Você está na página 1de 79

MARCADORES MOLECULARES

MARCADORES MOLECULARES

Marcadores de DNA so derivados de


pequenas regies do DNA que apresentam
polimorfismo entre indivduos dentro de uma
espcie.

Categorias de marcadores
Andersen e Lubberstedt, (2003)

Marcadores aleatrios (RDM- Randon DNA markers):


so gerados aleatoriamente, de stios polimrficos do
genoma

Marcadores gene-alvo ( GTM- gene targeted marker):


so derivados de polimorfismos dentro de genes
PCR-especficos ou PCR de seqncia especfica
Marcadores funcionais (FM- Functional markers): so
derivados de stios polimrficos dentro de genes
envolvidos em determinada variao fenotpica .

AVALIAO DO POLIMORFISMO
DIRETAMENTE DO DNA
RFLP (1980)- fragmentos de DNA de comprimento
polimrfico
PCR (1985)- reao de polimerase em cadeia
Mini e Microsatlites (1985)- seqncias adjacentes
que se repetem em nmero variado
 RAPD (1990)- polimorfismo de DNA amplificado ao
acaso
 AFLP (1994) - polimorfismo no comprimento de
fragmentos amplificados
SNP ( 1998) -

Polimorfismos de Nucleotdeos nicos

MARCADORES DE DNA
Hibridizao

RFLP Hibridizao
Minisatlites ou locos VNTR

RAPD
SCAR
Amplificao D STS
do DNA (PCR) Microssatlite ou SSR
AFLP
SNP
Seqncias
Expressas

ESTP
ASP
SNP

RFLP (Botstein et al., 1980)


(Identificao por hibridizao do DNA)

1- Extrao do DNA
2- Digesto por enzimas de restrio
3- Separao dos fragmentos (eletroforese)
4- Transferncia do DNA para membrana de nylon
5- Hibridao (fragmentos x sondas marcadas)
6- Autoradiografia(exposio da memb. a filme de raio X
ou compostos luminescentes
7- Anlise da segregao

RFLP (polimorfismo no comprimento de fragmentos de


restrio).

HIBRIDIZAO
Seqncia de DNA
ATGCTCGACGTTCGACTTAGC
CTGCAAGCT

Seqncia da Sonda:
(1000 pb tratadas com P32)

Marcadores RFLP

Usos marcadores RFLP


Diversidade gentica e identificao de
cultivares( caf , arroz , soja , milho , cana),
sorgo.
Construo de mapas de ligao e
mapeamento de QTLs ( sorgo ,caf ,milho cana
,arroz ).
Seleo assistida por marcadores (SAM)
(milho).

RFLP
VANTAGENS
Cobre potencialmente todo o genoma(detecta
variaes em seqncias de DNA de 4 a 8 pb)
Expresso co-dominante
Alta repetibilidade e consistncia

LIMITAES
Passos intensivos em mo de obra
Inexistncia de biblioteca de sondas disponvel
Instalaes

Marcadores baseados na amplificao do DNA


(PCR)
Aleatrios: RAPD
Microssatelites ou SSR e variaoes
AFLP
SNP
PCR-especificos (baseado na converso):
STS
Scars
CAPS

Tcnica de PCR
Reao em Cadeia de Polimerase
 Tcnica que replica milhes de vezes um fragmento de
DNA, possibilitando a sua deteco e anlise
 Extrao do DNA
Vrios protocolos
Kits prontos

RAPD-Fragmentos de DNA amplificados ao


acaso ( Williams et al, 1990)
Marcadores moleculares annimos distribudos pelo
genoma;
 Utiliza primers curtos e de seqncias arbitrrias, com
seqncias alvo desconhecida;
 Utiliza um primer nico;
 Detecta polimorfismo em apenas um par de bases;
 Baseia-se na amplificao de DNA;
 No Permite distinguir heterozigotos.

RAPD Polimorfismo de DNA Amplificado ao


acaso( Williams et al, 1990)
Oligonucleotdeo (primer) + DNA genmico
taq polimerase
 Mistura: condies cclicas de temperatura
 94o - desnaturao do DNA
 36o - anelamento
 72o - extenso (DNA polimerase)

 Gerao de fragmentos DNA polimrficos em grande


quantidade

Esquema representando resultados imaginrios de RAPD para 10 isolados de Leishmania


chagasi. possvel agrupar os isolados de co e de homem num nico grupo (colunas a - c,
i,j), que difere do grupo de isolados de raposa (faltam as bandas 1 e 3 e h uma nova banda
2 e do grupo de isolados de marsupiais (f-h), que tem menos duas bandas no padro RAPD.
As cores so apenas ilustrativas.

OP-B07

OP-B04

OP-B11

OP-B08

2
2

3
3

OP-C14

Produtos de amplificao de DNA obtidos com os iniciadores OP-B04, OP-B07, OP-B08, OPB11 e OP- C14. As colunas de 1 a 6 correspondem aos produtos de amplificao das cultivares
de feijo Carioca, Carioca MG, Apor, Prola, IAPAR 57 e IAPAR 81. As setas indicam as bandas
consideradas robustas.

RAPD
Mossor, Quitria,Chonan,Caador,Amarante,Amarante L,Chonan L

Identificao de cultivares

RAPD MELO
(Diversidade gentica)

MELO

RAPD MELO

Acares

Berinjela (Fitoplasma)RAPD
Diagnstico

RAPD
VANTAGENS
Simplicidade, rapidez e baixo custo
No requer biblioteca de sondas
LIMITAES
Expresso dominante
Baixo contedo de informao por bloco
Padronizao de condies de amplificao
Competio entre stios de amplificao

MICROSSATLITES (Litt & Luty


Luty,, 1989)
1 a 6 nucleotdeos repetidos n vezes

Freqncia de ocorrncia
1 microssatelite a cada 6-7 Kb (EST) Cardle et al,
2000

Variao quanto a classe (di,tri tetra)


Freqncia em plantas . (AT)n, (A)n e (AG)n(ATA)n, (AAC)n, (AGC)n, (AAG)n, (AATT)n,
(AAAT)n e (ACTC)n

MTODO
as sequencias que flanqueiam Regies repetidas so
amplificadas por um par de primers especficos (20 a 30
bases) - complementares as seqncias microssatlites.
Cada microssatlite um loco gentico altamente
varivel, multiallico
Separao por eletroforese (cada banda representa um
alelo diferente do mesmo loco)

Marcadores baseados em PCR - Microssatlites

AT

AT

so multi-allicos
AT
AT
AT
CA

CA

CA

CA
CCG

Alelo
Alelo
31
Alelo 2
Alelo
5
Alelo
Alelo
73

CA
CA

CA

CA

CA

CA

CA

CA

CA

CA

CA

CA

CA

CA

CA

CCG

CCG

CCG

Amplificao de microssatlites (PCR)

alelo A
alelo B
alelo C

AA

AB

AC

BB

BC

CC

Deteco de locos SSR (PCR)

CACACA
GTGTGT
CACACA
GTGTGT

Amostra 1

Amostra 2

Amostra 3

(CA)3

(CA)3

CA10/CA12

CA18/CA18

CA17/CA17

CA15/CA15

CA12/CA18

CA12/CA15

CA10/CA15

CA12/CA12

CA12/CA15

CA10/CA10

Diversidade de Acessos de Pupunha e Banana atravs de


Microsatlites

Fentipo eletrofortico representando o polimorfismo de microssatlites


com gentipos homozigotos (banda nica) e heterozigotos (duas bandas),
em indivduos diplides de Phaseolus vulgaris L.(1 a 16) e do padro de
peso molecular (M).

R R R R R R R R R R R R - S S S S S S S S S S S S S S S S - S S PR PS - - M

Anlise dos produtos de amplificao do DNA de feijo-caupi com o primer SSR VM70. PR- CNC
0434 (genitor resistente); PS- IPA 206 (genitor suscetvel); R- indivduos resistentes; S- indivduos
suscetveis; M Marcador de peso molecular 100 pb.

SSR Melo virus CYSDV


Diagnstico

CHICORIA (SSR)

Similaridade Gentica (Chicria)

Identificao de cultivares
Bnlg2291
Bnlg238
__________________ ___________________
M 8

3 8/3 7

7/4 8

8/3

7 4

7/4

Microssatlites de Linhagens e hibrido de milho

PIMENTO
Hbridos

DESENVOLVIMENTO DE MARCADORES DE
MICROSATLITES
DNA genmico total clivado com enzima de corte
freqente

Construo de biblioteca genmica de fragmentos


pequenos

Triagem de colnias com sonda complementar


sonda oligo (GT)n para SSR (CA)

Colnias positivas seqenciadas apenas para C e


A para verificar extenso do microssatlite

Seleo de clones com microsatlites de pelo menos


(CA)8 com seqncias flanqueadoras adequadas

Seqenciamento completo de clones selecionados

Desenho e sntese de pares de primers usando


softwares especficos

PCR com primers construdos para verificar nvel de


polimorfismo

DESENVOLVIMENTO DE MARCADORES DE
MICROSATLITES
A partir de Bancos de Dados
Recursos Computacionais
Tandem Repeats Finder verso 3.01 (BENSON,
1999)
EST-SSR
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
Pinto, 2006

Padro de amplificao em gel de poliacrilamida 6% do SSR 18, com quatro alelos,


embulks de plantas resistentes (1 a 11) e de plantas suscetveis (12 a 21) ao bichomineiro

Vantagens

Herana codominante;
alta abundncia nos genomas eucariotos;
multi-alelismo;
baixo custo e potencial para amplificao de
sistemas multiplex;
Fcil execuo ;
automatizvel

Transferibilidade

DESVANTAGENS
Desenvolvimento dos pares de primers
especficos-construo de bibliotecas genmicas
enriquecidas com os microssatlites
clonagem e seqenciamento desses e o desenho
dos primers complementares s regies
conservadas que flanqueiam os microssatlites

AFLP-- Polimorfismo de comprimento de fragmentos


AFLP
amplificados (Vos et al
al.., 1995).
Tcnica:
Clivagem do DNA genmico com duas enzimas de restrio
Ligao de adaptadores especficos aos terminais dos fragmentos
clivados
Pr-amplificao dos fragmentos,utiliza primers especificos para
cada adaptador mais uma base seletiva (Eco + A, M+C)
Amplificao seletiva utiliza primers especficos para o adaptador,
sitio de restrio mais trs bases seletivas
Eletroforese em gel de alta resoluo

Enzimas
de
Restrico

DNA Genmico +

Eco RI (sitio de restrio: 6 a 8 pb)


Mse I} (4pb)

Fragmentos de DNA
de variados tamanhos
Ligao de adaptadores

AATTC
G
TTAA5
EcoRI adaptador
5

PCR Amplificao Pre-seletiva


A
C
AATTC
TTAAG

AFLP

TTA
AAT

PCR Amplificao seletiva


5

Marcao de primers
Primers

T 5TA
AAT
MseI adaptador

AAC
AATTC
TTAAG

TTA
AAT
AAC

AFLP

Polimorfismo

MARCADOR AFLP
COLOR

IAC-22

PRECOCE
REDENO
ITA-96

Tamcot SP-37
GH-11-9-75

REDENO

ITA-90
0.49

0.58

0.68

0.77

0.87

Deltapine Acala 90

AFLP

AFLP Brssica diversidade

Tomate

Sacarose-- AFLP
Sacarose

AFLP nabo

Vantagens dos marcadores AFLP:

A grande quantidade de fragmentos que so gerados e resolvidos em


um nico gel, o mais alto entre todas as tecnologias de marcadores.

Grande poder de deteco de variabilidade gentica.


Da mesma forma que o ensaio de RAPD, o ensaio AFLP no requer
conhecimento prvio de seqncia de DNA.

Depois de preparados os fragmentos amplificveis, um grande nmero


de bandas polimrficas pode ser rapidamente obtido simplesmente com a
variao das bases arbitrrias dos primers.

O ensaio de AFLP bem mais eficaz quando comparado ao ensaio de


RAPD, pois na etapa de PCR, so utilizados primers bem mais longos, o que
aumenta a especificidade da amplificao, evitando com isso a competio
que ocorre durante a PCR no ensaio de RAPD.

Desvantagens dos marcadores AFLP:

Baixo contedo de informao gentica por loco .

Marcadores AFLP so dominantes, gentipos


heterozigotos no podem ser diretamente discriminados dos
homozigotos.

A anlise de marcadores AFLP envolve um nmero


maior de passos do que a anlise de RAPD, uma maior
quantidade de reagentes ( enzimas de restrio, adaptadores
e primers especficos ).

Um DNA de alto nvel de pureza necessrio para


garantir a digesto completa pelas enzimas de restrio em
todas as amostras, a digesto parcial ou a m qualidade do
DNA pode facilmente levar a interpretaes errneas do
polimorfismo.

MARCADORES MOLECULARES
Construo de mapas genticos
Anlise da diversidade gentica
Mapeamento de caractersticas de interesse
agronmico
AVALIAO DE POLIMORFISMOS DE SEQNCIAS DE DNA

MARCADORES MOLECULARES
Acesso de regies intergnicas
Regies que no codificam seqncias gnicas
INTERESSE

Marcadores para identificao de alelos especficos


PCR- especficos
Automatizao do seqenciamento de DNA

Marcadores PCR-especficos (Converso de marcadores)


Obtidos a partir de marcadores j existentes ou
Sequncias expressas de banco de dados
Uso de primers especficos
seqncias j mapeadas ou
caracterizadas
obtidos da converso de marcadores
RAPD(SCAR), RFLP(STS), AFLP, SSR
Converso:
Clonagem do DNA amplificado pelo marcador
Sequenciamento
Desenho de primers especficos (superior a 20pares de bases)
til na seleo assistida: resistncia a doenas, cor de flor
Se os primers estiverem disponveis, as tcnicas apresentam
custo baixo.

MARCADORES DERIVADOS DE SEQENCIAS

EXPRESSAS
SNP- Polimorfismo de um nucleotdeo
Single Nucleotide Polymorphism ou Polimorfismos de Nucleotdeos
nicos
Polimorfismo baseados na alterao de uma nica base no genoma
Exemplo: AAGGTTA muda para ATGGTTA

Tipos mais comuns de SNPs:


Transio: base purica substituda por
outra prica A-T, G-C
Transverso: prica substituda por
pirimdica ou vice-versa : A-C, G-T, A-C e C-T
.

Podem ocorrer em regies expressas e no expressas


So estveis do ponto de vista evolutivo
SNP se ocorrer em pelo menos 1% da populao
Alta freqncia

e distribuio no genoma:
Genoma humano: 90% polimorfismo SNPs 1,42 milho
Milho: 1SNP 48pb (Regies no-codificadoras)
Total 21.502 SNPs
1SNP 131 pb (Regies codificadoras) Barker, 2002
So encontrados no genoma em :
Haplogrupos: mutaes que ocorrem prximas e so herdadas juntas
Indivduo
Seqncia encontrada
Haplogrupo
1
GATATTCGTACGGATGTATC
AG
2
GATGTTCGTACTGATGTATC
GT
Individuais:

Mtodos para detectar SNPs


SNPs  no necessitam da separao de fragmentos de DNA por
tamanho
Sequenciamento de segmentos amplificados via PCR de indivduos
diferentes
Descoberta de SNPs em bibliotecas genmicas (SNP Finder)
Descoberta de eSNP em bibliotecas de EST

So encontrados em:
1. Em regies codificadoras: podem gerar

alelos

2. Em regies no codificadoras: servem como marcadores

moleculares.

VANTAGENS
Abundncia no genoma
Elevado grau de polimorfismo
Deteco de diferentes alelos para genes de interesse

DESVANTAGEM
 Seqenciamento de

DNA em grande escala

Aplicaes

Construo de mapas genticos


Mapeamento de caractersticas de interesse
Anlise de populaes
Identificao de cultivares

ESTP Expressed Sequence Tag Polymorphisms


Polimorfismo de seqncia Expressa Marcada
Seqncia de DNA para genes expressos
Desenvolvimento de marcadores baseados na seqncia de genes
Teste em diferentes gentipos
Podem ser identificadas ainda:
Microarray
SAGE (Serial Analysis of Gene Expression)
Diferential display

ASP Allele Specific Polymorphism


Polimorfismo Alelo Especfico
Trabalha-se com a seqncia do gene
Identificao de plantas  variantes allicos de um gene

Eventos de Insero / Deleo / Substituio de base na regio


transcrita de um gene

Desenvolvimento
Identificao e seqenciamento dos variantes allicos do gene
de interesse
Desenho de um par de primers
Anelamento local de insero / deleo / substituio

Uso de tcnica PCR para a


deteco de OGM.

Tcnica de PCR
detectar (screening)
identificar (especfico)

PCR Qualitativo

Sistema PCR screening


Detecta

Segmento comum s
construes gnicas

Ex.:
Soja RR:
CaMV 35S
Promoter

CP4 EPSPS

Petunia CTP

NOS Terminator

Sistema PCR screening


Mtodo de Rotina
Problemas

Falso positivo

Presena natural da sequncia alvo

Famlia Cruciferae

DETECO DE COMPONENTES GENETICAMENTE


MODIFICADOS EM PLANTAS E DERIVADOS

Sistema PCR especfico


 Detectar e identificar OGMs
 Amplifica regio especfica do evento
Ex.:
Soja RR:
CaMV 35S
Promoter

CP4 EPSPS

Petunia CTP

NOS Terminator

DETECO DE COMPONENTES GENETICAMENTE


MODIFICADOS EM PLANTAS E DERIVADOS

Sistema PCR especfico


 Necessrio conhecer a seqncia alvo
Problemas

Obteno de seqncias
Banco de dados

PCR Multiplex
 Amplifica mltiplas seqncias alvo
 Utiliza combinao de primers
 Identificados simultaneamente quatro eventos
DETECO DE COMPONENTES GENETICAMENTE
MODIFICADOS EM PLANTAS E DERIVADOS

PCR Quantitativo

PCR Semi quantitativo


 Amplificao DNA alvo
 Comparao visual com DNA padro
 Resultado em faixas
 Detecta a partir de 1% de OGM

DETECO DE COMPONENTES GENETICAMENTE


MODIFICADOS EM PLANTAS E DERIVADOS

PCR Quantitativo
PCR competitivo
- Visa a padronizao do teste de PCR
DNA competitivo

- Padro interno de DNA


- Amplifica DNA alvo e competitivo
- Geram bandas distintas

DETECO DE COMPONENTES GENETICAMENTE


MODIFICADOS EM PLANTAS E DERIVADOS

Princpio DNA competitivo

Primer 1

Primer 2
DNA fragment of transgenic soy

Amostra:

35S-Promotor

Padro Interno:

NOS

Artificially produced, shortened DNA fragment

Primer 1

Primer 2

DETECO DE COMPONENTES GENETICAMENTE


MODIFICADOS EM PLANTAS E DERIVADOS

PCR real time


- Amplificao e quantificao simultnea
- Utiliza dois primers e uma sonda

DETECO DE COMPONENTES GENETICAMENTE


MODIFICADOS EM PLANTAS E DERIVADOS

PCR real time

1. Anelamento especfico - sonda e primer

3. Liberao da sonda

2. Extenso do primer e hidrlise da sonda

4. Sinal aumenta em proporo ao nmero de ciclos


DETECO DE COMPONENTES GENETICAMENTE
MODIFICADOS EM PLANTAS E DERIVADOS

PCR real time

PCR-Cycles

DETECO DE COMPONENTES GENETICAMENTE


MODIFICADOS EM PLANTAS E DERIVADOS

PCR real time

GMO DNA

Fluorescence Intensity

Detection
15,0 %20

25

30

35

2,0 %
0,5 %
0,1 %

Cycle Number

DETECO DE COMPONENTES GENETICAMENTE


MODIFICADOS EM PLANTAS E DERIVADOS

Consideraes sobre PCR


Vantagens
 sensibilidade
 detectar, identificar e quantificar
 estveis
Desvantagens
 custo ($75-300)
 equipamentos sofisticados
 mo obra especializada
DETECO DE COMPONENTES GENETICAMENTE
MODIFICADOS EM PLANTAS E DERIVADOS