Você está na página 1de 22

UniversidadeFederaldeSoPaulo

CampusDiadema
DepartamentodeCinciasBiolgicas

ExercciosGentica2013

Professores:IleanaRubi
JoelMachadoJr.
KatiaC.M.Pellegrino
MarceloA.Vallim
MarielleC.Schneider

BibliografiaBsica:
GriffithsAJ,WesslerSR,LewontinRC,CarrollSB.2009.IntroduoGentica,9edio.GuanabaraKoogan.
PierceBA.2011.Gentica:umenfoqueconceitual.3edio.GuanabaraKoogan.
NussbaumRL,McInnesRR,WillardHF.2008.GenticamdicaThompson&Thompson.7aedio.Elsevier.

PadresdeHeranaAutossmica

1.Doiscobaiasforamcruzadose,durantevriosanos,produziramumaprolecom29filhotesdepelagempreta
e9depelagembranca.Expliqueessesresultados,fornecendoosgentiposdosgenitoresedaprole.

2.Socruzadososseguintesgentipos:AaBbCcDdXAaBbCcDd,Citeaproporodaproledestecruzamento
quepossuiosseguintegentipos:AaBbCcDd;aabbccdd;AaBbccDd.

3. Em milho, os gros prpura so dominantes em relao aos amarelos e gros cheios so dominantes em
relao a murchos. Uma planta de milho de gros prpura e cheios cruzada com uma planta de gros
amarelosemurchos,sendoqueaseguinteprolefoiobtida:
Prpura,cheio..112
Prpura,murcho....103
Amarelo,cheio..91
Amarelo,murcho...94
Quais os gentipos provveis dos genitores e da prole? Teste sua hiptese gentica utilizando o teste do
quiquadrado.

4. Suponhaquepara determinadogeneemumorganismo diplide,sonecessrias 8unidadesdeprodutos


proticosparaofuncionamentonormal.Cadaalelotiposelvagemproduzcincounidades.Seumamutaocria
umalelonulo,vocachaqueessealeloserrecessivooudominante?

5.Umalelorecessivoraroherdadodemodomendelianocausaadoenagalactosemia.Essadoenacausada
pela inabilidade em processar galactose, levando ao mau funcionamento muscular, nervoso e renal. Um
homemfenotipicamentenormalcujopaitemgalactosemiacasousecomumamulher,cujairmtambmtem
adoena.
a.Desenheoheredogramacomasinformaesdescritas,indicandoopossvelgentipodaspessoas.
b.Qualaprobabilidadedequeumfilhodessecasaltambmtenhagalactosemia?

6. Para os seguintes heredogramas, diga se a condio anormal dominante ou recessiva. Cite a lgica
subjacentesuaresposta.

7.Completeasseguintessentenascomotermoadequado:
Alelo
Homozigoto
Caractersticadescontnua
Locus
Cruzamentorecproco
Recessivo
Cruzamentoteste
Retrocruzamento
Dominante
Selvagem
Gene
Gentipo
Fentipo
Heterozigoto

a. ______________________ Exibe apenas alguns fentipos facilmente distinguveis. Um exemplo a forma da


sementedeervilha,aqualpodeserlisaourugosa.
b.______________________CruzamentoentreumindivduodaF1eumdosgentiposparentais(P).
c.______________________Conjuntodegenesqueumindivduopossui.
d. ______________________ Cruzamentos nos quais os fentipos dos genitores masculino e feminino so
revertidos.
e.______________________Refereseacaractersticaqueexpressanosindivduoshomozigotoseheterozigotos.
f.______________________Refereseaoindivduoquepossuidoisalelosidnticosemumlcus.
g.______________________Umadentreasformasalternativasdeumgene.
h.______________________Refereseaofentipoqueexpressoapenasquandoemhomozigose.
i.______________________Formanomutantedeumgene.
j.______________________Posionocromossomoondeestsituadoumgeneespecfico.
k.______________________Indivduoquepossuidoisalelosdiferentesemumlcus.
l.______________________Fatorgenticoqueajudaadeterminarumacaracterstica;emgeral,definidocomouma
seqnciadeDNAquetranscritaemumamolculadeRNA.
m.______________________Cruzamentoentreumindivduocomumgentipodesconhecidoeumindivduocom
gentipohomozigotorecessivo.
n.______________________Aparecimentooumanifestaodeumacaracterstica.

Determinaodosexo,HeranaligadaaosexoeHeranacitoplasmtica

1. A fenilcetonria (PKU) uma doena autossmica recessiva que resulta de um defeito em uma enzima que
normalmente metaboliza o aminocido fenilalanina. Quando esta enzima est defeituosa, altos nveis de um
derivadodefenilalaninacausamdanocerebral.Nopassado,amaioriadascrianascomPKUapresentavamretardo
mental. Atualmente, o retardo mental pode ser evitado nas crianas com essa doena controlandose
cuidadosamenteaquantidadedefenilalaninanadieta.Comoresultadodessetratamento,muitaspessoascomPKU
esto atingindo a idade reprodutiva sem retardo mental. Ao final da adolescncia, quando o desenvolvimento do
sistemanervosocentraljestcompleto,
muitaspessoascomPKUdeixamadietarestritiva.OsfilhosdemulherescomPKU,quenofazemmaisrestriode
fenilalanina, freqentemente tm baixo peso ao nascimento, anomalias no desenvolvimento e retardo mental,
muitoemborasejamheterozigotosparaoalelorecessivodePKU.Entretanto,osfilhosdeumhomemcomPKUno
temessesproblema.Forneaumaexplicaoparaessasobservaes.

2. Na planta ornamental maravilha, as ramificaes podem ser verdes, variegadas e brancas. A gerao F1,
provenientedocruzamentodefloresfemininaspresentesemramosverdesoubrancos,possuiosmesmosfentipos
maternos,independentedogenitormasculino.Emqualquercruzamentoemqueaflorfemininaseencontraemum
galhovariegado,aprognieapresentaplantasverdes,variegadasoubrancas,damesmaforma,independentemente
dogenitormasculino.
a.Qualaexplicaoparaaheranadacordafolha?
b.Qualoresultadoesperadodosseguintescruzamentos?
galhobrancoXgalhoverde
galhoverdeXgalhobranco
galhovariegadoXgalhobranco
galhobrancoXgalhovariegado

c.Porquplantasquepossuemfolhasvariegadassobrevivemeplantascomfolhasbrancasno?

3.Oquesegregaocitoplasmtica?

4. A produo de pigmento nos olhos dos indivduos jovens de mariposa do gnero Ephestia est relacionada ao
efeito materno.Aoatingiroestgioadulto,acordosolhospodeficar claraouescura,dependendonestafaseda
vidadogentipodoindivduo.Aproduodequinurenina(substnciaqueresultanapigmentaoescuradoolho)
est relacionada ao alelo dominante Q. A partir do cruzamento entre uma fmea heterozigota com um macho
homozigoto recessivo, indiqueo gentipoe a proporo fenotpica esperada na prole quando joveme noestgio
adulto.

5.Ocasionalmente,umcromossomoXdecamundongosequebraemdoisfragmentos,ecadafragmentoficaligadoa
um autossomo diferente. Nesse evento, apenas os genes de um dos fragmentos sofreram inativao do X. O que
essaobservaoindicasobreomecanismodeinativaodoXemmamferos?

6.Umhomem euma mulhertmvisonormal, emborao pai deambospossua daltonismoverdevermelho,uma


heranarecessivaligadaaocromossomosexualX.Desenheoheredograma,mencionandoogentipodosindivduos
eindiqueaprobabilidadedosfilhosdestecasalserem:
a.Ummeninocomvisonormalparaascoresverdevermelho
b.Umameninacomvisonormalparaascoresverdevermelho
c.Ummeninodaltnico
d.Umameninadaltnica

7.Emovelhas,apresenadechifresproduzidaporumaleloautossmicoquedominanteemmachoserecessivo
em fmeas. Uma fmea com chifres cruzada com um macho sem chifres. Uma das fmeas resultantes de F1
cruzadacomummachosemchifres.Queproporodaproledemachosefmeasdessecruzamentoterchifres?

8.Desenheumheredogramaquerepresenteumacaractersticaautossmicadominante,limitadaaosexomasculino,
eexcluaapossibilidadedequeacaractersticasejaligadaaoY.

9.Umhomemcomumdefeitonoesmaltedentrio,oqualresultanacoloraoamareladadosdentes,casasecom
umamulhernormalparaestacaracterstica.Todasastrsfilhasdocasaltmdentesamarelados,masosfilhosso
normais. Os filhos casamse com mulheres normais e todas as crianas tm esmalte dentrio normal. As filhas
tambmsecasamcomhomensnormais,porm50%dascrianaspossuemdentesamarelados.Dopontodevista
gentico,comovocexplicaestefato?

10.AlgumasDrosophilasomuitosensveisaodixidodecarbono.Talsensibilidadeumcasodeheranamaternae
est relacionada ao alelo recessivo de um gene denominado sigma. Quais so os resultados esperados dos
cruzamentos:sensvelXresistente;resistenteXsensvel.

11.Umhomemcomumacaractersticagenticaespecficaincomumcasasecomumamulhernoafetada,eeles
tmquatrofilhos.Oheredogramadessafamliamostradoabaixo,masapresenaouausnciadacaractersticanas
crianasnoestindicada.Paracadatipodeherana,indiquequantascrianasdacadasexoseesperaqueexpresse
acaracterstica.Suponhaqueofentipodopairaroetotalmentepenetrante.
CaractersticarecessivaligadaaoX
CaractersticadominanteligadaaoX
CaractersticaligadaaoY

11.UmgeneticistacruzoufmeasdeDrosophilaquetinhamolhosbrancosecoloraodocorpoescuro(ebony)com
machos selvagens. Sabese que para estas duas caractersticas os fentipos selvagens so dominantes sobre os
mutantes.NageraoF1,todasasfmeastinhamolhosvermelhosecorpocinzaenquantoqueosmachostinham
olhosbrancosecorpocinza.AsmoscasdaF1foramintercruzadasparaobterseumageraoF2.Os384indivduos
daF2foramclassificadosdeacordocomoseufentipo,conformemostradoabaixo:
Cordosolhos Cordocorpo Prole

Branco
Ebony
2021
Branco
Cinza
7073
Vermelho
Ebony
2825
Vermelho
Cinza
7671
Expliqueotipodeheranaparaacordosolhosedocorpo,indicandoogentipodosindivduos.

12.ComoadeterminaodosexonosistemaXY/XXdiferedosistemaZZ/ZW?

13.TantoaespciehumanacomoasmoscasdefrutaspossuemcromossomossexuaisdotipoXY/XX.Pormhuma
diferenanadeterminaodosexoentreessesorganismos.Expliquetaldiferena.

14.Nopeixemosquito,quetemumadeterminaosexualdotipoXY/XX,asmanchasnocorposoherdadascomo
umacaractersticaligadaaoY.Acaractersticaexibe100%depenetrnciaquandoopeixecriadoa22oC;porma
penetrnciacaipara42%quandoopeixecriadoa26oC.Ummachocommanchascruzadocomumafmeasem
manchaseaF1entrecruzadaparaproduziraF2.Setodaaproleforcriadaa22oC,queproporodaF1eF2ter
manchas?Aocontrrio,setodaaproleforcriadaa26oC,queproporodaF1termanchas?

15.Determineopadrodeheranadosheredogramasmostradosaseguir.

16.Quaissoascaractersticaquedevemoslevaremconsideraoquandofazemosaanlisedeheredogramasde
distrbiosrecessivosligadosaoX?

17.Quaissoascaractersticaquedevemoslevaremconsideraoquandofazemosaanlisedeheredogramasde
distrbiosdominatesligadosaoX?

18.QualafunodogeneSRYeondeeleselocaliza?

19.AhipertricosenaorelhamasculinaumacaracteristicaligadaaoXouY?

20.Oqueumacaractersticainfluenciadapelosexo?Doexemplodabarbadobode

21.Oqueumacaractersticalimitadaaosexo?Doexemplodaplumagememgalinhas

22.Quaissoascaractersticaquedevemoslevaremconsideraoquandofazemosaanlisedeheredogramasde
distrbiosrecessivosligadosaoX?

23. Quaisso as caracterstica quedevemoslevar emconsideraoquando fazemosa anlisedeheredogramsde


distrbiosdominantesligadosaoX?

24.QualafunodogeneSRYeondeeleselocaliza?

25.AhipertricosenaorelhamasculinaumacaractersticaligadaaoXouY?

VejanolivrodoPierce,B.2004GenticaumenfoqueconceitualCapitulo5eresponda:

26.Oqueumacaractersticainfluenciadapelosexo?Doexemplodabarbadobode.

27.Oqueumacaractersticalimitadaaosexo?Dexemplodaplumagememgalinhas.

Extensesemodificaesdomendelismo

1. O diagrama abaixo representa um gel de eletroforese. As linhas direita indicam as posies nas quais os
fragmentos de DNA podem migrar de acordo com os seus tamanhos. A posio de um fragmento de DNA que
correspondeapartecodificantedeumgene,extradodeumorganismocom gentiposelvagem(AA)mostrada.
Considerandoqueoalelomutantea1possuiumainserode2kbemrelaonaseqnciadoaleloselvagemeque
o alelo mutante a2 tem uma deleo de 1kb, represente as bandas de DNA no gel de eletroforese que seriam
esperadasdeacordocomogentipodosindivduos.

2. Em humanos, a doena galactosemia causa retardo mental durante a infncia. A lactose (acar do leite)
degradada em glicose e galactose. Normalmente, a galactose decomposta pela enzima galactose1fosfato
uridiltransferase(GALT).Entretanto,empacientescomgalactosemia, GALTinativa,levandoaoacmulodealtos
nveis de galactose, a qual, no crebro, causa retardo mental. Que tratamento para a cura secundria da
galactosemiavocsugere?

3. Cinco casais numerados de 1 a 5 so mostrados na tabela abaixo, incluindo seus respectivos fentipos para o
grupo sanguneo ABO, MN e fator Rh. Cada casal teve apenas um dos cinco filhos apresentados na tabela.
Considerandoasinformaesfornecidas,indiquequalcrianapertenceacadacasal.
Fentipoparental
(1)A,M,RhXA,N,Rh
(2)B,M,RhXB,M,Rh+
(3)O,N,Rh+XB,N,Rh+
(4)AB,M,Rh+XO,N,Rh+
(5)AB,MN,Rh XAB,MN,Rh

Fentipodosfilhos
(a)A,N,Rh
(b)O,N,Rh+
(c)O,MN,Rh
(d)B,M,Rh+
(e)B,MN,Rh+

4.Emhumanos,aPKU(fenilcetonria)umadoenacausadapelaineficinciaenzimticanaetapaAdaseqncia
simplificadadereaes,eaAKU(alcaptonria)devidaeumaineficinciaenzimticaemumadasetapas,resumida
aquicomoB:
AB
FenilalaninatirosinaCO2+H2O
UmapessoacomPKUcasasecomumapessoacomAKU.Quefentiposvocesperaparaseusfilhos?

5. Entre raposas criadas surgiu uma mutao que deu cor de pelagem platina. A cor era de grande interesse dos
criadores, os quais no conseguiam desenvolver uma linhagem pura de platina. Toda vez que duas platinas eram
cruzadas,apareciamnaprolealgumasraposasselvagens.Porexemplo,asreproduesrepetidasentreummesmo
casal de raposas platina produziu 82 platinas e 38 com colorao selvagem. Todos os outros cruzamentos com
parentais platina resultaram em prole com propores semelhantes de pelagem. Formule uma hiptese gentica
concisaquejustifiquetaisresultados.

6.Umamulherquetemumpoodlealbino(umfentipoautossmicorecessivo)desejaobterfilhotesbrancos.Assim,
elalevouocoaumcriador,quedissequeiriacruzarafmeacomummachoalbino,tambmdeumestoquepuro.
Quandonasceramosseisfilhotes,todoserampretos.Amulherprocessouocriador,alegandoqueelesubstituiuo
machoporumcopreto,dandoosseisfilhotesindesejados.Vocfoichamadocomoespecialistatestemunha,ea
defesalheperguntasepossvelproduzirprolepretadedoisalbinosrecessivospuros.Quetestemunhovocdaria?

7. A sndrome Marfan um distrbio do tecido conjuntivo fibroso, caracterizada por muitos sintomas, incluindo
dedosfinos,defeitosocularesedoenacardaca.
a.UseoheredogramamostradoaseguirparaproporummododeheranaparaasndromeMarfan.

b.Quefenmenosgenticossomostradosnoheredograma?Explique.

8.Foramisoladosvriosmutantes,todososquaisrequeremocompostoFparacrescimento.Oscompostos(AeE)
naviabiossintticaparaFsoconhecidos,massuaordemnavianoconhecida.Cadacompostotestadoquanto
asuahabilidadedeapoiarocrescimentodecadamutante(1a5).Noquadroseguinte,umsinal+indicacrescimento
eumsinalindicafaltadecrescimento.
a.QualaordemdoscomponentesdeAaEnavia?b.Emquepontodaviacadamutanteestbloqueado?

Mutante1
Mutante2
Mutante3
Mutante4
Mutante5

+
+

+
+

D
+
+

+
+

F
+
+
+
+
+

9.Emcebola,acordobulbopodeseramarela,roxaoubranca.Docruzamentoentreplantashomozigotascombulbo
roxoebulbobranco,foiobtidonageraoF2aproporode9roxos:3amarelos:4brancos.
a. Qual aexplicao gentica para esteresultado?b.Estabelea um esquemaque explique bioquimicamenteeste
resultado.

10. A cor de pelagem das raposas pode ser negro, platina (azul acinzentado) o zafira (azul muito claro). Nos
cruzamentosaseguirforamobtidasasseguintesF1:
negroxzafira:Todosnegros.
negroxzafira:1/2negros+1/2zafira
negroxzafira:1/2negros+1/2platina
zafiraxzafira:Todoszafira
platinaxzafira:1/2platina+1/2zafira
Qualhipteseexplicariamelhoressesresultados?

11.Umcachorronegro,cujopaierabranco,cruzacomumacadelacinza,cujameeranegra.Sabesequeacorda
pelagem negra dominante sobre a branca nos machos e observase dominncia incompleta nas fmeas,
apresentando cor cinza. Explique como sero os gentipos dos cachorros do cruzamento citado e os gentipos e
fentiposdosfilhotes.

Ligao,RecombinaoeMapeamentoGnicoemEucariotos

1. Uma srie de cruzamentos de dois pontos envolve sete loci, produzindo as seguintes freqncias de
recombinao.Usandoestas
freqnciasderecombinao,mapeieosloci,mostrandoosgruposdeligaoeaordemdasdistnciasentreosloci
decadagrupodeligao.
a,b10;a,c50;a,d14;a,e50;a,f50;a,g50;b,c50;b,d4;b,e50;b,f50;b,g50;c,d50;c,e
8;c,f50;c,g12;d,e50;d,f50;d,g50;e,f50;e,g18;f,g50.

2. No tomateiro, o alelo que condiciona planta alta (D) dominante em relao aquele para planta an (d). A
presenadepilosidadenofrutodependedoalelorecessivop,enquantooaleloPcondicionafrutoslisos.Apsum
cruzamentoteste,oseguinteresultadofoiobtidonaprole:5anelisa,118anepilosa,5altaepilosa,161altae
lisa.
a. Qual a freqncia esperada de cada fentipo a partir de um cruzamentoteste, se os genes apresentarem
distribuioindependente?
b.Deacordocomasuarespostanoitema,qualaexplicaoparaosresultadosobtidos?
c. Esquematize as situaes que ocorreram no paquteno, anfase I e telfase II, nos meicitos do indivduo da
geraoF1.

3. Um cruzamento entre indivduos com os gentipos a+ab+b X aabb, produz a seguinte prole: a+ab+b=122;
a+abb=79;aab+b=81;aabb=118.
a.OsgenesdoslcusAeBestoligados?
b.Seosgenesestiveremligados,qualadistnciaentreosdoisloci?
c.Osalelosnogenitorheterozigotoestoemqualconfigurao?Justifique.

4.Emumadeterminadaespciedeplanta,acoloraoalaranjadadaflor(s)recessivaemrelaoacoloraoazul
(S); o estigma vermelho (r) recessivo em relao ao estigma verde (R), e o estilete longo (l) recessivo se
comparadoaoestiletecurto(L).Umindivduotriploheterozigotoparaosgenesacimamencionadosfoisubmetidoa
umcruzamentoteste,resultandonaprole
Fentipo
Nmerodeindivduos
Floralaranjada,estigmaverde,estiletecurto
27
Floralaranjada,estigmavermelho,estiletecurto 85
Florazul,estigmavermelho,estiletecurto
402
Floralaranjada,estigmavermelho,estiletelongo 977
Floralaranjada,estigmaverde,estiletelongo
427
Florazul,estigmaverde,estiletelongo
95
Florazul,estigmaverde,estiletecurto
960
Florazul,estigmavermelho,estiletelongo
27

a.Expliqueos resultadosobtidos,indicando ogentipoda prole,dagerao parental eestabelecendoomapade


ligao.
b.Desenheosalelosemsuasposiesadequadasnoscromossomosdotriploheterozigotoeindiqueaconfigurao
dosalelos.
c.Seforapropriadodeacordocomsuaexplicao,calculeainterfernciaeexpliqueosignificadodovalorobtido.

5.Comofeitoomapeamentodecentrmero?

6.Quaissoostiposdeorganismosquepodemosempregarparamapearmosocentrmero?

7.Considereumaespciedepeixeondeocorrem3genesligadoscomaseguinterelaodedominncia:
b+dominantesobreb
w+dominantesobrew
c+dominantesobrec

Aorealizarmosumcruzamentoteste(F1xPhomozigotorecessivo),foramobtidasasseguintesclassesgenotpicas
comosrespectivosnmerosdepeixesporclasse:
b+w+c/bwc=382
bwc+/bwc=379
b+wc/bwc=69
bw+c+/bwc=67
b+wc+/bwc=48
bw+c/bwc=44
bwc/bwc=6
b+w+c+/bwc=5
a)Quaisosgruposnaprolequerepresentamostiposparentaisounocrossing?
b)Quaisosgruposnaprolequerepresentamostiposcrossingduplo?
c)Qualaseqnciacorretadosgenes?
d)Quaisasdistnciasentreosgenes?
e)Hinterferncia?Seafirmativo,qualoseuvalor?
f)Construaomapa

8.Apartirdosfentiposdadosnoquadroabaixoparacruzamentostestedetrspontospara(1)a,b,ce(2)b,c,d,
determineaseqnciadosquatrogenesa,b,ced,eastrsdistnciasdemapaentreeles.Osfentiposrecessivos
sosimbolizadosporletrasminsculaseosfentiposdominantesporsinais+.
1
2
+++669
bcd8
ab+139
b++441
a++3
b+d90
++c121
+cd376
+bc2
+++14
a+c2280
++d 153
abc653
+c+65
+b+2215
bc+141

9.OslociAeBdistamumdooutro10cM.Docruzamentotestaabaixoqualaproporodaprole?

A
B
a
b

a
b
a
b

Genticabacterianaeseusvrus

1.Descrevaciclolticoeciclolisognico.corretoafirmarqueumbacterifagocomciclolisognicopodetambm
desenvolverocicloltico.Justifiquesuaresposta.

2.QualadiferenaentreumabactriadoadoracomoplasmdiocontendooFatorFeoutradefinidacombactria
comaltafreqnciaderecombinao(Hfr)?

3.Definaconjugaobacteriana.Enumerequaisfatoresestoenvolvidosquequaissoospassosnesseprocesso.

4. Aps a conjugao de uma bactria doadora contendo o plasmdio com o fator F com uma receptora F, voc
esperariaoaparecimentodeduasclulasF+?VocesperariaomesmodaconjugaodeumabactriaHfrcomoutra
F?Justifiquesuasrespostas

5.Atransduodomaterialgenticobacterianodeumacpamediadoporumvrus.Descrevaquaissoostipos
possveisdetransduo.

Princpiosbsicosdecitogentica

1.Respondaositensabaixo:
a)Quaissoascaractersticascromossmicasutilizadasparadescriodeumcaritipo,empregandosecolorao
convencional?
b) Discuta como tcnicas de colorao diferencial dos cromossomos podem auxiliar na resoluo de problemas
prticosdasdiferentesreasdagentica.
c)Diferencieeucromatinadeheterocromatinaquantonaturezaefuno.

2.Definaasseguintesregiescromossmicas:
a)Cromtidesirms
b)Centrmero
c)Telmero
d)RONs

3. Descreva, em detalhes, a estrutura da cromatina dos eucariotos e explique como ocorre o processo de
empacotamentodoestgiodefibrade10nmatocromossomometafsico.

4.Descrevaaestruturadeumcromossomometafsicoesuaclassificaoquantoposiodocentrmero.

5. Considere uma clula com nmero diplide de 2n=8 cromossomos, sendo o primeiro par metacntrico de
tamanhogrande,osegundoacrocntricodetamanhomdio,oterceirosubmetacntricodetamanhomdio,mas
menorqueosegundopar,eoquartotelocntricodetamanhopequeno:
a)Qualonmerofundamental(NF)debraoscromossmicosnestaclula?
b)Quantascromtidesexistemnafasedemetfasemittica?
c) Faa uma representao esquemtica dos cromossomos durante a anfase da mitose, levando em conta os
diferentestiposmorfolgicospresentesnaclula.

6.Considerandooscromossomosemmetfasemitticadaclulamostradaabaixo,determine:
a)Onmerodiplide(autossomosecromossomosexual).
b)Amorfologiadoscromossomos.
c)Quaisostiposdegametasformadosporestemachodegafanhoto?
d) Supondo que a clula metafsica mostrada na foto completasse o processo de diviso mittica, quantos
cromossomos(autossomosesexuais)seriamobservadosnasclulasfilhas?

7.Diferenciemutaocromossmicademutaognica.Comosoclassificadasasmutaescromossmicas?

8.Diferencieeuploidiadeaneuploidia.Almdisso:
a)Expliqueaorigemdessesmecanismosatravsdeexemplos.
b)Comentesobreovalordospoliplidesvegetaisparaohomem.

9.Expliqueadiferenaentreindivduosautopoliplidesealopoliplides.

10.Porquosindivduostriplidessonormalmenteestreis?Dexemplo.


11.Expliqueomecanismodeorigemdasaneuploidias.ExemplifiqueatravsdaSndromedeDown.

12.Compareasconseqnciasderearranjosestruturaisbalanceadosenobalanceados.

13. Uma mulher normal (2n=46, XX) casada com um homem portador de uma translocao (Robertsoniana)
equilibradaentreumelementodopar21eumdoselementosdopar22(2n=45,XY,t(21q;22q).Esquematize(com
asrespectivaslegendase/ouexplicaes)ostiposdedescendentesqueessecasalpodeoriginar.

14. Um homem normal (2n=46, XY) casado com uma mulher portadora de uma translocao (Robertsoniana)
equilibrada entre um elemento do par 21 e um dos elementos do par 13 (45, XX, t(13q,21q). Sabendose que a
trissomia do cromossomo 13 causa a Sndrome de Patau e que monossmicos para autossomos so abortados,
esquematize os tipos de descendentes que esse casal pode originar, citando a porcentagem de prole normal e
afetadapelasSndromedeDownePatau.

15. Diferencie, quanto a constituio citogentica, as sndromes de Klinefelter, Down e Turner. Qual o principal
mecanismodeorigemdessasaneuploidias?

16.UmaespciediplideA(2n=4)aparentadaaumaespciediplideB(2n=6).Descrevaosmecanismosdeorigem
nosseguintespoliplides,especificandoonmerodecromossomosdecadaumdeles:
a)umautotriplideparaaespcieA;
b)umalotetraplideapartirdasespciesAeB.

17. Em uma espcie de planta com 2n=16 cromossomos, qual ser o nmero de cromossomos encontrados por
clulanosseguintesmutantes:a)monossmico;b)autotetraplide;c)tetrassmico;d)autopentaplide.

ElementosdeTransposio

1.Emboraoselementostransponveisdaclasse2sejamabundantesnosgenomasdeeucariontesmulticelulares,os
elementos da classe 1 geralmente constituem a maior frao dos genomas muito grandes, tais como os dos
humanos, milho e cevada. Considerando o que voc sabe sobre os elementos da classe 1 e 2, o que h nesses
mecanismosdistintosdetransposioqueexplicariaessadiferenadeabundncia?

2.Antesdaintegraodeumtransposon,suatransposasefazumcortedesencontradonoDNAalvodohospedeiro.
Seoscortessonosstiosindicadospelassetasaseguir,desenhecomoseraseqnciadoDNAhospedeiroapso
transposontersidoinserido.Representeotransposoncomoumretngulo.

5AATTTGGCCTAGTACTAATTGGTTGG3
3TTAAACCGGATCATGATTAACCAACC5

3.Quaisassimilaridadesediferenasentreretrovrus,retrotransposonsetransposons?

4.Umdeterminadoelementodetransposiogerarepetiesflanqueadorasdiretasquetm4pbdetamanho.Cite
aseqnciaqueserencontradaemambososladosdeumelementodetransposioseesteelementoseinserirna
posioindicadanaseguinteseqnciadeDNA.

5ATTCGAACTGACCGATCA3

5.UmalinhagemdeE.coliresistenteaoantibiticoestreptomicinaeaoutralinhagemresistenteaoantibitico
ampicilina.Asduaslinhagensforamcultivadasjuntaseentoplaqueadasemmeioseletivocontendoestreptomicina
eampicilina.Surgiramvriascolnias,indicandoqueasclulasadquiriramresistnciaaambososantibiticos.Sugira
ummecanismoparaexplicaraaquisiodaduplaresistncia.

6.Quecaractersticasgeraissoencontradasemmuitoselementosdetransposio?

7.Comooselementosdetransposioparticipamnadisseminaodaresistnciaaantibiticosembactrias?

8. Quais dos seguintes pares de seqncias de DNA podem ser encontradas nas repeties terminais de uma
seqnciadeinsero?Explique
a)5GAATCCGCA3e5ACGCCTAAG3
b)5GAATCCGCA3e5CTTAGGCGT3
c)5GAATCCGCA3e5GAATCCGCA3
d)5GAATCCGCA3e5TGCGGATTC3

9.Citetrshiptesesqueexplicamaamplaocorrnciadoselementosdetransposionogenomadosorganismos
procarionteseeucariontes.

10.PorqueoselementosdetransposiosoclassificadosemtransposonsdeDNAetransposonsdeRNA?Quala
diferenaeasprincipaiscaractersticasdecadaumdeles?
11.Comoelementosdetransposioautnomosenoautnomosdiferem?

12.Comopodemoshumanossobreviverdadoque45%dogenomahumanoderivadodeelementosmveis?

13.Estabeleaarelaoentreelementosdetransposioerearranjoscromossmicos.

14.Comentecomooselementosdetransposiopodemserutilizadoscomoferramentasbiolgicasteis.

Genticadepopulaes

1.Quaissoasforasevolutivasquecausammudanasnasfreqnciasallicasnaspopulaes?Escolhaumdelese
explique.

2.Calculeasfreqnciasallicasegenotpicasparaasseguintespopulaes.Escolhaumadelaseverifiqueseest
emequilbriodeHardyWeinberg.
a)AAAaaab)AAAaaac)AAAaaa
D=20H=50R=30D=80H=100R=120D=40H=220R=240

3.Umalelocausadordeumadoenararanamaioriadaspopulaesincomumenteencontradoemaltafreqncia
emumadeterminadapopulao.Comovocexplicariaessefato?

4.Relacioneseleonaturalearesistnciabacterianaaosantibiticos.

5.Umafileiraextradecliosumacaractersticaautossmicarecessivaqueocorreem900dos10.000residentesde
umailhadoPacficosul.Calculeasfreqnciasgnicasegenotpicasnessapopulao.

6.Emumapopulaodecamundongos,existemosalelosA1eA2.Nessapopulao,384camundongosapresentamo
gentipoA1A1,210ogentipoA1A2 e260ogentipoA2A2.CalculeasfreqnciasdosalelosA1 eA2 easfreqncias
paracadaclassegenotpica.VerifiqueseapopulaoestounoemequilbriodeH.W.

7.Adistoniaumdistrbiodemovimentoqueafeta1em1.000pessoasjudaicasdescendentesdolesteeuropeu
(ashkenazi).Qualafreqnciadeportadoresnestapopulao?

8. A acidria glutrica tipo I causa uma paralisia progressiva e dano cerebral. muito comum nos amish da
Pensilvnia(EUA),onde0,25%dosneonatostmodistrbio.Calculeaporcentagemquenotemoalelocausador
dadoena.

9.EmDrosophila,corpodecorpretaumcarterdominanteenquantocorpomarromrecessivo.Emumaamostra
de 210 drosfilas, 90 apresentam o gentipo duplo dominante, 50 so heterozigotas e 70 moscas possuem o
gentipoduplorecessivoparacordocorpo.AssumindoqueessapopulaoestemequilbriodeHardyWeinberg,
calculesuasfreqnciasallicasegenotpicas.
10.Expliquecomoumalelomutantequecausaumadoenahereditriaquandoemhomozigosepersisteemuma
populaoeporqusuafreqnciaaumentadaemcertasregiesgeogrficas.

11. A partir das informaes apresentadas abaixo, indique qual das populaes esto em equilbrio de Hardy
Weinbergutilizandootestedoquiquadrado.
a)GeneCCR5:1/1,60%;1/32,35.1%;32/32,4.9%
b)Genedahemoglobina:AA,75.6%;AS,24.2%;SS,0.2%

12.Deumapopulaodeumaespciedeinseto,foramanalisados1000indivduosquantopigmentaodotrax.
Destes,40eramgranulados,640estriadose320uniformes.ConsiderandoequilbriodeHardyWeinberg,aponteo
gentipoheterozigoto,supondoheranacodominanteeumpardealelos.

13. Em uma grande populao natural da espcie Hypotetica sp. a variabilidade para um lcus gnico (M) foi
avaliada. No gel de eletroforese, trs padres de bandas foram observados, conforme mostrado abaixo. A partir
destainformao,determineasfrequnciasallicas.

GenticaQuantitativa

1.Emumaplanta,aalturavariade6a36cm.Quandoplantascom6e36cmforam cruzadas,todasasplantasda
geraoF1apresentaramcercade21cmdealtura.NageraoF2,umavariaocontnuanaalturadasplantasfoi
observada;porm,amaioriatinhacercade21cme3das200plantaseramdealturabaixa(6cm)talcomoumdos
parentais.
a.Qualotipodeinteraoallicapredominantenadeterminaodocarteralturadaplanta?
b.Quantosgenesestoenvolvidosnadeterminaodaalturadaplantaequalacontribuiodecadaalelo?
c.Quaisospossveisgentiposdasplantascom31cm?

2.Comodiferemasherdabilidadesemsentidoamploesentidorestrito?

3.Paraaesquizofrenia,aconcordnciaparagmeosmonozigticosde60%eparagmeosdizigticosde10%.
Estesfatosmostramqueaesquizofreniaumacaractersticacomlimiardebasegentica?

4.Avariaofenotpicanaproduodeleiteemumrebanhodegadoleiteirofoianalisada,sendoqueosseguintes
componentesdevarinciaforamobtidos:
Varinciagenticaaditiva=0,4
Varinciadedominnciagentica=0,1
Varinciadeinteraognica=0,2

Varinciaambiental=0,5
Varinciadeinteraogenticoambiental=0,0

a.Qualaherbabilidadedesentidorestritoparaaproduodeleite?
b.Qualaherbabilidadedesentidoamploparaaproduodeleite?

5.AmdiaeavarinciadocomprimentodacoroladeduaslinhagensdeNicotinaedaprognie
estomostradasnatabelaabaixo.
Umparental(P1)possuicorolacurtaenquantoooutro(P2)apresentacorolalonga.
a.QualavarinciagenticaeambientalnageraoF1eF2?
b. Calcule o valor da herdabilidade em sentido amplo da F2 e explique o significado do valor
obtido.
Gerao Mdia
Varincia
P1
40,47
3,12
P2
93,75
3,87
F1
63,90
4,74
F2
68,72
47,70

6.Qualadiferenaentrecorrelaesfenotpicasegenticas?

7.Umestudiosoemgenticaquantitativadizqueaherdabilidadeemsentidorestritoparamassa
corprea em seres humanos 0,7, enquanto a herdabilidade em sentido amplo 0,3. Estes
valoresestocorretos?Explique.

8.Emumacriaodecoelhos,opesomdiodapopulaode3kg.Umcriadorselecionaos10
coelhosmaioresdessapopulao,cujopesomdiode4kg,eosendocruza.Seaherdabilidade
do peso corpreo de coelhos de 0,7, qual o peso esperado entre a prole de coelhos
selecionados?

9. O grau de comportamento antisocial uma caracterstica quantitativa em homens. Alguns


pesquisadores utilizaram dados de centenas de homens para investigar a relao entre o
comportamentoantisocialedoisfatores.Oprimeirofatoreraogentiponolocoquecodificaa
enzima monoamina oxidade A (MAOA). A MAOA age no encfalo, onde degrada vrios
neurotransmissoresqueasclulasnervosasutilizamparasecomunicar.OgeneparaaMAOAest
localizado no cromossomo X. Em conseqncia a diferenas genticas no promotor desse gene,
alguns homens tm MOAO de baixa atividade, outros, de alta atividade. O segundo fator era a

experinciademaustratosduranteainfncia.Combaseemdiversasevidncias,ospesquisadores
determinaram se cada homem havia sofrido maustratos, provveis maustratos ou graves
maustratos.Osdadosestoresumidosnogrficoabaixo.

a. A variao no comportamento antisocial, entre homens, , pelo menos em parte, devido a


diferenasambientais?Explique.
b.Ocomportamentoantisocialhereditrio?

10. O transportador da serotonima uma protena de superfcie celular que recicla o


neurotransmissorserotonina,depoisdetersidousadoparatransportarumamensagementreas
clulas nervosas no encfalo. Existem dois alelos do gene transportador de serotonina: s e l.
Alguns pesquisadores descobriram que as pessoas com gentipos sl e ss apresentaram escores
mais altos que as pessoas com gentipo ll em teste de neuroticismo, conforme mostra a figura
abaixo.
a.Essesdadossocompatveiscomahiptesedequeogenedotransportadordaserotonina
umQTLqueinfluenciaoneuroticismo?Explique.

11. Quais as interaes allicas e gnicas que so comumente estudadas em gentica


quantitativa?DiferencieasinteraescombasenocomportamentodaspopulaesF1.

12.Comopoderiaserdefinidaumacaractersticaquantitativa?Compareacomumacaracterstica
qualitativa.

ReplicaoeTranscrio

1.Oprincpiodetransformaodasbactriasfoiumadasevidnciasqueomaterialgenticoera
constitudoporDNA.DescrevaoracionaldoexperimentodeFrederickGriffith.

2.QualexperimentodemonstrouqueomaterialgenticoeraconstitudoporDNAenoprotena?
Explique.

3. Qual experimento foi determinante para que Watson e Crick sugerissem a estrutura da
molculadeDNA.Quaisconclusesforamtiradasdesteexperimento?

4.Quaissoostiposdeligaesqumicasenvolvidasnaformaodafitasimplesenafitaduplade
DNA.Qualosentidodemontagemosdesoxirribonucleotdeosemcadafita.Qualoracionalque
issoocorra?

5.Descrevaoexperimentoquedemonstrouqueoprocessodereplicaosemiconservativo.

6. Quais so as funes de cada uma das enzimas ou protenas na replicao do DNA: primase,
ligase, DNA polimerase III, DNA polimerase I, helicase, protenas SSB, grampo deslizante,
topoisomerase, grampo conector. Coloque estas protenas numa ordem lgica quanto ao seu
aparecimentoduranteareplicao.

7.Comoocorreainiciaodareplicaoemprocariotoseeucariotos?

8.Comoocorreainiciaodatranscrioemprocariotos?

9.Comoocorreainiciaodatranscrioemeucariotos?

10.DescrevaomecanismoderecomposiodosxonsduranteoprocessamentodosmRNA.

11.ParademonstrarqueoDNA(enoprotenas)eraomaterialgentico,bacterifagosT4foram
marcadoscomP32ouS35eemseguidaforaminfectadosemE.coli.Qualmolculabiolgicaesses
istoposmarcam?Osbacterifagosqueforamproduzidosporestainfecoreteramqualistopo
marcado?ComoesteexperimentomostrouqueoDNAeraomaterialgentico?

12.Desenheaforquilhadereplicaoemarqueosfinais5e3eindiquequalafitacontinuaea
descontnua. Abaixo do seu desenho, indique em qual direo a forquilha de replicao est se
movendo.Porqueogrupo3OHnadesoxirribosetoimportanteparaasntesedoDNA?

13.Oqueumaspliceossomoeoqueelefaz?QualtipodeRNAestpresentenospliceossomo.

14. Descreva a funo de cada um dos seguintes componentes envolvidos na transcrio:


subunidadesigma,RNApolimerase,fatordetranscrio,protenaRho,sequnciaAAUAAA.

15.DesenheumaseqnciadeDNAcom30nucleotdeosedefinaestaseqnciacomosendo5
3ou35.Apartirdisto,desenheafitacomplementar.Definaumaseqnciade15basesnafita
moldeparaotranscritocodificante.IndiqueosentidodasntesedestemRNA.

Sntesedeprotenas

1.DescrevacomoocorrealigaodeumaminocidoaumRNAtransportador.

2.Descrevaaestruturadosribossomosemeucariotoseprocariotos.

3.Emrelaoaosribossomos,oqueocentrodecodificadoreocentrodepeptidiltransferase?

4.Emrelaoaoinciodatraduoemprocariotos,oquesoseqnciasdeShineDalgarno?

5.Comoocorreainiciaodatraduoemeucariotos?

6.Qualaimportnciadaestruturacapparaoinciodatraduoemeucariotos?

7.Emrelaoaoprocessodealongamentoduranteatraduo,qualaimportnciadosfatoresde
alongamentoTu(EFTu)edofatordealongamentoG(EFG)?

Regulaodaexpressognica

1.QuaissooselementosdoDNAeosgenesestruturaispresentesnooperonlac?

2.Quaisprotenassocodificadaspelosgenesestruturaisequaissosuasfunes?

3.Porquedizemosqueoprodutodatranscriodosgenesestruturaisdooperonlacresultaem
umtranscritopolicistrnico?

4.Comoorepressorprevineatranscriodooperonlac?

5.Qualoefeitosobrearegulaodooperonlacseaconcentraodeglicosenomeiodecultura
estiverelevadoeaconcentraodelactosetambm?Explique.

6.Qualoefeitosobrearegulaodooperonlacseaglicosenomeiodeculturaestiverausenteea
concentraodelactoseestiverelevada?Explique.

7.Qualoefeitosobrearegulaodooperonlacseaconcentraodeglicosenomeiodecultura
estiverelevadoeaconcentraodelactoseestiverausente?Explique.

8.Qualoefeitosobrearegulaodooperonlacseglicoseelactosenomeiodeculturaestiverem
ausentes?Explique.

9. Qual o efeito sobre a regulao do operon lac se a ocorrer uma mutao do tipo deleo do
operador?Ocorrertranscriodooperonnapresenadelactoseeausnciadeglicosenomeio?
Explique.

10.Qualoefeitosobrearegulaodooperonlacseaocorrerumamutaodotipodeleodo
genelacI?Ocorrertranscriodooperonnapresenadelactoseeausnciadeglicosenomeio?
Explique.

11.Qualoefeitosobrearegulaodooperonlacseaocorrerumamutaodotipodeleodo
stioCAP?Ocorrertranscriodooperonnapresenadelactoseeausnciadeglicosenomeio?
Explique.

12.QualaimportnciadoAMPcnarepressocatabolicadooperonlac?

13.Porquearegulaognicadiferenteemaiscomplexadoseucariotosquenosprocariotos?

14.Qualaimportnciadosacentuadoresnaregulaognicadoseucariotos?

15. Quais so os modos de represso da transcrio por protenas que se ligam em stios
repressoresnoDNA?

MutaognicaemecanismosdereparodoDNA

1.Umgenecodificaumaprotenacomaseguinteseqnciadeaminocidos:
MetArgCisIleLisArg
Umamutaoemumniconucleotdeoalteraaseqnciadeaminocidospara:
MetAspAlaTirLisGliGluAlaProVal
Ocorre uma segunda mutao de um s nucleotdeo no mesmo gene, e suprime os efeitos da
primeiramutao(umsupressorintragnico).Comapresenadamutaooriginaleosupressor
intragnico,aprotenatemaseguinteseqnciadeaminocidos:
MetAspGliIleLisArg
Qualanaturezaealocalizaodaprimeiramutaoedamutaosupressoraintragnica?

2. Cite trs tipos diferentes de mecanismos de reparo de DNA e explique resumidamente o


funcionamentodecadaum.
3.AseguinteseqnciadenucleotdeosencontradaemumcurtotrechodoDNA:
5AG3
3TC5
a. Cite uma seqncia mutante que pode resultar da depurinao espontnea nesse trecho do
DNA.
b. Cite uma seqncia mutante que pode resultar da desaminao espontnea nesse trecho do
DNA.

4.AseqnciadenucleotdeosabaixoencontradaemumcurtotrechodoDNA:
5ATGT3
3TACA5
Seestaseqnciatratadacomhidroxilamina,queadicionagrupohidroxilaaumacitosina,que
seqnciasresultaroapsareplicao?

5. A seguinte seqncia de nucleotdeos encontrada no filamento molde de DNA. Primeiro


determineos aminocidos da protena codificados por essa seqncia e depois cite a seqncia
alteradadeaminocidosdaprotenaqueserencontradaemcadaumadasmutaes:

3TACTGGCCGTTAGTTGATATAACT5
a.Mutante1:transiononucleotdeo11.
b.Mutante2:transiononucleotdeo13.
c.Mutante3:deleodonucleotdeo7.
d.Mutante4:transversodeTAnonucleo deo15.
e.Mutante5:adiodeTGGapsonucleotdeo6.
f.Mutante6:transiononucleotdeo9.

6.Definamutaodepontoediscutasobresuasorigens.

7.Oqueumamutaoespontnea?Comoelaocorre?Quaissuasconseqncias?

8.QuaissooserrosnareplicaodoDNAecomoelespodemserreparados?