Você está na página 1de 2

1.

A replicao do DNA fita dupla exige que as duas fitas sejam separadas, o
que implica a necessidade de girar o DNA sobre si mesmo milhes de vezes
durante o processo. Se o DNA for circular, a tenso gerada nele pelo avano
bidirecional da forquilha de replicao enorme; alm disso, no fim do
processo as duas fitas duplas de DNA ficam presas uma a outra (catenadas).
Que enzimas so responsveis pelo relaxamento da tenso gerada na
replicao e pela decatenao dos DNAs circulares?
Topoisomerases
2. Foi demonstrado experimentalmente que a maioria das seqncias
altamente repetitivas de DNA de cromossomos eucariotos no so
transcritas. O que isso indica a respeito da funo deste tipo de DNA?
3. Porque surgem os fragmentos de Okasaki?
4. Compare e contraste a replicao, a transcrio e a traduo de
procariontes e eucariontes?
5. Considere o segmento de fita de DNA abaixo: 3
AAAGAACGATGATTTCGGATTT 5 a) Qual a seqncia de bases do RNAm
correspondentes? b) Quais os anti-cdons dos tRNAs acima considerados?
c) Qual a seqncia de aminocidos codificados pelo RNAm?
6. Escolha a alternativa cujas associaes entre as duas colunas esto todas
corretas. Col. 1: a. cdigo gentico b. ribossomo c. traduo d. cdon e.
anticdon a) a-V; b-III; c-II; d-I; e-IV. b) a-III; b-II; c-II; d-V; e-IV. c) a-V; b-IV; cIII; d-II; e-I d) a-IV; b-I; c-II; d-III; e-V. e) a-I; b-II; c-III; d-IV; e-V.
7. Diferencie regies codificadoras de regies no-codificadoras do DNA.
8. Quais as principais enzimas envolvidas no processo de Replicao e suas
funes?
9. Quais os estgios da Replicao e o que ocorre em cada estgio?
10. Diferencie regio promotora de Unidade Transcricional.
11. Quais os tipos de RNA fazem parte da sntese protica e suas funes.
12. Quais as fases do ciclo celular?
13. Em qual fase do ciclo celular o DNA replicado? Col 2.: I. Organela que
traduz a fita de RNAm. II. Sntese de protenas a partir da leitura de RNAm.
III. Trinca de nucleotdeos, em RNAm, que codifica um aminocido. IV.
Correspondncia entre cdons e aminocidos por eles codificados. V. Trinca
de nucleotdeos no RNAt, complementar ao RNAm.
14. Descreva as diferenas entre mitose e meiose.
15. O que diferencia a meiose I da meiose II?
16. Explique o que ocorre na prfase I da meiose I que contribui com a
variabilidade gentica.
17. O que so mutaes gnicas, nulas e pontuais.
18. Uma nica adio de nucleotdeos e uma deleo aproximadamente 15
pontos distantes do DNA causam a mudana na sequncia de uma protena
de: LYS SER PRO SER LEU ASN ALA ALA LYS Para LYS
VAL HIST HIST LEU MET ALA ALA LYS a) Quais as sequencias
de nucleotideos do RNA velho e do novo? b) Que tipo de RNA? c) Qual o
nucleotideo que foi deletado e qual foi adicionado?

19. Explique o processo de exciso de ntrons ou SPLICING


20. Porque apenas 61 trincas (sequencias de nucleotideos) codificam
aminoacidos?
21. Como a transcrio iniciada e terminada?
22. Considerando-se a sequncia de cdons 5 AUG CGA 3 responda
justificando:
a) De que molcula o cido nuclico faz parte?
b) Qual o anti-cdon correspondente?
c) De que molcula a resposta b) faz parte?
d) Qual e a sequencia template (sense ou molde) correspondente?
e) e a nao templante?
f) A que molcula as duas ultimas respostas pertencem?
23. Discuta as principais caractersticas do cdigo gentico.
24.Por que e necessria a primase para a replicao?
25. Que partes do DNA constituem uma unidade de transcrio?
26. Descreva a estrutura da RNA polimerase bacteriana.
27. Explique o processamento do pr-mRNA nos genes nucleares.
28. O modelo do peron, formulado por Jacob e Monod, serve para explicar a
regulao gnica das enzimas que degradam a lactose em Escherichia coli.
Explique o que ocorre se houvesse:
a) A presena de triptofano no meio celular.
b) Uma mutao do tipo substituio de bases silenciosa do gene operador
(O).
c) Uma mutao do tipo deleo de base nos genes estruturais (Z, Y, A).
d) Presena de glicose no meio celular.
e) Uma mutao de sentido errado no primeiro gene estrutural.
29. Diferencie repressores de indutores.
30. Em E. Coli o operon da lactose compreende 3 genes estruturais: galk,
galt e gale, cujos produtos esto envolvidos no metabolismo do acar
galactose. Galr codifica um repressor e a galactose um indutor do sistema.
Descreva a sequncia de processos: a) Na ausncia de galactose. b) Na
presena de galactose. 31. Existem 40 cromossomos nas clulas somticas
do rato. a) Quantos cromossomos um rato deve receber de sua me? b) Qual
o nmero haplide do rato? timos estudos!! Lembre-se: A instruo que
voc segue. Determina o futuro que voc cria... Mike Murdock