNA


na velocidade de migrao

Baixa resoluo das


molculas de DNA acima
de um determrnado tamanho

!^

o<

$e em gel

CZ
o
.Eo

pne de interesse? Para


lde hibridizao de
DNA cromossmico

F:

Figura 10.3
kgina 78, o campo el
DNA migram em um linha

panhos diferentes podem


fas so capazes de migrar

Resoluo adequada das


molculas de DNA nessa
faixa de tamnho

O:i
j.c)
ot

em gel
agarose convene suas limitaoes.

oE
Distncia migrada em x horas

21O

T.A.Bnowru

molculas com mais de vrios milhares de quilobases de comprimento podem ser separadasEssa amplitude de tamanho inclui molculas cromossmicas de muitos eucariotos, incluindo
levedura, virios fungos filamentosos importantes e protozorios, tal como o parasita da m[na plasmodiumfalciparum. Gis mostrando os cromossomos desses organismos podem, patanto, ser obtidos (Figura 10.4b).
A eletroforese em gel de campo pulsado ortogonal e tcnicas relacionadas, tais como on
campos eltricos homogneos de contornos grampeados (CHEF, do ingls contour clam'
pediomogeneous electric fields) e a eletroforese em gel de campo invertido (FIGE' do ingl,sfietd irwersion gel electrophoresis), so importantes por inmeras razes' Por exemplo'o
bNa. a" cromossomos individuais pode ser purificado do gel, possibilitando que conjuntos &
bibliotecas genmicas cromossmicas sejam preparadas. Cada uma dessas bibliotecas, colD'
tendo os genes de somente um nico cromossomo, substancialmente menor e mais fcil &
manipular do que uma biblioteca genmica completa. Alm disso' molculas de DNA co"
mossmicas podem ser imobilizadas em uma membrana de nitrocelulose ou nilon pela tram.
ferncia de Southern e serem submetidas anlise por hibridizao. Assim, o c
que possuir um gene clonado ou um gene isolado pela PCR pode ser identificado.

A hibridiza
cromossom
As tcnicas de

limitadas aos er
culas muito ma
de alguma fom

molculas de D
sui a vantagem
do, mas tambr

A hibridiza

servar cromoss
tos organismos
pelo padro de
fornece uma lo
tica de um cro
As clulas r

com ribonucle
DNA. O parea

(a) OFAGE

mossomos des
enclausurados
da e aplicada
mossmica hor

'mt
\l-'
;i_ \

o dessa manr
ca difcil, a hib
meros genes ni

Como uma
sonda e a hibri

-/

\1

ptico. Se fluc
mesmo tempo
tas de suas flu
ingls fluoresc

jas localizat
estudo de clu
cromossmica

identificados r

(b) Separao dos cromossomos de


levedura por meio da OFAGE

nicas de colon
tV
XV

iO.2 Seqencii

Xlll. XVI

-: xtv
---VII,

de um ger

--tl
-xl

Provavelmentr
ciamento de f
Nmero do cromossomo

l-

ser determina<

Figura 10.4
Eletroorese em gel de camPo
do ortogonal (OFAGE).

Pul*

do e eficiente

Croxneev Grurcn e ANLrsE oe

podem ser

muitos eucariotos, inc


tal como o parasita da
organismos podem,
relacionadas. tais
, do ingls contour

invertido (FIGE, doi


razes. Por e

bilitando que
uma dessas bibliotecasmenor e mals
sso, molculas de DNA
ulose ou nilon pela
;o. Assim, o cr
ser identificado.

DNA

211

A hibridizao in siu para visualizar a posio de um gene em um


cromossomo eucaritico
As tcnicas de eletroforese em gel no-convencionais, incluindo OFAGE, so, at o momento,
limitadas aos eucariotos inferiores, cujos cromossomos so relativamente pequenos. As molculas muito maiores (> 50.000 kb) dos mamferos e outros eucariotos superiores esto ainda,
de alguma forma, alm da capacidade da tecnologia atual. A localizao de um gene nessas
molculas de DNA extensas pode, no entanto, ser obtida pela hibridizao in sia, a qual possui a vantagem adicional de no apenas identificar em qual cromossomo o gene est localizado, mas tambm fomecer informao a respeito da posio do gene no seu cromossomo.
A hibridizao in situ deriva das tcnicas de microscopia ptica padro, utilizadas para observar cromossomos em clulas que esto em processo de diviso (Figura 10.5a). Com muitos organismos, cromossomos individuais podem ser reconhecidos por meio de suas formas e
pelo padro de bandeamento produzido por vrios tipos de corantes. A hibridizao in situ
fornece uma localizao visual direta de um gene clonado sobre a imagem de microscopia ptica de um cromossomo.
As clulas so tratadas com um fixador, ligadas a uma lmina de vidro e, ento, incubadas
com ribonuclease e hidrxido de sdio para degradar o RNA e desnaturar as molculas de
DNA. O pareamento de bases entre as fitas polinucleotdicas individuais desfeito, e os cromossomos desempacotam-se em um certo nvel, expondo segmentos de DNA normalmente
enclausurados dentro da sua estrutura (Figura 10.5b). Uma amostra de gene , ento, macada e aplicada preparao cromossmica. A hibridizao ocorre entre o gene e sua cpia cromossmica homloga, resultando em uma mancha escura em uma auto-radiografia. A posio dessa mancha indica a localizao do gene em seu cromossomo. Embora seja uma tcnica difcil, a hibridizao in situ com sondas radioativas tem sido ilizadapnaposicionar inmeros genes no mapa citogentico humano.
Como uma alternativa marcao radioativa, um marcador fluorescente pode ser ligado
sonda e a hibridizao observada diretamente, utilizando-se um tipo especial de microscpio
ptico. Se fluorocromos diferentes so utilizados, dois ou mais genes podem ser sondados ao
mesmo tempo, com os diferentes sinais de hibridizao sendo distinguidos pelas cores dstitas de suas fluorescncias. Essa tcnica, hibridizao in stu com fluorescncia (FISH, do
ingls fluorescence in sitn hibridization), tambm freqentemente utilizada com sondas, cujas localizaes cromossmicas normais j so conhecidas. Isso particularmente til para o
estudo de clulas que sofreram rearranjos cromossmicos. Rearranjo.s, tais como duplicaes
cromossmicas, ou a translocao de um segmento de um cromossomo para outro, podem ser
identificados relativamente rpido pela FISH, bem mais rapidamente do que por meio das tcnicas de colorao convencionais.

Seqenciamento de DNA: revelando a estrutura


de um gene

110.4

h"r" er gel de campo


lgonal(OFAGE).
I
I

I
!

ra'-'

Provavelmente, a tcnica mais importante disponvel para o biologista molecular o seqenciamento de DNA, pelo qual a ordem exata dos nucleotdeos em um segmento de DNA pode
ser determinada. Somente a partir do final da dcada de 1970 o seqenciamento de DNA rpido e eficiente tornou-se possvel.

212

T.A.BRowN

10.2.1 O mtodo de
de cadeia

(a) Cromossomos humanos na metlase

t/.r,ts

Padro de
bandeamento
reconhecvel

fl=

*4 *o,*l ,,
Nrly.;:5,,a
' rnlrV
^r,t
I

O mtodo de termir
a ser seqenciada t
to por terminao r
plementar a um m(

O iniciador

ffi

-.--------**') /

O primeiro Pasn

romossomo

10 pm

lamento de um olil
nante (Figura 10-

fita comPlementar,

ma relacionada" tal
cada peloSc6
dupla, a Partir da q

(b) Hibridizao in situ

/)

sio adjacente ao

3::ffi::i::"'

Sntese da ita
A reao de sntes
cada um dos quan

f f

midina 5'-trifosfat
fosfato [dCTP]).1

.Apricao da sonda,

auto-radiografia

Lmina de vidro
com as clulas

ra de reao. Esse

fixadas

rado na cadeia Pc

cleotdeo normal,
cleotdeo no Pos
Esse grupo nect

deia ocorre, poru


la enzima.
Se didesoxi-l
Manchas mostram
a localizao

cromossmica
de um gene clonado

opostas s timina
meira T, uma vez

/ -'t

,/
=-qj
-/o

,4'

i i ,[/
|,/
-/
\

Figura 10.5
Cromossomos e
hibridizao rn sr
tu.

didesoxinucleo
ser polimerizada

ja incorporada-

diferentes, mas c

Quatro rea
itas terminat
A reao de sntr
Duas tecnologias diferentes foram desenvolvidas quase que simultaneamente - o mtodo'
de terminao de cadeia por F. Sanger e A. R. Coulson, no Reino Unido, e o mtodo de degradao qumica por A. Maxam e W. Gilbert, nos Estados Unidos. As duas tcnicas so radicalmente diferentes, mas igualmente valiosas. Ambas permitem que seqncias de DNA de vrrios quilobases de tamanho sejam determinadas em um tempo mnimo. A seqncia do DNA
, no momento, a primeira e o tipo mais bsico de informao a ser obtido, em relao a um
gene clonado.

com didesoxi-Al
soxi-CTP. O resr

uma famflia cent


do em didesoxi-1
O prximo p
tos de cada fita 1
gel, embora as cr

Croruecev Grurca e ANLtsE oe

DNA

213

O mtodo de Sanger-Coulson: nucleotdeos terminadores


de cadeia
O mtodo de terminao de cadeia necessita de um DNA de fita simples e, assim, a molcula
a ser seqenciada normalmente clonada em um vetor M13. Isso porque o seqenciamento por terminao de cadeia envolve a sntese enzimtica de uma segunda fita de DNA, complementar a um molde existente.

O iniciador
O primeiro passo em um experimento de seqenciamento por terminao de cadeia o anelamento de um oligonucleotdeo iniciador pequeno Qtrimer) na molcula de M13 recombinante (Figura 10.6a). Esse iniciador atua como o ponto de partida paru arcao de sntese da
fita complementar, realizada pelo fragmento de Klenow da DNA-polimerase I, ou uma enzima relacionada, tal como a "Sequenase", uma verso modihcada da DNA-polimerase codifi-

cadapeloE@'Lembre.sedequeessasenzimasnecessitamdeumaregiodefita
dupla, a partir da q'ual iniciam a sntese da fita (p. 68). O iniciador anela no vetor em uma posio adjacente ao stio de clonagem.

Sntese da ita complementar


A reao de sntese

da fita complementar iniciada pela adio da enzima, juntamente com


cada um dos quatro desoxinucleotdeos (2'-desoxiadenosina 5'-trifosfato [dATP], 2'-desoxiti-

midina 5'-trifosfato IdTTP], 2'-desoxiguanosina 5'-trifosfato tdGTPl, 2'-desoxicitidina 5'-trifosfato tdCTPl). Alm disso, um nico nucleotdeo modificado tambm includo na mistura de reao. Esse um didesoxinucleotdeo (p. ex., didesoxi-AlP), o qual pode ser incorporado na cadeia polinucleotdica em crescimento da mesma maneira eficiente como um nucleotdeo normal, mas que bloqueia o avano da sntese da fita. Isso porque o didesoxinucleotdeo no possui o grupo hidroxila na posio 3' da molcula de acar (Figura 10.6b).
Esse grupo necessirio para que o prximo nucleotdeo seja adicionado; a terminao da cadeia ocorre, portanto, em todo o momento em que um didesoxinucleotdeo incorporado pe-

laenzima.

Figura 10.5

Cromossomc
hibridizao in
tu.

Se didesoxi-AlP adicionado na mistura de reao, a terminao ocoffe nas posies


opostas s timinas no molde (Figura 10.6c). Porm, a terminao nem sempre ocorre na primeira I uma vez que dATP normal tambm est presente e pode ser incorporado, em vez do
didesoxinucleotdeo. Arazo de dATP para didesoxi-ATP tal que uma fita individual pode
ser polimerizada por uma extenso considervel, antes que uma molcuia de didesoxi-AlP seja incorporada. O resultado que uma famflia de fitas novas obtida, todas de comprimentos
diferentes, mas cada uma terminando em um didesoxi-ATP.

Quatro reaes separadas resultam em quatro amlias de


itas terminadas
multaneamente

Unido,eomtodode
s duas tcnicas so radi
e

seqncias de DNA de

nimo. A seqncia do
ser obtido, em relao a

A reao de sntese

da fita realizadaem quatro reaes simultneas. Assim como a reao


com didesoxi-ATP, existe uma com didesoxi-TTP, uma com didesoxi-GTP e uma com didesoxi-CTP. O resultado so quatro famflias distintas de polinucleotdeos recm-sintetizados,
uma famlia contendo fitas em que todas terminam em didesoxi-ATP, uma de fitas terminando em didesoxi-TTP, etc.
O prximo passo separar os componentes de cada famlia, de forma que os comprimentos de cada fita possam ser determinados. Isso pode ser obtido por meio da eletroforese em

gel, embora as condies devam ser cuidadosamente controladas, pois necessrio separar as

214

T. A. Bnowr.r

fitas que diferem em extenso por apenas um nucleotdeo. Na prtica, a eletroforese reahada em gis de poliacrilamida muito hnos (com menos de 0,5 mm de espessura). Os gis cmtm uria, a qual desnatura o DNA, de forma que as fitas recm-sintetizadas dissociam-se dan
fitas-molde. Ademais, a eletroforese realizada em uma voltagem elevada, de maneira queo'
gel aquecido at 60oC ou mais, garantindo que as fitas no se iro reassociar de forma algu-

o introduzida.

ma.

A leitura da

Cada banda no gel contm somente uma pequena quantidade de DNA, de forma que urn
auto-radiografia deve ser utilizada para a visualizao do resultado (Figura 10.6d). A marw

mais, localizadavido incorpora


essa banda aparec(
qncia , portantr
A prxima bar
cleotdeo mais lon
Figura 10.7); o sq
O processo coi
nam-se to aglorn
partir de uma auto

(a) Anelamento do iniciador

Gene inserido em
um vetor M13

M13

tivo (p. e*., "P-

on

experimento.

Lendo a seqi
seq

lniciador

10.2.2 O mtodo de

NHr

b) Didesoxi-ATP
DNA-polimerase
dATP dTTP
dGTP dCTP
didesoxi-ATP

'G-

-O-P-?-O-P-o?
P

lt

ilill

/-"-"-\"

cH2

Existem somente

"\!l
'l-".-"2"" l-

Sanger-Coulson e

DNA de fita dupla

!,r"-.-l
pC
n'ficrc iJ
tt

cial. Tampouco ur
a sntese de umi

Cu

reagentes qumict

HH

.Posio onde o -OH


(c) Sntese das itas

de um dNTP foi substitudo


por -H

qtrltr-r-

__

___

Novasfitas, -iiri
i iii
iii
--ii
todasterminamem Jjl

I rr

um

didesoxi-ATP

--a'r
::_i

i ii
i

Didesoxi-ATp

lniciador
(d) Auto-radiograia resultante

Fragmentos menors

Figura 10.6
Seqenciamento de
DNA por terminao de
cadeia.

lnterpretao da auto-radi
duzida em um experimento
ciamento por terminac
Cada canaleta contm os
produzidos pelas snteses
presena de um dos quatro
cleotdeos trifosatos (dide
A seqncia lida pela iden
canaleta em que cada rag
rece, iniciando-s com aqr
grou para mais longe d

gradualmente avanando i
autG

CLoNAcEM Grutcn e ANLtsE oe

DNA

215

radioao introduzida, nas fitas recm-sintetizadas, pela incluso de um deoxinucleotdeo


t'S-dATP;
do
incio
fitas
no
sntese
das
de
na
etapa
de
reao
mistura
na
(p.
ou
ex.,"Ptivo

eletroforese
de espessura). Os gis
intetizadas dissociam-se
elevada, de maneira
iro reassociar de forma
a

experimento.

Lendo a seqncia de DNA a partir da auto'radiograia


muito fcil (Figura 10.7). A primeira banda, ou seja, a que migrou
mais, localizada, a qual representa o menor segmento de DNA, a fita que foi terminada devido incorporao do didesoxinucleotdeo na primeira posio do molde. A canaleta na qual
essa banda apareceu anotada. Digamos que foi na canaleta A; o primeiro nucleotdeo da seqncia , Portanto, A.
A prxima banda com maior mobilidade corresponde molcula de DNA que um nucleotdeo mais longa do que a primeira. A canaleta registrada (T no exemplo mostrado na
Figura 10.7); o segundo nucleotdeo , portanto, I e a seqncia, a o momento, AIO processo continua ao longo de toda auto-radiografia at que as bandas individuais tornam-se to aglomeradas que no podem mais ser separadas umas das outras. Geralmente, a
partir de uma auto-radiografia, possvel ler-se uma seqncia de cerca de 400 nucleotdeos.

A leitura da seqncia
de DNA, de forma que

(Figura 10.6d). A

10.2.2

NHp
I

o mtodo de Maxam-Gilbert: degradao qumica de DNA


Existem somente umas poucas sirnilaridades entre os mtodos de seqenciamento de DNA de
Sanger-Coulson e Maxam-Gilbert. O mtodo de Maxam-Gilbert necessita de fragmentos de
DNA de fita dupla, de forma que a clonagem em um vetor M13 no um passo inicial essencial. Tampouco um iniciador adicionado, pois o princpio da tcnica de Maxam-Gilbert no
a sntese de uma fita nova, mas a clivagem de uma molcula de DNA existente, utilizando
reagentes qumicos que atuam especificamente em um determinado nucleotdeo.

"-"\"
ltl

-*?t*

Didesoxi-NTP
G

ATTGCGATTCG ddc

ATTGCGATTCddc
ATTGCGATTddc

Figura 10.7

Figura
mento de
DNA por
minao
cadeia.

r_-

Interpretao da auto-radiograia prorzida em um experimento de seqenciamento por terminao de cadeia.


Cada canaleta contm os ragmentos
produzidos pelas snteses das itas na
de um dos quatro didesoxinudeotdeos triosatos (didesoxi-NTPs).
seqncia lida pela identiicao da
canaleta em que cada ragmento aparece, iniciando-se com aquele que migrou para mais longe da origem, e

gradualmente avanando ao longo da


auto-radiograia.

ATTGCGATddT
ATTGCGAddT
ATTGCG ddA

ATTGCddc
ATTG ddC

ATTddc

AddT
AddT
ddA

Direo da
eletroforese

216

T.A.BRowN

Existem diversas variaes do mtodo de Maxam-Gilbert, diferindo em detalhes,


tais como a maneira pela qual o DNA marcado obtido e anaturezaexata dos reagentes
de clivagem
que so utilizados. A maioria desses reagentes muito txica produtos qumicos
que clivam
molculas de DNA em um tubo de ensaio iro fazer o mesmo no organismo,
devendo ser tomado um cuidado muito grande quando estes so utilizados.
A descrio seguinte uma verso popular da tcnica de Maxam-Gilbert. Um fragmento
de DNA de fita dupla que ir ser seqenciado , primeiramente, marcado pela
ligao de um
grupo fosfato radioativo na extremidade 5'de cada fita (Figura 10.8a). limtilsutixido
(DMSO) , eto, adicionado e a amostra de DNA marcada aluecida a 90"C. Isso resulta
na quebra do pareamento de bases e dissociao da molcula de DNA em suas duas fitas componentes, as quais so separadas uma da outra pela eletroforese em gel (Figura lg.Sb),
com base no
fato de que uma das fitas provavelmente contenha uma maior quantidade de nucleotdeos
punicos do que a outra, e ir, portanto, ser levemente mais pesada, movendo-se mais lentamente durante a eletroforese. Uma fita purificada do gel e dividida em quatro amostras,
cada
uma delas tratada com um dos reagentes de clivagem. De fato, o primeiro conjunto de reagentes a ser adicionado provoca uma modificao qumica nos nucleotdeos para os quais
eles so
especficos, tornando a fita suscetvel clivagem naquele nucleotdeo, quando um produto
qumico adicional - piperidina - for adicionado (Figura 10.8c). A modifico e as reaes
de
clivagem so realizadas sob condies que resultam em apenas uma quebra por fita.
Alguns dos fragmentos clivados retm a marcao com "P nas suas extremidades 5'. Aps
a eletroforese, utilizando-se as mesmas condies especiais como paa
o seqenciamento por
terminao de cadeia, as bandas so visualizadas pela auto-radigrafia qe representa
tais
fragmentos marcados. A seqncia de nucleotdeos pode, ento, ser lida da auto-radiograha
exatamente como para o experimento de terminao de cadeia (Figura lO.gd).

10.2.3 Seqenciamento de produtos de pCR


Conforme descrito na pgina 195, alguns experimentos de PCR so projetados de forma
que
a informao desejada a respeito do gene, ou outra seqncia de DNA que
est sendo estuanoA" ser obtida simplesmente pela anlise dos produtos por meio da eletroforese em gel.

{u'

Freqentemente, no entanto, necessrio determinar a seqncia do fragmento


de DNA amplificado, o que pode ser obtido pela clonagem do produto da pcR (p. 1 96) e pela
utilizao
de um mtodo de seqenciamento padro com terminadores de cade
ou degradao qumica, conforme foi descrito.

Um problema com essa abordagem que as seqncias dos clones individuais podem
no
representar fielmente a seqncia da molcula de DNA-molde originat, em
decorrncia dos erros ocasionalmente introduzidos pela DNA-polimerase de Taq durante o processo
de amplifi-

cao (p. 200). Mtodos que seqenciam diretamente um produto de PCR,


sem a necessidade
de clonagem, so, portanto, necessrios.

Figura 10.8
Uma verso do s+.
qenciamento de DNA
pelo mtodo de degradao qumica.

Seqenciamento direto dos produtos da pCR


O mtodo de seqenciamento direto est baseado na tcnica de Sanger-Coulson
e, portanto,
requer DNA de fita simples como material inicial. O produto da PCR
, obviamente, de fita
dupla, de forma que maneiras de purificar fitas simpls so necessirias. H
virias possibilidades, a melhor delas realizar-se a PCR inicial com um iniciador
normal e um modificado,
o iniciador modificado de tal maneira que as ftas de DNA sintetizadas
a partir dele sejam facilmente purificadas. Um modo brilhante de se realizar isso pela ligao
de pequens esferas magnticas em um dos iniciadores. Aps a PCR, o DNA de fita
smples e utioo pela se-

parao da fiti
za um iniciadr
na, uma protel
Uma vez c

tes so semell
culas com cad
Sequenase. A

Cr-orueeeu GNrcA

E ANLrsE

oe

DNA

217

diferindo em detalhes, tais


dos reagentes de cli

(a) Marcao e dissociao das itas

produtos qumicos que


no organismo, devendo ser

Polinucieotdeo-

*#:il rrfltr

-@

Um
marcado pela ligao de

@'.,

;PdATP*

5:1'ff[:;

DMSO

10.8a). Dimetilsulfxido

90'C

ida a 90'C. Isso resulta na


em suas duas fitas com
(Figura 10.8b), com base
idade de nucleotdeos
movendo-se mais
em quatro amostras,
o primeiro conjunto de
deos para os quais eles
quando um

A modificao

.---.I

qurnase

,--"-O---l

o--

,---t--o

.-/
(b) Separao das itas leve
e pesada

/
Marcao das
extremidades 5'

Fitas simples
marcadas

--"t-

e as

uma quebra por fita.


nas suas extremidades 5'.
para o seqenciamento
que representa
ser
lida
da
auto-radi
,
(Figura 10.8d).

Reaes de clivagem

._A
.-A

a
a--------::4
')----------.-A

.-T
.- T_
o-1 T
a.)-T

etc.

(d) A auto-radiograia resultante


so projetados de

forma

DNA que est sendo


meio da eletroforese em
ia do fragmento de DNA
PCR (p. 196) e pela uti
cadeia ou degradao
clones individuais podem
iginal, em decorrncia dos
durante o processo de
de PCR, sem a necess

Sanger-Coulson e,
da PCR . obviamente, de
ssrias. H vrias

normal e um modifi
a partir dele sejam
pela ligao de pequenas
fita simples obtido pela
I

t
i

Figura 10.8
Uma verso do seqiirenciamento de DNA
pelo mtodo de degradao qumica.

parao da fita "magntica" da fita normal (Figura 10.9). Uma metodologia semelhante utiliza um iniciador marcado com biotina, com as fitas simples separadas pela ligao com avidina, uma protena que possui uma elevada afinidade por biotina (p. 175).
Uma vez que o DNA de fita simples tenha sido purificado, os procedimentos subseqentes so semelhantes queles do mtodo-padro de Sanger-Coulson, no qual famlias de molculas com cadeias terminadas so sintetizadas pela ao de uma DNA-polimerase, tal como a
Sequenase. A nica complicao diz respeito ao iniciador utilizado no seqenciamento, como

2'18

T. A. Bnowrrr

I
I
I
II

lnlclar as reao
purificadas e, Pl
com biotina.

lniciadores da fita

superior

Seqenciam

lniciadores da
fita inferior

*-)

DNA-molde

Sempre neces
posta no, Pot
o, resultando

'Esferas

No seqenc

magnticas

te a uma mistur
iniciador adic
da PCR no Por

fita do DNA-m,

reao cicladi
duz as cpias

flr.rrIt'
I

Desnaturao

----

:.

//\
/
l_-

deias terminad,
DNA lida de

pode ser utiliz:


(p. 211), a mar
centes, abrindc
Marcadoret

--------.to
-

<

/\

Na metodologi

-' -Y

----------t'

que a Primeira

10,2.4 Seqenciat

-------l'

------

tdeo diferente
to, cadeias tern
a corrida dos PI
mo para um ex

II

segunda

-\

Separao das fitas


marcadas com as esferas
maonticas

cada molcula

__________r-

- -------:
-------:

Figura 10.9
Uma das maneiras de purificar
DNA de fita simples, a partir de um
produto de PCR de fita dupla. Um
dos iniciadores marcado com
uma esfera magntica. Aps a
PCR, os produtos de fita dupla so
desnaturados e as fitas magnticao
separadas das itas no-marcadas-

gura 10.11a). I
NTPs, cujavar
tro reaes em
to com todos o
rentes podem s
Como os si
cessirio, um ti
vez de confiar
uma nica can
co tubo de um

(Figura 10.1 1t
ponto de partida para as reaes de sntese das fitas. No procedimento de seqenciamento-p
dro, esse iniciador anela em um stio do vetor Ml3, adjacente ao stio de clonagem, dentm
do qual o DNA a ser seqenciado foi clonado (Figura 10.6). Esse iniciador "universal" nfu
pode ser utilizado com produtos de PCR, uma vez que esses no possuem as seqncias fu
M13 apropriadas. Ao invs dele, um dos iniciadores da PCR inicial tambm utilizado pme

dados para o c
seqncia pod
te paa um arq
96 seqncias
dos muito mai

Cronnceu GNrcA

E ANLrsE

oe

DNA

219

iniciar

as reaes de seqenciamento. Esse iniciador dever ser complementar s fitas simples


purificadas e, portanto, ser o iniciador que no foi marcado com as esferas magnticas ou
com biotina.

Seqenciamento em ciclos trmicos


Sempre necessirio purificar fitas simples a fim de seqenciar um produto de PCR? A resposta no, porque possvel combinar PCR e seqenciamento de DNA em uma nica reao, resultando na tcnica chamada seqenciamento em ciclos trmicos.
No seqenciamento em ciclos trmicos, a mistura de reao que preparada semelhante a uma mistura de PCR, mas com duas excees importantes. A primeira que somente um
iniciador adicionado reao, o que significa que o processo de amplihcao caractestico
da PCR no poder ocorrer, e, em.vez disso, tudo o que acontecer ser a reproduo de uma
fita do DNA-molde. No entanto, esse processo de reproduo repetido muitas vezes, pois a
reao ciclada de forma trmica, exatamente como em uma PCR real, e a enzima que produz as cpias termoestvel, tal como a DNA-polimerase de Taq.
A segunda diferena entre a reao de seqenciamento em ciclos trmicos e uma PCR
que a primeirarealizada em quatro reaes simultneas, cada uma com um didesoxinucleotdeo diferente includo na reao. As novas molculas que so sintetizadas possuem, portanto, cadeias terminadas (Figura 10.10), podendo a seqncia da molcula-molde ser lida aps
a corrida dos produtos das quatro reaes em um gel de poliacrilamida, da mesma maneira como para um experimento padro de Sanger-Coulson.

10.2.4 Seqenciamento automtico de DNA


Na metodologia tradicional de seqenciamento de Sanger-Coulson, as molculas com as cadeias terminadas que so sintetizadas mostram-se radioativamente marcadas e a seqncia de
DNA lida de uma auto-radiografia. Essa no a nica estratgia de marcao e deteco que
pode ser utilizada com a metodologia de terminao de cadeias. Como na hlbidizao in situ
(p.211), a marcao radioativa vem sendo substituda pela utilizao de marcadores fluorescentes, abrindo novos horizontes pam o seqenciamento do DNA.

das maneiras de purificar


de ita simples, a partir de um
de PCR de ita dupla. Um
iniciadores marcado com
. esera magntica. Aps a
, os produtos de ita dupla so
e as fitas magntica
das itas no-marcadas.

mento de seqenciamento-p*te ao stio de clonagem, denuu


Esse iniciador "universal" no
no possuem as seqncias do
inicial tambm utilizado pre

Marcadores fluorescentes so normalmente ligados aos didesoxinucleotdeos, de forma que


cada molcula com a cadeia terminada contm uma nica marcao na sua extremidade 3' (Figura l0.1la). Um fluorocromo diferente pode ser utilizado para cada um dos quatro didesoxiNTPs, cuja vantagem principal est no fato de que no se faz mais necessrio realizar-se as quatro reaes em tubos separados. Assim, possvel executar uma nica reao de seqenciamento com todos os quatro didesoxi-NTPs, pois as molculas terminadas com didesoxi-NTPs diferentes podem ser identificadas por meio de seus sinais fluorescentes distintos.
Como os sinais fluorescentes so detectados? Um tipo especial de sistema de imagem necessrio, um tipo que envolve a utilizao de um computador para ler a seqncia de DNA, em
vez de confiar nos olhos de um biologista molecular. Os produtos da reao so aplicados em
uma nica canaleta de um gel de poliacrilamida ou, na tecnologia mais moderna, em um nico tubo de um sistema de e-letrofgrese capilar e, ento, passados pelo detector de fluorescncia
(Figura 10.11b). O detector identifica o sinal fluorescente emitido pelas bandas e transmite os
dados para o computador, o qual converte a informao na seqncia de DNA apropriada. A
seqncia pode ser impressa para anillise pelo operador (Figura 10.1Ic) ou enviada diretamente para um arquivo de dados para anlises futuras. Seqenciadores automticos podem ler at
96 seqncias diferentes em um perodo de duas horas e, por conseguinte, podem adquirir dados muito mais rapidamente do que possvel ao longo do seqenciamento manual.

22O

T.A.Bnowru

PCR com um
iniciador e
didesoxi-ATP

Figura 10.11

rrrrrrrrttttttttttttt

Aps quatro ciclos

ddA
ddA

Fooa
L

ddA

Figura 10.10
O princpio do seqenciamento em ciclos trmicos.
Uma PCR realizada
com somente um dos iniciadores e um dos didesoxi-NTPs. Uma das itas
do molde copiada, originando uma amlia de polinucleotdeos com cadeias terminadas. ddA =
didesoxi-AP.

Seqenciamento
automtico d
DNA. (a) Para o
seqenciamento
automtico, cada didesoxi-NTP
marcado com
um marcador
fluorescente. (b)
Cada didesoxiNTP marcado
com um luorocomo dierente,
de orma que os
polinucleotdeos
com cadeias terminadas so distinguidos medida que Passam Pelo detector. (c) Um
exemplo de uma
seqncia impressa.

podem ser local

10.2.5 Montando uma seqncia de DNA extensa


Um nico experimento de terminao de cadeia realizado pelos procedimentos manuais fornece cerca de 400 nucleotdeos da seqncia, assim como uma nica corrida em um seqenciador automtico resulta em cerca de 750 nucelotdeos. Porm, a maioria dos genes muito
mais longa do que isso. como uma seqncia de virios quilobases pode ser obtida?
A resposta : realizando experimentos de seqenciamento de DNA com um conjunto de
fragmentos clonados ou produtos de PCR diferentes, todos derivados a partir de uma nica e
extensa molcula de DNA (Figura l}.l2). Esses fragmentos devero sobrepor-se, de forma
que as seqncias de DNA individuais iro, elas mesmas, apresentar sobreposies, as quais

a seqncia

sequence) gra

Existem vl
molcula de D
zindo um conju

um mt
tagem de que ot
se era

tos individuais

quatro ou cinco
chimento de lat

Croruncev GNrcA

E ANLrsE

oe

DNA

221

(a) Um polinucleotdeo com cadeia terminada, marcado com luorescncia

ddA

:-:_

fluorescncia

(b) Deteco de polinucleotdeos com cadeias terminadas

Figura 10.11

I
I
I
I

II
lFisura 10.10
O princpio do seqencia
f
|mento em ciclos trmicc.
[Uma PCR realizada
]mm somente um dos inF
lciadores e um dos dide.
lsoxi-NTPs. Uma das itas
[Oo motOe copiada, orii
fnando uma amlia de f
hnucleotdeos com caldeias terminadas. ddA =
]didesoxi-ATp

Seqenciamento
automtico de
DNA. (a) Para o
seqenciamento
automtico, cada didesoxi-NTP
marcado com
um marcador
fluorescente. (b)
Gada didesoxiNTP marcado
com um luorocromo dierente,
de forma que os
polinucleotdeos
com cadeias terrninadas so disnguidos medida que passam pelo detector. (c) Um
exemplo de uma
seqncia impressa.

lwt-

,r:,,

ffigB affi-

ddT
ddC .

ddG .:::

tu

ww_

'

,*
{"

Sistema
de imagem

Detctor

ddG
I
I

Polinucleotdeos passam
pelo detector

(c) A impresso de um seqenciamento automtico

TT

TTiC

GTT 'GCTTGG

I
I

I
I
I

hrcedimentos manuais frSa conida em um seqenlmaioria dos genes muito


b

pode ser obtida?

bNA com um coniunto

dc

bs a partir de uma nicac


Ho sobrepor-se. de forme
far sobreposies,

as

qu*i*

podem ser localizadas, tanto pela inspeo visual quanto pela utilizao de um computador, e
a seqncia principal ou cong (uma abreviao de seqncia contnua, do ingls contiguous
s e quenc e) gradualmente construda.
Existem virias formas de produzir fragmentos sobrepostos. Previamente clonagem, a
molcula de DNA deveria ser clivada com duas endonucleases de restrio diferentes, produzindo um conjunto de fragmentos com, digamos, Saa3A e outro comAlul (Figura 10.13). Esse era um mtodo popular de produo de seqncias sobrepostas, mas apresentava a desvantagem de que os sos de restrio poderiam estar inconvenientemente distribudos e fragmentos individuais poderiam ser muito extensos para seqenciamento completo. Freqentemente
quatro ou cinco endonucleases de restrio diferentes tinham que ser utilizadas para o preenchimento de lacunas na seqncia principal.

-"l

222

T. A. Bnowr.r

Uma alterna

de uma forma

resultantes iro
da. Os fragmen

Molcula de DNA extensa

sobressalentes.

Clivagem em
fragmentos sobrepostos

7-77

4
_-

10.2.6 As realizaE
A primeira mol

cleotdeos do h
seqncias do r
vamente, o seqi
seqncia do gr
em 1982. Atualr
de pesquisa ten

o--

tnserao em um

vetor M13

:K
/--\ s:;
/

Os projetos
do a obteno d
primeira seqr

--'

foi publicada

s"q,i"n"i"rento

er

ra seqncias g
melanogaster. <
nar as mais de I
micos sero ex:

\-,
/

to com enzimas

de cada

traomento

Leituras adicior

\
Seqncias individuais
sobrepostas

Permitem que aseqncia


extensa sela montada

Figura 10.12
Montando uma seqncia de DNA
extensa, a partir de um conjunto
de seqncias sobrepostas curtas.

Carle, G.E. & Olso


Scences of the
Heiskanen, M., Pel
3'.79-82.

Maxam, A. & Gilbt


ces of the USA
Oliver, S.G., van de
mosome ITI- -ii
Prober, J.M., Train
minating dider
Sanger, F., Nicklen

Molcula de DNA
mostrando os stios de
SaUOA (S) e Alut (A)

the National Ar
Southern, E.M. (l!
Journal of Mol
The ArabdopsisG

Seqncias de diferentes
ragmentos de A/ul

g---

LJ
pb

200

ft

r-+

Fragmentos individuais
podem ser muito extensos para
seqenciamento completo

Seqncias de dierentes
ragmentos de Sarr3A

liana. Narure,,

Figura 10.13
Montando uma seqncia de
DNA extensa por meio da determinao das seqncias
de ragmentos de restrio
sobrepostos.

Ct-orueceu Gucn e ANLrsE oe

DNA

223

Uma alternativa quebrar a molcula de DNA por meio de sonicao, a qual cliva o DNA
de uma forma mais aleatna e, assim; fornece possibilidades maiores de que os fragmentos
resultantes iro apresentar sobreposio e de que uma seqncia principal contnua ser obtida. Os fragmentos resultantes da sonicao possuem uma variedade de extremidades 3' e 5'
sobressalentes, mas essas podem ser convertidas em extremidades cegas seguindo o tratamento com enzimas apropriadas, antes da clonagem pelos mtodos convencionais.

10.2.6 As realizaes do seqenciamento de DNA


A primeira molcula de DNA

a ser completamente seqenciada foi o genoma de 5.386 nucleotdeos do bacterofago QX174, completada em 1975. Essa foi rapidamente seguida pelas
seqncias do vrus SV40 (5.243 pb), em 19'77, e do pBR322 (a.363 pb), em 1978. Gradativamente, o seqenciamento foi aplicado a molculas maiores. O grupo de Sanger publicou a
seqncia do genoma mitocondrial humano (16,6 kb) em 1981 e a do bacterifago (49 kb)
em 1982. Atualmente, seqncias de 100 a 200 kb so rotineiras e a maioria dos laboratrios
de pesquisa tem a experincia necessria para gerar tal quantidade de informao.
Os projetos pioneiros de hoje so as massivas iniciativas genmicas, cada uma objevando a obteno da seqncia nucleotdica do genoma inteiro de um determinado organismo. A
primeira seqncia cromossmica, do cromossomo III da levedura Saccharomyces cerevisiae,
foi publicada em 1992, e a do genoma completo da levedura ocoffeu em 1996. Existem agora seqncias genmicas completas do verme Caenorhabditis elegans, da mosca Drosophila
melanogaster, da planta Arabidopsis thaliana e do humano Homo sapiens, paa no mencionar as mais de 100 diferentes espcies microbianas. Esses projetos de seqenciamentos genmicos sero examinados com maiores detalhes no Captulo 12.

Leituras adicionais
Carle, G.E.

& Olson, M.V. (1985) An electrophoretic karyotype for

yeast. Proceedings of the National Academy

of

Sciences of the USA,82,3156-60. [Uma aplicao de OFAGE.]

10.12
uma seqncia de D|fl
a partir de um conjunto
ias sobrepostas

Heiskanen, M., Peltonen, L.


379-82.

& Palotie, A. (1996) Visual mapping by high resolutionFISH.

Maxam,A.&Gilbe,W.(1977)Anewmethodof

Trends in Genetics, 12,

sequencingDNA. ProceedingsoftheNationalAcademyofScien-

ces of the USA,74, 560-64.

Oliver, S.G., van der Hart, O.J.M., Agostine Carbone, M.T. et aL (1992)The complete DNA sequence of yeast chromosome lll. Nature, 357 ,38-46.
Prober, J.M., Trainoq G.L., Dam, R.J. et al. (1987) A system for rapid DNA sequencing with fluorescent chain-terminating dideoxynucleotides. Science, 238, 336-41.
Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proceedings of
the National Academy of Sciences of the USA, 74, 5463-7 .
Southem, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis.
Journal of Molecular Biology, 98,503-7 . [Hibridizao de Southern.l
The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant rabidopsis thaliana. Nature. 408. 796-8 I 5.

10.13
uma seqncia de
eldensa por meio da dedas seqncias
ragmentos de restrio

Cnprulo 11
Estudando a Expresso
e a Funo dos Genes

Estudando o transcrito de um gene clonado,226


Estudando a regulao da expresso gnica, 233

ldentificando e estudando o produto de traduo de


um gene clonado, 242

Todos os genes devem ser expressados para que tenham funcionalidade. O primeiro passo na
expresso a transcrio do gene em uma fita de RNA complementar (Figura I I . I a). Para alguns genes - por exemplo, aqueles que codificam molculas de RNA transportador (IRNA) e

!
I

'

ii

de RNA ribossmico (rRNA) - o prprio transcrito a molcula funcionalmente impoante.


Para outros, o transcrito traduzido em uma molcula de protena.
Para entender como a expresso de um gene, o RNA transcrito deve ser estudado. Em es-

pecial, o biologista molecular ir querer saber se o transcrito uma cpia fiel do gene, ou se
segmentos do gene no esto presentes no transcrito (Figura I I .1b). Tais pedaos que faltam
so chamados de ntrons e um interesse considervel est centralizado em suas estruturas e
possveis funes. Alm dos ntrons, as localizaes exatas dos pontos inicial e final do transcrito so importantes. A maioria dos transcritos cpia, no apenas do prprio gene, mas tambm de ambos os lados de suas regies nucleotdicas (Figura 11.1c). Os sinais que determinam o incio e o trmino do processo de transcrio so apenas parcialmente entendidos, emboram devam ser localizados, caso a expresso de um gene esteja para ser estudada.
Neste captulo, sero examinados os mtodos utilizados para a anlise dos transcritos.
Tais mtodos podem ser utilizados para determinar se um gene contm ntrons e para mapear
as posies dos pontos inicial e final de transcrio. Depois, sero consideradas brevemente
algumas das numerosas tcnicas desenvolvidas nos ltimos anos para examinar como a expresso de um gene regulada. Essas tcnicas so importantes, pois aberraes na regulao
gnica constituem a base para muitos problemas clnicos. Finalmente, ser tratado o difcil
problema de como identificar o produto da traduo de um gene.

226

T. A. Bnowr.r

11.1.1 A microscopii

(a) Os genes so expressados por

transcrio e traduo

A microscopia ele

desde que os Polin


nem seus dimeuc

Gene

---77-,--7--------I

Molcula de DNA

sualizar.

Transcrio

RNA

I
,W

Normalmente,
mo c, a qual se lig

TRNA, IRNA

rraoueao do mRNA

lculas encobertas
denso para aumen
tanto espetacularq
No passado, a
zao entre molc
progressivamente
ra determinar se u

Protena

(b) Alguns genes contm ntrons


ntrons

,/\
/\
7-'---------'-7T.--'-

ta de DNA, contel
da fita de DNA n

Molcula de DNA

lizar um pareamel
tura caracterstica

I Transcrio

Primrio do RNA
ainda contm ntrons

:l:T:::l:
,/l

-r--r,.-.- -.t I

e as Posies dessi

Processamento

ne. Informaes a
pela procura das I
cDNA possui a su

comprada com a

------\__+__-------_F

mRNA maduro _ no

contm ntrons

II

.'tr

'

rraouao
Protena

(c) O RNA transcrito inclui regies


de ambos os lados do gene

.-.

Gene

Figura 11.1
Alguns princpios da expres.

Sinal de iniciao
para a transcrio

Sinal de terminao

so gnica.
mRNA = RNA mensageiro,
IRNA = RNA transportado
rRNA = RNA ribossmico.

11.1 Estudando o transcrito de um gene clonado


A maioria dos mtodos de anlise dos transcritos est baseada na hibridizao entre o transcrito de RNA e um fragmento de DNA contendo o gene de interesse. A hibridizao dos cidos
nuclicos ocorre exatamente da mesma maneira entre fitas complementares de RNA e DNA
como entre molculas de DNA de fitas simples. O hbrido DNA-RNA resultante pode ser analisado por meio de microscopia eletrnica ou com nucleases especficas para fitas simples.

Preparando uma molx


para a observao com o n

Ct-oruneeu Gr'rrcr e ANLrsE op

11

DNA

227

.1.1 A microscopia eletrnica das molculas de cidos nuclicos


A microscopia eletrnica pode ser utilizada para visualizar molculas de cidos nuclicos,
desde que os polinucleotdeos sejam primeiramente tratados com produtos qumicos que tornem seus dimetros visveis. Molculas no-tratadas so simplesmente muito finas para vi-

suaizar.

Normalmente, as molculas de DNA so misfuradas com uma protena, tal como citocromo c, a qual se liga aos polinucleotdeos, cobrindo as fitas com uma camada espessa. As molculas encobertas podem ser coradas com acetato de uranil ou algum outro material eletrodenso para aumentar a capacidade de visualizao da preparao (Figura 11.2). Vises um
tanto espetaculares das molculas de cidos nuclicos podem ser obtidas.
No passado, a microscopia eletrnica foi primeiramente utilizada para analisar a hibridizao entre molculas de DNA diferentes, mas, em anos recentes , a tcnica tem-se tornado
progressivamente importante no estudo dos hbridos DNA-RNA. Ela especialmente til para determinar se um gene contm ntrons. Considere a aparncia de um hbrido entre uma fita de DNA, contendo um gene, e seu RNA transcrito. Se o gene contm ntrons, essas regies
da fita de DNA no possuiro similaridade com o RNA transcrito e, assim, no podero realizar um pareamento de bases. Ao contririo, elas formaro uma "ala", originando uma estrutura caracterstica, quando observadas com a microscopia eletrnica (Figura 11.3). O nmero
e as posies dessas alas correspondem diretamente ao nmero e posies dos ntrons no gene. Informaes adicionais podem, ento, ser obtidas por meio do seqenciamento do gene e
pela procura das marcas caractersticas que delimitam os limites dos ntrons. Se um clone de
cDNA possui a sua seqncia disponvel, a qual, obviamente, no possui ntrons, ela pode ser
comparada com a seqncia gnica paralocalizar os ntrons com preciso.

Figura 11.1
Alguns princpios da
so gnica.
mRNA = RNA mensa;drq
IRNA = RNA transportadq,
rFNA = RNA ribossmirn

hado
I

lhibridizao entre o
ts. A hibridizao dos ci
fplementares de RNA e
|RNA resultante pode serr
[ecficas para fitas simples.

Figura 11.2
Preparando uma molcula de DNA
para a observao com o microscpio
eletrnico.

o
eletrnico

228

T. A. Bnowlt

Infelizmente,
lntrons

Figura 11.3
A visualizao por microscopia eletrnica de um hbrido DNA-RNA,
formado entre um gene contendo
um ntron e seu transcrito processado.

11.1.2 A anlise dos hbridos DNA-RNA por meio do tratamento


com nuclease

cial

final do transr

seqncia de DNA.
No exemplo mo
codificadora, juntar

um vetorMl3 e ob

adicionada e pern

do, de fita simples,


O restante, com ex(
dado com rlcali, re

O segundo mtodo para o estudo de um hbrido DNA-RNA envolve uma nuclease especfica
para fita simples, tal como a S1 (p. 65). Essa enzima digere DNA de fita simples ou polinucleotdeos de RNA, inclusive regies de fita simples na extremidade de molculas predominantemente de fitas duplas, mas no possui qualquer efeito em DNA de fita duplaou sobre hbridos DNA-RNA. Se uma molcula de DNA contendo um gene hibridizada com seu RNA
transcrito, e, ento, tratada com a nuclease Sl, as regies de DNA de fita simples no-hibridizadas em cada extremidade do hbrido so digeridas, juntamente com qualquer ala de ntron
(Figura 11.4). O resultado um hbrido completamente de fita dupla. Os fragmentos de DNA
de fita simples protegidos da digesto pela nuclease Sl podem ser recuperados se a fita de
RNA for degradada em um tratamento com lcali.

HbridoDNArNA

,@

\*''

,rW

Regies de DNA de ita simples


so digeridas

Alcali para
degradar o RNA

__-,/ -_--_---

ar

tamanhos dos fragl


mas o procedimenl
das. No entanto, m(

Fragmentos de DNA de ita simples


que oram protegidos pelo RNA

Figura 11.4
O efeito da nuclease 51 sobre um hbrido DNA-RNA.

Figura 11.5
Localizando um ponto
de iniciao de transcrio pelo mapeamento
com a nuclease 51.

Cr-oruneeu Grurcn e ANLrsE oe

b por microscopia

229

Infelizmente, as manipulaes mostradas na Figura 11.4 no so muito informativas. Os


tamanhos dos fragmentos de DNA protegidos poderiam ser medidos por eletroforese em gel,
mas o procedimento no permite que as suas ordens ou posies relativas sejam determinadas. No entanto, modificaes pequenas e sutis na tcnica permitem determinar os pontos inicial e final do transcrito, bem como qualquer ntron que ele contenha pode ser posicionado na
seqncia de DNA.
No exemplo mostrado na Figura 11.5, um fragmento de Sau3{contendo 100 pb da regio
codificadora, juntamente com 300 pb da seqncialder que precede o gene, foi clonado em
um vetor Ml3 e obtido como uma molcula de fita simples. Uma amostra do RNA transcrito
adicionada e permitida anelar molcula de DNA. A molcula de DNA ainda , antes de tudo, de fita simples, mas agora ela possui uma pequena regio protegida pelo RNA transcrito.
O restante, com exceo dessa regio protegida, digerido pela nuclease S1 e o RNA degradado com ilcali, restando um pequeno segmento de DNA de fita simples. Se tais procedimen-

ele-

h hbrido DNA-RNA,

b um gene contendo

hr

DNA

transcrito proces-

fatamento
t

l* u-u

nuclease especfice

ide nta simples ou polin$ de molculas predoni-

_t

Oe nta dupla ou sobre


lhiUriOizada com seu RML
E fita simples no-hibri
fom qualquer ala de
p- os fragmentos de
P recuperados se a fita

Gene
7--?7--?--?--?-

Fragmento de 400 pb
de SatA

lnsero do
ragmento de

X^emM13
\
/s"3A

[--l"*^
DNA de ita simples

t./

rt

Anelamento do mBNA

\L

\r._-___-__fl-...-.-

-/

DNA ,, / _-./
ffi
RNA

Nuclease 51

l'**o

bdi

r
\

DNA
Tamanho por eletroorese,

porexemplo, 150pb

\
150 pb

Hgura 11.4
D

efeito da nuclease 51
um hbrido DNA-R.|^,

le

Figura 11.5
Localizando um ponto
de iniciao de transcrio pelo mapeamento
com a nuclease 51.

Regio de fita duPla

a
\

Ponto de iniciao
de transcrio

23O

T.

A. Bnowlr

tos so examinados detalhadamente se tornar claro que o tamanho desse fragmento


de fita
simples corresponde distncia entre o ponto de iniciao de transcrio o rtio de
Sau3A
" por eletroforedo lado direito. O tamanho do fragmento de fita simples , ento, determinado
se em gel e essa informao utllizada para localizar o ponto de iniciao
deranscrio na
seqncia de DNA. Exatamente a mesma estratgia poderia localizar o ponto de terminao
da transcrio e os pontos dejuno entre ntrons e xons. A nica diferena seria posio
a
do stio de restrio escolhido para delimitar uma extremidade do fragmento de DNA
de frta
simples protegido.

11.1.3 A anlise dos transcritos por extenso de iniciador


(primer extension)
A anlise com a nuclease S I uma tcnica poderosa que permite que ambas as extremidades
5'e 3' de um transcrito, bem como as posies dos limites ntron-xon, sejam identihcadas. O
mtodo final da anlise dos transcritos que iremos considerar a extenso de iniciador (pn:-

mer extension) - menos adaptvel, porque ele somente permite identificar a extremidade 5"
de um RNA. Apesar de tudo, uma tcnica importante que freqentemente utilizada para
conhrmar os resultados das anlises com S l.
A extenso de iniciador somente pode ser utilizada se uma parte da seqncia do transcrito conhecida. Isso porque um oligonucleotdeo iniciador pequeno deve ser anelado ao
RNA em uma posio conhecida, idealmente dentro dos 100 a 200 nucleotdeos da extremidade 5' do transcrito. Uma vez anelado, o iniciador estendido pela transcriptase reversa (p. 68)' a qual continua copiando a fita de RNA at que ela alcance a extremidade
5' (Figura 11.6). A extremidade 3' dessa fita de DNA recm-sintetizada corresponde, portanto,

extremidade 5' do transcrito. A localizao da posio dessa extremidad na seqiincia de


DNA facilmente obtida pela determinao do comprimento da molcula de DNA de fita
simples e correlacionando essa informao com a posio de anelamento do iniciador.

11.1-4 outras tcnicas para o estudo dos RNAs transcritos


Nos ltimos anos, uma grande variedade de tcnicas de manipulao de RNA foi desenvolvida, cujo emprego resultou em numerosos e importantes avanos no entendimento
de como os
transcritos so sintetizados e processados. Essas tcnicas incluem:

Hibridizao de northern
Trata-se de uma tcnica equivalente de RNA da hibridizao de Southern (p. 206).
um RNA
extrado submetido eletroforese em gel de agarose, utilizando-se um tampo de eletroforese desnaturante (por exemplo, um contendo formaldedo) para garantir qu"
o, RNAs no
formaro pares de bases inter ou intramoleculares, uma vez que o paremento de bases poderia afetar a velocidade com a qual as molculas migram atravs do gel. Aps a eletroforese,
o
RNA do gel transferido para uma membrana de nilon ou de nitrocelulose e hibridizado
com
uma sonda marcada (Figura 11.7). se a sonda for um gene clonado, a banda que
aparece na
auto-radiografia o transcrito daquele gene. O tamanho do transcrito pode ser determinado
a
partir da sua posio no gel e, se RNA de diferentes tecidos for aplicad em canaletas
diferentes do gel, ento a possibilidade de que esse gene seja diferenciul-"nt" expressado
poder
examinada.

ser

PCR com transcrio reversa (RT-PCR)


Essa tcnica possibilita que o RNA seja utilizado como molde em uma reao
de polimerizao em cadeia (PCR). O primeiro passo em uma RT-PCR converter a molcula e RNA em
um cDNA de fita simples com a transcriptase reversa. Uma vez que esse procedimento
preli-

Figura 11.6
Localizando um
ponto de iniciao de transcri@o por meio da
e)denso de iniciador.

minar tenha sido


dos e o experimr
polimerases tern

de DNA (isto , r
se dependente dr

nica reao. Os
fita dupla (cDN1

da molcula de R
tuam-se no interi
crio reversa I
a presena de un
gene. Uma versr

Ct-ouoeu Guca r
desse fragmento de fita
lanscrio e o stio de Sau3A

ANLtsE oe

DNA

231

Fnho

5'

p, determinado por eletroforeiniciaao de transcrio na


icalizar o ponto de terminao
diferena seria a posio
fnica
ldo fragmento de DNA de fita

RNA transcrito

Anelamento do iniciador

lniciador

- _/

Extenso com transcriptase reversa

que ambas as extremidades


sejam identificadas. O

extenso de iniciador (pridentificar a extremidade


entemente utilizada pan

Desnaturao do RNA,
medida do tamanho do DNA
por exemplo, 239 nucleotdeos

parte da seqncia do trans-

deve ser anelado ao

200 nucleotdeos da extrepela transcriptase revea extremidade 5' (Frcorresponde, portanto.


na seqncia dc
da molcula de DNA de fita
amento do iniciador.

Correlao com a seqncia de DNA

Figura 11.6
de RNA foi desenvolvino entendimento de como ui

Southern (p. 206). Um RNA


um tampo de eletrofe
garantir que os RNAs nib
pareamento de bases podedo gel. Aps a eletroforese, o
ulose e hibridizado com
a banda que aparece rn
ito pode ser determinado e
icado em canaletas diferennte expressado poder ser

uma reao de polimerizaa

molcula de RNA en

que esse procedimento preli-

F.

Localizando um
ponto de iniciao de transcrio por meio da
extenso de iniciador.

DNA

23epb \

iniciao
transcrio

Ponto de
de

,/\/

------

posio da extremidade 5'


do iniciador

minar tenha sido realizado, os iniciadores da PCR e a DNA-polimerase de Taq so adicionados e o experimento prossegue exatamente como na tcnica-padro (Figura 11.8). Algumas
polimerases termoestveis so capazes de sintetizar cpias tanto de molculas de RNA como
de DNA (isto , elas possuem ambas as atividades de transcriptase reversa e DNA-polimerase dependente de DNA) e, assim, podem realizar todos os passos de uma RT-pcR em uma
nica reao. Os produtos de uma RFPCR so muitas molculas de DNA complementar de
fita dupla (cDNA), cpias do RNA-molde, apesa de essas, provavelmente, no serem cpias
da molcula de RNA completa, pois, normalmente, os stios de anelamento dos iniciadores situam-se no interior do transcrito, emvez de estarem nas suas extremidades. A PCR com transcrio reversa freqentemente utilizada para testar RNA extrado de tecidos diferentes para
a presena de um determinado transcrito, a fim de determinar o padro de expresso de um
gene. Uma verso modificada, chamada de amplificao rpida de extremidades de cDNA

T. A. Bnowr.r

/ffi ffi ffi


ffi ffi ffit

Gel de RNA

Hibridizao

Arrastes de RNA

de northern

Auto-radiograia
Banda de
hibridizao

Figura 1'
A PCR com trans

o reversa (RT-PCI

11.2 Estuda
Figura 1.7
A hibridizao de northern.Trs extraes de RNA de tecidos dierentes oram submetidas
eletroorese em um gel de agarose. As extraes possuem muitas molculas de RNA de tam+
nhos dierentes, de forma que cada uma ornece um arraste de RNA, mas duas bandas distintas so visualizadas, uma para cada um dos RNAs ribossmicos mais abundantes. Os tamanhos desses rRNAs so conhecidos (por exemplo,4.718 e 1.874 nucleotdeos em mameros),
de forma que eles podem ser utilizados como marcadores de tamanho internos. O gel transferido para uma membrana, sondado com um gene clonado e os resultados visualiiados por
meio de auto-radografia. Somente na canaleta 1 aparece uma banda, mostrando que o gene
clonado expressado somente no tecido do qual essa extrao de RNA foi obtida.

(RACE, do ingls rapid amplification of cDNA ends), pode ser utilizada para identificar as
extremidades 5'e 3'das molculas de RNA.

Seqenciamento de RNA
O seqenciamento de RNA normalmente realizado pela anlise da seqncia do produto de
uma RT-PCR. Mtodos diretos para o seqenciamento de molculas de RNA foram desenvolvidos, mas eles foram ineficientes e - muito importante a molcula de RNA teve de ser purificada antes de ser seqenciada. possvel obterem-se amostras puras de genomas de RNA de
vrus e de RNAs celulares muito abundantes, tais como as molculas de RNA ribossmico,
mas a purificao de um nico mRNA muito difcil. No entanto, se os iniciadores para uma
RFPCR forem projetados corretamente, apenas o nico mRNA-alvo ser copiado e anlise
da seqncia do produto da RT-PCR fornecer a seqncia desse mRNA.

Poucos g
ativados r
de regula

gular a el
produtos

as enzim:
quantidar

triptofanc
tose, so
Nos orga

to maior

padres d
to necessi
tes na exl

Muito

sica: ager
te que os
explorar i

ria dos av

os estudo
DNA con
sobre os t

Cr-onaceu GNrcA

E ANLrsE

oe

DNA

233

RNA

Ib

RNA

Transcriptasereversa

,--<rr-r-rT

tnrthern

-t---.---\

ftrto-radiografia

Figura 11.8

PCR-padro

A PCR com transcri@o reversa (RT-PCR).

11,2 Estudando a regulao da expresso gnica


oram submetidas
molculas de RNA de tanr*.
mas duas bandas dislir
rnais abundantes. Os tarn+.
rucleotdeos em mamferosft

internos.Ogel trars.
visualizados por
mostrando que o gee
RNA oi obtida.
,

utilizada para identificar er

da seqncia do produto

&

de RNA foram desenv*


de RNA teve de ser purde genomas de RNAdc

las de RNA ribossmico,


iniciadores para nmr

se os

sercopiadoeaanlise
mRNA.

Poucos genes so expressados durante todo o tempo. Muitos esto sujeitos regulao e so
ativados somente quando a clula requisita seus produtos gnicos. Os sistemas mais simples
de regulao gnica so encontrados em bactrias, como E. coli, por exemplo, a qual pode regular a expresso de genes paa os processos biossintticos e metablicos, de forma que os
produtos gnicos desnecessirios no so sintetizados. Por exemplo, os genes que codificam
as enzimas envolvidas na biossntese do triptofano podem ser inativados quando existem
quantidades abundantes de triptofano na clula, e ativados novamente quando os nveis de
triptofano diminuem. De maneira similar, os genes para a utilizao de acares, como a lactose, so ativados apenas quando o acar em questo estiver presente para ser metabolizado.
Nos organismos superiores, a regulao gnica mais complexa, pois existe um nmero muito maior de genes para controlar. A diferenciao celular envolve mudanas volumosas nos
padres de expresso gnica, e o processo de desenvolvimento do vulo fertilizado at o adulto necessita da coordenao entre clulas diferentes, alm de mudanas temporais-dependentes na expresso gnica.
Muitos dos problemas na regulao gnica necessitam de uma abordagem gentica clssica: a gentica possibilita que os genes que controlam a regulao sejam distinguidos, permite que os sinais bioqumicos que influenciam a expresso gnica sejam identificados e pode
explorar as interaes entre genes e famlias gnicas diferentes. por essa razo qlue a maioria dos avanos no entendimento do desenvolvimento nos organismos superiores iniciou com
os estudos da mosca-das-frutas Drosophila melanogaster. A clonagem gnica e a anlise do
DNA complementam a gentica clssica, pois fornecem informaes muito mais detalhadas
sobre os eventos moleculares envolvidos na regulao da expresso de um nico gene.

234

T.A.BRowN

Agora sabe-se que um gene sujeito regulao possui uma ou mais seqncias contr
ladoras na sua regio a montante (Figura 11.9) e que o gene ativado e inativado pela ligao de protenas reguladoras a tais seqncias. Uma protena reguladora pode reprimir a expresso gnica, nesse caso, o gene inativado quando a protena est ligada s seqnciar
controladoras, ou, alternativamente, a protena pode ter um papel positivo ou reforador"
ativando ou aumentando a expresso do seu gene-alvo. Nesta seo sero examinados os
mtodos paralocalizar seqncias reguladoras e determinar seus papis na regulao da expresso gnica.

11.2.1 Identiicando os stios de ligao de protenas na


molcula de DNA
Uma seqncia controladora uma regio do DNA onde uma protena reguladora pode se ligar. Deveria ser possvel, portanto, identificarem-se seqncias controladoras a montante de
um gene pela procura da regio relacionada ao stio de ligao da protena. Existem trs maneiras diferentes de se realizar isso.

Uma protena ligada d


dade de um ragmento
te a eletn

Retardao em gel de complexos DNA-protena


As protenas so estruturas um tanto volumosas e uma protena ligada em uma molcula de
DNA resulta em um aumento considervel da massa molecular total. Se esse aumento pode
ser detectado, um fragmento de DNA contendo um stio de ligao de protena ser identificado. Na prtica, um fragmento de DNA com uma protena ligada a ele identificado por
eletroforese em gel, pois possui uma mobilidade menor do que a molcula de DNA nocomplexada (Figura 1 1. 10). O procedimento referido como retardao em gel (gel retardation).
Em um experimento de retardao em gel (Figura 11.11), a regio do DNA a montante do
gene que est sendo estudado clivada com uma endonuclease de restrio e, ento, misturada com a protena reguladora ou, se a protena reguladora no foi ainda identificada, com um
extrato protico nuclear no-fracionado (lembre-se de que a regulao gnica ocorre no ncleo). Os fragmentos de restrio contendo a seqncia controladora formam um complexo
com a protena reguladora: todos os demais fragmentos permanecem como DNA "descobertos". A localizao da seqncia controladora , eno, determinada pelo posicionamento, no
mapa de restrio, do fragmento que foi retardado durante a eletroforese em gel. A preciso
com a qual a seqncia controladora pode ser localizada depende de o quo detalhado o mapa de restrio e de o quo convenientemente localizados esto os stios de restrio. Uma
nica seqncia controladora pode ser menor do que 10 pb de extenso, de forma que a retardao em gel raramente capaz de defini-la com exatido. Tcnicas mais precisas so, portanto, necessirias para delimitar a posio da seqncia controladora dentro do fragmento
identificado pela retardao em gel.

Realizando um experit
Seqncias controladoras

l\

Gene

Promotor

200 pb

Figura 11.9
Posies possveis para seqncias
controladoras na regio a montante de
um gene.

Footprint

O procedim

controlador
retardao

Cr-oruneeu Grlrcn e Aru-rse oe

DNA

235

lr ou mais seqncias conG


iativado e inativado pela

lig*

Fguladora pode reprimir a exna est ligada s seqncier

papel positivo ou reforada;


h seo sero examinados c

[s papis na regulao

da

erGel de agarose

ls na
I

Fotena reguladora pode se


i controladoras a montante
rda protena.

Existem trs mr.

Figura 11.10
Uma protena ligada diminui a mobilidade de um ragmento de DNA durante a eletroforese em gel.

b ligada em uma molcula ds


ttotal. Se esse aumento po&

iao

Oe

Canaleta 1: Fragmento de DNA


Canaleta 2: Fragmento de DNA +
protena ligada

1234-Gene
..........-.................,.RRRRRRR

protena ser identif,-

a ele identificado

,t,-,

a molcula de DNA
em ge (gel

Clivagem com a
endonuclease de restrio

do DNA a montante
restrio e, ento, mi
unda identifrcada, com uE
lao gnica ocore no -

--4

2
4

formam um complexo
como DNA "descober*
pelo posicionamento,
em gel. A

n-z-

Mi"tur"do.
"or "
otot"inu reguladora

deoquodetalhadoon

t--]-

os stios de restrio.
nso, de forma que a reilicas mais precisas so, pc,
dentro do fragmen!

/
Figura 11.11
Bealizando um experimento de retardao em gel.

I
I

Determinao das mobilidades dos fragmentos


por meio de eletroforese em gel

Footprinting com DNase I


O procedimento geralmente denominadofootprinting ("pegada") possibilita que uma regio
controladora seja posicionada dentro de um fragmento de restrio que foi identificado pela
retardao em gel. A tcnica defootprintitcg funciona com base no fato de que a interao

236

T. A. Bnowr'r

com uma protena reguladora protege o DNA da regio de uma seqncia controladora da
ao degradante de uma endonuclease, tal como a desoxirribonuclease (DNase) I (Figmr
Il'12). Esse fenmeno pode ser utilizado paralocalizar o stio de ligao da protena na rnolcula de DNA.
O fragmento de DNA em estudo primeiramente marcado em uma extremidade com utrr
marcador radioativo e, ento, complexado com a protena reguladora (Figura l1.l3a). Ent\
DNase I adicionada, mas a quantidade utilizada limitada, de forma que no ocorre a dogradao completa do fragmento de DNA. Ao contririo, o objetivo clivar cada molcula em
uma nica ligao fosfodister (Figura 1 1. l3b). Se o fragmento de DNA no possui uma pru
tena ligada a ele, o resultado desse tratamento uma famflia de fragmentos marcados, diferindo em tamanho em apenas um nucleotdeo cada.
Aps a separao em um gel de poliacrilamida, a famflia de fragmentos aparece corm
uma escada de bandas em uma auto-radiografia (Figura 1 I . 13c). No entanto, a protena ligan.
te evita que determinadas ligaes fosfodister sejam clivadas pela DNase I. Conseqentomente, nesse caso, a famlia de fragmentos no estar completa, pois os fragmentos resultantes da clivagem dentro da regio da seqncia controladora no estaro presentes. Essa ausncia notada na auto-radiografia como uma "pegada", claramente visualizada na Figun
I 1.13c. A regio da molcula de DNA contendo a seqncia controladora pode, agora, sor
analisada a partir dos tamanhos dos fragmentos em ambos os lados da pegada.

Ensaios de interferncia por modiicao


As anlises por retardao em gel e footprinting possibilitam que as seqncias controladoras
sejam localizadas, mas no fornecem informaes em relao s interaes entre a protene
ligante e a molcula de DNA. A tcnica mais precisa dessas duas o footprinting somentc
revela a regio do DNA que protegida pela protena ligante. As protenas so relativamentc
grandes, se comparadas com uma hlice dupla de DNA, e podem proteger virias dezenas dc
pares de bases, quando ligadas a uma seqncia controladora que possua somente uns poucqs
pares de bases de comprimento (Figura I I .14). O
footprinting, portanto, no delimita a regio
controladora propriamente dita, somente a regio onde ela est localizada.

Protena reguladora
Par de base

Figura 11.13
Footprinting com
DNase l.

Molcula de DNA

ol.t"."

fotri:o
+
-o

og

Os nucle
ficados por
fragmentos r

Figura 11.12

Fragmento de DNA protegido


pela protena ligada

Uma protena ligada


protege uma regio de
uma molcula de DNA
da sua degradao por
uma nuclease, tal como
a DNase l.

eles so trata
plo sendo o r
11.15). Essa

nucleotdeo

extrato protr

Clonnceu GNrcA

E ANLrsE

oe

DNA

237

seqncia controladora dr
lmuclease (DNase) I (Figun
e igao da protena na

mr'

'/..-t

,--

'/

fu

uma extremidade com m


bdora (Figura 11.13a). Entfu
lc forma que no ocore a
Fvo clivar cada molcula eri
lde nNe no possui uma Fnr"
fc fragmentos marcados, difu'

Molculas de

&'

DNA

/t,
\

2'

fragmentos aparece cotrrl


No entanto, a protena
pela DNase I. C

Extremidade

marcada

(a) Marcao da extremidade,


adio da protena reguladora

-a-

--t'-r.*na

---;-

rigada

pois os fragmentos
presentes. Essa

*::-

aufu

pode, agora,
da pegada.

a-

control

interaes entre a

footprinting

tul Limitada degradao

visualizada na Fi

as seqncias

--a-

Tamanhos dos
fragmentos de DNA

protenas so relati
proteger virias dezenm
possua somente uns

F {-

zada.

ru:l:riruH::"
protegida pela protena
"t"

(c) Eletroorese em gel, auto-radiograia

Auto-radiograia

++
++
+
++
++
+
+
+
.<

no delimita a

com DNase

a---------------

.+r
-

"e"ouou'

-l

t-t
+
-t

I
I

-t

'-J

Figura 11.13
Footprinting com
DNase l.

Figura 11.12
Uma protena ligada
protege uma regior
uma molcula de Dl{fi
da sua degradao
uma nuclease, tal
a DNase l.

Canaleta 1: Controle - sem protena ligada


Canaleta 2:Teste - DNA + protena ligada

Posies onde
a protena est ligada

Os nucleotdeos que realmente formam ligaes com a protena ligante podem ser identificados por meio do ensaio de inteerncia por modificao. Como no footprinting, os
fragmentos de DNA devem ser primeiramente marcados em uma das extremidades. Ento,
eles so tratados com um reagente qumico que modifica nucleotdeos especficos, um exemplo sendo o dimetil-sulfato, que se liga nos grupos metila de nucleotdeos de guanina (Figura
11.15). Essa modificao rcalizada sob certas condies limitantes, de forma que apenas um
nucleotdeo por fragmento de DNA seja modihcado. Em seguida, o DNA misturado com o
extrato protico. O ponto-chave do experimento que a protena ligante provavelmente no

238

T.A.Bnowru

Figura 11.14
Protena ligante

Uma protena li-

gada pode proteger uma regio


de DNA que
muito mais extensa do que a
seqncia controladora.

ir se ligar ao DNA se um dos nucleotdeos de guanina dentro da regio controladora estiver


modificado, pois a metilao de um nucleotdeo interfere na reao qumica especfica qm
possibilita que ele forme uma ligao com a protena.
Como a ausncia da protena monitorada? Se a mistura de DNA e protena for examina
por
da
eletroforese em gel de agarose, duas bandas sero visualizadas, uma correspondendo
ao complexo DNA-protena e, a outra, ao DNA no-ligado protena - em essncia, essa pate do experimento constitui-se em um ensaio de retardao em gel (Figura I 1.15). A bande
correspondente ao DNA no-ligado purificada do gel e tratada com piperidina, um reager
te qumico que cliva molculas de DNA nos seus nucleotdeos metilados (p.216). Os produtos do tratamento com piperidina so, agora, separados em um gel de poliacrilamida e o resultado visualizado em auto-radiografia. O tamanho da banda ou das bandas que aparecem na
auto-radiografia indica a posio no fragmento de DNA das guaninas, cujas metilaes imp+
diram a ligao da protena. Essas guaninas localizam-se dentro da seqncia controladora 0
ensaio de modihcao pode, agora, ser repetido com reagentes qumicos que possuam corm
alvos os nucleotdeos A, T ou C para determinar a posio precisa da seqncia controladora

Figura 11.15
Um ensaio de interferncia por
modificao.

11.2.2 ldentiicando seqncias controladoras por meio de


ensaios de deleo

cap

A tcni

Os experimentos de retardao em gel,footprinting e interferncia por modificao so


zes de localizar possveis seqncias controladoras a montante de um gene, mas no fomecem
informaes sobre a funo das seqncias individuais. O ensaio de deleo uma abordagem totalmente diferente, que no s pode localizar seqncias controladoras (embora apena$

ra I 1.16). l
veria resul

com a preciso de uma retardao em gel), como, mais importante, pode tambm indicar e

qncias

funo de cada seqncia.

es result

emumami

c,

Clorunoeu GNrcA

nl/_

./

Figura

Gs modificadas
11.1t1

Uma protena "


gada pode pro.
teger uma
de DNA que
muito mais extensa do que a
seqncia cur
troladora.

E ANLrsE

or

DNA

239

Fragmentos de restrio com uma extremidade marcada

\--

Dimetil-sulfato

?r
/r

do extrato nuclear

\Oieao
Protenas

t'o au"

- ){
Eletroforese em gel
de agarose

-tY <

Nenhuma

protena ligada
(stio bloqueado)

regio controladora

qumica especfica

Purificaco do DNA
J

protena for
uma

em essencla, essa

I (Figura I1.15). A
piperidina, um
( p. 216). Os
de poliacrilamida e o
bandas que aparecem

cujas metilaes
seqncia
que possum
da seqncia

Figura 11.15

llm ensaio de in-

Pipendina

Determinao do tamanho
por meio de eletroorese em
gel de poliacrilamida

terferncia por
modiicao.

de
por modificao so
um gene, mas no
de deleo uma
adoras (embora
, pode tambm

A tcnica baseia-se na suposio de que a deleo da seqncia controladora ir resultar


em uma modificao na maneira pela qual a expresso de um gene clonado regulada (Figura 1 1.16). Por exemplo, a deleo de uma seqncia que reprime a expresso de um gene deveria resultar naquele gene sendo expressado em um nvel mais elevado. Similarmente, seqncias controladoras tecido-especficas podem ser identificadas, uma vez que as suas delees resultam na expresso do gene-alvo em tecidos outros que o tecido correto.

24O T.A.Bnowru

Silenciador

Promotor

Expresso

\
Expresso menos

\
Expresso mais elevada

Tabela

Figura 11.16

em organ

O princpio subjacente
anlise de deleo

Geneo

lacZ
neo

Genes-reprteres
Antes de realizar-se o ensaio de deleo, uma maneira deve ser encontrada para analisar o
efeito de uma deleo sobre a expresso do gene clonado. Provavelmente, o efeito ser apenas observado quando o gene for clonado nas espcies de onde ele foi originalmente obtido
em nada resultar a anlise de um gene vegetal, envolvido na regulao pela luz, se esse gene
for clonado em uma bactia.
Existem, atualmente, vetores de clonagem desenvolvidos para a maioria dos organismm
(Captulo 7), de forma que a clonagem do gene em estudo de volta ao seu hospedeiro no d+
veria constituir-se em um problema. A dificuldade que, na maioria dos casos, o hospedeiro
j possui uma cpia do gene em seus cromossomos. Como podero as mudanas no padro
de expresso de um gene clonado ser distinguidas do padro normal de expresso exibido pela cpia cromossmica do gene? A resposta uttllizar um gene-reprter. Trata-se de um gene-teste, que fusionado regio a montante do gene clonado (Figura II.l7), substituindo esse gene. Quando clonado dentro do organismo hospedeiro, o padro de expresso do gene-re-

prter dever mimetizar exatamente o do gene original, pois o gene-reprter estar sob a influncia de exatamente as mesmas seqncias controladoras do gene original.
O gene-reprter deve ser escolhido com cuidado. O primeiro critrio que ele deve codificar um fentipo que no ainda exibido pelo organismo hospedeiro. O fentipo de um gene-reprter deve ser relativamente fcil de detectar aps o gene haver sido clonado no hospedeiro, e, idealmente, dever ser possvel de submet-lo a um experimento de quantificao fenotpica. Tais critrios no tm demonstrado dificuldade de serem satisfeitos e uma variedade de genes-reprteres diferentes utilizada nos estudos de regulao gnica. Alguns exemplos esto listados na Tabela I 1.1.

cat

dhr

aphN
lux
uidA

" Todos er

minescen

Realiz
Umavs

ensaio d
constru(

gura

ll,

organisr
prter. I

remor
na esps

ladora t

Osr
cuidadc

Clorureer,r GNrcA E Ar.rlrse oe

Seqncias

controladoras

DNA

241

Promotor

Gene sob investigao

sro.titriao do gene por


um oene-reorrer

I
Gene-reprter

+-nv?z\-

Figura 11.17
Um gene-reprter.

\ \\,/\ /

Promotor

Seqncias controladoras

LL.l Alguns exemplos de genes-reprteres utilizados no estudo da regulao gnica


em organismos superiores
Tabela

figura 11.16
D princpio subjacente
rnlise de deleo

Geneo

Produto gnico

Ensaio

lacZ

p-galactosidase

Teste histoqumico

neo

Neomicina-fosfotransferase
Cloranfenicol-acetiltransferase
Dihidrofolato-redutase
Aminoglicosdeo-fosfotransferase
Luciferase
p-glucoronidase

Resistncia
Resistncia
Resistncia
Resistncia

cat

dhfr
encontrada para anali
petmente, o efeito se
fe foi originalmente
paao pela luz, se esse
l

ja

maioria dos organismc


lao seu hospedeiro no de
iA aos casos, o hospedeiro
fo as mudanas no padro
f de expresso exibido pefrter. Trata-se de um ge
I 1. l7), substituindo esb de expresso do gene-rcle-reprter estar sob a in-

be original.
que ele deve codiO
tiro. fentipo de um geier sido clonado no hospequantificao feinento de
isatisfeitos e uma variedagnica. Alguns exemfo

fitrio

aphN
lux
uidA
o

canamicina

ao cloranfenicol
ao metotrexato

higromicina

Bioluminescncia
Teste histoqumico

Todos esses genes foram obtidos de E. coli, com exceo de lux, que possui trs fontes: as bactrias lu-

minescentes Vibrio harveyii e

V.

fischeri e o vaga-lume Photinus pyralis.

Realizando um ensaio de deleo


Uma vez que o gene-reprter tenha sido escolhido e feita a construo necessria, realizar um
ensaio de deleo bastante fcil. As delees podem ser realizadas na regio a montante da
construo, por meio de uma das diversas estratgias. Um exemplo simples mostrado na Figura 11.18. O efeito da deleo , ento, analisado pela clonagem da construo deletada no
organismo hospedeiro e pela determinao do padro e da extenso da expresso do gene-reprter. Uma elevao na expresso indicar que uma seqncia repressora ou silenciadora foi
removida, uma diminuio indicar a remoo de um ativador ou reforador, e uma mudana
na especificidade do tecido (como mostrado na Figura 11.18) revelar uma seqncia controladora tecido-especfi ca.
Os resultados de um projeto de ensaio de deleo devem ser interpretados com bastante
cuidado. Complicaes podem surgir se uma nica deleo remove duas seqncias contro-

242

T. A. Bnowr.r

nado. Ambas dep


tenas em sisteme
preparados a part

Seqncia controladora
especfica para a semente

Gene-reprter

@-

\---=-

Figura 11.18
Expresso gnica
semente-especica

Deleo da seqncia

controladora

O gene agora
expressado
em todos os tecidos

Ensaio de deleo. Um gene


reprter foi ligado regio a
montante de um gene espe
cico para a semente de uma
planta. A remoo do ragmento de restrio, situado
entre os stios R, deleta a seqncia controladora, a qud
comanda a expresso gnica
especica para a semente,
de orma que o gene-reprtsr
, agora, expressado em todos os tecidos da planta.

coelho (ambas ex
as demais molcu
sistema de tradu
trados nas proten
molculas de mR
a qual pode ser se
da representa um
amostra.
Tanto a HRT
diretamente da ar
bilizado em uma
(Figura 11.20). C

nece ligado me
recuperado e tra<

protena erlifica
ladoras bastante pximas ou, como bastante comum, duas seqncias controladoras distintas cooperam para a produo de uma nica resposta. A despeito dessas potenciais dificuldades, ensaios de deleo, em combinao com estudos dos stios de ligao de protenas, frnecem informaes importantes a respeito de como a expresso de genes individuais regu
lada, tendo complementado e ampliado as anlises genticas mais gerais sobre a diferencir
o e o desenvolvimento.

11.3 ldentiicando e estudando o produto de traduo


de um gene clonado
Nos ltimos anos, a clonagem gnica tem se tornado progressivamente til no estudo, no apenas dos genes propriamente, mas tambm das protenas codihcadas pelos genes clonados. Investigaes sobre a estrutura e a funo da protena tm se beneficiado enormemente do desenvolvimento de tcnicas que permitem que mutaes sejam introduzidas em pontos especficour
de um gene clonado, resultando em mudanas diretas na estrutura da protena codificada.
Antes de se considerar tais procedimentos, ser, primeiramente, focalizado o problenre
mais real de como isolar a protena codificada por um gene clonado. Em muitos casos, essr
anlise no ser necessria, pois a protenaj foi caraceizada muito antes de o experimento
de clonagem gnica ser realizado, e amostras purificadas da protenaj se encontram disponveis. Por outro lado, h ocasies em que o produto de ttaduo de um gene clonado no foi
identificado. Um mtodo para o isolamento da protena , ento, necessrio.

11.3.1 HRT e HART podem identificar o produto de traduo


de um gene clonado
Duas tcnicas relacionadas, traduo com liberao do hbrido (HRT, do ingls hybrid-release translation) e traduo com reteno do hbrido (HART, do ingls hybrid-arrest
translation), so utilizadas para identificar o produto de traduo codificado por um gene clo-

Traduo lM

Crorunoev GNrcA

figura 11.18

Ensaio de deleo. Um gere


Fprter oi ligado regio a
de um gene espe
para a semente de unrr
. A remoo do ragde restrio, situado
os stios R, deleta a se.
controladora, a qual
a expresso gni:r
para a semente,
orma que o gene-rePrt
agora, expressado em te
os tecidos da planta.

E ANLrs

oe

DNA

243

nado. Ambas dependem da capacidade de um mRNA purificado conduzir a sntese das protenas em sistemas de traduo livres de clulas. Esses so extratos celulares, normalmente
preparados a partir de sementes de trigo na fase germinativa ou de clulas de reticulcitos de
coelho (ambas extremamente ativas na sntese protica), contendo ribossomos, tRNAs e todas
as demais molculas necessrias para a sntese protica. A amostra de mRNA adicionada ao
sistema de traduo livre de clulas, juntamente com uma mistura dos 20 aminocidos encon3sS-metionina
utilizado). As
trados nas protenas, um dos quais marcado (freqentemente
molculas de mRNA so traduzidas em uma mistura de protenas radioativas (Figura 11.19),
a qual pode ser separada por eletroforese em gel e visualizada por auto-radiografia. Cada banda representa uma nica protena, codificada por uma das molculas de mRNA presentes na
amostra.
Tanto a HRT quanto a HART funcionam melhor quando um clone de cDNA, preparado
diretamente da amostra de mRNA, est disponvel. Para a HRT, o cDNA desnaturado, imobilizado em uma membrana de nitrocelulose ou nilon, e incubado com a amostra de mRNA
(Figura 11.20). O mRNA especfico, correspondente ao cDNA, hibridiza com esse e permanece ligado membrana. Aps a remoo das molculas no-ligadas, o mRNA hibridizado
recuperado e traduzido em um sistema livre de clulas, o que fornece uma amostra pura da
protena codificada pelo cDNA.

as controladoras

dessas potenciais di
de ligao de protenas,
de genes individuais
is gerais sobre a dife

a\q
\\t ^'

*?q*.

.l:..

\..\\
\\
\ ?

traduo

mRNAs

sistemade

traduolivre
/ '."o+
o" tu'''"'
/r,or*oo".o,n
\
tut-t"'

\
purificados \

til no estudo, no
pelos genes clonado*

-{

enormemente do
em pontos
da protena codificada
focalizado o
rnado. Em muitos casos
muito antes d" o
"*p"#
j se encontram

mRNA

\
\

Eletroforese em gel,
auto-radiograia

\
\

traduo

codificado por um

de um gene clonado
necessrio.

(HRT, do ingls /t
RT, do ingls hybrid

Protena marcada

\'j=l

Produtos
de traduo

marcados

Figura 11.19
Traduo livre de clulas.

Marcadores de
peso molecular
para protenas

244

T. A. Bnowlr

cDNA especfico

/\
Membrana

Aplicao da mistura de mRNA

Hibridizao com o mRNA especfico

/\

./\

,#;,TFFV,
Remoo do mRNA hibridizado

Traduo livre de clulas, eletroforese


e auto-radiografia

Protena
codiicada
pelo cDNA

Figura 11.21

Figura 11.20

Traduo com reteno do hbrido.

Traduo com liberao do


hbrido.

A traduo com reteno do hbrido

ligeiramente diferente, no sentido de que o cDNA


desnaturado adicionado diretamente amostra de mRNA (Figura 1I.21).4 hibridizao mvamente ocorre entre o cDNA e seu mRNA correspondente, mas, nesse caso, o mRNA noligado no descartado. Em vez disso, a amostra inteira traduzida em um sistema livre

&

clulas. O mRNA hibridizado incapazde conduzir a traduo, de modo que todas as prote
nas' com exceo daquela codificada pelo gene clonado, so sintetizadas. O produto de traduo do gene clonado , portanto, identificado como a protena que est ausente na auto-radio
grafia.

11.3.2 A anlise de protenas por mutagnese in vitro


Embora HRT e HART possam identificar o produto de traduo de um gene clonado, essas
tcnicas pouco informam a respeito da protena propriamente dita. As principais perguntas,
questionadas pelo biologista molecular de hoje, esto centralizadas na relao entre a estrutura de uma protena e o seu modo de atividade. A melhor maneira de cuidar desses problemas
induzir uma mutao no gene que codifica a protena e, ento, determinar qual oifeito que
a alterao na seqncia de aminocidos tem nas propriedades do produto de traduo (Figuta 11.22). No entanto, sob circunstncias normais, as mutaes ocorem aleatoriamente e um

grande nme
o proveito:
se

in vitro, tt

especfico de

Dierentes
Uma quase i

mutaes em

(1)
(2)

Um fra
Ogene

(3)

eogen
Um ol

ser rem

ll.23c
adicior

hlice.

CLorueoeu Gr.lcr e ANLtsE oe

q(
I \ i \\^
.,

N...
preparao de

DNA

245

Adio do cDNA

es'ecico

mRNA \

a\

\s
\\

Ct
Hibridizao do

cDNAcomo mRNA
correspondente

Traduo livre de clulas

-9.,./
rQlt
(\_-/
)r

//
mRNA hibridizado
no pode ser
traduzido

lura

Figura 11.21

11.20

pduo com liberao do


brido.
]

Eletroorese em gel,
auto-radiograf ia

Produtos de HART

Traduo com reteno do hbrido.

Produtos da

traduo total

no sentido de que o

It.2t). A hibridi
nesse caso, o mRNA

ida em um sistema livre


modo que todas as
izadas. O produto de
p esti ausente na auto-

grande nmero delas pode ter sido selecionado, antes que um4 que nos desse uma informao proveitosa, fosse encontrada. Uma soluo para o problema fornecida pela mutagnese in vitro, tcnica que possibilita que uma mutao direcinada seja realizada em um local
especfico de um gene clonado.

Dierentes tipos de tcnicas de mutagnese in vitro


Uma quase ilimitada variedade de manipulaes do DNA pode ser utilizada para introduzir
mutaes em genes clonados, destacando-se, a seguir, as mais simples.

(1)
(2)

ib
b d"

,r-

gene clonado,
principais
pe
Eta.As

ps na relao entre

de cuidar desses oroble

ideterminar qual o efeito

;;;;.o"';il;;;

rcorem aleatoriamente e

F-

(3)

Um fragmento de restrio pode ser deletado (Figura ll.23a).


O gene pode ser clivado em um nico stio de restrio, uns poucos nucleotdeos podem
ser removidos com uma endonuclease especfica para fita dupla, tal como Bal3l (p.&),
e o gene religado (Figura ll.23b).
um oligonucleotdeo pequeno pode ser inserido em um stio de restrio (Figura
ll.23c). A seqncia do oligonucleotdeo pode ser tal que a seqncia de aminocidos
adicional, inserida na protena, produz, por exemplo, uma nova estrutura, tal como uma
hlice-o, ou desestabilize uma estrutura existente.

246

T. A. Bnowr.r

Embora potenc
Mutao, p. ex., T

Gene

7-7777---71

de restrio na

gonucleotdeo

v--.----a-7-7-71

cal do gene.

Utilizando r
em um gen

Existem inrnr
mos considera
forma de fita s

Protena

Mutao, por
exemplo, ile -) leu

ples purifica

Um oligonucl

contendo a al
to, o oligonucl

\
\

\t

\
Propriedades da
protena normal

Propriedades da
protena mutante

Gompare

Figura11.22

da fita compl

Uma mutao pode alterara


seqncia de aminocidos
de uma protena, aetando,
possivelmente, suas propri+
dades.

11.24b). Essa
e a molcula n

(a) Deleo de um ragmento de restrio

Aps a int

DNA produz I

vativa da replir
duzidas ter ar
maneira semel
mutada e metr

queados em m

Alul
Gene
r
,,ar,,,,o, ---F-

Alti

Alul

Alul
ligao

I
I

q$$S Protena

"

Protena com uma


deleo importante

normat

4N

(b) Remoo de um nucleotdeo de um stio de restio


EcoRl

v)r---t

Ejtl _

conter a mol
meio de hibrid
dies muito t
As clulas
dividir (p. 36)

v-J-"-l
Gene
I'
d"l"r"do

v-.,
Bdst ?-

ras, resultan
do pode ser p
efeito de uma

Deleo
pequena

ligao_

to, ser avaliad

771

O potencia

al:fi'"*,

qgsd{;:",l""

A mutagnes
tencial extrac
Por exemplo,

uma ^t"?g

Protena com
deleo pequena

maneira cornt

svel, por me
cidos que det
zimtica. As t
tirem que o p
alternativo e

(c) lnsero de um oligonuclotdeo


EcoRl

"-+I
I

"ss'

Protena
normal

EcoRl_

rioco

at/!l
/l
Oligonucleotde.

lnsero

Ur-?
(
C
(

Figura 11.23
d""""-

Diversas tcnicas de mu-

tabitizada

tagnese rn

Protena

vitro.

capacid

rveis, segun
engenharie r

vimento de nr

Cr-orueceu GNrcA E ANLrsE DE

DNA

247

Embora potencialmente teis, tais manipulaes dependem da ocorrncia casual de um stio


de restrio na rea de interesse, dentro do gene clonado. A mutagnese direcionada por oligonucleotdeo uma tcnica mais verstil, que pode introduzir uma mutao em qualquer lo-

cal do gene.

Utilizando um oligonucleotdeo para introduzir uma mutao pontual


em um gene clonado

ura11.22
na mutao pode alterara
ncia de aminocidos
uma protena, aetando,
ivelmente, suas proprbr

LFen"
febtado
I
I
F

h
r
I

Existem inmeras maneiras diferentes de realizar-se a mutagnese por oligonucleotdeo; iremos considerar o mais simples desses mtodos. O gene a ser mutado deve ser obtido em uma
forma de fita simples e, por isso, em geral clonado em um vetor M13. O DNA de fita simples purifcado e a regio a ser mutagenizada identificada por seqenciamento do DNA.
Um oligonucleotdeo pequeno , eno, sintetizado, complementar regio relevante, mas
contendo a alterao nucleotdica desejada (Figura ll.24a). A despeito desse malpareamento, o oligonucleotdeo ir anelar ao DNA de fita simples e atuar como iniciador para a sntese
da fita complementar, utilizando o fragmento de Klenow da DNA-polimerase I (Figura
Il.24b). Essa reao de sntese defrta continuada at que uma nova fita completa seja feita
e a molcula recombinante fique completamente de fita dupla.
Aps a introduo, via transfeco, em clulas de E. coli competentes, a replicao do
DNA produz numerosas cpias da molcula de DNA recombinante. A natureza semiconservativa da replicao do DNA garante que a metade das molculas de fita dupla que sero produzidas ter ambas as f,rtas no-mutadas, enquanto metade ser mutada em ambas as fitas. De
maneira semelhante, metade da prognie de fagos resultante portar cpias da molcula nomutada e metade portar a mutao. Os fagos produzidos pelas clulas transfectadas so plaqueados em meio gar slido, de forma que placas so produzidas. Metade das placas dever
conter a molcula recombinante original, e metade a verso mutada, o que determinado por
meio de hibridizao em placa, utilizando o oligonucleotdeo como sonda e empregando condies muito severas, de forma que somente o hbrido completamente pareado seja estvel.
As clulas infectadas com vetores M13 no so lisadas, mas, ao contririo, continuam a se
dividir (p. 36). O gene mutado pode, portanto, ser expressado nas clulas de E. coli hospedeiras, resultando na produo da protena recombinante. A protena codificada pelo gene mutado pode ser purificada a partir das clulas recombinantes e suas propriedades estudadas. O
efeito de uma mutao em um nico par de bases sobre a atividade da protena pode, portanto, ser avaliado.

O potencial da mutagnese direcionada por oligonucleotdeo


A mutagnese direcionada por oligonucleotdeo e as tcnicas relacionadas possuem um potencial extraordinrio, tanto para a pesquisa bsica quanto para a biotecnologia aplicada.
Por exemplo, o bioqumico pode, agora, formular questes muito especficas a respeito da
maneira como a estrutura da protena afetaa atividade de uma enzima. No passado, foi possvel, por meio de anlises bioqumicas, obter-se alguma noo da identidade dos aminocidos que determinavam a ligao ao substrato e as funes catalticas de uma molcula enzimtica. As tcnicas de mutagnese fornecem uma viso muito mais detalhada, por permitirem que o papel de cada aminocido seja avaliado pela substituio desse por um resduo
alternativo e determinando-se o efeito que essa substituio causa na atividade enzimtica.
A capacidade para manipular enzimas dessa maneira tem resultado em avanos considerveis, segundo nosso entendimento da catlise biolgica, e tem nos levado ao novo campo da
engenharia de protenas, na qual as tcnicas de mutagnese so utilizadas para o desenvolvimento de novas enzimas com propsitos biotecnolgicos. Por exemplo, alteraes cuidado-

L,ao

Figura
t

Fna
es-

Eada

Diversas
nicas de
tagnese
vitro.

ir

248

T. A. Bnowr.r

(phage disph,

bilitam que e

(a) Oligonucleotdeo

gly
-------- ccA

ci

GCT

AAT

leu
TTA

AAT

TAC

ala

tyr

leu

met

ala

gly

asn

met
ATc

--------l
-------

Apresenta

Seqncia
gnica normal

Essa tcnica,

nas na superl
clonagem do
no gene clon
do fago (Figr

otioonucleotioeo

Malpareamento no-complementar

(b) Sntese da tita complementar


Gene no vetor M13
Fragmento

de Klenow,

(a) Apresentao d

dNTPs

Oligonucleotdeo

Fila complementar
totalmente sintetizada

(c) lsolamento dos agos contendo a mutao


Fagos contendo

(b) Fuso nt o

o gene

normal

,/

/ Plagueamento

em gar
Placas contendo
o gene mutado

Placas

Hibridizao
em placa,

sondagem com
o oligonucleotdeo
marcado

Figura 11.24
Um mtdo para a
mutagnese direcb
nada por oligonucleotdeo.

(c) Utilizando

ur

Placa de mbro
sas na seqncia de aminocidos da subtilisina, uma enzima utilizada no sabo em p, resnl.
taram em verses manipuladas com maior resistncia aos desgastes trmico e de branqu*
mento (oxidativos) que ocorrem nas mquinas de lavar roupas.

Lr

11.3.3 Estudando as interaes protena-protena

c*

Nas clulas vivas, poucas, se que existem, protenas funcionam em total isolamento. Ao
trrio, as protenas trabalham juntas em rots bioqumicas e em complexos multiproticos. Informaes a respeito da funo de uma protena que no tenha sido previamente estudada
dem, freqentemente, ser obtidas por meio da determinao de quais outras protenas trab*

lham juntamente com ela na clula. Duas tcnicas importantes, a apresentao por

fagl

Figura 11.25
Apresentao por fagr
nante. (b) O gene usit
teraes entre a Prote

Clorunoeu Grurcr e ANLrs oe

Qthage display) e o sistema de dois

bilitam que

essas interaes

DNA

249

hbridos de levedura $teast two hybrid systen), possi-

protena-protena sejam examinadas.

Apresentao por ago


Essa tcnica chamada de apresentao por fago porque envolve a "apresentao" de protenas na superfcie de um bacterifago, normalmente M13 (Figura ll.25a).Isso obtido pela
clonagem do gene que codifica a protena em um tipo especial de vetor Ml3, um que resulta
no gene clonado tornando-se fusionado com um gene que codifica uma protena do capsdeo
do fago (Figura ll.2sb).Aps a transfeco de E. coli, esse gene fusionado comanda a snte-

(a) Apresentao da protena na supercie de um ago


Apresentao das protenas

(b) Fuso ente o gene clonado e um gene do capsdeo do ago

Gene do ago

Expressao

Gene clonado

dogene \\

Protena do
capsdeo
do ago

Figura 11.24
Um mtodo panaa
mutagnese
nada por oligonu
cleotdeo.

*
!
I

^A
ffirffi,
j\)v6''

.-,,

Apresenrao
da protena

(c) Utilizando uma biblioteca de apresentao por ago

Placa de microtitulao

pada no sabo em p,
istes trmico e de brar

Biblioteca de
apresentao
por ago

/(

ffi

Lavagens

Fagos retidos

Protena-teste

Fm total isolamento. Ao

firplexos multiproticoe.
ho previamente esfudade
lquais outras protenas
g, a apresentao por

Figura 11.25
Apresentao por ago. (a) Apresentao de protenas na supercie de um ago filamentoso recombimnte. (b) O gene usionado utilizado para apresentar a protena. (c) Uma maneira de detectar as inbraes entre a protena-teste e um ago de uma biblioteca de apresentao.

250

T. A. Bnowlr

se de uma protena hbrida, parcialmente constituda da protena do capsdeo e parcialmente


do produto do gene clonado. Com sorte, essa protena hbrida ser inserida dentro do capsdeo do fago, de forma que o produto do gene clonado fique localizado na superficie das partculas de fago.
Normalmente, essa tcnia realizada com uma biblioteca de apresentao por fago,
constituda de muitos fagos recombinantes, cada um apresentando uma protena diferente. Bibliotecas representativas podem ser preparadas por clonagem de uma mistura de cDNAs preparados a partir de um determinado tecido ou, menos facilmente, por clonagem de fragmentos de DNA genmicos. A biblioteca consiste em fagos apresentando uma variedade de protenas e uilizada para identificar aqueles que interagem com a protena a ser testada. Essa
protena-teste poder ser uma protena pura ou uma que, ela prpria, seja apresentada em urit
superfcie de fago. A protena imobilizada nas canaletas de uma placa de microtitulao ou
sobre partculas que podem ser usadas em uma coluna de cromatografia de afinidade, e, ento, misturada com a biblioteca de apresentao por fago (Figura ll.25c). Os fagos retidos na
placa de microtitulao ou dentro da coluna, aps uma srie de lavagens, sero aqueles que
apresentam protenas que interagem com a protena-teste imobilizada.

O sistema de

dois hbridos de levedura

O sistema de dois hbridos de levedura muito diferente da apresentao por fago. Esse procedimento est baseado na descoberta de que a expresso gnica na levedura Saccharomyces
cerevisiae depende de interaes entre pares de fatores de transcrio (Figura ll.26a). No sistema de dois hbridos, um pr de fatores de transcrio, responsvel pela expresso de um gene de levedura, substitudo por protenas fusionadas, cada uma parcialmente composta do
fator de transcrio e parcialmente da protena a ser testada. A capacidade desse par de hbridos de conduzir a expresso do gene-alvo da levedura , ento, testada.
Para utilizar o sistema, dois experimentos de clonagem em levedura devem ser realizados.

O primeiro experimento de clonagem envolve o gene cujo produto protico est sendo estudado. Esse gene fusionado quele de um dos pares de fatores de transcrio e a construo
ligada em um vetor de levedura. As leveduras recombinantes produzidas no so capazes de
expressar o gene-alvo, pois esse fator de transcrio modificado no pode interagir com o seu
parceiro (Figura ll.26b).
No segundo experimento de clonagem, uma verso hbrida do parceiro construda e inserida nas clulas de levedura. A restaurao da expresso do gene-alvo indica que os dois fatores de transcrio hbridos podem interagir. As fuses so projetadas de tal maneira que isso somente poder acontecer se as interaes oco1Terem entre os componentes das protenasteste dos hbridos, e no entre os segmentos dos fatores de transcrio (Figura 11.26c). Pares
de protenas-teste que atuam um sobre o outro so, portanto, identificados. O segundo expe-

rimento de clonagem pode envolver uma biblioteca de recombinantes que representam protenas diferentes, de forma que uma protena poder ser testada contra muitas outras.

Figura 11.26
O sistema de
dois hbridos de
levedura. (a) Um
par de atores de

transcrio que
devem interagil
a im de um gene
da levedura ser
expressado. (b) A
substituio do
ator de transcrio 1 pela prote
na hbrida 1. interrompe a expresso do gene,
uma vez que 1*
no pode interagir com o fator de
transcrio 2. (c)
A substituio do
ator de transcrio 2 pela protena hbrida 2* restaura a expresso do gene, caso as partes h
bridas de 1* e 2*
sejam capazes
de interagir.

Cr-ounceu Grurcn e ANLrsE oe

capsdeo e parcialmente
inserida dentro do caps-

DNA

(a) Interaes entre atores de transcrio

na superficie das par-

ooit fatores de transcrio

apresentao por fago"


protena diferente. Bi-

mistura de cDNAs pre-

/-;(^
\IX

por clonagem de fragmer


uma variedade de pro
na a ser testada. Essa
seja apresentada em u'na
placa de microtitulao m
de afinidade, e, *
1.25c). Os fagos retidosn
sero aqueles qrc

por fago. Esse

\
Figura 11.26
O sistema de

dois hbridos de
levedura. (a) Um
par de atores de
transcrio que
devem interagir,
aim de um gen
da levedura ser
o<pressado. (b) A
substituio do
tator de transcrio 1 pela prote
na hbrida 1* interrompe a expresso do gene,
*
uma vez que 1
pode
interano
gir com o fator de
nanscrio 2. (c)
A substituio do
ator de transcrio 2 pela prote
na hbrida 2* restaura a expresso do gene, caso as partes h
bridas de 1* e 2*
sejam capazes
de interagir.

pu

levedura Saccharom
(Figura 11.26a). No
pela expresso de um
parcialmente composta
idade desse par de
devem serreali

protico est sendo


idas no so capazes
pode interagir com o

parceiro construda e
indica que os dois
de tal maneira quei
componentes das

(Figura II.26c).
ificados. O segundo
que representam

F
I

!'

tnterao

-_:::::j=:::=.=;i

Expressao
do gene

(b) O resultado do primeiro expeimento de clonagem

-o

Fator de transcrio

hbrido

Ausncia de interao

No ocorre a
expresso do gene

(c) O resultado do segundo experimento de clonagem

@@
@

lnterao

Expresso
do gene

251

CnpruLo 12
I

. fnna,
I

llL

in Biotechnology,

Estudando Genomas

vitusspecific RNA: analysis by

le.

itin

interactions. Trends in Gert-

fotft"tur.

chain reaction. Irendr

interactions by polyacrylamih
from rare transcripts: rF
the National Academy of Sciaof protein-DNA binding

ry-

binding of proteins to specift


system. Nucleic Acith
major groove regions at

t2,3129-33. An example

rh

offt

selection. Proceedings of b
por oligonucleodeo.l
mapping by DNA.mRNA\I
of the USA, 74, 437G74in phage and host biologffl.

Genmica: como seqenciar um genoma, 254


Ps-genmica: tentando entender a seqncia de um
genoma,265

Estudos do transcritoma e do proteoma, 269

No incio do sculo XXI, a nfase da biologia molecular passou do estudo de genes individuais para o estudo de genomas inteiros. Essa mudana foi possvel graas ao desenvolvimento, durante adcadade 1990, de mtodos para o seqenciamento de grandes genomas. O seqenciamento de genomas comeou antes da dcada de 1990 - vimos, no Captulo 10, como
o primeiro genoma, aquele do fago QXl74, foi completado em 1975 -, mas somente 20 anos
depois, em 1995, o primeiro genoma de um organismo de vida livre, o dabactna Haemophilus influenzae,teve seu seqenciamento concludo. Os cinco anos seguintes constituram-se
em um divisor de guas, com as seqncias dos genomas de quase 50 outras bactrias sendo
publicadas, juntamente com as seqncias completas de genomas muito maiores, como o de
levedura, o da mosca-das-frutas, o de Caenorhabditis elegans (um verme nematdeo), o da
Arabidopsis thaliana (uma planta) e o humano. Em 2001, o seqenciamento de genomas bacterianos j havia se tornado uma rotina e a execuo de projetos dirigidos a genomas eucariticos, passado a ser encarada com uma confiana muito maior do que a possvel apenas uns
poucos anos antes.
Para o entendimento de um genoma, trs tipos distintos de anlise devem ser executados:

(1)

A genmica a aquisio dos dados de seqncia. Os dados so adquiridos na forma de

(2)

muitas seqncias individuais de 500 a 800 pb, que devem ser montadas na seqncia genmica contnua. necessrio, portanto, ser elaborada uma estratgia para a montagem
correta das seqncias.
A ps-genmica ou a anlise funcional a anlise da seqncia de um genoma para localizar os genes, as seqncias controladoras e outros elementos interessantes, seguida de
vrios experimentos para determinar as funes de quaisquer genes desconhecidos que tenham sido descobertos.

254

T. A. Bnowlr

(3)

o uso de sistemas computadorizados para auxiliar as pesquisas gen.


mica e ps-genmica. A bioinformtica inclui a montagem computadorizada de contip
de seqncias, o exame de seqncias para verificao da presena de genes, a previso
de funo para genes identificados e o armazenamento da vasta quantidade de dados ge
rados durante um projeto de seqenciamento de genoma.

A bioinformtica

12.1 Genmica: como seqenciar um genoma

Figura 12.1
A abordagem de
brica para o
seqenciamento
de DNA em
grande escala.

Um experimento de seqenciamento por terminao de cadeia simples executado manualmente produz em torno de 400 nucleotdeos de seqncia, enquanto uma nica corrida em um
seqenciador automtico gera em torno de 750 pb. Mas o tamanho de um genoma bacteriano
tpico de 4.000.000 pb e o do genoma humano de 3.200.000.000 pb (Tabela 12.1). Fica L
vio que um grande nmero de experimentos de seqenciamento deve ser executado para determinao da seqncia completa de um genoma.
Essa situao, aparentemente desanimadora, pode ser resolvida com o uso de sistemas robotizados para a preparao de DNA para seqenciamento e para a execuo dos experimentos de terminao de cadeia, com as seqncias sendo lidas por seqenciadores automticm
que transferem os dados diretamente para um computador (Figura 12.1). Nos laboratrion
com estilo de fbrica que executam esses projetos, o principal objetivo manter os seqenciadores automticos operando em suas capacidades mximas. Cada seqenciador capaz &
executa at 96 experimentos em paralelo, gerando 72.000 pb de seqncia a cada duas horas
As maiores iniciativas de seqenciamento utilizam at 100 seqenciadores automticos operando 24 horas por dia, o que representa uma produo terica diria de 50.000.000 pb. Nesse contexto, o seqenciamento de genomas j no parece ser uma tarefa to assustadora.
Na prtica, a gerao de dados de seqncia suficientes um dos aspectos mais rotineirm
de um projeto de seqenciamento de genoma. O primeiro problema real que surge a necessidade de montar os milhares, ou, s vezes, milhes, de seqncias individuais de 750 pb em
uma seqncia genmica contnua. Duas estratgias diferentes foram desenvolvidas para a
montagem de seqncias (Figura 12.2).

E
Figura12.2
(a) A abordagem aleatria (sf,otgun approach) e
(b) a abordagem de
contigs de
clones para
a montagem
da seqncia de um
genoma.

(1)

aleator

Tabela 12.1 Tamanhos de genomas representativos


Espcie

Tipo de organismo

Mycoplasma genitalium

Bactria
Bactria
Bactria
Levedura

H ae mop hilu s infl ue nzae

Escherichia coli
iae
C aenorhab ditis e le g ans
D ro s op hil a me lano g a s t e r
S ac

charomy

ce

ce

rev

Arabidopsis thaliana
Homo sapiens
Triticum aestivum

is

Verme nematdeo
Inseto
Planta

Mamfero
Planta (trigo)

A aboi

Tamanho do genoma (Mb)


0,58
1,83

4,64

t2,t

(2)

busca r
A abor

rante

todel
mente
a

parti

91
180

12.1.1 A aborda

t25

A exigncia
breposies
ra que seja t
rado e no 1

3.200
17.000

Cr-oruncev Grurca e ANLrsE oe

nrxiliar

as pesquisas

-l
t-*"*-"
I I

genil

ontip
imputadorizad
henca de senes. a orevisfu
p quantidade de dados gsa de c

t
i.

Figura 12.1

lExeculamlllll

A abordagem de
brica para o
seqenciamento
de DNA em
grande escala.

or

I
I

experimentos

|
de I

F;"^;
lnurourrcosl

------------*

lseqenciamentol

|
I

Lemas I
seqncias I

DNA

255

"-;;l
I

--------------------=

|
I

Analisam
os

dados

executado
puma nica corrida em
Iae um genoma bacteri
f pb (Tabela l2.l ). Fica
ser executado para

hrt"t

Molcula de DNA
Quebra em fragmentos

aleatrios

Montagem de um

conlunto de fragmentos
clonados com sobreposies parciais

fzve

12.1). Nos
seqenciador , capaz

[incia a cada duas h


iadores automticos
a de 50.000.000 pb.

efa to assustadora
aspectos mais rotinei
real que surge a na
individuais de 750 pb
desenvolvidas pmr

Frgura12.2
(a) A abordagem aleatria (sho
gun approach) e
(b) a abordagem de
contigs de
dones para
a montagem
da seqncia de um
genoma.

(1)
(2)

iI

o,sS
1,83

.
', l2'r
,97
'

4,64

180

r25
I3.200
.000

Montasem da

seqncia

/
Seqncia de DNA

(a) A abordagem aleatria

(b) A abordagem de contigs


de clones

A abordagem aleatria (do ingls shotgun approach), na qual o genoma quebrado


aleatoriamente em fragmentos curtos. As seqncias resultantes so examinadas em
busca de sobreposies, utilizadas para a montagem da seqncia contnua do genoma.

Aabordagem decontigs declones, queenvolveumafasedepr-seqenciamento,

durante a qual identificada uma srie de clones parcialmente sobrepostos. Cada segmento de DNA clonado , ento, seqenciado e as seqncias so posicionadas adequadamente no mapa de contigs, para ordenar e gradualmente montar a seqncia genmica
a partir das sobreposies.

12.1.1 A abordagem aleatria para o seqenciamento de genomas


A exigncia fundamental para

a abordagem aleatria a viabilidade da identificao de sobreposies parciais entre todas as seqncias individuais que forem geradas. Alm disso, para que seja obtida a seqncia genmica correta, esse processo de identihcao deve ser acurado e no pode ser ambguo. Um erro na identificao de um par de seqncias sobrepostas

256

T. A. Bnowr'r

parcialmente poderia levar montagem da seqncia genmica em uma ordem incorreta ou


perda completa de algumas partes dela. Como a probabilidade de ocorrncia desse tipo de erro aumenta para genomas maiores, a abordagem aleatria tem sido utilizada principalmenc
com os genomas bacterianos menores.

ram executa
rejeitadas, p,
ram entrada

O projeto de seqenciamento do genomade H. influenzae

genoma de,l
Poderia I

A abordagem aleatria foi utilizada com sucesso pela primeira vez com abactna H. influenzae,pnmeiro organismo de vida livre que teve seu genoma completamente seqiienciado, com
os resultados publicados em 1995. A primeira etapa foi quebrar o genoma de 1.830 kb da bactria em fragmentos curtos, que serviriam de molde para os experimentos de seqenciamento
(Figura 12.3). Poderia ter sido utilizada uma endonuclease de restrio, mas a sonicao (p223) for escolhida por ser mais aleatria e, portanto, capaz de reduzir a possibilidade de ap
recimento de lacunas na seqncia do genoma.
Foi decidido que o projeto concentrar-se-ia nos fragmentos de 1,6 a 2,0 kb, pois eles poderiam gerar duas seqncias de DNA, uma a partir de cada extremidade, reduzindo a quarF
tidade de clonagens e de preparaes de DNA que seriam necessrias. O DNA sonicado fo(
portanto, fracionado por eletroforese em gel de agarose e os fragmentos de tamanho deseja
do, purificados a partir do gel. Aps a clonagem, 28.643 experimentos de seqenciamento fe

conjunto de

acabassem

sem, por aci

mos de tenrl
lacunas indi
a mais bempreparada er

gonucleotd
mentos. Em

dicando que
estavam adj
chada pelo

GENOMA
(1.830 kb)

FRAGMENTOS ALEATORIOS

cronaoem

/
Figura 2.4

BIBLIOTECA DE CLONES

LJtilizando hibridiza-

/
Seqenciamento

/a
24.304 SEONCtAS

Figura 12.3
Montajem de seqncias

Uma representa-

o esquemtica
140 CONTTGS

das principais etapas do projeto de


seqenciamento
do genoma de H.
influenzae.

de seqncii
grande quan

o com oligonucleotdeos para fechamento das lacunas na seqncia do


genoma de H. influenzae. Os oligonucleotdeos 2 e 5
hibridizam com o
mesmo clone de ,
indicando que os
otigs I e lll so adjacentes. A lacuna
entre eles pode ser
echada a partir do
seqenciamento de
parte do clone de 1..

Cr-onecev Grutcn e ANltse oe

pma ordem incorreta ou


tsorrncia desse tiPo de erf

to

utilizada princiPalmene

\t"rr"e
lcom a bactiaH. influet

con

Famente seqenciado,
1.830 kb dabrlenoma de
de seqenciamem

mas a sonicao
a

(r

possibilidade de aP*'

1,6 a2,O kb, pois eles 1n-

idade, reduzindo a qum


as. O DNA sonicado fc*
de tamanho deseja"
de seqenciamentof

DNA

257

ias - 4'339 no total - foram


ram executados com 1g.687 dos clones. Algumas dessas seqn
seqncias restantes derejeitadas, porque tinham extenses menores que 400 pb. As24.304
os dados' O resultado foi um
ram entrada em um computador, que levou 30 horas analisando
a um segmento diferente do
conjunto de 140 seqncas contnuas, cada uma correspondendo
genoma de H. influenzae.
sonicados, para que
Poderia ter sido possvel continuar o seqenciamento dos fragmentos
11'631'485 pb
Porm'
individuais'
acabassem sendo fechadas as lacunas entre os segmentos
que uma
sugerindo
do genoma -,
de seqnciaj haviam sido gerados - seis vezes a extenso
foscorretos
que os fragmentos
granO" quantldade de trabalho adicional seria necessiria at
terem
eficiente
J"-, poi acaso, seqenciados. Nesse estgio do projeto, a abordagem mais
das
uma
cada
de
*or." tempo foi a utilizao de uma estratgia fu.igiOu para o fechamento
lacunas'
das
para o fechamento
lacunas individualment". V,riu, abordagens foram utilizadas
de uma biblioteca de clones
por
hibridizao

anlise
envolvendo
delas
a mais bem-sucedida
com uma srie de sondas (olipreparada em um vetor 1, (Figura I2.4). Abiblioteca foi triada
de cada um dos 140 seggonucteotfOeos), cujas ,"qu"iut correspondiam s extremidades
com o mesmo clone de l" inmentos. Em alguns casos,ois oligonuclotdeos hibridizavam
por aqueles oligonucleodeos
dicando que axtremidades dos dois segmentos representados
extremidades podia, ento' ser feestavam adjacentes no genoma. A lacuna entre esss duas
de )"'
chada pelo seqenciamnto da parte apropriada do clone

(a) Preparao dos oligonucleotdeos a seem

utilizados como sondas

Contigl l---------12
Contigll !-----------:
34
Contiglll

Figura 12.3
Uma representao esquemtica
das principais eF
pas do projeto d
seqenciamento
do genoma de H.
influenzae.

Figura 12.4
Utilizando hibridizao com oligonucleotdeos Para echamento das lacunas na seqncia do
genoma de H. influenzae. Os oligonucleotdeos 2 e 5
hibridizam com o
mesmo clone de ?r,
indicando que os
antigs I e lll so adjacentes. A lacuna
entre eles Pode ser
echada a Partir do
seqenciamento de
parte do clone de L.

Sondas de
oligonucleotdeos

(b)Triagem de uma biblioteca genmica

Sonda com o
oligonucleotdeo 2
*&**4*&
&&*eer&
S9&A&**a6e
eaa$**s*

**ssss&*&
48s*4*S*

Goncluso:

tlll
|_--_-.:|-_-_-_-:l

1256

Sonda com o

oligonucleotdeo 5

6&&&&a****
&&ss&&*64
S*9&8Aea*A
essg&a?
9S**s*&ss
**a6*?***

Oscontgslelll
esto adiacentes
no genoma

258

T. A. Bnowlr

Problemas da clonagem aleatria


A estratgia de clonagem aleatria foi exitosa com muitos genomas bacterianos. Isso

se del.e
ao fato de tais genomas bacterianos serem pequenos, de modo que as exigncias computacionais para a identificao de sobreposies de seqncias no so muito grandes. Ademais"

eles no contm seqncias de DNA repetidas, que so seqncias de poucos pares de bases
at vrias quilobases, repetidas em dois ou mais locais em um genoma. Tais seqncias provocam problemas para a abordagem aleatria pois, quando so montadas, aquelas que se erF
contram parcial ou inteiramente no interior de um elemento repetido podem ser alinhadas, por
sobreposio acidental, com a seqncia idntica presente em um elemento de repetio diferente (Figura 12.5). Isso pode levar ao posicionamento inconeto ou a perdas de parte ou de toda a seqncia quando da montagem do genoma. Por essa razo, o seqenciamento aleatrio
considerado inadequado para genomas eucariticos, visto que eles possuem muitos elementos repetidos. Mais adiante, neste captulo, ser visto como essa limitao pode ser superada
pelo uso de um mapa genmico para dirigir a montagem de seqncias obtidas pela abordagem aleatria.

12.1.2 A abordagem de contigs de clones


A abordagem

de contigs de clones no tem as limitaes do seqenciamento aleatrio e, portanto, capaz de gerar uma seqncia acurada de um grande genoma com DNA repetitivo, clF
jo inconveniente envolver muito mais trabalho, o que a torna mais demorada e cara. O tempo e o esforo adicionais so necessrios para a construo das sries de fragmentos de DNA
clonados parcialmente sobrepostos. Depois de isso haver sido feito, cada fragmento clonado
seqenciado pelo mtodo aleatrio e a seqncia do genoma montada passo a passo (Fi*
gura 12.2).
Cada fragmento de DNA clonado deve ser o mais longo possvel, de modo a minimizaro
nmero total de clones necessrio para cobrir todo o genoma. Um vetor de alta capacidade
por isso utilizado. O primeiro cromossomo eucaritico a ser seqenciado - o cromossomo IIil
de Saccharomyces cerevisiae - foi inicialmente clonado em um vetor do tipo cosmdeo (p-

139), com,
te curto e c
noma hurn

ciais (BAC

emcontigs

Montage
(chromo

Uma das t

mossmic

um clone

sonda de hi
nes que ger

cialmente s
blioteca. M

posies ac
um procedi
te quando c

lativamen
entre contil

Mtodos

O ponto fn
truir, apart
pidas para

objetivo

Figura 12.5
Seqncias repetidas

idnticas

\
Molcula de DNA

Seqncia

Seqncia 2

Sobreposio das seqncias 1 e 2

Um problema da
abordagem der
tria. Uma sobreposio incorreta de duas
seqncias leita devido ao ab
de ambas term
narem em uma
regio interna
um elemenlo r+
petido. lsso re.
sulta na ausncia de um segr
mento da mol
cula de DNA na

&

2
I

Montagem da seqncia

-----

Seqncia de DNA deduzida

seqncia morr
tada.

Figura 12.6
Caminhada cromossmica
(chromosome
walking).

a i,

Croueceu GNtcA

bacterianos. Isso se
as exigncias com

muito grandes.
de poucos pares de
Tais seqncias

aquelas que se
podem ser alinhadas.
elemento de repetio
a perdas de parte ou de
o seqenciamento
possuem muitos
limitao pode ser
obtidas pela

to aleatrio e,
com DNA repetifivois demorada e cara. O
de fragmentos de

ito, cada fragmento c


montada passo a passo
l, de modo a mini
vetor de alta
- o cromossomo
vetor do tipo cosmdeo

Arulrsr oe

DNA

139), com o contig resultante incluindo 29 clones. Contudo, o cromossomo III relativamente curto e o tamanho mdio dos fragmentos era de apenas 10,8 kb. O seqenciamento do genoma humano, muito mais longo, exigiu 300.000 clones de cromossomos bacterianos artificiais (BAC, de bacterial artificial chromosome) (p. lal). A montagem de todos esses clones
em contigs cromossomo-especficos foi uma tarefa gigantesca.

Montagem de contigs de clones por caminhada cromossmica


(chromosome walkingl
Uma das tcnicas que pode ser utilizada para montar um contig de clones a caminhada cromossmica (do ingls chromosome walking). Para iniciar uma caminhada cromossmica,
um clone selecionado aleatoriamente a partir da biblioteca, marcado e utilizado como uma
sonda de hibridizao contra todos os outros clones da biblioteca (Figura 12.6a).Aqueles clones que geram sinais de hibridizao so os que se sobrepem sonda. Um desses clones parcialmente sobrepostos , ento, marcado e utilizado em uma segunda etapa de triagem da biblioteca. Mais sinais de hibridizao so, ento, identificados, alguns deles indicando sobreposies adicionais (Figura 12.6b). Assim, o contig de clones construdo gradualmente, em
um procedimento passo a passo. Entretanto, esse processo laborioso, sendo utilizado somente quando o contig corresponde a um cromossomo curto, de modo a envolver um nmero relativamente pequeno de clones, ou quando o objetivo o fechamento de uma ou mais lacunas
entre contigs, que foram montados por mtodos mais rpidos.

Mtodos rpidos para a montagem de contigsde clones


O ponto fraco da caminhada cromossmica comear em um ponto de partida fixo e construir, a partir dali, o contig de clones em um lento processo passo a passo. As tcnicas mais rpidas para a montagem de contigs de clones no utilizam um ponto de partida fixo e tm por
objetivo a identificao de pares de clones parcialmente sobrepostos: quando um nmero su-

(a)Triagem da biblioteca com o clone A1

Figura 12.5
Um problema
abordagem
tria. Uma so
breposio incorreta de duag
seqncias
ta devido ao
de ambas tern
narem em utna
regio interna
um elemento re
petido. lsso re
sulta na ausr
cia de um segr
mento da md
cula de DNA m

seqncia
tada.

f.
94

mm

259

ABCDEFGHIJ
1

at

r: a r, a a t t

A1

B4

5
6

(b)Triagem da biblioteca com o clone

14

ABCDEFGHIJ
1

Figura 12.6
Caminhada cromossmica

(chromosome
walking).

2
3

4
5
6

a6 * & t 6 t * i *
a ? t a a, * * a
9r;*!&t4t?
3 $ I & ar * as
*4***gt
?*4*e?*

A1
B4

F2

260

T. A. Bnowr.r

ficiente desses pares for identificado, o contig revelado (Figura 12.7). As vrias tcnicas que
podem ser utilizadas para a identificao das sobreposies so conhecidas coletivamente por
datiloscopia de clones (do ingls cloneftngerprinting).
A datiloscopia de clones baseada na identificao de caractersticas da seqncia que so
compatilhadas por um par de clones. A abordagem mais simples consiste em digerir cada
clone com uma ou mais endonucleases de restrio e buscar pares de clones que compartilham fragmentos do mesmo tamanho, excluindo aqueles derivados do vetor e no do DNA nele inserido. Essa tcnica pode parecer de simples execuo, mas, na prti ca, ela bastante demorada na parte de anlise dos gis de agarose resultantes, em busca dos fragmentos compartilhados. Existe tambm uma possibilidade relativamente elevada de que dois clones que no
se sobrepem gerem, por acaso, fragmentos de restrio distintos, mas com tamanhos indistinguveis por eletroforese em gel de agarose.
Resultados mais acurados podem ser obtidos por PCR de DNA repetitivo, tambm conhecido como PCR de elemento repetido disperso (IRE-PCR, do ingls interspersed repeat
element PCR). Esse tipo de PCR utiliza iniciadores projetados para anelar com seqncias de
DNA repetitivo e para dirigir a amplificao de DNA entre repeties adjacentes (Figura
12.8). Repeties de um tipo determinado esto distribudas essencialmente de maneira aleatria em genomas eucariticos, com distncias variveis entre elas, de modo que produtos de
diferentes tamanhos so obtidos quando tais iniciadores so utilizados com clones de DNA
eucaritico. Se um par de clones gera produtos de PCR de mesmo tamanho, eles devem conter repeties espaadas de maneira idntica, possivelmente porque os fragmentos de DNA
sobrepem-se parcialmente.

Montagem de contigs de clones pela anlise do contedo


de stios-alvo seqncia-especf icos
Uma terceira maneira de montar um contig de clones a busca sistemtica de pares de clones que contm uma seqncia de DNA especfica, que ocoe em apenas uma posio no
genoma em estudo. Se dois clones diferentes contm essa caracterstica, ento eles claramente devem sobrepor-se parcialmente (Figura 12.9). Uma seqncia desse tipo chamada de stio-alvo seqncia-especico (srs, do ingl,s sequence tagged sie). Freqentemente, uma STS um gene que foi seqenciado em um projeto anterior. Como a seqncia
conhecida, pode ser projetado um par de iniciadores de PCR especficos para aquele gene, os quais podem ser utilizados para identificar os membros de uma biblioteca de clones
que o contm. Entretanto, a STS no tem de ser necessariamente um gene, mas qualquer

F2

Figura 12.8
PCR de elemento
repetido disperso
(interspersed repeat element
PCH) (rRE-PCR).

t4

: trb

tz

H7

Sobreposies identif icadas


por datiloscopia de clones

B4

A1

A1

Figura 12.7

H7

F2

A1

Deduo do conrg de clones


14

G6

Montagem de
um contig de
clones pela tecnica de datiloscopia de clones
(clone finger-

printingl.

z
b

::

Figura 12.9
A base do mapeamento por
contedo de
STS.

Clorueeeu Grurcr e ANLtsE oe

DNA

12.7). As virias tcnicas

hhecidas coletivamente

(a) A base da IRE-PCR

fbticas da seqncia que


consiste em digerir
hs de clones que
vetor e no do DN
b prtica,.ela bastante
fca dos fragmentos coq
lde que dois clones que
L mas com tamanhos i

Duas repeties idnticas

I
l

(\
J

Anetamento dos iniciadores

lrepetitivo, tambm
i

ingls interspersed rqs

anelar com seqncias

O produto da PCR inclui a regio


entre repeties adjacentes

leties adjacentes (Fi


fcialmente de maneira

I, de modo que produtos


pados com clones de
Itamanho, eles devem
pe os fraementos de

(b) lnterpretao dos resultados

cc*

Clone

Marcadores

ht".ioo

Clone ll

Clone lll

de pares de ch"
apenas
uma
posio m
im

$emtica

herstica, ento eles claralncia desse tipo cham


p tagged sde). Freqenlointerior. Como a seqncie
foecficos para aquele go-

luma biblioteca de cloner


P um gene, mas qualqrm

A banda compartilhada
sugere que os clones ll
e lll sobrepem-se

Figura 12.8
PCR de elemento
repetido disperso
(interspersed re-

parcialmente

peat element
PCR) (rRE-PCR).

Coleo de
clones

-il

ilt
IV

o
V

Stio-alvo
seqncia-especf ico

Figura12.7
Montagem de
um contig de
clones pela tcnica de datilos.
copia de clones
(clone finger-

printingl.

Figura 12.9
A base do mapeamento por
contedo de
STS.

-.l

IV

--a

il

Os clones lV e ll devem se sobrepor

261

262

T. A. Bnowrrr

segmento curto de DNA obtido a partir do genoma, desde que ele no seja oriundo de um

elemento repetitivo.

12.1.3 Utilizando um mapa para auxiliar na montagem


de uma seqncia
O mapeamento do contedo de stios-alvo seqncia-especficos um mtodo particularmente importante para a montagem de contigs de clones, pois, muitas vezes, as posies das STSs
no genoma foram determinadas por mapeamento gentico ou mapeamento fsico. Isso significa que as posies das STSs podem ser utilizadas para ancorar um contig de clones em um
mapa genmico, permitindo que a posio do contig no interior de um cromossomo seja determinada. Veremos agora como esses mapas so obtidos.

Mapas genticos
Um mapa gentico aquele obtido por meio de estudos genticos, utilizando princpios mendelianos e envolvendo progrmas de cruzamentos dirigidos, para organismos experimentaiq
ou anlise de pedigrees, para humanos. Na maioria dos casos, os lcus estudados so genes
cujos padres de herana so acompanhados pelo monitoramento dos fentipos da prognie
produzida aps um cruzamento entre pais com caractersticas contrastantes (por exemplo,
plantas altas e baixas, pira os ps de ervilha estudados por Mendel). Mais recentemente, foram elaboradas tcnicas pra o mapeamento de seqncias de DNA que no so genes, mas
que apresentam variabilidade na populao humana. Dentre esses marcadores genticos, os
mais importantes so:

(1)

(2)

(3)

Polimorfismos de comprimento de fragmentos de restrio (RFLPs, do ingls restriction fragment length polymorphisms) so causados por uma variao na seqncia
que resulta em uma alterao em um stio de restrio. Quando digeridos com uma endonuclease de restrio, a perda do stio revelada porque dois fragmentos permanecem
unidos. Originalmente, as RFLPs eram tipificadas por hibridizao de Southern de DNA
genmico clivado por endonucleases de restrio. Tal procedimento, porm, demorado, de modo que, hoje em dia, a presena ou ausncia de um stio de restrio geralmente determinada por PCR (Figura l2.l}). Existem aproximadamente 100.000 RFLPs
no genoma humano.
Repeties curtas em tandem (STRs, do ingls short tandem repeats), tambm chamadas de microssatlites, formadas por seqncias repetitivas curtas, como CACACA
As unidades de repetio tm extenses de 1 a l3 nucleotdeos e esto geralmente repetidas 5 a 20 vezes. O nmero de repeties em um lcus pode ser determinado a partir
de uma PCR utilizando iniciadores que anelam um em cada lado da STR, seguida da
anlise do tamanho dos produtos resultantes por eletroforese em gel de agarose ou pG
liacrilamida (Figura l2.ll). Existem pelo menos 650.000 STRs no genoma humano.

Polimorismo de nucleotdeos individuais (SNPs, do ingls single nucleotide poly


morphisms) so posies em um genoma nas quais qualquer um de dois ou mais nucleotdeos diferentes pode ocorrer (Figura I2.I2). Essas mutaes pontuais so tipificadas por anlise com sondas oligonucleotdicas curtas, as quais hibridizam com formas

Figura 12.10
Tipificao de um polimorfismo de stio de
restrio Por PCR. Na
trilha central, o produto da PCR gera duas
bandas, porque oi clivado pelo tatamento
com a enzima de restrio. Na trilha direita,
existe apenas uma
banda, porque o DNAmolde no possui o s
tio de restrio.

lt,lt

I t_
|

=,-

Figura 12.11

Tipiicao d

doqueodal

unidade CA i

alternativas da SNP. O nmero de SNPs no genoma humano ainda permanece desconhe-

cido, mas de pelo menos 1,4 milho.


Todos esses marcadores de DNA so variveis, existindo, portanto, em duas ou mais formas
allicas. A herana de alelos alternativos em um determinado lcus acompanhada pela an
lise do DNA preparado a partir da prognie de cruzamentos genticos.

Mapas si

Um mapa ffs

especficas er
cus estudadq

dores de seq

Clorunoev GNrcA

e no seja otion6s ds rrm

E ANLrsE

oe

DNA

263

Stio de restrio

f
- *-..-_->---/,

II

\
um mtodo particularmen
Yezes, as posies das STSm
fsico. Isso si
um contig de clones em utrt
um cromossomo seja do-

utilizando princpios rnen


organismos experi mentei**
lcus estudados so gencr
dos fentipos da prognL
trastantes (por exemplq
.

Mais recent"-"nr".

Figura 12.10

piicao de um polimorfismo de stio de


restrio por PCR. Na
trilha central, o produto da PCR gera duas
bandas, porque oi clivado pelo tratamento
com a enzima de restio. Na trilha direita,
existe apenas uma
banda, porque o DNAmolde no possui o s
tio de restrio.

PCR, restrio

Marcadores

\l

lniciadores

daPCR

PCR, restrio

:
-:

f*]

que no so genes, mecr


marcadores genticos, m

(RFLPs, do ingls

ra-

uma variao na seqncie


digeridos com uma elis fragmentos pemaneoel
de Southem de D{,
mento, porm, demqr

stio de restrio gereft.


amente 100.000

RFLh

repeats), tambm ch*


curtas, como CACAC"T.
e esto geralmente reper.
Fode

ser determinado a

prrfo

Fda lado da STR, seguida r


iro.. gel de agarose ou F
bTRs no genoma humano)g)s single nucleotide pafir
luer um de dois ou mais nrltaes pontuais so tipifi*

lpais hibridizam com

form

Figura 12.11
Tipificao de uma STR por PCR. O produto da PCR na trilha direita um pouco mais longo
do que o da trilha central, porque o DNA-molde, a partir do qual ele oi gerado, contm uma
unidade CA a mais.

n ainda permanece desconho

Mapas sicos
pto, em duas ou mais

form

i:us acompanhada pela anir

ticos.

Um mapa fsico gerado por mtodos que localizam diretamente as posies de seqncias
especficas em uma molcula de DNA cromossmico. Como no mapeamento gentico, os lcus estudados podem ser genes ou marcadores de DNA. Estes ltimos podem incluir marcadores de seqncias expressadas (ESTs, do ingls expressed sequence /ags), que so se-

264

T.A.Bnowru

A impor

ATAGACCRTGGcAA

possvel
co. Essa p

ATAGACTATGGCAA

na256,ep

[,*,

xflio de
Figura12.12
Duas verses de uma SNp.

qncias curtas obtidas a partir das extremidades de DNAs complementares (cDNAs)


(p.
172). Os marcadores de seqncias expressadas so, pois, seqncias parciais
de genes, que"
quando utilizadas na construo de um mapa, permitem o rrpido posiiionamento
dos geneu
correspondentes, mesmo que a identidade de cada gene no seja aparente a partir
aa seqtincias dos ESTs. Dois tipos de tcnica so utilizados no mapemento fsico:
(1)

(2)

Exame direto de molculas de DNA cromossmico, como, por exemplo, pela hibridiza_
o de fluorescncia ,/r silu (FISH, do ingls/a orescence in situ hyuiaization) (p. 2rr')t
Se a FISH executada simultaneamente com duas sondas de DNA, cada
uma delas mar_
cada com um fluorocromo diferente, as posies relevantes de ambos os marcadores
representados pelas sondas podem ser visualizadas no cromossomo. Tcnicas
especiai*
para o trabalho com cromossomos descompactados, cujas molculas de DNA
so esten_
didas, em oposio compactao normal, permitem que os marcadores sejam posicio
nados com um elevado grau de preciso.
Mapeamento fsico com um reagente mapeador uma coleo de fragmentos
de DNA
parcialmente sobrepostos que cobre o cromossomo ou o genoma em estudo.
os pares de
marcadores que esto em um mesmo fragmento devem estar prximos um
do outro no
cromossomo: a distncia entre ambos pode ser determinada pela medio
da freqncia
com a qual o par ocorre junto em diferentes fragmentos do reagente mapeador (pigu,a
12.13). Hfuridos de radiao constituem-se em um dos tipos de reagente
mapeadr
que tem sido de importncia para o Projeto Genoma Humano. Esses
hbridos de radiao so linhagens celulares de hamster que contm fragmentos de cromossomos humanos, preparadas por um tratamento envolvendo irradiao (da o
4ome). o mapeamento
executado por hibridizao de sondas marcadas com um painel
de linhagens celulares"
cada uma contendo uma parte diferente do genoma humano.

ur

maior es

car se als
cias curtas

meios gen
passa-se a

Mapas
no e tamhx
elegans e t

pas tambr
am a aborc
cao do s
das, o que
de modo a

dem ser el
ma. Essa'
promisson

12.2 Ps-ger

deuml

Depois de
calizar tod
ser trivial,
e

por tcni

qncia dr
contm ce
base em er

similar d

es descc

Apesar

completad
fos. ner
t provand

12.2.1 ldentific
A localizar
nhecida, o

Figura 12.13
O princpio por trs do uso de um reagente mapeador. Pode-se deduzir que
os marcadores
1 e 2 esto relativamente prximos, pois aparecem juntos
em quatro ragmentos de DNA. Ao
contrrio, os marcadores 3 e 4 devem estar relativamente distantes, pois
aparecem juntos
apenas em um fragmento.

corTespon(

qualquer

ir

Sob tais cir

ja dispor

Cloruneeu GNrcA

E ANLrsE DE

DNA

265

A importncia de um mapa na montagem da seqncia

SNP.

(cDNAs)

(p

parciais de genes, q,
posicionamento dos gro
nte a partir da seqlb
ffsico:
as

exemplo, pela hibridize.


hy b ridizati on) (p. 2l lfrDNA, cada uma delas mrambos os marcadoresrn*
. Tcnicas especiefo

su

ulas de DNA so estrsej am posicio.

possvel obter-se a seqncia de um genoma sem a utilizao de um mapa gentico ou fsico. Essa possibilidade ilustrada pelo projeto de H. influenzae, que acompanhamos na pgina256, e pelos de muitos outros genomas bacterianos que vm sendo seqenciados sem o auxflio de um mapa. Entretanto, um mapa passa a ter muita importncia quando um genoma
maior est sendo seqenciado, pois ele se constitui em um guia que se pode usar para verificar se a seqncia do genoma est sendo montada corretamente a partir das inmeras seqncias curtas que emergem do seqenciador automtico. Se um marcador que foi mapeado por
meios genticos e/ou fsicos aparece na seqncia do genoma em uma posio inesperada,
passa-se a suspeitar de um erro na sua montagem.
Mapas genticos e/ou fisicos detalhados foram importantes para o Projeto Genoma Humano e tambm para aqueles de seqenciamento dos genomas de levedura, mosca-das-frutas, C.
elegans e A. thaliana, todos eles baseados na mesma abordagem de contigs de clones. Os mapas tambm esto sendo utilizados para dirigir a montagem de seqncias em projetos que usam a abordagem aleatria. Conforme descrito na pgina 258, o principal problema para a aplicao do seqenciamento aleatrio em um grande genoma a presena de seqncias repetidas, o que determina a possibilidade de que a seqncia montada "pule" entre duas repeties,
de modo a excluir ou posicionar incorretamente parte do genoma (Figura 12.5). Tais eos podem ser evitados se a montagem da seqncia referir-se constantemente a um mapa do genoma. Essa "abordagem aleatria dirigida" ("directed shotgun approach") parece ser bastante
promissora como um mtodo rpido para o seqenciamento de grandes genomas.

marcadores

de fragmentos de Dtr{tr
em estudo. Os pares&

prximos um do outo m
pela medio da freqncirr
eagente mapeador (Figurr
s de reagente mapeadr
Esses hbridos de radie.
de cromossomos humero nome)..O mapeametrb
Finel de linhagens celulaer,

b.
t
i

12.2 Ps-genmica: tentando entender a seqncia


de um genoma
Depois de a seqncia de um genoma haver sido completada, a etapa seguinte consiste em localizar todos os genes e determinar todas as suas funes. Trata-se de um processo longe de
ser trivial, mesmo prra genomas que j foram extensivamente estudados por anlise gentica
e por tcnicas de clonagem gnica antes da concluso do seqenciamento. Por exemplo, a seqncia de S. cerevisiae,vm dos organismos mais bem-estudados, revelou que esse genoma
contm cerca de 6.000 genes. Desses, somente 3.600 tiveram sua funo determinada, com
base em estudos previamente executados ou porque o gene da levedura tinha uma seqncia
similar de um j estudado em outro organismo. Restaram, portanto, 2.400 genes com funes desconhecidas.
Apesar da quantidade massiva de trabalho investida desde que o genoma da levedura foi
completado, em 1996, ainda no foram determinadas as funes da vasta maioria desses rffios. nessa rea que a bioinformica, s vezes chamada de biologia molecular in silico, est provando ser de maior valia, como um complemento aos experimentos convencionais.

12.2.1 ldentificando os genes em uma seqncia genmica


A localizao de um gene

deduzir que os marcadores


ntro ragmentos de DNA. Ao
Ies, pois aparecem juntos

fcil se a seqncia de aminocidos do seu produto protico conhecida, o que permite que a sua seqncia nucleotdica seja predita, ou se um cDNA ou EST
correspondente foi previamente seqenciado. Todavia, para a maioria dos genes, no existe
qualquer informao prvia que permita que a seqncia de DNA correta seja reconhecida.
Sob tais circunstncias, a localizao de um gene pode ser difcil, mesmo que um mapa esteja disponvel. A maioria dos mapas possui uma preciso limitada e capaz apenas de delinear

266

T. A. Bnowlr

a posio aproximada de um gene, possivelmente deixando virias dezenas ou mesmo


centenas de quilobases por analisar para que o gene seja encontrado. Alm disso, muitos genes
no
aparecem em mapas, pois a existncia dos mesmos ainda no foi evidenciada. Como esses
genes podem ser localizados em uma seqncia genmica?

Buscando fases abertas de leitura


A seqncia de DNA de um gene uma fase de leitura aberta (ORF, do ingls open reading
frame), uma srie de trincas de nucleotdeos, iniciando com um cdon ds inico (g"d

mente, mas no sempre, um AUG) e terminado em um cdon de terminao (TAA, TAG ou


TGA, na maioria dos genomas). A anlise de uma seqncia genmica em busca de ORFs"
manualinente ou, mais comumente, com o auxlio de um computador, , portanto, o primeiro
passo pa-ra alocalizao de um gene. importante que a anilise seja feita em todas as seis
fases de leitura, pois os genes podem estar orientados em ambas as direes ao longo da hlice dupla de DNA (Figura l2.l4a). Em um genoma bacteriano, o resulrado tpico deise tipo de
anlise a identificao de longas oRFs, que quase certamente correspondem a genes, e de
muitas ORFs mais curtas, parcial ou totalmente contidas nos genes, mas presentes em fases
de leitura diferentes (Figura l2.l4b). Tais seqncias curtas quase certamente so combinaes de nucleotdeos que formaram ORFs por acaso, mas no constituem genes. Se uma dessas ORFs curtas est inteiramente contida entre dois genes, existe a possibilidade de que
ela
seja erroneamente identificada como um gene real. Entretanto, na maioria dos genomas bacterianos, existe muito pouco espao entre os genes, de modo que esse problema no muito
freqente.

A localizao

de genes em eucariotos muito mais

difcil. Os genomas eucariticos no


existindo espaadores muito mais longos entre os genes. Isso significa que a inspeo da seqncia revela muitas ORFs curtas que
so to densamente compactados como os bacterianos,

xons e ntror

Diferencia
Alguns genor
to, o genoma
molecular, pc

qncia dis
gene. Mas ca
sidade de mt

Para muit

neira til de <


aminocidos,
alanina, por t
nomas, nem
qncia. O h<
tos cdons: p
vezes mais fr
raros, ento,

Essa busca, e

Figura 12.14

--ATT
--TAT
--TTA

tt
100 pb

ral2.l5),d

interior de nt

A identifi

5'_A TGACCAA TGACA TGCAA TAA _3'


tttllttttttttltttttt
3'_T AC TGGT TAC TG TACGT TA T T _5'

+++

terminadas se

1
GAC--*
2 T GA -*
3 ATG ---*

o resultado tpico

ria "question
ria no corres
No homer
que muitos dr

apresentado
de de ela con

(a) Cada seqncia de DNA possui seis ases de leitura

(b)

no podem se
de levedura,

4
5

de uma busca por oRFs em um genoma bacteriano

Genes

_-

ORFs esprias

.Buscando fases
de leitura abertas. (a) Cada seqncia de DNA
possui seis ases
de leitura e qualquer uma delas
pode conter um
gene. (b) O resultado tpico de
uma busca por
ORFs em um
genoma bacteriano. As setas
indicam as direes nas quais
os genes e as
ORFs esprias
esto orientados.

gnicas pres
mente com g

todas as dem

Figura 12.11

As seqnci
vertebrados.
cam as posir

Crorunoeu GNrcA

ou mesmo centedisso, muitos genes nfu


iada. Como esses ge-

E ANLrsE oe

DNA

267

no podem ser descartadas, pois no se sobrepem a qualquer gene real. A anlise do genoma
de levedura, por exemplo, identificou mais de 400 ORFs que foram colocadas nessa categoria "questionvel". Possivelmente, algumas delas so genes reais, mas provvel que a maio-

ria no corresponda a seqncias codificadoras

',

do ingls open reading

de iniciao (g"dinao (TAA, TAG ou


ica em busca de ORFs,
; ,

portanto, o primeiro

feita em todas as seis f+.


s ao longo da hlitpico desse tipo dc
a genes, e dc
mas presentes em fases
te so combina.
m genes. Se uma despossibilidade de que el;r
ioria dos genomas bacproblema no muito

eucariticos no
muito mais lonmutas ORFs cwtas qw

Figura 12.14

hs
I
I

Buscando ases
de leitura abertas. (a) Cada se.
qncia de DNA
possui seis ases
de leitura e qualquer uma delas
pode conter um
gene. (b) O resultado tpico de
uma busca por
ORFs em um
genoma bacteriano. As setas
indicam as direes nas quais
os genes e as
ORFs esprias
esto orientados.

No homem e em outros eucariotos, a busca de genes ainda mais complicada pelo fato de
que muitos deles so interrompidos, estando divididos em xons e ntrons (Figura 11.1). Determinadas seqncias nucleotdicas sempre ocorrem nos limites entre xons e ntrons (Figura 12.15), mas tais seqncias tambm so encontradas tanto no interior de xons quanto no
interior de ntrons. A definio de quais dessas seqncias marcam verdadeiros limites entre
xons e ntrons pode ser bastante difcil.

Dierenciando genes reais de ORFs casuais


Alguns genomas apresentam indicadores bastante teis da presena de um gene. Nesse aspecto, o genoma humano e os de outros vertebrados so particularmente acessveis ao bilogo
molecular, pois 50 a607o dos seus genes so acompanhados por uma ilha de CpG, uma seqncia distinta, rica em CG, cuja posio indica aproximadamente o local de incio de um
gene. Mas caractersticas como essa so mais exceo do que regra, o que determina a necessidade de mtodos de uso mais geral para a identificao de genes.
Para muitos genomas, o vis de cdons (do ingls codon bias) constitui-se em uma maneira til de conferir um certo grau de ceteza identificao de um possvel gene. Todos os
aminocidos, exceto a metionina e o triptofano, so especificados por dois ou mais cdons. A
alanina, por exemplo, possui quatro cdons - GCA, GCC, GCG e GCT. Na maioria dos genomas, nem todos os membros de uma famlia de cdons so utilizados com a mesma fre-

qncia. O homem tpico em relao a esse aspecto, apresentando um vis distinto para certos cdons: por exemplo, para a famlia de cdons da alanina, o homem utiliza GCC quatro
vezes mais freqentemente do que GCG. Se uma ORF contm uma alta freqncia de cdons
raros, ento, provavelmente, ela no corresponde a um gene. Considerando o vis de cdons
apresentado por uma ORF, pode ento ser feita uma avaliao mais confivel da probabilidade de ela corresponder ou no a um gene.
A identificao de um provvel gene em geral seguida por uma busca por homologia.
Essa busca, executada por computador, compra a seqncia do gene com todas as seqncias
gnicas presentes nas bases internacionais de dados de DNA. Tal comparao feita no somente com genes conhecidos do organismo em estudo, mas tambm com todos os genes de
todas as demais espcies disponveis. Arazo disso que dois genes de diferentes organismos

ntron

Exon

Exon
3'

LI

/\

,t/

/\
AG{GTAAGT

LI
\

PYPYPYPYPYPYNCAG

Figura 2.15
As seqncias de consenso para os limites xon-ntron a montante e a jusante de ntrons de
vertebrados. Py = nucleotdeo pirimidnico (C ou T), N = qualquer nucleotdeo. As setas indicam as posies dos limites.

268

T. A. Bnowlr

que possuem funes similares tambm apresentam seqncias similares, refletindo suas
trias evolutivas comuns (Figura 12.16).
Para a execuo de uma busca por homologia, a seqncia nucleotdica de um possvel gone geralmente traduzida em uma seqncia de aminocidos, pois isso torna a busca rnas
sensvel. Isso ocorre porque existem 20 aminocidos, mas apenas quatro nucleotdeos, o
T
determina que a chance de duas seqncias de aminocidos parecerem similares por puro Erso menor.
A anlise executada atravs da Internet, a partir da conexo com a pgina (web site) lh
um dos bancos de dados de DNA e da utilizao de um programa de busca, como o BLAST
(Basic ktcal Alignment SearchTool, ou ferramenta bsica para a busca de alinhamento localilSe a seqncia-teste tiver uma extenso maior que 200 aminocidos e uma identidade de Iffi
ou mais com uma seqncia no banco de dados (isto , em 30 de 100 posies o mesmo aainocido ocoffe em ambas as seqncias), ento as duas so quas com certeza homlogas ee
ORF estudada pode ser confirmada como um gene real. Uma confirmao adicional, se mcessria, pode ser obtida com autllizao de uma anlise de transcrito (p.226), que permin
demonstrar que o gene transcrito em RNA.

12.2.2 Determinao da funo de um gene desconhecido


A

busca por homologia serve a dois propsitos. Alm de testar a veracidade da identif,rca@
do provvel gene, ela tambm fornece uma indicao a respeito da sua funo, presumindose que a funo do gene homlogo conhecida. Quase 2.000 genes do genoma de levedurativeram suas funes estabelecidas desse modo. Muitas vezes, contudo, as homologias encontradas nas buscas so com outros genes cujas funes ainda no foram determinadas. Tais genes no-caracterizados so chamados de rfos e a identificao de suas funes um dm
maiores desafios da cincia ps-genmica.
Em anos futuros, provavelmente ser possvel utilizar a bioinformtica para a obteno de
pelo menos uma indicao da funo de um gene 6rfo. J possvel utilizar-se a seqncie
nucleotdica de um gene para prever as posies das hlices c e iolhas na protena por ele
B
codificada, apesar da preciso limitada, e a informao estrutural resultante da pode, s vezes, ser utilizada para inferncias a respeito da funo da protena. Protenas que se ligam a
membranas podem freqentemente ser identificadas por possurem arranjos de hlices a quc
atravessam a membrana, e motivos de ligao a DNA, como dedos de zinco, tambm podem
ser reconhecidos. Uma abrangncia e uma preciso maiores desse aspecto da bioinformca

AGGACCAGACCCATATAGGACC

Vrias

\
AGGGCCAGACCCATACAGGACC

\
AGGACCAGACTCATATAGGACC

Homologia entre
duas seqncias
que compartilham
um ancestral comum. As duas se
qncias adquiriram mutaes durante suas histrias evolutivas,
mas as similaridades entre suas seqncias indicam
que elas so homlogas.

t<

das elas podt


caute gnico
so funciona

o entre o g

resultar na sr
tipo do orgar
o do gene.

mundongo-l

no estabeleci
problemas. I
qualquer efe
fica que, ap
terao fenor

12.3 Estudos

At agora, c

de genes ind
to de novos I

noma como

(1) Otrar
(2)

teopa
O prot
qumi<

Figura 12.16
Seqncia ancestrat

/\

Duas seqncias modernas

sero alcanz
nas e as sus
mente de exp

Figura 12.17
Nocaute gnico
por recombinao entre uma
cpia cromossmica de um gee e uma verso
deletada presente em um vetor
de clonagem
plasmidial.

Clonnceu GNrcA

Lares,

ldica de um possvel ge.


3 isso torna a busca mafu
por puro rc&.

a pgina (web site) lh


bbusca, como o BLAST
ba de alinhamento locall,

)fr

b posies o mesmo

ami-

h."tt"ru

homlogas ea

hmao adicional, se m.
ftto (p.226), que permin
I

DNA

269

das elas podem ser aplicadas a rfos. Uma estratgia no-descrita no Captulo I I a do nocaute gnico. Nessa tcnica, uma verso deletada do gene utilizada para "nocautea" a verso funcional presente nos cromossomos do organismo. Isso possvel porque a recombinao entre o gene deletado, presente em um vetor de clonagem, e a cpia cromossmica pode

latro nucleotdeos, o qtr

p uma identidade de

oe

sero alcanadas quando mais informaes a respeito da relao entre a estrutura das protenas e as suas funes forem obtidas. At l, a anlise funcional de rftos depende principalmente de experimentos convencionais.
Virias tcnicas pra o estudo das funes dos genes foram descritas no Captulo 11 e to-

refletindo suas his-

h similares

E ANLrsE

resultar na substituio desta por aquela (Figura 12.17). O efeito do nocaute gnico no fentipo do organismo , ento, analisado para a obteno de alguma indicao a respeito da funo do gene. O efeito de um nocaute de gene humano inferido a partir do estudo de um camundongo-nocaute, portador da verso deletada do gene homlogo. Os nocautes auxiliaram
no estabelecimento das funes de diversos genes, mas nem sempre tal abordagem livre de
problemas. Particularmente problemtico o fato de que alguns nocautes no apresentam
qualquer efeito bvio no fentipo do organismo, ou porque o gene dispensvel, o que significa que, aps a sua inativao, outros genes podem compensar a sua ausncia, ou porque a alterao fenotpica muito sutil para ser detectada.

lido
facidade da identi fi cao
pra funo, presuminb
b genoma de levedura tifo, as homologias encooh determinadas. Tais eeb suas funes um dm

12.3 Estudos do transcritoma e do proteoma


At agora, consideramos aqueles aspectos da pesquisa ps-genmica que tratam de estudos
de genes individuais. A mudana de nfase de genes para genomas levou ao desenvolvimento de novos tipos de anlise, os quais so direcionados para a compreenso da atividade do genoma como um todo. Esse trabalho levou inveno de dois novos temos:

Lti"u p-u a obteno de


bI utilizar-se a seqncie
F^ nu protena por eh
$rltante da pode, as re
Protenas que se ligam e
lranjos de hlices a qu
le zinco, tambm poden

(1)
(2)

O transcritoma, que o contedo de RNA mensageiro (nRNA) de uma clula e reflete o padro geral de epresso gnica daquela clula.
O proteoma, que o contedo de protena de uma clula e reflete a sua capacidade bio-

qumica.

tpecto da bioinformtice
!r

Gene completo
---

Figura 12.16
Homologia entre
duas seqncias
que compartilham
um ancestral
mum. As duas se
qncias adquir
ram mutaes
rante suas historias evolutivas,
mas as similarid+
des entre suas s
qncias indicam
que elas so homlogas.

--

DNA cromossmico

Gene deletado

Figura 12.17
Nocaute gnico
por recombinao entre uma
cpia cromossmica de um gene e uma verso
deletada presente em um vetor
de clonagem
plasmidial.

DNA plasmidial
\

Recombinao

I
Nocaute gnico

27O

T. A. Bnowr.r

12.3.1 Estudando o transcritoma

do cancer<

As tcnicas para o estudo do transcritoma foram inicialmente desenvolvidas como pate do


projeto ps-genmico de levedura. Essencialmente, essas tcnicas envolvem um tipo sofisticado de anlise por hibridizao. Todos os 6.000 genes de levedura foram obtidos como clones
individuais e, a partir deles, produziram-se amostras que foram aplicadas sobre lminas de vi
dro, em arranjos de 80 x 80 pontos (cada ponto correspondendo aplicao de uma amostra),
o que chamado de microarranjo. Para a determinao de quais genes esto ativos sob determinadas condies de cultivo, mRNA foi extrado das clulas e convertido em cDNA (p. 112),
que, depois de marcado, foi hibridizado com os microarranjos (Figura 12.18). Foram utilizados mrcadores fluorescentes, e a hibridi zao foi detectada pelo exame dos microarranjos por
microscopia confocal. Os pontos que geraram um sinal indicaram os genes ativos sob as condies que estavam sendo estudadas. Alteraes na expresso gnica quando a levedura era
transferida para diferentes condies de cultivo (por exemplo, depleo de oxignio) puderam
ser monitoradas a partir da repetio do experimento com uma segunda preparao de cDNA.
Os microarranjos esto agora sendo utilizados para a monitorao de alteraes nos transcritomas de muitos organismos. Em alguns casos, a estratgia a mesma utilizada para a levedura, com o microarranjo representando todos os genes do genoma. Mas isso possvel somente para aqueles organismos que possuem relativamente poucos genes. Um microarranjo
de todos os genes humanos poderia ser executado utilizando-se apenas l0 lminas de vidro de
18 x I 8 mm, mas a preparao dos clones para cada um dos 30.000 a 40.000 genes humanos
seria uma tarefa gigantesca. Felizmente, isso no necessrio. Por exemplo, para estudar as
alteraes no transcritoma decorrentes de um cncer, poderia ser preparado um microarranjo
com uma biblioteca de cDNA de tecido normal. A hibridizao com cDNA marcado do teci-

ao estado

Uma a
lcio capa
sintetizadr

I milho 1
cional. A I
mo os olil
especiais,

jas seqn

12.3.2 Estudat

O proteon

informa
pois um
tena, devi

lipeptdeo
pos qumi
forilao,
nas.
Para

er

separado
canaleta d
culares. O
dessa vez

sional de

Microarranjo

/rtoriai.
(

ao.o. \
cDNA

amostras de

Hibridizao detectada
por microscopia confocal

Figura 12.18
Anlise por microarranjo. O microarranjo mostrado aquioi hibridizado com
duas preparaes de cDNA dF
erentes, cada
uma delas marcada com um
marcador luoreg
cente. Os clones
que hibridizam
com os cDNAs
so identificados
por microscopia
conocal.

Fl(

Um chipde DNA. U

conteria um nr
maior de oligonucle
que aqueles mostra
cada oligonucleotd
a 30 nucleotdeos de

Ct-oruncev GNrcA E ANLrsE oe

penvolvidas como parte


pvolvem um tipo sofisti*
foram obtidos como clom
ifuadas sobre lminas de vt
[rplicaao de uma amostnfu
pnes esto ativos sob deE-

i"e.tiao em cDNA (p.

172fr.

iura l2.l 8). Foram uriliz*


lrame

pu

dos microarranjos

ios genes ativos sob as oF

lica quando a levedura cnr


pao Oe oxignio) puderur
pda preparao de cDli.L
po de alteraes nos trrc

DNA

271

do canceroso ento revelaria quais genes tm a transcrio estimulada ou inibida em resposta


ao estado canceroso.
Uma alternativa para os microarranjos so os chips de DNA, isto , pastilhas finas de silcio capazes de carregar muitos oligonucleotdeos diferentes (Figura 12.19), os quais so
sintetizados diretamente na superfcie do chip e podem ser preparados em uma densidade de
I milho por cm', substancialmente maior do que a possvel com um microarranjo convencional. A hibridizao entre um oligonucleotdeo e a sonda detectada eletronicamente. Como os oligonucleotdeos so sintetizados de novo, utilizando procedimentos automatizados
especiais, relativamente simples a preparao deum chip portador de oligonucleotdeos cujas seqncias so especficas para cada gene humano.

12.3.2 Estudando o proteoma

pas 10lminas

O proteoma a coleo completa de protenas de uma clula. Estudos protemicos fornecem


informaes adicionais que no podem ser obtidas simplesmente pelo exame do transcritoma,
pois um nico mRNA (e, conseqentemente, um gene) pode dar origem a mais de uma protena, devido ao processamento ps-traduo (Figura 12.20). Em eucariotos, a maioria dos polipeptdeos que so sintetizados por traduo adicionalmente processada pela adio de grupos qumicos. As adies especficas feitas determinam a funo precisa da protena. A fosforilao, por exemplo, uma modificao importante, utilizada para ativar algumas prote-

p a 40.000

nas.

[mesma utilizada para a


Mas isso possvel

ina.

b"

n.

!s genes. Um microarranfu
de
genes hur

f exemplo, para estudrr


|reparado um microarrmi
h

cDNA marcado do

tqi

Para estudar o proteoma, todo o contedo protico de uma clula ou tecido inicialmente
separado por eletroforese bidimensional. Nessa tcnica, as protenas so aplicadas em uma
canaleta de um gel de poliacrilamida quadrado e separadas de acordo com seus pesos moleculares. O gel quadrado ento girado em 90o e uma segunda eletroforese levada a efeito,
dessa vez separando as protenas com base em suas cargas. O resultado um padro bidimensional de manchas de diferentes tamanhos, formas e intensidades, cada uma delas represen-

Figura 12.18
Anlise por miC
G

croarranjo. O n*.

croarranjo mctrado aqui rci


bridizado com
duas prepanaes de cDNA
erentes, cada
uma delas nrarcada com um
marcador

t*

Cente. Os

Clorn

que hibridizam
com os cDNs
so identificadc
por microscoia
conocal.

C
G

c
c

c
G

T
T

CTA
CTC
CAG
GCA
AGA
TGA

Oligonucleotdeos

T
T

Figura 12.19
Um chipde DNA. Um chipreal
conteria um nmero muito
maior de oligonucleotdeos do
que aqueles mostrados aqui e
cada oligonucleotdeo teria 20
a 30 nucleotdeos de extenso.

Pastilha de silcio

272

T. A. Bnowlr

tando uma diferente protena ou grupo de protenas relacionadas (Figura lL.2la).As diferenas entre dois proteomas so aparentes a partir de diferenas no padro de manchas quando
os dois gis so comparados. Para a identificao da protena em uma determinada mancha,
uma amostra da mesma purificada a partir do gel e tratada com uma protease que cliva o po
lipeptdeo em uma seqncia de aminocidos especfica (de uma maneira similar atividade
de uma endonuclease de restrio). Os peptdeos resultantes so ento examinados por espectrometria de massa (Figura 12.21b). O espectrmetro de massa determina a composio de
aminocidos {e cada pepdeo. Essa informao geralmente suficiente para permitir que o
gene que codifica a protena seja identificado a partir da seqncia genmica.

Um gene

ranscrio

Um mRNA

Traduo

Figura 12.20

a+

Novos grupos qumicos adicionados


por processamento ps{raduo

Um gene individual pode


dar origem a duas prote
nas, cada uma com uma
uno distinta, se o produto inicial de traduo puder
ser modificado de duas maneiras diferentes por processamento ps-traduo.

Figura122

Anlise prol
(b) ldentifrc
se seguido

CLoNAGEM GNtcA E ANLlsE DE

l2.2la).As

difer*

de manchas quando
uma determinada mancht,
protease que cliva o po
ira similar ativida&
examinados por espscina a composio &
para permitir qrc o

DNA 273

(a) Eletroorese bidimensional das protenas

Amostra de protenas

l"

ru______]ru__-__l|___--:r-___--

l, -l

;)tl= ltl

Gel de poliacrilamida

l:1",',,

1. Separao de acordo com o tamanho


2. Rotao do gel
3. Separao de acordo com a carga

(b) ldentiicao de uma Protena

Puriicao da protena,

tratamento com Protease,


exame por espectrometria de massa

\
I

I
coMPosroES

oos peproeos
Comparao dos
peptdeos com as
seqncias de genes

ldentif icao da protena

gene individual pode


origem a duas prote
cada uma com ume
distinta, se o produ
inicial de traduo puder
modiicado de duas ne
dierentes por pro

ps-tradu@.

Figura12.21

ntise protemica. (a) Eletroforese bidimensionaldas protenas em gel de poliacrilamida.

(b) ldeniiicao da protena contida em uma mancha individual por tratamento com protease seguido por espectrometria de massa dos peptdeos resultantes.

PARTE 3
melanogaster.
das tcnicas para

publicada, em lngur

,282,744-6.
ofgene expressia
ios no estudo de-um

263-70. [Descreve a

fines para

os genes-l

APLTCAOES DA
CLONAGEM GNICA E DA
ANALISE DE DNA NA
BIOTECNOLOGIA

and assemblyd
um genoma bacteriam
1

of DNA microarrays

il

,t

of the human

Cnprulo 13
Produo de Protenas a Partir
de Genes Clonados

Vetores especiais para a expresso de genes


exgenos em E. coli,2'79

Produo de protenas recombinantes por clulas


eucariticas. 29 I

Problemas gerais para a produo de protenas


recombinantes em E. coli-288

Agora que foram cobertas as tcnicas bsicas envolvidas na clonagem gnica e na anlise
de DNA e examinada a maneira como essas tcnicas so utilizadas na pesquisa cientfica,
pode-se seguir adiante e considerar como a tecnologia de DNA recombinante est sendo
aplicada na biotecnologia. Esse no um assunto novo, embora a biotecnologia venha recebendo muito mais ateno agora do que no passado. A biotecnologia pode ser definida
como o uso de processos biolgicos na indstria e na tecnologia. De acordo com os arqueologistas, a indstria biotecnolgica britnica data de 4.000 anos, no final do perodo neoltico, quando os processos fermentativos que fazem uso de clulas vivas de levedura para a
produo de cerveja e hidromel foram inicialmente introduzidos no Reino Unido. Com certeza, a fabricao de bebidas fermentadas, como a cerveja, j estava bem-estabelecida quando da invaso da Gr-Bretanha pelos romanos.
Durante o sculo XX, a biotecnologia expandiu-se com o desenvolvimento de diversos
usos industriais para os microrganismos. A descoberta por Alexander Fleming, em 1929, de
que o fungo Penicillium sintetiza um potente agente antibacteriano levou utilizao em
grande escala de fungos e bactrias para a produo de antibiticos. Inicialmente, os microrganismos eram multiplicados em grandes recipientes de cultura, a partir dos quais os
antibiticos eram purificados depois da remoo das clulas (Figura 13.1a). Mais recentemente, contudo, esse mtodo de cultivo estanque (batch culture) foi amplamente suplantado por tcnicas de cultivo contnuo, que fazem uso de um fermentador. A partir do cultivo em fermentador, amostras do meio podem ser continuamente removidas, suprindo ininterruptamente a demanda pelo produto (Figura 13.1b). Esse tipo de processo no est limitado produo de antibiticos, tendo sido tambm utilizado para a obteno de grandes
quantidades de outros compostos produzidos por microrganismos (Tabela 13.1).
Uma das razes pelas quais a biotecnologia vem recebendo tanta ateno desde a ltima dcada a clonagem gnica. Embora muitos produtos teis possam ser obtidos de cul-

278

T. A. Bnowr.r

turas microt

(a) Gultivo estanque (batch culturel

mente sinter
produzidos

dos dessa m
Centriugao

-= L-..,

|--- --)-lI
l- _--- _-l_t

4Recipiente de cultura fechado

\\

capacidade,
um animal c
tor de clona

Preparao do
produto a partir:
do meio
ou
das clulas

executadas

bacteriana. l
claro c
mo pode pa
mento satisl
tulo, tratare
minaremos

Sedimento de clulas

(b) Cutivo contnuo

Entradade +
meio resco

Sada de meio + clulas


I

-il

--

il
_ tt
il
--lJt

i
Preparao do produto

Tabela 13.1 Alguns dos compostos produzidos

Figura 3.1

13.1 Vetores
exgen(

Dois dierentes sis-

temas para a multi-

Se um gene

plicao de microrganismos: (a) cultivo estanque e (b)


cultivo contnuo.

clonado em

partir do cultivo de nucrorgamsmos

em escala indrstrial

Composto

Microrganismo

Antibiticos
Penicilinas

Penicillium spp.

Cefalosporinas

Cephalosporium spp.

Gramicidinas, polimixinas
Cloranfenicol, estreptomicina

Bacillus spp.
streptomyces spp.

Enzimas
Invertase

Bacillus

lcool

S. cerevisiae, Saccharomyce s carlsbergensis


S. cerevisiae
S. cerevisiae, bactrias acticas

Glicerol
Vinagre
Dextran
cido butrico
Acetona, butanol
cido ctrico

;.
F

Saccharomyc e s c e rev isiae


ssp., Aspergillus spp.

Proteases, amilases

Leuconostoc spp.
Bactrias produtoras de cido butrico
Clostridium spp.

Aspergillus niger

Figura 13.2
Um possvel esquema para a
produo de
uma protna
animal em uma
bactria. mRNA
= RNA mensageiro.

Cloruneeu Grurcn e ANLrsE oe

DNA

279

turas microbianas, a lista dos mesmos limitava-se, no passado, queles compostos natural-

mente sintetizados por microrganismos. Muitos medicamentos importantes que no so


produzidos por micrbios, mas sim por organismos mais complexos, no podiam ser obtidos dessa maneira. Isso mudou a pafrir da aplicao da clonagem gnica biotecnologia. A
capacidade de clonar genes implica que um gene que codifica uma protena importante de
um animal ou planta pode agora ser retirado de seu hospedeiro normal, inserido em um vetor de clonagem e introduzido em uma bactria (Figura 13.2). Se as manipulaes forem
executadas corretamente, o gene ser expressado e a protena ser sintetizada pela clula
bacteriana. Pode, ento, ser possvel a obteno de grandes quantidades da protena.
claro que, na prtica, a produo de uma protena recombinante no to simples como pode parecer primeira vista. Tipos especiais de vetores so necessrios e um rendimento satisfatrio da produo da protena muitas vezes difcil de ser obtido. Neste captulo, trataremos dos vetores de clonagem para a sntese de protenas recombinantes e examinaremos alguns dos problemas associados ao uso dos mesmos.

Figura 13.1

13.1 Vetores espec:ais para a expresso de genes


exgenos em E. coli

Dois dierentes sis-

temas para a multF


plicao de micror-

Se um gene exgeno (isto , no-bacteriano) for simplesmente ligado a um vetor comum e


clonado em E. coli, bastante improvvel que uma quantidade significativa da protena re-

ganismos: (a) cultF


vo estanque e (b)
cultivo contnuo.
Clula animal

de microrganismos

a9\
Vetor portador
do gene animal

spp

yces carlsbergensis

[de aciao burrico


I

I
t

Figura 13.2
Um possvel esquema para a
produo de
uma protena
animal em uma
bactria. mRNA
= RNA mensageiro.

@
mRNA

Protena animal

Bactria modificada
por engenharia
gentica sintetizando
a protena animal

280

T. A. Bnowlr

combinante venha a ser sintetizada. Isso ocore porque a expresso do gene depende de ele
estar cercado por uma coleo de sinais que podem ser reconhecidos pela bactria. Esses sinais, que so seqncias curtas de nucleotdeos, informam da presena do gene e fornecem
instrues para os aparatos de transcrio e traduo da clula. Os trs sinais mais importantes para genes de E. coli so os seguintes (Figura 13.3):

(1)

O promotor, que marca o ponto no qual a transcrio do gene deve iniciar. Em E. co'
/i, o promotor reconhecido pela subunidade o da enzima RNA-polimerase, respont
svel pela transcrio.
O terminador, que marca o ponto no final do gene onde a transcrio deve parar. Um
terminador geralmente uma seqncia nucleotdic a capaz de parear com ela mesma'
formando uma estrutura de ala com haste (stem loop)'
O stio de ligao do ribossomo, uma seqncia nucleotdica curta reconhecida pelo
ribossomo como o ponto no qual ele deve ligar-se molcula de RNA mensageiro
(pRNA). O cdon de iniciao do gene est sempre uns poucos nucleotdeos a jusan-

(2)
(3)

Existem ser
paz de liga
simplesmer
Uma sol
do a coloc
possvel, o

suprem a fa

combinantt

13.1.1 O prom<

O promoto
controla o

se ao DNA
de de prote

ponibilizad

te desse stio.
Os genes de organismos superiores tambm esto cercados por sinais de expresso, mas
as suas seqncias nucleotdicas no so as mesmas das verses de E. coli' Esse aspecto

ilustrado pela comparao entre promotores de E. coli e de genes humanos (Figura 13'4)'

Pomotor

Stio de ligao
do

ribossomo
rtt'-'
llGene+
.

Terminador

_--t_t--DNA

Transcito de RNA

Figura 13.3
Os trs sinais mais importantes
para a expresso gnica em
E. coli.

Ponto no qual o ribossomo


liga-se ao mRNA

(a) E. coli

TTGACA
box-35

TATMT

cene

box-10

(b) Animais
vrios

Figura 13.4

sinais

TATAAAT
box

-25

Gene

Seqncias promotoas
tpicas de genes de
E. coli e de clulas
animais.

$'

Figura 13.5
A utilizao de um
vetor de expresso
para a produo de
uma protena a Partir de um gene exG
geno em E. coli-

Crorurceu Grutcn e ANLlsE oe

gene depende de ele


[a bactria. Esses sildo gene e fornecem
h sinais mais imPor-

rye iniciar. Em E' co-

r-polimerase, respon"

rio deve Parar. Um


rear com ela mesm
I

nrta reconhecida Pelo

.de RNA mensageim


nucleotdeos a jusan'

DNA

281

caExistem semelhanas, mas seria improvvel que uma RNA-polimerase de E' coli fosse
coli
E'
em
inativo
permanece
gene
exgeno
paz de ligar-se a um promotor humano. Um
iimplesmente porque a bactria no reconhece os seus sinais de expresso.

problema seria a insero do gene exgeno em um vetor de mode um conjunto de sinais de expresso de E. coli. Se isso for
do a coloc-lo
que
possvel, o gene dever ser transcrito e traduzido (Figura 13.5). Veculos de clonagem
reprotenas
de
produo
na
usados
podem
ser
,upr"- a falta desses sinais e que, por isso,
combinantes so chamados de vetores de expresso'

ma soluo pru

"rr"
sob o controle

13.1.1 O promotor o componente crtico de um vetor de expresso


porque ele
O promotor o componente mais importante de um vetor de expresso' Isso
RNA-polimeraenzima
uma
(a
de
ligao
da expresso gnica
controla o primeiro
"itagio
Portanto, a quantidase ao DNA) e determina a freqncia na qual o mRNA sintetizado.

do promotor disde de protena recombinante obtida depende em grande parte da rravreza

ponibilizado pelo vetor de expresso'

de expresso, mali
E coti. Esse asPecto

pis

tmanos (Figura 13.4f'


Vetor de
expresso

P = Promotor
R = Siio de ligao
do ribossomo
T = Terminador

Sinais de expresso
de E. coli:

Stio de restrio nico

lnsero de um gene exgeno


no stio de restrio nico

I
Fis mais importantes
resso gnica em

_-

Gene exgeno

,r"n.rort"

ode E. coti

\
Figura 13.5
A utilizao de um

Figura 13.4
Seqncias Promotor
lpicas de genes de
.E.colie de clulas
'animais.

vetor de expresso
para a produo de
uma protena a Partir de um gene exgeno em E. coli.

O gene exgeno
expressado

em E. coli

t'

282

T.A.Bnowr

O promotor deve ser escolhido com muito cuidado


As duas seqncias mostradas na Figura 13.4a so seqncias consensuais, mdias de todas as seqncias de promotores de E. coli conhecidas. Embora a maioria dos promotores
de E. coli no difira muito dessas seqncias consensuais (por exemplo, TTTACA ao invs
de TTGACA), qualquer pequena variao pode ter um efeito importante na eficincia
com
a qual o promotor capaz de dirigir a transcrio. Promotores fortes so aqueles capzes
de sustentar uma taxa elevada de transcrio; promotores fortes geralmente controlam genes cujos produtos de traduo so necessrios em grandes quantidades na clula (Figura
13.6a). Promotores fracos, ao contrrio, so relativamente ineficientes e dirigem u tr-rcrio de genes cujos produtos so necessrios apenas em pequenas quantiddes (Figura
13.6b). Fica claro que um vetor de expresso deve ser portador de um promotor forte, para
que o gene clonado possa ser transcrito com a maior freqncia possvel.
Um segundo fator a ser considerado na construo de um vetor de clonagem a possibilidade de regular o promotor de alguma maneira. Dois tipos principais de rgulao gnica so reconhecidos em E. coli - induo e represso. Um gene induzvel aquele cuja
transcrio ativada pela adio de um composto qumico ao meio de cultura; muitas vLzes, esse composto qumico um dos substratos da enzima codificada pelo gene induzvel
(Figura 13.7a). Um gene reprimvel, ao contririo, inativado pela adio de um composto
qumico regulador (Figura 13.7b).
A regulao gnica um processo complexo, que envolve o promotor apenas indiretamente. Contudo, muitas das seqncias importantes para a induo ou a represso esto
em
regies adjacentes ao promotor e, portanto, tambm esto presentes em um vetor de
expresso. E, por isso, possvel estender a regulao ao vetor de expresso, de modo qo"
o

"o--

(a) Um promotor orte

Figura

posto

bm

-'

,..-F- :._ Transcrio


/

_.\

-ra /J

binantr

_,-

Numerosos

--1'

Promotor
raco

Traduo

transcritos

raco

^*\
/

.-- -r .t1
-rn/.nn/t'-_=-

Promotor
orte
(b) um promotor

dosamr
seguidr

,,,?

rf3
gs

gene cl
te no

te alto
event

Numerosas

Transcrio

-=--

Exem

:i!:"
/

Virios

deder

..

-)
J .-
r
-/
Traduo

Retativamenre
poucos transcritos
Nmero u",Sno o"
molculas de protena

tados

(1)

Figura 13.6

Promotores fortes

lz

e fracos.

i-

ca

impo

Gene

Exemplos dos c
maiores tipos de
gulao gnica <
ocorrem em ba<
ria: (a) um gene
duzvel, e (b) um
ne reprim

Cloucer',1 GNtcA

, mdias de

to-

E ANLlsE

oe

DNA

283

(a) Um gene induzvel

ioria dos promotores


TTTACA ao invs

Composto qumico regulador.'

Gene normalmente
inativo

na eficincia com
so aqueles capazes
mente controlam ge-

/|/

tesedirigematrans-

...ativa o gene

Gene

Promotor

na clula (Figura

Sem transcrio

-\-/"=\--#

Transcritos

7-

quantidades (Figura
um promotor forte, para
vel.

(b) Um gene rePrimvel

declonagemapossiis de regulao gniinduzvel aquele cuja


de cultura; muitas vepelo gene induzvel
adio de um composto
apenas indiretaou a represso esto em
em um vetor de expres-

de modo que o com-

Composto qumico regulador...

Figura 13.7
Exemplos dos dois
maiores tipos de regulao gnica que
ocorrem em bactria: (a) um gene induzvel, e (b) um gene rePrimvel.

Gene normalmente
ativo
I
I

I
4-...*_
#
#

...inativa o gene

i
X

promotor tamposto qumico que induz ou reprime o gene normalmente controlado pelo
uma vantagem
pode
representar
Isso
gene
clonado.
do
bm cpaz de rgular a expresso
recomprotena
se
a
Por
exemplo,
recombinantes.
protenas
importante para a produ de
cuidapode
ser
sntese
sua
a
a
bactria,
sobre
danoso
binante a se produzida iem urnefeito
conpode
ser
isso
txicos:
nveis
at
acumulao
sua
a
dosamente mnitorada para impedir
do
expresso
a
para
controlar
regulador
qumico
seguido pelo uso criterioso do composto
recombinanprotena
que
a
mesmo

desejvel
gene
lonado
gee ctonaao. A regulao do
ie no seja prejudiial para a clula hospedeira, pois um nvel de transcrio continuamen sua
te alto pde atetar a capacidade de replicao do plasmdeo recombinante, levando
eventual perda na cultura.

Exemplos de promotores utilizados em vetores de expresso


facilidaVrios promotores de E. coli combinam as caractersticas desejadas de fora e de
so lisde
expresso
vetores
em
utilizados
freqentemente
mais
Aqueles
de de rgulao.
tados a seguir:

(1)
Figura 13.6
Promotores fortes
e racos.

g.

gete lacZ,
O promotor tac (Figura 13.8a) a seqncia que controla a transcrio do
nos
ptesene
gnico
lacz'
(e
fragmento
,
a
do
tambm
qu; codifica a B-galactosidase
por
isopropiltiogainduzido

promotor
lac
O
vetores pUC e tvtt:mp; p. 119 e 122).
de
lactosdo (IPTG, p 105), de modo que a adio desse composto qumico ao meio

284

T.A.BRowN

cultura ativa a transcrio de um gene inserido


um vetor de expresso.
(2)

o promotor trp (Figura

jusante do promotor /ac presente em

13.8b) est normalmente a montante do agrupamento de ge-

nes que codificam virias das enzimas envolvidas na biossntese


do arninocido tripo-

(3)
(4)

fano. o promotor trp rep/.mido pelo triptofano, mas mais facilmente


induzido pe_
lo cido 3-B-indolacrflico.
o promotor tac (Figwa 13.8c) um hbrido entre os promotores trp e lac.Ele mais
forte do que qualquer um deles, mas ainda induzvei por IpTG.
o promotor l,P" (Figura 13.sd) um dos promotores responsveis pera transcrio
da molcula de DNA de 1,. o promotor l.p, muito forte eiambm
ieconhecido pe_
la RNA-polimerase de E. coli, que levad por a transcrever o DNA
do bacterifa_
go. o promotor reprimido pelo produto do gene l,cl. vetores de
expresso portadores do promotor l,P. so utilizados em uma linhagem de E. coli
hospedeira que sinte_
tiza numa forma termossensvel da protena cI (p. 56). A uma baixaiemperatura
(me_
nor que 30"c), essa protena mutante capazde reprimir o promotor l,pr;
em temperaturas elevadas, a protena inativada, resultando na transc;io do gene
clonado.

13.1.2 Cassetr
Um vetor

bm uma

maioria dc
o gene ex(
to de sinair
tanto, na p
Em alg
stio de lig
gene de

executada

com o seg
produto dr
deo curto,
protena e;

(1)

Atra

ns c

cia n

estru
rir ni
lidad

(a) O promotor lac


IPTG

(b)

-35

-10

o promotor

trp

(2)
Transcrio

-ll

cido

3-B-indolacrlico

trpA

#--

rme

A pr

mol
no
hosp
O sq

Trlptofano

\
rranscnao

(3)
Semtranscrio

da pr

rivad
(c) O pomoto tac

-35

Transcrio

-10

(d) Promoto PL

-10

NCS

IPTG

-ll

rr

'

3o"c

- s",

transcriol

> 3o.c

Transcrio

Figura 13.!
Um vetor de cassete

tpicoeamaneiraco
mo ele utilizado

Figura 13.8
Quatro promotores utilizados reqentemente em vetores de
expresso. os promotores /ac e
rp so apresentados a montante dos genes que eles
normalmente controlam em E. coli.

P-promotor,R=s.
tio de ligao do ri
bossomo, T = termi

nador

Ct-orunceu Grurca e ANLrsE oe

lromotor /ac presente em


P do agrupamento de geixe do aminocido triptop facilmente induzido pe|rles trp e lac.Ele mai$

mG.
onsavers pela transcnD
mUem reconhecido peter o DNA do bacterifa-.
;es de expresso portade
pali hospedeira que sinte-

pbaixa temperatura (mpromotor l"Pr; em tempcpio do gene clonado-

DNA

285

13.1.2 Cassetes e uses gnicas


Um vetor de expresso eficiente no requer apenas um promotor foe

e regulvel, mas tambm uma seqncia de ligao do ribossomo e um terminador reconhecveis por E. coli.Na
maioria dos vetores, esses sinais de expresso formam um cassete, assim chamado porque
o gene exgeno inserido em um stio de restrio nico presente no meio do agrupamento de sinais de expresso (Figura 13.9). A ligao do gene exgeno ao cassete o coloca, portanto, na posio ideal em relao aos sinais de expresso.
Em alguns vetores de cassete, o stio de clonagem no est imediatamente adjacente ao
stio de ligao do ribossomo, sendo, ao invs disso, precedido pelo segmento inicial de um
gene de E. coli (Figura 13.10).A insero do gene exgeno nesse stio de restrio deve ser
executada de modo a fundir as duas fases de leitura, produzindo um gene hbrido que inicia
com o segmento de E. coli e progride sem interrupo at os cdons do gene exgeno. O
produto da expresso do gene , portanto, uma protena hbrida, que consiste em um peptdeo curto, codificado pela fase de leitura de E. coli, fusionado poro aminoterminal da
protena exgena. Esse sistema de fuso possui quatro vantagens:

(1)

A traduo eficiente do mRNA produzido

partir do gene clonado no depende ape-

nas da presena do stio de ligao do ribossomo, sendo tambm afetada pela seqn-

(2\

(3)

cia nucleotdica no incio da regio codificadora. Isso provavelmente ocorre porque


estruturas secundrias resultantes de pareamentos de bases intracadeia podem interferir na interao do ribossomo com o seu stio de ligao (Figura I 3. I 1). Essa possibilidade pode ser descartada se a regio pertinente for constituda por seqncias inteiramente naturais de E. coli.
A presena do peptdeo bacteriano no incio da protena de fuso pode estabilizar a
molcula e impedir a sua degradao pela clula hospedeira. Protenas exgenas que
no possuem o segmento bacteriano, ao contrrio, so muitas vezes destrudas pela
hospedeira.
O segmento bacteriano pode ser um peptdeo-sinal, responsvel pelo direcionamento
da protena de E. coli para a sua posio correta na clula. Se o peptdeo-sinal for derivado de uma protena que exportada pela clula (por exemplo, os produtos dos genes ompA e malU), a prpria protena recombinante poder ser exportada. Essa expor-

Gene exgeno inserido


no cassete

- > 30"c
rl

Figura 13.9
Um vetor de cassete

Fcio

tpicoeamaneiracomo ele utilizado.

Sn" "'oo"nornfl
\

_(

P-promotor,R=s-

bo

rso. Os promotores
pcontrolam em E. coli.

tio de ligao do ribossomo, T = terminador.

)
\__,/

286

T.A.Bnown

ta
tI

lncio de um
gene de E. coll

PF

(4) o

Stio de restrio nico

L'J

ni

vl

s(

Ad

segmetr
portantr

lnsero de um
gene exgeno

lo trata

Gene exgeno

polipep
exempl
bromet
(Figua

PR

em stir

\
Fuso correta

tue).

clivage

......GGA GCT ATA TT4......


E.

coli

O gene exgeno
ser traduzido

Fuso incorreta

......GGA GCATA TT4..,...

Segmento

O gene exgeno no

de E. coli

,;""0"'0"
Extremidade C

Figura 13.10
A construo de um

genehbridoeasntese de uma protena de


uso.

Pareamento de bases

Figura 13.1
O stio de ligao do
ribossomo fica encoberto

Um problema causado
pela ormao de estrutura secundria no
incio de um mRNA.

Figura 13.12
A utilizao de
cromatograia de
ainidade para
purificar uma
protena de uso com a glutationa-S-transferase.

lo

Cr-orueeeu GNtcA

(4)

E ANLtsE

oe

DNA

287

tao poder ser para o meio de cultura ou para o espao periplsmico, que fica entre
as membranas interna e externa da clula. A exportao desejvel porque simplifica
o problema da purificao da protena recombinante a partir da cultura.
O segmento bacteriano tambm pode auxiliar na purificao, permitindo que a protena de fuso seja recuperada por cromatografia de afinidade. Por exemplo, fuses en-

volvendo a protena glutationa-S-transferase de E. coli podem ser purificadas por adsoro a partculas de agarose com glutationa ligada a sua superfcie (Figura 13.12).

A desvantagem dos sistemas de fuso decorre das possveis alteraes que a presena do
segmento de E. colipode causar nas propriedades da protena recombinante. So necessirios,
portanto, mtodos para a remoo do segmento bacteriano. Geralmente isso conseguido pelo tratamento da protena de fuso com um composto qumico ou enzima que cliva a cadeia
polipeptdica na juno entre os seus dois componentes ou em um stio prximo a ela. Por
exemplo, se uma metionina est presente na juno, a protena de fuso pode ser clivada com
brometo de cianognio, que cliva polipeptdeos especificamente em resduos de metionina
(Figura 13.13). Alternativamente, podem ser utilizadas enzimas como a trombina (que cliva
em stios adjacentes a resduos de arginina) ou o fator Xa (que cliva aps a arginina de GlyArg). importante considerar-se sempre que as seqncias de reconheciment do agente e
clivagem no devem ocorer no interior da protena recombinante.

Adio da protena de fuso com


glutationa- S-transerase

lura 13.10

pnstruo de um

Matriz de
glutationa-

frefrfOriOoeasnte
f

ebsee_99f
glutationa

agarose

de uma protena de

po.

Protena de

Figura 13.12

lura

13.11

lr problema causado
fa ormao de es-

iura secundria no

bo

$-

de um mRNA.

A utilizao de
cromatografia de
afinidade para
purificar uma
protena de uso com a glutationa-S-transerase.

Partcula de

agarose
da matriz

fuso pura

'";.:
---------

Protena de fuso ligada glutationa


pelo seu componente de
glutationa- S{ransferase
Molculas de glutationa
ligadas superfcie da partcula

288

T.A.BRowN

(2)

Ost
coli

fa nl

Pept deo de E. coli

so

Protena animal ou vegetal

I
\

Tratamento com brometo de cianognio

Figura 13.13

\
,,

/t

Clivagem esPecif icamente


no resduo de metionina

Um dos mtodos Para a


recuperao de um Polipeptdeo exgeno a
partir de uma Protena
de fuso. O resduo de
metionina na juno
dos dois componentes
da fuso deve ser o nico presente em todo o
polipeptdeo: se outros
estiverem presentes, o
brometo de cianognio
clivar a protena de uso em mais de dois
ragmentos.

19.2 Problemas gerais para a produo de protenas


recombinantes em E. coli
Apesar do desenvolvimento de vetores de expresso sofisticados, existem numerosas dificuldades associadas produo de protenas a partir de genes exgenos clonados em E- colj. Esses problemas podem ser agrupados em duas categorias: aqueles devidos seqncia
do gene xgeno, e aqueles devidos s limitaes de E. coli como hospedeira para a sntese de protenas recombinantes.

19.2.1 Problemas resultantes da seqncia do gene exgeno


Existem trs maneiras pelas quais a seqncia nucleotdica pode impedir a expresso eficiente de um gene exgeno emE' coli:

(1)

O gene exgeno pode conter ntrons. Esse seria um problema importante, pois genes
de E. coli no possuem ntrons e, portanto, a bactria no possui a maquinaria necessria para a remoo dos mesmos dos transcritos (Figura 13'14a)'

Figura 13
Trs dos problen

que podem ser,


contrados quando
nes exgenos so
pressados em E r
(a) lntrons no t
removidos em E r
(b) Terminao I
matura da trans
o. (c) Um proble
de vis de codc

Clonnceu Grurcn e ANLtsE oe

(2)

DNA

289

O gene exgeno pode conter seqncias que atuam como sinais de terminao em E
coli (Figuta 13.14b). Essas seqncias so perfeitamente incuas na clula hospedeira normal, mas, na bactria, resultam em terminao prematura e na perda da expresso gnica.

(al E. coli no capaz de remover ntons

ntron

pra

13.13

I
I

n dos mtodos para a

-r--------

pperao de um po
futioeo exgeno a

Transcrio

de uma protena
lfuso. O resduo de

$r

ntron presente no mBNA

\\

rraduo

iionina na juno

b dois componentes
!fuso deve ser o nF
lpresente em todo o
heptdeo: se outros
lnerem presentes, o
[neto de cianognio
Lar a protena de ub em mais de dois

/- f \

Um polipeptdeo incorreto
sintetizado

\
(b)Terminao prematura da transcrio

PR

l\l.

gmentos.

Seqncia semelhante a um terminador


de E. coli no interior do gene exgeno

Somente parte do
gene transcrita

i:
t

t-

Hnas

(c) Vis de

cdons

Gene humano

ccA ccT ccA

kem numerosas difiLsclonados emE.coidevidos seqncia

pedeira para

a snte-

igeno
I

[ndir a expresso efilportante, pors genqs

ia maquinari necesD.

CCC

A maioria dos cdons de prolina CCA, CCT ou CCC

Figura 13.14
Trs dos problemas

que podem ser encontrados quando genes exgenos so expressados em E. coli.


(a) ntrons no so
removidos em E. coli.
(b) Terminao prematura da transcrio. (c) Um problema
de vis de cdons.

Gene de E coll

CCG CCG

CCG

A maioria dos cdons de prolina CCG

RESULTADO: E. coli tem diiculdades na traduo dos cdons


de prolina de um gene humano

29O

T.A.BRowN

(3)

O vis de cdons do gene pode no ser o ideal para a traduo em E. coli. Como descrito na pgina267, apesar de virtualmente todos os organismos utilizarem o mesmo
cdigo gentico, cada um possui um vis associado tendncia de utilizar preferencialmente determinados cdons. Esse vis reflete a eficincia com a qual as molculas de RNA de transferncia (tRNA) so capazes de reconhecer os diferentes cdons
no organismo. Se um gene clonado contm uma proporo elevada de cdons desfavorveis, os tRNAs da clula hospedeira podem encontrar dificuldades na traduo do
gene, reduzindo a quantidade de protena que sintetizada (Figura 13.14c).

Esses problemas geralmente podem ser solucionados, embora as manipulaes necessrias


possam consumir tempo e ser de custo elevado (uma considerao importante em um projeto industrial). Se um gene contm ntrons, pode ser utilizado como alternativa o seu DNA

complementar (cDNA), preparado a partir do mRNA (p. 172) e, portanto, livre de ntronsA mutagnese dirigida por oligonucleotdeos pode ento ser empregada para alterar as seqncias de possveis terminadores e para substituir cdons desfavorveis por aqueles preferidos por E. coli. Uma alternativa para genes com extenso inferior a2kb a produo
de uma verso artificial. Isso envolve a sntese de um conjunto de oligonucleotdeos parcialmente sobrepostos, projetados de modo a garantirem que o gene resultante contm os
cdons preferidos por E. coli e no possui terminadores'

13.2.2 Problemas causados por E. coli


Algumas das dificuldades encontradas quando da utilizao de E. coli como hospedeira para sntese de protenas recombinantes advm de propriedades inerentes prpria bactriaPor exemplo:

(1)

(2)

(3)

E. col pode no processar a protena recombinante corretamente. As protenas da


maioria dos organismos so processadas aps a traduo, por modificao qumica de
aminocidos presentes no polipeptdeo. Muitas vezes, esses eventos de processamento so essenciais para a atividade biolgica coreta da protena. Infelizmente, as pro'
tenas de bactrias e de organismos superiores no so processadas de maneira idntica. Em particular, algumas protenas animais so glicosiladas, o que significa que
elas possuem grupos de acar ligados a elas aps a traduo. A glicosilao extremamente incomum em bactrias e as protenas recombinantes sintetizadas em E. coli
nunca so glicosiladas corretamente.
E. coli pode no enovelar a protena corretamente e geralmente incapaz de sintetizar
as ligaes dissulfeto presentes em muitas protenas animais. Se a protena no adota
a sua estrutura terciffia com enovelamento correto, ela geralmente insolvel e forma corpos de incluso no interior da bactria (Figura 13.15). A recuperao da protena apartir de corpos de incluso no um problema, mas a sua converso na forma
corretamente enovelada difcil ou impossvel in vitro. Obviamente, sob tais circunstncias a protena inativa.
E. coli pode degradar a protena recombinante. No se sabe exatamente, entretanto,
como E coli capaz de reconhecer a protena exgena e fazer dela um alvo preferencial para reciclagem.

Esses problemas so mais difceis de serem resolvidos do que os problemas de seqncia descritos na seo anterior. A degradao de protenas recombinantes pode ser reduzida
com a utilizao, como hospedeira, de uma linhagem de E. coli deficiente em uma ou mais
proteases responsveis por esse processo. O enovelamento correto de protenas recombi-

Figura

Corpos de inc

nantes tam

se caso, u
rem respol
a ausncia

utilizao
maneira.

13.3 Produ

eucarid
Os proble

recombini

temas de t
tras bactr
so

foi alct

/i

so euc

eucarioto

prximo

binantes t
em cultivr
a partir d

milar qu

13.3.1 Proten
ungos
O potenc

mente re(
versas pr

Ct-ouneev GNtcA

E ANLtsE

oe

DNA

291

o em E. coli. Como des-

nos utilizarem o mesmo


sia de utilizar preferenI com a qual as molcucer os diferentes cdons
levada de cdons desfabuldades na traduo do
fgura 13.14c).

Clula de

E coll
Corpos de incluso

anipulaes necessrias
I importante em um pron alternativa o seu DNA
Drtanto, livre de ntrons.
Egada para alterar as seorveis por aqueles prenor a2 kb a produo

I oligonucleotdeos parne resultante contm os

pli como

hospedeira paEntes prpria bactria-

mente. As protenas da
modificao qumica de
FYentos de processamen-

m. Infelizmente.

as pro-

Esadas de maneira idndas, o que significa que


r A glicosilao extre-

sintetizadas em E. coli

E incapaz de sintetizar
Se a protena no adota
hnente insolvel e for.

). A recuperao da pro.
I sua converso na forma
mente, sob tais circuns-

exatamente, entretanto"
dela um alvo preferen-

m problemas de seqnmntes pode ser reduzida


Eciente em uma ou mais
n de protenas recombi-

Figura 13.5

Nucleide

Corpos de incluso.

nantes tambm pode ser promovido pela escolha de uma linhagem hospedeira especial, nesse caso' uma que sintetize grandes quantidades de protenas chaperonas, que se acredita
serem responsveis pelo enovelamento de protenas na clula. Porm, o principal problema
a ausncia de glicosilao. At o momento, esse problema no teve soluo, o que limita
a
utilizao de E. coli sntese de protenas animais que no precisam ser modificadas dessa

maneira.

13.3 Produo de protenas recombinantes por clulas


eucariticas
Os problemas associados com a obteno de um alto rendimento na produo
de protenas
recombinantes ativas a partir de genes clonados em E. coli levou ao desenvolvimenio
de sistemas de expresso para outros organismos. Houve algumas tentativas de utilizao
de outras bactrias como hospedeiras para a sntese de protenas recombinantes e
algum progresso foi alcanado com Bacillus subtilis, mas as principais alternativas
utilizao e n. co/i so eucariotos microbianos. o argumento para a utilizao desses organismos que um
eucarioto microbiano, como uma levedura ou um fungo filamentoso, ? um parente mais
prximo de um animal e, por isso, pode ser capaz delidar com a sntese de protenas
recombinantes mais eficientemente do que E. coti. Leveduras e fungos podem ser multiplicados
em cultivos contnuos to facilmente quanto bactrias e podem expressar um gene
clonado
a partir de um organismo superior e processar a protena resultante
de uma maneira mais similar quela que ocore naturalmente.

13.3.1 Protenas recombinantes produzidas a partir de leveduras e de


fungos filamentosos
O potencial de eucariotos microbianos para a expresso de genes exgenos j foi
amplamente reconhecido e esses organismos esto sendo utilizados na rotina de produo
de diversas protenas animais. Os vetores de expresso continuam sendo necessrios,
pois os

292

T. A. Bnowr.r

promotores e outros sinais de expresso de genes animais geralmente no funcionam de


maneira eficiente nesses eucariotos inferiores. Os vetores utilizados so baseados naqueles
descritos no Captulo 7.

Saccharomyces cerevisiae como hospedeira para a sntese de


protenas recombi nantes
A levedura Saccharomyces cerevisiae atualmente o eucarioto microbiano mais popular
para a produo de protenas recombinantes. Os genes clonados so freqentemente colocados sob o controle do promotor GAL(Figura 13.16a), que est normalmente a montante
do gene que codifica a galactose-epimerase, uma enzima envolvida no metabolismo da galactose. O promotor GAL induzido por galactose, constituindo-se, por isso, em um sistema simples para a regulao da expresso de um gene exgeno clonado. Outros promotores teis so PHO5, que regulado pelo nvel de fosfato no meio de cultivo, e CUPl, qae
induzido por cobre. A maioria dos vetores de expresso de levedura tambm possui uma seqncia de terminao de um gene de S. cerevisiae, porque sinais de terminao de genes
animais no funcionam eficientemente em leveduras.
O rendimento da produo de protenas recombinantes em S. cerevisiae relativamente
elevado, mas essa levedura incapaz de glicosilar protenas animais corretamente. Muitas
vezes ela adiciona um nmero excessivo de unidades de acar ("hiperglicosilao"), embora isso possa ser evitado ou pelo menos amenizado a partir da utilizao de uma linhagem mutante . S. cerevisiae tambm no possui um sistema eficiente para a secreo de protenas para o meio. Na ausncia de secreo, as protenas recombinantes ficam retidas na
clula e, conseqentemente, tm sua purificao dificultada. O vis de cdons (p. 290) tambm pode ser um problema.

Apesar desses inconvenientes, S. cerevisiae permanece sendo o eucarioto microbiano


mais freqentemente utilizado para a sntese de protenas recombinantes. Isso se deve, em
parte, ao fato de ela ser aceita como um organismo seguro para a produo de protenas para utllizao em medicamentos ou alimentos. Alm disso, foi adquirida ao longo dos anos
uma riqueza de conhecimentos muito grande a respeito da bioqumica e da gentica de S.
cerevisiae, o que torna relativamente mais fcil a elaborao de estratgias para a superao
das dificuldades que eventualmente surgem.

Figura 3.16
Quatro promotores
utilizados reqentemente em vetores de
expresso de eucariotos microbianos.
P - promotor.

Outras leveduras e ungos


Embora S. cerevisiae seja o organismo eucaritico preferido por muitos bilogos moleculares para a sntese de protenas recombinantes, existem outros eucariotos microbianos
igualmente qualificados, se no mais eficientes, para a execuo dessa tnefa. Pichia pastoris, em especial, uma segunda espcie de levedura, capaz de sintetizar grandes quantidades de protena recombinante (at307o da protena celular total) e as glicosilaes feitas por
ela so muito similares quelas de clulas animais. As estruturas de acar que ela sintetizano so precisamente as mesmas que as verses animais (Figura 13.17), mas as diferenas so muito pequenas e provavelmente no tm um efeito significativo na atividade da
protena recombinante. Mais importante ainda, improvvel que as protenas glicosiladas
produzidas por P. pastorls induzam uma reao antignica se injetadas na corrente sangnea, um problema freqentemente encontrado com protenas glicosiladas em excesso sintetizadas por S. cerevisiae. Vetores de expresso para P. pastoris utilizam o promotor da lcool-oxidase (AOX) (Figura 13.16b), que induzido por metanol. O nico problema significativo com P pastoris a degradao eventual das protenas recombinantes antes de elas

Figura

Comparao entre
estrutura de glicosil
tpica encontrada em
protena animal e a
truturas sintetizada
P.

pastoris e S. cerev,

Clonnoev GNrcA

&

no funcionam

E ANLrsE

oe

DNA

293

(a) O promotor GL

so baseados naqueles

Galactose

sntese de

..\

GAL 10

Transcrio

-a
iano mais popular
freqentemente colo'
mente a montante
no metabolismo da ga
por isso, em um sisteOutros promote

(b) O promotor
-ll OX
Metanol

tambmpossui uma s
de terminao de genes

(c) O promotor da glicoamilase

Muim

er

icosilao"),

tlrzao de uma linh*


para a secreo de pro-

inantes ficam retidas


de cdons (p. 290)

tan'

o eucarioto microbiam,
. Isso se deve,
de protenas

ooo
da
glicoamilase
..+\tr

Xilose

Gene

relativamenE

is corretamente.

Transcrio

-a,------tr

cultivo, eCUPL,que

Gene da
lcool-oxidase

Figura 13.16
Quatro promotores
utilizados freqentemnt m vetores de
expresso de eucariotos microbianos.
P - promotor.

lrSClQO

+\

Sem transcnao

-a'---=(d) O promotor da celobioidrolase


Celulose

da
\
p celobioidrolase \
Gene

lransclao

-a!-----.-D

prr

irida ao longo dos


e da gentica dc

t,

muitos bilogos

glicosilaes feitas
de acar que ela
13.17), mas as
ivo na atividade
as protenas glicosi
as na

corrente

ilizam o promotor da
O nico problema si
inantes antes de

Figura 13.17
Comparao entre uma
estrutura de glicosilao
tpica encontrada em uma
protena animal e as estruturas sintetizadas por
P pastoris e S. cerevisiae.

YI
I
t

Vr

-Asn-

-Asn-

Homem

P pastoris

-AsnS. cerevisiae

Acares

294

T. A. Bnowr.r

poderem ser purificadas, mas isso pode ser controlado pelo uso de um meio de cultrvo especial. Outras leveduras que vm sendo utilizadas para a sntese de protenas recombinantes so Hansenula polymorpha, Yarrowia lipolytica e Kluveromyces lactis. Esta ltima tem
o atrativo especial de poder ser cultivada em meio derivado de resduos da indstria de ali-

sadas corn
a abordagt

mentos.

Produ

Os dois fungos filamentosos mais populares so Aspergillus nidulans e Trichoderma


reesei. As vantagens desses organismos so as suas boas propriedades de glicosilao e a
capaci<lade de secretarem protenas para o meio de cultivo. Esta ltima vantagem uma caracterstica particularmente forte do fungo T. reesei, que, em seu hbitat natural, secreta enzimas celulolticas que degradam a madeira em decomposio sobre a qual ele vive. As caractersticas secretrias implicam que esses fungos so capazes de produzir protenas recombinantes em uma forma que auxilia na purificao das mesmas. Vetores de expresso
paraA. nidulans geralmente possuem o promotor da glicoamilase (Figura 13.16c), induzido por amido e reprimido por xilose; aqueles paraT. reesei uilzamo promotor da celobioidrolase (Figura 13.16d), que induzido por celulose.

13.3.2 Utilizando clulas animais para a produo de protenas


recombinantes

possibili,

procedime

Clulas dt

cultura, a:
tm como
produzirer
O siste

em inseto:
o gene da

corpos de

nico gen

lares de pi
ne exger
rias protet

corretam(

As dificuldades inerentes sntese de protenas animais inteiramente ativas em um hospedeiro microbiano levaram os biotecnlogos a explorarem a possibilidade de utilizar clulas
animais para a sntese de protenas recombinantes. Para protenas com estruturas de glicosilao complexas e essenciais, uma clula animal pode ser o nico tipo de clula hospedei-

vantagem

ra na qual a protena ativa pode ser sintetizada.

Uma inor

Produo de protenas em clulas de mameros

nantes i
em todas
(p. 160).

Os sistemas de cultivo para clulas animais j esto disponveis desde o incio da dcada de
1960, mas somente durante os dez ltimos anos foram desenvolvidos mtodos para a cultura contnua e em larga escala dessas clulas. Um dos problemas de algumas linhagens de
clulas animais decorre do fato de elas exigirem uma superfcie slida para sua multiplicao, o que complica a concepo dos recipientes utilizados no cultivo. Uma das solues
encontradas foi o preenchimento do interior do recipiente com placas, que suprem a demanda por uma grande rea plana. Isso, contudo, tem a desvantagem de tornar bastante difcil a
mistura completa e contnua do meio no interior do recipiente. Uma segunda possibilidade
a de uilizar um recipiente comum, mas colocar no seu interior pequenas partculas inertes (por exemplo, partculas de celulose) sobre as quais as clulas podem se multiplicar. Em
comparao com microrganismos, a velocidade de multiplicao e as densidades celulares
mximas que podem ser atingidas so muito menores para as clulas animais, limitando o
rendimento da produo de protenas recombinantes. Isso, contudo, pode ser tolerado, se
essa for a nica maneira para a obteno da protena ativa.
Obviamente, a clonagem gnica pode no ser necessriapara a obteno de uma protena animal a partir de um cultivo de clulas animais. Apesar disso, vetores de expresso e genes clonados so ainda utilizados para a maximizao do rendimento, colocando o gene sob
controle de um promotor que mais forte do que aquele ao qual ele est normalmente ligado. Esse promotor freqentemente obtido de um vrus, como SV40 (p. 160). Linhagens de
clulas de mamferos derivadas de tecidos humanos ou de hamster vm sendo utilizadas na
sntese de vrias protenas recombinantes e, em todos os casos, essas protenas so proces-

Pharmi
de anin

rvel, por
ne clonat

Corpos de inclusi
cleos de clulas

Cr-oruneeu GNrcA

;meio de cultivo esftenas recombinan-

rni. Esta ltima tem


p

da indstria de ali-

'lbns e Trichoderma

I de glicosilao e a
ivantagem uma ca-

lnatural, secretaenqual ele vive. As capduzir protenas rePtores de expresso


lra 13.16c), induziIomotor da celobioi-

ftenas
f,inu,

.-

he de

utilzar clulas

um hospe-

lot-turu, de slicGI de clula rrorJ.a"lf^


i
i

lirri.io

da dcada de

fetoaos para a cultu[u*ur linhagens de

foara sua multiplica[- Urnu das solues


pe suprem a demanpar bastante difcil a

E ANLlsE DE

DNA

sadas corretamente e so indistinguveis das verses no-recombinantes. Entretanto, essa


a abordagem mais cara para a produo de protenas recombinantes, especialmente porque
a possibilidade de co-purificao de vrus com as protenas implica o emprego de rigorosos
procedimentos de controle de qualidade para a garantia de que o produto seguro.

Produo de protenas em clulas de inseto


Clulas de inseto representam uma alternativa para a produo de protenas animais. Em
cultura, as clulas de inseto comportam-se da mesma maneira que as de mamferos, mas
tm como grande vantagem a caracterstica de, graas a um sistema natural de expresso,
produzirem as protenas recombinantes com um alto rendimento.
O sistema de expresso baseado nos baculovrus, um grupo de vrus que so comuns
em insetos, mas apaentemente no infectam vertebrados. O genoma do baculovrus inclui
o gene da poliedrina, cujo produto normal acumula-se nas clulas de inseto como grandes
corpos de incluso nucleares ao final do ciclo de infeco (Figura 13.18). O produto desse
nico gene freqentemente chega a representar 5OVo da protena celular total. Nveis similares de produo de protena tambm ocorrem se o gene normal for substitudo por um gene exgeno. Vetores de baculovrus vm sendo utilizados com sucesso na produo de vrias protenas de mamfero, mas, infelizmente, as protenas resultantes no so glicosiladas
corretamente. Em relao a esse aspecto, o sistema de baculovrus no oferece qualquer
vantagem em comparao a S. cerevisiae ou P' pastoris.

Pharming: protenas recombinantes produzidas a partir


de animais vivos
Uma inovao recente e potencialmente importante para a produo de protenas recombinantes autllizao de um animal transgnico, um animal que contm um gene clonado
em todas as suas clulas, geralmente introduzido por microinjeo em um vulo fecundado
(p. 160). A produo de animais transgnicos cara, mas a relao custo-benefcio favorvel, porque, depois de o animal ter sido produzido, ele pode reproduzir-se e passar o gene clonado a sua prognie, de acordo com os princpios mendelianos bsicos'

possibilidade

fuunda
bnas partculas iner-

h se multiplicar.

Em

Citoplasma

pnsidades celulares
himais, limitando o
h'de ser tolerado.

se

Membrana nuclear

foio de uma protek de expresso e ge-

plocando o gene sob


p normalmente ligaI too;. Linhagens de
I sendo utilizadas na
I

fotenas so proces-

295

Figura 13.18
Corpos de incluso cristalinos em ncleos de clulas de inseto infectadas
com um baculovrus.

Corpos de incluso

296

T. A. Bnowlr

A abordagem mais bem-sucedida at agora para a produo de protenas recombinantes


em animais transgnicos utiliza animais de fazenda, como ovelhas ou porcos, com o gene
clonado ligado ao promotor do gene da p-lactoglobulina do animal. Esse promotor ativo
no tecido mamrio, o que significa que a protena recombinante secretada no leite (Figura 13.19)' A produo de leite pode ser contnua durante a vida adulta do animal, resultndo em um grande rendimento na produo da protena. Alm disso, como a protena secretada, a sua purificao relativamente simples. Mais importante ainda futo d" on"lhs e porcos serem mamferos, de modo que protenas humanas produzidas dessa maneira
so modificadas corretamente. A produo de protenas de uso farmacutico em animais
de
fazenda vem sendo chamada de pharming (do ingls pharmaceuticals xfarming). Apesar
de controversa, essa tcnica uma das que oferece maiores perspectivas para a sntese de
protenas humanas corretamente modificadas para utilizao na medicina.

13.3.3 Protenas recombinantes produzidas a partir de vegetais


Os vegetais representam a ltima possibilidade para a produo de protenas recombinantes. Plantas e animais possuem atividades de processamento de protenas similares e a
maioria das protenas animais produzidas em plantas passa pelas modificaes ps-traduo corretas, sendo, portanto, completamente funcionais. O cultivo de clulas ueg"tui,
uma tecnologia bem estabelecida, que j vem sendo utilizada para a sntese comercial de
produtos naturais de plantas. Alternativamente, plantas intactas podem ser cultivadas a campo em altas densidades, o que determina um elevado rendimento na produo de protenas
recombinantes, com bom potencial para armazenamento de longo prazo, emrgos como
tubrculos ou frutos, naturalmente ricos em protena.
Seja qual for o sistema de produo utilizado, as plantas oferecem meios baratos e de
baixa tecnologia para a produo massiva de protenas recombinantes. Uma ampla gama de
protenas j foi produzida em sistemas experimentais, inclusive produtos farmacuticos
importantes, como interleucinas e anticorpos. Essa uma rea depesquisa intensa no
momento, com virias empresas de biotecnologia vegetal desenvolvendo sistemas que esto prximos da produo comercial. Uma das possibilidades futuras mais promissoras a uitiruo de plantas para a produo de vacinas, o que serviria de base para programas de vacinao baratos e eficientes.

ra

296

T. A. Bnowlr

A abordagem mais bem-sucedida at agora para a produo de protenas recombinantes


em animais transgnicos utiliza animais de fazenda, como ovelhas ou porcos, com o gene
clonado ligado ao promotor do gene da B-lactoglobulina do animal. Esse promotor ativo
no tecido mamrio, o que significa que a protena recombinante secretada no leite (Figura 13.19). A produo de leite pode ser contnua durante a vida adulta do animal, resultando em um grande rendimento na produo da protena. Alm disso, como a protena secretada, a sua purificao relativamente simples. Mais importante ainda o fato de ovelhas e porcos serem mamferos, de modo que protenas humanas produzidas dessa maneira
so modificadas corretamente. A produo de protenas de uso farmacutico em animais de
fazenda vem sendo chamada de pharming (do ingls pharmaceuticals xfarming). Apesar
de controversa, essa tcnica uma das que oferece maiores perspectivas para a sntese de
protenas humanas corretamente modificadas para utilizao na medicina.

13.3.3 Protenas recombinantes produzidas a partir de vegetais


Os vegetais representam a ltima possibilidade para a produo de protenas recombinantes. Plantas e animais possuem atividades de processamento de protenas similares e a
maioria das protenas animais produzidas em plantas passa pelas modificaes ps-traduo corretas, sendo, portanto, completamente funcionais. O cultivo de clulas vegetais
uma tecnologia bem estabelecida, que j vem sendo utilizada para a sntese comercial de
produtos naturais de plantas. Alternativamente, plantas intactas podem ser cultivadas a campo em altas densidades, o que determina um elevado rendimento na produo de protenas
recombinantes, com bom potencial para arnazenamento de longo prazo, em rgos como
tubrculos ou frutos, naturalmente ricos em protena.
Seja qual for o sistema de produo utilizado, as plantas oferecem meios baratos e de
baixa tecnologia para a produo massiva de protenas recombinantes. Uma ampla gama de
protenas j foi produzida em sistemas experimentais, inclusive produtos farmacuticos importantes, como interleucinas e anticorpos. Essa uma fuea de pesquisa intensa no momento, com viirias empresas de biotecnologia vegetal desenvolvendo sistemas que esto prximos da produo comercial. Uma das possibilidades futuras mais promissoras a utilizao de plantas para a produo de vacinas, o que serviria de base para programas de vacinao baratos e eficientes.

Cr-oruaeeu GNrcA E ANLrsE oe

recombinantes
lx)rcos, com o gene
promotor ativo
no leite (Figudo animal, resultana protena se
o fato de ovedessa maneira
em animais de
xfarming). Apasar
para a sntese dc

DNA

297

Promotor da p-lactoglobulina
Clonagem em uma
ovelha transgnica

is
recombinar

nas similares e I
ificaes ps-tra&
clulas vegetais
sntese comercial dc
ser cultivadas a cah
em rgos como
meios baratos e dc
Uma ampla gama&
farmacuticos

ir

intensa no momcr
que esto prxi-

programas de vaci.

Figura 13.19
Protena recombinante
secretada no leite

Produo de uma
protena recombinante no leite de
uma ovelha transgnica.

Cnprulo 4

hion in Biotechnology, 10,


licl derived from he

Clonagem Gnica e Anlise


de DNA na Medicina

trp anil

h-5.
Qenic

Re

se

arch, 9,

27 9 -99 -

ldies: a comparison of Sac3. Gene, lg0, 87-gi .


ix for biopharmaceuticals.
I

Lession in Escherichia coF

ifor insect and mammalian


Drstems for high level gene
I

lgenic Research, 9, 301-4i


;

coli strains deficient in all


|otechnology, 12, I 107-10.
I

pntes

em E. coll.l
ksion controlled by the P.,

Produo de medicamentos recombinantes, 299


Identificao de genes responsveis por doenas

Terapia gnica,3l4

humanas. 309

hslation of genes in Escei

Vin Escherichia coli

as

fu-

Iesis and secretion of hI

recombinant protein pro-

A medicina foi e continua

a ser a maior beneficiria da revoluo do DNA recombinante; assim, um livro inteiro poderia ser escrito a respeito deste tpico. Mais adiante, neste captulo,
aborda-se a forma como as tcnicas de DNA recombinante esto sendo utilizadas para identificar genes responsveis por doenas hereditirias e para o desenvolvimento de novos tratamentos para esses distrbios. Inicialmente, ser dada continuidade ao tema tratado no captulo anterior e examinada a maneira como os genes clonados esto sendo utilizados na produo de medicamentos recombinantes.

14.1 Produo de medicamentos recombinantes


Diversas doenas humanas podem ser identificadas como decorrentes da ausncia ou do mau
funcionamento de uma protena normalmente sintetizada no colpo. A maioria dessas enfermidades pode ser tratada a partir do fornecimento ao paciente da verso coeta da protena, mas,
para que isso seja possvel, necessrio que a protena relevante esteja disponvel em quantidades relativamente grandes. Se o defeito pode ser corrigido apenas com a administrao da
protena humana, a obteno de quantidades suficientes da mesma pode ser um grande problema, a menos que sangue fornecido por doadores possa ser utilizado como fonte pira sua
purificao. Por isso, protenas de origem animal so usadas sempre que possvel. Entretanto,
no existem muitas enfermidades que podem ser tratadas com protenas animais e, alm disso, h sempre a possibilidade de ocorrncia de efeitos colaterais quando elas so empregadas,
como, por exemplo, uma resposta alrgica.
O Captulo 13 mostrou que a clonagem gnica pode ser utilizada para a obteno de grandes quantidades de protenas recombinantes humanas. Como essas tcnicas esto sendo aplicadas produo de protenas que sero usadas como medicamentos?

[.'

300

T. A. Bnowr.r

14.1.1 Insulina recombinante


A insulina, sintetizada pelas clulas

B das ilhotas de Langerhans, no pncreas, controla o nvel de glicose no sangue. Uma deficincia em insulina manifesta-se como diabete melito, um
complexo de sintomas que podem levar moe, quando no-tratados. Felizmente, muitas formas de diabete podem ser atenuadas por um programa contnuo de injees de insulina, suplementando assim a quantidade limitada desse hormnio que sintetizada pelo pncreas do
paciente. A insulina utilizadano tratamento tradicionalmente obtida a partir de pncreas de
sunos e de bovinos abatidos para a produo de carne. Embora a insulina de origem animal
seja geralmente satisfatria, ela pode eventualmente causar problemas quando utilizada no
tratamento do diabete humano. Um dos problemas decorre das pequenas diferena's entre a
protena humana e as de origem animal, que podem levar a efeitos colaterais em alguns pacientes. Outro problema a dificuldade dos procedimentos de purificao, que nem sempre
eliminam contaminantes potencialmente perigosos.
A insulina apresenta duas caractersticas que facilitam a sua produo por tcnicas de
DNA recombinante. Primeiramente, a protena humana no modificada aps a traduo pela adio de molculas de acar (p.289); portanto, a insulina sintetizada por uma bactria deve ser ativa. A segunda vantagem relaciona-se ao tamanho da molcula. A insulina uma protena relativamente pequena, composta por dois polipeptdeos, um de 21 aminocidos (a cadeiaA) e o outro de 30 (a cadeia B; Figura 14.1). No homem, tais cadeias so sintetizadas como um precursor chamado pr-proinsulina, que contm os segmentos A e B ligados por uma
terceira cadeia (C) e precedido por uma seqnciaJder. A seqncialder e a cadeia C so
removidas aps a traduo, deixando os polipeptdeos A e B ligados um ao outro por duas
pontes de dissulfeto.
Virias estratgias j foram utilizadas para a obteno de insulina recombinante. Um dos
primeiros projetos, envolvendo a sntese de genes artificiais para as cadeis A e B seguida pela produo de protenas em E. coli, ilustra inmeras tcnicas gerais usadas na produo de

protenas recombinantes.

Sntese e expresso de genes de insulina artificiaas


No final da dcada de 1970, aidia de sintetizar um gene artificial era extremamente inovadora. Naquela poca, a sntese de oligonucleotdeos estava na sua infncia e os mtodos disponveis para a produo de molculas de DNA artificiais eram muito mais complicados do
que as tcnicas automatizadas atuais. Apesar disso, genes codificando as cadeias A e B da insulina foram sintetizadosj em 1978.
A estratgia utilizada sintetizava trinucleotdeos representando todos os cdons possveis,
que foram ento unidos na ordem ditada pelas seqncias de aminocidos das cadeias A e B.
Os genes artificiais no tinham necessariamente as mesmas seqncias nucleotdicas que os
segmentos gnicos reais que codificam essas cadeias, mas, ainda assim, eles especificavam os
polipeptdeos corretos. Dois plasmdeos recombinantes foram consffudos, um carregando o
gene artificial para a cadeia A e o outro, o gene da cadeia B.
Em ambos os casos, o gene artificial foi ligado a uma fase de leitura de.lacZ',presente em
um vetor do tipo pBR322 (Figura 14.2a). Os genes de insulina estavarri, portanto, sob o controle do forte promotor lac (p.283) e foram expressados como protenas de fuso, as quais
consistiam nos primeiros aminocidos da B-galactosidase seguidos pelo polipeptdeo A ou B
(Figura 14.2b). Cada gene foi projetado de modo a que seus segmentos de
B-galactosidase e
de insulina fossem separados por um resduo de metionina, para que esses dois componentes
pudessem ser liberados por clivagem, proporcionada por tratamento com brometo de ciano-

L.
?

Figura 14.1
A estrutura da molcula de insulina
e um resumo da
sua sntese por
processamento da
pr-proinsulina.

;-

gnio (p. 287r.

de pontes de dis
A etaPa final

ciente. Um aprn
duais, mas de to
(Figura 14.l). Is

DNA, mas apro


pontaneamente
correspondente

proteoltica.

Ct-orueeeu GNtcA

pncreas, controla o bmo diabete melito, tm


muitas foriFelizmente,

Alrr-s- DNA

30 aminocidos

ffees de insulina, sw
lizada pelo pncreas do
ia partir de pncreas de
hina de origem animal

CadeiaB

21 aminocidos

A molcula de insulina

guando utilizada no
ienas diferena's entre e
platerais em alguns pabao, que nem sempE

Lder
(Proinsulina = BCA

Pr-proinsulina

- sem lder)

I
I

i"ao por tcnicas dc

iada aps a traduo pe-

Enovelamento espontneo

ha por uma bactria def- A insulina uma pK>


b

2l

aminocidos (a

e.
e

pias sao sintezadas


iA e B ligados por nrn

hlfdereacadeiaCso

b um ao outro por dum


I

precombinante. Um dm

ideiasAeBseguidape-

[usadas na produo dc

Clivagem

I'

Figura 14.1

f
I

extremamente inov+
pncia e os mtodos dirlo mais complicados &

[ascadeiasAeBdair
i

ps

Fdos, um carregando o
r

pde lacZ', presente n

$, portanto, sob o conpnas de fuso, as qn*h


po polipeptdeo A ou B
de p-galactosidase

pses dois componentes


bom brometo de ciano
:

SS
I ^
A

Insulina

lq eles especificavam oe

os cdons possveis*
das cadeias A e B-

lidos
ps nucleotdicas que

A estrutura da molcula de insulina


e um resumo da
sua sntese por
processamento da
pr-proinsulina.

gnio (p. 287). As cadeias A e B purificadas eram ento ligadas uma outra, pela formao
de pontes de dissulfeto em tubo de ensaio.
A etapa final, envolvendo a formao de pontes de dissulfeto, mostrou-se bastante ineficiente. Um aprimoramento posterior da tcnica permitiu a sntese no de genes A e B individuais, mas de toda a fase de leitura da proinsulina, especificando cadeia B-cadeia C-cadeia A
(Figura 14.1). Isso constitui-se em uma proposio mais desafiadora em termos de
sntese de
DNA, mas a produo do pr-hormnio trouxe consigo a grande vantagem de enovelar-se espontaneamente na estrutura correta, com a formao das pontes de dissulfeto. O segmento
correspondente cadeia C podia, ento, ser removido com relativa facilidade por clivagem

proteoltica.

302

T.

A. Bnowr.r

A son

(a) Os genes atiiciais

lacZ'
Promotor /ac

.a

Gene A

protena n
te adequar
ma descrir
tor lacZ' I

Gene B

nognio.
A snt
tem uma

()

ficial corr

fcil, pois

\_/

Vetor carregando o

Por isso, I
mentar (c

Vetor carregando o
gene B artiicial

gene A artificial

mensageir

(b) Sntese da protena insulina

po human
fina con
va em doi

rq
T,4

/{
/\

/\
_ \
1-- A

Segmento

da

1-. - -

---\

--\

Clulas de E coll
transformadas
sintetizam as
protenas de
fuso A e B

l9l, foi n

nor foi su
somatoto

modificad

B-galactosidase I

-)-,

cadeia A

met

I
tt

I .
rI

Brometo

de

cranogenro

"^o"ru,

i
Protenas de uso
clivadas

Puriicao das cadeias A e B,


associao por pontes de dissuleto

-rrlnsulina

Figura 14.2
A sntese da insulina
recombinante a partir
de genes artiiciais

dascadeiasAeB.

14.1.2 sntese de hormnios de crescimento humanos em E. coti


Aproximadamente na mesma poca em que foi produzida pela primeira vez a insulina
recombinante em E- coli, outros pesquisadores estavam trabalhando em projetos
similares envolvendo os hormnios de crescimento humanos somatostatina e somatotrofina.
Essas duas protenas agem em conjunto para controlar processos de crescimento no corpo
humano e o mau
funcionamento das mesmas leva a enfermidades dolorosas e incapacitanes,
como a acromegalia (crescimento sseo descontrolado) e o nanismo.

Fi

Produo de somdo
c

k
#

E-t
a\
E
F

Ct-orunceu Gnrcn e ANLtsE

or DNA

303

A somatostatina foi a primeira protena humana a ser sintetizada em E coli.por ser uma
protena muito pequena, com uma extenso de apenas 14 aminocidos, elae particularmente adequada para a sntese do gene artificial correspondente. A estratgia utitr iadafoia mesma descrita para a insulina recombinante, envolvendo a insero do gen artificial em um vetor lacZ'(Figura 14.3), a sntese de uma protena de fuso e a clivagem com brometo de cianognio.
A sntese de somatotrofna foi um problema de soluo mais complexa. Essa protena
tem uma extenso de 191 aminocidos, equivalente a quase 600 pb, e a sntese do gene artificial correspondente representava, no final da dcada de l97},uma tarefa extremamente difcil, pois seria um desafio at mesmo para a capacidade de sntese de DNA dos dias atuais.
Por isso, foi utilizada uma combinao de sntese artificial e de clonagem de DNA complementar (cDNA) para a obteno da linhagem de E. coli produtora de somatotrofina. RNA
mensageiro (mRNA) foi obtido da pituitria, a glndula que produz a somatotrofina no corpo humano, e, a partir dele, foi preparada uma biblioteca de cDNA. O cDNA da somatotrofina continha um stio nico para a endonuclease de restrio HaeIlI, que, portanto, o clivava em dois segmentos (Figura 14.4a). O segmento mais longo, incluindo os cdons de 24 a
191, foi mantido para utilizao na construo do plasmdeo recombinante. O fragmento menor foi substitudo por uma molcula de DNA artificial, que reproduzia o incio do gene da
somatotroina e inclua os sinais corretos para a traduo em E coli (Figura 14.4b). O gene
modificado foi ento ligado a um vetor de expresso portador do promotor /ac.

lacZ'
Promotor /ac

Gene artificial da somatostatina

L.

>.R.

/
(
\
\--./

14.2
sntese da insulina
te a pa
genes artiiciais
cadeias A e B.

---.-

)
/

rransrormao

\oee.cori

Segmento da
p-galactosidase

E.

'1,"\'
met \\

Somatostatina

coli
insulina

Protena
oe usao

Brometo de
cianognio

recm.

similares envolven
Essas duas protehUmanO e O til

como a acrorln-

\
Figura 14.3
Produo de somatostatina recombinante.

Somatostatina

Cloruaoeu Grurca e ANLtsE oe

DNA

303

A somatostatina foi a primeira protena hur{ana a ser sintetizada em E coli.Por ser uma
protena muito pequena, com uma extenso de a[gna$ 14 aminocidos, ela era particularmente adequada para a sntese do gene artificial correspondente. A estratgia utilizada foi a mesma descrita para a insulina recombinante, envolvendo a insero do gene artificial em um vetor lacZ' (Figura I4.3), a sntese de uma protena de fuso e a clivagem com brometo de cianognio.
A sntese de somatotrofina foi um problema de soluo mais complexa. Essa protena
tem uma extenso de 191 aminocidos, equivalente a quase 600 pb, e a sntese do gene artificial correspondente representava, no final da dcada de 1970, uma tarefa extremamente difcil, pois seria um desafio at mesmo para a capacidade de sntese de DNA dos dias atuais.
Por isso, foi utilizada uma combinao de sntese artificial e de clonagem de DNA complementar (cDNA) para a obteno da linhagem de E. coli produtora de somatotrofina. RNA
mensageiro (mRNA) foi obtido da pituitria, a glndula que produz a somatotrofina no corpo humano, e, a partir dele, foi preparada uma biblioteca de cDNA. O cDNA da somatotrofina continha um stio nico para a endonuclease de restrio HaeIII, que, portanto, o clivava em dois segmentos (Figura 14.4a). O segmento mais longo, incluindo os cdons de 24 a
191, foi mantido para utilizao na construo do plasmdeo recombinante. O fragmento menor foi substitudo por uma molcula de DNA artificial, que reproduzia o incio do gene da
somatotrofina e inclua os sinais corretos para a traduo em E. coli (Figwa I4.4b). O gene
modificado foi ento ligado a um vetor de expresso poador do promotor /ac.

lacZ'
Promotor /ac

sntese da insulina
a partir
de genes artiiciais

--..)
\

\
/

rransormao

\deeco/r

\_-,'

dascadeiasAeB.

E.

).4

/
(
\

Figura14.2

Gene artificial da somatostatina

L,

Segmento da
p-galactosidase

.af\_
'
\
met \
Brometo de
cianognio

vez a insulina recom-

tl)

similares envolven. Essas duas

F_

r
h
F

t,
F

,
E-

lusao

Somatostatina

coli

protee
humano o mau
como a acrome-

Protena
Oe

Figura 14.3
Produo de somatostatina recombinante.

--

Somatostatina

304

T. A. Bnowlt

cedimento co

(a) Preparao do ragmento de GDNA da somatotroina

cesso de

purifi

las virais presr

Cdons 0

moflicos por i

24

19.1

contaminao,
O gene do:
dido em 26 x

Haelll
I

(com 2.351 an
ps-tradutu, I

Restrio com Haelll

0 24 24

Descartado

-"'

dade maior, dc
nor, derivada d
17 pontes & d
tena tio grand

191

coli.
Por isso, as

lulas de marn
(b) Expresso

o24
,/I

Lder

sinttico
/

191

separados

/
/

em clulas de I
baixo. Issogo
retamente n I
va, compro{n

CDNA

obt

tro codifican
Presso,

lnsero em um

ajnse

globina de cod

vetorde expresso

Os

plasmdec

Promotor /ac
Transormao

em E.

coti

Sntese da

somatotrofina

Figura 14.4
Produo da somatotroina
recombinante.

14.1.3 FatorVlll recombinante


Embora vrios compostos de uso farmacutico tenham sido
obtidos a partir de genes clona-

dos em E' coli, os problemas gerais associados ao uso de


bactrias para sntese de protenas
exgenas (p. 288) levou, em muitos casos, substituio
desses organismos por eucariotos.
um exemplo de medicamento recombinante produzido em clulas zucariticas
o fatorvlll
humano,,uma protena que tem uma funo entral na
coagulao sangnea. A forma mais
comum de hemofilia no homem resulta da incapacidade de
sinttizar tor vIII, o que leva
a uma intemrpo na rota de coagulao sangnea e
aos conhecidos sintomas associados a
essa doena.
At recentemente, a nica maneira de tratar a hemofilia era com
injees da protena fator
vIII purificada de sangue humano obtido de doadores. A purificaoo rutorvtu
um pro-

F
E

i:t
f

F.

Figura 14.5
O gene do fatorVlll e o
seu produto de traduo.

Cr-oruaeeu Grrce e ANLtsE oe

DNA

305

cedimento complexo e, por isso, o tratamento bastante caro. Para piorar a situao, o processo de purificao problemtico, especialmente no que diz respeito remoo
de partculas virais presentes no sangue. A hepatite e a AIDS podem ser, e j foram, transmitidas
a hemofilicos por injees de fator VIII. Assim, o fator VIII recombinante, livre de problemas de
contaminao, seria uma conquista importante para a biotecnologia.
O gene do fator VIII muito grande. Ele tem uma extenso de mais de 186 kb e est dividido em 26 xons e 25 ntrons (Figura 14.5a). O seu mRNA codifica um grande polipeptdeo
(com 2.351 aminocidos), que passa por uma srie complexa de eventos de procesiamento
ps-traduo, acabando por resultgr-eq uma protena dimrica, que consiste em uma subunidade maior, derivada da regio a rontjnte do polipeptdeo inicial, e em uma subunidade menor, derivada do segmento a jusante (Figura 14.5b). As duas subunidades contm um total de
17 pontes de dissulfeto e vrios stios glicosilados. Como pode ser antecipado para uma protena to grande e complexa, impossvel a sntese da sua verso recombinare ativa em E
coli.
Por isso, as tentativas iniciais para a obteno do fator VIII recombinante envolveram clulas de mamferos. Nos primeiros experimentos executados, o cDNA completo foi clonado
em clulas de hamster, mas o rendimento da produo da protena foi desapontadoramente
baixo. Isso provavelmente aconteceu porque os eventos ps-traduo, embora executados corretamente nas clulas de hamster, no converteram todo o produto inicial em uma forma ativa, comprometendo o rendimento final. Como alternativa, foram utilizados dois segmentos
separados obtidos a partir do cDNA, um codificando a subunidade polipeptdica maior e outro codificando a subunidade menor. Cada fragmento de cDNA foi ligado a um vetor de expresso, a jusante do promotor Ag (um hbrido entre seqncias de p-actina de galinha
e Bglobina de coelho) e a montante de um sinal de poliadenilao do vrus SV40
@gura la.6).
Os plasmdeos foram introduzidos em uma linhagem celular de hamstere obtidas as prote-

(a) O gene do

atorVlll

t4
I

somatotroina
lda

lnte.
,

Exons

lntrons

20 kb

Itir de genes clona-

(b) Pocessamento ps-taduo do ator Vlll

lintese de protenas

hos por eucariotos.

fticas o fatorVIII
hea. A forma mais
Eventos de processamento

lor VIII, o que leva


fumas associados a
i

bs da protena fator

htor VIII um pro-

:.

Figura 14.S
O gene do fator Vlll e o
seu produto de traduo.

Produto de traduo
primrio (2.351
aminocidos)

*c

-A

Protena ator Vlll madura

306

T. A. Bnowr.r

Thbela 14.1 A
dos em bactri:

cDNA do ator Vlll

Promotor Ag

Seqncia de
de SV40

Protena

Insulina
Somatostatina

Figura 14.6
Os sinais de expresso utilizados na produo do fator Vlll recombinante. O promotor um
hbrido artiicial de seqncias de B-actina de galinha e B-globina de coelho e o sinal de po'
liadenilao (necessrio para o processamento correto do mRNA antes de sua traduo em
protena) obtido do vrus SV40.

nas recombinantes correspondentes. O rendimento foi mais de l0 vezes superior quele obtido a partir de clulas contendo o cDNA completo e a protena fatorVIII resultante era funcionalmente indistinguvel da forma nativa.
A tecnologia mais recente para a produo do fator VIII envolve o pharming (p. 295). O
cDNA humano completo foi ligado ao promotor do gene suno da protena acdica do soro do
leite, levando sntese do fator VIII humano em tecido mamrio suno e subseqente secre-

o da protena no leite. O fator VIII produzido dessa maneira parece ser exatamente o mesmo que a protena nativa e inteiramente funcional em ensaios de coagulao sangnea.

14.1.4 Sntese de outras protenas humanas recombinantes


A lista de protenas humanas sintetizadas por tecnologia recombinante continua a crescer (Tabela l4.l). Alm das protenas utilizadas no tratamento de doenas por substituio ou suplementao da atividade das verses no-funcionais, a lista tambm inclui virios fatores de

Somatotrofila

FatorVIII
Fator D(

Interferon-cr
Interferon-p
Interferon-y
Interleucinas
Fator

estimuk

Fator de neco
Fator de crescir
Fator de crescir

Eritropoietina

Ativador de plz
Superxidodir
Protena surfac

ot,-antitripsina
Albumina sfic
Relaxina
Desoxirribonrx

crescimento (por exemplo, interferons e interleucinas) com potencial para utilizao na tera-

pia do cncer. Tais protenas so sintetizadas em quantidades muito limitadas no corpo, de


modo que a tecnologia recombinante representa a nica maneira vivel para a obteno das
mesmas nas quantidades necessrias para propsitos clnicos. Outras protenas, como a albumina srica, so mais facilmente obtidas, mas necessrias em quantidades to grandes que a
produo em microrganismos ainda uma opo mais atraente.

14.1.5 Vacinas recombinantes

i:

;
;
F

I
I
E

As grandr

em geral r
da hepatit

Produo d

A utilizao da

A categoria final

das protenas recombinantes um pouco diferente dos exemplos dados na


Tabela 14.1. Uma vacina uma preparao antignica que, depois de injetada na coente sangnea, estimula o sistema imune a sintetizar anticorpos que protegem o corpo contra uma in-

pecficos so s
tra componentr
das das proter

feco. O material antignico presente na vacina normalmente uma forma inativada do


agente infeccioso. Por exemplo, vacinas antivirais freqentemente consistem em partculas de
vrus que foram atenuadas por aquecimento ou por um tratamento similar. No passado, dois
problemas dificultaram a preparao de vacinas virais atenuadas.

identif,rcar e iru

(1)

(2)

cas de um detet

animais poderir
utilizao corn
e de serem obti,

O processo de inativao deve ser IOOVo efrciente, pois a presena na vacina de apenas
uma partcula viral viva j poderia resultar em infeco. Esse tem sido um problema para vacinas para a aftosa bovina.

Infelizment

porque as prote
des antignicas

Clorunoeu GNtcA

E Ar.rlrse

oe

DNA

907

Tabela 14'1 Algumas das-protenas humanas que foram


sintetizadas aparrirde genes clonados em bactrias e/ou clulas eucariticas ot por pharming
Protena

Utilizada no tratamento de

Insulina

Diabete
Anomalias no crescimento
Anomalias no crescimento

Somatostatina

Somatotrofina

Ante.Opromotorum

poelhoeosinaldepe

de sua traduo ent

i
faes

superior quele
resultante era

ti-

funcie

Io pharming (p. 295)- O


pena acdica do

soro&

pesubseqentesec
ser exatamente o

H-

VIII
Fator IX
Fator

Hemofilia

Interferon-cr
Interferon-B
Interferon-y
Interleucinas
Fator estimulador de colnia de granulcitos
Fator de necrose tumoral
Fator de crescimento epidrmico
Fator de crescimento de fibroblastos

Eritropoietina
Ativador de plasminognio tecidual
Superxido-dismutase

[agulao sangnea

Protena surfactante pulmonar

prtes
I

p continua a crescer (T*


substituio ou

sr4b

&
na E*.

inclui virios fatores


para utilizao

cr,-antitripsina

Albumina srica
Relaxina
Desoxirribonuclease

Doena de Christmas

Leucemia e outros cnceres


Cnceres, AIDS

Cnceres, artrite reumatide


Cnceres, enfermidades do sistema imune
Cnceres
Cnceres

lceras

lce.u.
Anemia
Ataque cardaco
Danos por radicais livres em
transplantes renais
Insufi cincia respiratria

Enfisema
Utllizada como um suplemento de plasma
Utilizada como auxiliar no parto
Fibrose cstica

limitadas no corgn-- &,


para a obteno dr:
protenas, como a db
to grandes qrcn

(2)

As grandes quantidades de partculas virais necessrias para


a produo de vacinas so
em geral obtidas a partir de culturas de tecidos. Infelizmente,
ugun, vrus, sobretudo o
da hepatite B, no se multiplicam nesse tipo de cultura.

Produo de vacinas como protenas recombinantes


A utilizao

dos exemplos dadorin


iiol"tuou nu corrente srF
p o corpo contra u'nf,foF
lma forma inavada &,

lnsistem em partculro&,
Fmitar. No passado, d;
I

[a

na vacina de apenc

hm sido
I

:-D

umproblemapr

da clonagem

gnica na reabaseia-se na descoberta de que


anticorpos vrus-especficos so s vezes sintetizados em resposta
no a toda a partcula virat, mas tambm contra componentes isolados do vrus. Isso particularmente
verdade para preparaes purificadas das protenas presentes no capsdeoiral (Figura
14.7).4; h;iesse possibilidade de
identificar e inserir em um vetor de expresso os genes
que codificam as protenas antignicas de um determinado vrus, os mtodos descrito-s
ant".iorm"nte p*u ,int"r. de protenas
animais poderiam ser empregados para a produo
de protenas rcombinantes passveis de
utilizao como vacinas, as quais teriam ai vantagens
d no conter partculas virais
e de serem obtidas em grandes quantidades.

intactas

Infelizmente, tal abordagem no tem sido aplicada


com inteiro sucesso, principalmente
porque as protenas de capsdeo recombinantes
muitas vezes no posru"-,odu, as propriedades antignicas do vrus intacto. uma experincia
bem-suceoida foi feita com o vrus da he-

308

T. A. Bnowlr

aa
a'a

lnjeo na corrent sangnea

a
Protenas de capsdeo
viral isoladas

ts

.C.t
r.

. o)--

P o:= )/

t/

Anticorpos especicos
contra a protena de
capsdeo

/ lnleco posterior por

um vrus completo

'

>.'3%
-{.tcrn
// tF
a}-

'l'$ :

;'"'

T['";ff."ffffii"

Figura 14.7
O princpio subjacente ao
uso de uma preparao
de protenas de capsdeo
viral isoladas como uma
vacina.

patite B, cuja protena de capsdeo (o "antgeno de superfcie principal") foi sintetizada em


Saccharomyces cerevisiae, utilizando um vetor baseado no plasmdeo de 2 pm (p. lag). A
protena foi obtida em quantidades razoavelmente elevadas e, quando injetada emmacacos,
protegeu os animais contra a hepatite B. Essa vacina recombinante j foi aprovada para utilizao em humanos.

Vacinas recom

bi

nantes vivas

O uso do vrus da vacnia vivo como uma vacina para a varola data de 1796, quando
Edward
Jenner descobriu que esse vrus, incuo para humanos, eracapazde estimular imunidade
contra o vrus da varola, muito mais perigoso. O termo "vacina" vem de vacnia; o seu
uso resultou na erradicao mundial da varola em 1980.

Uma idia mais recente considera que vrus de vacnia recombinantes poderiam ser usados como vacinas vivas contra outras doenas. Se um gene codificando uma protena
de capsdeo viral, como, por exemplo, o antgeno de superfcie principal da hepatite B, for
ligado ao
genoma de vacnia sob o controle de um promotor do prprio vrus, ele ser expressdo
1pigura 14.8). Aps injeo na corrente sangnea, a replicao do vrus recombinante
resulta
no apenas em novas partculas de vacnia, mas tambm em quantidades significativas
do antgeno de superfcie principal. O resultado disso o desenvolvimento de imunidade tanto
contra varola quanto contra hepatite B.
Essa tcnica notvel tem um potencial considervel. Vrus de vacnia recombinantes
expressando vrios genes exgenos j foram construdos e se demonstraram capazes
de confe-

Figura t4-O
O princpio subjacente ao uso potencial de um vrus de
vacnia recombinante.

rir imunid

possibilid
o de qu
do vrus d

rus do her
quesio il

logia viral
fera por n

14.2 ldentiir

doena

Uma segu
grande
14s. fJma
cfico (Tat
sio ao d
hereditria

iq

Cr-orunceu Grurcn e Arur-lse oe

Promotor

vacnia

de
-- _ ,/-

z\
l

DNA

30g

Gene do antgeno de superfcie


principal da hpatite B

---

/\

/
de vacnia

---_\

Genoma
recombinante

tnjeo das partcutas de vacnia


recombinates na corrente sangnea

protena da
hepatite B

O sistema imune
sintetiza anticorpos
tanto contra vacnia
como contra hepatite B

14.7
pio subjacente ao
de uma preparao
protenas de capsdeo
isoladas como una

nl") foi

Figura 14.8
O princpio subjacente ao uso potencial de um vrus de
vacnia recombinante.

%.

Y=

Vrus de vacnia

Antivacnia
Anti-hepatite B

sintetizada en

de 2 pm (p. 140). A
o injetada em macacosi
foi aprovada para utili-

?1196, quando Edward


fimular imunidade conlracnia; o seu uso resul-

rir imunidade contra as doenas correspondentes


em animais experimentais (Thbela
l4.z). A
possibilidade do desenvolvimento de vcinas
de amplo espectro surge a partir da
demonstrao de que um nico vrus de vacnia recombinante,expressando
os genes da hemaglutinina
do vrus da gripe, do antgeno de superfcie
principal aa hepatite Be glicoprotena
do vrus do herpes simples, confere imunidade
u
u-u d"rru, d";;;* em macacos. uma
questo importante que agora deve ser
"ont "du
respondida
se sabemos o ,un"nr" a respeito
da biologia viral para estarmos certos de que
a liberao de vrus a" ua"rnia.e"ombinantes
na
bios_
fera por meio de programas de vacinao
pode ser permitida.

btes poderiam

b u.u

ser usa-

protena de

cap

lepatite B, for ligado ao


He ser expressado

(E-

b recombinante resulte
fes significativas do anle imunidade tanto conI

hia recombinantes extam capares de confe-

1t
I

ii

14.2 ldentifica.o de genes responsveis por


doenas humana
uma segunda irea importante de pesquisa
mdica na qual a cronagem gnica
vem tendo um
grande impacto na identificao-e
n isolameno de glnes r"rporau"i, por
doenas huma_
nas. uma doena gentica ou h_ereditria
aquela cauJada pr, il;;;ro
em um gene espe_
cfico (Tabela r4.3), com os indivduos portaores
dogeneefe"ri* upr"r"ntando predispo_
sio ao desenvolvimento da doena
utgu estg de suas vidasim algumas
doenas
hereditrrias, como a hemofilia, o g"n" "fr"r"nt" no cromossomo X, de modo que homens
"tta

310

T. A. Bnowr.r

quanto as doq
cam a segundar
pecialmente e4
que seu incio s
Posio 4 teis d

Tbela 14.2 Alguns dos genes exgenos que foram expressados em vrus de
vacnia recombinantes
Gene

Antgeno de superfiier\ Plasmodiumfalciparum (o parasito da malria)

cuidadosa rea
sencadeameo
As doenas
tncia das mesr
vacinao, c a

Protenas de capsdeo do |rus da gripe


Protena G do vrus daaiva

Antgeno de superficie principal da hepatite B


Glicoprotenas do herpes simples

doenas infecci

Potenas de envoltrio do vrus da imunodeficincia humana (HIV)

alta mortalidad
lao morre agt
nifestao ta
pesquisa mdic

Protenas de capsdeo do vrus da estomatite vesicular


Protenas do vrus Sindbis

igualmente ex
Existem in

Tabela 14.3 Algumas das doenas genticas mais comuns no Reino Unido

doenas

Freqncia
(nascimentos por ano)

Doena

Sintomas

Cncer de mama hereditirio

Cncer

Fibrose cstica

Doena pulmonar

I a cada 300 mulheres


I em 2.000

Coria de Huntington

Neurodegenerao

Distrofia muscular de

Fraqaeza muscular
progressiva

I em 3.000 homens

HemofiliaA

Hemopatia

Anemia falciforme

Hemopatia

Fenilcetonria

Retardo mental

l em 10.000
l em 12.000

B-talassemia

Hemopatia

Retinoblastoma

Cncer ocular

Hemofilia B

Hemopatia

Doena de Tay-Sachs

Cegueira, perda de

I em 20.000
I em 25.000 homens
I em 200.000

Duchenne

(1)

permitid
nejaruml

ditm1

ber acoog

ncaog
a doena

em 4.000 homens

controle motor

(3)

o clnto

A idntifi

14.2.1 Como iden

NO existe E

lhor abordagen
preender oa pri

difcil. Esse co
mas pessoas so

dem
portadores do gene expressam os sintomas da doena; mulheres com um gene defectivo e um
gene correto so saudveis, mas podem transmitir a doena para a sua prognie do sexo masculino. Genes de outras doenas esto presentes em autossomos e, na maioria dos casos, so
recessivos, de modo que ambos os cromossomos do par devem portar a verso defectiva para
a ocorrncia da doena; algumas poucas doenas, inclusive a coria de Huntington, so autossmicas dominantes, de forma que uma nica cpia do gene defectivo suficiente para provocar a manifestao da doena.
Em algumas doenas genticas, os sintomas manifestam-se precocemente durante a vida
do indivduo afetado. Em outras, os sintomas podem no ser expressados antes que o indivduo atinja a meia-idade ou a velhice. A fibrose cstica um exemplo do primeiro caso, en-

A identifi

(2) Aidentif

em 2.000

em 20.000

gen

levarla

Localizandr
Se no hinfu
do genoma hu

para que possa

no. O mapeam

comparao &
cos cujas pos(
estar muito pr
recombinao

Ct-oruaoeu GNrcA E Ar.rlrse oe

DNA

31

quanto as doenas neurodegenerativas, como as de Alzheimer e a de Huntington, exemplificam a segunda situao. Em diversas patologias que parecem ter componentes genticos, especialmente em cnceres, a sndrome global complexa e a doena pernanece dormente at
que seu incio seja desencadeado por algum estmulo metablico ou ambiental. Se a predisposio a tais doenas pudesse ser diagnosticada, seria possvel reduzir o fator de risco pela
cuidadosa readequao do estilo de vida do paciente, de modo a minimizar as chances de desencadeamento do processo patolgico.
As doenas genticas sempre estiveram presentes nas populaes humanas, mas a importncia das mesmas vem crescendo em dcadas recentes. Isso ocorre porque os programas de
vacinao, os antibitios e a melhoria das condies sanitirias reduziram a prevalncia de
doenas infecciosas, como a varola, a tuberculose e a clera, que erm responsveis por uma
alta mortalidade no incio do sculo XX. O resultado disso que uma maior parcela da populao morre agora de doenas que tm componentes genticos, especialmente aquelas de manifestao tardia, que agora so mais comuns devido ao aumento da expectativa de vida. A
pesquisa mdica foi bem-sucedida no controle de muitas doenas infecciosas; poder ela ser
igualmente exitosa no controle de doenas genticas?
Existem inmeras razes que tornam importante a identificao de genes responsveis por
doenas genticas.

por ano)

(1)

cada 300 mulheres

(2)

2.000

2.000
3.000 homens
4.000 homens

(3)

10.000

A identificao do gene pode fornecer uma indicao

da base bioqumica da doena,


permitindo a elaborao de estratgias teraputicas.
A identificao da mutao presente em um gene defectivo pode ser utilizada para planejar um programa de triagem, de modo a identificar a presena do gene mutante em indivduos poadores que ainda no desenvolveram a doena. Os portadores podem receber aconselhamento a respeito das chances de seus filhos herdarem a doena. A identificao precoce da forma mutante do gene em indivduos que ainda no desenvolveram
a doena permite que sejam adotadas precaues para reduzir o risco de sua manifestao clnica.
A identificao do gene um pr-requisito para a terapia gnica (p. 31a).

12.000

14.2.1 Como identiicar um gene responsvel por uma doena gentica

20.000
20.000
25.000 homens
200.000

um gene defectivo eum


prognie do sexo masmaioria dos casos, so
a verso defectiva Pan

Huntington, so autoe suficiente para Pr>


durante a vide
$aOos antes que o

indi-

plo do primeiro caso, eF

No existe uma estratgia nica para a identificao de genes que causm doenas, pois a melhor abordagem depende das informaes disponveis a respeito de cada patologia. Para compreender os princpios desse tipo de trabalho, ser considerado o cenrio mais comum e mais
difcil. Esse cenirio ocoffe quando tudo o que sabemos a respeito de uma doena que algumas pessoas sofrem dela. Mesmo com um ponto de partida to vago, as tcnicas de DNA podem levar localizao do gene relevante.

Localizando a posio aproximada do gene no genoma humano


informao a respeito do gene desejado, como ele pode ser localizado naseqncia
do genoma humano? A resposta a essa questo o retorno aos princpios genticos bsicos,
para que possa ser determinada aproximadamente a posio do gene no mapa gentico humano. O mapeamento gentico geralmente executado por anlise de ligao, que envolve a
comparao do padro de herana do gene-alvo com os padres de herana de lcus genticos cujas posies no mapaj so conhecidas. Se dois lcus so herdadosjuntos, eles devem
estar muito prximos um ao outro no mesmo cromossomo: se esse no o caso, eventos de
recombinao e a segregao aleatria dos cromossomos durante a meiose resultaro em lSe no h

312

T. A. Bnowru

cus que apresentm diferentes padres de herana (Figura 14.9). A demonstrao de ligao
com um ou mais lcus genticos mapeados , portanto, a base para a determinao da posio cromossmica de um gene no-mapeado.
Com a espcie huma2a-n(o possvel a realizao de programas de cruzamentos dirigidos, visando determiao $h posio de mapa de um gene desejado. Em vez disso, o mapeamento de genes associads a doenas deve utilizar os dados disponveis a partir de anlises depedigree, nas quais a herana do gene examinada em famlias com uma alta inci-

dncia da doena que est sendo estudada. E importante que seja vivel
amostras de DNA de pelo menos trs geraes de cada famlia - e quanto maior for o nmero de membros de uma famflia estudados a cada gerao, melhor. Via de regra, possvel encontrar pedigrees adequados, a menos que a doena seja muito incomum. A ligao
entre a presena/ausncia da doena e a herana de outros genes pode ser estudada, mas,
a obteno de

sendo possvel
marcadores de

Para ilustra
nes relacionad
ocorreu em 19

fragmentos&

Berkeley. O es
mero significa

chamadaDITS
mo 17 (Figura
no brao longo

tremamente im
ne do cncer dl
to, acredita-se
Portanto, o pr
nar BRCAI

l l

(b) Os genes esto em

cromossomos dierentes

ollo

"llo ollo "ll,

Isso foi cor


peties cutas
la mais precisa
alelos possvei
em um mesmo
mapeamento d
BRCAI de 20 I
um gene deo

(a) Os genes esto ligados

Figura 14.9
l3

(c) Os genes esto no mesmo


comossomo, mas distantes
um do outro

t l;

olo

Produto de
recombinao

t;

Padres de herana
para genes ligados e
no-ligados. Trs am
lias so mostradas,
com os crculos representando indivduos do
sexo eminino e os
quadrados representando indivduos do sexo masculino. (a) Dois
genes com ligao estreita so quase sempre herdados em conjunto. (b) Dois genes
em dierentes cromossomos apresentam segregao aleatria. (c)
Dois genes em um
mesmo cromossomo,
mas distantes um do
outro, so reqentemente herdados juntos, mas eventos de recombinao podem separ-los.

Mapeamento do gen
mama. lnicialmente, o g
do em um segmento de
mossomo 17 (regio real
nho esquerda). Experil
peamento adicionais res
segmento a uma regio r
queada por dois lcus pn
peados, D1751321 e D|,
nho central). Aps o r
qncias expressadas,
um orte candidato a ser

Cloruroeu GNrcA

pnstrao de ligao
bterminao da posicruzamentos dirigi,Em vez disso, o maveis a partir de ans com uma alta inci-

rivel a obteno de
tanto maior for o nVia de regra, poss-

,incomum. A ligao

le ser estudada, mas,

lura

E ANLtsE

oe

DNA

sendo possvel a anlise de amostras de DNA, geralmente preferida a anlise de ligao a


marcadores de DNA (p.262).
Para ilustrar como a anilise de ligao atilizada, ser visto brevemente como um dos genes relacionados ao cncer de mama humano foi mapeado. O primeiro avano desse projeto
ocorreu em 1990, como resultado de anlises de ligao de polimorfismos de tamanho de
fragmentos de restrio (RFLP) executadas por um grupo da Universidade da Califrnia em
Berkeley. O estudo mostrou que, em famflias com alta incidncia de cncer de mama, um nmero significativo de mulheres que sofriam da doena possua a mesma verso de uma RFLP,
chamada Dl7574.Essa RFLP havia sido previamente mapeada no brao longo do cromossomo 17 (Figura 14.10): o gene buscado - BRCAL - deveria, portanto, tambm estar localizado
no brao longo do cromossomo 17. Esse resultado inicial da anlise de ligao mostrou-se extremamente importante, pois indicou em qual regio do genoma poderia ser encontrado o gene do cncer de mama, embora ainda estivesse longe de indicar a sua localizao exata. De fato, acredita-se que mais de 1.000 genes estejam nessa poro de 20 Mb do cromossomo 17.
Portanto, o prximo objetivo era arealizao de mais estudos de ligao para tentar posicionar BRCA| com maior preciso.
Isso foi conseguido inicialmente pelo exame da regio contendo BRCAI em busca de repeties curtas em tandem (STRs) (p.262).As STRs so teis para o mapemento em escala mais precisa porque muitas delas existem em trs ou mais formas allicas, em vez dos dois
alelos possveis para uma RFLP. Portanto, vrios alelos de uma STR podem estar presentes
em um mesmo pedigree, o q\e viabiliza a execuo de um mapeamento mais detalhado. O
mapeamento de ligaes de repeties curtas em tandem reduziu o tamanho da regio de
BRCAI de 20 Mb para apenas 600 kb (Figura 14.10). Essa abordagem para a localizao de
um gene denominada clonagem posicional.

14.9

hres de herana
ha genes ligados e
lo-ligados. Trs fam
b so mostradas,
iln os crculos reprebntando indivduos do
Ero eminino e os
padrados represenlrdo indivduos do seb masculino. (a) Dois
pres com ligao esEita so quase semire herdados em connto. (b) Dois genes
;n dierentes cromosDos apresentam sepegao aleatria. (c)
lois genes em um
nesmo cromossomo,
ms distantes um do
[tro, so reqentenente herdados junDS, mas eventos de reDnbinao podem s+

nr-los.

313

I
Figura 14.10
Mapeamento do gene do cncer de
mama. lnicialmente, o gene oi mapeado em um segmento de 20 Mb do cromossomo 17 (regio realada no desenho esquerda). Experimentos de mapeamento adicionais restringiram esse
segmento a uma regio de 600 kb lanqueada por dois lcus previamente mapeados, D1751321 e D1751325(desenho central). Aps o exame das seqncias expressadas, foi identiicado
um forte candidato a ser BBC (desenho direita).

D17s74-[,..

I
I
Cromossomo 17
(80 Mb)

|""",

314

T. A. Bnowr,r

ldentificao de candidatos a genes responsveis por doenas

reta do

u^attdeterminada a posio do gene no mapa, poderia-se imaginar que a prxima

de qualq

etapa

seria simplesmente analisar a seqncia do genoma para identificar o gene procurado.


Infelizmente, ainda resta uma grande quantidade de trabalho a ser feita, pois o mapeamento
gentico' mesmo na sua forma mais precisa, d apenas uma indicao aproximadaa
localizao do
gene. No projeto cncer de mama, os pesquisadores tiveram sorte de
conseguir reduzir-area
de busca para apenas 600 kb; freqentemente, uma extenso de l0 Mb
ou mais de seqncia
de DNA deve ser examinada. Esses longos segmentos de DNA podem conter
muitos genes:
os 600 kb da regio do cncer de mama contm mais de 60 genei e qualquer
um deles pode-

rjaser BRCAI.
Virias abordagens podem ser empregadas pa.ra identificar qual dos genes da regio
ma-

peada responsvel pela doena.

(1)

(2)

(3)

Os perhs de expresso dos genes-candidato podem ser examinados por anlise


de hibridizao ou por transcrio reversa-reao em cadeia da polimerase
6r-ecn; (p. 230) de
RNA de diferentes tecidos. poderia-se esperar que BRCAI, por exemplo, hibridizasse
com RNA preparado a paftir de tecido mamirio e tambm com RNA de tecido ovariano,
pois cncer de ovirio freqentemente est associado a cncer de mama.

uma anlise por hibridizao de Southem (p. 206) pode ser executada com DNA de di_
ferentes espcies (os chamados zoo blots). A base disso que um gene humano
impor-

tante quase que certamente ter homlogos em outros mamferos e esses homlogos,
embora tendo seqncias um pouco diferentes da verso humana, sero detectveis
por
hibridizao com uma sonda adequada.
As seqncias dos genes podem ser examinadas em indivduos com e sem a doena, para verificar se os genes de indivduos afetados contm mutaes capues
de explicar

ior

(4)

que eles tm a doena.


Para confirmar a identidade de um gene-candidato, pode ser possvel preparar-se
um camundongo-nocaute (p.269), que possui uma verso inativa do gene correspondente.
se
o camundongo-nocaute apresentar sintomas compatveis com a doena humana,
ento
o gene-candidato quase que certamente o correto.

Quando aplicado regio do cncer de mama, esse tipo de anlise resultou na identificao de um gene de aproximadamente 100 kb, que um iorte candidato a ser BRC1. Ele
formado pot 22 xons e codifica uma protena de 1.863 aminocidos. Transcritos
do gene foram detectados em tecidos mamirio e ovariano e genes homlogos a
ele esto pr"rJnt",
camundongos, ratos, coelhos, ovelhas e porcos, mas no em galinhas.
E, mais iportante, "*
os
genes de cinco famflias suscetveis continham mutaes (como
mutaes de muana de fase ou sem sentido), que provavelmente levam a uma protena
no-funcional. Embora circunstanciais, as evidncias em suporte do candidato foram suficientemente
convincentes paa que
esse gene fosse identificado como sendo BRC1.

examina

cas envo

14.3.1 Terapii
Existem

terapia d
uma cp
for bemresultant
clula-or
hereditrr

A ter

las que p
po. Essa

talassem

dula

ssr

consiste
tar essas

qente n
sente en
viral q

permite
o novo

ter

monares
do

emli;

duo nr

apenas d

eficiente
Para

dificar u

remoo
gentica
quadm p

mas tam

que pror

modo qr

uma tcl

aplica

14.3 Terapia gnica


A aplicao final da tecnologia de DNA recombinante na medicina que ser aqui
considerada a terapia gnica. Esse o nome que foi originalmente dado
utodo, que tm por

objetivo a cura de uma doena hereditria pela introduo, no paciente,


de um cpia cor-

14.3.2 Terapi
A utiliza
J foram

feco d
sa mais i

)
Cr-orecev Gr'ircn e ANLtsE oe

[oenas
Ique a prxima etapa

procurado. InfelizImapeamento gentihda da localizaco do

fsegui, reduzir

a rrea

bu mais de. seqncia


ponter murtos genes:
Suer um deles podeI

da regio ma-

Is"n",
I

ir por anlise de

hibri-

knr-pcn) (p.230) de
[emplo, hibridizasse
[A de tecido ovariano,

h*u.

hdu.o-

DNA de di-

humano impor[gene
e
esses
homlogos,
I
detectveis por

fro

,"*

in

"
pzes

a doena, pade explicar por

lr"p*ar-se um cacorrespondente.
Se
fe
humana,
ento
Sna
fel

i
r

huttou

na identifica-

I ,", BRCA\.Ele
u

pnscritos do gene foesto presentes em


mais
importaxte, os
I
de
mudana
de faS
Je

hd. Embora circunsfonvincentes para que


t

l
t

f" *.u

aqui consideptodos que tm por


l, de uma cpia cor-

DNA

315

reta do gene defectivo. O conceito de terapia gnica foi agora estendido para incluir a
cura
de qualquer doena pela introduo de um gene clonado no paciente. Primeiramente,
sero
examinadas as tcnicas utilizadas na terapia gnica e depois sero tratadas as questes ticas envolvidas.

14.3.1 Terapia gnica para doenas hereditrias


Existem duas abordagens bsicas para a terapia gnica: a terapia de linhagens germinais e a
terapia de clulas somticas. Na terapia de linhagens germinais, um vulofecundudo recebe
uma cpia da verso correta do gene relevante e reiLptantado na me. Se o procedimento
for bem-sucedido, o gene estar presente e ser expressado em todas as clulas do indivduo
resultante. A terapia de linhagens germinais geralmente feita pela microinjeo de DNA na
clula-ovo isolada (p. 11 1) e, teoricamente, poderia ser utilizada para ftatar qualquer doena
hereditria.
A terapia de clulas somticas envolve a manipulao de clulas comuns, em geral aquelas que podem ser removidas do organismo, transfectadas e depois colocadas de volta no corpo. Essa tcnica mais promissora para hemopatias hereditirias (por exemplo, hemofilias e
talassemias), com o tratamento sendo feito pela introduo de genes em clulas-tronco da medula ssea, que do origem a todos os tipos celulares especializados no sangue. A estratgia
consiste em preprrar um extrato de medula ssea contendo virios bilhes de clulas, transfectar essas clulas com um vetor de tipo retroviral e depois reimplantJas no paciente. A subseqente replicao e diferenciao de transfectantes faz com que o gene adicionado esteja presente em todas as clulas sangneas maduras (Figura 14. I 1). A vantagem de um vetor retroviral que tal tipo de veculo tem uma freqncia de transfeco extremamente alta, o que
permite que uma grande proporo das clulas-tronco em um extrato de medula ssea receba
o novo gene.
A terapia de clulas somticas tambm tem potencial para o tratamento de doenas pulmonares, como a fibrose cstica, pois DNA clonado em vetores adenovirais (p. 160) ou contido em lipossomos (p. 155) pode ser incorporado por clulas epiteliais pulmonares aps introduo no trato respiratrio por meio de um inalador. Entretanto, a expresso do gene ocorre
apenas durante poucas semanas e, at agora, essa estratgia ainda no considerada um meio
eficiente para o tratrmento da fibrose cstica.
Para aquelas doenas genticas cuja patologia surge em funo de o gene mutado no codificar uma protena funcional, necessirio fornecer clula uma verso correta do gene: a
remoo dos genes defectivos no necessria. A situao mais complicada para doenas
genticas dominantes (p. 31 l), pois, nelas, o produto do gene defectivo que rsponde pelo
quadro patolgico, de modo que a terapia deve incluir no somente a adio do gene
correto,
mas tambm a remoo da verso defectiva. Isso requer um sistema de transferncia
do gene
que promova a recombinao entre a cpia fornecida pelo vetor e a cpia cromossmica,
de
modo que a cpia cromossmica defectiva seja substituda pelo g"n" do vetor. Trata-se
de
uma tcnica complexa e inconfivel, no tendo ainda sido desenvolvidos procedimentos
de
aplicao mais amplos para ela.

14.3.2 Terapia gnica e cncer


A utilizao clnica da terapia gnica no est limitada ao tratamento de doenas hereditirias.
foram feitas tentativas de utilizao da clonagem gnica para a interrupode ciclos de infeco de patgenos humanos, como o vrus da AIDS. Contudo, atualmente, a fuea depesquiJ

sa mais intensiva na terapia gnica est relacionada sua

utilizao no tratamento do cncer.

316

T. A. Bnowlr

desenvolvim

Clula-tronco isolada

Novo gene

o
'

do seja incorl

Uma nova
matasse seleti

eficiente pa
compreenso
e

da. So

Transeco

conh

em um tunx)
O aspecto bs
s clulas ca
um sistema

expressado 4r

@
Reimplante

motor que a
Umaoumr

"u,,,",

temaimune

nos teoricam
fortes, que s
muitas outras
ta contra o c

aasoriro

/..3

\.t/

Eosinrito

14.3.3 As quest

Neutrilo

Figura 14.11
Moncito

Todas as clulas maduras


contm o novo gene

A diferenciao de
uma clula-tronco
transfectada faz
com que o novo
gene esteja presente em todas as
clulas sang
neas maduras.

A terapia gni
tes ticas, es
jeo justific

ne da fibrme I

dula so aceiti
mopatias porl
rvel que a rc

criticvel com
Por outro I

quesio. O prr
doenas hered

A maioria dos cnceres resulta da ativao de um oncogene que leva formao


de um tu-

mor ou inativao de um gene que normalmente suprime u ro fo.-uo.


Em ambos os casos, pode-se considerar a terapia gnica para o tratamento do cncer. A
introduo de um gene que codifica uma cpia de RNA anti-senso (p.32D de um oncogene
poderia, po.
plo, reduzir ou impedir a expresso do oncogene e reverter a sua atividad
"*_
tumorognica.
Se
o cncer causado pela inativao de um gene supressor de tumor,
a terapia gnica iria envolver a introduo de uma verso ativa daquele gene. O maior obstculo no
momento no a
identificao dos genes apropriados parautilizao na terapia gnica do
cncer, mas, sim, o

o, nessas

senvolvimenta
ntica" mas, si

plo, alterae
pulao, no

hereditiri4
dificil amaniF
e

solucionafuso
dzds dg sansr

Cr-oruacev Guca e ANLtsE oe

DNA

317

desenvolvimento de mtodos de administrao adequados, que assegurem que o gene clonado seja incorporado pelas clulas cancerosas.
Uma nova aplicao da terapia gnica para o cncer seria a introduo de um gene que
matasse seletivamente clulas cancerosas. Essa abordagem considerada como a mais geral
e eficiente para o tratamento de muitos tipos de cncer, principalmente porque no requer
uma
compreenso detalhada das bases genticas da doena que est sendo especificamente tratada. So conhecidos muitos genes que codificam protenas txicas e a introduo de um deles
em um tumor deveria resultar na morte das clulas cancerosas e na recuperao do paciente.
O aspecto bsico dessa estratgia que o gene clonado deve ser direcionado especificamente
s clulas cancerosas, para que clulas saudveis no sejam atingidas e mortas. Isso exigiria
um sistema de administrao bastante acurado ou algum meio de assegurr que o gene fosse
expressado apenas nas clulas cancerosas, por exemplo, colocando-o sob controle de um promotor que ativo apenas naquelas clulas.
Uma outra abordagem utllizaaterapia gnica para aumentar a eficincia com a qual o sistema imune do paciente naturalmente mata as clulas cancerosas. Isso pode ser feito, pelo menos teoricamente, com um gene que faa com que as clulas tumorais sintetizem antgenos
fortes, que so eficientemente reconhecidos pelo sistema imune. Todas essas abordagens e
muitas outras que no so baseadas em terapia gnica esto sendo atualmente testadas na luta contra o cncer.

14.3.3 As questes ticas provocadas pela terapia gnica

:
(

Fgura 14.11

dierenciao de

Lna clula-tronco
hansectada az
bm que o novo
fene esteia prebnte em todas as
llulas sang
bas maduras.
!

i
fonnaao de um tuL Em ambos os capduo de um ge-

poderia, por exemI tumorognica. Se

:^.

lgenlca rna envolmomento no a


ncer, mas, sim, o
D

li'

A terapia gnica deve

ser utilizada na cura de doenas humanas? Como muitas outras questes ticas, essa pergunta no tem uma resposta simples. Certamente no haveria qualquer objeo justif,rcvel rotina de aplicao, via um inalador respiratrio, de verses corretas
do gene da fibrose cstica para tratamento dessa doena. Da mesma forma, se transplantes de me-

dula so aceitveis, fica dificil argumentar contra terapias gnicas destinadas correo de hemopatias por meio de transfeco de clulas-tronco. Ademais, o cncer uma doena to terrvel que a recusa de mtodos de tratamento eficientes por motivos morais seria ela mesma
criticvel como imoral.
Por outro lado, a terapia de linhagens germinativas representa um aspecto mais difcil da
questo' O problema que as tcnicas utilizadas para a coffeo, em linhagens germinais, de
doenas hereditirias so exatamente as mesmas que poderiam ser utilizadas par a manipulao, nessas mesmas linhagens, de quaisquer outras caractersticas hereditirias. De fato, o desenvolvimento dessa tcnica para animais no foi feito visando cura de qualquer doena gentica, mas, sim, com o objetivo de "melhorar" animais domsticos, prouzindo, por exemplo, alteraes genticas que resultem em um menor contedo de gordura. Tal tip de manipulao, no qual a constituio gentica de um organismo alterada de uma
-uni.a dirigida
e hereditria, claramente inaceitvel para humanos. Atualmente, problemas
tcnicos tornam
difcil a manipulao de linhagens germinais humanas. Antes de problemas como esses serem
solucionados, deveramos nos assegurar de que o desejo de fazer o bem no trar a possibilidade de causar um mal muito maior.

Cnprulo 15
coli of

Clonagem Gnica e Anlise de


DNA na Agricultura

DNA sequence

l
synthesized genes

synthesized gene for

atual do desenvolvimenovarian cancer suscepti-

factorVIII in milkOxford. [Contm


gnica.l (Publicado em
A estratgia de adio de um gene na engenharia
gentica vegetal, 320

Problemas com vegetais geneticamente modifi cados,

330

A subtrao de genes, 324

A agriculhrra, ou, mais especificamente, o cultivo de plantas, a mais antiga biotecnologia do


mundo, com uma histria connua que se estende para mais de 10.000 anos. Durante todo esse perodo, os homens tm constantemente procurado melhorar as variedades de suas culturas: variedades com melhores qualidades nutricionais, maior rendimento, ou caractersticas
que auxiliam no seu cultivo e colheira. Durante os primeiros milnios, as melhorias nas lavouras ocorerm de uma maneira espordica, mas, nos ltimos sculos, novas variedades foram
obtidas por meio de programas de cruzamento cada vez mais sofisticados. No entanto, o programa de cruzamento mais sofisticado ainda retm o elemento do acaso, dependendo dele para que ocorra a unio aleatria das caractesticas parentais na descendncia hbrida que produzida. O desenvolvimento de uma nova variedade de cultura, apresentando uma combinao
precisa das caractersticas desejadas, um processo longo e difcil.
A clonagem gnica fornece uma nova dimenso para os cruzamentos na agricultura, por
possibilitar que modificaes direcionadas sejam realizadas no gentipo da planta, enganando o processo aleatrio, inerente dos cruzamentos convencionais. Duas estratgias gerais so
utilizadas:

(1)

A adio de um gene, na qual a clonagem utilizada para alterar as caractersticas

(2)

uma planta por fornecer a ela um ou mais genes.


A subtrao de um gene, na qual tcnicas de engenharia gentica so utilizadas para
inativar um ou mais genes existentes na planta.

de

Inmeros projetos esto sendo realizados em todo o mundo, muitos por companhias biotecnolgicas, objetivando a explorao do potencial da adio ou da subtrao gnica na melhoria das culturas. Neste captulo, ser investigada uma seleo representativa desses projetos, bem como analisados alguns dos problemas que devem ser resolvidos, caso a engenharia
gentica vegetal seja amplamente aceita na agricultura.

32O

T. A. Bnowlr

15.1 A estratgia de adio de um gene na engenharia


gentica vegetal
A adio de um gene envolve

a utilizao de tcnicas de clonagem para introduzir em uma


planta um ou mais genes novos, que codificam caractersticas teis que a planta no possui.
Um bom exemplo da tcnica fomecido pelo desenvolvimento de plantas que resisrcmo a12que de insetos por meio da sntese de inseticidas codificados pelos genes clonados.

15.1.1 Plantas que produzem os seus prprios inseticidas


As plantas esto sujeitas predao por praticamente todos os demais tipos de organismos
vrus, bactrias, fungos e animais -, mas, em termos de agricultura, os maiores prlemas so
causados por insetos. Para reduzir as perdas, as culturas so regularmente vaporizadas com inseticidas. A maioria dos inseticidas convencionais (p. ex., piretrides e organofosfatos) um
veneno relativamente no-especfico, que mata uma ampla variedade de insetos, no apenas
aqueles que devoram as lavouras. Devido sua elevada toxicidade, virios desses inseticidas
tambm possuem efeitos colaterias extremamente perigosos pra os outros membros da biosfera local, incluindo, em alguns casos, o homem. Tais problemas so intensificados pela necessidade de aplicao de inseticidas convencionais nas superfcies das plantas por intermdio de vaporizao, o que significa que os deslocamentos subseqentes dos proutos qumicos no ecossistema no podem ser controlados. Alm disso, insetos que vivem dentio das
plantas, ou nas partes de baixo das folhas, podem, algumas vezes, escapa.r totalmente dos efeitos txicos.
Quais as caractersticas que um inseticida ideal deveria apresentar? Certamente ele dever ser txico aos insetos contra os quais direcionado, mas, se possvel, essa toxicidade deveria ser altamente seletiva, de forma que o inseticida fosse inofensivo para os demais insetos e
no venenoso aos animais e aos homens. O inseticida deveria ser biodegradvel, de forma que
qualquer resduo que pennanecesse aps a colheita da cultura, ou que fosse arrastado para
longe da plantao pela chuva, no permanecesse por um longo perodo para no prejudicar
o meio ambiente. Alm disso, deveria ser possvel aplicar o inseticida de tal maneiru qu"
todas as partes da planta, no somente suas superfcies superiores, fossem protegidas
contra o
ataque dos insetos.
O inseticida ideal no foi ainda descoberto. O mais prximo que se tem so as -endotoxinas produzidas pela bactria do solo Bacillus thuringiensis.

As -endotoxinas de Baciilus thuringiensis


Os insetos no comem apenas plantas: as bactrias tambm constituem uma parte ocasional
da sua dieta. Em resposta, vrios tipos de bactrias desenvolveram mecanismos
de defesa contra a predao dos insetos, um exemplo sendo B. thuringiensis, a qual, durante a esporulao,

forma corpos cristalinos intracelulares que contm uma protena inseticida chamaa
-enOotoxina' A protena ativada altamente venenosa aos insetos, algo 80.000 vezes mais txico

que os inseticidas organofosfatos, e relativamente seletiva. Diferentes linhagens


de bactria
sintetizam protenas efetivas contra as larvas de diferentes grupos de insetos (Tabela 15.1).
A protena -endotoxina que se acumula na bactria um piecursor inativo. Aps a ingesto pelo inseto, essa pr-toxina clivada por proteases, resultando em verses
mais curtas da
protena que apresentam a atividade txica, ligando-se na parte interna do intestino
do inseto

Tabela 15.1

B. thuringiensi

Tipo de &endr

CryI

CrytI
CTyIII

CryIV
CryV

CryVI

danificando

qentemente, r
em diferentes 1
dades apresenr

As toxinas,
ra a sua

utilizr

ocorreram vri
mas suas biode
veriam ser rci{
custos do agric
tem de reaplic
247), modifica
abordagem

Clonando u

O milho consti

convencionais.
dentro da plant
escapando dos
teno dessa g
realizada pelos
Eles trabalhara
da serumapml

to situado entrr
ba-Geigy cons

sntese gnica a
ra melhorar a s

artificial foram

pares GC do ge

so bacteriana I

(p 285), entre

Ct-onnceu Gr.rrcr e ANLtsE

haria

que resistem ao ata-

clonados.

5
foos de organismos piores problemas so
ivaporizadas com inbrganofosfatos) um
b insetos, no apenas
bs desses inseticidas
membros da biosios
tsnsificados pela ne-

plantas por interm-

ldos produtos qumifue vivem dentro des


totalmente dos efei-

Frrtamente ele deveessa toxicidade devea os demais insetos e

advel, de forma que


fosse arrastado para
l para no prejudicar
b tal maneira que ton protegidas contra o
fuem sao as -endotoI
i
!
I:

I uma pane ocasional


hismos de defesa con-

hrante a esporulao
chamada -ende
iida
I
l)0 vezes mais txico

iiot ug"n,

de bactria
betos (Tabela 15.1).

ingeslnrses mais curtas da


fo intestino do inseto
:
I

321

Tabela 15.1 A abrangncia de insetos envenenados pelos virios tipos de -endotoxinas de

foativo. Aps

DNA

B. thuringiensis

F introduzir em uma
I a planta no possui.

DE

Tipo de -endotoxina

Efetiva contra

CryI
CryII
CryIII
CryIV
CryV
CryVI

Larvas de lepidpteros (traa e borboleta)


Larvas de lepidpteros e dpteros (mosca de duas asas)
Larvas de lepidpteros
Larvas de dpteros
Vermes nematdeos
Vermes nematdeos

e danificando a superficie epitelial, de forma que o inseto incapaz de alimentar-se e, conseqentemente, molre de fome (Figura 15.1). A variao na estrutura desses stios de ligao,
em diferentes grupos de insetos, , provavelmente, a principal causa das elevadas especificidades apresentadas pelos diferentes tipos de -endotoxinas.
As toxinas de B. thuringensis no so descobertas recentes, sendo a primeira patente para a sua utilizao na proteo de lavouras sido concedida em 1904. Com o passar dos anos,

ocoeram vrias tentativas de transform-las em inseticidas inofensivos ao meio ambiente,


mas suas biodegrabilidades atuaram como uma desvantagem, pois isso implicava que elas deveriam ser reaplicadas em intervalos regulares durante o perodo de cultivo, aumentando os
custos do agricultor. As pesquisas atuais visam obteno de -endotoxinas que no necessitem de reaplicaes regulares. Uma abordagem por meio da engenharia de protenas (p.
247), modifrcando-se a estrututra da toxina, de forma a torn-la mais estvel. Uma segunda
abordagem modificar a cultura, para que ela prpria sintetize a toxina.

Clonando um gene de -endotoxina no milho


O milho constitui-se em um exemplo de lavoura que no bem protegida pelos inseticidas
convencionais. A maior peste a broca do milho (Ostrinia nubilialis), a qual forma um tnel
dentro da planta, a partir de ovos depositados nas superfcies internas das folhas, e, portanto,
escapando dos efeitos dos inseticidas aplicados por vaporizao. A primeira tentativa de conteno dessa peste foi a modificao de plantas de milho para a produo de -endotoxinas,
realizada pelos biotecnologistas vegetais do laboratrio da Ciba-Geigy, na Carolina do Norte.
Eles trabalharam com a verso CryIA(b) da toxina, a qual havia sido previamente demonstrada ser uma protena de I . 155 aminocidos, com a atividade txica localizada em um segmento situado entre os aminocidos 29 a6OT.Emvezde isolarem o gene natural, o grupo da Giba-Geigy construiu uma verso mais curta, contendo os primeiros 648 cdons, por meio de
sntese gnica artificial. Essa estratgia possibilitou a introduo de modificaes no gene para melhorar a sua expresso nas plantas de milho. Por exemplo, os cdons utilizados no gene
artificial foram aqueles que se sabia serem os preferidos pelo milho, tendo o contedo total de
pares GC do gene sido ajustado para65Vo, comparado com o contedo de GC de387o da verso bacteriana nativa do gene (Figura 15.2a). O gene artificial foi ligado em um vetor-cassete
(p 285), entre um promotor e um sinal de poliadenilao do vrus do mosaico da couve-flor

322

T. A. Bnowr.r

Gene da &endotoxina

Expresso

bactria

na

Toxina ativa

Danos s clulas epiteliais


do intestino

Figura 15.1
Modo de ao de uma
-endotoxina.

(Figura 15.2b), e introduzido em embries de milho, pelo bombardeamento de microprojteis


cobertos com DNA (p. 111). Os embries desenvolveram-se em plantas maduras, e os transformantes foram identificados pela anilise dos DNAs extrados pela reao de polimerizao
em cadeia (PCR), utilizando-se iniciadores especficos para um segmento do gene artificial
(Figura 15.2c).
A etapa seguinte foi utilizar um teste imunolgico para determinr se a -endotoxina estava sendo sintetizada pelas plantas transformadas. Os resultados demonstraram que o gene
artificial era ativo, mas as quantidades de -endotoxina produzidas variavam de uma planta
para outra, desde aproximadamente 250 a 1.750 ng de toxina por miligrama de protena total.
Tais diferenas eram, provavelmente, devidas aos efeitos de posio; o nvel de expresso de
um gene clonado em uma planta (ou animal) freqentemente influenciado pela localizao
exata do gene nos cromossomos do hospedeiro (Figura 15.3).
As plantas transformadas eram capazes de resistir aos ataques da broca do milho? Isso foi
testado em trabalhos de campo, nos quais plantas de milho transformadas e normais foram artificialmente infestadas com larvas e os efeitos da predao, medidos durante um peodo de
seis semanas. Dois critrios foram utilizados: (l) a quantidade de perdas apresentada pela folhagem das plantas infestadas e (2) a extenso dos neis produzidos pelas larvas que penetraram nas plantas. Em ambos os aspectos, as plantas transformadas apresentaram melhores re-

{a
il,:

I'

t"
E*

*
b
ft
F

E
E
b
P

b.
F.

Figura 15
Etapas importantes n
procedimento utilizad
para a obteno
plantas de milho gene
ticamente modifica
das, expressando un
gene de -endotoni
artificial

Figura 153
Eeitos de posio.

Crorueeeu Grurcn

(a) Sntese de um gne de -endotoxina

E ANLtsE

oe

DNA

323

artiicial

1155

Gene de B. thuringiensis

Gene artificial

29

607
Cdons preferenciais e contedos
de GC apropriados ao milho

(b) Ligao de um promotor e sinal de poliadenilao

Seqncia promotora

Seqncia de poliadenilao

(c) Anlise por PCR das plantas maduras

123

t--------1 t----------, t-------7


1. Marcadores de tamanho de DNA

de ao de urrar

de microprojrcir

maduras, e os tranF
de

polimeri"afr

do gene artificiCl
a

2. Resultado da PCR com DNA


de uma planta transormada

Figura 15.2
Etapas importantes no
procedimento utilizado
para a obteno de
plantas de milho geneticamente modiicadas, expressando um
gene de -endotoxina
artiicial.

3. Resultado da PCR com DNA


de uma planta no-transformada

-endotoxina*

de uma plante
de protena totalvel de expresso dc

iado pela localizao

\----..-...- Gene inserido


na posio A

fracamente expressado

do milho? Isso

fci

foram

r-

e normais

te um perodo de
apresentada pela folarvas que penetra-

melhores re-

Cromossomo

Figura 15.3
Eeitos de posio.

o"n"

inserido na posio B altamente expressado

324

T. A. Bnowr.r

sultados dos que as normais. Em especial, o comprimento mdio dos tneis das larvas foi reduzido de 40,7 cm nos controles para apenas 6,3 cm nas plantas modificadas. Em termos
reais, esse um nvel de resistncia muito significativo.

15.1.2 Outros proietos de adio de genes


O milho no a nica planta que foi modificada para produzir a -endotoxina. Projetos semelhantes foram realizados com anoz, algodo, batata, tomate e outras culturas. Tampouco a resistncia a insetos a nica abordagem. Resultados igualmente bem-sucedidos foram obtidos
com genes que codificam inibidores de proteinases, pequenos polipeptdeos que interrompem
a atividade de enzimas no intestino do inseto, impedindo ou retardando o crescimento. Inibidores de proteinases so produzidos naturalmente por virios tipos de plantas, principalmente
legumes, tais como ervilhas e o feijo comum, e seus genes tm sido, de forma exitosa, transferidos para outras culturas, as quais normalmente no produzem quantidades significativas
dessas protenas. Os inibidores so eficientes sobretudo contra larvas de besouros que se alimentam de sementes e, assim, podem ser uma alternativa melhor do que as -endotoxinas para plantas, cujas sementes so estocadas por longos peodos.
Exemplos de outros projetos de adio de genes esto listados na Tabela l1.Z.Emmuitos
casos, o objetivo melhorar a capacidade da planta de resistir a pestes, tais como insetos, fungos, bactrias e vrus, ou de torn-lacapaz de resistir aos efeitos txicos dos herbicidas utilizados para controlar ervas daninhas. Outros projetos esto comeando a explorar a utilizao
da modificao gentica para melhorar a qualidade nutricional das plantas cultivveis, por
exemplo, pelo aumento do contedo de aminocidos essenciais e pela alterao da bioqumica da planta, de forma que uma maior quantidade de nutrientes fique disponvel para ser utilizada durante a digesto nos seres humanos ou animais.

15.2 A subtrao de genes

Tabela 15.i

Gene de

-endotoxin
Inibidores d
Chitinase

Glucanase
Protena in"a

Omitinoca
RNA-polim
RNAs sarl
Protenas

2'-5'-oligoa
Acetolacta!

Enolpiruvil

fosfatosi
Glifosato-o

Nitrilase
Fosfinorict
Inibidor da
ribonucle
DNA-adeni

Protena ri<

Aminocick
cido car

S-Adenosil

A subtrao de genes

uma denominao imprpria, pois a modificao no envolve a remoreal


de
um
gene,
simplesmente
a sua inativao. Existem vrias maneiras pelas quais um
o
nico gene escolhido pode ser inativado em uma planta viva, a mais bem-sucedida at o momento, em termos prticos, vem sendo a utilizao da tecnologia do anti-senso. O exemplo
que ser analisado um dos mais importantes, uma vez que resultou emum dos primeiros gneros alimentcios geneticamente modificados a ser aprovado para a venda ao pblico geral.

Monelina
Taumatina
Protena

gnpo
Delta-12
de

15.2.1 O princpio subjacente tecnologia do anti-senso


Em um experimento de anti-senso, o gene a ser clonado ligado em um vetor na orientao
inversa (Figura 15.4). Isso significa que quando o "gene" clonado transcrito, o RNA que
sintetizado o complemento reverso do RNA mensageiro (mRNA) produzido a partir da verso normal do gene. Esse complemento reverso ser referido como um RNA anti-senso, algumas vezes abreviado com asRNA.
Um RNA anti-senso pode impedir a sntese do produto do gene contra o qual ele direcionado. O mecanismo de como isso ocorre no est totalmente esclarecido, mas quase certo que envolve a hibridizao entre as cpias anti-senso e senso do RNA (Figura 15.5). possvel que o bloqueio na expresso surja porque a molcula de RNA de fita dupla resultante
rapidamente degradada pelas ribonucleases celulares, ou a explicao pode ser que o RNA anti-senso simplesmente impede que os ribossomos se liguem fita senso. Independentemente

it
c

t
.

de qual se
uma IIme

15.2.2 O RNA t
em ruti
At o

merr

mente mll
tados at c
o processi(

Crorunesu GNtcA

flqnmfuire

E ANLtsE oe

DNA

gs

Thbela 15.2 Exemplos de projetos de adio de genes em plantas

F:mrm,

mrrotmmrwr.
ffima@olfu

Organismo de origem

-endotoxina
Inibidores de proteases
Chitinase

B. thurtngiensis

Resistncia
Resistncia
Resistncia
Resistncia
Resistncia
Resistncia
Resistncia

Resistncia
Resistncia
Resistncia
Resistncia
Resistncia

vrus
vrus
a vrus
a herbicidas
a herbicidas

Glucanase
Protena inativadora de ribossomos

ffimsqltu

m#.

Caracterstica conferida

Gene de

Ornitino-carbomil-transferase
RNA-polimerase, helicase

Vrios legumes

Arroz
Alfafa
Cevada
Pseudomonas syringae

Luteovrus da folha

planta modihcada
a insetos
a insetos

fungos
fungos
a fungos
a
a

a bactrias

vrus

enrolada da batata

Ugmnm;m

pmd[.

RNAs satlites
Protenas do capsdeo viral

mmnn

2'-5'-oligoadenilato-sintetase
Acetolactato-sintase
Enolpiruvilchiquimato- 3fosfato-sintase
Glifosato-oxido-redutase

olrw-*'*hr-

mm

mmmr-

Ochrobactrum anthropi
Klebsiella ozaenae

Fosfinotricino-acetil-transferase

Streptomyces spp.

Inibidor da barnase-

B acllus

ribonuclease
DNA-adenino-metilase
Protena rica em metionina

Esterilidade do macho

E. coli

Aminociclopropanocido carboxlico-deaminase
.l-Adenosilmetionino-hidrolase

Orqp

Agrobacterium spp.

Resistncia a herbicidas
Resistncia a herbicidas
Resistncia a herbicidas

Nitrilase

omtfrc+tu

Virios vrus
Virios vrus
Rato
Nicotiana tabacum

amyloliquefaciens

Nozes brasileiras

Esterilidade do macho
Contedo de enxofre
aumentado

Vrios

Monelina

Thaumatococc

Taumatina

T.

Protena tioesterase portadora


de grupos acila
Delta- I 2-desafurase

danielli
Umbellularia
califurnica

Amadurecimento de frutas
modificado
Amadurecimento de frutas
modificado
Doura
Doura
Contedo de gordura/
leo modificado

Glycine max

Contedo de gordura./

Bacterifago T3
u

s dan ie ll i

leo modificado

de qual seja o mecanismo, a sntese de um RNA anti-senso


em uma planta transformada
uma maneira eficiente de realizar_se a subtrao de um gene.

15.2.2

o RNA anta-senso e a modificao do amadurecimento


em rutas e no tomate
At o momento, os tomates comercialmente cultivados e
as frutas mais frgeis so normalmente colhidos antes de seu amadurecimento completo,
a fim de garantir que sejam transpor-

tados at os superrnercados antes de estarem totalmente


estragads. Isso essencial para que
o processo seja economicamente vivel, mas existe probleria
o
de que a maioria das frutas e

326

T.A.Bnowru

dos tomales i

Gene na orientao
correta

esE
freqentem
antes de

Duas compa

do - utilizra
de tomateq d
ao produtrd

no qual o sd
transpote e r

mRNA

O papel dr
O espaodel

Gene na orientao

semanas4

inversa

inci

o-_

desde o

merodeger
le que codifi

o amauecir

Promotor

poligalacnr
amolecimen

\',,"
#

rnto teryo
A inativr

RNAanti-senso
(complemento reverso
do mRNA)

senvolviffi
Figura 15.4
RNA anti-senso.

hzadzpaal-

A clonag:
Oexperiro
tas daICIS.

dcadade lg

dapotigala

""-"

dora (Figura
co da cmrs

RNA anti-senso

-"''"'*

s;.."""

Ribossomos no
podem se ligar?

Degradado por
ribonucleases?

Figura 15.5
Possveis mecanismos para a inibio
da expresso gnica por meio do RNA
anti-senso.

Fqlr

A elevao da erresd
gene da poligalacn
vista durante os es(i
nais do amadurecinsr

Croruaeeu Gwrcn e ANLrsE oe

DNA

327

dos tomates imaturos no desenvolve totalmente seu sabor, caso sejam removidos da planta
antes de estarem totalmente amadurecidos. O resultado que a produo massiva de tomates
freqentemente possui um sabor brando, o que os torna menos atraentes aos consumidores.
Duas companhias biotecnolgicas - Calgene, nos Estados Unidos, e ICI Seeds no Reino Unido - utilizaram a tecnologia do anti-senso como forma de modificar geneticamente as plantas
de tomates, de maneira que o seu processo de amadurecimento foi retardado. Isso possibilita
ao produtor deixar as frutas na planta para que elas amaduream at um determinado esgio,
no qual o sabor tenha sido completamente desenvolvido, com tempo ainda suf,rciente para o
transporte e a comercializao da cultura antes que ela se estrague.

O papel do gene da poligalacturonase no amadurecimento do tomate


O espao de tempo para o desenvolvimento de uma fruta medido como o nmero de dias ou
semanas aps o florescimento. No tomate, esse processo leva aproximadamente oito semanas,
desde o incio at o seu trmino, com as modificaes na colorao e no sabor associadas com
o amadurecimento iniciado aps cerca de seis semanas. Nesse perodo, um determinado nmero de genes envolvidos nos estgios finais do amadurecimento induzido, incluindo aquele que codifica a enzima poligalacturonase (Figura 15.6), a qual degrada lentamente o cido
poligalacturnico, componente da parede celular do pericarpo das frutas, resultando em um
amolecimento gradual. O amolecimento torna o fruto palatvel, mas se ele se prolonga por
muito tempo, o resultado um tomate amassado e estragado, pouco atraente.
A inativao parcial do gene da poligalacturonase deveria aumentar o perodo entre o desenvolvimento do sabor e o estrago da fruta. Como a tecnologia do anti-senso poderia ser utilizadapar:a a obteno desse resultado?

A clonagem do "gene" anti-senso da poligalacturonase


O experimento que ser analisado foi realizado pelo Departamento de Biotecnologia de Plantas da ICI Seeds, juntamente com cientistas da Universidade de Nottingham, em meados da
dcada de 1980. Um fragmento de restrio de 730 pb foi obtido a partir da regio 5' do gene
da poligalacturonase normal, representando apenas menos da metade da seqncia codificadora (Figura 15.7). A orientao do fragmento foi revertida e um promotor do vrus do mosaico da couve-flor foi ligado no incio dessa seqncia, alm de um sinal de poliadenilao de

oo
(

'g

E.6

s3
o
( (

-Eo
c6)

(:

lura

15.5
hsveis mecanispara a inibio
gniexpresso
I
I por meio do RNA

ili-senso.

Figura 15.6
A elevao da expresso do
gene da poligalacturonase
vista durante os estgios inais do amadurecimento do
tomate.

50

Expresso do gene
da poligalacturonase

328

T. A. Bnowr.r

calos, co
crescime
que confi
ficados e
Os re

Gene da poligalacturonase

Clivagem, ligao a seqncias


controladoras na orientao inversa

(1)

A1
me

(2)

Ar

(p.
R

promotor

\/

Sinal de poliadenilao
\

-=-

(3)

Ot

nu

col

Figura 5.7

"Gene" anti-senso
da poligalacturonase

Tai

Construo de um "gne"
anti-senso da poligalacturonase. R = stio de restrio.

m2

pla

(4)

As

pla

ap
da

plantas tendo sido ligado no seu final. A construo foi, ento, inserida no vetor plasmidial Ti
binrio, pBINl9 (p. 152). Uma vez dentro da planta, a transcrio a partir do promotor do vrus do mosaico da couve-flor deveria resultar na sntese de um RNA anti-senso, complementar primeira metade do mRNA do gene da poligalacturonase. Experimentos anteriores com
RNA anti-senso haviam sugerido que isso deveria ser o suficiente para reduzir, ou mesmo impedir, a traduo do mRNA-alvo.
A transformao foi realizada por intermdio da introduo das molculas de pBINl9 recombinantes na bactria grobacterium tumefaciens e, depois, permitindo que a bactria infectasse segmentos do caule do tomate (Figura 15.8). Quantidades pequenas de material dos

sesmentodocaure

rat
gu

Mait

dual, po
rem. Iss

galacnr
ra etart

;t'ff5tffi3ili,llt"

do tomate

-----'--<--- -"3'z"o
-l------- : | .

tl- -'t' ''


,.,/i :.\-)i:'
./.-)-2 zZ .

---.//,/7'z

'

lncubao

Porvriosdias

Meio gar

Calos crescidos

----")

..ir,l

./7

,r/
,z
z')

Teste para
resistncia
canamicina

Figura 15.8
Obtendo plantas
transormadas por
meio da ineco
de segmentos do
caule com A. tumefaciens recombinantes.

As dierenas

poligalacturona

normais e em fr
do o "gene" anti.

--_

Cloruneeu Grurcn e ANLtsE oe

DNA

329

calos, coletadas das superfcies desses segmentos; foram testadas para a sua capacidade de
crescimento em meio gar contendo canamicina (lembre-se de que pBINl9 contm um gene
que confere resistncia canamicina; Figura 7.14). Transformantes resistentes foram identificados e deixados para se desenvolverem em plantas maduras.
Os resultados do experimento foram analisados das seguintes maneiras:

(1)

A presena do "gene" anti-senso no DNA das plantas transformadas foi verificada por
meio de hibridizao de Souern (p.206).

(2)

A expresso do gene anti-senso foi medida de acordo com

(3)

(p.230), com uma sonda de DNA de fita simples que deveria hibridizar somente com o
RNA anti-senso.
O efeito da sntese do RNA anti-senso sobre a quantidade de mRNA de poligalacturonase nas clulas de frutas amadurecidas

de um "gene"
da poligalacturostio de restrio.

vetor plasmidial Ti
promotor do vcomplemenanteriores com
,

(4)

de

pBINl9 re-

de material dos

Mais importante, as frutas transformadas, embora apresentassem um amolecimento gradual, poderiam ser estocadas por um peodo de tempo mais prolongado, antes de se estragarem. Isso indicava que o RNA anti-senso no havia inativado completamente o gene da poligalacturonase, mas, apesar de tudo, produzido uma reduo suficiente na expresso gnica para retardar o processo de amadurecimento, conforme desejado.

oE
:E
y9.50
=9'
E
gofura 1s.8
fendo plantas
fsiormadas por
fo Ca intecao
pegmentos do

Ie com A. tumeFrs recombiI

5.
I

r'
il
e:

iD

de northern,

As quantidades de enzima poligalacturonase produzidas nas frutas amadurecidas de


plantas transformadas foram estimadas, a partir da intensidade das bandas relevantes,
aps a separao das protenas da fruta por meio da eletroforese em gel de poliacrilamida, e da medio direta das atividades enzimticas nas frutas. Os resultados demonstrarrm que uma menor quantidade de enzima foi sintetizada nas frutas transformadas (Figura 15.9).

o
a

foi determinado por hibridizao

com uma segunda sonda de DNA de fita simples, essa especfica para o mRNA senso.
Tais experimentos mostraram que as frutas amadurecidas, a partir das plantas transformadas, continham menos mRNA de poligalacturonase do que as frutas originadas de
plantas normais.

oumesmo im-

que a bactria in-

ps.

a hibridizao de northern

(0)
Figura 15.9
As dierenas na atividade da
poligalacturonase em tomates
normais e em rutas expressando o "gene" anti-senso da poligalacturonase.

ttE
E

330

T. A. Bnowr.r

15.2.3 outros exemplos da utilizao do RNA anti-senso na engenharia


gentica vegetal
Em termos gerais, as aplicaes da subtrao de genes na engenharia gentica vegetal so provavelmente menos amplas do que aquelas da adio de genes. muito mais fcil pensar nas
caractesticas teis que uma planta no possui e quais poderiam ser introduzidas pela adio
de genes, do que identificar caractersticas desvantajosas que a plantaj possua e quais poderiam ser removidas pela subtrao de genes. No entanto, existe um nmero crescente de projetos de biotecnologia vegetal baseados na subtrao de genes (Tabela 15.3) e a abordagem
ir, provavelmente, aumentar em importncia, medida que as incertezas que circundam os
princpios que fundamentam a tecnologia do anti-senso forem gradualmente resolvidas.

cpia do
das sejan

nptll,ten
seu prodr

que a ne(
animais-r

(1)

Po<

do

(2)

bi

Po<

resr

15.3 Problemas com vegetais geneticamente modificados

Nen

atual. Po
Tomates com o amadurecimento retardado, produzidos pela subtrao de genes, foram os primeiros gneros alimentcios geneticamente modificados aprovados totalmente para a comercializao. Em parte devido a isso, a engenharia gentica vegetal tem servido de campo de batalha, no qual biotecnologistas e outras partes interessadas tm discutido em relao segurana e s questes ticas que surgem, a partir da capacidade de alterar-se a constituio gentica dos organismos vivos. Inmeras das questes mais importantes no dizem respeito diretamente aos genes e tampouco os conhecimentos necessrios para respond-las sero encontrados neste livro. No podemos discutir de uma maneira confivel o possvel impacto,
bom ou mau, que as culturas geneticamente modificadas possam causar nas prticas agcolas locais nos pases em desenvolvimento. Tampouco podemos comentar os motivos subjacentes ao desenvolvimento de plantas resistentes a herbicidas por companhias que tambm
comercializam o herbicida que os agricultores devero utilizar com a cultura modificada. No
entanto, podemos - e devemos - examinar os aspectos biolgicos.

15.3.1 A segurana em relao s marcas de seleo


Um dos principais pontos de preocupao a surgir, a partir do debate sobre os tomates geneticamente modificados, foram os possveis efeitos danosos das marcas de seleo gentica utilizadas com os vetores de clonagem em plantas. A maioria dos vetores de plantas possui uma

de um al

riana do

transfe
De form;

modifica
COmUnS

cial no

Osn

do os bir

aps a o,

mado h
sa

fragn

(Figura
nagen

de sele
Cre. Ap

DNA

da

Thbela 15.3 Exemplos de projetos de subtrao de genes em plantas


Gene-alvo
Poligalacturonase

Aminociclopropano-cido
carboxflico-sintase
Polifenol-oxidase
Sintase de amido
Delta- 12-desaturase
Chalcono-sintase

Caractestica modifi cada


Retardamento do estrago em tomates
Modificao no amadurecimento
do tomate
Inibio do descoloramento em frutas e vegetais
Reduo do contedo de amido em vegetais
Contedo elevado de cido olico em soja
Modificao da colorao da flor em virias plantas decorativas

Exciso de DN
enzima recor

Clouoera

engenharia
vegetal so prois fcil pensar nas

uzidas pela adio

Grurce e ANLrsE oe

DNA

331

cpia do gene que confere resistncia canamicina, possibilitando que as plantas transformadas sejam identificadas durante o processo de clonagem. O gene kanR, tambmchamado de
nptll,temorigem bacteriana e codifica a enzima neomicina-fosfotransferase IL Esse gene e o
seu produto enzimtico esto presentes em todas as clulas da planta modificada. O receio de
que a neomicina-fosfotransferase pudesse ser txica ao homem foi abrandado por testes com
animais-modelo, mas duas outras questes de segurana penanecem:

possua e quais pode-

crescente de pro15.3) e a abordagem


que circundam os
resolvidas.

os
genes, foram os pri-

para a comerde campo de baem relao segua constituio gedizem respeito di-

las sero eno possvel impacto,


nas prticas agrcoos motivos subjaque tambm

modificada. No

os tomates geneseleo gentica uti-

(1)
(2)

Poderia o gene kanR presenteem um alimento geneticamente modificado ser transmitido para bactrias do intestino humano, tornando-as resistentes canamicina e aos antibiticos relacionados?
Poderia o gene knn* ser transmitido para outros organismos do meio ambiente, podendo
resultar em prejuzo ao ecossistema?

Nenhuma dessas questes pode ser totalmente respondida com o nosso conhecimento
atual. Pode ser argumentado que o processo de digestio poderia destruir todos os genes kan*
de um alimento geneticamente modificado antes de que esse pudesse alcanar a flora bacteriana do intestino, e que, mesmo se um gene escapasse da destruio, as chances de ele ser
transferido para uma bactria seriam muito pequenas. No entanto, o fator de risco no zero.
De forma semelhante, embora experimentos sugiram que o cultivo de plantas geneticamente
modificadas teria um efeito insigniicante no meio ambiente, uma vez que genes kanR j so
comuns em ecossistemas naturais, a futura ocorrncia de algum evento indesejado e prejudiial no pode ser considerada uma impossibilidade absoluta.
Os receios que cercam a utilizao de kanR e de outros genes marcadores tm estimulado os biotecnologistas a desenvolver maneiras de remover tais genes do DNA das plantas,
aps a ocorrncia do evento de transformao. Uma dessas estratgias faz uso de uma enzima do bacterifago Pl, chamada Cre, a qual catalisa um evento de recombinao que excisa fragmentos de DNA flanqueados por seqncias de reconhecimento de 34 pb especficas
(Figura 15.10). Para utilizar esse sistema, a planta transformada com dois vetores de clonagem, o primeiro contendo o gene a ser adicionado planta, juntamente com a sua marca
de seleo kanR, flanqueada pelas seqncias-alvo de Cre, e o segundo contendo o gene
Cre. Aps a transformao, a expresso do gene Cre resulta na exciso do gene kan* do

DNA

da planta.

plantas possui uma

Seqncias-alvo para Cre

/\

--.

Molcula de DNA

Recombinao

catalisada por Cre

fe

vegetais

-_______________I___

Ftals
FOJA

lias plantas decorativas

Figura 15.10
Exciso de DNA por meio da
enzima recombinase Cre.

Fragmento flanqueado pelas


seqncias-alvo excisado

332

T. A. Bnowlr

Leituras adicit

E se o prprio gene Cre for de alguma forma prejudicial? Isso impossvel, uma vez que
os dois vetores utilizados na transformao provavelmente iro integrar seus fragmentos de
DNA em cromossomos diferentes, de forma que a segregao aleatria durante a reproduo
sexual ir resultar em uma primeira gerao de plantas que contm um dos fragmentos de
DNA integrado, mas no o outro. A planta que no contenha nem o gene Cre e nem a marca
de seleo kan*, mas que contenha o gene de interesse, que se deseja adicionar no genoma da
planta, poder, assim, ser obtida.

Bachem,

C.WJ

genqs inlih

Courtney4rm

cation offl
genetics. B
Feitelson J-S-I
talhes de

15.3.2 A possibilidade de eeitos preiudiciais ao meio ambiente

&

Fischhoff, D-A807-13. [A

Uma segunda rea de preocupao, em relao s plantas geneticmente modificadas, que


as suas novas combinaes genticas possam prejudicar o meio ambiente de alguma maneira. Determinados problemas foram destacados com respeito s plantas modificadas serem resistentes infeco viral. Uma estratgia aqui transfornar a planta com os genes que codificam as protenas do capsdeo de um vrus patognico. A expresso desses genes no resulta
em sintomas de doena, mas fornece planta um grau de proteo contra a infeco pelo vrus intacto. Um receio que a planta que est sintetizando protenas do capsdeo de um vrus
patognico pode ser atacada por um segundo tipo de vrus, cuja replicao poderia originar
uma prognie hbrida, contendo genomas de vrus infecciosos, empacotados nas protenas do
capsdeo sintetizadas pela planta. Tais hbridos poderiam apresentarpropriedades inesperadas
e danosas, por exemplo, as novas protenas do capsdeo poderiam ampliar a faixa de hospedeiro do segundo vrus, capacitando-o a infectar novas plantas, que nornalmente eram resis-

Flavell, R-B-

l4l4-l
neticam
10,

Koziel, M-Gan

insecrii

Shade, R.E- Sc

commmh

resisenrcs
Smith, CJS- \

uansgsnb
Tepfer, M" (19!

lr2r3z I
Truve,E-Aq
lat sYr

tentes, resultando em doenas.

tUanipr
Yoder, J.I. lk

H tambm a questo de se um novo gene, introduzido em uma planta geneticamente modificada, poderia "escapar" e colonizar plantas selvagens e, caso isso acontecesse, qual o impacto que teria no meio ambiente. Pesquisas com plantas nativas e geneticamente modificadas esto gradualmente acumulando dados, a partir dos quais essas questes sero respondidas. Porm, importante perceber que a determinao do efeito que plantas geneticamente
modificadas podem ter sobre o meio ambiente ser possvel somente se experimentos adequados forem realizados, em sistemas-modelos, antes que a liberao em larga escala das plantas
seja permitida. Tais experimentos sero incompletos se no envolverem testes com plantas geneticamente modificadas cultivadas sob condies rigorosamente controladas no ambiente
natural. Se no for possvel realizar esses testes corretamente, ento efeitos prejudiciais podero ser perdidos.

tecffig

Cnprulo 16
Clonagem Gnica e Anlise de
DNA na Cincia Forense
i

Anlise do DNA na identificao de suspeitos

criminais, 335

Identificao do sexo por meio da anlise do DNA,


340

Estudando o parentesco por meio do perfil do DNA,


339

A cincia forense

a ltima rea da biotecnologia que ser considerada neste volume. Dificilmente uma semana termina sem uma reportagem na imprensa sobre mais um crime hediondo
que tenha sido solucionado graas anilise do DNA. As aplicaes da biologia molecular no
laboratrio criminal centralizam-se, em grande parte, na capacidade da anlise do DNA em
identificar um indivduo a partir de cabelos, manchas de sangue e outros itens recuperados do
local do crime. Nos meios de comunicao populares, essas tcnicas so conhecidas como
datiloscopia gentica (genetic fingerprinting), embora o termo mais preciso paa os procedimentos utilizados hoje em dia seja perfil do DNA. Este captulo inicia com um exame dos
mtodos utilizados na datiloscopia gentica e no perfil do DNA, incluindo suas utilizaes,
tanto na identificao de indivduos quanto na confirmao se indivduos so membros de
uma mesma famflia, o que nos levar a uma explorao das maneiras pelas quais as tcnicas
genticas esto sendo usadas em ireas de criminalstica e em outras, alm da investigao policial, como a arqueologia.

16.1 Anlise do DNA na identificao de suspeitos criminais


provavelmente impossvel algum cometer um crime sem deixar um rastro de seu DNA.
Cabelos, sangue e mesmo impresses digitais convencionais contm traos de DNA suficientes para serem estudados por meio da reao de polimerizao em cadeia (PCR). A anilise
no necessita ser realizada imediatamente. Nos ltimos anos, um certo nmero de crimes do
passado foi solucionado e o criminoso levado Justia, graas ao teste de DNA realizado com
material arquivado. Assim sendo, como tais mtodos poderosos funcionam?
A base da datiloscopia gentica e do perfil do DNA que os gmeos idnticos so os nicos indivduos que possuem cpias idnticas do genoma humano. claro, o genoma humano
mais ou menos o mesmo em todas as pessoas - os mesmos genes estaro na mesma ordem

'ij
L'

E.

l-

i;.

336

T.A. Bnowru

com as mesmas seqncias de DNA de regies intergnicas entre eles. Mas o genoma humano, bem como o dos demais organismos, contm muitos polimorfismos, posies onde
a se-

qncia de nucleotdeos no a mesma em cada membro da populao. J havia sido


destacada a principal importncia desses stios polimrficos anteriormente, pois as seqncias
variveis so aquelas mesmas utilizadas como marcadores de DNA no .rrup"u-"nio genmico

(p.262). Elas incluem polimorfismos de comprimento de fragmentos d restriaolRFlps),


repeties curtas em tandem (STRs) e polimorfismos de nucleotdeos individuaii (SNpO. 1'odas essas trs podem ocoffer dentro de genes, e em regies intergnicas, existindo, no total,
vrios milhares desses stios polimrficos no genoma humano, destacando-se os SNps como
os mais comuns.

16.1.1 A datiloscopia gentica por meio da sondagem por hibridizao


O primeiro mtodo de utilizao da anlise do DNA para identificar indivduos foi desenvolvido em meados da dcada de 1980 por SirAlec Jeffreys, da Universidade Leicester. Essa tcnica no se baseou em qualquer um dos tipos de polimorfismos recm-listados, mas em um
tipo de variao no genoma humano chamada de seqncia repetitiva dispersa hipervarivel. Como o nome indica, trata-se de uma seqncia repetida que ocoe em vrios lugares
("dispersa") do genoma humano. A caracterstica fundamental dessas seqncias que
suas
posies genmicas so variveis: elas esto localizadas em diferentes posies nos genomas
de diferentes pessoas (Figura 16.1a).
A repetio especfica que foi inicialmente utilizada na datiloscopia gentica contm a seqncia GGGCAGGANG (onde N qualquer nucleotdeo). Para preparar uma datiloscopia,
uma amostra de DNA clivada com uma endonuclease de restrio, os fragmentos so separados por eletroforese em gel de agarose e realizado um experimento de South em (p.207).
A hibridizao da membrana com uma sonda marcada contendo a seqncia repetida revela
uma srie de bandas, cada uma representando um fragmento de restrio que contm a repetio (Figura 16.1b). Uma vez que os stios de insero da seqncia repetia so variveis, o
mesmo procedimento, realizado com uma amostra de DNA de uma segunda pessoa, ir fornecer um padro diferente de bandas, as quais so datiloscopias genticas para aqueles
indivduos.

16.1.2 O perfil do DNA por meio da pCR de repeties


curtas em tandem
Estritamente falando, a datiloscopi a gentica refere-se somente s anlises de hibridizao
das seqncias repetidas dispersas. Essa tcnica, embora valiosa no trabalho
criminalista, foi
penalizada por trs limitaes:

(1)
(2)

(3)

Uma quantidade relativamente grande de DNA necessria, pois a tcnica depende


da
anlise por hibridizao. A datiloscopia no pode ser ilizadacom as quantidades
nfi-

mas de DNA de cabelos e manchas de sangue.


da datiloscopia pode ser difcil, em decorrncia de variaes nas intensidades dos sinais de hibridizao. Em um processo judicial, pequenas diferenas
na in_
tensidade das bandas entre uma datiloscopia-teste e outra realizadade um suspeito
podem ser suficientes para que este seja inocentado.
Embora os stios de insero das seqncias repetidas sejam hipervariveis, existe
um
limite dessa variabilidade e, portanto, uma pequena chance " qu" dois indivduos
no-relacionados possam ter as mesmas, ou pelo menos muito semelhantes, datilos_
copias. Novamente, essa considerao pode levar absolvio, quando um caso le-

A interpretao

vado ao tribunal.

A tcn
cias polim
cia curta,

seqencia
lCAl,, na

O nn

adicionad;
o do D
de uma de
peties.

terminado
meio de P

uma repet
gel de agz
na mosu
uma nica
mossomo

Umarr

de resulta

tados so
cia em uu

Figura 16.1
A datiloscopia gentica. (a) As por*es das repeti@es
polimricas, tais
como as seqc"
cias repetitivas dispersas hipervariveis, nos genoa;
de dois indivduos.
Nos segmentos cK>
mossmicos mostrados, a segunda
pessoa possui urna
seqncia repetida
adicional. (b) Uma
auto-radiograia ebe as datiloscopias
genticas de dois
indivduos.

Croueeu
o genomahumaies onde a sehavia sido destaseqncias va-

genmico
(RFLPs),
is (SNPs). To.
istindo, no total,
os SNPs como

foi desenvolEssa tcms em um

hipervarirrios lugares
ias gue suas
EOS

genoras

contm a se-

Grurcn e ANusE oe

DNA

A tcnica mais poderosa do perfil do DNA evita tais problemas. perfis utilizam
seqn-

cias polimrficas chamadas STRs. Conforme descrito na pgina


262,umaSTR uma ,"qticncia curta, de 1 a 13 nucleotdeos de comprimento, que repetida vrias
vezes

em um arranjo
seqencial. No genoma humano, o tipo mais comum ae SfR
a repetio dinucleotdica
[cA],, na qual "n", o nmero de repeties, est normalmente entre s zo 6igur a 16.2a).
O nmero de repeties em uma determinada STR varivel, pois repeties
podem ser
adicionadas ou, menos freqentemente, removidas por erros qu"
o"orr"- durante a replicao do DNA. Na populao como um todo, devem existir emiorno de l0 verses diferentes
de uma determinada STR, cada um dos alelos caracterizados por
um nmero diferente de repeties. No perfil do DNA, os alelos de um nmero selecionado
de STRs diferentes so determinados. Isso pode ser rapidamente obtido e com quantidades muito pequenas
de DNA por
meio de PCRs com iniciadores que se anelam s seqncias de DNA m
ambos os lados de
uma repetio (Figura l2.ll). Aps a PCR, os produtos so examinados por
eletroforese em
gel de agarose' com o tamanho da banda ou bandas indicando o alelo
ou os alelos presentes
na amostra de DNA testada (Figura 16.2b). Dois alelos de uma STR podem
estar presentes em
uma nica amostra de DNA, visto que existem duas cpias Oe caAa StR,
uma vinda do cro-

mossomo herdado da me e a outra, do cromossomo herdado do pai.


Uma vez que a PCR utllizada, o perfil do DNA muito sensvel e possibilita
a obteno
de resultados com cabelos e outros materiais que contenham apenas
traos de DNA. Os resultados so precisos e uma identidade entre perfis de DNA normalmente
aceita como evidncia em um julgamento. importante destacar que o perfil do DNA, quando

conduzido com

datiloscqia
so sp&

$.w7).
repetida revela

mfuaEpe-

(a) Seqncias repetidas polimrficas no genoma humano

sfro vui:f;veis, o

isqsm, ir

f-

Primeira Pessoa

eryeles iudiDNAs cromossmicos

---------Figura 16.1

dlFCrrL df

rf ingrnil[F
surycimpo.
FriflrUr

hffim
ffiecesoh-

f-

ggz

A datiloscopia gentica. (a) As posies das repeties


polimrficas, tais
como as seqncias repetitivas dispersas hipervariveis, nos genomas
de dois indivduos.
Nos segmentos cromossmicos mostrados, a segunda
pessoa possui uma
seqncia repetida
adicionat. (b) Uma
auto-radiograia exibe as datiloscopias
genticas de dois
indivduos.

Segunda pessoa

-----

posies das seqncias


repetidas

(b) Duas datiloscopias genticas


Linhas 1 e 2:
1

DNA de dois
indivduos

338

T. A. Bnowrir

STRs com um grande nmero de alelos, fornece uma probabilidade estatstica elevada de que
uma identidade entre um perfil-teste e o de um suspeito seja significativa e no devida a um
acaso de similaridade entre duas pessoas diferentes. possvel alcanar o grau necessirio de
ceteza pela anlise de um painel de nove STRs, que pode ser estabelecido em uma nica
PCR multiplex, na qual um conjunto de pares de iniciadores utilizado em uma nica reao. Os resultados podem ser interpretados, porque as PCRs so projetadas de tal maneira que

os prod

empmi
so mer

da dos I

16.2 Estud
Assimr
ra infer

(a) Os dois alelos de uma STR

doch

....CACACACACA..

n=5

....cAcAcAcAcAcA

n=6

dade.

16.2.1 lndiv
O

pefl

sua

(b) Os resultados da PCR

apaent

@gua

petift

criana
alelo
1. DNA marcador de tamanho

2, 3. PCRs de uma nica STR em


dois indivduos

:2

4. PCR multiplex de trs STRs (1-3)

cee72
vduo's,

urnaI'l

16.2.2 O per
Umex

cido pe
memhr
o Ru
Apos,

dadoo
(c) Anlise dos resultados de uma PCR multiplex em um seqenciador de DNA automtico

00

150

2OO

Tamanho (pb)

Figura 16.2
O perfit do DNA. (a) O perfil do DNA az uso de STRs, as quais possuem unidades repetidas variveis.
(b) Um gel obtido aps o perfil do DNA. Nas linhas 2 e 3 a mesma STR foi examinada em dois indiv
duos. Essas duas pessoas possuem perfis dierentes, mas uma banda em comum. A linha 4 mostra o
resultado de uma PCR multiplex, na qual trs STRs oram determinadas em uma nica PCR. (c) Um
seqenciador de DNA automtico pode ser utilizado para determinar o tamanho dos produtos da PCR.

Figura 163
Padro de he'
rana de alelos
de STRs em
uma amlia

Cloruneeu Grurcn e ANLtsE oe

elevada de qrre
no deda a rrm
messrio de

em um unlca
uma rrntca IEa_
tal maneiraqre

DNA

339

os produtos obtidos, a partir de cada STR, possuem tamanhos diferentes e, assim, aparecem
em posies diferentes no gel de agarose (Figura 16.2b).Alternativamente, se os iniciadores
so marcados com fluorocromos diferentes, os resultados podem ser visualizados pela corrida dos produtos em um seqenciador de DNA automtico (Figura 16.2c).

16.2 Estudando o parentesco por meio do perfil do DNA


Assim como na identificao de criminosos, o perfil do DNA pode tambm ser utilizado para inferir se dois ou mais indivduos so membros de uma mesma famflia. Esse tipo de estudo chamado de anlise do parentesco e a sua aplicao dirria d-se nos testes de paternidade.

16.2.1 lndivduos relacionados possuem perfis de DNA semelhantes


O perfil do seu DNA, assim como outros aspectos do seu genoma, parcialmente herdado de
sua me e parcialmente de seu pai. Proximidades dentro de uma famflia, portanto, tornam-se
aparentes quando os alelos de uma determinada STR so destacados emum pedigree familiar

(Figura 16.3). Nesse exemplo, vemos que trs de quatro crianas herdaram o alelo de 12 repeties de seu pai. Essa observao, por si s, no suficiente para se deduzir que essas trs
crianas so irms, embora a probabilidade estatstica pudesse ser bastante elevada, caso o
alelo de 12 repeties fosse incomum na populao como um todo. Para aumentar o grau de
certeza, mais STRs deveriam ser determinadas, mas, assim como com a identificao de indivduos, as anlises no necessitam ser infinitas, pois uma comparao de nove STRs fornece
uma probabilidade aceitvel de que as identidades observadas sejam reais.

16.2.2 O perfil do DNA e os resqucios dos Romanov


Um exemplo interessante da utilizao do perfl do DNA em um estudo de parentesco fornecido pelo trabalho realizado durante a dcadade 1990 com os ossos dos Romanov, os ltimos
membros da famia dominadora da Rssia. O Tsar Nicholas II foi deposto durante a Revoluo Russa e, juntamente com sua esposa, a Tsarina Alexandra, e seus cinco filhos, foi preso.
Aps, os sete foram mortos, alm de seu mdico e de virios empregados. Em 1991, aps queda do comunismo, os co{pos foram recuperados de suas covas na margem de uma estrada.

O uutn",.
I Homem
lf famanfro das repeties das STRs
ranaYs-

tisindr4

nao

FCR(c) tlm

daFCR

Figura 16.3
Padro de herana de alelos
de STRs em
uma amlia.

340

T. A. Bnowr.r

A anlise de STR dos ossos dos Romanov


Os corpos recuperados erm um pouco mais do que uma coleo de ossos, de adultos e de
crianas, misturados, com nenhuma indicao de quais pertenceriam aos Romanov e quais ao
seu mdico e aos empregados. No entanto, os nicos ossosjuvenis, dentro da coleo, deveriam pertencer s crianas do tsar e da tsarina. Isso significava que os ossos do tsar e da tsarina poderiam ser identificados por meio do estabelecimento de quais adultos poderiam ser os
pais das crianas.
O DNA foi extrado dos ossos de cada indivduo e cinco STRs foram determinadas por
PCR. De fato, apenas duas dessas STRs forneceram informaes suficientes pam que o pai e
a me das crianas fossem identificados com preciso (Figura 16.4). Mas seriam esses mesmos os ossos dos Romanov ou poderiam ser os resqucios de algum outro grupo de pessoas
desafortunadas? Para resolver esse problema, o DNA dos ossos foi comparado com amostras
de DNA de parentes vivos dos Romanov. Esse trabalho incluiu estudos do DNA mitocondrial, um pequeno DNA circular de 16 kb contido nas mitocndrias geradoras de energia das
clulas. O DNA mitocondrial contm polimorfismos que podem ser utilizados para inferir parentescos entre indivduos, mas o grau de variabilidade no to grande quanto aquele apresentado pelas STRs, de forma que o DNA mitocondrial raramente utilizado para estudos de
parentesco entre indivduos extremamente relacionados, tais como aqueles de uma mesma famlia. Mas o DNA mitocondrial possui a propriedade importante de ser herdado somente da
linhagem feminina, com o DNA mitocondrial do pai sendo perdido durante a fecundao e
no contribuindo para o contedo de DNA do filho ou da hlha. Esse padro de herana materna torna mais fcil a determinao de parentesco, quando os indivduos que esto sendo
comparados so mais distantemente relacionados, como foi o caso com os parentes vivos dos
Romanov. Tais estudos do DNA mitocondrial mostraram que os ossos eram com certeza os do
Tsar Nicholas, da Tsarina Alexandra e de trs de suas filhas.

As crianas perdidas
Somente trs crianas foram encontradas no tmulo dos Romanov. Alexei, o nico menino, e
uma das quatro meninas estavm faltando. Na metade do sculo XX, vrrias mulheres reivindicavam ser a princesa Romanov, porque, mesmo antes de os ossos serem descobertos, havia
boatos de que uma das meninas, Anastsia, teria escapado da crueldade dos bolchevistas e fugido para o ocidente. Lamentavelmente, testes de DNA mostraram que nenhuma dessas requerentes poderia ter sido a filha do tsar e da tsarina e a histria de Anastsia , provavelmente, apenas um romance. A explicao mais provvel para a aparente ausncia das duas crianas na sepultura que seus ossos estavam extremamente degradados para serem recuperados,
ou que elas foram enterradas em locais diferentes. De fato, os resqucios de um menino e de
uma menina, a ltima com jias semelhantes quelas usadas por Maria, foram recentemente
encontrados.

Fig

Aa

ca(

16.3 ldentificao do sexo por meio da anlise do DNA


A anlise do DNA tambm pode

mel

osi
adt

utilizada para identificar o sexo de um indivduo. A diferena gentica entre os sexos a presena de um cromossomo Y nos indivduos do sexo masculino, de forma que a deteco de DNA especfico do cromossomo Y deve possibilitar que
homens e mulheres sejam distinguidos. Os cientistas criminalistas ocasionalmente tm que
tratar com corpos que esto de tal forma gravemente danificados, que a anlise do DNA a
nica maneira de determinar o sexo.
ser

nhr
trs

@n

qu

me

de'

l
l

Clorunoeu Guca e ANLtsE oe

adultos e de

DNA

341

(a) A rvore genealgica da amlia Romanov

e quars ao

devetsar e da tsariTsarina Alexandra

por
que o pal e
esses mesde pessoas

amostras

nitoconenergia das
Anastsia

inferirpaaqnele apreesndos de

mafa-

mi{mte da

(b) A anlise de STR

humana-

STRs

emo $ndo

ryirudm
crdo

m,c
IEflID'

THOl
Criana

8,10

15,16

Criana 2

7,8

15,16

Criana 3

8,10

15,16

Mulher adulta

8,8

1s,16

Mulher adulta 2

o,o

16,17

Homem adulto

hlsir

cfr-

VWN?l

9,10

14,20

Homem adulto 2

6,10

17,17

Homem adulto 3

7,10

15,16

Homem adulto 4

6,9

15,17

Figura 16.4
A anlise de repeties curtas em tandem dos ossos dos Romanov. (a) A rvore genealgica da amlia Romanov. (b) Os resultados das anlises de STR. THO| e VWA/gl so os nomes dos dois lcus de srR. os nmeros nas colunas (8, 10, etc.) so os de repeties para
os alelos determinados em cada indivduo. O resultado com THOI mostra que a mulher
adulta 2 no pode ser a me das crianas, porque ela possui somente o alelo 6, o qual nenhuma das crianas possui. A mulher adulta 1, no entanto, possui o alelo g, o qual todas as
trs crianas aprsentam, e, dessa maneira, ela identiicada como a tsarina. O resultado
com THol exclui o homem adulto 4 de ser o possvel pai das crianas, mas no permite
que os outros trs homens adultos sejam distinguidos todos poderiam ser o pai de pelo
menos duas crianas. Entretanto, o resultado com VWNS| exclui os homens adultos 1 e 2,
de orma que o homem adulto 3 identiicado como o tsar.

U2

T.A. Bnowr.r

Testes de DNA tambm podem ser utilizados para


a identificao do sexo de uma criana
que ainda no nasceu. A descoberta de que um
feto um menino u uma meninu Jg".ut-"nte retardada at que as diferenas anatmicas tenham
se desenvolvido e o sexo poss ser iden-

tificado por meio de uma ecografia, mas, sob determinadas


circunstnciar,

u-u

indicao

mais precoce do sexo desejvel. Um exemplo quando pedigreeda


o
famlia indica que um
menino ainda no-nascido poder apresentar u- do"nu -tr"r"it.iu
e os pais gostariam de
decidir com antecedncia a respeito de continuar ou no a gestao.
uma terceira aplicao da identificao do sexo com bse no DNA
- e que tem sido responsvel por muito do desenvolvimento nesse campo

a
anlise
de
espcirnes
arqueolgicos' Esqueletos de homens e mulheres podem ser ditinguidos
se os seus ossos-chave, tais como o crnio ou a plvis, estiverem intactos, mas com cadveres
incompletos, ou cadveres de
crianasjovens, no existem diferenas anatmicas sexuais especfics
suficientes para que
uma identificao precisa seja realizada. Se DNA antigo
estiver presente nos ossos, um mtodo com base no DNA poder informar aos arqueologistas
se eles esto tratando com um homem ou com uma mulher.

16.3.1 PCRs direcionadas a seqncias especicas do cromossomoy

16.3.2 PCF

Aca

cias t

cador

para.
que a

dos p
te tr

quan
onde
outra

um

ir

rente

pois

A maneira mais simples

de utilizar a anlise do DNA para determina.r o sexo planejar


uma
PCR especficapata uma regio do cromossomo Y. A PCR
deve ser planejada com cuidado,
pois os cromossomos X e Y no so completamente
diferentes,
lgun, segmentos sendo
compartilhados entre ambos. Porm, h muitas regies nicas "oy. Em
dentro Jo
especial, existem virias seqncias repetidas qu" tao localizadas
apenas"ro--orromo
no cromossomo y,
as quais atuam como alvos mltiplos para a PCR
e, portanto, fornecm uma maior sensibilidade, uma considerao importante, caso se esteja
trtando com um corpo extremamente danificado ou com um osso muito antigo.
A PcR direcionada a seqncias especficas do cromossomoy poder
fornecer um produto com o DNA de homem, mas nenhuma banda, caso
a amostra u"nhu d. u-u
-uitr..Figura
16'5)' Essa uma distino clara entre as duas alternativas
e, portanto, um sistema perfeitamente satisfatrio para a maioria das aplicaes. Mas,
e se a amostra no conver qualquer
DNA ou se o
estiver muito degradado para se trabalhar em uma pcR,
ou se a amostra
fNA
tambm possuir
da DNA-poli-"rui" de Taq,de maneira que a pcR no
funcione?
il|igores
Todas essas possibilidades podem ocorrer com espcimes
arqueolgicos, especialmente aqueles que foram enterrados no solo e tornaram-se contaminados
com cidos hmicos e outros
compostos conhecidos por inibirem a maioria das enzimas
utilizadas na pesquisa em biologia
molecular' Nesse momento, o teste torna-se incerto, porque
um espcime qu" in"upuz de fornecer um produto de PCR por uma ou mais razes poderia
ser enonemente identificado como uma mulher. o resultado seria exatamente o mesmo:
nenhuma banda no gel.

(r

Figura 16.5

1. DNAs marcadores

2. DNA de homem
3. DNA de mulher
4. PCR fracassada

A identiicao do sexo por


meio da PCR de uma seqncia de DNA especica
do cromossomo y. O DNA de
homem origina um produto
de PCR (linha 2), mas o
DNA de muther, no (tinha
3). O problema que uma
PCR racassada (linha 4) origina o mesmo resultado que
o DNA de mulher.

Figr

A idr
gen(

origi
Gae

PCF

pos

Ct-orunoeu GNrcA E ANLrsE oe

macriana
irnngealnen-

gmraseridenmml indicao

icaqueum

gMiam

de

rcm sido res-

ueolgitais co.
mcadveres de
paa qu
um m-

moq

oornum

[g-

planejar rtma

DNA

343

16.3.2 PCR do gene da amelogenina


A carncia

na discriminao entre "mulher" e "PCR fracassada" que ocorre quando seqncias especficas do Y so estudadas levou ao desenvolvimento de testes de DNA mais sofisticados para a identificao do sexo, alguns dos quais fornecem resultados inequvocos, tanto
para homens quanto para mulheres. O mais amplamente utilizado desses testes envolve PCRs
que amplificam o gene da amelogenina.
O gene da amelogenina codifica uma protena encontrada no esmalte do dente. Ele um
dos poucos genes que esto presentes no cromossomoY e, como a maioria desses genes, existe tambm uma cpia no cromossomo X. Porm, as duas cpias so bastante idnticas, e,
quando as seqncias de nucleotdeos so alinhadas, um grande nmero deindels, posies
onde um segmento de DNA pode ter sido tanto inserido em uma seqncia como deletado de
outra, identificado (Figura 16.6a). Se os iniciadores de uma PCR anelarem nos dois lados de
um indel, os produtos obtidos a partir dos cromossomos X e Y apresentaro tamanhos diferentes. O DNA da mulher fornecer uma nica banda quando os produtos forem examinados,
pois as mulheres tm apenas o cromossomo X, enquanto os homens iro apresentar duas ban-

(a) Parte do gene da amelogenina

com cuidado,
sendo
Y. Em

Cromossomo Y

cromossomoY,
maior sensibili-

Cromossomo X

da-

umprodumulher (Figrrra
sistema perfeitaiver qualquer

Deleo de 6 pb na seqncia
do cromossomo X

(b) Resultados das PCRs

se a mostra

no funcione?
aquehinicos e outros
isa em biologia
incapazde foridenti-ficado cogel.

:_-_
1. DNAs marcadores

2. DNA de homem
3. DNA de mulher
4. PCR fracassada

clo sexo por


de uma seDNA especica
Y. O DNA de

um