Você está na página 1de 7

Curso: Cincias Biolgicas

Disciplina: Biologia Molecular

Perodo: 5

Professor(a):

Letcia da C. Braga

Exerccios de fixao
Assunto: Estrutura e Replicao do DNA
01. Determine a cadeia complementar para o segmento de DNA abaixo:
5 AAC

TGC ACG AGG TAA CAC AAG ATG CTA TAT ATA ATC TTA TGT TAG ACA 3OH

02. Estudando modelos que fizeram da estrutura a partir dos dados de raios X, Watson e Crick
mostraram que apenas dois pareamentos tinham complementariedade necessria para
permitir pontes de hidrognio eficientes. Quais so estes pareamentos e como a dupla chegou
a esta concluso?
03. Se voc extrai um DNA com a seguinte composio 25% A, 33% T, 24% G e 18% C.
a)

Essa composio faz sentido com relao s regras de Chargaff?

b) Como voc interpretaria este resultado?


c)

Descreva como este organismo replicaria seu DNA?

04. Caracterize as enzimas DNA polimerase, RNA polimerase e transcriptase reversa, quanto aos
nucleotdeos precursores, atividade, sentido preferencial de reao, necessidade de iniciador e
molde.
05. Diferencie as DNAs polimerase I e III.
06. Descreva o padro esperado de bandas em um gradiente de CsCl para a replicao
conservativa no experimento de Meselson-Stahl. Em seguida, desenhe um diagrama.
07. Descreva as enzimas e nucleotdeos precursores envolvidos na sntese do filamento lagging e
do filamento leading.
08. Cite a funo das seguintes enzimas: DNA girase, primase e ligase.
09. O que uma alta temperatura de desnaturao de uma amostra de DNA indicaria? E qual seria a
base qumica para esta afirmao?
10.
Exerccios de fixao: Estrutura e Funo dos cidos Nuclicos
1.

Quais as diferenas de composio e estrutura entre RNA e DNA. Como se distingue entre a
uracila e a timina, e entre a ribose e a desoxirribose.

2.

Escreva os nomes das bases, ribonucleosdeos, desoxirribonucleosdeos, ribonucleotdeos e


desoxirribonucleotdeos do DNA e RNA.

3.

Escreva a seqncia de bases da fita complementar do DNA dupla fita que apresenta uma fita
com a seqncia:

(5') ATGCCGTATGCATTGCATTC (3')


Exprima, em porcentagem, a composio de bases do DNA de fita dupla.
4.

Como so chamadas as ligaes covalentes que unem dois nucleotdeos consecutivos nas
molculas de cidos nuclicos? Esquematize estas ligaes.

5.

Uma molcula de cido nuclico tem a seguinte composio de bases: C = 24,1%; G = 18,5%; T
= 24,6% e A = 32,8%. O que se pode afirmar sobre a natureza desta molcula?

6.

RNA facilmente hidrolizado por lcali, enquanto DNA no o . Por qu?

7.

Explique por que os cidos nuclicos so desnaturados quando submetidos a alta temperatura
o pHs extremos? Como estas molculas podem ser renaturadas?

8.

Temperatura de fuso (Tm) representa a temperatura necessria para se desnaturar a dupla


hlice de DNA. O valor de Tm para o DNA pode ser calculado usando-se a frmula:

Tm = 69,3 + 0,41(%GC), onde GC a porcentagem de Guanina + Citosina.


a. DNA de E. coli contm 50% GC. Calcular o Tm para o DNA desta bactria.
b. As curvas de fuso da maioria dos DNAs que ocorrem naturalmente revelam que o Tm
o

normalmente maior do que 65 C. Por que isto importante para a maioria dos
organismos?
9.

Quais as principais caractersticas da dupla-hlice de DNA de acordo com o modelo proposto


por Watson e Crick?

10. Descreva os principais experimentos que indicaram que o DNA o material gentico.
(PESQUISE).
11. Descreva o experimento de Meselson-Stahl. Qual seria o resultado deste experimento se
a replicao do DNA fosse conservativa?
Assunto: Transcrio e traduo.
01. Observe a seqncia de DNA abaixo:
3OH CTTGACGTGCTACATGGTGTTCTTCGATAAATATAACTATACTATTTGT5

Determine:
a)

A seqncia de RNA correspondente.

b) As regies no traduzidas, a regio codificadora, o cdon de incio e trmino na molcula de


RNA mensageiro transcrita.
c)

A cadeia polipeptdica correspondente.

d) Cite o anticdon do 4 RNA transportador envolvido na sntese do polipeptdio nascente.


e)

O que ocorrer clula se houver uma deleo da primeira base nitrogenada


correspondente ao cdon iniciador?

02. Diferencie as trs RNAs polimerases encontradas nas clulas eucariotas.


03. Descreva a funo do mRNA, tRNA e rRNA.
04. Diferencie a estrutura do mRNA de procarioto e eucarioto.
05. A seqncia de DNA abaixo pertence a um organismo procarioto.
5TCGCCTGTTGACATTGACGTATTCCGCGTTATAATGTCTCCTTGACGTGCTACATGCACGATGGAACGACTATCCT

GACGTTACCCGACTAGATTTGTAGCCCCGCTAGCATAAGGCGGGCTTTTTTTTT3 OH
a)

Podemos afirmar que sua transcrio ir se processar? Justifique sua resposta.

b) Determine o produto final da transcrio.


c)

Qual a regio codificante?

d) Ocorrer algum efeito para a transcrio, se ocorrer uma mutao na regio 5 UTR alterando a
2 adenina da regio promotora por por uma guanina? Justifique sua resposta.
06. Descreva os principais eventos que ocorrem durante cada uma das etapas da traduo gnica.
07. A seqncia de aminocidos a seguir encontrada em um tripeptdeo: Met-Trp-His. Cite todas
as possveis seqncias de nucleotdeos no mRNA, no filamento molde de DNA e no filamento
no-molde de DNA que poderiam codificar esse tripeptdeo.
08. Quantas seqncias diferentes de mRNA podem codificar uma cadeia polipeptdica com a
seqncia de aminocidos Met-Leu-Arg? (Certifique-se de incluir o cdon finalizador.)
09. Foi isolado um DNA de gene eucaritico, desnaturado e anelado com o mRNA transcrito do
gene. A estrutura hibridizada foi ento observada com o uso de um microscpio eletrnico. Foi
observada a seguinte estrutura. Sabendo que este mRNA j havia passado por todas as etapas
do processamento, responda:

a)

Quantos ntrons e xons existem nesse gene? Explique sua resposta.

b)

Identifique os xons e ntrons nessa estrutura hibridizada.

10. Complete o quadro abaixo supondo que a leitura acontece da esquerda para a direita:
T

Dupla Hlice de DNA


A

A
U

T
A

mRNA transcrito
Anticdon
apropriado de tRNA
Aminocidos
incorporados
a
protena

Serina

11. Observando o cdigo de m-RNA determinado in vitro para Escherichia coli, notamos que:
a) UUU e UUC codificam fenilalanina.
b) Por outro lado, com altas concentraes de lcool etlico, a incorporao de leucina e isoleucina so
aumentadas, enquanto que diminui a incorporao de fenilalanina, para os mesmos cdons.
Cite e explique qual das situaes descritas demonstra degenerao do cdigo gentico?
12. Se uma partcula viral contivesse uma dupla fita de DNA com 150.000 pares de bases
nitrogenadas. Responda:
a. Quantos nucleotdeos estariam presentes nesta partcula?
b. Quantos tomos de fsforo estariam presentes nesta partcula?
c. Quantos tipos de bases nitrogenadas diferentes poderiam ser encontrados? E quais seriam elas?
d. Quantos cdons estariam presentes no RNA mensageiro?
e. Quantos aminocidos teriam a cadeia polipeptdica formada?
f. Quantas ligaes peptdicas seriam formadas na sntese protica?
13. A lisozima uma protena de massa molecular 12.000 KDa. Considerando que a massa
molecular mdia dos aminocidos igual a 120 KDa. Determine o nmero mnimo de
nucleotdeos presentes na cadeia de DNA necessrio para codificar a sntese dessa protena.
14. Considere a seqncia de aminocidos de um polipeptdio:
PHE - SER - VAL - ISO - GLU - TRP
Vrios componentes do sistema informacional participam da sntese deste polipeptdio.
Proponha a seqncia de nucleotdeos correspondentes para:
a) A molcula do DNA
b) A molcula do RNA mensageiro
c) Os RNAs transportadores

15. Leia o Texto abaixo e responda:


Galactosemia: incapacidade de transformar galactose em glicose
As reaes bioqumicas que envolvem a galactose monossacardeo derivado da lactose (acar
do leite) so de particular interesse porque, em seres humanos, esto sujeitas a defeitos genticos
que resultam na doena conhecida como galactosemia. Quando o defeito est presente, os indivduos
so incapazes de metabolizar a galactose a metablitos da glicose, o que freqentemente ocasiona
catarata, crescimento deficiente, retardo mental e eventual morte por leso heptica. Um dos
distrbios genticos devido mutao no gene GALK1, expressa como uma deficincia celular
da enzima galactoquinase, promotora da degradao do referido monossacardeo.
Sabendo-se que a enzima galactoquinase possui 392 aminocidos e que o gene GALK1 ocupa uma regio
de 7.300 pb no genoma, qual a porcentagem da regio codificadora (xons) em relao ao tamanho
total do gene?

Assunto: Transcrio e traduo II


1.

Que anticdon voc preveria para um tRNA isoleucina? H mais de uma resposta possvel?
Caso: cite as respostas alternativas e justifique sua resposta.

2.

Um gene para uma enzima composto de trs xons. Abaixo est a seqncia da fita codificante
do DNA para os 2 xons (letras maisculas) bem como parte da seqncia no codificante
(ntrons-letras minsculas) ao redor desses xons.

...accggcagtagATATCAGACCATGCTAATCGCTCCCCGACAGgtaagttgcaacgcaatatccttcctctgacagGGGTAGTTT..
.
a)

Quantas bases esto no primeiro xon? Quantos cdons esto presentes nesse xon?

3.

Indique se as sentenas abaixo so verdadeiras (V) ou falsas (F). Se a sentena for falsa explique
o porqu.

( ) A ligao com o promotor orienta a RNA polimerase a transcrever o gene adjacente.


( ) Em geral, apenas uma das fitas utilizada como molde na transcrio de um segmento qualquer da
dupla hlice do DNA.
( ) A transcrio e traduo representam os dois nveis de expresso gnica em uma clula.
( ) Se o contedo de C-G de uma molcula de DNA de 70%, nesse DNA h 30% de A.
( ) Traduo o processo pelo qual se constri uma molcula de mRNA a partir do DNA
( ) Na maioria dos genes eucariticos, os xons so interrompidos por ntrons, que so seqncias de
DNA que no so traduzidas.

( ) Em organismos eucariotos, a RNA polimerase I responsvel pela sntese de snRNA, scRNA e


tRNA.

4.

(a) Qual a funo da seqncia Shine-Dalgarno nos mRNA procariticos? (b) Que efeito a
deleo da seqncia Shine-Dalgarno de um mRNA tem em sua traduo? (c) Quais as funes
dos stios de ligao A e P do tRNA no ribossomo?

5.

Um segmento de DNA em um gene humano tem a seguinte seqncia de pares de nucleotdeos:

5 TATAATGACGTTACCCGACATAGCTACGATGACGATAAGCGACATAGC 3 OH

(a) Qual a seqncia de nucleotdeos na cadeia complementar do DNA?


(b) Quando este segmento de DNA transcrito pela RNA polimerase, qual ser a seqncia de
nucleotdeos no RNA transcrito supondo que o promotor est situado esquerda da sequncia
mostrada?
(c) Suponha que tanto o cdon de incio quanto de trmnino estejam presentes. Qual ser a sequncia
de aminocidos do polipeptdeo codificado por este gene?

6.

Qual a funo de cada um dos seguintes componentes do aparelho de sntese de protenas: (a)
aminocil-tRNA sintetase, (b) fator de liberao l, (c) peptidil transferase, (d) fatores de iniciao,
(e) fator de alongamento G?

7.

Uma cadeia de a-globina humana tem 141 aminocidos de comprimento. Quantos nucleotdeos
no mRNA so necessrios para codificar uma a-globina humana?

8.

Uma sequncia parcial de nucleotdeos (5' subterminal) de um mRNA procaritico a seguinte:

5'..AGGAGGCUCGAACAUGUCAAUAUGCUUGUUCCAAUCGUUAGCUGCGCAGGACCGUCCCGGA...3'
Suponha que tanto o cdon de incio quanto de trmnino estejam presentes. Quando este mRNA
traduzido, que sequncia de aminocidos ser especificada?

9.

O terminal 5'de um mRNA humano tem a seguinte sequncia:

cap5'GAAGAGACAAGGTCAUGGCCAUAUGCUUGUUCCAAUCGUUAGCUGCGCAGGAUCGCCCUGG3 Suponha
que tanto o cdon de incio quanto de trmnino estejam presentes. Quando este mRNA
traduzido, que sequncia de aminocidos ser especificada?

10. A seguinte sequncia de DNA ocorre em uma bactria (a sequncia promotora est situada
esquerda mas no mostrada).

5' CAATCATGGACTGCCATGCTTCATATGAATAGTTGTACAT -3'


3' GTTAGTACCTGACGGTACGAAGTATACTTATCAACTGTA-5'

a)

Qual a sequencia de ribonucleotdeos da molcula de mRNA que transcrita a partirdo filamento


molde deste trecho de DNA?

b) Suponha que tanto o cdon de incio quanto de trmnino estejam presentes. Qual a seqncia de
aminocidos do polipeptdeo codificado por este RNA?