Você está na página 1de 109

EXERCCIOS

DE
BIOLOGIA

NDICE

QUESTES DE MULTIPLA ESCOLHA .......................................................................................... 1


GABARITO ....................................................................................................................................... 25
QUESTES DISCURSIVAS .............................................................................................................. 26
GABARITO .................................................................. 53
GABARITO .................................................................. 95

PROFESSORES:

Pr Vestibular Diferencial

BIOLOGIA
nenhuma manifestao fenotpica aparente, ele fez
algumas suposies sobre a herana desse
cromossomo. Assinale a suposio que est
geneticamente coerente:

QUESTES DE MULTIPLA ESCOLHA


1) (UFV02)As plantas produzem diversos compostos
denominados de metablitos secundrios. So
exemplos os compostos das classes dos terpenides,
alcalides, flavonides e coumarinas. Esses produtos
naturais tm sido utilizados como fitoterpicos,
antioxidantes, flavorizantes, corantes, cosmticos,
inseticidas, e ainda na defesa natural de plantas contra
certos patgenos e herbivoria. Em termos celulares,
esses compostos so predominantemente armazenados
no:
a)
b)
c)
d)
e)

a)
Se eu tenho este Y, todos os meus
descendentes tambm o tero.
b)
Entre as minhas filhas, apenas 50% tero esse
cromossomo.
c)
Acho que o meu pai herdou essa condio
gentica da me dele.
d)
Provavelmente esse Y ficou grande para ser o
homlogo do X.
e)
Se o meu irmo no tiver esse Y, talvez ele no
seja meu irmo.

retculo endoplasmtico.
peroxissomo.
complexo de Golgi.
vacolo.
cloroplasto.

5)
(UFV02)Conta a lenda que, num certo meio
ambiente, cinco insetos haviam violado o painel
eletrnico da grande mata, ferindo a confiana dos que
l viviam. Para descobrir o nome do principal artrpode
articulador da enorme vergonha nacional, foram dadas
trs pistas do tal inseto:

2) (UFV02)Observe o cladograma indicando as


relaes filogenticas entre os principais grupos de
embrifitas.
Brifitas

Pteridfitas

Progimnospermas Gimnospermas Angiospermas

II
III

Assinale a alternativa que contm o nome do referido


inseto:

Entre as caractersticas abaixo, consideradas como


ponto de ramificao evolutiva, aquela que corresponde
indicada pela seta :

a)
b)
c)
d)
e)

a)
xilema e floema secundrios.
b)
sementes nuas ou protegidas.
c)
saco embrionrio com 4-16 clulas.
d)
zigoto multicelular com arquegnio ou saco
embrionrio.
e)
traquedes
com
paredes
desigualmente
espessadas.

I
II
III

- Erradicar o protozorio causador da doena.


- Vacinar a populao contra o vetor.
- Evitar que o bacilo se reproduza na gua parada.

- O tecido muscular estriado esqueltico constitui a


maior parte da musculatura do corpo humano.
- O tecido muscular liso responsvel direto pelo
desenvolvimento dos glteos e coxas.
- O tecido muscular estriado cardaco, por ser de
contrao involun-tria, no se altera com o uso
de esterides anabolizantes.

Analisando as afirmativas, pode-se afirmar que:

Analisando cada uma das medidas, pode-se afirmar


que:
a)
b)
c)
d)
e)

Triatoma infestans.
Culex fatigans.
Anopheles sp.
Lutzomya sp.
Drosophila melanogaster.

6)
(UFV 02)Preocupados com a boa forma
fsica, os freqentadores de uma academia de ginstica
discutiam sobre alguns aspectos da musculatura
corporal. Nessa discusso, as seguintes afirmativas
foram feitas:

3) (UFV 02)Durante o ano de 2001, houve no Brasil


uma grande campanha contra a febre amarela. Na fila
de um posto de sade, algumas pessoas sugeriram que
as seguintes medidas so consideradas efetivas para
evitar essa doena:
I
II
III

- Embora seja um tipo de sanguessuga, no um


aneldeo; embora pique as pessoas, no um
marimbondo.
- Diretamente no injeta parasitas, mas os defeca
perto da fonte de alimento.
- Esconde-se entre frestas de paredes, caminha
pelo rosto das pes-soas, no destila veneno, mas
deflagra um mal que ataca o corao.

a)
b)
c)
d)
e)

apenas I correta.
apenas II correta.
apenas II e III so corretas.
apenas I e II so incorretas.
I, II e III so incorretas.

apenas I est correta.


apenas II est correta.
apenas II e III esto corretas.
apenas I e II esto corretas.
I, II e III esto corretas.

7)
(UFV 02)Uma reportagem publicada em
revista de circulao nacional afirmava que a cincia j
capaz de vencer a batalha em nove de cada dez
casos de infertilidade. Um dos recursos utilizados
atualmente para este fim o mtodo da fertilizao in
vitro, no qual a ovulao estimulada pelo uso de

4)
(UFV02)O exame citogentico de um
indivduo normal revelou que o seu cromossomo Y
contm,
aproximadamente, 30%
a
mais
de
heterocromatina na regio distal, em relao ao padro
de cromossomo Y presente na populao. Embora sem

Pr Vestibular Diferencial

BIOLOGIA
Com base nesses dados, assinale a alternativa
INCORRETA:

medicamentos sintticos, e os vulos produzidos so


colocados em contato com os espermatozides.
Considerando que tais medicamentos so anlogos a
gonadotrofinas humanas, a sua funo fisiolgica
substitui os seguintes hormnios:
a)
b)
c)
d)
e)

a)
A, B e C correspondem, respectivamente, a
Minas, Brasil e Mundo.
b)
I, II e III correspondem, respectivamente, a
mamferos, aves e rpteis.
c)
A biodiversidade de Minas proporcionalmente
semelhante do Brasil.
d)
O percentual dos vertebrados pecilotrmicos
maior no Mundo.
e)
Em termos absolutos, Minas e Brasil tm mais
aves que no Mundo.

estrgeno e progesterona.
luteinizante e folculo-estimulante.
progesterona e prolactina.
luteinizante e ocitocina.
estrgeno e prolactina.

8)
(UFV 02)O grfico abaixo representa o perfil
bsico da reao bioqumica de uma catlise
enzimtica.

10)
(UFV 02)Os invertebrados prepararam uma
grande festa zoolgica. Entretanto, para manter os bons
costumes e evitar confuso, os convites continham a
seguinte advertncia: "Aqueles que apresentarem
fecundao interna, no entram". Assim, dos
invertebrados abaixo, aquele que poder participar da
festa :

II

III

a)
b)
c)
d)
e)

IV

11)
(UFV 02)Contrariando a sua fama de vils,
como causadoras de doenas nos seres vivos, muitas
bactrias se relacionam com a natureza como agentes
importantes nos ciclos biogeoqumicos. No ciclo do
nitrognio, as bactrias nitrificantes convertem:

Energia

o ourio-do-mar.
o gafanhoto.
a aranha.
a lombriga.
o caracol-de-jardim.

Curso da reao
a)
b)
c)
d)
e)

Observe o grfico e assinale a afirmativa INCORRETA:


a)
III representa a energia de ativao para
desencadear a reao.
b)
II representa o estado de transio, com o
mximo de energia.
c)
V pode ser um produto final da reao
enzimtica.
d)
I pode ser representado pelos substratos da
catlise.
e)
IV representa a diferena de energia entre a
enzima e o produto.
9)
(UFV 02)A tabela abaixo representa algumas
estimativas da biodiversidade de reptis, aves e
mamferos quanto ao nmero absoluto de espcies
presentes em Minas Gerais, no Brasil e no Mundo. O
grfico seguinte representa os dados da tabela, porm
em percentuais.
Vertebrados
Rpteis
Aves
Mamferos

Minas
Gerais
179
780
190

Brasil

Mundo

467
1678
524

7828
9881
4809

12)
(UFV 02)Um palco montado para a realizao
de um show no Maracan ocupou toda a extenso do
gramado. Quatro semanas aps o show, com a
desmontagem do palco, observou-se que o gramado
estava amarelado, perdendo o seu verde exuberante.
Assinale a alternativa INCORRETA:
a)
O gramado, na ausncia de luz, interrompe a
produo dos pigmentos de clorofila.
b)
A fotossntese foi comprometida com a
ausncia da luz, o que interferiu na sntese de parede
celular.
c)
Na ausncia da luz, ocorreu estiolamento das
folhas e dos caules do gramado.
d)
Na ausncia da luz, o padro de lamelao
normal dos cloroplastos foi desestruturado.
e)
Mesmo no escuro, houve intensa sntese de
tecidos de conduo e de sustentao.
13)
(UFV 02)A embriologia dos rpteis tem sido
abordada em filmes de fico sobre dinossauros.
Entretanto, considerando os rpteis atuais, assinale a
alternativa que NO poderia ser abordada numa cena
de filme, como sendo um fato biologicamente correto:

100%

80%
60%

II

40%
20%

a)
Embries de rpteis apresentando mnio, crio
e alantide.
b)
Embries de rpteis dentro de ovos com muito
vitelo.

III

0%
A

nitrognio atmosfrico em amnia.


amnia em aminocidos.
aminocidos em amnia.
amnia em nitrato.
nitrato em nitrognio.

Pr Vestibular Diferencial

BIOLOGIA

c)
Embries de rpteis com a coluna vertebral
surgindo do mesoderma.
d)
Embries de rpteis apresentando fendas
branquiais.
e)
Embries
de
rpteis
nutrindo-se
da
vascularizao placentria.

c)
O ar chega aos pulmes pelo esfago, indicado
por I.
d)
Os bronquolos, indicados por II, conduzem ar
aos alvolos.
e)
Embora no esteja indicada, a laringe se
localiza acima da traquia.

14)
(UFV 02)O esquema abaixo representa o
ciclo de uma clula diplide normal, cujas fases foram
identificadas e enumeradas, conforme as observaes
de um grupo de estudantes.

16)
(UFV 03)Os tegumentos dos vertebrados
podem originar diversos tipos de diferenciaes que
auxiliam no desempenho de suas funes. Todas as
alternativas
abaixo
contm
exemplos
dessas
diferenciaes, EXCETO:
a)
b)
c)
d)
e)

II

VII

III
IV
VI V

Penas.
Unhas.
Cascos.
Escamas.
Chifres.

17)
(UFV 03)Considere a ovulognese de uma
mulher normal para analisar o contedo cromossmico
e de DNA nas clulas durante a diviso e assinale a
afirmativa CORRETA:

Assinale, entre as opes abaixo, aquela que NO


uma observao citologicamente correta:

a)
A ovognia tem a metade do contedo de DNA
do ovcito I.
b)
Os ovcitos I e II tm o mesmo nmero de
cromtides.
c)
O ovcito II e o vulo tm o mesmo nmero de
cromossomos.
d)
O corpsculo polar I no difere na quantidade
de DNA do ovcito I.
e)
O gameta tem valor correspondente a 4C e a
ovognia a 1C.

a)
A fase I poder corresponder ao perodo de
sntese de DNA, se confirmar a observao dos
fragmentos de Okasaki.
b)
A fase IV poder corresponder metfase,
pelo que se observou da morfologia bem compactada
dos cromossomos.
c)
Se for observado que a fase VII tem a metade
da quantidade de DNA da fase II, ento ela poder
representar G1.
d)
As fases V e VI confirmaro que o ciclo
mittico, se observado que cada um de seus
cromossomos apresenta duas cromtides-irms.
e)
A fase III poder representar uma prfase
mittica, j que no se observaram pareamentos entre
os homlogos durante a compactao.

18)
(UFV 03) semelhana do que acontece na
formao de clculos renais nos animais, o metabolismo
celular em plantas pode formar incluses cristalferas
constitudas por oxalato de clcio, tambm conhecidas
como drusas, rfides e monocristais. Essas incluses
so comumente encontradas em uma das organelas
abaixo. Assinale a alternativa CORRETA:

15)
(UFV 02)Observe o esquema representado
abaixo, de parte do sistema respiratrio humano, e
assinale a alternativa INCORRETA.

a)
b)
c)
d)
e)

Plastdeo.
Lisossomo.
Vacolo.
Complexo de Golgi.
Peroxissomo.

19)
(UFV 03)Considere o desenho abaixo e
assinale a afirmativa CORRETA:

I
III

II

IV
V

a)
O diafragma, indicado por V, auxilia nos
movimentos respiratrios.
b)
Os pulmes e brnquios esto indicados por III
e IV, respectivamente.

a)
O anexo indicado por II tambm tem funo
secretora hormonal.

Pr Vestibular Diferencial

BIOLOGIA
foram muito importantes nessa adaptao. Com relao
a essas substncias, analise as afirmativas abaixo.

b)
Durante o parto, I se rompe e liberado com a
criana.
c)
O lquido indicado por III fornece nutrientes e
oxignio para o feto.
d)
O crio, indicado por IV, o anexo embrionrio
mais interno.
e)
As quatro indicaes representam anexos
embrionrios.

II

20)
(UFV 03)Na fotossntese, a energia da luz
absorvida pelos pigmentos excita os eltrons para nveis
mais elevados de energia. Os eltrons energizados so
transferidos dos centros de reaes dos fotossistemas
para formar intermedirios ricos em energia. Uma
simplificao da seqncia deste fluxo de eltrons est
representada abaixo.

III

Assinale a opo CORRETA:


a)
b)
c)
d)
e)

Assinale a alternativa com a seqncia CORRETA:


a)
b)
c)
d)
e)
eltrons

A lignina de ampla ocorrncia nas plantas


vasculares e se relaciona principalmente
sustentao.
A cutina est associada aos tecidos de
revestimento, sendo depositada na superfcie da
parede celular da face externa da clula.
A suberina est relacionada restrio de perda
de gua e pode ser encontrada em peridermes e
em estrias de Caspary da endoderme.

NADPH O2 CO2
H2O NADPH ciclo de Calvin
NADPH fotossistema-II ciclo de Calvin
Fotossistema-I fotossistema-II H2O
NADP O2 cadeia de transporte de

Apenas a afirmativa I verdadeira.


Apenas a afirmativa II verdadeira.
Apenas as afirmativas I e III so verdadeiras.
Apenas as afirmativas II e III so verdadeiras.
Todas as afirmativas so verdadeiras.

24)
(UFV 03)O esquema abaixo representa duas
espcies de plantas com diferentes distribuies em
relao aos tipos florais.

21)
(UFV 03)Recentemente a engenharia
gentica possibilitou a transferncia de genes da rota de
biossntese da provitamina A para o genoma do arroz
(Golden Rice). De acordo com os autores do projeto, o
consumo desse tipo de arroz poderia amenizar os
problemas de carncia dessa vitamina em populaes
de pases subdesenvolvidos. Em relao provitamina
A, INCORRETO afirmar que:
a)
est associada ao beta-caroteno.
b)
sua deficincia est normalmente associada ao
escorbuto.
c)
pode ser encontrada como provitamina na
cenoura e abbora.
d)
sua deficincia est associada xeroftalmia.
e)
no biossintetizada pelo organismo humano.

Assinale a alternativa INCORRETA:


a)
A espcie I um exemplo de planta monica.
b)
Plantas da espcie II no podem se
autofecundar.
c)
A variabilidade gentica pode ocorrer nas duas
espcies.
d)
Na espcie I cada flor pode se autofecundar.
e)
As duas espcies apresentam flores dclinas.
25)
(UFV 03)Como se fossem organismos vivos,
os ecossistemas naturais esto em constantes
modificaes. Do estdio jovem at maturidade ou
clmax, os ecossistemas sofrem profundas mudanas
no somente na composio e diversidade de espcies,
como tambm na sua biomassa e produtividade. Assim,
do incio da sucesso at o clmax da comunidade, NO
se observa proporcionalmente aumento da:

22)
(UFV 03)Observe o esquema geral do
sistema circulatrio humano.

a)
b)
c)
d)
e)

Assinale a alternativa CORRETA:


a)
b)
c)
d)
e)

IV representa as veias cavas.


II representa a artria pulmonar.
I transporta o sangue arterial.
III transporta o sangue venoso.
I representa a aorta.

taxa de respirao.
diversidade de espcies.
reciclagem de nutrientes.
produtividade lquida.
biomassa total.

26)
(UFV 03)O esquema abaixo representa o
cruzamento entre duas variedades puras de ervilha-decheiro (Lathyrus odoratus) de flor branca. A F1
resultante apresentou 100% das ervilhas com flores
avermelhadas. Aps autofecundao das plantas F1,
foram produzidas 371 plantas com flores avermelhadas
e 287 com flores brancas, na gerao F2.

23)
(UFV 03)Na transio evolutiva das plantas
do habitat aqutico para o terrestre, algumas
substncias, como a lignina, a suberina e a cutina,

Pr Vestibular Diferencial

BIOLOGIA
29)
(UFV 03)Leia com ateno o trecho abaixo:
...e como nesses organismos o sangue no permanece
somente no interior de vasos, sua presso baixa e a
velocidade do fluxo reduzida. Por essa razo, a
distribuio de substncias lenta e no vence longas
distncias, e no entanto, esses organismos podem
apresentar movimentos to rpidos que indicam que a
oxigenao dos tecidos muito eficiente. (Fonte:
Avancini, E. B. e Favaretto, J. A. Biologia. So Paulo:
Moderna, 1997. v.2, p. 655.)
Pode-se afirmar que o organismo a que o trecho acima
se refere um exemplo de:

Analise este padro de herana e assinale a afirmativa


CORRETA:

a)
inseto, pois a oxigenao dos tecidos
independe do sistema circulatrio.
b)
celenterado, pois as brnquias transferem o
oxignio diretamente para os tecidos.
c)
nematide, pois o lquido celomtico se
encarrega de levar o oxignio aos tecidos.
d)
aneldeo, pois, embora a respirao seja
cuticular, o oxignio transportado pelos tbulos de
Malpighi.
e)
platelminto, pois na fase adulta, alm de
respirao branquial, apresenta tambm respirao
cutnea.

a)
Trata-se de um exemplo tpico da primeira Lei
de Mendel.
b)
Pelos resultados, deduz-se que um padro
de herana intermediria.
c)
A proporo fenotpica 9:7 um padro de
segregao independente.
d)
O gene para a cor avermelhada codominante
em relao ao alelo.
e)
O exemplo de interao gnica j que est
envolvido apenas um loco.
27)
(UFV 03)Os processos evolutivos dos seres
vivos esto fundamentados em trs mecanismos
bsicos, conforme representados no esquema abaixo.
Um deles (I) representa a nica fonte de variabilidade
nova. Esta variabilidade aumentada pelo segundo (II)
e diminuda pelo terceiro (III).

30)
(UFV 03)Segundo o IBGE, por falta de
investimentos do governo em saneamento bsico, o
volume de gua sem tratamento distribudo para
consumo da populao aumentou 191,3% em 2001
(Fonte: Folha de S. Paulo, 9/4/2002). Tal quadro
favorece o aumento de risco para aquisio de diversas
doenas por parte da populao. Assinale a doena que
NO est diretamente relacionada ao quadro acima
descrito:
a)
b)
c)
d)
e)

Assinale a alternativa que corresponde aos nmeros I, II


e III, respectivamente:
a)
b)
c)
d)
e)

31)
(UFV 05)Os citologistas tradicionalmente
classificam todos os organismos vivos em dois grupos
principais: os eucariontes e os procariontes.
Basicamente, essa classificao separa os organismos
que apresentam suas clulas com material gentico
nuclear compartimentalizado por membrana daqueles
que no apresentam. Assinale a alternativa cuja
caracterstica NO pertence s clulas eucariotas.

Mutao, seleo natural, recombinao.


Recombinao, deriva gnica, migrao.
Mutao, recombinao, seleo natural.
Seleo natural, migrao, recombinao.
Recombinao, seleo natural, mutao.

28)
(UFV 03)A Organizao Mundial de Sade
tem alertado que, nos prximos 20 anos, a AIDS dever
causar a morte de 70 milhes de pessoas,
aproximadamente. Apesar do grande impacto que a
AIDS tem provocado na vida moderna, outras doenas
sexualmente transmissveis, como a blenorragia e a
sfilis, tambm necessitam de cuidados preventivos e de
mais divulgao de informaes.

a) DNA complexado com histonas.


b) Presena de citoesqueleto.
c) Organelas envolvidas por membranas.
d) Genoma nuclear com DNA circular.
e) Dimetro celular relativamente largo.
32)
(UFV 05)Os principais produtos da resposta
imune humoral so os anticorpos ou imunoglobulinas.
Cada imunoglobulina constituda de cadeias de
polipeptdeos ligadas por pontes dissulfeto (S),
conforme a representao abaixo. Os nmeros I, II, III,
IV e V indicam componentes ou regies bsicas dessa
molcula.

Pode-se afirmar CORRETAMENTE que essas trs


doenas so:
a)
b)
c)
d)
e)
DNA.

Hepatite.
Clera.
Gastroenterite.
Febre tifide.
Hidrofobia.

causadas por vrus.


transmissveis de me para filho.
transmitidas apenas pelo contato sexual.
transmitidas tambm por transfuso sangnea.
causadas por microrganismos que contm

Pr Vestibular Diferencial

BIOLOGIA

Assinale o palpite que corresponde afirmativa


biologicamente CORRETA:
a) Trata-se de um caro, pois apresenta as
caractersticas de um aracndeo.
b) Observando que o organismo ptero, afirmo que
mesmo um aracndeo.
c) Pelo nmero de patas e tipo de corpo, no concordo
que seja um aracndeo.
d) Se olharmos bem para a sua morfologia, aposto que
um tipo de carrapato.
e) Tambm concordo que se trata de um aracndeo,
mas ele mesmo um piolho.

Assinale a alternativa CORRETA:


a) As cadeias pesadas esto indicadas por III.
b) Uma das cadeias leves est indicada por V.
c) O stio de ligao dos antgenos est indicado por II.
d) A regio constante est indicada por I.
e) A regio varivel est indicada por IV.
33)
(UFV 05)A seqncia dos cinco primeiros
aminocidos (aa), de um peptdeo em incio de sntese,
est representada abaixo. Na tabela, aparecem tambm
representados alguns RNAs transportadores (tRNA) e
seus respectivos aminocidos.

36)
(UFV 05) Antes da organognese de
vertebrados, certas anormalidades morfolgicas que
eventualmente ocorrem nos folhetos embrionrios
podem ser detectadas nos tecidos e rgos dos
indivduos na fase adulta. Se uma dessas
anormalidades
ocorrer
no
mesoderma,
o
desenvolvimento anormal poder ser detectado no:
a) epitlio do tubo digestivo.
b) alvolo pulmonar.
c) crebro.
d) msculo estriado.
e) revestimento epidrmico.
37)
(UFV 05)Observe o ciclo abaixo, que
representa parcialmente o mecanismo de controle da
glicemia. As indicaes correspondem ao aumento ou
diminuio da glicemia (I), o hormnio envolvido (II) e
molculas de carboidratos (III).

Assinale a alternativa que contm o mRNA que traduziu


a seqncia de aminocidos para formar o peptdeo:
a) 5 -AUG-CUC-CCC-CAA-GCA- 3
b) 5 -CCC-CAA-GCA-CUC-AUG- 3
c) 5 -CAA-GCA-GAG-UAC-CCC- 3
d) 5 -GCA-CUC-GUU-AUG-CAA- 3
e) 5 -UAC-GAG-GGG-GUU-CGU-3
34)
(UFV 05)Em humanos, a espermatognese e
a ovulognese apresentam eventos citolgicos e
genticos correspondentes. Considerando eventos
normais, assinale a alternativa que NO exemplo de
correspondncia entre as duas gametogneses:
a) Ocorrncia de vrios ciclos de mitoses nas gnias.
b) Presena de clulas diplides em cito-I.
c) Proporcionalidade de gametas viveis produzidos.
d) Alterao de tamanho nas clulas que formam os
gametas.
e) Formao de gametas com gentipos recombinados.

Assinale a alternativa CORRETA:

35)
(UFV 05)O bichinho representado abaixo foi
retirado do couro cabeludo de um aluno. Mas, na
escola, no faltaram palpites, entre os colegas, para
descrever o tal organismo encontrado.

a) Se o nvel de I for alto, os de II e III tambm sero.


b) Se II for a insulina, o nvel de I aumentar.
c) Se o nvel de glucagon for alto, o de III ser baixo.
d) Se o nvel de III for alto, o de I ser baixo.
e) Se o nvel de I for baixo, II ser o glucagon.
38)
(UFV 05) Frutos com fentipo Violeta so os
nicos resultantes de herana do tipo dominncia

Pr Vestibular Diferencial

BIOLOGIA

incompleta entre cruzamentos de plantas com fruto


Roxo e plantas com fruto Branco. Foram obtidas, de
um cruzamento entre heterozigotas, 48 plantas. Esperase que a proporo fenotpica do fruto entre as plantas
descendentes seja:
a) Violeta ( 0 ): Roxo (36): Branco (12).
b) Violeta (12): Roxo (24): Branco (12).
c) Violeta (24): Roxo (12): Branco (12).
d) Violeta (36): Roxo (12): Branco ( 0 ).
e) Violeta (48): Roxo ( 0 ): Branco ( 0 ).
39)
(UFV 05) A pobreza, a desinformao e a
falta de saneamento bsico so os principais
responsveis por verminoses em humanos, tais como:
ascaridase,
ancilostomose,
cisticercose,
esquistossomose, faciolose e tenase. Considerando
apenas essas seis verminoses, assinale a afirmativa
CORRETA:

Aps a anlise, assinale a afirmativa INCORRETA:


a) A sntese de amido diretamente proporcional
absoro do CO2 ao longo do perodo diurno.
b) Tanto a sacarose quanto o amido atingem nveis
mnimos ao amanhecer.
c) As flutuaes de concentrao de sacarose e de
amido nas folhas so decorrentes da sntese e da
degradao desses carboidratos.
d) O acmulo mximo de sacarose ocorre por volta das
14 horas, e a absoro mxima de CO2 em torno das
10 horas.
e) A sntese de sacarose e a absoro do CO2 iniciamse nas primeiras horas de luz.

a) Duas delas so causadas por vermes que so


nematides e quatro por platelmintos.
b) Duas delas so causadas por ingesto de ovos e
quatro por ingesto passiva de larvas.
c) Duas delas so causadas por penetrao ativa e
quatro por penetrao passiva das larvas.
d) Duas delas so causadas por vermes heteroxenos e
quatro por monoxenos.
e) Duas delas so causadas por vermes diicos e
quatro por monicos ou hermafroditas.

42)
(UFV 05)As plantas, como organismos
ssseis, necessitam de adaptaes para sobreviverem a
determinadas condies ambientais. Nos cerrados ou
em campos rupestres, onde o fogo de ocorrncia
freqente, certas espcies apresentam um tipo de rgo
subterrneo rico em substncias de reserva, o qual
pode brotar aps as queimadas. A alternativa em que
aparece exemplificado esse tipo de rgo :

40)
(UFV 05) A tabela abaixo contm valores
referentes s taxas de natalidade (n), mortalidade (m),
emigrao (e) e imigrao (i) de cinco populaes de
roedores (I, II, III, IV e V).

a) Pneumatforo.
b) Hidatdio.
c) Xilopdio.
d) Laticfero.
e) Haustrio.

Assinale a alternativa que corresponde populao com


maior taxa de crescimento:
a) I.
b) II.
c) III.
d) IV.
e) V.

43)
(UFV 05)Entusiasmado com as aulas de
botnica no colgio, um estudante pediu sua me que
lhe preparasse um lanche especial, uma vez que ele
gostaria de se alimentar apenas de ovrios fecundados
e hipertrofiados pela ao de fito-hormnios. Dentre as
alternativas abaixo, assinale aquela que poderia entrar
no cardpio daquela refeio.

41)
(UFV 05) Analise o grfico abaixo, que
representa a absoro de CO2 (g CO2.h-1.m-2) e o
acmulo de sacarose (mol.g de massa fresca-1) e de
amido (g de equivalentes de glicose.m-2) pelas folhas
em relao s horas do dia.

a) Uma salada de alface.


b) Uma vitamina de abacate.
c) Uma poro de palmito.
d) Um picadinho de cenoura.
e) Uma sopa de batata.
44)
(UFV 05)A figura estilizada abaixo representa
parte do processo da fotossntese em plantas,
correspondente ao esquema Z da etapa fotoqumica.

Pr Vestibular Diferencial

BIOLOGIA
b) A proliferao das irregularidades e das diversas
formas de malignidade ocorre quando sistemas
inibitrios e controladores relacionados esto ausentes.
c) Em muitos casos, a condio invasiva anormal se
espalha, corrompendo, generalizadamente, a funo
dos rgos e do sistema como um todo, mas com
grandes chances de cura.
d) Como a forma de desenvolvimento tumoral no
drasticamente diferente da condio saudvel, atribui-se
a esta forma silenciosa e quase assintomtica do dano a
dificuldade de extirpao do mal.
e) A agressividade desta doena se mostra pela forma
com que os componentes de um tumor primrio
penetram nas vias de circulao do sistema e originam
tumores secundrios e falncia dos rgos.
47)
(UFV 06) Basicamente, quanto mais distante
um gene est do outro no mesmo cromossomo, maior
a probabilidade de ocorrncia de permutao (crossingover) entre eles. Se os genes Z, X e Y apresentam as
freqncias de permutao XZ (0,34), YZ (0,13) e XY
(0,21), a ordemmapa desses genes no cromossomo :
a) XZY
b) ZXY
c) ZYX
d) YZX
e) YXZ

Assinale a afirmativa INCORRETA:


a) Os operrios no topo das torres correspondem aos
aceptores primrios de eltrons.
b) A torre de tamanho menor corresponde ao
fotossistema I, e a maior ao fotossistema II.
c) O operrio com a marreta em punho, na torre maior,
recebe eltrons de baixa energia para recompor os
eltrons energizados que ele lanou.
d) A roleta, entre as torres, corresponde cadeia
transportadora de eltrons que tem como funo a
produo de ATP.
e) O operrio que est no solo lana os eltrons
provenientes das molculas de H2O.

48)
(UFV 06) Cinco mulheres alegaram
maternidade de uma determinada criana e, como parte
dos exames, o seqenciamento das bases em um stio
especfico do DNA identificou a me biolgica. Em uma
das duas cadeias do DNA da criana o stio apresentou
a seguinte seqncia: GTACTCGA. O padro de
bandas da seqncia de oito bases deste stio, de uma
das duas cadeias de DNA de cada mulher, est
representado abaixo. Assinale a alternativa cujo padro
com as oito bases corresponde ao da verdadeira me
da criana:

45)
(UFV 05)Em relao ao sistema circulatrio
ou de transporte foram feitas as seguintes afirmativas:
I. Nos animais pseudocelomados, o lquido da cavidade
corprea desempenha a funo de transporte interno.
II. Nos organismos com circulao aberta, ocorre
contato direto entre a hemolinfa ou sangue e as clulas.
III. O sistema circulatrio do tipo fechado surgiu pela
primeira vez nos vertebrados.
IV. Nos metazorios sem cavidade corprea, a
circulao realizada por difuso.

49)
(UFV 06) Suos produzem confiana
engarrafada (Folha de S. Paulo, 02 jun. 2005, ttulo de
reportagem). Nos experimentos, os pesquisadores
suos mostraram que numa transao financeira,
usando um spray nasal com oxitocina em um grupo de
investidores, estes passaram a confiar mais nos
gerentes, ao contrrio daqueles que receberam uma
substncia incua. Este hormnio est ligado criao
de elos sociais e regulao da atividade cerebral,
dentre outros, mas ningum sabia que ele participava de
forma to ativa num processo como a confiana. Em
relao oxitocina, INCORRETO afirmar que ela:

CORRETO o que se afirma apenas em:


a) I, II e III.
b) I, II e IV.
c) II, III e IV.
d) I, III e IV.
e) II e III.

46)
(UFV 06) A corrupo que assola um pas
tem uma estreita analogia com o cncer, no apenas
pela amplitude da malignidade que ambos podem
causar, mas tambm pela maneira como se
estabelecem e proliferam. Restringindo-se a aspectos
biolgicos, assinale a afirmativa INCORRETA com
relao ao processo cancergeno:
a) Como na maioria dos casos o cncer no herdado,
a investigao da anormalidade tem sido centrada na
identificao da origem da informao alterada no
prprio indivduo.

a) acelera as contraes uterinas que levam ao parto.


b) promove diretamente a maturao do folculo
ovariano.
c) secretada pela neuro-hipfise.
d) atua na contrao da musculatura lisa das glndulas
mamrias.
e) pode ser liberada pelo estmulo de suco do peito da
me pelo beb.

Pr Vestibular Diferencial

BIOLOGIA

50)
(UFV 06) Foi proposto um modelo gentico
para o florescimento em que a formao normal dos
verticilos era resultante de uma atividade combinatorial
de genes com a diferenciao de determinados setores
meristemticos (X, Y e Z). A ausncia de um ou mais
verticilos resultado de mutao gnica que afeta um
ou mais setores. No esquema abaixo, os nmeros I, II,
III e IV indicam, respectivamente, a posio de cada
verticilo: spala, ptala, estame e carpelo. Na hiptese
dos setores X e Z serem mutantes, assinale a
alternativa que contm os verticilos formados:

53)
(UFV 06) Durante o desenvolvimento
embrionrio dos vertebrados, o conjunto de clulas que
se diferenciam dos blastmeros forma os folhetos
germinativos e, posteriormente, as diversas clulas do
corpo. Com relao a esse processo, analise as
afirmativas abaixo:
I. O mesoderma origina as fibras musculares.
II. O ectoderma origina as clulas nervosas.
III. O endoderma origina as clulas do epitlio intestinal.
CORRETO o que se afirma em:
a) I e II, apenas.
b) II e III, apenas.
c) I e III, apenas.
d) I, apenas.
e) I, II, e III.

a) Ptalas.
b) Spalas.
c) Estames.
d) Carpelos.
e) Estames e carpelos.

54)
(UFV 06) Na figura estilizada abaixo, a
enfermeira e o paciente representam dois tipos celulares
vegetais intimamente associados e especializados de
um mesmo tecido. Embora sejam clulas vivas, um
desses tipos celulares no possui ncleo quando
completamente diferenciado. O outro tipo de clula
adjacente nucleado e denso em material
citoplasmtico e mitocondrial.

51)
(UFV 06) As boas prticas de alimentao
tm sinalizado que o consumo de vegetais de colorao
amarela a vermelho-alaranjada tem reflexos positivos
para a nutrio. Os responsveis por tais coloraes e
pelo valor nutritivo so os pigmentos carotenides,
dentre eles o -caroteno. Nas plantas, esses pigmentos
so encontrados na seguinte organela:
a) vacolo.
b) plastdeo.
c) complexo de Golgi.
d) mitocndria.
e) peroxissomo.
52)
(UFV 06) Estudos do nmero de espcies
vegetais em uma rea de pntano sugeriram que as
abundncias relativas das espcies numa comunidade
assumem distribuies previsveis. No grfico abaixo, as
associaes s classes de freqncia esto baseadas
em percentuais de 25 reas de amostragens. Com base
no grfico, assinale a afirmativa INCORRETA:

Pode-se afirmar CORRETAMENTE que o tecido em


questo o:
a) meristema.
b) colnquima.
c) floema.
d) xilema.
e) esclernquima.
55)
(UFV 06) Em Angiospermas, a formao dos
gametas
ocorre
na
microsporognese
e
megasporognese, a partir da meiose das clulas-me
dos micrsporos e dos megsporos, respectivamente.
Estes dois processos so anlogos na etapa meitica,
inclusive nas propores de micrsporos e megsporos
produzidos. Entretanto, aps essas gametogneses, a
proporo dos ncleos que contribuiro efetivamente
com as ploidias das clulas resultantes das fecundaes
diferente. Assinale a alternativa que representa a
proporo CORRETA de ncleos que participam
efetivamente nessas fecundaes:

a) O nmero das espcies assume uma forma de j


invertido.
b) Na comunidade, a maioria das espcies
relativamente rara.
c) Poucas espcies na comunidade so abundantes.
d) No h evidncia, no grfico, de espcies em
extino.
e) Aproximadamente 14 espcies so as mais
freqentes.

a) 2:3
b) 1:2
c) 2:6
d) 1:4
e) 3:8

Pr Vestibular Diferencial

BIOLOGIA

56)
(UFV 06) Embora as atividades das enzimas
ptialina, pepsina e tripsina sejam bem caracterizadas
nos seus respectivos pH fisiolgicos em seres humanos,
o grfico abaixo demonstra estas atividades com as
variaes de amplitude de pH quando realizadas in vitro.
Observe o grfico e assinale a afirmativa CORRETA:

a) pertence ao filo Mastigophora, cujos membros podem


ser parasitas ou de vida livre.
b) trata-se de um parasita heteroxeno, pois seu ciclo de
vida envolve dois ou mais hospedeiros.
c) reproduz-se sexuadamente por esquizogonia com
formao de esporozotos.
d) uma das formas eventuais de transmisso desta
parasitose ocorre por transfuso sangnea.
e) alm dos locais de picada e de ferimentos externos,
as mucosas podem ser vias de penetrao da forma
flagelada no homem.
60)
(UFV 06) Observe o esquema abaixo, que
representa algumas das etapas da hiptese de que as
clulas eucariticas surgiram, em parte, como resultado
evolutivo de um processo gradual de endossimbiose:

a) A pepsina representada por II; a sua atuao ocorre


tanto em pH cido quanto em neutro.
b) A ptialina representada por I; a sua atividade
maior em pH mais alcalino.
c) A tripsina representada por III; a sua atividade pode
ocorrer do pH cido ao alcalino.
d) As enzimas I e III atuam sobre carboidratos, embora
suas atividades ocorram em pH diferentes.
e) As enzimas II e III no apresentam atividades na
digesto de seus substratos em pH neutro.
57)
(UFV 06) Uma espcie denominada
indicadora de um determinado ambiente quando sua
presena est correlacionada a uma condio abitica
(ou a um conjunto de condies). Assim, CORRETO
afirmar que so melhores indicadoras das condies
ambientais as espcies que:

Utilizando o esquema como base, assinale a afirmativa


INCORRETA:
a) A endossimbiose de um procariota fotossinttico VI
com um proeucariota originou as clulas eucariticas
heterotrficas atuais.
b) As invaginaes da membrana plasmtica
aumentaram a superfcie de contato e a capacidade de
transporte em procariticos IV.
c) Uma clula procaritica aerbia I associou-se a uma
procaritica heterotrfica anaerbia II, aumentando o
potencial energtico.
d) Como resultado das invaginaes, um envelope
nuclear precursor formou-se em uma clula
proeucaritica V.
e) Uma clula procaritica III teve a sua capacidade
aerbia
aumentada,
em
virtude
da
compartimentalizao
das
membranas
nas
mitocndrias.

a) apresentam pequenos limites de tolerncia s


variaes das condies ambientais.
b) so dominantes numericamente, pois so as mais
resistentes s variaes ambientais.
c)
apresentam
alta
capacidade
competitiva,
independentemente das condies ambientais.
d) ocorrem em diversos tipos de ambiente, sem mostrar
qualquer preferncia pelas condies abiticas ou
biticas.
e) indicam de forma acentuada a especializao de
outras espcies em um ambiente particular.
58)
(UFV 06) Em um trabalho de zoologia, uma
turma de estudantes coletou alguns organismos e
utilizou duas caractersticas morfolgicas externas
bsicas para separ-los necessariamente em trs
grupos distintos.

61)

As duas caractersticas utilizadas foram:


a) diviso do corpo e exoesqueleto.
b) nmero de antenas e presena de asas.
c) nmero de patas e nmero de antenas.
d) exoesqueleto e patas articuladas.
e) presena de asas e nmero de patas.

(UFMG - 03) Analise esta tabela:

Com base nos dados dessa tabela e em outros


conhecimentos sobre o assunto, CORRETO afirmar
que:

59)
(UFV 06) ... tomou caldo-de-cana e de troco
adquiriu Doena de Chagas!. Parece inacreditvel, mas
na Amrica do Sul cerca de 7 milhes de pessoas ainda
sofrem desta parasitose causada pelo Tripanosoma
cruzi. Sobre este parasita INCORRETO afirmar que:

A) o peso a caracterstica que apresenta maior


influncia gentica.
B) as diferenas entre gmeos MZ indicam diferenas
genticas entre eles.

10

Pr Vestibular Diferencial

BIOLOGIA

C) a influncia ambiental pode ser avaliada em gmeos


MZ.
D) o comprimento da cabea apresenta maior influncia
ambiental.

C) a ocorrncia do fentipo mutante resultado de um


cromossomo extra.
D) a fecundao de um vulo X por um espermatozide
XY d origem a um indivduo Klinefelter.

62)
(UFMG - 03) Analise estes grficos, em que
esto representados surtos epidmicos de algumas
doenas no Brasil:

65)
(UFMG - 03) Em todas as alternativas,
diferentes tipos de radiao esto corretamente
associados
a fenmenos biolgicos, EXCETO em
A) Radiao ultravioleta participa do bronzeamento e da
produo de vitamina D na pele.
B) Ondas de rdio orientam as rotas de aves
migradoras.
C) Luz visvel desencadeia o processo de crescimento
das plantas.
D) Radiao infravermelha emitida pela presa
percebida por rgos sensoriais das cobras.
66)
(UFMG - 03) A maioria das espcies de
bromlias vive em ambientes de florestas, sobre galhos
e troncos de rvores. Pesquisadores verificaram que
indivduos da mesma espcie
podem apresentar grande variao fenotpica.
Analise estes grficos do comportamento da bromlia
Neoregelia johannis:

Fonte: FUNASA-Folha de S. Paulo,24 fev .2002


Considerando-se as doenas indicadas, INCORRETO
afirmar que os ndices de casos registrados no perodo
definido nos grficos podem ser explicados
A) pelo incentivo ao ecoturismo e reforma agrria.
B) pela coordenao das aes do Governo no
tratamento dos doentes.
C) pela coleta irregular de dados pelos agentes pblicos
de sade.
D) pela falta de estrutura de saneamento bsico e coleta
de lixo.

FONTE: Cincia Hoje 26 (155), 1999.


Com base nas informaes desses grficos e em outros
conhecimentos sobre o assunto, pode-se concluir que,
nas bromlias, a rea da folha e o nmero de espinhos
se relacionam com todas as seguintes adaptaes,
EXCETO
A) Reduo dos efeitos da insolao em locais abertos
B) Aumento de defesa contra herbvoros em locais
abertos
C) Aumento da captao de luz em locais sombreados
D) Reduo da transpirao em locais iluminados

63)
(UFMG
- 03) Para minimizar o uso de
inseticidas sintticos na fruticultura e atenderes normas
de segurana alimentar da FAO (Food and Agriculture
Organization), esto sendo implantadas biofabricas de
controle de pragas no Nordeste do Brasil. Essas
biofabricas podem adotar todas as seguintes
tecnologias, EXCETO

67)
(UFMG - 03) Um laboratrio recebeu trs
amostras de DNA para investigar se pertenciam a
espcies diferentes. A quantidade e a relao entre as
bases das amostras esto apresentadas nesta tabela:

A) Produo de parasitas das pragas


B) Extrao de inseticidas naturais
C) Criao de comensais das pragas
D) Produo de machos estreis das pragas
64)
(UFMG - 03) O nmero de cromossomos da
espcie humana pode, as vezes, apresentar alteraes.
Pessoas com sndrome de Klinefelter possuem 47
cromossomos, entre os quais, os cromossomos sexuais
so representados por XXY.
Com base nessas
informaes e outros conhecimentos sobre o assunto,
INCORRETO afirmar que
A) os pais de um indivduo Klinefelter tm nmero
normal de cromossomos nas clulas somticas.
B) a presenaa de dois cromossomos X impede a
manifestao do fentipo masculino.

Com base nas informaes dessa tabela e em outros


conhecimentos sobre o assunto, INCORRETO afirmar
que
A) as trs amostras so provenientes de diferentes
espcies.

11

Pr Vestibular Diferencial

BIOLOGIA
Com base nas informaes dessa tabela e em outros
conhecimentos sobre o assunto, CORRETO afirmar
que a diferena entre a diversidade de Gimnospermas e
de Angiospermas pode ser explicada

B) a amostra 3 possui o mais alto contedo de pares de


bases A e T.
C) a amostra 2 apresenta DNA de fita simples.
D) as amostras 1 e 3 apresentam alta homologia entre
seus DNAs.
68)

A) pelos tipos de folhas e sementes.


B) pela ao dos insetos polinizadores.
C) pela ao menos intensa de herbvoros.
D) pelos modos de disperso dos frutos.

(UFMG - 03) Observe esta figura:

71)
(UFMG - 03) Analise este esquema relativo
obteno de clulas-tronco:

Na prtica mdica, a utilizao de sanguessugas como


agentes indutores de sangramento remonta ao ano 180
a.C. Atualmente, as sanguessugas tm sido usadas na
preveno de necrose tecidual, aps cirurgias
reparadoras. Considerando-se essa situao,
CORRETO supor que o uso de sanguessugas se deve
A) reduo da oxigenao dos tecidos lesados.
B) estimulao da atividade da trombina.
C) ao anestsica, visando-se reduo da dor.
D) preveno da coagulao sangunea.
69)

Com base nas informaes desse esquema e em outros


conhecimentos sobre o assunto, INCORRETO afirmar
que clulas-tronco
A) retiradas de embries congelados eliminam as
questes ticas e religiosas associadas obteno de
rgos para transplantes.
B) de um paciente podem ser usadas para regenerar
seus tecidos ou orgos lesados, eliminando o risco de
rejeio imunolgica.
C) de adulto so capazes de se diferenciar em outro tipo
de clula, independentemente do seu tecido de origem.
D) embrionrias so capazes de se diferenciar em outros
tipos de clulas, desde que cultivadas sob condies
adequadas.

(UFMG - 03) Analise este experimento:

72)

(UFMG - 03) Analise esta figura:

Considerando-se o resultado desse experimento,


CORRETO afirmar que:
A) os ratos produzem dixido de carbono quando
absorvem oxignio.
B) a troca de gases aumenta quando maior a
produo de energia.
C) gua resultante do metabolismo da glicose produto
de oxidao.
D) o carbono do CO2 eliminado pelos ratos
proveniente da glicose.
70)

(UFMG - 03) Analise esta tabela:

Considerando-se a implantao de corredores


ecolgicos, INCORRETO afirmar que
A) os parques, na falta desses corredores, constituem
ilhas isoladas de ampliao
da biodiversidade e de formao de novas espcies.
B) esse tipo de ligao permite o fluxo gnico entre
indivduos da mesma espcie e a manuteno de seus
ciclos biolgicos.

12

Pr Vestibular Diferencial

BIOLOGIA

C) alguns animais favorecidos, nas regies assim


interligadas, so a ona-pintada,o lobo-guar, a ema e o
veado-campeiro.
D) os animais e plantas dependentes desses corredores
so espcies sensveis a ambientes alterados.
73)

(UFMG - 03) Analise estas figuras:

Considerando-se os processos de imunizao


representados, INCORRETO afirmar que
A) os anticorpos so produzidos tanto em I quanto em II.
B) o cdigo gentico do patgeno igual ao do
camundongo.
C) o antgeno do patgeno produzido pelo
camundongo em I.
D) o mRNA do antgeno do patgeno traduzido em II.
74)
(UFMG - 03) Observe estas figuras, em que
esto ilustrados alguns tipos de polinizao de plantas
com flores:

FONTE: RAVEN, P. N., et al. Biologia Vegetal. 6. ed.


Rio de Janeiro:Guanabara Koogan, 2001. p. 510-519.
Com base nas informaes dessas figuras e em outros
conhecimentos sobre o assunto, INCORRETO afirmar
que, para a ao dos agentes polinizadores,
importante
A) em IV, o tamanho das anteras.
B) em II, a colorao das ptalas.
C) em I, a quantidade de gro de plen.
D) em III, a produo de nctar.

13

Pr Vestibular Diferencial

BIOLOGIA

75)
(UFMG - 03) Muitos agricultores tm
abandonado o plantio nas encostas das serras devido
dificuldade
de
mquinas
agrcolas
modernas
trabalharem em terras ngremes. Observa-se, em vrios
desses locais, a recuperao de florestas, inclusive de
trechos de Mata Atlntica, graas ao processo
representado nesta figura:

Considerando-se o processo de recuperao dessas


reas, CORRETO afirmar que
A) os ciclos do carbono e do nitrognio so mais
demorados no final desse processo.
B) esse processo comea com espcies pioneiras que
produzem poucas sementes.
C) a biomassa e a taxa de respirao, no incio da
recuperao, so maiores que no final.
D) o tempo necessrio para a recuperao da floresta
de, aproximadamente, cinco anos.

Os ndulos formados nas razes das leguminosas


resultam da colonizao por bactrias fixadoras de
nitrognio. Devido presena desses ndulos nas
razes, as sementes de leguminosas como a soja, por
exemplo so boas armazenadoras de
A) amido.
B) carboidratos.
C) lipdios.
D) protenas.

76)
(UFMG - 04) Pretende-se realizar uma
pesquisa sobre as possveis causas de ocorrncia de
malria na populao humana que habita a Regio
Metropolitana de Belo Horizonte manancial Rio
Manso/COPASA , no vero de 2003. Nesse caso,
podem ser considerados todos os seguintes fatores,
EXCETO

80)

(UFMG - 04) Observe estas figuras:

A) Contaminao da fauna silvestre pelo protozorio


B) Migrao constante de pessoas contaminadas
C) Proliferao do transmissor em ambiente aqutico
D) Vacinao da populao em pocas de chuva
77)
(UFMG - 04) Todas as alternativas apresentam
situaes em que morcegos, golfinhos e algumas aves
utilizam o sistema acstico de orientao espacial por
ressonncia, EXCETO
A) Capturar presas.
B) Escapar de ambientes iluminados.
C) Evitar ataque de predadores.
D) Impedir colises.

Entre as funes que ocorrem nessas razes e nesse


caule comestveis, NO se inclui
A) armazenagem de nutrientes.
B) reproduo sexuada.
C) reserva de gua.
D) resistncia ao frio.

78)
(UFMG - 04) Casacos de l, sapatos de couro
e cintos de algodo guardados por algum tempo em
armrios podem ficar mofados, pois os fungos
necessitam de

81)
(UFMG - 04) Observe esta seqncia de
ambientes numerados de I a IV:

A) algas simbiticas para digerir o couro, a l e o


algodo.
B) baixa luminosidade para realizar fotossntese.
C) baixa umidade para se reproduzirem.
D) substrato orgnico para o desenvolvimento
adequado.
79)

(UFMG - 04)Observe esta figura:

14

Pr Vestibular Diferencial

BIOLOGIA

Com base nessa representao, INCORRETO afirmar


que
A) a enguia, o trito, o lagarto e a cobra possuem
ancestral comum.
B) a especiao dos lagartos foi anterior do trito.
C) as cobras so mais aparentadas com os lagartos que
com as enguias.
D) parentes distantes, nessa rvore, podem apresentar
semelhanas fenotpicas.
Considerando-se as caractersticas desses ambientes,
CORRETO afirmar que o parmetro que aumenta na
seqncia indicada a
A) concentrao de CO2 atmosfrico.
B) diversidade de nichos ecolgicos.
C) temperatura mdia anual.
D) velocidade de evaporao da gua de chuva.

84)
(UFMG - 04) Analise estes agrupamentos de
animais:

82)
(UFMG - 04) Observe este esquema, em que
as representaes esto numeradas de I a VI:

Para a formao desses trs agrupamentos, o critrio


comum adotado foi
A) a regulao de temperatura.
B) o nmero de membros locomotores.
C) o revestimento do corpo.
D) o tipo de fecundao.

Considerando-se esse esquema, INCORRETO afirmar


que
A) a primeira diviso mittica ocorre entre a fase II e a
fase III.
B) as clulas so totipotentes na fase IV.
C) o nmero de clulas diferente na fase V e na fase
VI.
D) os cromossomos homlogos esto pareados na fase
I.

85)
(UFMG - 04) Analise estes grficos
representativos de atividade do sistema cardiovascular
durante a realizao de exerccio fsico:

83)
(UFMG - 04)Observe esta representao de
parte de uma rvore evolutiva:

15

Pr Vestibular Diferencial

BIOLOGIA

Com base nas informaes contidas nesse grfico e


nessa tabela, bem como em outros conhecimentos
sobre o assunto, INCORRETO afirmar que
A) a atividade dos ovrios importante para a
resistncia ssea.
B) as mulheres com DMO menor que 1,0 tm 10% de
chance de sofrer fraturas.
C) as mulheres em menopausa devem consumir mais
leite ou seus derivados.
D) uma pequena reduo na DMO pode causar
enfraquecimento sseo.

Com base nas informaes contidas nesses grficos e


em outros conhecimentos sobre o assunto,
INCORRETO afirmar que, durante o exerccio fsico,
A) o msculo da perna recebe maior quantidade de
oxignio entre 14 e 16 minutos de atividade.
B) o volume de sangue de um indivduo pode aumentar
at cinco vezes.
C) o volume de sangue que passa pelo corao de um
indivduo, a cada minuto, maior que no repouso.
D) um fluxo maior de hemcias aumenta a oxigenao
do msculo da perna.

87)
(UFMG - 04) Analise este grfico, em que est
representada a produo de diferentes tipos de cadeias
polipeptdicas ,, e  determinadas pela ao de
diferentes genes e que vo compor as hemoglobinas em
vrias fases do desenvolvimento humano:

86)
(UFMG - 04) Analise este grfico e esta tabela,
em que esto expressas informaes coletadas numa
populao de mulheres:

Com base nas informaes contidas nesse grfico e em


outros conhecimentos sobre o assunto, INCORRETO
afirmar que
A) a ativao do gene responsvel pela sntese da
cadeia polipeptdica ocorr e dias antes do nascimento.
B) a sntese da cadeia polipeptdica permanece
constante durante a mudana de produo das cadeias
e .
C) o gene responsvel pela sntese da cadeia
polipeptdica aumenta sua atividade a partir do terceiro
ms da concepo.

16

Pr Vestibular Diferencial

BIOLOGIA

D) os quatro tipos de cadeias polipeptdicas , , e


 estaro presentes no indivduo adulto.
88)
(UFMG - 04) A identificao do fator que
origina indivduos com sndrome de Down tornou-se
possvel pela utilizao da tcnica de
A) contagem e identificao dos cromossomos.
B) cultura de clulas e tecidos.
C) mapeamento do genoma humano.
D) produo de DNA recombinante.

Folha de S. Paulo, 25 abr. 2004.


Tema constante de piadas, a flatulncia s NO pode
ser causada
A) pelo hbito de falar durante as refeies.
B) pela fermentao de carboidratos por bactrias.
C) pelo costume de andar aps as refeies.
D) pela ocorrncia de parasitoses intestinais.

89)
(UFMG - 04) Analise estes grficos, em que
esto representadas populaes de insetos com trs
tipos de gentipos e fentipos insetos com asas
longas (SS), insetos com asas curtas (Ss) e insetos sem
asas (ss) em dois ecossistemas diferentes lagoa
permanente e lagoa temporria:

92)
(UFMG-05)No trajeto de um rio, localizou-se
um ponto de despejo de esgoto domstico, como
mostrado nesta figura:

Para avaliar-se a extenso das conseqncias desse


despejo, foram feitas a medio do oxignio dissolvido e
a contagem das bactrias encontradas em amostras de
gua coletadas nos pontos I, II, III e IV. Considerandose essa situao, CORRETO afirmar que, entre as
seguintes previses, a mais provvel a de que
A) o nmero de bactrias ser igual nos pontos I e II.
B) a taxa de oxignio no ponto III ser menor que no
ponto II.
C) o nmero de bactrias no ponto IV ser maior que no
ponto II.
D) a taxa de oxignio ser semelhante nos pontos I e IV.
Considerando-se as informaes contidas nesses
grficos, CORRETO afirmar que a seleo natural
A) atua favorecendo fentipos diferentes nas duas
lagoas.
B) aumenta a probabilidade de os insetos SS deixarem
descendentes nas duas lagoas.
C) favorece os indivduos heterozigotos na lagoa
permanente.
D) impede os cruzamentos de homozigotos recessivos
na lagoa temporria.

93)
A Campanha Nacional de Vacinao do Idoso,
instituda pelo Ministrio da Sade do Brasil, vem-se
revelando uma das mais abrangentes dirigidas
populao dessa faixa etria. Alm da vacina contra a
gripe, os postos de sade esto aplicando, tambm, a
vacina contra pneumonia pneumoccica. CORRETO
afirmar que essas vacinas protegem porque
A) so constitudas de molculas recombinantes.
B) contm anticorpos especficos.
C) induzem resposta imunolgica.
D) impedem mutaes dos patgenos.

90)
(UFMG - 04) A distrofia muscular do tipo
Duchenne, doena recessiva ligada ao cromossomo X,
caracteriza-se por debilidade muscular progressiva e
deformidades sseas, inicia-se na infncia e impede a
reproduo dos afetados. Considerando-se essas
informaes e outros conhecimentos sobre o assunto,
INCORRETO afirmar que:

94)
(UFMG-05)Analise estas figuras, em que esto
representadas fases da vida de um organismo
encontrado em lagoas hipersalinas:

A) casais com filhos afetados tm 25% de probabilidade


de ter outra criana comnessa doena.
B) indivduos do sexo masculino afetados por essa
distrofia muscular so filhos de mes heterozigotas.
C) indivduos do sexo masculino que possuem um gene
mutante para essa distrofia manifestam a doena.
D) mulheres afetadas recebem os cromossomos X
materno e paterno com o gene para essa distrofia.

91)

FONTE: Journal of Structural Biology, 145, mar. 2004.


Esse
organismo

uma
bactria
que,
surpreendentemente, apresenta uma caracterstica no
usual ao grupo a que pertence. CORRETO afirmar
que tal caracterstica consiste no fato de essa bactria

(UFMG-05)Leia esta charge:

17

Pr Vestibular Diferencial

BIOLOGIA

A) ter nmero haplide de cromossomo.


B) alimentar-se de forma heterotrfica.
C) ser organismo multicelular.
D) possuir DNA disperso no citoplasma.
95)

(UFMG-05)Observe estas figuras:

A partir dessa anlise, CORRETO afirmar que o


ancestral desses quatro grupos
apresentava
A) membros locomotores e pulmes.
B) corao com quatro cavidades e brnquias.
C) plos no corpo e glndulas mamrias.
D) homeotermia e placenta.
98)

Sabe-se que a origem das espcies resultou de uma


interao de fatores evolutivos. CORRETO afirmar
que, entre esses fatores, NO se inclui a
A) seleo.
B) autofecundao.
C) mutao.
D) migrao.

(UFMG-05)Observe esta figura:

96)
(UFMG-05)Analise estas figuras, em que est
representada a evoluo de seres eucariotas oriundos
da endossimbiose com bactrias:

CORRETO afirmar que a presena de lagartas em


espigas de milho se deve
A) ao processo de gerao espontnea comum aos
invertebrados.
B) transformao dos gros em lagartas.
C) ao desenvolvimento de ovos depositados por
borboletas.
D) ao apodrecimento do sabugo e dos gros.
99)

(UFMG-05)Observe esta figura:

A partir dessa anlise, INCORRETO afirmar que


estratgias de endossimbiose resultaram em
A) produo do prprio alimento.
B) obteno de energia nos processos respiratrios.
C) transmisso das organelas ao longo das geraes.
D) difuso de molculas pela membrana.
97)
(UFMG-05)Analise esta figura, em que est
representada a provvel filogenia dos vertebrados:
A cana-de-acar foi introduzida no Brasil pelos
portugueses, no incio da
colonizao, e sua explorao constitui um importante
setor da economia do pas.
INCORRETO afirmar que a cana-de-acar
A) reproduz vegetativamente, por meio do caule.
B) , filogeneticamente, relacionada com o milho e o
arroz.
C) produz flores vistosas polinizadas por pssaros.

18

Pr Vestibular Diferencial

BIOLOGIA

D) utilizada para a fabricao de lcool.

A) os mRNAs transcritos antes da adio do antibitico


B so traduzidos.
B) a queda da sntese de protena resulta da inibio da
duplicao do DNA.
C) os dois antibiticos A e B atuam sobre o mesmo
alvo.
D) o antibitico A impede a sntese de novas molculas
de mRNA.

100)
(UFMG-05)Observe este mapa, em que esto
demarcados alguns dos tipos de biomas do Brasil:

103)
(UFMG-05)Analise este heredograma, que
representa uma famlia em que h indivduos afetados
por um tipo de tumor de gengiva:

Cada um dos biomas demarcados apresenta vegetao


caracterstica, relacionada com o ambiente onde
encontrada. Considerando-se essas informaes,
CORRETO afirmar que a vegetao caracterstica de
grande parte dos estados de Minas Gerais, Mato Grosso
e Gois consiste em

Considerando-se as informaes desse heredograma e


outros conhecimentos sobre o assunto, INCORRETO
afirmar que
A) os indivduos normais, em todas as geraes, so
homozigotos.
B) a ocorrncia do tumor uma caracterstica
autossmica.
C) o prximo filho do casal II.1 x II.2 ser normal.
D) a probabilidade de o indivduo III.2 ser heterozigoto
de dois teros.

A) rvores muito espaadas; ervas com caules


subterrneos, razes superficiais e folhas estreitas.
B) rvores baixas, espaadas e com razes profundas;
arbustos com razes armazenadoras e folhas grandes e
duras.
C) rvores em nmero reduzido, com caules lenhosos e
grossos; arbustos suculentos, com folhas reduzidas.
D) rvores com troncos finos e pouco ramificados; e
outras com razes suporte e folhas grandes, de pontas
afiladas.

104)
(UFMG-05)Com freqncia, agricultores tm
utilizado queimadas como recurso na preparao do
solo para o plantio. CORRETO afirmar que o uso
sistemtico
dessa
conduta
no

indicado,
principalmente porque

101)
(UFMG-05)O uso da camisinha considerado
um mtodo eficaz para a prtica do sexo seguro. Entre
as finalidades desse mtodo, NO se inclui
A) impedir a formao do zigoto.
B) bloquear a passagem do smen.
C) evitar o contgio de doenas sexualmente
transmissveis.
D) dificultar a formao do gameta masculino.

A) retira a gua do solo.


B) destri microorganismos do solo.
C) impermeabiliza o solo.
D) dificulta a aerao do solo.
105)

(UFMG-05) Observe estas figuras:

102)
(UFMG-05)Analise estes grficos:
Efeito dos antibiticos A e B sobre a sntese de
protenas em bactrias

O mexilho dourado de gua doce, molusco originrio


do sudoeste da sia, uma espcie invasora do
sistema hdrico brasileiro, que provoca srios problemas
em estaes de gua, indstrias e hidreltricas. Entre as
caractersticas que facilitam a disseminao e o
aumento da populao desse molusco, NO se inclui

Considerando-se as informaes desses grficos,


CORRETO afirmar que

19

Pr Vestibular Diferencial

BIOLOGIA

A) o notvel controle de sua populao por inimigos


naturais.
B) a intensa disseminao de suas larvas.
C) a sua rpida maturao sexual.
D) a sua considervel capacidade adaptativa a
diferentes ambientes.

d)
109)
(UFMG-06)Analise esta tabela, em que se
relaciona a temperatura com a quantidade de oxignio
dissolvido na gua:

106)
(UFMG-06)Uma pesquisa realizada pela Escola
de Enfermagem da UFMG revelou a ocorrncia de altos
ndices de leishmaniose visceral humana na Regio
Nordeste de Belo Horizonte. CORRETO afirmar que
esses altos ndices de leishmaniose podem ser
explicados por
A) presena de caixas d.gua destampadas.
B)
aumento da populao de hospedeiros
contaminados.
C) ausncia de tratamento adequado de esgoto.
D) existncia de casas sem reboco ou de tbua.
107)
(UFMG-06)O arroz dourado . geneticamente
modificado . produz -caroteno (vitamina A). assim
sendo, CORRETO afirmar que o uso desse gro na
alimentao humana resulta em benefcio para a sade
porque ele

FONTE: CHARBONNEAU, J. P. et al. Enciclopdia


deEcologia. So Paulo: EPU/EDUSP, 1979. p.120.
Os dados dessa tabela NO podem ser usados para
explicar

A) previne alguns tipos de cegueira.


B) aumenta o peristaltismo.
C) evita o aparecimento do bcio.
D) diminui a formao de cogulos.

A) o predomnio de fermentao anaerbica em guas a


30 C.
B) a eutrofizao rpida em temperaturas entre 15 e 20
C.
C) a morte dos peixes em guas com temperaturas
acima de 30 C.
D) aumento de populaes de algas em temperaturas
abaixo de 5 C.

108)
(UFMG-06)Analise este esquema de parte de
uma rvore evolutiva de invertebrados, em que I, II, III e
IV representam grupos de organismos com as
caractersticas destacadas nos quadros a que cada um
deles se relaciona:

110)
(UFMG-06)Analise as situaes representadas
nestas figuras:

Considerando as informaes desse esquema e outros


conhecimentos sobre o assunto, assinale a alternativa
em que o animal mostrado NO representa o grupo
indicado.

Considerando-se as informaes dessas figuras,


CORRETO afirmar que NO ocorre tropismo na
situao
A) IV.
B) I.
C) II.
D) III.
111)
(UFMG-06)Analise os esquemas I e II, em que
esto
representadas diferentes situaes de
crescimento de uma mesma espcie vegetal:

a)

b)

c)

20

Pr Vestibular Diferencial

BIOLOGIA

A partir dessa anlise, INCORRETO afirmar que a


variabilidade gentica observada
A) em II se explica por mutao e recombinao.
B) em I decorre da troca de material gentico.
C) em II
possibilita a sobrevivncia em vrios
ambientes.
D) em I resulta de um processo de mutao.
114)
(UFMG-06)Nas situaes em que vtimas de
acidentes necessitam de transfuso de sangue, sem
que se conhea o tipo sangneo de cada uma
delas, recomendvel utilizar-se o tipo O negativo.
CORRETO afirmar que, nesse caso, tal tipo sangneo
o mais adequado porque, nas hemceas do doador,
esto

A partir dessa anlise, CORRETO afirmar que a


mudana observada nas plantas do esquema II decorre
de
A) redirecionamento dos hormnios de crescimento.
B) aumento da concentrao dos hormnios de
dormncia.
C) estimulao dos hormnios de envelhecimento.
D) produo de hormnios de amadurecimento.
112)

A) presentes os antgenos correspondentes aos


anticorpos do receptor.
B) ausentes os anticorpos correspondentes aos
antgenos do receptor.
C) ausentes os antgenos correspondentes aos
anticorpos do receptor.
D) presentes os anticorpos correspondentes aos
antgenos do receptor.

(UFMG-06)Analise esta figura:

115)
(UFMG-06)O mal de Huntington uma doena
autossmica dominante caracterizada por deteriorao
mental progressiva, convulses e morte. Os indivduos
afetados so heterozigotos. Analise este grfico, em que
se mostra o percentual de indivduos doentes entre
aqueles que possuem gentipo favorvel:

Durante a evoluo da vida na Terra, o aumento no


nmero de organismos fotossintetizantes alterou a
fisionomia do planeta. Assim sendo, INCORRETO
afirmar que o aumento na taxa de oxignio atmosfrico
teve como conseqncia a
A) reduo dos nichos ecolgicos.
B) ampliao da teia alimentar.
C) expanso de seres heterotrficos.
D) formao da camada de oznio.

113)

Com base nas informaes desse grfico e em outros


conhecimentos sobre o assunto, INCORRETO afirmar
que,
A) em torno dos 65 anos, cerca de 85% dos indivduos
heterozigotos j manifestaram a doena.
B) antes de atingirem a idade de 15 anos, indivduos
portadores do alelo mutante podem expressar a doena.
C) aos 30 anos, aproximadamente 75% dos indivduos
Aa se apresentam sem os sinais clnicos da doena.
D) aos 40 anos, filhos de casais Aa x aa tm 50% de
probabilidade de manifestar a doena.

(UFMG-06)Analise estas figuras:

116)
(UFMG-06)Analise esta tabela, em que esto
relacionadas caractersticas das geraes F1 e F2,

21

Pr Vestibular Diferencial

BIOLOGIA

resultantes dos cruzamentos de linhagens puras de trs


organismos diferentes:

Considerando-se as informaes contidas nesta tabela


e outros conhecimentos sobre o assunto,
INCORRETO afirmar que
A) os pares de genes que determinam o .tipo. e a .cor.
da asa nas moscas esto localizados em cromossomas
no-homlogos.
B) as caractersticas .tipo de semente. e .cor de
plumagem. so determinadas, cada uma delas, por um
nico par de gene.
C) as plantas da F2 com .sementes rugosas., quando
autofecundadas, originam apenas descendentes com
sementes rugosas.
D) o gene que determina .plumagem azulada.
dominante sobre os genes que determinam .plumagem
preta. ou .plumagem branca..

Considerando-se as informaes contidas nesses


grficos e outros conhecimentos sobre o assunto,
CORRETO afirmar que a pastagem faz diminuir
A) os recursos disponveis para outros herbvoros.
B) a competio entre gramneas e ervas.
C) a diversidade dessas espcies vegetais.
D) a produtividade das ervas.
119)

(UFMG-06)Analise estas figuras:

117)
(UFMG-06)Analise este grfico, em que est
representado o efeito de duas aplicaes de inseticida
em uma plantao de cana-de-acar infestada de
cigarrinhas:

Com base nas informaes desse grfico e em outros


conhecimentos sobre o assunto, INCORRETO afirmar
que,
A) para ocorrer uma nova reduo da populao,
necessrio mudar o tipo de inseticida ou a forma de
controle da cigarrinha.
B) aps a primeira aplicao do inseticida, se evidencia
a eficincia deste pela queda acentuada no nmero de
cigarrinhas ocorrida nesse perodo.
C) depois da segunda aplicao do inseticida, os
organismos resistentes se tornam mais numerosos que
os sensveis.
D) feita a primeira aplicao do inseticida, ocorre
alterao no gentipo dos insetos sensveis, o que
resulta no decrescimento da populao.

A obstruo dos vasos indicados observada nessas


figuras pode causar infarto do miocrdio, o que implica
srios danos ao corao e pode, s vezes, resultar em
morte.
Considerando-se
a
ocorrncia
de
infarto,

INCORRETO afirmar que


A) o aporte de oxignio para o msculo cardaco fica
reduzido.
B) a leso do miocrdio conseqncia da morte de
clulas endoteliais.
C) a ingesto de gordura animal e o sedentarismo so
fatores de risco.
D) a produo de energia nas clulas musculares fica
comprometida.

118)
(UFMG-06)Analise estes grficos, em que est
representado o efeito da pastagem de uma populao
herbvora que se alimenta, preferentemente, de
gramneas sobre uma comunidade vegetal:

120)
(UFMG-06)Na atualidade, uma das doenas
que mais freqentemente se detecta na populao
mundial o diabetes melito. E, no tratamento dessa
doena, vem-se utilizando, com relativo sucesso, o
transplante de clulas.
Analise este esquema:

22

Pr Vestibular Diferencial

BIOLOGIA
pela presena de vlvulas especializadas no interior das
veias.
IV. O miocrdio constitudo por tecido muscular
estriado cardaco e sua fase de contrao
denominada distole.
V. O sangue humano constitudo por hemcias,
leuccitos, plaquetas, gua e substncias dissolvidas,
como protenas, hormnios, sais, gases, e excrees.
Assinale a alternativa que contm as afirmativas
CORRETAS:
a) I, II e IV
b) I, III e V
c) II, III e IV
d) I, II e IV
e) III, IV e V

Considerando-se as informaes contidas nesse


esquema e outros conhecimentos sobre o assunto,
CORRETO afirmar que, em tal situao, as clulas
cultivadas so

123)
(UFJF-04-2)Algumas
caractersticas
dos
organismos das aves e dos mamferos que conferem a
capacidade de controle da temperatura corporal so:

A) pancreticas e possuem genes para a sntese de


insulina.
B) hepticas e geneticamente modificadas para
sintetizar hormnios.
C) hepticas e vo sintetizar glucagon, que reduz a taxa
de glicose no sangue.
D) pancreticas e capazes de captar insulina por meio
de receptores.

a) pulmo alveolar em ambos os grupos, penas nas


aves e diafragma muscular nos mamferos.
b) completa oxigenao dos tecidos nos dois grupos,
ossos pneumticos nas aves e plos nos mamferos.
c) camada de gordura subcutnea em ambos os grupos,
glndula uropigiana nas aves e glndulas mamrias nos
mamferos.
d) alta taxa metablica em ambos os grupos, controle do
eriamento das penas nas aves e glndulas sudorparas
nos mamferos.
e) vasos sanguneos perifricos em ambos os grupos,
excreo de cido rico nas aves e dieta altamente
calrica nos mamferos.

121)
(UFJF-04-2)Os insetos influenciam diversos
aspectos da vida humana. Alguns trazem benefcios,
como a polinizao e a produo de mel e seda, e
outros acarretam srios prejuzos, como o ataque a
plantaes e a transmisso de doenas. O combate aos
insetos praga pode ser feito, por exemplo, com
inseticidas, no controle qumico, e com inimigos
naturais, no controle biolgico. Todas as afirmativas
abaixo so informaes corretas sobre o controle
biolgico, EXCETO:

124)
(UFJF-04-2)O
crescimento
e
o
desenvolvimento das plantas so controlados por
interaes de fatores externos e internos. Entre os
fatores internos, destacam-se os hormnios vegetais,
em especial, as auxinas. O grfico abaixo ilustra a
influncia da concentrao de auxina no crescimento de
diferentes partes das plantas. Analisando o grfico
abaixo e considerando o mecanismo de ao das
auxinas, CORRETO afirmar que:

a) O controle biolgico pode ser feito pelo uso de vrus,


fungos, bactrias e alguns insetos predadores, exticos
ou no.
b) Por ser uma tcnica de controle baseada em relao
ecolgica, reduz o impacto ambiental.
c) O agente de controle deve ser generalista, pois ir
competir pelos mesmos recursos com o inseto praga,
levando diminuio das duas espcies.
d) O controle biolgico no promove resistncia nos
insetos praga.
e) O controle biolgico pode ser associado a outras
tcnicas de controle, como, por exemplo, o uso de
inseticidas seletivos, permitindo uma maior eficcia no
controle de pragas.
122)
(UFJF-04-2)Considere as afirmativas abaixo
sobre a circulao humana:

a) o aumento da concentrao de auxina promove o


aumento do tamanho das razes formadas.
b) os caules so mais sensveis auxina do que as
razes.
c) a auxina, quando em altas concentraes, pode ser
usada como herbicida.
d) o aumento da concentrao da auxina, a partir do
ponto I, estimula o crescimento da planta, sendo V a
concentrao tima para o crescimento mximo.
e) a faixa de concentrao tima de atuao da auxina
varia somente de espcie para espcie.

I. A circulao humana classificada como dupla e


completa e o corao possui quatro cavidades.
II. A artria pulmonar transporta o sangue rico em
oxignio dos pulmes para o corao, ao passo que a
veia pulmonar transporta o sangue rico em gs
carbnico do corao para os pulmes.
III. O retorno do sangue venoso ao corao promovido
pela ao de msculos esquelticos e respiratrios, e

23

Pr Vestibular Diferencial

BIOLOGIA
e) III, IV e V esto corretas.

125)
(UFJF-04-2)Em um canteiro de samambaias
ornamentais, surgiram insetos que se alimentam dos
prtalos formados. Como conseqncia imediata dessa
ao, pode-se esperar que:
a) no haver mais a produo de esporngios e a
formao de esporos diplides.
b) haver reduo na formao de soros e,
conseqentemente, novos prtalos no sero formados.
c) no haver formao de arquegnios e esporngios,
interrompendo o ciclo reprodutivo.
d) no haver formao de anterdeos e, portanto,
novos esporos no sero formados.
e) no haver formao de zigotos e, como resultado,
novos esporfitos no sero formados.
126)
(UFJF-04-2)A
realizao
de
exerccios
exaustivos causa dores musculares devido ao acmulo
de cido ltico, que conseqncia:
a) do aumento da respirao anaerbica.
b) do aumento de transporte de eltrons na cadeia
respiratria.
c) da morte de mitocndrias das fibras musculares.
d) do acmulo de piruvato no interior das mitocndrias.
e) do aumento excessivo da produo de ATP.
127)
(UFJF-04-2)Alguns anestsicos locais agem
impedindo a despolarizao da membrana plasmtica
dos neurnios. A sensao de dor , ento, eliminada
em funo da:
a) modificao da fenda sinptica.
b) ruptura da bainha de mielina dos neurnios.
c) diminuio do nmero de sinapses.
d) inibio da secreo do neurotransmissor.
e) inverso no sentido do impulso nervoso.
128)
(UFJF-04-2)Os organismos geneticamente
modificados, usados comercialmente, so homozigotos
dominantes para o gene que confere uma nova
caracterstica. A soja cultivada no Rio Grande do Sul,
por exemplo, recebeu um gene que confere resistncia
ao herbicida glifosato. Plantas no-transgnicas,
quando submetidas ao do herbicida, morrem,
possibilitando o controle de plantas daninhas. A partir
dessas informaes, analise as afirmativas abaixo:

I)

Plantas de soja homozigotas (RR), quando


cruzadas com soja no-transgnica, produziro
uma prole 100% resistente ao herbicida e a
gerao F2 ter uma proporo de trs plantas
resistentes para uma susceptvel.
II)
Plantas de soja transgnicas s sero favorecidas
mediante a aplicao do herbicida glifosato.
III) Plantas de soja transgnicas promovem a morte
tanto de insetos praga como de polinizadores.
IV) O monocultivo de soja, transgnica ou no,
impacta o solo e reduz a biodiversidade.
V) Os transgnicos so obtidos por multiplicao
vegetativa de variedades mutantes selecionadas
em laboratrio.
Assinale a alternativa CORRETA:
a) I, II e III esto corretas.
b) I, II e IV esto corretas.
c) I, IV e V esto corretas.
d) II, III e V esto corretas.

24

Pr Vestibular Diferencial

BIOLOGIA

GABARITO
12345678910111213141516-171819-202122-232425-2627282930-

D
B
E
E
A
A
B
E
E
A
D
E
E
D
C
E
C
C
A
B
B
A
E
D
D
C
C
B
A
E

3132333435-363738-394041424344454647484950515253-5455565758-5960-

D
B
A
C
C
D
E
C
A
E
A
C
D
B
A
C
C
A
B
B
B
E
E
C
A
C
A
C
C
A

6162636465666768697071-7273-747576-7778-798081-828384-858687888990-

919293949596979899100101102103104105106-107108-109110111112113114115116117-118119120-

D
B
D
D
B
B
D
B
C
B
B
D
A
A
D

25

C
D
C
C
B
D
A
C
C
B
D
A
C
B
A
B
A
C
D
C
A
A
B
C
D
D
D
B
B
A

121122123124125126127128129-130131132133134135-136137138-139140-141-142143-144-145-146147148149150-

C
B
D
C
E
A
D
B

Pr Vestibular Diferencial

BIOLOGIA

QUESTES DISCURSIVAS
1)
(UFV - 01)Apesar de o osso ser um rgo duro
e resistente, ele relativamente flexvel e capaz de ser
remodelado em resposta a foras ou trao, conforme
verificado no uso de aparelhos ortodnticos e
ortopdicos. Considere as caractersticas do tecido
sseo para resolver os itens:
a)
Cite os dois principais componentes qumicos
da matriz ssea que so responsveis pela dureza dos
ossos:

a)
Identifique o grupo sangneo do indivduo I-1:
b)
Qual o gentipo do indivduo II-5?
c)
O Sr. Lalau poder ser receptor de sangue de
seu genro para transfuso?

b)
Cite o nome do principal componente orgnico
da matriz ssea que confere flexibilidade aos ossos:

d)
O indivduo III-5 NO poder ser de qual grupo
sangneo?
e)
No caso do casal III-3 e III-4 ter uma segunda
criana, qual a probabilidade dela ser uma menina e
do grupo sangneo B?

c)
Qual a funo dos osteoclastos nos processos
de remodelagem ou fratura ssea?
d)
Cite uma conseqncia do excesso de
paratormnio no organismo para a estrutura ssea de
um indivduo:

04.
(UFV - 01)O dono de um viveiro de plantas
pediu ao seu empregado que separasse algumas
monocotiledneas das dicotiledneas na vitrine. Para
auxili-lo, o patro lhe deu as dicas de que a semente
de milho tem dois cotildones e a semente de feijo
apenas um e uma pequena cartela guia, porm
incompleta e sem nomes, conforme representada
abaixo. Para ajudar o pobre empregado a cumprir
CORRETAMENTE a sua tarefa, resolva os itens
seguintes:

e)
Cite a vitamina que tem importante papel no
processo de mineralizao e estruturao dos ossos:
2)
(UFV - 01)Em um caso surpreendente de um
paciente que tomava soro via parenteral, a agulha de
soro desprendeu-se e, aps ter percorrido os vasos
sangneos, o corao e a artria pulmonar, foi
encontrada alojada no pulmo. Considere o esquema
abaixo e apenas o trajeto da agulha no corao para
responder os itens:

a)
As dicotiledneas esto indicadas pelos
nmeros:
b)
As plantas com flores trmeras devem ficar na
vitrine juntamente com as:
c)
Que tipo de nervura dever haver nas folhas
das plantas para que elas no fiquem juntas com as que
tm razes fasciculadas?
d)
Pode no ser uma dica prtica, mas o
empregado poder considerar que o caule de milho tem
a disposio dos feixes lbero-lenhosos difusa e o caule
do feijo tem estes feixes regulares?
e)
Mesmo que a cartela guia seja completada, cite
um bom argumento tcnico de botnica para que o dono
da loja mude de ramo:

a)
Cite o nmero e o nome da cavidade cardaca
pela qual a agulha passou primeiro:
b)
Cite o nmero e o nome da vlvula pela qual a
agulha passou para o ventrculo:
c)
Cite o nome da contrao ventricular que, ao
bombear o sangue, possibilitou a passagem da agulha
ao pulmo:
d)
No trajeto da agulha, qual foi o papel da
estrutura indicada pelo nmero VIII?

4)
"(UFV - 01)Embora sapiens o Homo parece
no se ter dado conta, ainda, de que a terra finita, e
que necessariamente so finitos tambm os
suprimentos de ar, gua e solo" (Ferri, 1978). Apesar
dessa e outras advertncias, o homem continua a
provocar distrbios ecolgicos graves como os recentes
derramamentos de petrleo. Considere os dois grandes
derramamentos de petrleo que ocorreram na costa do
Estado do Rio de Janeiro e no rio Barigui, no Paran,
para responder os itens:

3)
(UFV - 01)Ao descobrir que seu gentipo era
homozigoto, o Sr. Lalau (indivduo II-1) elaborou o
seguinte heredograma sobre a herana de grupos
sangneos do sistema ABO.

26

Pr Vestibular Diferencial

BIOLOGIA

a)
Cite duas regies fitogeogrficas diretamente
afetadas:
b)
Cite dois fatores abiticos que comprometeram
a teia alimentar desses ambientes:
c)
Qual o nvel trfico mais baixo da pirmide
alimentar atingido pela camada de petrleo?
d)
Cite
a
conseqncia
grave
que
o
derramamento de petrleo no rio Barigui poderia ter
causado para o homem, e cujo tipo difere dos riscos do
ocorrido no mar:

c)
Quantos cromossomos tem cada clula
presente na regio III?
d)
Cite o nome da clula produtora de
testosterona e o nmero correspondente regio onde
ela se encontra:
7)
(UFV - 02)A pseudo-acondroplasia um tipo de
nanismo determinado geneticamente pelo alelo D
autossmico dominante que interfere no crescimento
dos ossos durante o desenvolvimento. A princpio,
pensou-se que o fentipo ano seria expresso pelo
gentipo D/D ou D/d. Entretanto, foi considerado que a
severidade do alelo dominante, quando em dose dupla,
produz efeito letal durante o desenvolvimento
embrionrio,
provocando
aborto
precocemente.
Considere um casal de anes pseudo-acondroplsicos,
para responder s seguintes questes:

5)
(UFV - 02)A primeira etapa da germinao da
maioria das sementes a embebio. A hidratao faz
com que a semente se expanda e rompa seus
tegumentos, induzindo modificaes metablicas que
levam emisso do eixo embrionrio. Isso se d pela
ao de enzimas produzidas de novo, em resposta a
estmulos hormonais provenientes do embrio. Observe
a figura da germinao de uma semente e responda s
questes abaixo:

a)
Quais so os gentipos de cada indivduo do
referido casal?
b)
Caso a mulher deste casal venha dar luz uma
criana, qual a probabilidade dela nascer
geneticamente com a pseudo-acondroplasia?
c)
Como o casal j tem trs crianas com a
pseudo-acondroplasia, qual a probabilidade de, em
um eventual quarto nascimento, a criana nascer
tambm afetada?
d)
Se o casal tem planos para ter uma menina
normal em relao a esta condio gentica, qual a
probabilidade que se espera para este evento?
e)
Em uma outra famlia, com 3 meninas e 2
meninos, todos apresentando a pseudo-acondroplasia,
quantas destas crianas so homozigotas no loco
correspondente a este tipo de nanismo?

I
II
III

IV
V

8)
(UFV - 02)O grfico abaixo representa a
variao do tamanho populacional, ao longo de 50 anos,
de uma espcie de carnvoro (I) e a de um roedor (II)
que vivem em uma mata natural. Analise o grfico e
responda s questes seguintes:

a)
Qual a classe taxonmica da semente
representada no esquema?
b)
Cite o nome da estrutura indicada por IV:
c)
Qual o nmero que est indicando a regio
do endosperma?
d)
Cite o nome do hormnio, produzido em III,
responsvel pela induo da sntese de enzimas em I:
e)
Qual a funo das enzimas produzidas em I?

160

Indivduos (1000 x)

140

6)
(UFV - 02)Observe as regies (I, II, III e IV) do
corte histolgico abaixo, de um testculo humano
normal, e responda s questes seguintes.

120
100

80

II

60
40
20
0
1950

1960

1970

1980

1990

2000

Anos

a)
As oscilaes de duas populaes como as
observadas no grfico sugerem qual tipo de relao
ecolgica?
b)
Cite dois exemplos de animais cujas
populaes podero representar no grfico os nmeros I
e II, respectivamente:
c)
Qual a importncia da existncia deste tipo de
relao para as comunidades da mata?
d)
O que poder acontecer com o nmero de
indivduos das duas populaes, se for considerado que
a regio ser desmatada?

II
III
IV

a)
As regies I, II e III esto evidenciando qual
componente do testculo?
b)
A etapa final da gametognese est
representada por qual nmero?

9)
(UFV - 02)O esquema abaixo exemplifica um
dos tipos de transporte de membrana cuja funo
fundamental para o metabolismo celular. No esquema
+
est indicado que a concentrao de K maior no meio

27

Pr Vestibular Diferencial

BIOLOGIA

interno da clula e, ao contrrio, a concentrao de Na


maior no meio externo.

Na

Na

Meio externo

Meio interno

Aps analisar a seqncia proposta, responda aos itens


seguintes:

De acordo com o esquema, responda:


a)
Cite o nome e a origem da estrutura
representada em A.
b)
Cite o nome do processo representado pelas
letras de A a K.
c)
O processo representado pelas letras de A a K
ocorre, especificamente, no interior de qual estrutura?
d)
Com base na figura, como se justifica o fato do
processo de desenvolvimento esquematizado ser
caracterstico de uma dicotilednea?

a)
Que tipo de transporte permite clula manter
a diferena de concentrao desses ons em relao
aos meios?
b)
Cite o nome do principal componente qumico
da membrana responsvel por esse tipo de transporte:
c)
O que poderia acontecer com esse tipo de
transporte, se a respirao celular fosse bloqueada?
d)
Se a permeabilidade dessa membrana fosse
+
+
aumentada, permitindo o livre transporte de Na e K ,
qual seria a diferena de concentrao desses ons
entre os dois meios, aps um certo tempo?
e)
Para que o esquema representasse o
transporte em um neurnio em repouso, como ficaria a
concentrao de K+ no meio interno em relao ao
externo?

12)
(UFV - 03)
O comportamento das taxas
de crescimento populacional em relao sua
densidade pode ser observado nos padres I, II e III, no
grfico abaixo.

10)
(UFV - 03)
Para detectar o tipo de
hemoglobina presente nas hemcias normais e
falciformes em trs indivduos (I, II e III), foi preparada
uma eletroforese com as respectivas amostras de
sangue. Nesta tcnica, protenas diferentes migram em
um gel formando bandas, como representado na figura
abaixo. Aps a separao das bandas proticas, os
genes HbA (selvagem) e HbS (mutante) foram
associados com as respectivas bandas. Os fentipos
dos indivduos tambm foram associados. A seta, no
esquema, indica o sentido de migrao das bandas.
Aps anlise do grfico, resolva os itens abaixo:
a)
Cite dois fatores que atuam positivamente na
taxa de crescimento de uma populao.
b)
Em qual dos trs padres (I, II e III) a taxa de
crescimento inversamente proporcional densidade?
c)
Qual dos trs padres (I, II e III) poderia
representar um exemplo de populao de bons
reprodutores com menor dependncia da densidade?
Justifique.
13)
(UFV - 03)O desenho abaixo representa um
processo bioqumico presente em procariontes.

Aps a anlise da figura, responda:


a)
Qual o indivduo heterozigoto?
b)
Se as amostras (I, II e III) pertencem a um
casal e seu filho, qual delas corresponde do filho?
c)
Qual o gentipo do casal?
d)
Qual a probabilidade do casal ter uma criana
com anemia falciforme?
e)
Na hiptese do casal ter uma segunda criana,
qual a probabilidade dessa criana apresentar o
gentipo igual ao da primeira?
11)
(UFV - 03)A seqncia representada abaixo (A
a K) faz parte do processo de desenvolvimento de uma
dicotilednea.

28

Pr Vestibular Diferencial

BIOLOGIA
a)
A assimilao total est sendo representada
por qual(is) nmero(s)?
b)
A produo primria lquida est sendo
representada por qual(is) nmero(s)?
c)
O que significa, do ponto de vista ecolgico, a
taxa de produtividade primria?
d)
Cite dois exemplos de atividades biolgicas
que poderiam substituir corretamente o nmero IV:
16)
(UFV - 04) Considere que os genes
autossmicos, identificados nos cromossomos (I e II),
correspondam a aptides para aprender biologia (B),
matemtica (M) e tocar guitarra (G). Em um dado loco,
um indivduo com gentipo recessivo no apresenta
aptido; um indivduo heterozigoto apresenta aptido
mediana; e um indivduo homozigoto dominante
apresenta maior aptido.

Aps anlise do desenho, resolva os itens seguintes:

B G

a)
Qual o nome do processo representado no
desenho?
b)
Em que local da clula ocorre este processo?

Com base nessas informaes, faa o que se pede:


a)
Um casal (P1), formado por um indivduo triplo
homozigoto dominante e outro triplo homozigoto
recessivo, poder esperar descendentes (F1) com
qual(is) gentipo(s)?
b)
Se um descendente (F1) se casar com um
indivduo sem aptido para as trs habilidades, qual a
probabilidade desse casal ter uma criana com aptido
mediana para matemtica?
c)
Qual o nome do mecanismo gentico, proposto
por Thomas Hunt Morgan, que permitiria ao casal do
item b ter filhos com aptido mediana para aprender
biologia mas sem aptido para tocar guitarra?
d)
Quais os locos cuja herana no resultar em
propores segregantes dentro dos padres da
segunda Lei de Mendel?
e)
Uma me sem aptido para aprender biologia e
tocar guitarra, mas com aptido mediana para aprender
matemtica, ter 100% dos filhos(as) com aptido no
mnimo mediana para as trs caractersticas, ao se
casar com um indivduo com gentipo:

c)
Cite os nomes das molculas indicadas,
respectivamente, por I, II e III:
d)
Cite uma diferena bsica que caracteriza este
processo em clulas de eucariontes.
14)
(UFV - 03)A forma do animal, como um todo,
depende de estruturas rgidas, internas ou externas,
denominadas
esqueleto.
Essas
estruturas
de
sustentao tambm permitem a execuo de
movimentos variados, funcionando como um sistema de
alavancas potencializando a ao dos msculos. Com
base nessa informao, resolva os itens abaixo:

a)
Cite o nome da estrutura, presente em todos os
vertebrados no perodo embrionrio, que desempenha a
funo de sustentao.
b)
Cite o nome do filo, na escala evolutiva,
imediatamente abaixo do filo Cordata, que apresenta
endoesqueleto.
c)
Qual foi a principal funo adaptativa do
exoesqueleto dos Artropoda na conquista do ambiente
terrestre?
d)
Cite o nome do processo pelo qual os
Artropoda tm superado a limitao ao crescimento
imposta pelo exoesqueleto.
e)
Embora no seja uma estrutura rgida, o
esqueleto hidrosttico tambm tem funo de
sustentao em alguns invertebrados. Cite o nome de
um filo que apresenta este tipo de esqueleto.

17)
(UFV
04)Os
manguezais constituem um dos mais importantes
ecossistemas brasileiros. So reas de clima quente e
solos alagados e pouco aerados. A vegetao tpica dos
manguezais possui caractersticas que lhe conferem alto
grau de adaptabilidade a tais condies. Abaixo,
encontra-se uma representao de um corte transversal
de uma folha de Rhizophora mangle, uma planta tpica
de manguezais.
Com base no texto e na observao da figura, faa o
que se pede:
a)
Cite o nome da estrutura epidrmica indicada
em I.
b)
O tecido indicado em II tem funo de
armazenamento. Cite a substncia que esse tecido
armazena.
c)
Qual a funo principal da estrutura indicada
em III?

15) (UFV - 04)Os eclogos consideram muito


importante compreender a base energtica de um
ecossistema. Na figura abaixo, os nmeros I, II, III, IV e
V fazem parte dos aspectos bsicos deste processo.
III

LUZ

M
II

II
IV
V

Com base na observao da figura, faa o que se pede:

29

Pr Vestibular Diferencial

BIOLOGIA

d)
Cite o nome do tecido indicado em IV.
18)
(UFV - 04)O grfico abaixo representa quatro
fases aproximadas (I, II, III e IV) da evoluo de um
quadro tpico de Sndrome de Imunodeficincia
Adquirida (AIDS).
I

II

III

5
6
Anos

tomada de oxignio (entre 0 e 120 ml/Kg/h) pelo pulmo


e pela pele foram avaliadas em diferentes temperaturas
ambientais ao longo do ano, conforme o grfico abaixo:

IV

10

Tendo como referncia os dados do grfico, cite:


a) a Classe do vertebrado analisado.
b) a classificao deste vertebrado quanto regulao
trmica.
c) o tipo de respirao predominante neste vertebrado
na fase larval.
d) a causa fisiolgica do aumento da respirao
pulmonar deste vertebrado nos meses de temperaturas
mais elevadas.
e) a adaptao presente neste vertebrado que permite a
absoro de oxignio pela pele.
f) a diferena de valor entre o maior consumo de
oxignio pelos dois rgos deste vertebrado.

Concentrao de HIV
Contagem de linfcitos T4

Analise o grfico e faa o que se pede:


a)
Cite a fase que corresponde eliminao da
maioria dos vrus pelo sistema imune.
b)
Cite
a
condio
que
caracteriza
a
imunossupresso observada nas fases III e IV.
c)
Cite a manifestao geral que acomete a sade
de um indivduo durante as fases III e IV.
d)
Cite o nome do rgo no qual os linfcitos T4
se diferenciam.
e)
Que tipo de protena especfica encontrada no
organismo define o indivduo como soro-positivo?

21)
(UFV-05) Embora Zequinha esteja infestado
por um tipo de parasita flagelado, que adquiriu
alimentando-se das verduras de sua horta, ele trabalha
muito cuidando de um bode e de umas vaquinhas
atacadas por carrapatos e morcegos. Eventualmente, as
sobras da cultura so fornecidas para as crias. Com
base nesta teia alimentar, cite:

19)
(UFV - 04)A tabela abaixo representa uma
verso fictcia do cdigo gentico. Entretanto, esse
cdigo segue o padro do cdigo gentico universal, no
qual trs bases codificam um aminocido.
Trinc
a de
base
s
AAC
AAU
AGG
AUA
AUC
AUG
CAU
CCU
CGA
CGC

Aminoc
ido

Trinca de
bases

Aminocido
a) o nvel trfico ocupado por Zequinha, quando se
infestou com o parasita.
b) o nmero de hetertrofos mencionados no texto.
c) o nome especfico do componente trfico que est
faltando nessa teia alimentar para torn-la completa.
d) o nome do parasita que infestou Zequinha.
e) a relao ecolgica estabelecida entre o carrapato e
o morcego.

N
O
C
O
S
iniciao
O
S
W
I

CUA
R
GAA
K
GCA
T
GCC
N
GCU
T
GGC
W
GGG
S
UAA
terminao
UAC
A
UAU
E
UCG
A
Analise a tabela e faa o que se pede:
a)
Cite o nome da enzima que catalisa a sntese
de RNA mensageiro.
b)
Cite a seqncia do anticdon correspondente
ao cdon de iniciao.
c)
Qual a seqncia de aminocidos que resultar
da traduo da seguinte molcula de RNA mensageiro?
5
3
AUAUGCGAUCGGCUAUCCAUGCCUAUAGGCUACG
CAGGGAAUAACUAA
d)
Qual a seqncia de aminocidos que resultar
da traduo da mesma molcula de mRNA, aps uma
deleo do terceiro nucleotdeo?

22)
(UFV-05) Numa visita a um museu de Histria
Natural, um grupo de estudantes entrou numa seo
destinada evoluo das plantas. Nessa seo havia
um painel com uma rvore representativa das relaes
filogenticas, conforme o esquema abaixo. Os nmeros
I, II, III e IV correspondem s adaptaes evolutivas das
Divises do Reino Plantae.

20)
(UFV-05) Em um experimento realizado com
determinado vertebrado adulto, as funes relativas

Aps a anlise do esquema, cite:

30

Pr Vestibular Diferencial

BIOLOGIA

a) os nmeros cujas divises apresentam a


caracterstica de transportar gua e nutrientes a longas
distncias, advinda da capacidade adaptativa de
sintetizar lignina.
b) o nmero que na rvore filogentica corresponde ao
ponto da linha evolutiva que deu incio a embries
protegidos por estruturas especializadas.
c) um exemplo de adaptao evolutiva indicado pelo
nmero I.
d) os nomes das classes que divergiram evolutivamente
do ramo indicado pelo nmero IV.
e) o nmero correspondente ao incio da especializao
dos processos reprodutivos em interao principalmente
com os insetos e aves, o que favoreceu a disperso
bem sucedida das plantas no ambiente terrestre.

Aps anlise da figura e dos dados, responda:


a) Qual o gentipo do grupo sangneo de Lineu?
b) Qual o grupo sangneo de Beatriz?
c) Quais os nomes das duas pessoas suspeitas, que os
detetives inocentaram, de imediato, assim que
souberam que o grupo sangneo detectado na
mancha de sangue no era o de Lineu?
d) Comparando calmamente o grupo sangneo da
mancha de sangue com os grupos identificados no
sangue de cada um dos suspeitos restantes, os
detetives no tiveram mais dvidas de quem era o real
culpado. Deste modo, quem matou Lineu?
e) Supondo que a distribuio dos grupos sangneos
A, B, AB e O, em uma populao de 20.000
indivduos,
esteja
na
proporo
de
1:2:3:4,
respectivamente, quantos indivduos deveriam ter o
mesmo grupo sangneo da pessoa acusada?

23)
(UFV-05) Analise a figura abaixo, que
representa diversos tipos celulares indicados com
nmeros de I a VIII. As clulas representadas
correspondem s especializaes morfolgicas e
funcionais na formao dos tecidos e rgos das
plantas.

25)
(UFV-06) Observe o esquema abaixo, que
representa as relaes evolutivas entre os subfilos e
classes de Chordata, a partir de um equinodermo
ancestral.

Com base no esquema, cite:


a) uma das caractersticas comuns que se atribui
origem dos cordados a partir dos equinodermos
ancestrais.
b) uma novidade morfolgica externa e evolutivamente
importante que diferencia os organismos V e VI em
relao ao IV.
c) o nmero a partir do qual se inicia os organismos
classificados como Craniata.
d) a classe de Chordata tetrpoda que apresenta
exemplos de organismos ovulparos com fecundao
externa.
e) dois nmeros cujos organismos apresentam
notocorda tanto na fase larval quanto na adulta.

Aps anlise da figura, cite:


a) o nome do processo que origina as clulas indicadas
pelas setas a partir de I.
b) o nome do tecido que contm as clulas indicadas
por I.
c) uma funo desempenhada pelo tecido representado
pela clula IV.
d) os nmeros correspondentes aos tipos celulares que
apresentam cloroplastos.
e) o nmero associado com os escleredeos.
f) a natureza qumica da estrutura presente na clula II.
24)
(UFV-05) Em uma outra verso do caso quem
matou Lineu, os detetives, com ajuda de geneticistas,
reabriram o processo para descobrir o real culpado.
Aps anlise dos grupos sangneos do sistema ABO
das dez pessoas envolvidas, conforme o heredograma
da famlia, representado abaixo, osdetetives obtiveram
informaes seguras: o culpado era um dos nove
suspeitos relacionados que tambm pertencia ao grupo
sangneo de uma mancha de sangue presente na
roupa da vtima.

26)
(UFV-06) Imagine a seguinte situao: ao
entrar na sala para fazer a prova de vestibular, o fiscal
lhe solicita o documento comprobatrio de inscrio e
voc verifica que o esqueceu em casa. Nesse momento,
seu
organismo
pode
passar
por
diversas
transformaes de alerta que ilustram bem como o
corpo se prepara para enfrentar as situaes de
emergncia ou de perigo. Com relao a estas
transformaes, responda:

31

Pr Vestibular Diferencial

BIOLOGIA
d) Cite o nome do componente que, embora ausente
neste tipo de clula, o responsvel pela biossntese de
hexoses a partir da reduo de dixido de carbono na
presena de ATP:
e) Represente a equao geral da principal reao
bioqumica da qual participa o componente de nmero I:

a) Qual das divises do sistema nervoso autnomo


responde imediatamente nesta situao?
b) Qual o nome do principal mediador qumico liberado
imediatamente nas sinapses?
c) Qual o nome do outro sistema orgnico que
diretamente responsvel pela palidez facial e mos
geladas, caractersticas nesses episdios de susto?
d) Qual o nome especfico da glndula secretora
hormonal que potencializa a ao desta estimulao
nervosa?
e) Qual a participao fisiolgica efetiva do fgado
nestes episdios de emergncia?

29)
(UFV-06) Uma certa condio gentica
autossmica recessiva (aa) afeta 1 em cada 10.000
indivduos. Os individuos AA e Aa so normais.
Considerando a hiptese de que a populao da cidade
tenha 200.000 habitantes e esteja em equilbrio de
Hardy-Weinberg, responda aos itens abaixo: (Obs.:
2
2
utilize a equao: p + 2pq + q = 1, para auxili-lo nas
resolues, quando for o caso.)

27)
(UFV-06) Os esquemas I e II abaixo
correspondem a um tipo de tecido de grande
importncia para as plantas e algumas de suas
especializaes celulares distribudas em dois padres
distintos.

a) Quantos indivduos devem ser afetados nesta


populao?
b) Qual a probabilidade (%) de que o primeiro
habitante que encontrarmos ao acaso nesta cidade seja
afetado?
c) Qual a freqncia do alelo dominante?
d) Quantos indivduos devem ser heterozigotos?
e) Quantos indivduos afetados so estimados para a
prxima gerao, considerando que o nmero de
habitantes seja o mesmo?

Com base nas caractersticas desse tipo de tecido, cite:


a) as duas Classes de vegetais que so diferenciadas
pelos padres de distribuio I e II, respectivamente.
I:
_________________________
II:
__________________________
b) o nome da estrutura especializada representada nos
esquemas.
c) o nome do meristema primrio que origina esse tipo
de tecido.
d) o nome das nicas clulas clorofiladas apresentadas
nesse tipo de tecido.
e) um exemplo de planta de interesse agronmico que
apresenta o padro de distribuio do tipo de tecido
observado no esquema II.

30)
(UFMG-04) Uma indstria localizada na regio
assinalada com o algarismo I, no mapa abaixo, foi
responsvel pelo derramamento de grande quantidade
de poluentes soda custica e cloro na bacia do Rio
Paraba do Sul.

28)
(UFV-06) O avano do conhecimento da clula
est na dependncia da nossa capacidade de
desvendar o quebra-cabea bioqumico e molecular
das estruturas que a compem. Observe a clula animal
esquematizada abaixo, com indicaes de alguns
componentes.

1. Aps o referido desastre ecolgico, algumas espcies


de plantas desapareceram da comunidade vegetal na
regio afetada. CITE um motivo que justifica esse
desaparecimento.
2. Diferentes estratgias podem ser adotadas para a
recuperao de reas degradadas.
JUSTIFIQUE a utilizao das estratgias que se
seguem.
A) Plantio de espcies de gramneas.
B) Cobertura do solo com compostos orgnicos.
3. Analise este grfico, em que est representado o
potencial hdrico do solo em duas reas I e II
situadas numa das margens do rio afetado, nas quais se
fez plantio de gramneas para sua recuperao:

Com base no esquema, faa o que se pede:


a) Cite o nome e o nmero do componente celular no
qual as molculas de cido ribonuclico so
organizadas em diferentes fases de amadurecimento
em subunidades mais complexas:
b) Cite o nome e o nmero da organela que realiza
ativamente reaes que envolvem o seguinte tipo bsico

:
de equao
c) Cite o nome da protena cujos polmeros formam as
estruturas indicadas por VII:

32

Pr Vestibular Diferencial

BIOLOGIA
existem servios mdicos especializados em Medicina
do Viajante.
1. Alguns viajantes queixam-se de leves dores ou de
sensao de ouvido entupido, que podem ocorrer na
decolagem ou na aterrissagem de avio. Outros
tambm sentem o mesmo quando, por exemplo, sobem
rapidamente uma montanha.
CITE o fator que provoca esses sintomas e EXPLIQUE
a atuao dele no ouvido.
Fator:
Explicao:
A) INDIQUE a causa do inchao das pernas e dos ps
em casos de viagens longas de nibus, carro ou avio.
B) Entre outras medidas preventivas desse incmodo,
aconselha-se o viajante a movimentar-se e, quando
possvel, levantar e abaixar as pontas dos ps para
exercitar as pernas. EXPLIQUE como essas duas
medidas podem prevenir ou reduzir o inchao das
pernas.
3. A doena mais comum entre os viajantes a diarria
infecciosa.
A) CITE um microrganismo causador desse tipo de
diarria.
B) INDIQUE um comportamento que o viajante pode
adotar para prevenir esse tipo de diarria.

Com base nas informaes desse grfico, observa-se


que as gramneas utilizadas na recuperao da rea
representada pela curva I apresentaram melhor
desenvolvimento
quando
comparadas
quelas
representadas pela curva II.
CITE o provvel tipo de solo da rea II.
JUSTIFIQUE sua resposta.
Tipo de solo:
Justificativa:
4. O movimento ascendente da gua em vegetais d-se
em funo das caractersticas das plantas e da
interao delas com fatores abiticos.
CITE os mecanismos responsveis pelo deslocamento
de gua que ocorre nos locais A, B e C, indicados nesta
figura:

4. Observe, nesta figura, as reas assinaladas com os


algarismos I e II:

Considerando as informaes dessa figura, CITE as


doenas relacionadas s medidas preventivas que
seseguem e EXPLIQUE o modo de ao de cada uma
dessas medidas.
A) Medida: Tomar vacina especfica antes de ir para as
regies indicadas por I.
Doena:
Ao da medida:
B) Medida: Evitar viagens no-essenciais para alguns
pases localizados nas regies indicadas por II.
Doena:
Ao da medida:
32)
(UFMG-04) A anorexia nervosa uma
desordem que afeta cerca de 2-5% das mulheres
jovens. Essas mulheres tm grande medo de engordar
e, por isso, impem a si prprias uma dieta rigorosa.
Atualmente, a anorexia nervosa uma das causas mais
comuns de desnutrio e, nesse caso, o risco de
mortalidade atinge 15-20% das pacientes anorxicas
com idade entre 15 e 25 anos. Os rgos I e II,

31)
(UFMG-04)
O ecoturismo e as viagens,
especialmente as internacionais, levam as pessoas a
diferentes partes do Planeta. Contudo o corpo humano
sofre alteraes em decorrncia de viagens, que podem
dar origem a vrios problemas de sade. Por isso, j

33

Pr Vestibular Diferencial

BIOLOGIA
que possa ser avaliado o efeito da desnutrio sobre
esse fator.

assinalados nesta figura, podem ser afetados pela


anorexia nervosa:

A) FORMULE a hiptese a ser testada nesse


experimento.
B) CITE uma varivel que deve ser controlada nesse
experimento.
33)
(UFMG-04) Observe estas figuras, em que
esto representados os aparelhos reprodutores feminino
e masculino:

Considerando
essas
informaes
e
outros
conhecimentos sobre a funo dos sistemas orgnicos
no ser
humano,
1. CITE o tecido que pode estar afetado quando a
paciente anorxica apresenta:
A) diminuio da espessura da parede no rgo I:

Considerando as informaes contidas nessas figuras e


outros conhecimentos sobre o assunto,
1. MARQUE com um X, na prpria figura, o local onde
ocorre a fecundao.
2. A) NOMEIE, nos quadros em branco em cada figura,
os rgos indicados por setas.
B) EXPLIQUE a importncia de exames mdicos
peridicos desses rgos, ressaltada, freqentemente,
por meio de campanhas pblicas de sade.

B) diminuio do peristaltismo no rgo II:


2. CITE um prejuzo para o organismo decorrente de
cada uma das alteraes descritas no item 1 desta
questo.
A) Prejuzo relacionado ao rgo I:

3. Observe estas figuras em que esto representados os


cromossomos X e Y:

B) Prejuzo relacionado ao rgo II:


3. Analise esta tabela em que so apresentados dados
relativos a mulheres anorxicas e a mulheres saudveis:

Com base nos dados contidos nessa tabela,


A) EXPLIQUE o baixo ndice de massa corporal em
mulheres anorxicas.
B) EXPLIQUE uma caracterstica prpria do
metabolismo energtico do grupo de mulheres
anorxicasem relao aos macronutrientes utilizados
para obteno de energia.
4. Com o objetivo de compreender melhor doenas que
afetam o homem, pesquisadores utilizam animais para
desenvolver modelos experimentais que simulam
situaes humanas. Nesse caso, os experimentos so
realizados em condies controladas, que permitem
testar a validade dos resultados obtidos. Escolha um
fator biolgico e planeje um experimento com ratos, em

No cromossomo Y, descobriu-se o gene SRY, que


algumas
evidncias
permitem
apontar
como
responsvel pela sntese de uma substncia que atua
na diferenciao dos testculos e, conseqentemente,
na definio do sexo masculino. Entretanto existem

34

Pr Vestibular Diferencial

BIOLOGIA
CITE um fator que justifica a necessidade
preservao de cada uma dessas espcies.

casos, relatados na literatura, de homens 46, XX e de


mulheres 46, XY.
EXPLIQUE por que ocorrem esses casos.

de

Minhocuu:
Ona-parda:

4. Analise este heredograma de uma famlia que


apresenta vrios casos de um tipo de raquitismo:

35)

A anlise desse heredograma permite concluir que o


tipo de raquitismo que caracteriza tal famlia ,
provavelmente, determinado por herana dominante
ligada ao cromossomo X. CITE a evidncia que permite
essa concluso.
JUSTIFIQUE sua resposta.
Evidncia:

1. Com base nas informaes desse quadro,


A) ESTABELEA uma relao entre o tamanho do
animal e a rapidez de reproduo dele.
B) CITE uma das evidncias utilizadas para estabelecer
essa relao.
2. CITE o anexo embrionrio exclusivo dos animais
apresentados no quadro e a funo dele.
Anexo:
Funo:

Justificativa:
34)

(UFMG-04) Analise este quadro:

(UFMG-04) Analise este grfico:

3. Outros grupos de animais, com caractersticas


prprias, reproduzem-se e relacionam-se com filhotes
de forma diferente.
A) CITE a classe animal que se caracteriza por possuir
regulao de temperatura e cujos filhotes no se
desenvolvem no corpo da me.
B) CITE o mecanismo de proteo dos embries dessa
classe.
4. Analise este grfico:

FONTE: Manual Global


Augustus,1996. p 25.

de

Ecologia.So

Paulo:

Programas de desenvolvimento sustentvel podem


inverter a tendncia extino de espcies
representada nesse grfico.
1. CITE duas estratgias que podem preservar parte
substancial da diversidade biolgica de uma regio.
Estratgia 1:
Estratgia 2:

Considerando o tipo de reproduo de peixes e de


mamferos, CITE qual desses dois grupos tem maior
chance de apresentar a curva de sobrevivncia descrita
nesse grfico.

2. CITE um critrio que permite evidenciar o fato de


uma espcie qualquer estar em extino.

JUSTIFIQUE sua resposta.


Grupo mais provvel:
Justificativa:

3. ESTABELEA uma relao entre a preservao da


biodiversidade e
A) o tratamento de doenas:
B) a produtividade agrcola:

36)
(UFMG-05) Observe esta figura, em que est
representada a recuperao da comunidade de uma
rea que sofreu queimada:

4. Entre os animais atualmente ameaados de extino,


esto o aneldeo conhecido como minhocuu e a onaparda.

35

Pr Vestibular Diferencial

BIOLOGIA

Durante o desenvolvimento dessa comunidade,


estudou-se a variao da biomassa e obteve-se esta
curva de grfico

1. CITE dois fatores de risco relacionados com a alta


incidncia de hepatite C na atualidade.
Fator 1:
Fator 2:
2. Que implicao tem para a sade da populao o fato
de 80% dos indivduos com hepatite C no
apresentarem sintomas?
3. O diagnstico de doenas requer, muitas vezes, a
realizao de bipsia.
A) Com base no Esquema II, CITE o nmero e NOMEIE
o rgo a ser analisado por bipsia em pacientes com
hepatite C.
Nmero:
Nome:
B) CITE duas funes desse rgo.
Funo 1:
Funo 2:

1. EXPLIQUE a causa da variao de biomassa descrita


nesse grfico.
2. CARACTERIZE clmax ou seja, o ltimo estgio
seral da sucesso.
3. CITE dois tipos de disperso de plantas que
possibilitam a recolonizao de uma rea.
Tipo 1:
Tipo 2:
37)
(Constituda de quatro itens o terceiro com
dois subitens.) (UFMG-05) A hepatite C uma doena
de evoluo lenta e tem vrias conseqncias
possveis. De acordo com estimativas da Organizao
Mundial de Sade (OMS), existem, no Brasil, mais de
trs milhes de indivduos contaminados com o vrus da
hepatite C. Nos Estados Unidos, esse nmero chega a
quatro milhes. Analise estes esquemas:

4. EXPLIQUE por que a cirrose compromete a absoro


de nutrientes no rgo 4, indicado no Esquema II.
38)
(UFMG-05) (Constituda de trs itens o
primeiro e o segundo com dois subitens cada um.)
Sabe-se que a espcie humana no sintetiza os
aminocidos fenilalanina e tirosina; por isso, faz-se
necessrio acrescent-los dieta dessa espcie.
Analise este esquema referente a algumas etapas do
metabolismo da fenilalanina e da tirosina no homem:

FONTE: N. Engl. J. Med. 2001; 345(1): 41-52.

1. Considerando as informaes contidas no esquema


dado, EXPLIQUE
A) por que indivduos fenilcetonricos apresentam pele
clara.
B) por que o teste do pezinho deve ser feito nos
primeiros dias aps o nascimento.

36

Pr Vestibular Diferencial

BIOLOGIA
No Brasil, o mercrio utilizado, indiscriminadamente,
em atividades de minerao para a extrao do ouro, o
que constitui uma agresso ao ambiente e ao prprio
garimpeiro. Analise esta figura, em que est
representado o corte de um rio:

2. Este grfico apresenta a concentrao plasmtica


percentual de tirosina, ao longo do tempo, no teste de
tolerncia fenilalanina a que se submeteram trs
indivduos:
A) Considerando esse grfico, a curva que caracteriza o
resultado do indivduo fenilcetonrico a
B) Com base nas informaes desse grfico, CITE os
gentipos que devem corresponder s curvas
I:
II:
III:
C) DETERMINE a probabilidade de os casais com
gentipos correspondentes aos da curva II terem filhos
do sexo feminino e normais.
(Deixe seus clculos registrados.)

1. FAA o esquema de uma cadeia alimentar que


apresente o deslocamento do mercrio do rio at o
ambiente terrestre.
2. EXPLIQUE por que a concentrao do mercrio
maior nos peixes do que no zooplncton.

39)
(UFMG-05) (Constituda de trs itens o
primeiro com dois subitens.)
A histria da vida em Minas Gerais, no perodo
Pleistoceno 2 milhes de anos a 11 mil anos atrs
pode ser resgatada pela descoberta de fsseis, como
mostrado nesta figura:

3. Analise este esquema de um experimento para


obteno de uma planta transgnica com resistncia ao
mercrio, utilizando a tecnologia do DNA recombinante:

A) EXPLIQUE por que, em I, ocorre o desenvolvimento


da planta transgnica.
B) CITE um argumento que justifica a importncia da
obteno desse tipo de organismo transgnico.
1. Considerando as caractersticas
mostrados nessa figura,

dos

fsseis
41)
(UFMG-05) (Constituda de trs itens.)
Para avaliar-se o ritmo biolgico de duas plantas de
espcies diferentes I e II , elas foram submetidas,
artificialmente, a dias longos (16 horas) e noites longas
(20 horas).
1. Observe estas figuras:

A) DESCREVA a provvel fisionomia da vegetao do


bioma de Minas Gerais no perodo Pleistoceno.
B) EXPLIQUE como possvel aos paleontlogos
reconstruir essa fisionomia vegetal.
2. Com base na Teoria Sinttica da Evoluo,
EXPLIQUE a sobrevivncia de parentes prximos de
algumas das espcies mostradas na figura como o
tatu e a preguia.
3. CITE duas caractersticas exclusivas dos
representantes atuais da classe dos animais mostrados
na figura.
Caracterstica1:
Caracterstica2:

EXPLIQUE por que apenas a planta da espcie I


floresceu.

40)
(UFMG-05) (Constituda de trs itens o
terceiro com dois subitens.)

37

Pr Vestibular Diferencial

BIOLOGIA
43)
(UFMG-06) Um pesquisador soltou seis
gavies numa regio em que havia pombos em bandos.
Os bandos eram constitudos por diferentes nmeros de
indivduos. Esse pesquisador anotou o nmero de
ataques desses gavies sobre os diferentes bandos de
pombos e a porcentagem de ataques bem sucedidos.
Os resultados esto expressos neste grfico:

2. Uma planta mantida no escuro por 12 horas, aps


receber um feixe de luz vermelha diretamente sobre
uma de suas folhas por 15 minutos, floresceu, conforme
mostrado nestas figuras:

EXPLIQUE o que ocorreria se a folha fotoinduzida fosse


retirada da planta imediatamente aps sua iluminao.
JUSTIFIQUE sua resposta.
O que ocorreria:
Justificativa:
3. Observe este quadro:
Perodos de florao de trs espcies vegetais
cultivadas em
condies naturais em alguns pases de clima
temperado

1. Com base nos dados apresentados neste grfico,


ELABORE uma hiptese plausvel que o pesquisador
se props a testar antes de montar esse tipo de
experimento.
2. Com base nos dados apresentados neste grfico,
DESCREVA a concluso a que chegou
o
pesquisador aps o experimento.
3. Os resultados desse experimento podem explicar o
comportamento social dos ancestrais do homem.
EXPLIQUE
um
benefcio
decorrente
desse
comportamento para a espcie humana.

Com base nos dados desse quadro, CITE os provveis


perodos de florao das trs espcies, se fossem
cultivadas em condies naturais no Brasil.
JUSTIFIQUE sua resposta.
Tomate:
Trigo:
Soja:
JUSTIFICATIVA:

44)
(UFMG-06) O tabagismo um importante fator
de alteraes patolgicas no pulmo . como o cncer e
o enfisema pulmonar. Substncias presentes no cigarro
podem lesar esse rgo comprometendo seu
funcionamento. Duas enzimas . elastase e a alfa-1antitripsina . so essenciais para manter a integridade
do pulmo.
Analise estes esquemas:

42)
(UFMG-05) (Constituda de trs itens.)
Analise este grfico:
Concentrao de CO2 em uma ilha, no perodo 1958
at 1999

1. CITE o mecanismo gentico que favorece o


aparecimento de indivduos deficientes para a sntese
da enzima alfa-1-antitripsina.
2. Foram descritos vrios alelos responsveis por
diferentes variantes enzimticas, como, por exemplo, M
(mais freqente) seguido de S e Z.
Analise esta tabela:

1. CITE duas atividades antrpicas que causam


variao na concentrao CO2 na atmosfera.
Atividade 1:
Atividade 2:
2. Curiosamente, a concentrao de CO2 atmosfrico
no tem variado da forma prevista pelos cientistas, o
que sugere a existncia de drenos de CO2. CITE um
desses possveis drenos:
3. Comumente, alguns agricultores usam, em estufas, a
queima de serragem. EXPLIQUE uma vantagem desse
comportamento no cultivo de plantas.

A) DETERMINE
a
probabilidade
de
casais
heterozigotos para o alelo M terem descendentes

38

Pr Vestibular Diferencial

BIOLOGIA

com gentipo favorvel


ao desenvolvimento de
enfisema pulmonar. EXPLICITE o seu raciocnio.
B) Suponha que h um mtodo para deteco desses
alelos na populao. RESPONDA:
Como os dados obtidos por esse mtodo poderiam
ser utilizados pelo Ministrio da Sade em
programas de preveno?
3. comum fumantes sentirem falta de ar ao praticarem
atividades fsicas. Considerando essa informao,
A) CITE a estrutura pulmonar lesada nesses fumantes.
B) EXPLIQUE o processo fisiolgico que provoca a falta
de ar nesses indivduos.

Problemas mais citados pelos municpios e aes


adotadas para a soluo deles.

45)
(UFMG-06)
A
fragmentao
de
um
ecossistema uma das principais causas da extino
de espcies.
Analise esta figura:

FONTE: Folha de S. Paulo, 14 maio 2005.


1. Com base nas informaes desse quadro e em outros
conhecimentos sobre o assunto, AVALIE e
JUSTIFIQUE a eficcia das aes que se seguem, para
a soluo dos problemas relacionados no
quadro.
A) Dragagem e limpeza de ambientes aquticos:
B) Ampliao da rede de esgoto:
C) Controle de vetores com aplicao de inseticidas:

Alm da extino de espcies, a fragmentao de


ecossistemas implica outras conseqncias igualmente
danosas natureza.

47)
(UFMG-06) Analise estes esquemas e a tabela
que se segue a eles:

1. CITE duas dessas conseqncias.


Conseqncia 1:
Conseqncia 2:
2. CITE o nmero do fragmento . I, II ou III . em que a
espcie remanescente apresenta maior risco
de extino. JUSTIFIQUE sua resposta.
Fragmento:
Justificativa:
3. Analise este fragmento:

A) CITE o fator evolutivo que atuou nesse fragmento.


B) EXPLIQUE como esse fator evolutivo atua.
4. Observe as espcies representadas nessas figuras:
:
1.
EXPLIQUE as taxas de fotossntese nos trs
ambientes.
2. CITE uma caracterstica de uma planta que explica o
fato de esta crescer no ambiente II.
JUSTIFIQUE sua resposta.
Caracterstica:
Justificativa:
3. Analise estes grficos, em que se representam as
taxas de fotossntese e de respirao realizadas pelas
plantas do ambiente III:

Alm da fragmentao de ecossistemas, outras causas


vm contribuindo para a extino dessas
espcies.
CITE duas dessas causas.
Causa 1:
Causa 2:
46)
(UFMG-06) Uma pesquisa do IBGE em 5.560
municpios brasileiros mostra que 77% das cidades tm
problemas ambientais.

39

Pr Vestibular Diferencial

BIOLOGIA
Cincia Hoje, 34 (201): 28-37, 2004.
1. Considerando a ao do hormnio cortisol,
EXPLIQUE o comportamento provvel dos indivduos
nas situaes A e B do esquema II.
2. Sabe-se que o cortisol diminui a atividade de linfcitos
e neutrfilos.
RESPONDA qual a implicao de tal ao do cortisol
para a sade humana.

A) EXPLIQUE a alterao observada entre o grfico de


janeiro e o de agosto.

3. As glndulas hipfise e adrenal exercem funes


importantes no organismo.
CITE uma funo de cada uma dessas glndulas.
A) Funo da glndula hipfise:

B) RESPONDA:
Se a alterao observada em agosto for mantida
por um longo perodo de tempo, qual ser a
conseqncia para as plantas? JUSTIFIQUE sua
resposta.
Conseqncia:
Justificativa:

B) Funo da glndula adrenal (supra-renal):


49)
(UFMG-06)
1. Observe estas figuras, em cuja seqncia est
representa uma sucesso de atos:

4. Observe este esquema, em que est representada


uma planta que se desenvolve no ambiente II:

EXPLIQUE como, nessa planta, ocorre o transporte de


nutrientes do rgo A para o rgo B.
A) EXPLIQUE o comportamento do pssaro na Figura
III.
B) EXPLIQUE o benefcio, para a populao de
borboletas, do tipo de alimento utilizado pela lagarta.

48)
(UFMG-06) Analise os esquemas I e II, em
que se retrata a atuao do hormnio cortisol e
sua
relao
com alteraes do humor. Nveis
sangneos elevados de cortisol estimulam o
hipotlamo, fechando um circuito de hiperatividade das
glndulas hipfise e adrenal.

2. Analise estas figuras:

A) Com base nessas figuras, preencha as lacunas deste


quadro:

B) a. CITE o nmero que identifica o animal que possui


corao com quatro cavidades.
b. EXPLIQUE
caracterstica.

40

importncia

evolutiva

dessa

Pr Vestibular Diferencial

BIOLOGIA

S U B S T N C I AS B I O L G I C A S
Parte I: gua e Sais Minerais
1) 0 constituinte inorgnico mais abundante na matria
viva :

celenterados 96% etc.)". Baseado nestes dados,o item


que representa um conjunto de maior taxa hdrica :
a) corao, ancio, cogumelo
b) estmago, criana, abacateiro
c) msculo da perna, recm-nascido, medusa
d) ossos, adulto, "orelha-de-pau"
e) pele, jovem adolescente, coral

a) a gua .
b) a protena.
c) o sal de sdio .
d) o lipdio .
e) o glucdio .

7) (UFBA-BA). A quantidade de gua nas clulas e nos


tecidos:

2) Os valores pH = 2, pH = 7 e pH = 9 so,
respectivamente, de solues:

a) tende a diminuir com o aumento da idade


b) tende a aumentar com o aumento da idade
c) permanece constante com o aumento da idade
d) no tem qualquer relao com a idade
e) tem relao com a idade mas a mesma em
qualquer espcie

a) cidas, bsicas e neutras.


b) bsicas, cidas e neutras.
c) neutras, cidas e bsicas.
d) cidas, neutras e bsicas.
e) neutras, cidas e cidas.

8) (UFPR-PR). Com relao ao papel desempenhado


pela gua nas estruturas celulares dos seres vivos, qual
das afirmaes no correta?

3) 0 pH da gua pura :
a) zero.
b) 7
c) 14
d) 1
e) 10

a) o veculo de eliminao dos excretas provenientes


do metabolismo celular.
b) Age como catalisador enzimtico de numerosas
reaes intracelulares.
c) Oferece grandes condies de estabilidade aos
colides protoplasmticos.
d) Tem participao direta nos fenmenos osmticos
entre a clula e o meio extracelutar.
e) Participa das reaes de hidrlise.

4) Dentre as propriedades fisico-qumicas da gua, com


grande importncia sob o ponto de vista biolgico,
podem-se citar:
a) o alto calor especfico, o pequeno poder
dissoluo e a grande tenso superficial.
b) o baixo calor especfico, o grande poder
dissoluo e a pequena tenso superficial.
c) o baixo calor especfico, o pequeno poder
dissoluo e a pequena tenso superficial.
d) o alto calor especfico, o alto poder de dissoluo
pequena tenso superficial.
e) o alto calor especfico, o alto poder de dissoluo
grande tenso superficial.

de
9) (CESGRANRIO-RJ). A percentagem de gua
progressivamente decrescente nos seguintes tecidos:

de
de

a) adiposo, muscular, substncia cinzenta do crebro


b) muscular, tecido nervoso de embrio, tecido nervoso
de adulto
c) muscular, sseo e adiposo
d) epitelial, sseo e nervoso
e) nervoso, adiposo e muscular

ea
ea

5) (CESESP-PE) So funes da gua no protoplasma


celular:

10) (UFES-80) Dos componentes da matria viva, quais


deles existem em maior proporo em qualquer clula?

I - atuar como dissolvente da maioria das


substncias
II - no atuar na manuteno do equilbrio
osmtico dos organismos em relao ao meio ambiente
III - constituir o meio dispersante dos colides
celulares
IV - participar das reaes de hidrlise
V - agir como ativador enzimtico
A alternativa que contm as funes verdadeiras :

a) protenas
b) hidratos de carbono
c) lipdios
d) gua
e) eletrlitos
11) (UFCE-CE). Das alternativas abaixo, referentes
qumica da clula viva, escolha as que so corretas:
(O1)
Das substncias orgnicas que
constituem a clula, podemos citar: carboidratos,
lipdios, aminocidos, protenas e cidos nuclicos.
(02)
Dos
componentes
inorgnicos
presentes na clula, a gua o mais abundante, tendo
como funo, entre outras, a de solvente de ons
minerais e de muitas substncias orgnicas.
(04)
Alm de favorecer a ocorrncia de
reaes qumicas, a gua indispensvel no transporte
de substncias.
(08)
Os sais minerais existentes na clula
esto sob duas formas: imobilizados como componentes
de estruturas esquelticas e dissolvidos na gua na
forma de ons.

a) I, II, III
b) III, IV, V
c) I, III, IV
d) V, II, III
e) III, II, I
6) (EFOA-MG). "A taxa de gua varia em funo de trs
fatores bsicos: atividade do tecido ou rgo (a
quantidade de H2O diretamente proporcional
atividade metablica do rgo ou tecido em questo);
idade (a taxa de gua decresce com a idade) e a
espcie em questo (homem 63%, fungos 83%,

41

Pr Vestibular Diferencial

BIOLOGIA

(16) Quanto ao on Mg + + (magnsio) certo


que tem papel importante na coagulao do sangue.

d) controlam a respirao celular.


e) ajudam a manter constante o pH da clula.

D como resposta a soma dos nmeros das


alternativas corretas.

17) O papel dos ons fosfato e carbonato no organismo


:

a) 3
b) 10
c) 12

a) facilitar a osmose atravs da membrana celular.


b) quebrar as molculas orgnicas maiores em
molculas orgnicas menores.
c) atuar como componente de estruturas de
sustentao.
d) proceder como catalisadores em reaes metablicas
intracelulares.
e) regular a transmisso do impulso nervoso.

d) 15
e) 47

12) (FCMSC-SP) Pode-se dizer corretamente que o teor


de gua nos tecidos animais superiores:
a) maior quanto maior o seu metabolismo e diminui
com o aumento da idade:
b) maior quanto maior o seu metabolismo e aumenta
com o aumento da idade.
c) maior quanto menor o seu metabolismo e diminui
com o aumento da idade.
d) maior quanto menor o seu metabolismo e aumenta
com o aumento da idade.
e) apresenta variaes diferentes das citadas nas
alternativas anteriores.

18) (PUC-SP) Dietas pobres em alimentos que so


fontes de sais de ferro para o nosso organismo podero
ocasionar:
a) anemia.
b) dificuldade de coagulao do sangue.
c) distrbios nervosos.
d) sangramento das mucosas.
e) raquitismo.

13) (F.Lusada-Santos) A taxa de gua em um


organismo pode variar de acordo com alguns fatores.
So eles:

19) (PUC-SP) 0 papel principal do on P04 na clula :


a) manter o equilbrio osmtico.
b) formar ligaes de alta energia.
c) atuar como oxidante energtico.
d) regular o equilbrio cido-base.
e) atuar como catalisador em reaes metablicas.

a) espcie, enzimas e protenas.


b) idade, espcie e protenas.
c) atividade, idade e espcie.
d) atividade, enzimas e protenas.
e) idade, enzimas e protenas.

20) (PUCSP) 0 papel principal dos ons CO3 na clula :


14) A respeito da gua como constituinte celular, foram
formuladas as seguintes afirmaes:
I- A gua age como solvente natural dos ons e outras
substncias encontradas nas clulas.
II- A gua geralmente se encontra dissociada
ionicamente mantendo o pH e a presso osmtica das
clulas.
III- A gua funciona como enzima em muitas reaes
intracelulares.
IV- A gua indispensvel para a atividade celular,
visto que os processos fisiolgicos s ocorrem em meio
aquoso.
Esto corretas as afirmaes:
a) I e II
b) I e Ill
c) lI e lIl

a) manter o equilbrio osmtico


b) formar ligaes de alta energia
c) atuar como oxidante energtico
d) regular o equilbrio cido-bsico mantendo o pH
neutro da clula
e) atuar como catalisador em reaes metablicas
intracelulares
Parte II: Glicdios e Lipdios
1) Exemplos de polissacardio, dissacardio, hexose e
pentose,respectivamente:

d) I e IV
e) III e IV

a) celulose, sacarose, ribose e frutose.


b) amido, maltose, glicose e desoxirribose.
c) coniferina, lactose, maltose e desoxirribose.
d) amido, celulose, glicognio e frutose.
e) cido hialurnico, quitina, frutose e ribose.

15) A gua participa em todos os fenmenos abaixo,


exceto:

2) (FGV-SP-78) Glicognio e celulose tm em comum,


na sua composio, molculas de:

a) Manuteno da temperatura corprea.


b) Participao em reaes metablicas
c) Transporte de substncias
d) Transporte de energia
e) Manuteno da vida em regies geladas

a) aminocidos
b) cidos graxos

c) carboidratos
d) protenas

e) glicerol

3) Os glicdios que podem ser hidrolisados dando outros


glicdios de molculas menores so chamados:

16) No correto afirmar que os sais minerais:

a) oses
b) monossacardeos
c) esterdeos

a) esto, na maioria das vezes, no meio intracelular,


dissociados em ons.
b) na sua frmula integral, participam com funo
estrutural da natureza de alguns tecidos, como por
exemplo os sais de clcio no tecido sseo.
c) tm papel importante no fenmeno da osmose.

42

d) osdeos
e) polipeptdios

Pr Vestibular Diferencial

BIOLOGIA

4) (CESCEM-SP-76) Qual o tipo de substncia que


exerce fundamentalmente funo energtica no
metabolismo energtico da clula?

13) Os steres de cidos graxos com lcoois so


quimicamente classificados como:

a) protena
b) hidratos de carbono
c) fosfolipdios

a) glicdios ou carboidratos
b) protdios ou protenas
c) enzimas ou fermentos

d) enzimas
e) vitaminas

d) lipdios
e) cidos nucleicos

5) (UCMG-78) So considerados polissacardios:

14) No podemos considerar como lipdios simples:

a) lactose e maltose
glicognio
b) amido e lactose
frutose
c) glicognio e glicose

a) steres de cidos graxos com glicerol apenas.


b) compostos conhecidos como gorduras, leos e ceras.
c) lipdios formados por C, H e O apenas.
d) steres de cidos graxos com lcoois, acrescidos de
radicais contendo N, P ou S.
e) lipdios que contm glicerol, colesterol ou outros
lcoois, sem radicais nitrogenados, fosforados ou
sulfatados.

d) amido e
e) glicose e

6) (PUC-RS-84) O polissacardio formado por unidades


de glicose e que representa a principal forma de
armazenamento intracelular de glicdios nos animais
denominado:
a) amido
b) colesterol
c) ergosterol

15) Os lipdios so:

d) volutina
e) glicognio

a)
os
compostos
energticos
consumidos
preferencialmente pelo organismo.
b) mais abundantes na composio qumica dos
vegetais do que na dos animais.
c) substncias insolveis na gua mas solveis nos
chamados solventes orgnicos (lcool, ter, benzeno).
d) presentes como fosfolipdios no interior da clula,
mas nunca na estrutura da membrana plasmtica.
e) compostos orgnicos formados pela polimerizao de
cidos carboxilcos de cadeias pequenas em meio
alcalino.

7) A hidrlise de um polissacardio (OSDEO) resulta em


muitas molculas de:
a) oses
b) gua
c) sais minerais

d) gua e sais minerais


e) amido

8) Dentre as substncias relacionadas, qual delas


representa o principal suprimento energtico de
preferncia das clulas?
a) protenas
b) celulose
c) glicose

16) Os lipdios mais comumente usados na nossa


alimentao so integrantes do grupo dos:

d) vitaminas
e) gua

a) monoglicerdios
b) triglicerdios
c) cerdios
d) esterdios
e) lipdios complexos

9) So considerados oses ou monosacardios:


a) maltose e glicose
frutose
b) sacarose e maltose
c) amido e glicognio

17) A respeito do colesterol no correto dizer:

d) glicose e
e) amido e sacarose

a) um lcool de cadeia fechada de estrutura complexa.


b) no participa da composio dos triglicerdios.
c) integrante da frmula dos lipdios ditos esterdios ou
esterides.
d) encontrado na composio da cortisona e dos
hormnios sexuais.
e) um lipdio que se acumula na parede das artrias,
provocando estreitamento e obstruo desses vasos
sangneos (aterosclerose).

10) (F. Lusada -Santos) Polissacardio que participa da


parede celular dos vegetais:
a) celulose
b) quitina
c) amido

d) glicognio
e) cerdio

Parte III: Vitaminas

11) (ISE/Sta. Ceclia-SP) So carboidratos muito


importantes na sntese dos cidos nucleicos:
a) glicose e galactose
desoxiribose
b) glicose e monose
desoxiribose
c) ribose e glicose

d)

ribose

1) (FAFI/BH) Afeco bucal, com irritao das gengivas,


que se tornam vermelhas e facilmente sangrantes,
enfraquecimento dos dentes, quadros hemorrgicos
generalizados e principalmente articulares e digestivos
so conseqncias da falta de vitamina:

e) glicose e

a) A
b) B
c) C
d) D
e) E

12) A quitina, substncia que forma o exoesqueleto dos


artrpodes, classificada quimicamente como:
a) monossacardio
b) lipdio simples
c) mucopolissacardeo

d) esteride
e) carotenide

2) (PUC-RS) Existe uma vitamina muito importante para

43

Pr Vestibular Diferencial

BIOLOGIA

o bom funcionamento do nosso organismo, visto ser


necessria formao de uma srie de substncias
indispensveis coagulao do sangue. Por isso,
quando se verifica sua deficincia, a coagulao
sangnea fica prejudicada.
0 texto acima refere-se vitamina:

Assinale entre as taxas abaixo referidas a que deve


corresponder s vitaminas, de acordo com o que se
sabe sobre sua significao nutritiva e suas exigncias
na alimentao.
a) > 60%
b) <11%
c) 5%
d) 13%
e) 16%

a) A
c) D
e) K.
b) C
d) E.

9) (CESESP/PE). 0 escorbuto, o raquitismo, a


xeroftalmia e o beribri so, respectivamente, alteraes
provocadas pela carncia das seguintes vitaminas:

3) (UA-AM) A carncia das vitaminas C, D e B12


produz, respectivamente:
a) o raquitismo, o beribri e o escorbuto.
b) o beribri, o raquitismo e a anemia.
c) o escorbuto, o beribri e o raquitismo.
d) o beribri, o escorbuto e o raquitismo
e) o escorbuto, o raquitismo e a anemia.

a) C, D, A, B1
c) C, A, E, B2
e) K, C, B, A
b) C, D, E, A
d) C, A, E, B1

4) (UFPI) "Vitamina que pode ser fabricada na pele, por


estimulao da radiao ultravioleta e relacionada
fixao do clcio nos ossos. Sua falta em crianas
provoca o raquitismo." 0 texto refere-se vitamina:

10) (UFMG/MG). Quanto s vitaminas, todas as


afirmativas abaixo so corretas, exceto:
a) A vitamina A, encontrada principalmente em ovos e
leite, protetora do epitlio e sua carncia pode
determinar a cegueira noturna.
b) A vitamina D, encontrada principalmente nas frutas
ctricas, age no metabolismo das gorduras e sua
carncia pode determinar o beribri.
c) A vitamina B12 pode ser sintetizada por bactrias
intestinais e sua carncia pode determinar a anemia
perniciosa.
d) A vitamina C, encontrada em vegetais, mantm
normal o tecido conjuntivo e sua carncia pode
determinar o escorbuto.
e) A vitamina K atua como um dos fatores
indispensveis coagulao sangnea.

a) A
b) B
c) C
d) D
e) E
5) (UGF/RJ). 0 escorbuto, uma doena comum nas
longas viagens martimas nos sculos passados,
caracteriza-se por hemorragias nas mucosas, sob a pele
e nas articulaes. Seu aparecimento decorrente da
falta de vitamina:
a) C.
b) A.
c) D.
d) K.
e) B6.

Parte III: Vitaminas

6) (UESPI/PI) A deficincia de vitamina K pode causar


tendncia hemorrgica porque:

1) (FAFI/BH) Afeco bucal, com irritao das gengivas,


que se tornam vermelhas e facilmente sangrantes,
enfraquecimento dos dentes, quadros hemorrgicos
generalizados e principalmente articulares e digestivos
so conseqncias da falta de vitamina:

a) diminui a sntese heptica de protrombina.


b) aumenta a fragilidade das hemcias.
c) aumenta a fragilidade capilar.
d) diminui o nmero de plaquetas.
e) diminui a sntese de fibrinognio.

a) A
b) B
c) C
d) D
e) E

7) (USU/RJ). 0 raquitismo causado pela carncia de


vitamina:

2) (PUC-RS) Existe uma vitamina muito importante para


o bom funcionamento do nosso organismo, visto ser
necessria formao de uma srie de substncias
indispensveis coagulao do sangue. Por isso,
quando se verifica sua deficincia, a coagulao
sangnea fica prejudicada.
0 texto acima refere-se vitamina:

a) C.
b) B12
c) A.
d) D.
e) B6.

a) A
c) D
e) K.
b) C
d) E.

8) (FUVEST/SP). Foi feita a anlise da composio


qumica do corpo inteiro de um pequeno animal,
determinando-se as taxas percentuais das seguintes
categorias de substncias: gua, protenas e
nucleoprotenas, lipdios e carboidratos, sais minerais
(cinzas) e vitaminas.

3) (UA-AM) A carncia das vitaminas C, D e B12


produz, respectivamente:

44

Pr Vestibular Diferencial

BIOLOGIA

a) o raquitismo, o beribri e o escorbuto.


b) o beribri, o raquitismo e a anemia.
c) o escorbuto, o beribri e o raquitismo.
d) o beribri, o escorbuto e o raquitismo
e) o escorbuto, o raquitismo e a anemia.

c) C, A, E, B2
e) K, C, B, A
b) C, D, E, A
d) C, A, E, B1
10) (UFMG/MG). Quanto s vitaminas, todas as
afirmativas abaixo so corretas, exceto:

4) (UFPI) "Vitamina que pode ser fabricada na pele, por


estimulao da radiao ultravioleta e relacionada
fixao do clcio nos ossos. Sua falta em crianas
provoca o raquitismo." 0 texto refere-se vitamina:

a) A vitamina A, encontrada principalmente em ovos e


leite, protetora do epitlio e sua carncia pode
determinar a cegueira noturna.
b) A vitamina D, encontrada principalmente nas frutas
ctricas, age no metabolismo das gorduras e sua
carncia pode determinar o beribri.
c) A vitamina B12 pode ser sintetizada por bactrias
intestinais e sua carncia pode determinar a anemia
perniciosa.
d) A vitamina C, encontrada em vegetais, mantm
normal o tecido conjuntivo e sua carncia pode
determinar o escorbuto.
e) A vitamina K atua como um dos fatores
indispensveis coagulao sangnea.

a) A
b) B
c) C
d) D
e) E
5) (UGF/RJ). 0 escorbuto, uma doena comum nas
longas viagens martimas nos sculos passados,
caracteriza-se por hemorragias nas mucosas, sob a pele
e nas articulaes. Seu aparecimento decorrente da
falta de vitamina:
a) C.
b) A.
c) D.
d) K.
e) B6.

Parte IV: Protenas


1) (UFF-RJ) A transformao do leite em coalhada se
deve:

6) (UESPI/PI) A deficincia de vitamina K pode causar


tendncia hemorrgica porque:

a) desnaturao espontnea das protenas do leite.


b) acidificao progressiva pelo envelhecimento da
lactose.
c) ao desdobramento das protenas pela ao de
microorganismos.
d) coagulao enzimtica da lactose e das protenas.
e) coagulao das protenas (desnaturao) pelo
cido produzido na fermentao da lactose.

a) diminui a sntese heptica de protrombina.


b) aumenta a fragilidade das hemcias.
c) aumenta a fragilidade capilar.
d) diminui o nmero de plaquetas.
e) diminui a sntese de fibrinognio.
7) (USU/RJ). 0 raquitismo causado pela carncia de
vitamina:

2) (Un.B-80) Obteve-se da hidrlise de uma substncia


de origem animal: glicina, serina, histidina, lisina,
arginina e fenilalanina. A substncia hidrolisada era:

a) C.
b) B12
c) A.
d) D.
e) B6.

a) um polissacardeo.
b) um cido nucleico.
c) um lipdio.

d) uma protena.
e) uma cetose.

3) (Universidade Estadual de Maring-80) A ligao


peptdica resulta da unio entre o grupo:

8) (FUVEST/SP). Foi feita a anlise da composio


qumica do corpo inteiro de um pequeno animal,
determinando-se as taxas percentuais das seguintes
categorias de substncias: gua, protenas e
nucleoprotenas, lipdios e carboidratos, sais minerais
(cinzas) e vitaminas.
Assinale entre as taxas abaixo referidas a que deve
corresponder s vitaminas, de acordo com o que se
sabe sobre sua significao nutritiva e suas exigncias
na alimentao.

a) carboxila de um aminocido e o grupo carboxila do


outro.
b) carboxila de um aminocido e o grupo amina do
outro.
c) amina de um aminocido e amina do outro.
d) amina de um aminocido e radical R do outro.
e) carboxila de um aminocido e radical R do outro.
4) (FGV) Para melhor suprir deficincia de protena a
dieta deve incluir;

a) > 60%
b) <11%
c) 5%
d) 13%
e) 16%

a) farinha de trigo
b) banha
c) ovo

9) (CESESP/PE). 0 escorbuto, o raquitismo, a


xeroftalmia e o beribri so, respectivamente, alteraes
provocadas pela carncia das seguintes vitaminas:

d) laranja
e) chocolate

5) (FCMS-SP-77) O componente no-aquoso da clula


constitudo na sua maior parte por:
a) carboidratos
b) lipdios

a) C, D, A, B1

45

d) cido ribonucleico
e) protenas

Pr Vestibular Diferencial

BIOLOGIA

c) cido desoxirribonucleico
6) (UFPA-84) Nome da ligao que ocorre entre dois
aminocidos:
a) aminoactica
b) proteica
c) lipdica

d) peptdica
e) glicosdica

7) (PUC-82) Considere as seguintes afirmativas:


I- As protenas so substncias de grande
importncia para os seres vivos: muitas participam da
construo da matria viva.
II- As protenas chamada enzimas facilitam
reaes qumicas celulares.

12) Constituem exemplos de protena globular e de


protena fibrosa respectivamente:

III- Os anticorpos, que tambm so protenas,


funcionam como substncias de defesa.

a)
b)
c)
d)
e)

Assinale:
a) se somente I estiver correta.
b) se somente II estiver correta.
c) se somente III estiver correta.
d) se I e II estiverem corretas.
e) se todas estiverem corretas.

13) (PUCCAMP-SP) O nitrognio incorporado s


plantas, principalmente sob a forma de nitratos, por
elas utilizado para a produo de:
a) amnia
b) nitritos
c) glicose
d) amido
e) aminocidos

8) No funo bsica das protenas


a) atuar no sistema imunolgico
b) participar da coagulao sangnea
c) catalisar reaes metablicas
d) transportar energia atravs da clula
e) transportar O2 pelo organismo

14) Uma protena retirada de clula epitelial humana


possui: 10 VAL, 32 ALAN, 14 TREON, 27 HISTID, 49
GLIC, 24 LIS. De clulas sangneas do mesmo
individuo, foi extrada outra protena, cuja hidrlise
demonstrou ser formada de: 10 VAL, 32 ALAN , 14
TREON, 27 HISTID, 49 GLIC, 24 LIS. Em face de tais
informaes, lcito concluir que:

9) (UFBA-BA). As proteinas produzem aminocidos


atravs de uma reao de:
a) isomerizao
b) hidratao
c) hidrlise

d) oxidao
e) descarboxilao

a)
trata-se da mesma protena, pois em ambos
encontramos o mesmo nmero de aminocidos.
b) trata-se da mesma protena, pois a quantidade de
cada aminocido igual em ambas.
c) trata-se da mesma protena, pois ambas tm os
mesmos aminocidos
d) trata-se de protenas diferentes, pois foram obtidas
de clulas estrutural, embrionria e funcionalmente
diferentes
e) pode-se tratar de protenas iguais ou diferentes, pois
s a anlise da disposio dos aminocidos poder
revelar a identidade ou a diferena entre elas

10) (UFBA-BA). 0 aminocido mais simples a:


a)
b)
c)
d)
e)

celulose e fibrina
hemoglobina e clorofila
colgeno e fibrina
fibrina e clorofila
hemoglobina e colgeno

alanina
lisina
glicina
cistena
triptofano

11) (UFBA-BA). Os aminocidos so compostos que


apresentam, em sua estrutura, os grupos funcionais:

15) A sntese de aminocidos diversos a partir do cido


glutmico realizada por meio de reaes chamadas
de:
a) hidrlise
b) oxidao
c) desidrogenao
d) transaminao
e) polimerizao
16) (PUCC-SP) As protenas so compostos:
a) formados por carboidratos e lipdios unidos por
pontes de hidrognio

46

Pr Vestibular Diferencial

BIOLOGIA
b)
c)
d)
e)

b) formados por aminocidos unidos por ligaes


peptdicas
c) de tamanho muito pequeno (micromolculas) e que
ocorrem em baixa concentrao dentro da clula
d) que no fazem parte da constituio qumica dos
cromossomos
e)
responsveis diretamente pela transmisso da
informao gentica

21) (UFPI-PI). A hidrlise de uma protena produz:


a)
b)
c)
d)
e)

17) (FMlt-MG) A desoxirribonucleoprotena uma


heteroprotena que tem como grupo prosttico:
a)
b)
c)
d)
e)

85, 1, 1
85, 84, 84.
84, 85, 85
1, 85, 85

uma protena simples


os aminocidos
a desoxirribose
uma molcula de DNA
uma molcula de RNA

aminas
lcoois
aminocidos
cidos carboxlicos
steres

22) (PUC-RJ). Chama-se aminocido essencial ao


aminocido que:
a)
b)
c)
d)
e)

(FMit-MG) Use o seguinte esquema para responder as


questes 55 e 56:

no sintetizado no organismo humano.


sintetizado em qualquer organismo animal.
s existe em determinados vegetais.
tem funo semelhante das vitaminas.
indispensvel ao metabolismo energtico.

23) (UFES-ES). So alimentos ricos em protenas:


a)
b)
c)
d)
e)

24) Os meios de comunicao, recentemente,


divulgaram que a venda de carne para a populao caiu
em 60%, sem haver aumento no consumo de aves e
peixes. Este fato preocupante porque indica que foi
reduzida a ingesto de nutrientes com funo plstica,
que so:

18) No esquema anterior:


I - As letras X e Z representam dois aminocidos
quaisquer.
II - A letra Y representa uma ligao peptdica.
III - A letra W representa uma protena qualquer.

a) glicdios
b) vitaminas
c) protenas
d) lipdios
e) sais minerais

Assinale:
a)
b)
c)
d)
e)

25) Os esquemas seguintes representam duas


possibilidades de alteraes das propriedades de uma
protena.
ESQUEMA I

se I, II e III forem verdadeiras


se I, II e III forem falsas
se apenas I e II forem verdadeiras
se apenas I e IIl forem falsas
se apenas II e III forem verdadeiras

19) No esquema anterior:


I - Se cinco aminocidos se unirem como X e Z se
uniram, teremos cinco ligaes peptdicas.
II - Considerando-se uma protena qualquer, X e Z
poderiam ser os monmeros dela.
III - 0 esquema representa uma sntese por
desidratao.
a)
b)
c)
d)
e)

leite, carne e soja


leite, carne e mandioca
leite, ovo e farinha de milho
leite, caf e banana
leite, batata e azeite

ESQUEMA II

se I, II e III forem verdadeiras


se I, II e III forem falsas
se apenas I e II forem verdadeiras
se apenas I e Il forem falsas
se apenas II e III forem verdadeiras

20) (EFOA-MG) . Num polipeptdio que possui 84


ligaes peptdicas, os respectivos nmeros de:
Aminocidos e de Grupamento(s) Amino-terminal e
Grupamento(s) cido-terminal so:

Os esquemas
respectivamente a:

a) 84, 1, 1

47

II

dizem

respeito

Pr Vestibular Diferencial

BIOLOGIA
a) no resista a essa segunda dose.
b) demore mais tempo para produzir a antitoxina.
c) produza a antitoxina mais rapidamente.
d) no produza mais a antitoxina por estar imunizado.
e) produza menor quantidade de antitoxina.

a) alterao na estrutura primria da protena e


desnaturao.
b) desnaturao e desligamento da estrutura terciria.
c) alterao na estrutura terciria da protena e solao.
d) solao e desnaturao.
e) nenhuma das respostas acima

2) (UF-OURO PRETO) Relacione a 2 coluna de acordo


com a 1:

26) (UF-BA) A ligao peptdica encontrada nas


protenas origina-se da reao entre o grupo NH2 e o
grupo:
a) OH
b) CHO
c) NH2

1 . Vacina antitetnica
2. Soro antitetnico
antgenos

d) COOH
e) CO

) contm anticorpos
(
) contm

) produz imunidade

passiva
(
(

27) Chama-se peptdica a ligao entre:

) induz imunidade ativa


) um toxide

A resposta correta :

a) dois dissacardios.
b) um lpdio e um aminocido.
c) dois cidos aminados.
d) dois cidos graxos.
e) duas oses.

a) 1, 1, 2, 1, 2.
b) 1, 2, 1, 1, 2.
c) 1, 2, 2, 2, 1.
d) 2, 1, 2, 1, 1.
e) 2, 1, 2, 2, 1.

28) (UNIFICADO-95) Leia o texto a seguir:

3) (PUC-SP) 0 grfico seguinte relaciona a velocidade


de uma reao qumica catalisada por enzimas com a
temperatura na qual esta reao ocorre. Podemos
afirmar que:

Cear joga fora opo alimentar


Segundo pesquisas da UFC, a cada ano 800
toneladas de carne de cabea de lagosta no so
aproveitadas sendo lanadas ao mar. O estudo
sobre hidrlise enzimtica de desperdcio de
lagosta, ttulo do pesquisador Gustavo Vieira ,
objetiva o uso de material de baixo custo para
enriquecer a alimentao de populaes carentes. O
processo consiste na degradao de molculas
orgnicas complexas em simples por meio de um
catalizador e na posterior liofilizao. O p
resultante de alto teor nutritivo, com baixa
umidade e resiste, em bom estado de conservao,
por longos perodos.
(Jornal do Brasil - 27/08/94)
Com base nos processos descritos no artigo
acima, assinale a opo correta:

a) a velocidade da reao independe da temperatura.


b) existe uma temperatura tima na qual a velocidade
da reao mxima.
c) a velocidade aumenta proporcionalmente
temperatura.
d) a velocidade diminui proporcionalmente
temperatura.
e) a partir de uma certa temperatura, inverte-se o
sentido da reao.

a) As molculas orgnicas simples obtidas so


glicerdios que so utilizados pelo organismo com
funo reguladora.
b) As molculas orgnicas complexas empregadas so
protenas que, ao serem digeridas em aminocidos so
utilizadas pelo organismo com funo estrutural.
c) O catalizador do processo uma enzima capaz de
degradar protenas em monossacardios essenciais
liberao de energia para as atividades orgnicas.
d) A hidrlise enzimtica de molculas orgnicas
complexas realizada por catalizador inorgnico em
presena de gua.
e) O alto teor nutritivo do produto devido ao fato de as
molculas orgnicas simples obtidas serem sais
minerais indispensveis ao desenvolvimento orgnico.

4) (MACK) Considerando-se a definio de enzimas,


assinale a alternativa correta:
I - So catalisadores orgnicos, de natureza proteica,
sensveis s variaes de temperatura.
II - So substncias qumicas, de natureza lipdica,
sendo consumidas durante o processo qumico.
IIl - Apresentam uma regio chamada centro ativo,
qual se adapta a molcula do substrato.
a) apenas a afirmativa I correta.
b) apenas as afirmativas II e III so corretas.
c) apenas as afirmativas I e III so corretas.
d) todas as afirmativas so corretas.
e) nenhuma afirmativa correta.

Parte V: Enzimas
1) (FUVEST) Um coelho recebeu, pela primeira vez, a
injeo de uma toxina bacteriana e manifestou a
resposta imunitria produzindo a antitoxina (anticorpo).
Se aps certo tempo for aplicada uma segunda injeo
da toxina no animal, espera-se que ele:

5) (UF-MG) Na pgina seguinte encontramos a curva de


crescimento de um mutante de Neurospora em
diferentes concentraes de vitamina B6. Esta curva foi
obtida por Beadle e Tatum quando estudaram o

48

Pr Vestibular Diferencial

BIOLOGIA

crescimento de um mutante de Neurospora, incapaz de


sintetizar a vitamina B6. Diferentes concentraes de
vitamina foram adicionadas cultura, e a taxa de
crescimento foi avaliada.

b) So consumidas no processo de acelerao de


reaes qumicas entre outras substncias.
c) So catalisadores de natureza mineral.
d) So catalisadores inespecficos de natureza orgnica.
e) So biocatalisadores especficos de natureza
orgnica.
9) (PUC-SP) As enzimas so:
a) carboidratos.
b) lipdios.
c) fosfolipdios.
d) protenas.
e) cidos graxos.
10) (UF-BA)

Sabendo-se que o teor de Vitamina B6 foi o nico fator


varivel no experimento, a observao do grfico nos
permite fazer as afirmaes seguintes, exceto uma:
a) H uma correlao positiva entre o crescimento do
mutante e a concentrao de vitamina B6 no meio de
cultura
b) A vitamina B6 um componente essencial ao
metabolismo da Neurospora.
c) Nas concentraes de vitamina B6 de 0,015 a O,12
3
micrograma por 25 cm de nutriente, a cultura apresenta
um ndice de crescimento mais acelerado.
d) 0 maior aumento da taxa de crescimento se verifica
entre as concentraes de 0,25 e 1,0 micrograma por 25
3
cm .
e) Se for usada a concentrao de 2,0 microgramas por
3
25 cm , provavelmente no haver um aumento
significativo na taxa de crescimento.

Uma propriedade das enzimas que se evidencia


atravs do diagrama acima :
a) apresentar natureza proteica.
b) acelerar a velocidade das reaes.
c) exigir pH apropriado para agir.
d) participar em reaes reversveis.
e) atuar sob determinadas temperaturas.

6) Quanto s enzimas, pode-se dizer que:

11) (FGV) Considere o seguinte esquema em que as


letras representam substncias qumicas e os nmeros
representam enzimas que catalisam reaes de
transformaes.

a) so protenas com funo de catalisadores qumicos


orgnicos que aumentam a velocidade das reaes
qumicas viveis.
b) so substncias altamente especficas que atuam
sempre sobre um determinado substrato, como se fosse
um sistema chave-fechadura.
c) aps a reao continuam quimicamente intactas.
d) sua atividade depende da temperatura e do pH do
meio.
e) todas as frases esto corretas.

Qual das seguintes afirmaes uma hiptese lgica


derivada da anlise do esquema?
a) A enzima 4 a mais importante da srie .
b) Se uma substncia destruir a enzima 3 todas as
reaes cessaro.
c) Se a enzima 1 for removida B ser formada a partir
de A, mas a reao reversa no ocorre.
d) Quando a substncia A for sintetizada no h
necessidade da formao de B.
e) A substncia C ser acumulada aps a remoo da
enzima 3.

7) (STA. CASA) Sobre as enzimas, est errado dizer


que:
a) so todas protenas que podem ou no estar
associadas a molculas de outra natureza.
b) agem acelerando reaes qumicas que normalmente
se processariam muito lentamente.
c) independentemente da temperatura ou do pH do
meio, uma vez unidas ao substrato sobre o qual agem,
as enzimas exercem sua funo.
d) h enzimas que agem mais rapidamente do que
outras.
e) possvel anular ou diminuir a atividade de uma
enzima.

12) (UFES-84) As enzimas so:


a) carboidratos que tm a funo de regular o nvel de
acar (glicose) no sangue dos animais superiores.
b) protenas que tm a funo de catalisar reaes
qumicas nos seres vivos.
c) protenas com funo estrutural que entram na
constituio da parede celular dos vegetais.
d) lipdios que tm a funo de fornecer energia para as
reaes celulares.

8) (UF-RJ) Assinalar o item que melhor se ajusta


conceituao das enzimas:
a) Reagem irreversivelmente com o substrato.

49

Pr Vestibular Diferencial

BIOLOGIA

e) mucopolissacardeos que tm a funo estrutural nos


exoesqueletos de artrpodes.

2) (UFPA-PA) Considerando que, no DNA de uma


determinada espcie, 35% do total de bases
nitrogenadas representado pela guanina, a proporo
de adenina :

13) Assinale o grfico que melhor representa o efeito da


concentrao do substrato na velocidade inicial de uma
reao catalisada por uma enzima.

a) 15%
b) 35%
c) 45%
d) 65%
e) 70%
3) (FUVEST-SP) A seqncia de aminocidos de uma
protena determinada pela seqncia de:
a) pentoses da molcula de DNA.
b) pentoses da molcula de RNA mensageiro.
c) bases da molcula de DNA.
d) bases da molcula de RNA transportador.
e) bases da molcula de RNA ribossmico.
4) (UFPA-PA) Fazendo-se uma anlise, por hidrlise, de
molculas
de cidos nucleicos, verifica-se o
aparecimento de:

14) (UFES-84) A atividade enzimtica essencial para o


funcionamento celular atravs do controle das reaes
orgnicas. Tendo em vista as funes enzimticas,
considere as seguintes afirmativas:

a) acar, fosfato e bases nitrogenadas


b) protenas, fosfato e bases nitrogenadas
c) aminocidos, acar e fosfato
d) pentoses, bases nitrogenadas e aminocidos
e) pentoses, aminocidos e fosfato

I- As enzimas tornam as molculas reagentes


mais lbeis, isto , mais reativas com as outras
molculas do meio.
II- A diminuio da energia de ativao a
caracterstica mais importante da enzima na reao.
III- O complexo enzima-substrato altamente
especfico e somente molculas especificamente
configuradas podem ter acesso a grupos qumicos
particulares da enzima.

5) (PUCSP-SP) Duas cadeias polinucleotdicas, ligadas


entre si por pontes de hidrognio, so constitudas por
fosfato, desoxirribose, citosina, guanina, adenina e
timina.
O enunciado anterior refere-se molcula de:
a) ATP
b) FAD
c) RNA

Assinale:
a) se apenas I e II forem corretas.
b) se apenas I e III forem corretas.
c) se apenas II e III forem corretas.
d) se todas forem corretas.
e) se todas forem incorretas.

d) DNA
e) NAD

6) (Fac. Engenharia de Sorocaba-80) Considerando-se


o total de bases nitrogenadas do DNA de um mamfero
qualquer, igual a 100, se nela existirem 20% de
adenina, a porcentagem de guanina ser:
a) 20 %
b) 40 %
c) 30 %

15) (CESCEM-SP) Na coagulao do sangue, a


protrombina do plasma transforma-se em trombina em
presena de ons clcio e de tromboplastina.
A
trombina age sobre o fibrinognio, que se transforma em
fibrina. Portanto, na coagulao do sangue, agem como
enzimas:

d) 60 %
e) 10 %

7) Sobre o DNA incorreto afirmar que:


a) encontrado em todos os pontos da clula.
b) origina o RNAm.
c) reproduz-se por processo semiconservativo.
d) integrante dos genes nos cromossomas.
e) constitui-se de dupla cadeia de nucleotdeos.

a) a tromboplastina e o fibrinognio.
b) a tromboplastina e a trombina
c) a trombina e a fibrina
d) o fibrinognio e a trombina
e) a protrombina e a tromboplastina

8) (CESCEM-SP) Uma cadeia de RNA mensageiro


formada a partir de uma fita de DNA, que apresenta a
seguinte seqncia de
bases
nitrogenadas:
TAAATGGCG. Sendo A= adenina, C= citosina, G=
guanina, T= timina e U= uracil, a seqncia das bases
da cadeia do RNA mensageiro formada deve ser:

Parte VI: cidos Nucleicos


1) (Univ. Est. de Maring-80) A diferena entre DNA e
RNA, com relao s bases, :
a) DNA tem uracil e citosina.
b) RNA tem timina e adenina.
c) DNA tem guanina e uracil.
d) DNA tem uracila e timina.
e) RNA tem adenina e uracila.

a) CGGGCAAUA
b) UTTTUCCGC
c) UTAAUUUGU
d) ACCCAUUGU

50

Pr Vestibular Diferencial

BIOLOGIA

e) AUUUACCGC

c) RNA-mensageiro
d) ATP
e) Concentrao do aminocido

9) (USU-90) A modificao de uma seqncia


nucleotdicade um trecho de uma molcula de DNA,
transmitida pela reproduo, caracteriza o fenmeno da:
a) duplicao
b) permutao
c) mutao

5) (CESGRANRIO-RJ) O antibitico estreptomicina


capaz de combinar-se com cidos nuclicos. Em sua
presena a clula produz enzimas e outras protenas
que no funcionam devido introduo de erros de
interpretao a partir dos cdons do ARN mensageiro,
ao nvel dos ribossomos. O resultado pode interpretarse dizendo que a estreptomicina determina erros:

d) ligao
e) replicao

10) (FMSA-SP) Se fosse possvel sintetizar in vitro uma


molcula proteica, nas mesmas condies em que esta
sntese ocorre nas clulas, utilizando-se: ribossomas
obtidos de clulas de rato; RNA-mensageiro de clula
de sapo; RNA-transportador de clulas de coelho e
aminocidos ativados de clula bacteriana, a protena
produzida teria a estrutura primria idntica :

a) na estrutura do ARN ribossomal


b) na reduplicao do ADN
c) na transcrio do cdigo gentico
d) na traduo do cdigo gentico
e) tanto de transcrio como de traduo do cdigo
gentico

a) da bactria
b) do sapo
c) do rato
d) do coelho
e) seria uma mistura de todas

6) (F. Objetivo-SP) A lisozima uma protena de massa


molecular 12 000. Considerando a massa molecular
mdia dos aminocidos igual a 120, podemos concluir
que o pedao da hlice de DNA que codifica esta
protena deve ter:

Parte VII: Sntese Protica


a) 100 nucleotdeos
b) 1000 nucIeotdeos
c) 12 000 nucleotdeos
6
d) 10 nucleotdeos
e) 300 nucleotdeos

1) (FMSA-SP) Os fenmenos 1,2 e 3 no esquema ao


lado so respectivamente:
DNA
1
DNA

RNA

7) (UFJF-MG). Basicamente, a informao gentica


expressa-se
nas
clulas
pelos
mecanismos
denominados, respectivamente:

PROTENA

a) transcrio - transporte ativo


b) polialelia - epistasia
c) transcrio - traduo
d) epistasia - transcrio
e) transporte ativo - conjugao

a) traduo, transcrio, duplicao


b) duplicao, transcrio, traduo
c) duplicao, traduo, transcrio
d) traduo, duplicao, transcrio
e) transcrio, duplicao, traduo

8) (CESGRANRIO-RJ) Assinale a opo que associa


corretamente os cidos nuclicos relacionados na
coluna da direita, em algarismos arbicos, com as
funes apresentadas na coluna da esquerda, em
algarismos romanos.

2) (FUVEST-SP)
Qual da seqncias abaixo
corresponde ao produto de transcrio do segmento
AATCACGAT de uma fita de DNA?
a)
b)
c)
d)
e)

TTACTCGTA
TTAGTGCTA
AAUCACGAU
UUAGUGCUA
UUACUCGUA

I) Transmite a informao gentica para outras clulas


II) Atravs da seqncia de suas bases determina a
posio dos aminocidos nas protenas.
III)Transporta os aminocidos, unindo o seu anticdon
ao cdon do mensageiro.

3) (UFPE) O cdon corresponde seqncia de trs


bases do:

1) RNA de transferncia
2) RNA ribossmico
3) DNA
4) RNA mensageiro

a) RNA-transportador
b) RNA-ribossmico
c) RNA-mensageiro
d) RNA-solvel
e) ribossomo

a) I-1,
b) I-2,
c) I-3,
d) I-2,
e) I-3,

4) (UFRS) Ao ser sintetizada uma protena pela ao de


um gene especfico, cada aminocido incorporado
numa seqncia predeterminada pela molcula de DNA.
Qual o fator mais importante para que um aminocido
seja colocado na posio correta durante esta sntese?

II-2,
II-4,
II-4,
II-4,
II-1,

III-3
III-1
III-1
III-3
III-2

9) (F.C. Chagas-BA). Considere um segmento de


molcula de DNA com a seguinte seqncia de bases:
AAT - CAA - AGA - TTT - CCG

a) DNA-polimerase
b) RNA-polimerase

51

Pr Vestibular Diferencial

BIOLOGIA

Quantos aminocidos poder ter, no mximo,


uma molcula de protena formada pelo segmento
considerado?

16) (UCP-Pelotas/90) A sntese de protenas feita


principalmente:

a) 15
b) 10
c) 5
d) 3
e) 1

a) na mitocndria.
b) no centro celular.
c) no complexo de Golgi

d) no ribossoma
e) no lisossoma

17) (UFPI-PI) Com relao sintese de protenas em


uma clula, foram feitas as seguintes afirmativas:

10) (FCMSCSP) Quantos cdons apresenta o RNA que


codifica uma protena com cinco ligaes peptdicas?

I - Todas as clulas sintetizam sempre os


mesmos tipos de protenas, nas mesmas propores.
II - A seqncia de bases nitrogenadas ao
longo da molcula de RNAm determina a seqncia dos
aminocidos incorporados na cadeia polipeptdica.
III - Durante a sintese proteica, o RNAt tem por
funo levar os aminocidos s mitocndrias.
IV - As mitocndrias no tm relao direta
com a sntese de proteinas, j que esta ocorre nos
ribossomos.
V - Um RNAm sinttico, que contenha apenas
um determinado tipo de cdon em seqncia,
condicionar a sntese de uma cadeia polipeptdica com
um nico tipo de aminocido.

a) 15
b) 10
c) 5
d) 30
e) 6
11) (UFPA-PA). Uma protena formada por 40
aminocidos codificada por uma molcula de RNA ( 1
) de no mnimo ( 2 ) nucleotdeos. ( 1 ) e ( 2 )
correspondem respectivamente a:
a) mensageiro, 40
b) mensageiro, 120
c) transportador, 60
d) transportador,120
e) ribossmico, 60

As afirmativas corretas so:


a) I, II
b) I, IV
c) III, V

12) (UFPR-PRI) A que elemento de ultra-estrutura se


referem os termos usados em microscopia ptica:
substncia basfila, substncia cromidial e
ergastoplasma?

d) II, V
e) II, III

18) (CESGRANRIO-RJ) . Os ribossomos, partculas


citoplasmticas de 15 a 25 nm de dimetro, compostas
de ARN e protenas, esto envolvidos diretamente na
sntese de protenas citoplasmticas e de protenas para
exportao pela clula. As trs afirmativas abaixo
referem-se estrutura e funo dessas organelas.

a) nuclolo
b) complexo de Golgi
c) incluses citoplasmticas
d) microvilosidades
e) retculo endoplasmtico granular

I - Os ribossomos so formados por trs


subunidades compostas por ARN e protenas de
diferentes pesos moleculares.
II - No processo de sntese e transferncia de
protenas para o retculo endoplasmtico granular, o
ribossomo se prende membrana do mesmo atravs da
subunidade menor.
III - Os polissomas, formados por ribossomos e
ARN mensageiro, representam formas ativas no
processo de sntese protica.

13) (UFRGS-RS). 0 cdon que corresponde ao


aminocido alanina dado pela seguinte seqncia de
bases: guanina, citosina, adenina. Isso permite dizer
que o anticdon da alanina no RNAt :
a) GCA
b) CGU
c) UGC
d) GTC
e) CTG

Assinale:
14) (UA-AM) 0 elemento que identifica a posio de
cada aminocido indicado pelo ARN mensageiro na
formao da cadeia polipeptdica :

a) se somente I for correta


b) se somente II for correta
c) se somente III for correta
d) se somente Il e III forem corretas
e) se I, II e III forem corretas

a) a enzima
b) o ARN transportador
c) o polirribossomo
d) o ADN
e) o prprio ARN mensageiro.

19) (FUVEST-SP)

15) (AEUDF-DF) Aderidos ao retculo endoplasmtico


rugoso encontram-se os orgnulos sobre os quais
ocorre a sntese de proteinas. Esses orgnulos so:
a) mitocndrias
b) lisossomos
c) ribossomos

d) nuclolos
e) cloroplastos

52

Pr Vestibular Diferencial

BIOLOGIA

GABARITO

O esquema apresenta a sntese de um


polipeptideo a partir de uma molcula de DNA. licito
dizer que o diagrama mostra:
a) a traduo do cdigo gentico
b) a transcrio do cdigo gentico
c) a transcrio e a traduo do cdigo gentico
d) a replicao do DNA
e) a replicao do DNA, a transcrio e a traduo do
cdigo gentico
20) O bacterifago t2 tem como material gentico uma
moIcula de DNA com cerca de 3600 nucleotideos, que
compreendem trs genes. Admitindo que esses trs
genes tenham aproximadamente as mesmas dimenses
e que a massa molecular mdia dos aminocidos seja
igual a 120, cada uma das protenas por eles codificada
deve ter uma massa molecular aproximada de:
a) 48000
3
b) 24 x 10
2
c) 4 x 10
d) 12 000
3
e) 144 x 10
21) (FCMSC-SP). Ao se isolar uma molcula pura e
completa de RNAm contaram-se nela 1600
nucleotdeos; destes, 300 eram cidos ribo-uraclicos e
no havia nenhum cido ribo-adenlico.
Por isso concluiu-se que o gene (ou a molcula
de DNA) que organzou tal RNAm apresenta um total de
quantas citosinas?
a) 600
b) 800
c) 900

Parte I gua
e sais minerais
123A
D
B
11- 12- 13D
A
C

4E
14D

5C
15D

6C
16D

7A
17C

8B
18A

9B
19B

10D
20D

Parte
II
Glicdios
Lipdios
21B
C
11- 12D
C

4B
14D

5D
15C

6E
16B

7A
17E

8C

9D

10A

Parte
III

Vitaminas
1234C
C
E
D

5A

6A

7D

8B

9A

10B

Parte
IV

Protenas
123E
D
B
11- 12- 13E
E
E
21- 22- 23C
A
A

4C
14E
24C

5E
15D
25A

6D
16B
26D

7E
17D
27C

8D
18C
28B

9C
19D

10C
20B

Parte
V
Enzimas
12C
D
11- 12E
B

4C
14B

5D
15B

6E

7C

8E

9D

10D

5D

6C

7A

8E

9C

10B

5D
15C

6E
16D

7C
17D

8C
18C

9E
19C

10C
20B

e
3D
13D

3B
13D

Parte
VI

cidos
Nucleicos
1234E
A
C
A

d) 1200
e) 1300

Parte VII
Sntese
Proteica
123B
D
C
11- 12- 13B
E
B
21- 22E
E

22) (UNIFICADO-91) Sobre a sntese das protenas


foram feitas as seguintes afirmaes:
I Um RNAt (RNA transportador) transporta sempre
um determinado aminocido. Este aminocido, porm,
pode ser transportado por vrios RNAt.
II A traduo do cdigo qumico do RNAm (RNA
mensageiro) ocorre nos ribossomas localizados no
retculo endoplasmtico rugoso.
III As molculas de RNAt apresentam numa
determinada regio da sua molcula uma trinca de
bases denominada anticdon.
Assinale a alternativa correta:
a) Apenas II.
b) Apenas III
c) Apenas I e II.
d) Apenas II e III.
e) I, II e III.

53

4C
14B

Pr Vestibular Diferencial

BIOLOGIA

EXERCICIOS DE CITOLOGIA

extracelular.
b) apresentam disposio fixa, o que possibilita sua
ao no transporte de ons e molculas atravs da
membrana.
c) tm movimentao livre no plano da membrana, o
que permite atuarem como receptores de sinais.
d) dispem-se na regio mais interna, sendo
responsveis pela maior permeabilidade da membrana
a molculas hidrofbicas.
e) localizam-se entre as duas camadas de fosfolipdeos,
funcionando como um citoesqueleto, que determina a
morfologia celular.

Parte I: Estrutura da membrana

1) (UFES-ES) O modelo abaixo representa a


configurao molecular da membrana celular, segundo
Singer e Nicholson. Acerca do modelo proposto,
assinale a alternativa incorreta.

6) (VEST-RIO-92) Os seres vivos, exceto os vrus,


apresentam estrutura celular. Entretanto, no h nada
que corresponda a uma clula tpica, pois, tanto os
organismos unicelulares como as clulas dos vrios
tecidos dos pluricelulares so muito diferentes entre si.
Apesar dessa enorme variedade, todas as clulas vivas
apresentam o seguinte componente:
a) retculo endoplasmtico.
b) membrana plasmtica.
c) aparelho de Golgi.
d) mitocndria.
e) cloroplasto.

a) O algarismo 1 assinala a extremidade polar (hidrfila)


das molculas lipdicas.
b) O algarismo 2 assinala a extremidade apolar
(hidrfoba) das molculas lipdicas.
c) O algarismo 3 assinala uma molcula de protena.
d) O algarismo 4 assinala uma molcula de protena que
faz parte do glicoclix.
e) O algarismo 5 assinala uma protena extrnseca
estrutura da membrana.

7) (UGF-93) Na maioria das clulas vegetais,


encontram-se pontes citoplasmticas que estabelecem
continuidade entre clulas adjacentes. Estas pontes so
denominadas:
a) microtbulos.
b) polissomos.
c) desmossomos.
d) microvilosidades.
e) plasmodesmos.

2) (USU-RJ) Na mucosa intestinal, as clulas


apresentam grande capacidade de absoro devido
presena de:
a) desmossomas
b) vesculas fagocitrias
c) microvilosidades
d) flagelos
e) clios

8) (UNIRIO-95) As clulas animais apresentam um


revestimento externo especfico, que facilita sua
aderncia, assim como reaes a partculas estranhas,
como, por exemplo, as clulas de um rgo
transplantado. Esse revestimento denominado:

3) (MOJI-SP) A membrana plasmtica, apesar de


invisvel ao microscpio ptico, est presente:

a) membrana celulsica.
b) glicoclix.
c) microvilosidades.
d) interdigitaes.
e) desmossomos.

a) em todas as clulas, seja ela procaritica ou


eucaritica.
b) apenas nas clulas animais.
c) apenas nas clulas vegetais.
d) apenas nas clulas dos eucariontes.
e) apenas nas clulas dos procariontes.

9) (UFF-95) Assinale, dentre as estruturas abaixo,


aquela que representa EXCEO especializao da
membrana plasmica:

4) (UF-AC) Quimicamente, a membrana celular


constituda principalmente por:

a) desmossomos.
b) plos absorventes na razes dos vegetais.
c) microvilosidades intestinais.
d) axnio.
e) clios.

a) acetonas e cidos graxos.


b) carboidratos e cidos nucleicos.
c) celobiose e aldedos.
d) protenas e lipdios.
e) RNA e DNA.
5) (UFF-94) A membrana plasmtica constituda de
uma bicamada de fosfolipdeos, onde esto
mergulhadas molculas de protenas globulares. As
protenas a encontradas:

10) (PUC-RJ) As clulas animais diferem das clulas


vegetais porque estas contm vrias estruturas e
organelas caractersticas. Na lista abaixo, marque a
organela ou estrutura comum s clulas animais e
vegetais.

a) esto dispostas externamente, formando uma capa


que delimita o volume celular e mantm a diferena de
composio molecular entre os meios intra e

a) vacolo
b) parede celular
c) cloroplastos

54

d) membrana celular
e) centrolo

Pr Vestibular Diferencial

BIOLOGIA
passagem de molculas de fora para dentro da clula e
impedindo a passagem no sentido inverso.
b) possibilita clula manter a composio intracelular
diversa da do meio ambiente.
c) impede a penetrao de substncias existentes em
excesso no meio ambiente.
d) exige sempre consumo energtico para a captao
de alimentos do meio externo.
e) impede a sada de gua do citoplasma.

11) (PUC-SP) As microvilosidades presentes nas


clulas do epitlio intestinal tm a funo de:
a) aumentar a aderncia entre uma clula e outra.
b) produzir grande quantidade de ATP, necessria ao
intenso metabolismo celular.
c) sintetizar enzimas digestivas.
d) secretar muco.
e) aumentar a superfcie de absoro.

4) (FUVEST-95) Clulas vegetais, como as


representadas na figura A, foram colocadas em uma
determinada soluo e, no fim do experimento, tinham
aspecto semelhante ao da figura B.

12) (PUC-SP) Sabe-se que clulas epiteliais acham-se


fortemente unidas, sendo necessria uma fora
considervel para separ-las. Isto se deve ao:
a) do ATP, que se prende s membranas plasmticas
das clulas vizinhas.
b) da substncia intercelular.
c) dos desmossomos.
d) dos centrolos.
e) da parede celular celulsica.
13) O reforo externo da membrana celular nos vegetais
:
a) rgido, celulsico e colado membrana plasmtica.
b) elstico, celulsico e colado membrana plasmtica.
c) rgido, celulsico e capaz de se descolar da
membrana plasmtica.
d) elstico, celulsico e capaz de se destacar da
membrana plasmtica.
e) rgido e de natureza exclusivamente proteica.

Comparando as concentraes do interior da clula na


situao inicial ( I ), da soluo externa ( II ) e do interior
da clula na situao final ( III ), podemos dizer que:

Parte II: Fisiologia da Membrana

a) I maior que II.


b) I maior que III.
c) I menor que II.
d) I igual a III.
e) III maior que II.

1) (UF-GO) Quando se coloca uma clula da epiderme


inferior da folha de Tradescantia zebrina em uma
soluo hipertnica, ocorre:
I- movimento de soluto e de solvente entre as
clulas e a soluo externa.
II- destruio da clula.
III- sada de solvente da clula.
IV- plasmlise.
Assinale:

5) (UERJ-95) Quando ganhamos flores, se quisermos


que elas durem mais tempo, devemos mergulh-las
dentro dgua e cortarmos, em seguida, a ponta da sua
haste. Este procedimento feito com o objetivo de
garantir a continuidade da conduo da seiva bruta. Tal
fenmeno ocorre graas diferena de osmolaridade
entre a planta e o meio onde ela est, que so
respectivamente:

a) Se apenas as afirmativas III e IV forem corretas.


b) Se apenas as afirmativas I e II forem corretas.
c) Se apenas as afirmativas II e IV forem corretas.
d) Se apenas as afirmativas I e III forem corretas.
e) Se apenas a afirmativa I for correta.

a) hipotnica e isotnico.
b) isotnica e hipotnico.
c) hipertnica e isotnico.
d) hipotnica e isotnico.
e) hipertnica e hipotnico.

2) (UFES-90) As molculas de glicose atravessam a


membrana celular das clulas intestinais, combinadas
com
molculas
de
protenas
transportadoras
denominadas
permeases.
Esse
processo

denominado:

6) (Un-BA-90) Um peixe tipicamente marinho


introduzido em um tanque contendo gua doce.
Analisando o balano osmtico, podemos dizer que:

a) transporte de massa.
b) difuso facilitada.
c) endocitose.
d) transporte ativo.
e) osmose.

a) o corpo do peixe perde gua para o meio externo.


b) a perda de gua do corpo do peixe para o meio
externo impedida pela presena de escamas e muco.
c) a gua do meio externo, menos concentrada, penetra
no corpo do peixe que mais concentrado.
d) a gua do meio externo, mais concentrada, penetra
no corpo do peixe que menos concentrado.
e) o corpo do peixe entra automaticamente em equilbrio
com a gua circundante, evitando a entrada ou a sada

3) Todas as clulas possuem uma membrana


plasmtica que separa o contedo protoplasmtico do
meio extracelular. A existncia e integridade da
membrana importante porque:
a) regula trocas entre a clula e o meio s permitindo a

55

Pr Vestibular Diferencial

BIOLOGIA
e) A gua acelera os processos mitticos, aumentando
a massa das batatas.

de gua.
7) (CESGRANRIO-83) Certos tipos de molculas
atravessam isoladamente a membrana plasmtica e
penetram no citoplasma. Tambm existem processos
nos quais grande quantidade de material passa para o
interior da clula. Sobre estes ltimos, assinale a opo
correta.

10) (UFRuRJ-95) Clulas vegetais plasmolisaram-se ao


entrar em contato com uma determinada soluo. Sobre
tal fenmeno pode-se dizer que:
a) na plasmlise o soluto move-se do meio hipotnico
para o hipertnico.
b) clulas trgidas plasmolisam-se quando entram em
contato com uma soluo hipotnica.
c) a soluo era hipertnica em relao concentrao
do suco celular.
d) plasmlise a perda de gua pela clula para uma
soluo hipotnica.
e) para ocorrer a deplasmlise necessrio submeter
as clulas a uma soluo hipertnica.

a) A transferncia de partculas visveis, tanto ao


microscpio ptico quanto ao eletrnico, para o interior
da clula conhecida pela denominao de
micropinocitose.
b) Fagocitose o termo utilizado para definir o
englobamento de pequenas quantidades de lquidos
pela superfcie da clula.
c) Na micropinocitose, para o englobamento de
partculas
ocorrem
depresses
na
membrana
plasmtica que se transformam em vesculas muito
pequenas, visveis somente ao microscpio eletrnico.
d) O englobamento de partculas slidas visveis, tanto
ao microscpio ptico quanto ao eletrnico, recebe a
denominao de pinocitose.
e) Em cultura de tecidos, as clulas demonstram uma
intensa atividade de englobamento de partculas
slidas, observveis somente ao microscpio eletrnico
e denominada de fagocitose.

11) (FESP-PE) prtica comum temperarmos a salada


com sal, pimenta-do-reino, vinagre e azeite. Porm,
depois de algum tempo, observamos que as folhas vo
murchando. Isto se explica porque:
a) o meio mais concentrado que as clulas.
b) o meio menos concentrado que as clulas.
c) o meio apresenta concentrao igual das clulas do
vegetal.
d) as clulas do vegetal ficam trgidas quando
colocadas em meio hipertnico.
e) por uma razo diferente das citadas acima.

8) (PUC-RJ-95) Trs funis, contendo substncias


diferentes, porm em mesmas quantidades, foram
colocados em um recipiente com uma determinada
soluo. Aps algum tempo, o nvel das substncias no
interior dos funis mostrava-se como no esquema abaixo:

12) (UFMG-MG) O esquema abaixo representa a


concentrao de ons dentro e fora dos glbulos
+
+
vermelhos. A entrada de K e a sada de Na dos
glbulos vermelhos pode ocorrer por:

a) transporte passivo.
b) plasmlise.
c) osmose.

Com base nestes dados, podemos afirmar que


a concentrao da soluo no recipiente :
a) 0,5 %
b) 1,0 %
c) 1,5 %
d) 2,0 %
e) 2,5 %

d) difuso.
e) transporte ativo.

13) (FGV-SP) Fagocitose :


a) englobamento de partculas slidas grandes pela
clula.
b) englobamento de partculas lquidas pela clula.
c) processo de formao de membranas.
d) um tipo de exocitose.
e) um mecanismo de difuso por membranas.

9) (Un. Guarulhos-95) Batatas, antes de serem fritas,


so imersas em gua com sal durante alguns minutos e
depois escorridas em papel absorvente. Alm de realar
o sabor, qual o efeito biolgico acarretado por essa
providncia?

14) (UFGO-GO) A incorporao de gotculas no


citoplasma, por invaginao da membrana plasmtica,
formando vesculas, denomina-se:

a) As batatas amolecem tornando-se mais fceis de


mastigar.
b) A gua com sal hidrata o alimento tornando-o mais
volumoso.
c) A gua lava o alimento e elimina as bactrias
alojadas nas clulas.
d) As batatas perdem gua, fritam melhor e tornam-se
mais crocantes.

a) fagocitose.
b) clasmocitose.
c) endocitose.

d) pinocitose.
e) plasmlise.

15)
(CESGRANRIO-RJ)
No
desenho
abaixo,
observamos trs tubos de ensaio contendo solues de
diferentes concentraes de NaCl e as modificaes

56

Pr Vestibular Diferencial

BIOLOGIA

sofridas pelas hemcias presentes em seu interior. Em


relao a este desenho, assinale a alternativa correta:

Parte IV: Sistema Reticular


1) (UF-SE) Considere as seguintes estruturas celulares:
I- retculo endoplasmtico.
II- complexo de Golgi.
III- grnulos de secreo.
A seqncia de estruturas em que seria encontrado um
aminocido radioativo, desde a entrada at sua sada
da clula, , respectivamente:
a) III, II, I
b) II, I , III
c) III, I, II
d) I, II, III
e) II, III, I

a) Em 1 a soluo isotnica em relao hemcia; em


2 a soluco hipertnica em relao hemcia e em 3
a soluo hipotnica hemcia.
b) As hemcias em 1 sofreram alterao de volume,
porm em 2 ocorreu plasmlise e em 3 turgncia.
c) Considerando a concentrao isotnica de NaCl = 0,9
%, a soluo 2 certamente possui uma concentrao de
NaCl inferior a 0,9 % e a soluo 3, uma concentra de
NaCl superior a 0,9 %.
d) As hemcias do tubo 2 sofreram perda de gua para
a soluo, enquanto as do tubo 3 aumentaram seu
volume, depositando-se no fundo.
e) A plasmlise sofrida pelas hemcias do tubo 2
ocorreu em razo da perda de NaCl para o meio.

2) (PUC-RJ) Um material sintetizado por uma clula


"empacotado" para ser secretado para o meio externo
no:
a) retculo endoplasmtico d) nuclolo
b) complexo de Golgi
e)vacolo secretor
c) lisossomo
3) (UFRS) Alm de armazenar secrees, como o suco
pancretico,
essa
organela
pode
sintetizar
polissacardios, como os que compoem o muco
intestinal, no homem.
A organela a que se refere o texto acima o:

Parte III: Citoplasma


1) (USC-94) O citoplasma de uma clula eucaritica
est compreendido no espao entre as membranas
nuclear e citoplasmtica. Sobre esse componente
celular, CORRETO afirmar:

a) ribossomo
b) ergastoplasma
c) retculo endoplasmtico
d) condrioma
e) complexo de Golgi

01. uma mistura complexa de substncias orgnicas e


inorgnicas.
02.
Ao
microscpio
eletrnico,
apresenta-se
heterogneo.
04. Existem, em seu interior, vrias organelas que
desempenham funes definidas.
08. Pode-se observar facilmente o seu movimento de
ciclose em clulas vegetais.
16. Todas as organelas citoplasmticas so comuns a
todas as clulas de todos os grupos de seres vivos.
32. No apresenta microtbulos em seu interior.
Assinale a opo que contem a soma das
afirmaes corretas:

4) (UNESP-91) A clula um estrutura que realiza suas


vrias funes de uma maneira dinmica.

a) 22
b) 18
c) 15
d) 61
e) 16
2) (PUC-SP) O termo ciclose empregado para
designar:

O esquema acima, de uma clula em atividade,


s NO mostra a:

a) movimentos citoplasmticos que no acarretam


alteraes da forma celular e que podem arrastar
determinadas estruturas e incluses.
b) uma estrutura circular dos cromossomos das
bactrias.
c) uma srie de movimentos circulares de hemceas em
torno de cogulos.
d) a formao de anis nos cromossomos de certas
moscas.
e) a propriedade dos leuccitos de atravessar paredes
de vasos sangneos e assim circular por entre os
tecidos.

a) correlao funcional existente entre organelas


celulares.
b) captura de substncias pela clula num processo
denominado endocitose.
c)
circulao
de
substncias
por
vesculas
membranosas da clula.
d) liberao de excreo lipdica para o meio
extracelular onde vo atuar.
e) produo, armazenagem e atuao de enzimas
digestivas.

57

Pr Vestibular Diferencial

BIOLOGIA

5) (UGF-93) O aspecto comum do Complexo de


Golgi em clulas animais, deduzido atravs de
observaes ao microscpio eletrnico, de:

a) nuclolo.
d) retculo endoplasmtico liso.
b) citosol.
e) retculo endoplasmico
rugoso.
c) citoesqueleto.

a) vesculas formadas por membrana dupla, a interna


sem granulaes e com dobras voltadas para o interior.
b) vesculas formadas por membrana dupla em que a
membrana interna, granulosa, emite prolongamentos em
forma de dobras para o interior.
c) membranas formando tubos anastomosados com
dilataes em forma de discos.
d) membranas lisas delimitando vesculas e sacos
achatados que se dispem paralelamente.
e) membranas granulosas delimitando vesculas e sacos
achatados que se dispem paralelamente.

11) (PUC-RJ) A sntese de protenas para exportao


em eucariontes acontece principalmente ao nvel de:
a) envoltrio nuclear.
b) ribossomos nucleares.
c) membranas do complexo de Golgi.
d) membranas do retculo endoplasmtico rugoso.
e) membranas do retculo endoplasmtico liso.
12) (PUC-RS) Na clula nervosa, ao contrrio do corpo
celular, o axnio no apresenta substncia de Golgi
nem retculo endoplasmtico rugoso. Alm disso h
pouqussimos ribossomos no axnio. O texto acima
permite deduzir que o axnio uma regio do neurnio
que:

6) (U. LONDRINA) Os grnulos que, ao microscpio


eletrnico, so vistos sobre o retculo endoplasmtico
so os:
a) ribossomos.
b) mitocndrios.
c) citocromos.
d) corpsculos de Golgi.
e) vacolos de pinocitose.

a) apresenta intensa sntese de lipdios.


b) dispe de numerosos grnulos glicdicos.
c) provavelmente inativa para sntese proteica.
d) apresenta uma intensa sntese de hormnios.
e) provavelmente muito ativa para sntese proteica.

7) (UECE) O ergastoplasma a regio formada por


cavidades tubulares, em cuja periferia situam-se
numerosos ribossomos, constituindo local de:
a) circulao celular
b) digesto proteica
c) sntese proteica

13) (PUC-SP) A estrutura apontada pela seta 1


derivada do(da) e chama-se, respectivamente:

d) respirao celular
e) sintese de lipdios

8) (UFRN) Uma clula animal que sintetiza, armazena e


secreta enzimas, dever ter bastante desenvolvidos o:
a) retculo endoplasmtico granular e o complexo de
Golgi.
b) retculo endoplasmtico agranular e o complexo de
Golgi.
c) retculo endoplasmtico granular e os lisossomos.
d) complexo de Golgi e os lisossomos.
e) complexo de Golgi e o condrioma.

a) do conjunto de lisossomos, acrossoma.


b) da membrana nuclear, peroxissomo.
c) do complexo de Golgi, acrossomo.
d) das mitocndrias, condrioma.
e) do complexo de Golgi, ergastoplasma.
Parte V: Lissosomos e Peroxissomos

9) (PUC-SP) A estrutura representada no desenho


abaixo :

1) (UNIVERSIDADE ESTADUAL DE LONDRINA-90)


Para que ocorra a digesto no interior de uma ameba,
necessrio que os fagossomos fundam-se a:
a) lisossomos.
b) mitocndrias.
c) ribossomos.
d) cinetossomos.
e) desmossomos.

a) o complexo de Golgi, corpsculo rico em cidos


nucleicos, presente no ncleo de clulas secretoras.
b) o complexo de Golgi, responsvel pela sntese de
enzimas da cadeia respiratria, presente no citoplasma
de vegetais inferiores.
c) a mitocndria, orgnulo responsvel pela respirao
celular.
d) o complexo de Golgi, que tem por funo armazenar
substncias a serem secretadas pela clula.
e) a mitocndria, orgnulo rico em DNA, RNA e
enzimas, preente tanto no ncleo como no citoplasma
das clulas secretoras.

2) (UNI-RIO-92) A utilizao racional da radioatividade


em vrios campos da pesquisa tem permitido a
compreenso de fenmenos importantes. Por exemplo,
possvel fornecer a uma cultura de clulas
aminocidos marcados com istopos radioativos e,
atravs de tcnicas especiais, acompanhar seu trajeto
na clula. Se isto for feito com um aminocido que entra
na composio das enzimas digestivas de um
macrfago, em que organela citoplasmtica haver
maior concentrao deste aminocido?
a) Mitocndria.
b) Ribossoma.
c) Retculo endoplasmtico liso.

10) (UFCE) A sntese de lipdios ocorre no:

58

Pr Vestibular Diferencial

BIOLOGIA
vacolo digestivo.
c) retculo endoplasmtico liso, ergastoplasma e
complexo de Golgi.
d) ribossomos, ergastoplasma e fagossomo.
e) ergastoplasma, complexo de Golgi e vacolo
digestivo.

d) Lisossoma.
e) Aparelho de Golgi.
3) (ASSOCIADO-91) Durante a metamorfose dos
anfbios, a cauda desaparece ao mesmo tempo em que
os seus constituintes celulares so digeridos e seus
produtos so utilizados no desenvolvimento do animal.
A organela que participa ativamente deste processo :

8) (UFRS) A organela celular que atua na regresso da


cauda dos girinos, durante a sua metamorfose,
denomina-se:

a) o lisossoma.
b) o peroxissoma.
c) a mitocndria.
d) o plasto.
e) o centrolo.

a) complexo de Golgi
b) condrioma
c) ergastoplasma

4) (PUC-RS) A inativao de todos os lisossomos de


uma clula afetaria diretamente a:

9) O processo de regresso da cauda dos girinos,


durante sua metamorfose denomina-se:

a) sntese proteica.
b) digesto intracelular.
c) sntese de aminocidos.
d) circulao celular.
e) secreo celular.

a) autofagia
b) autlise
c) autotrofia

I
sntese de protenas
sntese de acares
digesto intracelular

d)

sntese de protenas

e)

digesto intracelular

a) lisossomos.
b) mitocndrias.
c) centro celular

II
cloroplasto
cloroplasto
retculo
endoplasmtico
retculo
endoplasmtico
complexo de Golgi

d) complexo de Golgi
e) retculo endoplasmtico

11) O processo de destruio de organelas no interior


das clulas um processo chamado:
a) autofagia
b) autlise
c) autotrofia

d) hidrlise
e) citose

12) (PUC-RS) Certos tipos de leuccitos so atrados


pelas bactrias invasoras, sofrem mudans em sua
forma e englobam essas bactrias as quais destroem
por ao degradativa de enzimas. Esse fenmeno,
chamado fagocitose, somente se completar permitindo
a digesto do material englobado, desde que o vacolo
formado se una organela celular denominada:

6) (PUC-SP) Considere os seguintes eventos:


I- Fuso do fagossomo com lisossomo.
II- Atuao das enzimas digestivas.
III- Clasmocitose.
IV- Formao do fagossomo.
A seqncia correta em que esses eventos ocorrem no
processo de englobamento e digesto intracelular de
partculas em uma clula :
a) I - II - III - IV
b) II - I - III - IV
c) III - I - IV - II

d) hidrlise
e) citose

10) (FCMSC-SP) Nas clulas, a destruio de organelas


funo das organelas chamadas:

5) (UFSE) Qual a alternativa da tabela abaixo cujos


termos preenchem corretamente a frase seguinte?
Os lisossomos tm como funo
I
e so
produzidos na organela chamada
II .

a)
b)
c)

d) lisossomo
e) flagelo

a) ribossomo
b) microtbulo
c) lisossomo

d) IV - I - II - III
e) II - III - I - IV

d) microfilamento
e) peroxissomo

13) (Mackenzie -SP) Considere as seguintes funes


atribudas a uma organela celular:
I- Vescula com enzimas.
II- Realiza digesto de materiais endgenos e
exgenos
III- Forma-se a partir do complexo de Golgi.
Esta organela designada:

7) (FATEC-SP) O esquema a seguir representa


basicamente o processo da digesto intracelular. As
estruturas numeradas 1, 2, e 3 representam,
respectivamente:

a) lisossomo
b) mitocndria
c) dictiossomo

d) plasto
e) ribossomo

14) (U.C.MG) De acordo com o esquema a seguir, na


autlise ocorre:

a) ergastoplasma, fagossomo e vacolo digestivo.


b) retculo endoplasmtico liso, complexo de Golgi e

59

Pr Vestibular Diferencial

BIOLOGIA
nmero alto de mitocndrias nestas clulas pode ser
explicado porque as clulas hepticas:
a) so maiores que as demais clulas do corpo.
b) apresentam respirao aerbica.
c) tm grande atividade metablica.
d) tm volume citoplasmtico maior que o nuclear.
e) produzem enzimas digestivas em grande quantidade.
4) (PUC-RS) O microscpio eletrnico permite
constatar a presena de duas membranas, a externa
que lisa e a interna com invaginaes que se
apresentam sob a forma de cristas ou de tbulos. No
interior, formando uma espcie de recheio, encontra-se
uma substncia chamada matriz, muito rica em
protenas.
O texto acima descreva a estrutura tpica de:

a) danificao da membrana do nmero 5.


b) destruio da membrana do nmero 1.
c) no formao do nmero 2.
d) fuso dos nmeros 4 e 5.
e) rompimento da membrana do nmero 4.

a) ribossomo
b) mitocndria
c) peroxissomo

15) (Mackenzie-SP) Considere as seguintes funes


atribudas a uma organela celular:
I- Armazenamento de substncias.
II- Secreo celular.
III- Formao de lisossomas.

d) lisossomo
e) vacolo

5) (U.VAle dos Sinos-RS) Ao analisar os tecidos


conjuntivo e muscular, nota-se que esta organela celular
existe em maior nmero nas clulas musculares; isto
devido maior necessidade de
que estas clulas
apresentam para manter seu metabolismo que mais
acelerado.
A lacuna corretamente preenchida por:

Esta organela :
a) plasto.
b) mitocndria.
c) complexo golgiense.
d) retculo endoplasmtico.
e) vacolo.

a) sntese proteica
b) sntese de enzimas
c) sntese lipdica

Parte VI: Cloroplastos e Mitocndrias

d) sntese glicdica
e) sntese de ATP

6) (MOJI-SP) A liberao de O2 e a fixao de CO2


realizadas pelas plantas verdes representam as trocas
gasosas da:

1) (CESGRANRIO-91) Assinale a afirmativa correta


sobre a maneira como os seres vivos retiram a energia
da glicose.

a) respirao aerbica
d) transpirao
b) respirao anaerbica e) fermentao alcolica
c) fotossntese

a) O organismo, como precisa de energia rapidamente e


a todo tempo, faz a combusto da glicose em contato
direto com o oxignio.
b) Como a obteno de energia no sempre imediata,
ela s obtida quando a glicose reage com o oxignio
nas mitocndrias.
c) A energia, por ser vital para a clula, obtida antes
mesmo de a glicose entrar nas mitocndrias usando o
oxignio no citoplasma, com liberao de duas (02)
molculas de ATP (gliclise).
d) A energia da molcula de glicose obtida atravs da
oxidao dessa substncia pela retirada de hidrognios
presos ao carbono (desidrogenaes), que ocorre a
nvel de citoplasma e mitocndrias.
e) A obteno de molculas de ATP feita por enzimas
chamadas desidrogenases (NAD) depois que a
molcula de oxignio quebra a glicose parcialmente no
hialoplasma (gliclise).

7) (UNIFOR-CE) Os tilacides fazem parte dos:


a) cloroplastos
b) ribossomos
c) lisossomos

d) desmossomos
e) nuclolos

8) (UFRN) No interior de cloropastos e mitocndrias so


encontradas pequenas quantidades de DNA, RNA e
ribossomos. Tais componentes permitem que os
cloroplastos sejam capazes de realizar:
a) fluorescncia e sntese lipdica.
b) fotossntese e secreo celular.
c) autoduplicao e sntese proteica.
d) ciclo de Krebs e sntese de ATP.
e) fermentao anaerbica e sntese de clorofila.
9) (PUCCAMP-SP) Observe o esquema e na tabela a
seguir, assinale a alternativa que identifica corretamente
as organelas e os processos celulares representados
em I e II:

2) (PUCCAMP) As mitocndrias se originam a partir


a) dos centrolos.
b) do retculo endoplasmtico rugoso.
c) do retculo endoplasmtico liso
d) do complexo de Golgi.
e) de mitocndrias pr-existentes.
3) (PUC-RJ-95) Clulas do fgado possuem at duas mil
mitocndrias, ocupando cerca de 1/5 do seu volume. O

60

Pr Vestibular Diferencial

I
II
a) ribossomo - sntese mitocndria
de acares
respirao
b) cloroplasto
- ribossomo
fotossntese
respirao
c) cloroplasto
- mitocndria
fotossntese
respirao
d) mitocndria
- cloroplasto
respirao
fotossntese
e) mitocndria - sntese ribossomo
de acares
respirao

BIOLOGIA
relao com a locomoo de seres unicelulares.
c) Ambos so estruturas de funo idntica que se
distinguem por diferenas quanto ao tamanho e ao
nmero por clula.
d) Os clios determinam a movimentao de fluidos
extracelulares, o que no pode ser realizado pelos
flagelos.
e) O movimento flagelar ativo e consome energia, em
oposio ao movimento ciliar, que passivo e
provocado pelas correntes lquidas intracitoplasmticas.
4) Um clio cortado transversalmente e examinado ao
microscpio eletrnico revela em seu interior:

a) uma fibra central


b) duas microfibrilas centrais e dezoito perifricas
c) cinco microfibrilas centrais
d) onze microfibrilas centrais e outras perifricas
e) nove trios de microtbulos perifricos

5) )PUC) Os orgnulos celulares em questo podem ser


encontrados, ao mesmo tempo, em uma:

10) (UNI-RIO) Cientistas propem a hiptese de que


certas organelas originaram-se de organismos que h
mais de um bilho de anos passaram a viver
simbionticamente com eucariotos antigos. Apiam-se no
fato de que essas organelas possuem DNA prprio,
semelhante ao das bactrias, podendo-se auto-replicar.
Essas organelas so:

a) hemcia humana.
b) clula bacteriana.
c) clula meristemtica de uma
angiosperma.
d) clula embrionria de um
mamfero.
e) clula de cianofcea.

a) mitocndrias e ribossomos.
b) mitocndrias e cloroplastos.
c) mitocndrias e dictiossomos.
d) dictiossomos e cloroplastos.
e) dictiossomos e cloroplastos.

Parte VIII: Ncleo e cromossomos


1) (UFRN-90) A carioteca formada por:

Parte VII: Organelas no-membranosas

a) duas membranas proteicas com poros.


b) uma membrana proteica sem poros.
c) uma membrana lipoproteica com poros.
d) duas membranas lipoproteicas com poros.
e) duas membranas lipoproteicas sem poros.

1) (CESGRANRIO-RJ) O desenho abaixo corresponde a


um corte transversal da ultra-estrutura de:

2) Acerca do ncleo interfsico, assinale a alternativa


incorreta:

a) microvilosidade.
b) clio ou flagelo.
c) axnio.

a) A cromatina que se encontra desespiralizada


denominada eucromatina.
b) O nuclolo verdadeiro ou plasmossomo representa
um local de sntese de RNA ribossmico.
c) O nuclolo falso representa um acmulo de
heterocromatina, pois um novelo de cromonemas.
d) Os cromossomos so visveis como longos
filamentos espiralizados e corados por corantes cidos.
e) A carioteca uma grande bolsa achatada que
delimita o nucleossomo.

d) estereoclio
e) pseudpodo

2) (UFAC) A movimentao em meio lquido, captura de


alimento ou limpeza de superfcie so problemas que
podem ser resolvidos por clulas dotadas de flagelos
(espermatozides humanos) ou de clios (Paramecium,
protozorio de gua doce). A organela capaz de originar
os clios e os flagelos denominada:
a) microfilamento.
b) centrolo.
c) nuclolo.

3) (UFES-94) Uma clula humana, com caritipo de 46


cromossomas e quantidade de DNA equivalente a 5.6
picogramas (pg), apresentar na fase inicial da
metfase da mitose, respectivamente, um caritipo e
uma quantidade de DNA correspondente a:

d) ncleo.
e) cromossomo.

3) (CESGRANRIO-RJ) A propsito de clios e flagelos


correto afirmar:

a) 23 e 5.6 pg.
b) 23 e 11.2 pg.
c) 46 e 11.2 pg.
d) 92 e 5.6 pg.
e) 92 e 11.2 pg.

a) Os clios so responsveis pela locomoo de


procariontes e os flagelos, de eucariontes.
b) S se encontram os clios em relao com o
movimento vibrtil de clulas fixas e os flagelos em

61

Pr Vestibular Diferencial

BIOLOGIA

4) A cromatina, presente no ncleo interfsico, aparece


durante a diviso celular com uma organizao
diferente, transformando-se nos:
a) crommeros
b) cromossomos
c) centrmeros

d) cromocentros
e) cromonemas
I e II indicam:

5) Na aula de Biologia o grande Prof. Ricardo fez a


seguinte afirmao: A produo de ribossomos
depende,
indiretamente,
da
atividade
dos
cromossomos.
Em seguida pediu a seus alunos que
analisassem a afirmao e a explicassem. Foram
obtidas cinco explicaes diferentes, que se encontram
abaixo citadas
Assinale a nica explicao correta:

a) cromtides-irms
b) cromtides homlogas
c) cromossomos homlogos
d) cromossomos-no-homlogos
e) cromossomos-filhos
11)
(U.F.UBERLNDIA-MG)
Com
respeito
cromossomo abaixo esquematizado, sabemos que:

a) Os cromossomos so constitudos essencialmente


por RNA ribossmico e protenas, material utilizado na
produo de ribossomos.
b) Os cromossomos so constitudos essencialmente
por RNA mensageiro e protenas, material utilizado na
produo de ribossomos.
c) Os cromossomos contm DNA; este controla a
sntese de ribonucleoprotenas que formaro o nuclolo
e que, posteriormente, faro parte dos ribossomos.
d) Os cromossomos so constitudos essencialmente
por RNA transportador e protenas, material utilizado na
produo de ribossomos.
e) Os cromossomos, produzidos a partir do nuclolo,
fornecem material para a organizao dos ribossomos.

a) o nmero 1 indica a constrio secundria.


b) ele do tipo metacntrico.
c) o nucleotdio est indicado pelo nmero 2.
d) o nmero 3 indica o telmero.
e) o centrmero est indicado pelo nmero 4.
12) (FUC-MT) Dados os esquemas de cromossomos,
podemos classific-los, conforme a posio do
centrmero:

6) (CESGRANRIO-RJ) Dos constituintes celulares


abaixo relacionados, qual est presente somente nos
eucariontes e representa um dos critrios utilizados para
distingui-los dos procariontes?
a) DNA.
b) Membrana celular.
c) Ribossomo.

d) Envoltrio nuclear.
e) RNA.
a) Os cromossomos I e II so metacntricos e o III
submetacntrico.
b) Os cromossomos I e III so metacntricos e o II
acrocntrico.
c) Os cromossomos I, II e III so metacntricos.
d) Apenas o cromossomo III metacntrico.
e) Os cromossomos I, II e III so, respectivamente,
metacntrico, submetacntrico e acrocntrico.

7) (UFRO) Qual das seguintes estruturas celulares


responsvel pela formao dos ribossomos?
a) Retculo endoplasmtico
b) Complexo de Golgi
c) Centrolo
d) Nuclolo
e) Lisossomo

13) (UFPA) Clula diplide aquela em que:

8) (CESCEM-SP) Os nuclolos originam-se:

a) existem dois cromossomos no-homlogos.


b) o caritipo formado por dois conjuntos haplides.
c) o caritipo formado por dois conjuntos diplides.
d) cada cromossomo apresenta dois centrmeros.
e) No existe tal clula.

a) de invaginaes da membrana celular


b) da diviso de outros nuclolos
c) da solidificao do suco nuclear
d) da concentrao de ribossomos
e) de cromossomos especiais

14) (FUVEST-SP) Em determinada espcie animal, o


nmero diplide de cromossomos 22. Nos
espermatozides, nos vulos e nas clulas epidrmicas
dessa espcie sero encontrados, respectivamente:

9) (F.C.CHAGAS-BA) Nas clulas em intrfase, o


material gentico aparece na forma de:
a) carioteca
b) fuso acromtico
c) nuclolo

ao

d) cromatina
e) cariolinfa

a) 22, 22 e 44 cromossomos.
b) 22, 22 e 22 cromossomos.
c) 11, 11 e 22 cromossomos.
d) 44, 44 e 22 cromossomos.
e) 11, 22 e 22 cromossomos.

10) (FCC-SP) Observe o esquema abaixo:

62

Pr Vestibular Diferencial

BIOLOGIA

15) (UFES) A pironina cora especificamente o RNA. Se


corarmos clulas com esse corante, aparecem como
estruturas pironinoflicas:

e) Na fase da telfase, forma-se uma nova membrana


nuclear em torno dos cromossomos e o citoplasma se
divide.

a) cromatina e retculo endoplasmtico liso.


b) retculo endoplasmtico granuloso e retculo liso.
c) nuclolo e cromatina.
d) nuclolo e retculo endoplasmtico granuloso.
e) lisossomos e retculo endoplasmtico rugoso.

6) (F.Itaquerense-SP) O grfico abaixo revela a


variao de DNA durante as diversas fases da vida
celular. Com relao ao grfico, correto afirmar que:

(Quantidade de DNA por ncleo)

Parte IX: Diviso celular

2C
1) (UF-GO)

C
G1

Intrfase
Relacione as fases da mitose: anfase, telfase,
metfase e prfase, com os respectivos nmeros das
figuras acima:

G2
Mitose

G1

Intrfase

a) durante o perodo G1, a clula realiza uma intensa


sntese de DNA.
b) no decorrer do perodo S, a quantidade de DNA
aumenta progressivamente e ocorre a duplicao do
DNA.
c) no fim da Intrfase, a clula tem uma quantidade de
DNA menor que no seu incio.
d) no perodo de mitose propriamente dito, a
quantidade de DNA mantm-se constante.
e) nos perodos de G1 e S, a quantidade de DNA
mantm-se constante.

a) 4 - 3 - 2 - 1
b) 3 - 4 - 2 - 1
c) 1 - 2 - 3 - 4
d) 2 - 3 - 4 - 1
e) 3 - 1 - 2 - 4
2) (UF-PA) Qual o constituinte cromossmico
diretamente relacionado com seu movimento durante a
diviso celular?
a) telmero
b) crommero
c) centrmero
d) cromtide
e) intrfase

7) (FUVEST) Uma clula somtica que tem 4


cromossomos, ao se dividir, apresenta na metfase:
a) 4 cromossomos distintos, cada um com uma
cromtide.
b) 4 cromossomos distintos, cada um com duas
cromtides.
c) 4 cromossomos, pareados 2 a 2, cada um com duas
cromtides.
d) 4 cromossomos, pareados 2 a 2, cada um com uma
cromtide.
e) 2 cromossomos, cada um com duas cromtides.

3) (UF-RN) A conseqncia mais importante da mitose


:
a) determinar a diferenciao celular.
b) a produo de gametas e esporos haplides.
c) a produo de clulas iguais clula me.
d) aumentar a variabilidade gentica dos seres vivos.
e) aumentar a taxa de mutao.

8) (PUC-SP) A maioria das reaes qumicas da clula,


incluindo a duplicao de DNA, a sntese de RNA e a
produo
de
protenas
celulares,
ocorre,
principalmente, durante a:

4) (CAC/FETA) Espiralizao da cromatina, duplicao


dos centrolos e formao do fuso so ocorrncias
mitticas. Assinale a fase em que isto ocorre.

a) prfase.
b) metfase.
c) anfase.

a) metfase
b) anfase
c) telfase
d) prfase
e) intrfase

d) telfase.
e) intrfase.

9) (FUVEST) A figura a seguir representa o tecido


meristemtico de uma planta, onde podem ser
observadas clulas em diferentes fases de diviso.
Qual das alternativas corresponde seqncia do
processo mittico?

5) (UFRO-RO) Os tens abaixo se referem mitose e


todos eles esto corretos, exceto:
a) um processo de diviso celular importante para o
crescimento dos organismos.
b) Ocorre nas clulas somticas de animais e vegetais.
c) Uma clula-me origina duas clulas-filhas com o
mesmo nmero de cromossomos.
d) A duplicao do DNA ocorre na fase da metfase.

63

Pr Vestibular Diferencial

BIOLOGIA
e) "crossing-over"
14) (UFPE) Uma evidente diferena existente entre a
anfase da mitose e as anfases I e II da meiose que
os cromossomos em migrao para os plos celulares
so:
a) irmos nas anfases I e II e homlogos na anfase
da mitose.
b) homlogos nas anfases I e II e irmos na anfase
da mitose.
c) homlogos na anfase I e irmos na anfase II e na
anfase da mitose.
d) irmos na anfase I e anfase da mitose e
homlogos na anfase II.
e) irmos nas anfases I e II e anfase da mitose.

a) a  b  c  d  e  f
b) c  f  e  a  b  d
c) f  b  a  e  d  c
d) e  f  c  a  b  d
e) f  e  c  b  d  a

15) (U.TAUBAT-SP) Assinale a frase errada, em


relao meiose:

10) (STA.CASA) A colchicina uma substncia que


despolimeriza as fibras do fuso de diviso, impedindo
que este se forme. Em um meio de cultura foram
colocadas 5 clulas, em diferentes estgios do ciclo
celular: duas estavam em intrfase, duas estavam em
prfase e a ltima estava em telfase. Imediatamente
depois colocou-se colchicina. Aps um certo tempo,
contando-se as clulas presentes em tal meio, esperase encontrar um total de quantas clulas?
a) seis.
b) sete.
c) oito

a) Os cromossomos j entram duplicados na prfase I.


b) A formao das ttrades ocorre no paquteno.
c) A permutao nada mais do que a troca de
segmentos entre cromtides-irms
d) O quiasma, figura observada no diplteno,
conseqncia da permutao.
e) Na metfase I, a placa equatorial est formada por
pares de cromossomos.

d) nove.
e) dez.

16) (UC-PR) Quando uma clula conclui a sua primeira


diviso meitica, resultam:
a) duas clulas diplides.
b) quatro clulas diplides.
c) quatro clulas haplides.
d) duas clulas haplides.
e) duas clulas somticas.

11) (PUC-SP)
Considerando uma clula com 6
cromossomas (2n=6) que esteja em diviso, o esquema
ao lado representaria uma:
a)
anfase
I
meiose.
b) metfase I
meiose.
c) metfase II
meiose.
d) anfase II
meiose.
e) anfase mittica.

da

17) (UFGO) Relacione as fases meiticas (coluna I) com


os respectivos fenmenos (coluna II):
Colu Coluna II
na I
1)
( ) Migrao dos cromossomos homlogos
zigt para
eno
os plos
2)
( ) pareamento dos homlogos
paqu
teno
3)
(
) migrao dos cromossomos irmos
diplt para
eno
os plos.
4)
(
) visualizao dos quiasmas.
anfa
se I
(
) ocorrncia do crossing-over
5)
anfa
se II

da
da
da

12) (INST. TOLEDO) A ordem correta das subfases da


prfase :
a) leptteno
diacinese.
b) leptteno
diacinese.
c) leptteno
diacinese.
d) leptteno
diacinese.
e) leptteno
diacinese.

- paquteno - zigteno - diplteno - diplteno - zigteno - paquteno - diplteno - paquteno - zigteno - paquteno - diplteno - zigteno - zigteno - paquteno - diplteno -

A seqncia correta, de cima para baixo, na coluna II


a) 4, 1, 2, 3, 5
b) 4, 1, 5, 2, 3
c) 4, 1, 5, 3, 2

13) (CESGRANRIO) Durante a prfase da primeira


diviso meitica, ocorre a troca de fragmentos entre
cromossomas homlogos, possibilitando uma maior
variabilidade gentica. A esse evento d-se o nome de:

d) 4, 1, 3, 2, 5
e) 4, 2, 5, 1, 3

18) (CESGRANRIO) Sabe-se que a seqncia da


espermatognese a seguinte:
espermatognia  espermatcito I  espermatcito II
 espermtide  espermatozide.

a) formao de bivalentes.
b) formao de ttrades.
c) citocinese.
d) intercinese.

64

Pr Vestibular Diferencial

BIOLOGIA
GABARITO

Pergunta-se quantos espermatozides sero


produzidos, respectivamente, a partir de 100
espermtides e 100 espermatcitos I.
a) 400 e 400
b) 400 e 100
c) 100 e 800

Parte
I
Estrutura
membrana
12D
C
11- 12E
C

d) 200 e 400
e) 100 e 400

19) Assinale a alternativa correta:

da
3A
13C

4D

5C

6B

7E

8B

9E

10D

4C
14D

5E
15C

6C

7C

8B

9D

10C

6A

7C

8A

9D

10D

5E
15C

6D

7E

8D

9B

10A

5E

6C

7A

8C

9C

10B

5C
15D

6D

7D

8D

9D

10A

5E
15C

6B
16D

7B
17C

8E
18E

9B
19B

10A
20D

a) No perodo de diferenciao da ovognese ocorrem


transformaes maiores do que no mesmo perodo, na
espermatognese.
b) Os ovcitos primrios so bem maiores do que os
espermatcitos primrios.
c) O perodo germinativo na mulher dura quase toda a
vida.
d) No perodo de diferenciao da espermatognese o
complexo de Golgi modifica-se, originando a cauda do
espermatozide.
e) As divises celulares que ocorrem nas
gametogneses so todas meiticas.

Parte
II
Fisiologia
membrana
12A
B
11- 12A
E

20) (UNIFICADO-94) A figura abaixo caracterstica da


Meiose porque s nesse tipo de diviso celular
acontece:

Parte IV Sistema
Reticular
12345D
B
E
D
D
11- 12- 13D
C
C

da
3B
13A

Parte
III
Citoplasma
21C
A

Parte
V
Lisossomas
peroxissomas
123A
D
A
11- 12- 13A
C
A

a) separao dos centrolos.


b) formao do fuso acromtico.
c) manuteno da carioteca.
d) pareamento dos cromossomos homlogos.
e) duplicao das cromtides.

Parte
VI
Cloroplastos
mitocndrias
123D
E
C

21) (INTEGRADO-97) Considerando que uma espcie


possua n de cromossomas nas clulas somticas
2n=6, a clula apresentada na figura abaixo evidencia
esses cromossomas em:

Parte
VII
Organelas
membranosas
123B
B
C

a) metfase mittica.
b) metfase I.
c) metfase II.
d) anfase mittica.
e) anfase II.

e
4B
14E

e
4B

no4B

Parte VIII Ncelo e


cromossomas
1234D
D
C
B
11- 12- 13- 14A
E
B
C

22) (FATEC-SP) Das afirmativas abaixo:


I- O crossing-over permite a recombinao dos
genes localizados em cromossomos homlogos.
II- Meiose um tipo de diviso celular na qual
uma clula diplide d origem a quatro clulas
haplides.
III- A intrfase um perodo de grande
atividade metablica no ncleo. nessa fase que o
DNA se duplica e o RNA sintetizado.

Parte
IX

Diviso celular
123B
C
C
11- 12- 13A
E
E
21- 22D
E

a) apenas a afirmativa I correta.


b) apenas a afirmativa II correta.
c) apenas a afirmativa III correta.
d) apenas duas afirmativas so corretas.
e) todas as afirmativas so corretas.

65

4D
14C

5D

Pr Vestibular Diferencial

BIOLOGIA

EXERCCIO DE GENTICA
3

Parte I: 1 Lei de Mendel

Baseando-se na genealogia, podemos afirmar:


1) Em urtigas o carter denteado das folhas domina o
carter liso. Numa experincia de polinizao cruzada,
foi obtido o seguinte resultado: 89 denteadas e 29 lisas.
A provvel frmula gentica dos cruzantes :

a) O albinismo um carter dominante, sendo os


indivduos albinos todos homozigotos.
b) O albinismo um carter dominante, sendo os
indivduos albinos todos heterozigotos.
c) O albinismo um carter recessivo, sendo os
indivduos de nmeros 2 e 6 ( no grfico ) heterozigotos.
d) O albinismo um carter recessivo, sendo os
indivduos normais todos heterozigotos.
e) O albinismo um carter dominante porque o
indivduo de nmero 4 albino e filho de pais normais.

a) Dd x dd
b) DD x dd
c) Dd x Dd
d) DD x Dd
e) DD x DD
2) Se um rato cinzento heterozigtico for cruzado com
uma fmea do mesmo gentipo e com ela tiver
dezesseis descendentes, a proporo mais provvel
para os gentipos destes ltimos dever ser:

7) (UFPR-83) Um retrocruzamento sempre significa:


a) cruzamento entre dois heterozigotos obtidos em F1.
b) cruzamento entre um heterozigoto obtido em F1 e o
indivduo dominante da gerao P.
c) cruzamento de qualquer indivduo de F2 com qualquer
indivduo de F1.
d) cruzamento entre um heterozigoto de F1 e o indivduo
recessivo da gerao P.
e) cruzamento de dois indivduos de F2.

a) 4 Cc : 8 Cc : 4 cc
b) 4 CC : 8 Cc : 4 cc
c) 4 Cc : 8 cc : 4 CC
d) 4 cc : 8 CC : 4 Cc
e) 4 CC : 8 cc : 4 Cc
3) De um cruzamento de boninas, obteve-se uma
linhagem constituda de 50 % de indivduos com flores
rseas e 50 % com flores vermelhas. Qual a provvel
frmula gentica dos parentais?

8) Podemos dizer que o fentipo de um indivduo


dado por suas caractersticas:
a) unicamente morfolgicas.
b) morfolgicas e fisiolgicas apenas.
c) estruturais, funcionais e comportamentais.
d) herdveis e no herdveis.
e) hereditrias

a) VV x BB
b) VB x VB
c) VB x VV
d) VB x BB
e) BB x BB

9) (Fac. Objetivo-SP) Em camundongos o gentipo aa


cinza; Aa amarelo e AA morre no incio do
desenvolvimento embrionrio. Que descendncia se
espera do cruzamento entre um macho amarelo com
uma fmea amarela?

4)
(PUCSP-83) Em relao anomalia gnica
autossmica recessiva albinismo, qual ser a proporo
de espermatozides que conter o gene A em um
homem heterozigoto?

a) 1/2 amarelos e 1/2 cinzentos


b) 2/3 amarelos e 1/3 cinzentos
c) 3/4 amarelos e 1/4 cinzentos
d) 2/3 amarelos e 1/3 amarelos
e) apenas amarelos

a) 1/2
b) 1/4
e) 1
c) 1/8
d) 1/3
e) 1

10) A 1 lei de Mendel considera que:

5) (UFC-CE-83) Olhos castanhos so dominantes sobre


os olhos azuis. Um homem de olhos castanhos, filho de
pai de olhos castanhos e me de olhos azuis, casa-se
com uma mulher de olhos azuis. A probabilidade de
que tenham um filho de olhos azuis de:

a) os gametas so produzidos por um processo de


diviso chamado meiose.
b) na mitose, os pares de fatores segregam-se
independentemente.
c) os gametas so puros, ou seja, apresentam apenas
um componente de cada par de fatores considerado.
d) o gene recessivo se manifesta unicamente em
homozigose.
e) a determinao do sexo se d no momento da
fecundao.

a) 25%
b) 50%
c) 0%
d) 100%
e) 75%

11) Um homem de aspecto exterior normal, casado com


uma mulher normal, tem 11 filhos, todos normais. O seu
irmo gmeo, univitelino, tem 6 filhos normais e dois
albinos. Qual o gentipo dos dois irmos e das duas
mulheres?

6) (FEEQ-CE-79) O heredograma representado abaixo


refere-se a uma famlia com casos de albinismo
(anomalia que se caracteriza por total ausncia do
pigmento melanina na pele).
1

66

Pr Vestibular Diferencial

BIOLOGIA

a) irmos (Aa), 1 mulher (AA) e 2 mulher (Aa ou aa)


b) irmos (AA e Aa), 1 mulher (Aa) e 2 mulher (Aa ou
aa)
c) irmos (AA), 1 mulher (AA) e 2 mulher (Aa ou aa)
d) irmos (AA), 1 mulher (AA ou Aa) e 2 mulher (Aa)
e) irmos (Aa), 1 mulher (Aa) e 2 mulher (AA)
12) Quando o heterozigoto apresenta um fentipo
intermedirio entre os dois homozigotos, dizemos que
houve:

a) os indivduos afetados sempre so homozigotos.


b) os indivduos normais sempre so heterozigotos.
c) os indivduos heterozigotos so apenas de um dos
dois sexos.
d) pais normais originam indivduos homozigotos
recessivos.
e) pais normais originam individuos heterozigotos.

a) mutao reversa
b) no-dominncia ou co-dominncia
c) recessividade
d) dominncia
e) polialelia

17) (PUC-SP) A determinao da cor do caju (vermelha


ou amarela) devida a um par de genes alelos. O gene
dominante determina cor vermelha. Um cajueiro
proveniente de semente heterozigota dever produzir:

13) Identifique entre as caractersticas mencionadas


abaixo aquela que no hereditria.
a) cor dos cabelos.
b) conformao dos olhos, nariz e boca.
c) cor dos olhos.
d) deformidade fsica acidental.
e) hemofilia.

a) cajus vermelhos, vermelho-amarelados e amarelos,


na proporo de 1:2:1.
b) cajus vermelhos e amarelos, na proporo de 3:1.
c) cajus vermelhos e amarelos, na proporo de 1:1.
d) apenas cajus amarelos.
e) apenas cajus vermelhos.

14) (UFPA) Usando seus conhecimentos de


probabilidade, Mendel chegou s seguintes concluses,
com exceo de uma delas. Indique-a:

18) (F. OBJETIVO-SP-83) A genealogia anexa refere-se


a uma famlia com casos de alcaptonria, anomalia
provocada por um gene recessivo.

a) H fatores definidos (mais tarde chamados genes)


que determinam as caractersticas hereditrias.
b) Uma planta possui dois alelos para cada carter os
quais podem ser iguais ou diferentes.
c) Os alelos se distribuem nos gametas sem se
modificarem e com igual probabilidade.
d) Na fecundao, a unio dos gametas se d ao acaso,
podendo-se prever as propores dos vrios tipos de
descendentes.
e) Os fatores (genes) responsveis pela herana dos
caracteres esto localizados no interior do ncleo, em
estruturas chamadas cromossomos.

10

Nesta genelalogia os gentipos que no podem ser


determinados so os dos indivduos:

15) O albinismo, a ausncia total de pigmento devido


a um gene recessivo. Um homem e uma mulher
planejam se casar e desejam saber qual a probabilidade
de terem um filho albino. O que voc lhes diria se ( a )
embora ambos tenham pigmentao normal, cada um
tem um genitor albino; ( b ) o homem um albino, a
mulher normal mas o pai dela albino; ( c ) o
homem albino e na famlia da mulher no h albinos
por muitas geraes. As respostas para estas trs
questes, na seqncia em que foram pedidas, so:

a) 1, 2 e 5
b) 1, 3 e 6
c) 3, 5 e 6
d) 3, 8 e 10
e) 7, 8 e 10
19) (FUCMT-MS-83) Nos coelhos, a cor preta dos plos
dominante em relao cor branca. Cruzaram-se
coelhos pretos heterozigotos entre si e nasceram 360
filhotes. Destes, o nmero de heterozigotos
provavelmente :

a) 50%; 50%; 100%


b) 25%; 50%; 0%
c) 100%; 50%; 0%
d) 0%; 25%; 100%
e) 25%; 100%; 10%

a) zero
b) 90
c) 180
d) 270
e) 360

16) (UFBA) No heredograma a seguir, os smbolos em


preto representam indivduos afetados pela polidactilia e
os smbolos em branco, indivduos normais. Conclui-se,
desse heredograma, que, em relao polidactilia:

20) No monohibridismo com dominncia intermediria


(semidominncia ou co-dominncia), as propores
sero,
genotpicas
e
fenotpicas,
em
F2 ,
respectivamente:
a) 3:1 e 1:2:1

67

Pr Vestibular Diferencial

BIOLOGIA
creme e amarelo). Uma rainha, de olho marrom, porm
heterozigota para prola, produziu 500 ovos e foi
inseminada por espermatozides que portavam em
iguais propores os cinco alelos. Toda a descendncia
tem a mesma oportunidade de sobrevivncia, porm a
fertilizao ocorreu em 30% dos ovos somente.
Qual o nmero esperado de machos que tero
cor de olho marrom?

b) 3:1 e 3:1
c) 1:2:1 e 3:1
d) 1:2:1 e 1:2:1
e) 1:3:1 e 3:2
21) (UECE) Um grupo de coelhos de mesmo gentipo
foi mantido junto em uma gaiola e produziu 27 animais
de colorao escura para 9 de colorao clara.
Admitindo-se para C o gene dominante e c para o gene
recessivo, qual o gentipo dos animais, respectivamente
para machos e fmeas?

a) 75
b) 150
c) 175
d) 220
e) 250

a) CC x cc
b) Cc x CC
c) cc x cc
d) CC x CC
e) Cc x Cc

2) (FUVEST-SP) Considerando-se um locus gnico que


apresente trs tipos de alelos alternativos (alelos
mltiplos), quantos tipos diferentes de gentipos podem
ocorrer numa populao diplide?

22) (UFSCAR) Que fentipo?


a) o conjunto de caractersticas decorrentes da ao
do ambiente.
b) Influi no gentipo, transmitindo a este as suas
caractersticas.
c) o conjunto de caractersticas decorrentes da ao
do gentipo.
d) o conjunto de caractersticas de um indivduo.
e) o conjunto de caracteres exteriores de um
indivduo.

a) 3
b) 6
c) 8
d) 9
e) 12

23) (FUVEST-SP) Dois genes alelos atuam na


determinao da cor das sementes de uma planta: A,
dominante, determina a cor prpura e a, recessivo,
determina a cor amarela. A tabela abaixo apresenta
resultados de vrios cruzamentos feitos com diversas
linhagens dessa planta:

a) selvagem 50% - chinchila 25% - albino 25%


b) selvagem, chinchila, himalaia e albino - 25% cada
c) selvagem 50% - chinchila 25% - himalaia 25%
d) selvagem 25% - chinchila 50% - himalaia 25%
e) Nenhum dos itens correto.

CRUZAMENTO
I x aa
II x aa

RESULTADO
100% prpura
50%
prpura;
amarela
100% amarela
75%
prpura;
amarela

III x aa
IV x Aa

3) Qual a prole de um coelho selvagem


heterozigoto para himalaia com uma fmea chinchila
heterozigota para albina?

4) (UFPA-PA) Os grupos sanguneos ABO representam


um exemplo de:
a) herana polignica
b) polimeria
c) pseudo-alelismo
d) interao gnica
e) alelos mltiplos

50%

25%

5) Se um macho aguti, filho de um aguti com um


himalaio (ambos homozigotos), cruzar com uma fmea
ch a
chinchila (c c ), produzir coelhos com todos os
fentipos a seguir, exceto:

Apresentam gentipo Aa as linhagens:


a) I e II
d) I e IV

b) II e III
e) III e IV

c) II e IV

a) aguti.
b) himalaio.
c) chinchila.
d) albino.
e) himalaio e albino.

24) (MED. SANTO AMARO) Do primeiro cruzamento de


um casal de ratos de cauda mdia nasceram dois
ratinhos de cauda mdia e um ratinho de cauda longa.
Foram ento feitas vrias suposies a respeito da
transmisso da herana desse carter. Assinale a que
lhe parecer mais correta.

Parte III: Grupos Sangneos

a) Cauda mdia dominante sobre cauda longa.


b) Ambos os pais so homozigotos.
c) Ambos os pais so heterozigotos.
d) Cauda longa dominante sobre cauda mdia.
e) As suposies a e c so aceitveis.

1) (MED. ITAJUB) Num banco de sangue foram


selecionados os seguintes doadores: grupo AB - 5;
grupo A - 8; grupo B - 3; grupo O - 12. O primeiro pedido
de doao partiu de um hospital que tinha dois
pacientes nas seguintes condies:
Paciente I: possui ambos os tipos de aglutininas no
plasma.
Paciente II: possui apenas um tipo de antgeno nas
hemceas e aglutinina b no plasma.
Quantos doadores estavam disponveis para os
pacientes I e II, respectivamente?

Parte II: Alelos Mltiplos


1) (SANTA CASA) Admita que em abelhas a cor dos
olhos condicionada geneticamente por uma srie
allica constituda por 5 genes, sendo o alelo selvagem
(marrom) dominante sobre os demais (prola, neve,

68

Pr Vestibular Diferencial

BIOLOGIA
nascido) preciso que o pai, a me e o filho tenham
respectivamente, os tipos sanguneos:

a) 5 e 11
b) 12 e 12
c) 8 e 3
d) 12 e 20
e) 28 e 11

a) Rh+, Rh-, Rh+


b) Rh+, Rh-, Rhc) Rh+, Rh+, Rh+
d) Rh+, Rh+, Rhe) Rh-, Rh+, Rh+

2) (UFPA)
Uma mulher recebeu uma transfuso
sangnea. Seu primeiro filho nasce com eritroblastose
fetal. Classifique, quanto ao grupo sangneo Rh , a
mulher, seu marido, a criana e o sangue que a mulher
recebeu na transfuso:
a)
b)
c)
d)
e)

7) (UFPA-PA) Os grupos sanguneos ABO representam


um exemplo de:
a) herana polignica
b) polimeria
c) pseudo-alelismo
d) interao gnica
e) alelos mltiplos

Rh-, Rh+, Rh-, RhRh-, Rh+, Rh+, Rh+


Rh-, Rh+, Rh-, Rh+
Rh-, Rh-, Rh+, RhRh+, Rh-, Rh-, Rh+

8) (FUCMT-MS) O av paterno de uma mulher pertence


ao grupo sangneo AB e todos os outros avs so do
grupo O. Qual a probabilidade de esta mulher ser do
grupo AB?

3) (PUCC-SP) Mariazinha, criana abandonada, foi


adotada por um casal. Um ano mais tarde, Antnio e
Joana, dizendo serem seus verdadeiros pais, vm
reclamar a filha. No intuito de comprovar a veracidade
dos fatos, foi exigido um exame do tipo sangneo dos
supostos pais, bem como de Mariazinha. Os resultados
foram:

a) nula
b) 25%
c) 50%
d) 75%
e) 100%

Antnio B, Rh+; Joana A, Rh-; Mariazinha O, Rh-.


Voc concluiria que:
a) Mariazinha pode ser filha de Joana, mas no de
Antnio.
b) Mariazinha no filha do casal.
c) Mariazinha filha do casal.
d) Existe a possibilidade de Mariazinha ser filha do
casal, mas no se pode afirmar.
e) Mariazinha pode ser filha de Antnio, mas no de
Joana.

9) (MED.ABC) Considere as duas situaes seguintes:


I O sangue de uma macaco do gnero Rhesus
(indivduo 1) foi injetado em uma cobaia (indivduo 2).
Uma hora depois, dela foi extrada certa quantidade de
sangue, cujo soro foi removido. Ocorreu hemlise nas
hemcias quando se misturou parte desse soro com o
soro de um indivduo (3) da espcie humana.
II Uma mulher (indivduo 4) teve um filho (indivduo
5), que nasceu fortemente anmico devido incidncia
de eritroblastose fetal.

4) (FATEC-SP) Um casal em que ambos os cnjuges


possuem tipo sanguneo AB quer saber
I- quais os possveis tipos sanguneos dos seus filhos

Dentre os indivduos acima citados, somente possuem o


mesmo tipo de antgeno das reaes antgeno-anticorpo
envolvidas nas situaes I e II:

e
II- qual a probabilidade de terem uma criana do sexo
feminino, com sangue tipo AB.

a) 1, 3 e 4.
b) 1, 3 e 5.
c) 2, 3 e 5.
d) 2 e 4.
e) 3 e 5.

Assinale a alternativa que corresponde corretamente


s duas perguntas acima.
I
a) A, B e AB
b) A e B
c) A, B e AB
d) A e B
e) A, B e AB

II
1/3
1/4
1/4
1/2
1/2

Parte IV: Probabilidade


1) (UnB-DF) Se a famlia Silva tiver 5 filhos e a famlia
Oliveira tiver 4, qual a probabilidade de que todos os
filhos dos Silva sejam meninas e todos os dos Oliveira
sejam meninos?

5) (F.C.Chagas-BA) O pai de uma criana do grupo


sanguneo A e Rh+, cuja me B e Rh-, poderia ser:

a) 1/325
b) 1/512
c) 1/682
d) 1/921
e) 1/1754

a) AB e Rh+
b) AB e Rhc) B e Rh+
d) A e Rhe) O e Rh+

2) (FEEQ-CE) A capacidade de sentir o gosto de uma


substncia amarga chamada feniltiocarbamida (PTC)
deve-se a um gene dominante. A probabilidade de um

6) (FEI-SP) Para que ocorra a possibilidade da


eritroblastose fetal (doena hemoltica do recm-

69

Pr Vestibular Diferencial

BIOLOGIA

casal (sensvel a essa substncia e heterozigtico) ter


um filho do sexo feminino e sensvel ao PTC :

8) (FOS-SP) A polidactilia (presena de mais de 5 dedos


em cada membro) condicionada por um gene
dominante P. Se um homem com polidactilia, filho de
me normal, casa-se com uma mulher normal, qual a
probabilidade que tm de que em sucessivas gestaes
venham a ter 6 filhos com polidactilia?

a) 1/4
b) 1/8
c) 3/4
d) 3/8
e) 1/5

a) 1/16
b) 1/32
c) 1/64
d) 1/128
e) 1/256

3) (OSEC-SP). Quando dois indivduos que manifestam


um carter dominante tm um primeiro filho que
manifesta o carter recessivo, a probabilidade de um
segundo filho ser igual ao primeiro :

9) (F. Objetivo-SP). Qual a probabilidade de um casal de


olhos castanhos em que ambos os cnjuges so
heterozigotos ter 3 filhas de olhos castanhos e 2 filhos
de olhos azuis?

a) 3/4
b) 1/2
c) 1/4
d) 1/8
e) 1/16

a) 27/164
b) 3/8
c) 64/126
d) 270/32768
e) 0%

4) (UFRR-RR) Do cruzamento entre dois indivduos


portadores
do
gentipo
AaBBCcDd,
qual
a
probabilidade de ocorrncia numa F1 de indivduos com
o gentipo AABBccDd?
a) 1/85
b) 3/54
c) 1/32

10) (F. Objetivo-SP). Se consideramos que, no


problema anterior, o casal deseja que as 3 filhas de
olhos castanhos nasam em primeiro lugar e
seguidamente e, s depois, nasam os filhos de olhos
azuis, como ficaria, ento, a probabilidade?

d) 6/95
e) 1/64

5) (UFJF-MG) Um homem de pele com pigmentao


normal e olhos castanhos casa-se com uma mulher de
fentipo igual ao seu. Sabendo-se que o casal j tem
um filho albino de olhos azuis, qual a probabilidade de
num prximo nascimento este casal vir a ter uma filha
de olhos azuis e com a pigmentao da pele normal?

a) 2,7/164
b) 15/40
c) 640/1260
d) 27/32768
e) 5%
11) (UNIRIO-RJ) Um homem destro, heterozigoto para
este carter, que no possui a capacidade de enrolar a
lngua, casa-se com uma mulher canhota, com a
capacidade de enrolar a lngua, heterozigota para o
ltimo carter. Qual a probabilidade de o casal
mencionado vir a ter uma filha homozigota para ambos
os caracteres?

a) 2/16
b) 4/32
c) 6/16
d) 3/32
e) 7/16
6) (UGF-RJ) Certo tipo de miopia um carter
condicionado por um gene recessivo m. A adontia
hereditria determinada por um gene dominante D.
Um homem com adontia e viso normal casa-se com
uma mulher mope e com dentes, tendo o casal um filho
mope e com dentes. Se o casal tiver mais um filho, qual
a probabilidade de ele ser homem e normal para ambos
os caracteres?

a) 1/2
b) 1/6
c) 1/4

d) 1/8
e) 1/10

12) (FEI-SP). Um casal de olhos castanhos (dominante)


tem 4 filhos de olhos azuis (recessivo). Pergunta-se:
A) Qual a probabilidade de o 5 ter tambm olhos
azuis?
B) Qual a probabilidade de que ele tenha olhos
castanhos?

a) 1/8
b) 1/4
c) 1/16
d) 1/32
e) 0%

a)
b)
c)
d)
e)

7) (UFES-ES) Um determinado indivduo possui o


gentipo Aa. Qual a chance de o gene A ser transmitido
para um bisneto seu?
a) 50%
b) 3,125%
c) 1/4
d) 3/4
e) 12,5%

A
1/2
3/4
1/4
1/2
1/3

B
3/4
1/4
3/4
1/2
2/3

13) (UECE-CE). Numa familia com 9 filhas,


probabilidade de o dcimo filho ser homem :
a) 50%
b) 70%
c) 80%

70

Pr Vestibular Diferencial

BIOLOGIA

d) 90%
e) 25%

A probabilidade de um homem hbrido produzir


espermatozides contendo o gene recessivo de:

14) (Londrina) A representa o gene dominante para


determinado carter e a seu alelo recessivo. Em
quatro cruzamentos entre um indivduo Aa e um
indivduo aa, os descendentes foram Aa. A
probabilidade de, no quinto cruzamento, o descendente
ser aa :

a) 25 %
b) 30 %
c) 50 %.
d) 75 %
e) 100 %
19) (UNESP) Em organismos diplides sexuados, cada
par de cromossomos formado por um cromossomo de
origem paterna e um de origem materna. Qual a
probabilidade de os espermatozides conterem apenas
os cromossomos de origem materna, em um organismo
com quatro pares de cromossomos?

a) nula
b) 20%
c) 25%
d) 50%
e) 100%

a) 1/2
b) 1/4
c) 1/8
d) 1/16
e) 1/32

(UG-MG) As questes 15 e 16 referem-se a um


heredograma que representa a ocorrncia de uma
anomalia numa famlia.

20) (MED.SANTOS) A queratose (anomalia da pele)


devido a um gene dominante Q. Uma mulher com
queratose, cujo pai era normal, casa-se com um homem
com queratose, cuja me era normal. Se esse casal
tiver quatro filhos a probabilidade de todos eles
apresentarem queratose de:
a) 15,6%
b) 24,6%
c) 12,5%
d) 31,6%
e) 28,1%
Parte V: 2 Lei de Mendel

15) A probabilidade de nascer uma menina afetada do


cruzamento de 3 com 11 :

1) Uma planta que produz fruto vermelho e biloculado


foi cruzada com outra de fruto amarelo e multiloculado,
resultando 160 descendentes, assim distribudos:

a) 0,00
b) 0,25
c) 0,50
d) 0,75
e) 1,00

41 de frutos vermelhos biloculados


39 de frutos vermelhos multiloculados
38 de frutos amarelos biloculados
42 de frutos amarelos multiloculados.

16) Pelos dados fornecidos, no se podem determinar


os gentipos dos indivduos:

Quais os fentipos e gentipos dos tipos parentais?


a) 5, 9, 15.
b) 8, 9, 13.
c) 8, 11,16.
d) 9, 13, 15.
e) 13, 14, 16.

a) fruto vermelho biloculado =


multiloculado = aamm
b) fruto vermelho biloculado =
multiloculado = aaMM
c) fruto vermelho biloculado =
multiloculado = AAMM
d) fruto vermelho biloculado =
multiloculado = aamm
e) fruto vermelho biloculado =
multiloculado = Aamm

17) (Univ. Mogi da Cruzes) No homem, o albinismo


condicionado por um gene autossmico recessivo, a.
Pais normais que tm um filho albino desejam saber:
Qual a probabilidade de terem outro filho mas
com pigmentao normal da pele?

AaMm; fruto amarelo


AAMm; fruto amarelo
aamm; fruto amarelo
AaMM; fruto amarelo
AaMm; fruto amarelo

2) (ACAFE-SC) De acordo com as leis de Mendel,


indivduos com gentipo:

a) 1/2
b) 1/4
c) 3/4
d) 1/3
e) 2/3

a) AaBb produzem gametas A, B, a e b.


b) AaBB produzem gametas AB e aB.
c) Aa produzem gametas AA, Aa e aa.
d) AA produzem gametas AA.
e) AABB produzem dois tipos de gametas.

18) (FGV-SP) Na espcie humana, um determinado


carter causado por um gene autossmico recessivo.

71

Pr Vestibular Diferencial

BIOLOGIA

3) (UFPA) Na Drosophila melanogaster, a cor do corpo


bano produzida por um gene recessivo (e) e o corpo
de cor cinza, pelo seu alelo (E). A asa vestigial
produzida por um gene recessivo (v) e o tamanho
normal da asa determinado pelo seu alelo (V). Se
moscas dibridas so cruzadas entre si e produzem 256
indivduos,
quantas
moscas
desta
prognie
apresentaro o mesmo gentipo dos pais?

b) dois tipos de gameta na proporo 3:1.


c) trs tipos de gameta na proporo 1:2:1.
d) quatro tipos de gameta na proporo 1:1:1:1.
e) quatro tipos de gameta na proporo 9:3:3:1.
9) (FUVEST-SP) Em Drosophila melanogaster os alelos
recessivos dumpy e ebony esto em cromossomos no
homlogos. Do cruzamento entre indivduos duplamente
heterozigotos, a proporo de indivduos que
apresentam ao mesmo tempo os fentipos dumpy e
ebony :

a) 144
b) 128
c) 64
d) 8
e) 16

a) 1/2.
b) 1/4.
c) 1/8.
d) 1/16.
e) 1/32.

4) (U.F.SE-SE) A proporo fenotpica encontrada na


descendncia do
cruzamento entre indivduos
heterozigotos para dois caracteres com dominncia
completa :

Parte VI: Interao Gnica

a) 3:1
b) 1:2:1
c) 9:4:3
d) 9:7
e) 9:3:3:1

1) (FUND. LUSADAS-SP) Todos os filhos de um casal


so mulatos mdios. Provavelmente esse casal
constitudo por:
a) dois mulatos mdios.
b) um mulato mdio e um negro puro.
c) um mulato mdio e um branco puro
d) um negro puro e um branco puro.
e) um mulato claro e um escuro.

5) (FEI-SP) Em Drosophila melanogaster, asa vestigial


(curta) e corpo bano (preto) so caractersticas
determinadas por dois pares de gens recessivos v e e,
respectivamente. Asa longa e corpo cinzento so
caractersticas determinadas pelos gens dominantes V e
F. Do cruzamento entre parentais surgiu, em F1, 25% de
indivduos de asa longa e corpo cinzento. O gentipo
provvel dos pais ser:
a) VvEe X VvEe
b) VVEE X vvee
c) vvee X vvee

2) (FATEC-SP) Pares de genes, com segregao


independente, podem agir, conjuntamente, na
determinao de uma mesma caracterstica fenotpica.
Este fenmemo conhecido como:

d) VvEe X vvee
e) VvEe X VVEE

a) interao gnica.
b) epistasia
c) herana quantitativa
d) poligenia
e) dominncia completa.

6) (F.C.Chagas-BA) Sendo Aa, Bb e Cc trs pares de


gens com segregao independente, quantos tipos de
gametas podero ser formados por um indivduo AA Bb
Cc?

3) (ACAFE-SC) Os fentipos para a forma dos frutos da


abbora podem ser: discide, esfrica ou alongada.
A forma discide dos frutos da abbora
condicionada pelo gentipo A_B_; a forma alongada por
aabb. Do cruzamento de abboras discides, ambas
heterozigotas, espera-se que nasam:

a) 3
b) 4
c) 6
d) 8
e) 12

a) somente abboras discides.


b) 50% AaBb e 50% aabb.
c) abboras discides, esfricas e alongadas.
d) 75% A_B_ e 25% a_B_.
e) somente abboras discides heterozigotas.

7) Da autofecundao de uma planta heterozigota para


dois pares de alelos independentes e com dominncia
completa em cada par, foram obtidos 192
descendentes. esperado que nessa descendncia
devam existir aproximadamente:

4) (UNIMEP-SP) Sabe-se que, de uma maneira geral,


cada par de genes alelos determina uma nica
caracterstica, porm h casos onde um mesmo par de
genes, sob determinadas condies ambientais,
determina dois ou mais caracteres. Este fenmeno
conhecido como:

a) 16 tipos diferentes de gentipos.


b) apenas indivduos heterozigticos.
c) 48 indivduos homozigticos para dois pares de
genes.
d) 188 indivduos heterozigticos.
e) 144 indivduos heterozigticos para os dois pares de
genes.

a) epistasia.
b) genes aditivos.
c) interao gnica.
d) pleiotropia.
e) genes quantitativos.

8) (FUVEST-SP) Um indivduo heterozigoto quanto a


dois pares de genes localizados em diferentes pares de
cromossomos formar:

5) (UNIFOR-CE) Na moranga, a cor dos frutos deve-se


s seguintes combinaes de genes:

a) dois tipos de gameta na proporo 1:1.

72

Pr Vestibular Diferencial

BIOLOGIA

Estas informaes permitem concluir que o gene:

plo malhado, que a manifestao de um gentipo


heterozigoto em ausncia de dominncia, s
encontrado normalmente nas fmeas . 0 aparecimento
excepcional de machos malhados explicado a partir da
seguinte constituio sexual cromossmica:

a) A episttico sobre seu alelo.


b) B episttico sobre A e sobre a.
c) a hiposttico em relao a A.
d) b hiposttico em relao a B.
e) A episttico sobre B e sobre b.

a) XY
b) XX
c) XXY
d) XYY
e) XXX

6) (CESGRANRIO-RJ) Supondo-se que a cor da pele


humana seja condicionada por apenas dois pares de
genes autossmicos (A e B) dominantes, qual a
probabilidade de um casal de mulatos mdios, ambos
com gentipo AaBb, ter um filho branco?

3) (Fuvest-SP) 0 daltonismo de herana recessiva


ligada ao X. Uma mulher de viso normal, cujo pai
daltnico, casou-se com um homem de viso normal. A
probabilidade de crianas daltnicas na prole dessa
mulher de :

a) 1/16
b) 4/16
c) 5/16
d) 6/16
e) 8/16

a) 1 /4 dos meninos .
b) 1/4 das meninas.
c) 1/2 dos meninos.
d) 1/8 das crianas.
e) 1/2 dos meninos e 1/2 das meninas.

7) (STA.CASA-SP) Admita que em certos animais de


laboratrio o gene A condicione cor preta de pelagem e
seja dominante sobre o seu alelo a, que condiciona a
cor marrom. O gene E no alelo de A, e localizado em
diferente autossomo, condiciona cor branca de pelagem,
em homozigose ou heterozigose, tendo pois efeito
episttico sobre os genes A e a.
Um animal preto, filho de pais brancos,
retrocruzado com sua me e tem 20 descendentes com
as trs cores de pelagem citadas. Quantos devem ser
brancos?

4) (UnB-DF) 0 daltonismo um carter ligado ao sexo. 0


cromossomo X transporta um gene recessivo para o
daltonismo, no havendo alelo correspondente no
cromossomo Y. Isto explica porque:

B_aa = amarelo
bbA_ = branco

B_A_ = branco
bbaa = verde

a) existem muito mais homens daltnicos que mulheres


daltnicas .
b) existem muito mais mulheres daltnicas que homens
daltnicos.
c) o nmero de homens e mulheres daltnicas
aproximadamente o mesmo .
d) o daltonismo depende do fentipo racial.
e) o daltonismo, embora de carter gentico,
influenciado pelo meio ambiente

a) 2
b) 8
c) 10
d) 4
e) 5

5) (UFPA) A hipertricose na orelha condicionada por


um gen localizado na parte no homloga do
cromossomo Y (gen holndrico). Um homem, cujo av
paterno tinha hipertricose, casa-se com mulher normal e
sem hipertricose na famlia. Esse casal tem
descendentes com os seguintes fentipos:

Parte VII: Herana Sexual


1) (FASP) No diagrama abaixo est representado o
casamento entre um homem normal e uma mulher
normal, filha de um homem hemoflico .

a) Todas as mulheres so portadoras e todos os


homens apresentam hipertricose.
b) Todas as mulheres so normais e todos os homens
apresentam hipertricose.
c) 50% das mulheres e dos homens apresentam
hipertricose.
d) 100% das mulheres so normais, enquanto 25% dos
homens apresentam hipertricose.
e) Toda a descendncia de ambos os sexos normal.

Hemoflico
Normal

6) (UFBA) A anlise do heredograma a seguir permite


supor que a caracterstica apresentada pelos indivduos
:

Sabendo-se que a hemofilia uma doena


determinada por um gene recessivo e ligado ao sexo,
deste casamento podero nascer crianas hemoflicas
na proporo de :
a) 0 %
b) 25%
c) 50%
d) 75 %
e) 100%
2) (UFBA) Em gatos, a determinao da cor do plo
um caso de herana ligada ao cromossomo X. Assim, o

a) ligada ao cromossomo X.

73

Pr Vestibular Diferencial

BIOLOGIA

b) ligada ao cromossomo Y.
c) autossmica dominante.
d) autossmica recessiva.
e) letal na primeira infncia.

10) (PUC-SP) A hemoflia carter ligado ao sexo. Um


homem hemoflico casado com uma mulher normal,
cujo pai era hemoflico. Qual a probabilidade do primeiro
filho do casal ser menino e hemoflico?

7) (UFBA) No heredograma a seguir, os indivduos


representados por smbolos pretos so afetados pela
surdo-mudez. Da anlise do heredograma, conclui-se
que a surdo-mudez uma caracterstica hereditria:

a) 1/2
b) 1/4
c) 1/8

d) 1/16
e) 1/32

11) (PUC-RS) Num casamento em que o homem de


viso normal para as cores e sua esposa tambm
normal, porm filha de um homem daltnico, os filhos
podero ser:
a) todas as filhas normais e os filhos daltnicos .
b) todos os filhos normais e as filhas daltnicas.
c) filhas normais, filhas portadoras, filhos normais e
filhos daltnicos .
d) filhas portadoras e filhos normais, apenas.
e) filhos portadores e filhas daltnicas.

a) letal em homozigose.
b) recessiva e autossmica.
c) dominante e autossmica.
d) dominante e ligada ao cromossomo Y .
e) recessiva e ligada ao cromossomo X.

12) (PUC-SP) 0 cruzamento de uma drosfila de olho


vermelho, heterozigota, com um macho de olho branco,
sabendo-se que esse carter obedece ao mecanismo
da herana ligada ao sexo, deve dar:

8) (UFPA) A calvcie determinada por um gene


autossmico cuja dominncia influenciada pelo sexo,
comportando-se como dominante no homem e como
recessivo na mulher. Simbolizando-se o gene que causa
a calvcie por C e o seu alelo selvagem por c, indique o
gentipo dos indivduos ( 1 ), (2), (4) e (5) da genealogia
abaixo, na qual estes genes esto segregados.

a) todos os descendentes machos de olho vermelho,


porque eles no recebem o cromossomo X do pai.
b) descendentes machos de olho vermelho e olho
branco, porque 50% deles recebem o cromossomo X do
pai, que tem olho branco, e 50% o X da me, que tem
olho vermelho.
c) todos os descendentes femininos de olho branco,
porque as fmeas recebem o cromossomo X do pai, que
tem olho branco.
d) 50% dos descendentes femininos de olhos vermelhos
e 50% de olhos brancos, porque a fmea heterozigota
e o macho portador do gene recessivo.
e) tanto machos quanto fmeas 50% de olhos
vermelhos e 50% de olhos brancos, porque se trata do
cruzamento de um heterozigoto com um birrecessivo.

calvos

No-calvos

a) Cc, CC, CC, Cc


b) Cc, cc, cc, Cc
c) CC, cc,cc, Cc
d) CC, Cc, Cc, Cc
e) Cc, CC, CC, cc

13) (PUC-SP) Um casal normal para a viso das cores e


para a coagulao tem uma filha normal e um filho
daltnico e hemoflico.
Sendo os dois caracteres recessivos e ligados ao sexo,
pode-se afirmar corretamente que:

9) (CESGRANRIO-RJ) Do casamento de homem normal


com mulher normal nasceram: um menino daltnico com
sangue tipo A; um menino normal com sangue tipo 0;
uma menina normal com sangue tipo B; uma menina
normal com sangue tipo 0 e um menino daltnico com
sangue tipo AB. Isso leva-nos a concluir que:

a) tanto o pai quanto a me so portadores dos dois


genes recessivos .
b) apenas o pai portador dos sois gens recessivos.
c) apenas a me portadora dos dois genes recessivos.
d) o pai portador do gene para daltonismo e a me
portadora do gen para hemofilia.
e) o pai portador do gene para hemofilia e a me
portadora do gen para daltonismo.

a) 0 pai e a me possuem o gene para daltonismo; o pai


tem sangue tipo A e a me sangue tipo B ou vice-versa.
b) A me possui o gene para daltonismo, o pai no
possui esse gene; o pai tem sangue A e a me sangue
tipo B ou vice-versa.
c) A me possui o gene para daltonismo, o pai no
possui esse gene; o pai tem sangue tipo AB e a me
sangue tipo 0 ou vice-versa.
d) 0 pai possui o gene para daltonismo, a me no
possui esse gene; o pai e a me tm sangue tipo AB.
e) A me possui o gene para daltonismo, o pai no
possui esse gene; o pai tem sangue tipo AB e a me
sangue tipo A ou vice-versa.

14) (VUNESP-SP) Em Drosophila o gene W (dominante)


determina a cor vermelha do olho e seu alelo w
(recessivo) determina a cor branca. Esses genes so
levados no cromossomo sexual X.
Assinale o cruzamento que permite separar os
machos e fmeas pela colorao dos olhos:
a) Xw Xw cruzada com XW Y
b) XW Xw cruzada com Xw Y
c) XW XW cruzada com Xw Y
d) XW XW cruzada com XW Y

74

Pr Vestibular Diferencial

BIOLOGIA

e) os cruzamentos a e b

Parte VIII: Linkage e Mapas genticos

15) (FUVEST-SP) 0 gene recessivo h est localizado no


cromossomo X e o responsvel pela hemofilia na
espcie humana. Com base nessas informaes e nas
contidas na rvore genealgica abaixo, responda a
seguinte pergunta: se a mulher 4 casar com um homem
normal e seu primeiro filho for um menino hemoflico,
qual a probabilidade de que o prximo filho homem
desse casal venha a ser hemoflico?

1) (F.C.Chagas-SP) Os gens a e b encontram-se num


mesmo cromossoma, sendo a distncia entre eles de 17
unidades. A frequncia de gametas AB formados por
um indivduo AB/ab de:

a) 8,5%
b) 17%
c) 34%
d) 41,5%
e) 83%

Homem
hemoflico

2) No milho gro colorido I dominante sobre gro


incolor i e gro liso R dominante sobre gro rugoso r.
Os dois pares de genes esto em linkage. Plantas de
semente colorida lisa foram cruzadas com plantas de
sementes incolores rugosas. A F1, toda de sementes
coloridas e lisas, foi retrocruzada com plantas de
semente incolor e rugosa produzindo:

Homem normal
Mulher normal

3
a) 3/4
b) 1/3
c) 1/2

5
d) 1/4
e) 1/8

285 plantas com sementes coloridas lisas


10 plantas com sementes coloridas rugosas
297 plantas com sementes incolores rugosas
8 plantas com sementes incolores lisas

16) (UFBA) Uma caracterstica recessiva determinada


por gene ligado ao cromossomo X condiciona que:
a) as fmeas tenham maior probabilidade de serem
afetadas.
b) os machos tenham maior probabilidade de serem
afetados.
c) apenas as fmeas transmitam o gene.
d) apenas os machos transmitam o gene.
e) os machos s transmitam o gene aos descendentes
machos .

A taxa de crossing entre I e R :


a) 3%
b) 6%
c) 48,5%
d) 0,7%
e) 1,5%

17) Uma mulher com sndrome de Turner cromatina


negativa (sem corpsculo de Barr) e daltnica. Sabe-se
que filha de pai daltnico e me normal, homozigtica
para a viso das cores. 0 responsvel pelo gameta
cromossomicamente anormal foi:

3) (CESGRANRIO) Consideremos dois pares de genes


CD/cd durante a meiose. Supondo-se que ocorre
crossing entre eles numa freqncia de 16%, os
gametas formados sero:
a)
b)
c)
d)
e)

a) o pai, pois ele daltnico e deu-lhe o cromossomo X.


b) a me, pois ela normal e homozigtica.
c) o pai, pois ele deu-Ihe o cromossomo Y.
d) a me, pois ela deu-lhe o cromossomo X.
e) o pai ou a me, pois ambos apresentam, no gameta,
o cromossomo X.

25% CD, 25% cd, 25% Cd, 25% cD.


42% CD, 42% cd, 16% Cd, 16% cD.
42% CD, 42% cd, 8% Cd, 8% cD.
50% CD, 50% cd.
84% CD, 84% cd, 16% Cd, 16% cD.

4) (OMEC-SP) Cruzando-se um heterozigoto para dois


pares de genes AaBb com um duplo recessivo aabb,
obteve-se:

18) (FUVEST-SP) Um gene recessivo localizado no


cromossomo X transmitido pelas mulheres
heterozigotas a:

43 % - indivduos AaBb
43 % - indivduos aabb
7% - indivduos Aabb
7% - indivduos aaBb

a) metade de suas crianas


b) apenas suas crianas de sexo masculino
c) apenas suas crianas de sexo feminno
d) 1/4 de suas crianas
e) todas as suas crianas

Tratando-se, evidentemente, de um caso de


ligao fatorial, pode-se dizer que :

19) (FGV-SP) Uma mulher de viso normal, filha de pai


daltnico e de me normal, filha de pai daltnico e de
me normal, casou-se com um homem de viso
tambm normal. A probabilidade de o menino que
nasceu desse casamento ser daltnico :

a) o heterozigoto Ab/aB e a distncia entre os dois


genes de 7 unidades.
b) o heterozigoto AB/aB e a distncia entre os dois
genes de 7 unidades.
c) o heterozigoto Ab/aB e a distncia entre os dois
genes de 14 unidades.
d) o heterozigoto AB/ab e a distncia entre os dois
genes de 14 unidades.
e) no se pode saber a constituio do heterozigoto,
mas a distncia entre os dois genes de 14 unidades.

a) 1/4
b) 1/2
c) 1/3
d) 1/8
e) 1/16

75

Pr Vestibular Diferencial

BIOLOGIA

5) (FEI-SP) Qual a seqncia mais provvel dos genes


A, B, C, D, localizados no mesmo cromossomo,
apresentando
as
seguintes
freqncias
de
recombinao:
AB - 17%
- 18%

CD - 30%

AC - 5%

AD - 35%

Parte VII
Herana
Sexual
123B
C
C
11- 12- 13C
D
C

BD

a) A - B - C - D
b) A - C - B - D
c) A - B - D -C
d) C - A - B - D
e) C - A - D - B

AB
36%
34%
42%
8%
44%

Ab
14%
16%
8%
42%
6%

aB
14%
16%
8%
42%
6%

ab
36%
34%
42%
8%
44%

GABARITO GENTICA

Parte I 1 Lei
de Mendel
123C
B
C
11- 12- 13A
B
D
21- 22- 23E
C
C

5B
15C

Parte VIII Linkage e


Mapas genticos
23451D
A
C
D
B

6) (UNESP-SP) Se em um mapa gentico a distncia


entre os loci A e B de 16 morgandeos, qual a
frequncia relativa dos gametas AB, Ab, aB, ab,
produzidos pelo gentipo AB/ab?

a)
b)
c)
d)
e)

4A
14A

4A
14E
24E

5B
15B

6C
16D

7D
17E

8C
18D

9B
19C

Parte II Alelos
Mltiplos
1234C
B
C
E

5D

Parte
III

Grupos
Sangneos
1234D
B
D
C

5A

6A

7E

8A

9B

Parte
IV
Probabilidade
123B
D
C
11- 12- 13D
C
A

5D
15B

6A
16E

7E
17C

8C
18C

9D
19D

Parte V 2 Lei
de Mendel
1234A
B
C
E

5D

6B

7C

8D

9D

Parte
VI

Interao
Gnica
1234D
A
C
D

5E

6A

7C

4C
14D

10C
20D

10D
20D

76

6B
16B

6C

7B
17B

8A
18A

9B
19A

10B

Pr Vestibular Diferencial

BIOLOGIA

EXERCCIO F I S I O L O G I A

7)
(CESGRANRIO-RJ).
Numere
as
enzimas
responsveis pela digesto de protenas no homem,
relacionadas abaixo, na segunda coluna, de acordo com
as suas origens, citadas na primeira coluna:

Parte I: Digesto
1) (FUVEST-SP) Qual dos rgos humanos abaixo
citados no produz enzimas digestivas?

(1)
(2)
(3)
(4)

a) glndulas salivares
b) estmago
c) vescula biliar
d) jejuno-leo
e) pncreas

Assinale a seqncia correta:


a) 1 - 2 - 2 - 4 4
b) 2 - 3 - 3 - 3 4
c) 1 - 3 - 3 - 3 - 4
d) 1 - 2 - 2 - 3 - 3
e) 2 - 3 - 3 - 1 - 1

2) (CESESP-PE) A pepsina uma importante enzima


digestiva cujos substratos so:
a) protenas
b) glicdios
c) lipdios
d) cidos graxos
e) monossacardeos

8) (UFJF-MG). Qual dos animais a seguir enumerados


pode ter uma frmula dentria compatvel com a que se
segue?
0 0 3 3
3 0 3 3
a) lobo
b) gorila
c) homem
d) boi
e) tigre

3) (EPFESP-PE) Em indivduos humanos normais, o


canal coldoco estabelece uma comunicao anatmica
entre:
a)
b)
c)
d)
e)

o fgado e a vescula biliar


a vescula biliar e o jejuno
a vescula biliar e o leo
a vescula biliar e o duodeno
a vescula biliar e o ceco

9) (UFRGS-RS). A bile produzida pelo fgado tem como


funo:

4) (UFRGS-RS). Hetertrofa a nutrio de organismos


incapazes de sintetizar compostos orgnicos a partir de
inorgnicos. So hetertrofos:
a)
b)
c)
d)
e)

glndulas salivares
( ) pepsina
estmago
( ) tripsina
pncreas
( ) quimotripsina
glndulas da parede intestinal( ) carboxipeptidases
( ) aminopeptidases

a)
b)
c)
d)
e)

os animais, os fungos e a maioria das bactrias


os vegetais, os lquens e a minoria das bactrias
os vegetais, os fungos e a minoria das bactrias
os animais, os lquens e a minoria das bactrias
os animais, as algas e a maioria das bactrias

lubrificar a mucosa intestinal


emulsionar as gorduras
estimular a secreo gstrica
provocar a contrao da vescula
digerir as protenas

5)
(FUVEST-SP). As enzimas digestivas que agem
sobre os carboidratos atuam:

10)
(CESGRANRIO-RJ).
0
homem
nutre-se
essencialmente pela absoro de produtos assimilveis
derivados da hidrlise dos alimentos pela ao das
enzimas do trato gastrointestinal. Em decorrncia desta
afirmativa, este processo particulariza um exemplo de:

a)
b)
c)
d)
e)

a)
b)
c)
d)
e)

somente na boca
somente no intestino
somente no estmago
na boca e no intestino
no intestino e no estmago

11) (UCPR-PR) Um corte transversal da raiz dentria


humana apresenta sucessivamente:

6) (UFMG-MG). Uma mistura de suco pancretico,


protena, gordura e celulose foi repartida por dois tubos
de ensaio. Ao Tubo 1 acrescentou-se uma base e ao
Tubo 2, um cido. Que letra da tabela seguinte indica
corretamente os resultados esperados nessa
experincia? (O sinal - significa ausncia de digesto.)

b)

Tubo
1
(pH
8)
digesto de
protena, gordura e
celulose
-----------

c)
d)
e)

----------protena e gordura
protena e gordura

a)

a)
b)
c)
d)
e)

Tubo 2 (pH 3) digesto


de
-------------protena,
gordura
celulose
protena e gordura
protena e gordura
-----------

endocitose
pinocitose reversa
ingesto
digesto intracelular
digesto extracelular

esmalte, dentina e polpa


esmalte, polpa e dentina
esmalte, cimento, polpa e dentina
cimento, esmalte, polpa e dentina
cimento, dentina e polpa

12) (F. Objetivo-SP). Na digesto humana, das trs


enzimas abaixo citadas, os alimentos entram em
contato, sucessivamente, com:

a)
b)
c)
d)
e)

77

ptialina, tripsina e pepsina


ptialina, pepsina e tripsina
tripsina, ptialina e pepsina
tripsina, pepsina e ptialina
pepsina, tripsina e ptialina

Pr Vestibular Diferencial

BIOLOGIA
e) 5 - 4 - 1 - 6 - 7 - 1 - 5 - 3 - 2

13) (EFOA-MG) A opo que no equivale ao nome


correto do rgo e da substncia por ele produzida :
a)
b)
c)
d)
e)

18) (PUC-RJ) A diferena fundamental nos processos


digestivos entre animais carnvoros e animais
ruminantes a existncia, nesses ltimos, de recurso
especfico de digesto para:

glndulas salivares e ptialina


estmago e cido clordrico
fgado e bile
pncreas e tripsina
duodeno e pepsina

a) gordura
b) protena
c) celulose

14) (CESGRANRIO-RJ) 0 principal local de absoro


de nutrientes no tubo digestivo humano :
a)
b)
c)
d)
e)

19) (CESGRANRIO-RJ). A digesto da celulose nos


ruminantes ocorre graas a condies especiais
existentes no trato digestivo desses animais. Da ao
ordenada de seus quatro estmagos, os ruminantes
obtm substncias de alto valor energtico e
aminocidos que so absorvidos. Com relao aos
mecanismos de digesto nesses animais, so feitas
abaixo trs afirmativas:

estmago
jejuno-leo
colo transverso
colo descendente
sigmide

15) (OSEC-SP) 0 esquema a seguir apresenta um


conjunto de rgos, numerados, do aparelho digestivo.
As funes de absoro de gua e produo da bile
so realizadas, respectivamente, por:

a)
b)
c)
d)
e)

d) amido
e) glicose

I - A celulose degradada por ao direta de


enzimas secretadas por glndulas presentes na mucosa
dos dois primeiros estmagos (rmen e retculo).
II - Bactrias e protozorios so digeridos nos dois
primeiros estmagos (rmen e retculo) e seus produtos
absorvidos nos dois ltimos (omaso e abomaso).

Vel
IV e I
II e III
V e II
I e II

III - Microrganismos que proliferam nos dois


primeiros estmagos (rmen e retculo) a degradam
gorduras e celulose em cidos graxos, sacardeos
simples e gases como gs carbnico e metano.
Assinale:
a) se somente I for correta
b) se somente II for correta
c) se somente III for correta
d) se somente I e II forem corretas
e) se somente II e III forem corretas

16) (UFPA-PA). 0 material retirado de um determinado


rgo de um macaco foi repartido em seis tubos de
ensaio. Aos tubos I e II acrescentou-se um pedao de
carne; aos tubos III e IV, um pedao de batata; e aos
tubos V e VI, um pouco de manteiga. Aos tubos I, III e VI
acrescentou-se um pouco de cido clordrico. Aps 12
horas, a 38 C, verificou-se que apenas no tubo I h ouve
digesto. 0 material usado neste experimento foi
retirado:
a) do estmago
b) do intestino
salivares
c) da vescula

20)
(UCSal-BA) Para estudar experimentalmente a
digesto da protena do leite, o procedimento mais
adequado seria usar:
a)
b)
c)
d)
e)

d) do pncreas
e)
das glndulas

pepsina em meio cido


pepsina em meio bsico
tripsina em meio cido
lipase em meio cido
lipase em meio bsico

21) (F. C. Chagas-BA) Enzimas do suco gstrico so


ativas apenas em pH:

17)
(UFJF-MG)
Os tens relacionam-se com o
estmago de um ruminante. Verifique qual das
ordenaes corresponde seqncia correta do
processo digestivo:

a)
b)
c)
d)
e)

( 1 ) pana ou rmen
( 2 ) intestino
( 3 ) abomasum ou coagulador
( 4 ) esfago
( 5 ) boca
( 6 ) folhoso ou psaltrio (omasum)
( 7 ) retculo ou barrete

cido
aIcaIino
neutro
neutro e alcalino
cido e alcalino

22) (UFES-ES). Nas vilosidades intestinais, os


aminocidos e os cidos graxos so absorvidos,
respectivamente:
a) pelos capilares sangneos e vasos linfticos
b) pelos vasos linfticos e capilares sangneos
c)
pelos capilares sangneos venosos e pelos
capilares arteriais

a) 5 - 4 - 1 - 7 - 5 - 4 - 6 - 3 - 2
b) 5 - 4 - 3 - 2 - 1 - 6 - 7 - 4 - 2
c) 5 - 4 - 7 - 1 - 5 - 1 - 3 - 6 - 2
d) 5 - 4 - 1 - 7 - 1 - 5 - 6 - 2 - 3

78

Pr Vestibular Diferencial

BIOLOGIA

d) pelos capilares sangneos arteriais e pelos capilares


venosos
e) pelos vasos linfticos somente

c) drosfila
d) barata
e) aranha

23) (UNIB-SP) Se um indivduo apresentar uma doena


que impea a produo de bile pelo fgado, passar a
ter problemas com a digesto de:

2) (CESGRANRIO-RJ). Nas plantas, as estruturas


especializadas para as trocas de gases entre a planta e
o exterior so:

a) amido
b) protenas
c) acares

a) os estmatos e as lenticelas
b) o floema e os estmatos
c) as lenticelas e o colnquima
d) o esclernquima e o xilema
e) o sber e o cmbio

d) gorduras
e) vegetais.

24) (PUC-SP) Os ruminantes, grupo que inclui vacas,


carneiros, cabras, camelos e girafas, so capazes de
utilizar celulose como fonte de energia, devido:

3) (UFRN-RN). 0 diafragma e os msculos intercostais


tem participao ativa:

a) s enzimas secretadas pelos microrganismos do


rmen e do retculo.
b) ao fato de possurem uma srie de quatro estmagos,
que, em conjunto, secretam enzimas e cidos para essa
digesto.
c) s enzimas secretadas pelo rmen e retculo.
d) s concentraes altamente cidas secretadas
apenas pelo rmen.
e) Nenhuma das explicaes acima est correta.

a) nos movimentos peristlticos


b) na deglutio
c) na diurese
d) na mastigao
e) na respirao
4) (CESGRANRIO-RJ).

25) (UFBA) Na digesto, a reduo dos alimentos a


partculas atravs de processos mecnicos tem por
finalidade:
a) facilitar a eliminao de substncias inteis.
b) possibilitar a passagem do alimento para o sangue.
c) transformar os complexos alimentares em
substncias mais simples.
d) aumentar a superfcie de exposio dos alimentos
ao das enzimas.
e) reduzir grandes molculas orgnicas a molculas
pequenas com maior valor nutritivo.

No desenho ao lado mostrado um animal que


apresenta o sistema respiratrio tpico do grupo a que
pertence. Nesse grupo, a respirao do tipo:

26) (UECE-CE) Assinale a afirmao correta relativa


digesto e absoro de substncias nutritivas no
homem:

a) traqueal e cutnea
b) somente traqueal
c) somente cutnea
d) somente branquial
e) pela hipfise

a) O amido digerido pela ptialina existente na saliva e


o produto da digesto absorvido principalmente na
boca e no esfago.
b) As protenas so digeridas pela pepsina produzida
nas glndulas gstricas e sua absoro ocorre
principalmente no estmago.
c) Os lipdios so digeridos pela lipase produzida na
vescula biliar e sua absoro ocorre principalmente no
intestino grosso.
d) A celulose absorvida integralmente no intestino
grosso, sem necessidade de sofrer ao de enzimas
digestivas.
e) A glicose no necessita de desdobramento por
enzimas.

5) (UFPR-PR). 0 transporte de oxignio no organismo


humano se faz principalmente:
a) atravs dos leuccitos.
b) atravs do plasma sangneo
c) tanto pela hemoglobina plasmtica como pela
existente no interior das hemcias, quando a taxa de
hemoglobina normal
d) atravs da hemoglobina existente nas hemcias
e) na dependncia de boa funo plaquetria
6) (FCMSCSP). Qual das alternativas abaixo completa
corretamente a frase seguinte?
"A formao de H2C03 ocorre (I); a enzima
anidrase carbnica existe (II); o transporte de ons
bicarbonato ocorre principaimente (III)."

Parte II: Respirao

1) (FUVEST-SP/. Existem animais que no possuem


rgo ou sistema especializado em realizar trocas
gasosas. Na respiraco, a absoro do oxignio e a
eliminao do gs carbnico ocorrem por difuso,
atravs da superfce epidrmica. o caso da:

a) I = nas hemcias; II = apenas nas hemcias; III = no


plasma
b) I = no plasma e nas hemcias; II = apenas nas
hemcias; III = nas hemcias
c) I = no plasma e nas hemcias; II = apenas no plasma;
III = no plasma

a) planria
b) ostra

79

Pr Vestibular Diferencial

BIOLOGIA

d) I = apenas no plasma; II = no plasma e nas hemcias;


III = nas hemcias
e) I = apenas no plasma; II = apenas no plasma; III = no
plasma

11) (UFBA-BA). Qual das reaes abaixo ocorre nos


capilares dos pulmes?
a) CO2 + H20 H2C03
+
b) H2C03 H + HC03
+
c) HCO3 + H H2C03 H20 + CO2
+
d) H20 + CO2 H2CO3 H + HC03
e) H2C03 + CO2 H2O + 2 C02

7) (EPFESP-PE). fato conhecido que alguns peixes


(dipnicos) so capazes de sobreviver em guas cuja
concentrao de oxignio bastante baixa. Tal fato se
deve a que?

12) (UFJF-MG). Os esquemas abaixo representam


sistemas respiratrios.

a) Apresentam respirao cutnea.


b) Por no possuirem oprculo, deslocam-se com maior
velocidade, aumentando o fluxo d'gua atravs da boca
e, conseqentemente, garantem uma maior oxigenao
nas suas brnquias.
c) Possuem uma respirao celular muito menos intensa
que os demais peixes.
d) Suas brnquias apresentam uma vascularizao
muito maior que os demais peixes, bem como um
nmero muito grande de lamelas.
e) So capazes de respirar o ar atmosfrico por meio da
bexiga natatria.

Os insetos terrestres apresentam sistemas


respiratrios apenas:
a) dos tipos I e Il
b) dos tipos II e III
c) dos tipos III e I
d) do tipo I
e) do tipo II

8) (UFES-ES) No homem, o controle dos movimentos


respiratris exercido:
a) pelo crebro
b) pelo cerebelo
c) pelo bulbo
d) pela medula
e) pela hipfise

13) (UFRGS-RS). Qual a alternativa que relaciona os


mecanismos de trocas gasosas com os respectivos
animais.

a)
b)
c)
d)
e)

9) (UnB/ICSA-DF). A seqncia das estruturas do


sistema respiratrio pulmonar :
a) fossas nasais - laringe - esfago - brnquios traquia
b) fossas nasais - faringe - laringe - traquia - brnquios
c) fossas nasais - laringe - faringe - traquia - brnquios
d) fossas nasais - faringe - esfago - traquia brnquios
e) fossas nasais - faringe - traquia - laringe - brnquios

bagre
tegumentar
tegumentar
branquial
filotraqueal
branquial

tartaruga
branquial
filotraqueal
pulmonar
branquial
pulmonar

pingim
traqueal
pulmonar
pulmonar
pulmonar
branquial

abelha
traqueal
filotraqueal
traqueal
filotraqueal
traqueal

14) (UFBA-BA) Nas ilustraes que se seguem, as


hachuras representam o revestimento do corpo animal
em contato direto com o ambiente.

10) (OSEC-SP). Um mdico, ao ser chamado para


atender uma vtima de afogamento, tinha a sua
disposio
trs
recipientes
numerados
cujos
componentes e respectivas propores eram as
seguintes:
Recipiente I - 100% de 02
Recipiente II - 80% de N2 e 20% de 02
Recipiente III - 95% de O2 e 5% de
CO2

As ilustraes indicam, respectivamente, os


tipos de sistemas respiratrios:

0 seu procedimento mais correto seria utilizar:

a) traqueal, pulmonar e cutneo


b) cutneo, branquial e traqueal
c) pulmonar, traqueal e cutneo
d) cutneo, traqueal e branquial
e) traqueal, cutneo e pulmonar

a) a mistura do recipiente II, uma vez que o N2 estimula


o processo respiratrio, atuando sobre o cerebelo
b) a mistura do recipiente III, uma vez que o C02
estimula o bulbo a restaurar os movimentos respiratrios
c) o gs do recipiente I, porque somente o oxignio puro
pode satisfazer s exigncias respiratrias dos tecidos
celulares
d) a mistura do recipiente II, porque a porcentagem de
oxignio aproximadamente a mesma que a do ar que
respiramos
e) o gs do recipiente I, porque o oxignio puro estimula
a medula ssea a produzir maior nmero de hemcias

15) (UFMG-MG) Observe os esquemas a seguir.

80

Pr Vestibular Diferencial

BIOLOGIA
a) relaxamento do diafragma
b) diminuio do volume pulmonar
c) contrao da musculatura intercostal
d) aumento da presso intratorcica em relao
presso atmosfrica
e) eliminao de dixido de carbono
19) (FUVEST-SP) A obstruo dos bronquolos impede
que o oxignio atinja:
a) a faringe.
b) o esfago.
c) a laringe.
d) a traquia.
e) os alvolos.

Os
esquemas
2
e
4
representam,
respectivamente, formas de respirao de:
a) minhoca e planria
b) planria e mosca
c) medusa e sardinha
d) lombriga e sapo
e) gafanhoto e homem
16) (UFCE-CE). A reao: Hb + 4O2
Hb representa a hemoglobina, ocorre:

20) (VUNESP) As trocas gasosas durante a respirao


dos invertebrados (COLUNA 1) ocorrem ou no atravs
de estruturas especializadas (COLUNA 2).

COLUNA 1
1 - Planria
2 - Gafanhoto
3 - Camaro
4 - Caramujo-de-jardim

Hb(O2)4, onde

a) nos pulmes
b) no corao
c) no fgado
d) no bao
e) nos tecidos orgnicos em geral

(
(
(
(

)
)
)
)

COLUNA 2
Brnquias
Traquias
Pulmo
Epiderme

Relacione os animais s estruturas assinalando a


alternativa correta:
a) se a ordem correta for 3, 2, 4, 1.
b) se a ordem correta for 3, 2, 1, 4.
c) se a ordem correta for 2, 3, 4, 1.
d) se a ordem correta for 3, 4, 2, 1.
e) se a ordem correta for 4, 3, 1, 2.

17) (CESGRANRIO-RJ)

21)
FUMO MATA 3 MILHES POR ANO DIZ A
OMS
O maior estudo j realizado sobre os efeitos do
fumo nos ltimos 50 anos concluiu que o tabagismo
se tornou a maior causa de morte entre os adultos
do primeiro mundo.
(Folha de So Paulo
20/09/94)

Nos
esquemas
anteriores
o aparelho
respiratrio humano est sendo representado e neles
so localizadas suas principais estruturas, tais como:
vias areas superiores,
traquia,
brnquios,
bronquolos,bronquolos terminais e sacos alveolares,
que se encontram numerados. Sobre este desenho so
feitas trs afirmativas:

A longo prazo o fumo pode levar o indivduo


morte. Alm disso, a cada cigarro, o fumante absorve
uma substncia , o monxido de carbono, que tem efeito
nocivo imediato no organismo, j que:

I - Em 4, o ar passa em direo aos pulmes


aps ter sido aquecido em 1.
II - Em 6, o oxignio do ar penetra nos vasos
sangneos, sendo o fenmeno conhecido como
hematose.
Ill - Em 8, o gs carbnico proveniente do
sangue passa para o ar.

a) desnatura a hemoglobina, impossibilitando o


transporte de oxignio e gs carbnico.
b) reage com a gua, no plasma sangneo, produzindo
cido carbnico capaz de diminuir o pH do meio celular.
c) ao associar-se com a hemoglobina, impede-a de
realizar o transporte de oxignio.
d) ao combinar-se com a hemoglobina, impossibilita o
transporte e a liberao do gs carbnico pelo
organismo.
e) ao combinar-se com o cido carbnico no plasma,
impede a liberao do oxignio.

Assinale:
a) se somente I for correta
b) se somente II for correta
c) se somente I e II forem corretas
d) se somente I e III forem corretas
e) se I, II e III forem corretas

22) (FUVEST-SP) Alguns vertebrados no possuem


estruturas que funcionalmente facilitem a entrada do ar
nos pulmes, por isso, engolem o ar. Outros j
possuem pulmes elsticos, parenquimatosos, porm
no protegidos por pleuras. Finalmente h aqueles que
possuem pulmes parenquimatosos, protegidos por

18) (UA-AM). Na expirao no ocorre:

81

Pr Vestibular Diferencial

BIOLOGIA

pleura e cuja ao coadjuvada pelo diafragma e


msculos intercostais. Na ordem em que tais fatos se
observam, distinguem-se:

a)
b)
c)
d)
e)

I
rptil
anfbio
ave
rptil
anfbio

II
ave
ave
rptil
anfbio
ave

III
mamfero
mamfero
mamfero
mamfero
rptil

23) Muitos animais aquticos respiram por meio de


brnquias que permitem a respirao mesmo quando os
animais permanecem submersos. A respeito deste tipo
de respirao foram feitas as seguintes afirmativas:

No esquema acima correto dizer que:


a) a estrutura 1 a artria aorta e conduz sangue
arterial a partir do ventrculo direito.
b) ao nvel da estrutura 9, o sangue perde CO2 e
recebe O2, no fenmeno da hematose.
c) a estrutura 2 a artria pulmonar e traz sangue
arterial dos pulmes para o corao.
d) a estrutura 4 faz parte da pequena circulao.
e) na estrutura 5 comeca a grande circulao.

1- Estes animais so aerbios facultativos, pois


podem permanecer muito tempo sem contato com o ar
atmosfrico e quando esto submersos no recebem
oxignio livre.
2- A hematose ocorre nestes animais ao nvel
das brnquias com utilizao do oxignio dissolvido na
gua.
3- Quando submersos, utilizam para sua
respirao oxignio resultante do desdobramento de
molculas de gua e o oxignio resultante da respirao
das plantas aquticas.
4- As brnquias so reservatrios de ar que
permitem aos animais manter, durante o perodo em
que esto submersos, reservas do oxignio obtido na
atmosfera.

4) (CESGRANRIO-RJ) Assinale a opo que encerra o


dado correto em relao ao coraco dos mamferos.
a) 0 trio esquerdo recebe sangue oxigenado vindo do
organismo atravs das veias cavas.
b) 0 trio direito recebe sangue no oxigenado pelas
veias pulmonares.
c) 0 ventrculo esquerdo envia sangue oxigenado para
os vrios setores do organismo.
d) A artria pulmonar leva sangue oxigenado para os
pulmes.
e) 0 ventriculo direito envia sangue oxigenado para o
trio esquerdo.

Assinale a opo correta:


a) Somente 1 est correta
b) Somente 2 est correta
c) Somente 3 est correta
d) Esto corretas 1 e 3
e) Somente 4 est correta

5) (UECE-CE). Relacione as colunas:


(1) irrigao do miocrdio
artria pulmonar
(2) conduz sangue arterial
grande circulao
(3) conduz sangue venoso
pequena circulao
(4) leva O2 para os tecidos
coronrias
(5) retira CO2 da circulao
pulmonar

Parte III: Circulao


1) (FUCMT-MS). Considere os seguintes tecidos
vegetais:
I - xilema
III - floema
II - colnquima
IV - esclernquima
So tecidos condutores apenas:
a)
b)
c)
d)
e)

I e II
I e III
I e IV
I e III
III e IV

) veia

A seqncia numrica da segunda coluna :


a) 2 - 5 - 4 - 1 - 3
b) 2 - 4 - 5 - 1 - 3
c) 3 - 4 - 5 - 1 - 2
d) 3 - 5 - 4 - 1 - 2
e) 2 - 3 - 4 - 5 - 1

2) (UFJF-MG). Com referncia ao nmero de cavidades


do corao, as quais so aurculas (A) e ventrculos (V)
nos vertebrados, marque o item correto, de acordo com
a seguinte ordem:

6) (UFMG-MG). Em relao ao homem, que alternativa


est errada?

Peixes - Anfbios - Rpteis - Aves - Mamferos.


a)
b)
c)
d)
e)

2A-1V, IA-1V, 2A-2V, 2A-1V, 2A-2V


1A-1V, 1A-1V, lA-1V, 2A-2V, 2A-2V
1A-1V, 2A-1V, 2A-1V, 2A-2V, 2A-2V
2A-1V, 2A-2V, lA-2V, 2A-1V, lA-1V
lA-1V, lA-1V, lA-1V, 2A-2V, 2A-2V

a) O sangue venoso, que contm o CO2 excretado


pelas diversas clulas do organismo, passa pelo
coraco e, circulando por veias, vai at os pulmes.
b) Ao nvel dos alvolos pulmonares, o CO2 liberado e
o O2, ,absorvido pelo sangue. Este sangue arterial volta
ao corao, circulando por veias, e bombeado para
todo o corpo, passando pelas artrias.

3) (PUC-RJ).

82

Pr Vestibular Diferencial

BIOLOGIA

c) O alimento, reduzido a subunidades em grande parte


pela ao das enzimas digestivas, passa para os
lquidos circulantes, principalmente ao nvel do intestino
delgado, e ento levado at s clulas.
d) Nas clulas, a energia contida nos alimentos
liberada na presena de 02, com desprendimento de
CO2 e gua.
e) Substncias no utilizadas pelas clulas, que podem
prejudicar o organismo, quando acumuladas, passam
para o sangue, de onde so eliminadas pelos rins e
pelos pulmes.

11) (CESGRANRIO-RJ) Em relao ao sistema


circulatrio nos diversos grupos de animais, so feitas
as seguintes afirmativas:
I - 0 sistema circulatrio, no qual o corao envia
sangue para os tecidos e rgos atravs de vasos e o
recebe de novo parcial ou totalmente atravs de lacunas
do corpo, pode ser denominado de circulao aberta e
est presente na maioria dos invertebrados.
II - 0 sistema circulatrio, no qual o corao funciona
como uma bomba central, tanto enviando como
recebendo o sangue dos tecidos e rgos atravs de
vasos, pode ser denominado de circulao fechada e
est presente nos vertebrados.
III - A presena do corao obrigatria em todos os
sistemas
circuiatrios
existentes
desde
os
invertebrados. A localizao do corao bem como a
constituio e nmero de suas cavidades dependem de
a circulao ser aberta ou fechada.

7) (UFBA-BA). Vlvulas que impedem o refluxo da


circulao podem existir:
a) apenas em artrias
b) apenas em veias
c) em artrias e vasos linfticos
d) em veias e artrias
e) em veias e vasos linfticos
8) (UFMG-MG). Qual dos animais includos na tabela
abaixo tem respirao e sistema circulatrio dos tipos a
ele atribudos?

a)
b)
c)
d)
e)

Mosca
Esponja
Sapo
Caramujo
Peixe

RESPIRAO
Traqueal
Branquial
Cutnea
Pulmonar
Branquial

a)
b)
c)
d)
e)

SISTEMA
CIRCULATRIO
Fechado
Lacunoso
Fechado
Fechado
Lacunoso

Assinale:
se I, II e III estiverem corretas
se somente I e II estiverem corretas
se somente II e III estiverem corretas
se somente II estiver correta
se somente III estiver correta

12.
(PUCSP).
Um
pesquisador,
introduzindo
catteres plsticos atravs de veias e artrias perifricas
de um cachorro, colheu amostras de sangue nos locais
apontados na figura abaixo. Em cada amostra, dosou a
saturao de O2 do sangue. 0 resultado mais provvel
encontrado em relao saturao (SAT) foi:

9) (UCSal-BA). 0 esquema abaixo mostra a ligao


entre capilares venosos e arteriais.

a) SAT6 = SAT5 > SAT4 = SAT3


b) SAT3 = SAT4 > SAT1 = SAT2
c) SAT4 > SAT3 = SAT5
d) SAT6 > SAT5
e) SAT7 = SAT4

Esses capilares localizam-se:


a) no crebro
b) nos pulmes
c) no corao
d) no fgado
e) no intestino

13. (FM de Jundia-SP). O esquema representa a


circulao no homem, vista de frente. A propsito deste
esquema, so feitas trs afirmaes.

10) (UFPA-PA). 0 corao funciona como uma bomba.


Nos mamferos, o sangue com baixo teor de oxignio
enviado aos pulmes. Por outro lado, o sangue
oxigenado nos pulmes mandado para os vrios
setores do organismo.
Assinale a opo correta entre as abaixo
apresentadas.
a) 0 sangue que sai do ventrculo esquerdo enviado
aos pulmes para a oxigenao.
b) 0 trio direito recebe sangue das veias cavas e o
envia para o organismo.
c) As veias pulmonares levam o sangue oxigenado
para o trio esquerdo.
d) 0 ventrculo direito recebe o sangue oxigenado e o
envia para o organismo.
e) A aorta sai do ventrculo direito e transporta sangue
oxigenado.

I - No esquema, o nmero 1 indica o ventrculo


esquerdo e o nmero 9, as veias pulmonares.

83

Pr Vestibular Diferencial

BIOLOGIA
17)
(FMltajub-MG).
Homeotermia
e
corao
completamente dividido em quatro cmaras so
aquisies importantes de:

II - O nmero 4 indica as veias cavas e o nmero 7, a


artria pulmonar.
III - O nmero 2 indica a artria aorta e o nmero 5, a
aurcula direita.
Assinale a opo correta:

a) peixes em relao a protocordados


b) anfbios em relao a peixes
c) rpteis em relao a anfbios
d) aves em relao a rpteis
e) mamferos em relao a aves

a) as opes I e II esto corretas.


b) as opes II e III esto corretas.
c) as opes I e III esto corretas.
d) todas as opes esto corretas.
e) nenhuma das opes est correta.

18) (UFRGS-RS) Atravs de mtodos engenhosos, um


fisiologista conseguiu bloquear vrios capilares
sanguneos em diferentes locais e observou que, em
cada caso, no obstante o bloqueio, as hemcias
continuavam o seu trajeto em direo ao ponto
bloqueado. Essa experincia admite a interpretao:

14) (UFPR-PR). No apresentam mistura de sangues


arterial e venoso:
a) aves e mamferos
b) somente os mamferos
c) aves e rpteis
d) somente as aves
e) todos os vertebrados

a) A presso osmtica diminui ao longo do capilar em


direo ao ponto bloqueado.
b) Os capilares so integrantes de um sistema de
circulao aberta.
c) Na extremidade arterial do capilar entra mais fluido.
d) 0 fluido extravascular, devido ao bloqueio, penetra e
dilata o capilar.
e) 0 fluido do capilar sai para o espao extravascular.

15 (UFBA-BA) 0 grfico abaixo representa a saturao


de hemoglobina em relao substncia X, em
diferentes regies do sistema circulatrio.

19) (UFMA-MA) No corao humano, as vlvulas


tricspide e mitral esto localizadas, respectivamente:
a) entre o trio esquerdo e o ventrculo esquerdo e
entre o trio direito e o ventrculo direito
b) entre o trio direito e o trio esquerdo e entre o
ventrculo direito e o ventrculo esquerdo
c) entre a artria aorta e o ventrculo esquerdo e entre a
artria pulmonar e o ventrculo direito
d) entre o trio direito e o ventrculo direito e entre o
trio esquerdo e o ventrculo esquerdo
e) entre o trio direito e a veia cava superior e entre o
trio direito e a veia cava inferior.

A substncia X :
a) o gs carbnico
b) o monxido de carbono
c) o oxignio
d) o carbonato
e) o acar

20) (UA-AM). A aurcula esquerda recebe o sangue


proveniente diretamente do(a):

16) (CESGRANRIO-RJ). As figuras abaixo representam,


tipicamente, os coraes de:

a) ventrculo direito
b) pulmo
c) fgado
d) aurcula direita
e) ventrculo esquerdo
21) (UFRN-RN). Os coraes de tubaro, de jacar e
de salamandra possuem, respectivamente:
a) 2, 3 e 4 cavidades
b) 3, 3 e 3 cavidades
c) 2, 4 e 3 cavidades
d) 3, 2 e 4 cavidades
e) 2, 3 e 3 cavidades
22) (UFJP-PB). Assinale a resposta correta usando a
seguinte chave:
a) Somente 1 est correta.
b) Somente 2 est correta.
c) Somente 3 est correta.
d) Esto corretas 1 e 3.
e) Esto corretas 2 e 3.

a) 1 - rptil; 2 - anfbio; 3 - peixe; 4 - mamfero


b) 1 - rptil; 2 - mamfero; 3 - peixe; 4 - anfibio
c) 1 - peixe; 2 - anfbio; 3 - mamfero; 4 - rptil
d) 1 - peixe; 2 - anfbio; 3 - rptil; 4 - mamfero
e) 1 - mamfero; 2 - peixe; 3 - anfbio; 4 - rptil

Com relao ao corao e circulao foram feitas as


seguintes afirmativas:

84

Pr Vestibular Diferencial

BIOLOGIA
a) 2 aurculas e 2 ventrculos.
b) 2 aurculas e 1 ventrculo.
c) 1 aurcula e 1 ventrculo.
d) 1 aurcula e 2 ventrculos.
e) 2 aurculas e 1 ventrculo subdividido.

1. No sistema circulatrio dos vertebrados, as


artrias so os principais stios de troca entre sangue e
tecidos.
2. A artria pulmonar conduz sangue arterial para os
pulmes.
3. No indivduo, aps o nascimento, as veias
pulmonares so as nicas veias que conduzem o
sangue arterial

29) (SANTA CASA - SP) O sangue sofre menor


transformao ao passar:
a) pelos pulmes.
b) pelos rins.
c) pelo corao.
d) pelo intestino delgado.
e) pelo pncreas.

23) (OSEC-SP). Mistura de sangues arterial e venoso


ocorre, como regra geral, no corao de:
a) peixes e anfbios
b) anfbios e rpteis
c) rpteis e aves
d) aves e mamferos
e) mamferos e peixes

30) (UFPR) O transporte de oxignio no organismo


humano se faz:
a) atravs dos leuccitos
b) atravs do plasma sangneo.
c) tanto pela hemoglobina plasmtica como pela
existente no interior das hemcias, quando taxa de
hemoglobina normal.
d) atravs da hemoglobina existente nas hemcias.
e) na dependncia de boa funo plaquetria.

24) (CESGRANRIO-RJ). Nas opes abaixo, esto


relacionadas cavidades cardacas e vasos sangneos.
Assinale aquela que rene cavidades e vasos nos
quais, no homem adulto, o sangue encontrado
sempre sangue arterial.
a) ventrculo esquerdo, aorta e artria pulmonar
b) aurcula esquerda, veia pulmonar e aorta
c) ventrculo direito, artria pulmonar e aorta
d) aurcula direita, veia cava e veia pulmonar
e) ventrculo direito, veia pulmonar e artria pulmonar

31) (FUVEST-GV) Nos mamferos, pode-se encontrar


sangue venoso...
a) na aurcula direita, na artria pulmonar e na veia
cava.
b) no ventrculo direito, na veia pulmonar e na veia
cava.
c) na aurcula direita, na veia pulmonar e na artria
aorta.
d) na aurcula esquerda, na artria pulmonar e na veia
cava.
e) no ventrculo esquerdo, na veia pulmonar e na artria
aorta.

25) (F.Objetivo-SP). Existem nos mamferos 2 circuitos


completos de circulao sangunea, com sada e
chegada no corao; so as chamadas grande
circulao e pequena circulao.
Chamando o ventrculo direito de VD, o ventrculo
esquerdo de VE, a aurcula direita de AD e a aurcula
esquerda de AE, escolha a alternativa correta:
CIRCULAO
GRANDE
Sada
a) VD
b) VE
c) VE
d) VD
e) AD

chegada
VE
VD
AD
AE
VE

PEQUENA
sada
AD
AE
VD
VE
AE

32) Observe a figura abaixo:


chegada
AE
AD
AE
AD
VD

26) (CESGRANRIO-RJ) Quantas cavidades existem,


respectivamente, no corao de uma tartaruga, de um
cao, de um golfinho e de uma baleia?
a) 2, 3, 3 e 4 cavidades.
b) 2, 2, 2 e 2 cavidades.
c) 3, 2, 3 e 3 cavidades.
d) 3, 3, 4 e 4 cavidades.
e) 3, 2, 4 e 4 cavidades.
27) A trajetria
chamada:

A respeito dela podemos concluir que:


a) o acar transportado pelos vasos do xilema s
folhas e s razes.
b) a seiva ascendente transportada pelo xilema, e a
descendente, pelo floema.
c) a translocao s ocorre da folha para a raiz.
d) sendo a raiz uma regio com baixa presso de turgor,
consome o acar transportado.
e) sendo o ramo terminal em crescimento uma regio
com baixa presso de turgor, no consome o acar
transportado.

corao pulmo corao

a) circulao fechada.
b) circulao aberta.
c) grande circulao.
d) pequena circulao.
e) circulao linftica.

33)
Relacione as descries dos Sistemas
Circulatrios com seus respectivos Filos animais:

28) O corao dos mamferos possui:

85

Pr Vestibular Diferencial

BIOLOGIA
d) estmatos e exsudao.
e) pontuaes e gutao.

I - Ausente. O alimento distribudo diretamente da


cavidade gastrovascular.
II - Ausente. O alimento distribudo pelo intestino
muito ramificado.
III - Ausente. O alimento distribudo pelo fluido da
cavidade pseudocelmica.
IV - Presente. Do tipo fechado, com vasos pulsteis e
sangue dotado de pigmentos respiratrios.
V - Presente. Do tipo aberto, com corao e vasos
sangneos, onde circula o fluido celmico.
P - Artrpodes S - Nematelmintos
Q
Aneldeos
T - Platelmintos R - Moluscos
U - Cnidrios

3) (OMEC-SP) Os rins, alm de importante funo


excretora contribuem de maneira eficiente:
a) na manuteno do equilbrio endcrino.
b) no metabolismo dos acares
c) na manuteno da composio sangunea.
d. na manuteno da temperatura
e. no metabolismo dos lipdios.

4) (UC-MG) O filtrado glomerular percorrer,


seqencialmente, no nfron, os seguintes componentes:
a) cpsula de Bowman - tbulo contorcido proximal ala de Henle - tbulo contorcido distal
b) cpsula de Bowman - tbulo contorcido proximal ala de Henle - tbulo coletor.
c) glomrulo - ala de Henle - tbulo contorcido proximal
- tbulo coletor.
d) glomrulo - tbulo coletor - ala de Henle - tbulo
contorcido proximal.
e) tbulo contorcido proximal - cpsula de Bowman ala de Henle - tbulo contorcido distal.

Assinale a opo que contm as associaes corretas.


a) I - P; II - Q; III - R; IV - S; V - T
b) I - P; II - Q; III - R; IV - T; V - U
c) I - P; II - Q; III - R; IV - U; V - T
d) I - U; II - T; III - S; IV - Q; V - P
e) I - U; II - T; III - R; IV - Q; V - S
34) A irrigao do msculo cardaco, propiciando sua
nutrio e sua oxigenao, ocorre atavs das:

5) Correlacione no quadro de opes abaixo as formas


de excreo com os respectivos organismos abaixo
desenhados e numerados.

a) artrias aorta e pulmonar


b) veias pulmonares
c) veias cavas anterior e posterior
d) artrias coronrias
e) artrias pulmonar e cartidas
Parte IV: Excreo

Rins
Nefrdia
metanfricos s

1) (Cesgranrio-R)) Em alta madrugada, quando o ar est


muito mido, comum observar-se que as pontas e as
bordas das folhas de muitas plantas ficam cobertas de
gotculas de gua. A explicao para esse fenmeno :

a)
b)
c)
d)
e)

a) As gotculas de gua observadas de madrugada nos


rgos foliares de certas plantas significam que, durante
a noite, a transpirao reduzida e o excesso de gua
absorvida pelo vegetal eliminado pelos hidatdios.
b) As gotculas de gua referidas so explicadas pela
botnica como um caso de excreo da gua, sob forma
lquida, atravs do aparelho estomtico e da cutcula
foliar, visto que os hidatdios se fecham noite.
c) As gotculas de gua verificadas de madrugada, nas
pontas e nas bordas das folhas de muitas Plantas, so
produzidas simplesmente pelo sereno, nada tendo a ver
com a sua atividade vital.
d) As gotculas de gua observadas de madrugada, nas
pontas e bordas das folhas de muitas plantas, significam
que houve, durante a noite, intensa atividade
clorofiliana.
e) As gotculas de gua referidas significam que a
transpirao das plantas foi muito intensa durante a
noite, ocorrendo a excreo da gua pelo aparelho
estomtico, pelos hidatdios e pela cutcula foliar.

5
4
3
4
5

3
3
4
5
4

Vacol Tubos
o
de
pulstil Malpig
hi
2
4
1
5
2
5
2
3
1
3

Clulas
flama

1
2
1
1
2

6. (PUC-SP) Em decorrncia da baixa ingesto de gua


pelo organismo, pode-se prever que:
a) diminua a presso osmtica do sangue.
b) os tbulos renais fiquem mais permeveis gua.
c) diminua a taxa de hormnio antidiurtico liberado na
circulao.
d) aumente a secreo de aldosterona e diminua a de
hormnio antidiurtico.
7) (FMCSC-SP) Os animais tm adaptaes para:
I. remover produtos finais do metabolismo.
II. manter diferentes ons em concentraes
adequadas.
III. manter a gua do organismo em quantidade
adequada.

2) (OMEC-SP) H plantas que, embora saturadas de


gua, continuam a absorv-la, eliminando o excesso
atravs de poros especiais e sob forma lquida. Estes
poros
e
o
fenmeno
envolvido
recebem,
respectivamente, os nomes de:

0 sistema excretor est relacionado:


a) apenas com I.
b) apenas com I e II.
c) apenas com I e III.
d) apenas com II e III.
e) com I, II e III.

a) hidatdios e gutao.
b) hidatdios e transpirao.
c) estmatos e transpirao.

86

Pr Vestibular Diferencial

BIOLOGIA

8 (FCC) Os sistemas excretores dos animais tm em


comum

a) Nos animais aquticos, a amnia transformada em


cido rico (muito solvel), o qual eliminado atravs
da pele.
b). Os mamferos eliminam os radicais nitrogenados na
forma de uria, a qual, insolvel na urina, perde
totalmente a ao txica.
c). Os insetos e rpteis, por exemplo, eliminam os
radicais nitrogenados na forma de produtos de baixa
solubilidade, j que seu suprimento de gua limitado.
d). Os embries de aves, fechados na casca do ovo,
excretam uria, o que no os prejudica por esta se
acumular no alantide, onde deixa de ser perigosa
e). Animais que apresentam tubos de Malpighi (barata,
por exemplo) polimerizam a amnia em tais estruturas e
enviam os polimerizados (os poliuretanos) para os
intestinos, onde so eliminados juntamente com as
fezes.

a). a estrutura e a funo, que manter constante o teor


de certas substncias no interior do organismo.
b) apenas a funo, que eliminar do organismo os
alimentos no digeridos.
c) a estrutura e a funo, que manter o equilbrio
hdrico do organismo.
d) apenas a funo, que manter o equilbrio total do
meio interno.
e) apenas a funo, que manter o equilbrio hdrico do
organismo.
9) (UFSC) Cada ureter conduz a urina:
a) do rim bexiga.
b) da bexiga ao meio externo.
c) da bexiga ao rim.
d) do bacinete aos clices.
e) dos clices aos bacinetes.

14) (FM U/FIAM-SP) Assinale a alternativa incorreta


relacionada com a excreo no rim humano.

10) (Med. Santos-SP) Homeostase :

a) A substncia que passa em maior abundncia do


sangue para a cpsula de Bowman a gua.
b) A maior parte do lquido filtrado absorvida nos
tbulos renais.
c) Em condies normais, substncias como vitaminas,
hormnios e glicose, filtradas na cpsula de Bowman,
so reabsorvidas nos tbulos renais.
d) Os tbulos renais podem absorver ou deixar passar
cloreto de sdio, dependendo da concentrao dessa
substncia no sangue.
e) 0 principal produto da excreo eliminado pe!os rins
a amnia, que provm das protenas ingeridas.

a) a tendncia que os organismos apresentam para


regular seu meio interno, mantendo-o em equilbrio
dinmico quanto sua composio.
b) a tendncia que certos organismos apresentam de
manter inalterado o nvel de certas substncias
qumicas, essenciais ao desenvolvimento.
c) a capacidade de regulao do contedo de gua no
meio interno que banha as clulas.
d) uma parada da circulao do sangue, em uma rea
determinada de um organismo, frequentemente em
decorrncia de choque traumtico.
e) a capacidade que uma clula de permitir ou no a
passagem de gua atravs da membrana plasmtica.

15) (UFSC) Os tubos de Malpighi promovem a excreo


por osmose a partir da hemolinfa. Eles formam o
aparelho excretor nos

11) (MACK SP) 0 sangue deve passar por um processo


de filtrao, na cpsula de Bowman. Logo aps, esse
lquido circula atravs de estruturas, em que ocorrem
outros processos de reabsoro e secreo de
substncias, modificando muito a composio final do
filtrado. Esses ocorrem, particularmente:

a) crustceos
b) insetos
c) nematelmintos

d) aneldeos
e) platelmintos

16) (PUC-SP) (A) so clulas especializadas em (B) e


encontradas nos (C).

a) nas clulas hepticas.


b) nas ilhotas de Langerhans.
c) nos nfrons.
d) nas microvilosidades intestinais.
e) na medula ssea.

A frase acima tornar-se- correta se os espaos em


forem substitudos, respectivamente, por:
a) clulas-flama - excreo - platelmintos
b) clulas-flama - defesa - celenterados
c) coancitos - captao de alimentos - celenterados
d) cnidoblastos - defesa - porferos
e) cnidoblastos - excreo - celenterados

12) (FCC - Jundia - Rio Preto) Qual das alternativas


permite completar, corretamente a frase seguinte:
'" As clulas dos mamferos eliminam ( I ) para o
sangue e, no fgado, essa substncia converte-se em ( II
)

17) (UFPA) Nos mamferos, a comparao do contedo


de glicose, sais minerais e protenas do sangue com o
contedo da cpsula de Bowman em seus rins
mostraria, no fluido da cpsula

a) I = amnia; II = cido rico


b) I = amnia; II = uria.
c) I = uria; II = amnia.
d) I = uria; II = cido rico
e) I = cido rico; II = uria.

a) somente sais minerais.


b) somente protenas.
c) somente glicose.
d) sais minerais.
e) sais minerais e glicose.

13) (Unifor-CE) No aproveitamento dos cidos aminados


como fonte de energia, os animais removem seus
grupos amina pela "deaminao", do que resulta a
amnia, altamente txica; que deve, pois, ser eliminada
do organismo e rapidamente.
Sobre isso, apontar a alternativa correta:

18) (PUC-SP) Os tbulos renais tm a capacidade de


reabsorver toda a glicose filtrada a partir do plasma,
desde que a glicemia (taxa de glicose no plasma) no

87

Pr Vestibular Diferencial

BIOLOGIA
d) filtrado glomerular mais substncias secretadas no
tbulo.
e) filtrado glomerular adicionado de substncias
secretadas e diminudo de gua e outras substncias
reabsorvidas no tbulo.

ultrapasse determinado valor (ao redor de 180 mg%). A


partir desse valor, o excesso de glicose filtrado
totalmente excretado na urina. Indique o grfico que
melhor representa esta condio:

23. D origem ao ureter:


a) nfron.
b) glomrulo.
c) tubo coletor.
d) bacinete.
e) cpsula de Bowman.
24. A unidade funcional do rim chamada de :
a) nfron.
b) glomrulo.
c) tubo coletor.
d) bacinete.
e) cpsula de Bowman.
25. (UFPE) No homem, aproximadamente, 99% da gua
do filtrado glomerular so reabsorvidos, principalmente
ao nvel da (o):
a) cpsula de Bowman
d)
tbulo
proximal.
b) ureter
e) bexiga
c) glomrulo de Malpighi

19) (E Objetivo-SP) A funo dos rins nos mamferos :


a). armazenar urina.
b). produzir uria e cido rico.
c). realizar reaes de desaminao.
d). regular a composio qumica do meio interno
e). libertar o sangue de substncias no digeridas.

26. (FUND. C. CHAGAS-SP) Qual das alternativa


permite completar, corretamente, a frase seguinte:
"As
clulas
dos
mamferos
eliminam_______(1)_______ para o sangue e, no
fgado,
essa
substncia
converte-se
em
________(2)___________".

20. (FCC) 0 hormnio antidiurtico (ADH) regula o teor


de gua do corpo humano, determinando aumento de
reabsoro de gua nos tbulos renais. Assim, quando
o suprimento de gua do corpo for excessivo, espera-se
encontrar no sangue:

a) 1 = amnia;
b) 1 = amnia:
c) 1 = uria;
d) 1 = uria;
e) 1 = cido rico;

a) pouco ADH, o que reduz a reabsoro de gua.


b) pouco ADH, o que aumenta a reabsoro de gua.
c) nenhum ADH, o que eleva, no mximo, a reabsoro
de gua.
d) muito ADH, o que reduz a reabsoro de gua.
e) muito ADH, o que aumenta a reabsoro de gua.

2 = cido rico
2 = uria
2 = amnia
2 = cido rico
2 = uria

27. (VUNESP) Na formao da urina em mamferos, a


filtrao do sangue ocorre:
a) nos corpsculos renais.
d) na ala de Henle
b) no tbulo contorcido proximal
e) na bexiga urinria
c) no tbulo contorcido distal

21. (PUCC-SP) Os seguintes animais: rato, pombo,


crocodilo, sapo e piranha, quando adultos possuem,
respectivamente, rins do tipo:
a) metanefro
mesonefro
b) metanefro
pronefro
c) metanefro
mesonefro
d) metanefro
mesonefro
e) metanefro
pronefro

contornado

- metanefro - metanefro - metanefro -

28) Quando se bebe cerveja, observa-se que h


aumento do volume de urina. A provvel causa desse
fato :

- metanefro - mesonefro - mesonefro - metanefro - metanefro - mesonefro -

a) a diminuio da produo de adrenalina.


b) o aumento da presso osmtica do plasma
sangneo.
c) o aumento de concentrao da urina na bexiga.
d) a inibio da produo do hormnio antidiurtico.
e) a estimulao da produo do hormnio responsvel
pelo controle da diurese.

- metanefro - mesonefro - mesonefro - mesonefro - mesonefro - mesonefro -

22.
(OSEC-SP) A composio qumica da urina
excretada pelos rins humanos :

29) A gua do mar contem, aproximadamente, trs


vezes mais sais que o nosso sangue. Nossos rins
podem excretar uma soluo salina de concentrao
intermediria entre a gua do mar e a do nosso sangue.

a) exatamente igual do filtrado glomerular.


b) filtrado glomerular menos gua reabsorvida no tbulo.
c) filtrado glomerular menos substncias reabsorvidas
no tbulo.

88

Pr Vestibular Diferencial

BIOLOGIA

A ingesto de gua do mar por um nufrago acarreta,


entre outras coisas:

6) (UFPA-PA) A concentrao de glicose mantida


praticamente constante no sangue devido ao de
trs hormnios.

a) apenas desidrataa dos tecidos.


b) apenas diminuio do volume sanguneo.
c) apenas aumento do volume sanguneo.
d) desidratao dos tecidos e diminuio do volume
sanguneo.
e) desidratao dos tecidos e aumento do volume
sanguneo.

a) insulina, adrenalina e glucagon.


b) insulina,triiodotironina e tiroxina.
c) insulina,adrenalina e tiroxina.
d) insulina, tiroxina e glucagon.
e) insulina, glucagon e triiodotironina.
7) (UFRGS-RS) Os hormnios gonadotrficos ou
sexuais, que entram em atividade no perodo da pradolescncia para regerem a vida sexual, agem
especificamente
sobre
as
glndulas
sexuais,
determinando seu crescimento e maturao normal.
Indiretamente, so responsveis pelos caracteres
sexuais secundrios. A glndula que produz estes
hormnios chama-se:

Parte V: Coordenao Hormonal


1) (FUVEST) Considere as seguintes funes do
sistema endcrino:
1- controle do metabolismo do acar.
2- preparao do corpo para situaes de
emergncia.
3- controle de outras glndulas endcrinas.
As glndulas que correspondem a essas funes so,
respectivamente:

a) pncreas.
b) supra-renal.
c) timo.
d) tireide.
e) hipfise.

a) salivar, tireide, hipfise.


b) pncreas, hipfise, tireide.
c) tireide, salivar, adrenal.
d) salivar, pncreas, adrenal.
e) pncreas, adrenal, hipfise.

8) (ACAFE-SC) As auxinas so hormnios relacionados


com o crescimento dos vegetais.

2) (FUVEST) O hormnio folculo-estimulante induz as


clulas foliculares a liberar estrgeno, responsvel pelo
crescimento do endomtrio.
As estruturas relacionadas com a descrio
acima so:
a) hipfise, tireide e testculo.
b) hipfise, ovrio e tero.
c) tireide, supra-renal e tero.
d) pncreas, ovrio e supra-renal.
e) pncreas, tireide e testculo.

O grfico acima demonstra que:


I - A auxina nem sempre estimula o
crescimento, podendo tambm inibi-lo, dependendo da
sua concentrao e do rgo que atua.
II - Concentraes maiores de auxina
estimulam o crescimento do caule e passam a inibir o da
raiz.
III - O timo de concentrao de auxina no
varia para as diferentes partes de uma mesma planta.

3) (FUVEST) Num ciclo menstrual de 28 dias, a


ovulao normalmente ocorre:
a) no primeiro dia da menstruao.
b) ao redor do 14 dia aps o incio da menstruao.
c) no ltimo dia da menstruao.
d) ao redor do 7 dia aps o incio da menstruao.
e) ao redor do 28 dia aps o incio da menstruao.

Esto corretas:

4) (FCMSCSP) A deficincia de auxinas na raiz de uma


planta resulta, em ltima anlise, na inibio:

a) I e II
b) I, II e III
c) I e III
d) apenas I
e) apenas II

a) da elongao celular.
b) da formao de tecidos.
c) da diviso celular.
d) do crescimento em espessura.
e) da formao de razes secundrias.

9) (CESGRANRIO) Curvando-se uma plantinha em


ambiente escuro provido de uma pequena abertura, de
modo a permitir uma iluminao unilateral, verifica-se
que o vegetal cresce inclinando-se em direo fonte
lumnosa. Tal curvatura explicada:

5) (FEEQ-CE) A liberao dos hormnios vasopressina,


adrenalina e insulina efetuada, respectivamente, pelas
glndulas endcrinas:

a) pela maior concentrao de clorofila na face


iluminada.
b) pela ausncia de um tecido de sustentao,
suficientemente desenvolvido, capaz de manter o
vegetal em sua posio normal.
c) pela maior concentrao de auxina na face iluminada,
provocando seu maior crescimento e conseqente
inclinao do vegetal.

a) hipfise, pncreas e supra-renais.


b) pncreas, supra-renais e hipfise.
c) pncreas, hipfise e supra-renais.
d) hipfise, supra-renais e pncreas.
e) supra-renais, hipfise e pncreas.

89

Pr Vestibular Diferencial

BIOLOGIA

d) pela maior atividade meristemtica na face iluminada


resultante da presena de pigmentos.
e) pela distribuio desigual de auxina nas faces
iluminada e escura do vegetal, ocorrendo maior
concentrao hormonal na face escura.

a) ao dos hormnios da tireide


b) ao da testosterona
c) ao da adrenalina e da prolactina
d) ao dos estrgenos e progesterona ovarianos
e) ao de todos os hormnios da hipfise

10) (UFPR-PR) Sabemos que no ciclo ovulatrio da


mulher h uma interao entre hormnios da hipfise e
hormnios do prprio folculo ovariano. A hipfise
inicialmente produz o hormnio A que estimula a
produo do hormnio B pelo folculo. Aps a ovulao,
forma-se o corpo lteo por estmulo do hormnio C da
hipfise. O corpo lteo secreta, ento, o hormnio D. Os
hormnios A, B, C e D so respectivamente:

14) Indique a alternativa correta, relativa aos hormnios


humanos, suas glndulas produtoras e funes
respectivas.
a) Insulina - pncreas - regula o ciclo menstrual.
b) Progesterona - ovrios - regula a taxa de glicose no
sangue.
c) Glucagon - pncreas - transforma glicognio em
glicose.
d) Andrgenos - medula adrenal - caracteres sexuais
secundrios masculinos.
e) Adrenalina - neuro-hipfise - regula o volume de urina
excretada

a) progesterona hormnio folculo-estimulante


hormnio luteinizante estrgeno.
b) hormnio folculo-estimulante progesterona
estrgeno hormnio luteinizante.
c) estrgeno progesterona hormnio folculoestimulante hormnio luteinizante.
d) hormnio folculo-estimulante estrgeno
progesterona hormnio luteinizante.
e) hormnio folculo-estimulante estrgeno
hormnio luteinizante progesterona.

15) (UFRN) O esquema abaixo representa as


converses de glicose em glicognio, e vice-versa,
promovidas pelos hormnios A e B.

11) (UFPA-PA) H um hormnio que atua na


reabsoro tubular da gua e de certos eletrlitos cuja
liberao deficiente pela hipfise acarreta aumento da
diurese, com hemoconcentrao e sede intensa. Esse
hormnio

conhecido
como
hormnio
antidiabetognico, pois o quadro clnico que a sua
deficincia acarreta chamado diabete inspida.
Trata-se de:

A
Glicose

A e B so respectivamente:
a) glucagon e insulina
b) insulina e citocina
c) insulina e glucagon
d) glucagon e hormnio antidiurtico
e) ocitocina e hormnio antidiurtico

a) ocitocina.
b) insulina.
c) cortisona.
d) adrenalina.
e) ADH.

16) (UFRS) Se analisarmos o sangue de uma pessoa


em situao de perigo ou emergncia, ou num momento
de raiva ou susto, poderemos identificar o aumento do
hormnio:

12) (FAAP-SP) Associe as colunas:


Hormnios
Ocitocina
1)

Ao principal
(
) Desenvolve a parede uterina
( para
implantao do ovo e mantm
a gravidez.
( (
) Contrai a musculatura uterina

Tiroxina
2)
Insulina
(3 (
)
Adrenalina
( (
4)
Progesterona
( (
5)

Glicognio
B

a) tiroxina.
b) corticotrofina.
c) gonadotrofina.
d) ocitocina.
e) adrenalina.
Parte VI: Coordenao Nervosa

) Eleva a presso arterial

1) (UNICAP-PE)
constitudo:

) Controla a glicose no sangue


) Eleva o metabolismo basal

O sistema nervoso perifrico

a) da frao simptica, gnglios e nervos


b) da frao parassimptica, gnglios e nervos
c) do sistema autnomo, gnglios e nervos.
d) dos nervos e gnglios espinais e simpticos.
e) dos nervos cranianos e dos nervos raquianos.

A seqncia correta de cima para baixo :


a) 5, 4, 1, 2, 3
b) 5, 1, 4, 3, 2
c) 1, 5, 4, 2, 3
d) 4, 3, 2, 1, 5
e) 1, 2, 3, 4, 5

2) Os nervos raquianos possuem duas razes - uma


anterior e outra posterior. correto afirmar que:
a) as duas razes so exclusivamente motoras.
b) ambas so exclusivamente sensitivas.
c) as anteriores so sensitivas e as posteriores so
motoras.
d) as posteriores so sensitivas e as anteriores so
motoras.

13) Uma mulher normal, entre os 12 e os 50 anos,


apresenta fenmenos ciclcos mensais que culminam,
com a menstruao. O fenmeno cclico da
menstruao se d, especificamente, devido :

90

Pr Vestibular Diferencial

BIOLOGIA

e) ambas so mistas, pois varivel o sentido em que


ocorre o estmulo nervoso em cada uma delas.

8) Para se observar corpos de neurnios, o melhor seria


fazer lminas para o microscpio a partir de cortes
histolgicos de:

3) (UFGO) Considere as afirmativas:


I- As glndulas salivares tm sua ativao
controlada por nervos do sistema autnomo ou
neurovegetativo.
II- Os movimentos dos olhos so condicionados
por nervos que se originam diretamente no encfalo.
III- Os movimentos dos braos so controlados
por nervos raquianos.
Assinale:

a) nervos raquianos.
b) nervos cranianos.
c) cerebelo.

d) "H" medular
e) crtex medular

9) Dos sistemas abaixo relacionados, qual est


subordinado ao sistema nervoso vegetativo ou
autnomo?
a) sistema muscular estriado.
d) sistema
steo-articular
b) sistema sseo.
e) sistema glandular.
c) todo o sistema de revestimento.

a) se apenas I estiver correta.


b) se apenas II estiver correta.
c) se apenas III estiver correta.
d) se apenas duas afirmativas estiverem corretas
e) se todas as trs afirmativas estiverem corretas

10) Considere os seguintes elementos do sistema


nervoso:

4) (VUNESP) Quando uma pessoa encosta a mo em


um ferro quente, ela reage imediatamente por meio de
um reflexo. Neste reflexo o neurnio efetuador leva o
impulso nervoso para:

I- encfalo
III- nervos cranianos
II- medula
IV- nervos raquidianos
O sistema nervoso central constitudo por:

a) a medula espinhal.
b) o encfalo.
c) os msculos flexores do brao
d) as terminaes sensoriais de calor na ponta dos
dedos.
e) as terminaes sensoriais de dor na ponta dos dedos.

a) II e III
b) III e IV
c) I e II
d) I e III
e) II e IV
11) Um arco reflexo simples exige, pelo menos:

5) Assinale a alternativa que apresenta de forma


correta, a conduo do impulso nervoso nos neurnios
sensorial e motor.

a) um neurnio motor, um gnglio e a medula.


b) um neurnio sensorial, um gnglio e a medula.
c) um neurnio sensorial, dois gnglios e a medula.
d) um neurnio motor, um sensorial e um gnglio.
e) dois neurnios ( um sensorial e um motor) e a
medula.

a) O estmulo nervoso se propaga do dendrito para o


corpo celular e deste para o axnio no neurnio
sensorial, e o inverso no neurnio motor.
b) O estmulo nervoso se propaga do axnio para o
corpo celular e deste para o dendrito no neurnio
sensorial, e o inverso no neurnio motor.
c) O estmulo nervoso se propaga do dendrito para o
corpo celular e deste para o axnio no neurnio
sensorial e no neurnio motor.
d) O estmulo nervoso se propaga do axnio para o
corpo celular e deste para o dendrito, tanto no neurnio
sensorial como no motor.
e) O estmulo nervoso se propaga do dendrito para o
corpo celular ou do corpo celular para o dendrito no
neurnio sensorial e do corpo celular para o axnio no
neurnio motor.

12) Crebro, cerebelo e bulbo so rgos do:


a) sistema nervoso perifrico.
b) sistema nervoso parassimptico.
c) sistema nervoso autnomo.
d) sistema nervoso central
e) As respostas c e d esto corretas
13) Sobre o sistema nervoso dos vertebrados correto
afirmar:
( 01 ) composto de encfalo e medula raquiana ou
espinhal.
( 02) Tem sempre localizao dorsal.
( 04 ) O Sistema Nervoso Central (SNC) compe-se dos
nervos simpticos e parassimpticos.
( 08 ) O SNC tambm conhecido como sistema neuro
vegetativo.
( 16 ) Nos anfbios e peixes o crtex cerebral liso. Por
isso, a sua superfcie menor, dispe de menor nmero
de neurnios.
( 32 ) Ao reflexa toda resposta imediata do sistema
nervoso excitao de um nervo sem a interveno da
vontade do indivduo.

6) Se o cerebelo de um rato for destrudo, ele perder a


capacidade de:
a) digerir alimentos.
b) respirar.
anticorpos.
c) andar.

d) eliminar excretas
e)
produzir

7) A unidade estrutural e fisiolgica no sistema nervoso


denominada:
a) bulbo.
b) neurnio.
c) nfron.

d) axnio
e) gnglio

A opo que contm a soma das afirmativas corretas :


a) 14
b) 63
c) 22

91

Pr Vestibular Diferencial

BIOLOGIA

d) 51
e) 06

A opo que contm erro


:

14) Foi seccionada uma rea do sistema nervoso de um


mamfero. Em seguida, constatou-se que o referido
animal no manteve seu equilbrio corpreo,
permanecendo deitado no cho.
A rea seccionada em questo faz parte:

a)
Em
2
h
armazenamento
de
espermatozides.
b) 3 e 4 produzem
secrees para o smen.
c) 1 e 5 constituem as
gnadas.
d)
Em
6
ocorre
fecundao.
e) 7 constituinte do canal
do parto.

a) do bulbo
b) do cerebelo
c) do hipotlamo
d) das meninges
e) do sistema nervoso autnomo
15) comum nos animais a presena de receptores
especficos ou rgos dos sentidos capazes de obter
informaes ambientais ou corpreas. Aps a captao
destas informaes, impulsos so gerados e
transportados para serem processados e interpretados.
Por onde so transportados e onde ocorre a
interpretao desse estmulos, respectivamente?

4) (UFBA-BA). Com relao figura seguinte sao feitas


quatro afirmativas. Assinale a opo correta seguindo o
cdigo abaixo:

a) SNC e SNA
b) SNA e SNP
c) SNP e SNA
d) SNP e SNC
e) Nenhuma das respostas anteriores
Parte VII: Reproduo
1) (FGV-SP) Associe as estruturas abaixo relacionadas
com a funo realizada por cada uma:
1tbulos
seminferos
2- epiddimo
3clulas
intersticiais do
testculo
4- prstata

( ) local de produo
espermatozides
( ) local de armazenamento
espermatozides
(
) local de produo
hormnio sexual masculino
(
) local de produo
esperma

I - A fecundao, na espcie humana, se d mais


comumente no tero externo de uma das trompas de
Falpio.
II - Quando ocorre a penetrao do espermatozide no
gameta feminino, este ainda se encontra na fase de
ovcito de 2 ordem.
III - Na polispermia verifica-se a entrada de vrios
espermatozides no vulo, justificando a formao de
gmeos.
IV - A razo do grande nmero de espermatozides
eliminados numa ejaculao reside na dificuldade que
eles devem enfrentar at atingir o vulo.

de
de
do
do

a) 1, 2, 3, 4
b) 2, 3, 4, 1
c) 3, 4, 1, 2
d) 4, 3, 2, 1
e) 2, 1, 4, 3

a) se apenas uma afirmativa est certa


b) se nenhuma afirmativa est certa
c) se todas as afirmativas esto certas
d) se apenas uma afirmativa est errada
e) se apenas duas afirmativas esto certas

2) O processo de unio dos ncleos do vulo e do


espermatozide chamado de:

5) (FUVEST-SP) Desde a sua origem at a fecundao


do vulo, o espermatozide humano segue o seguinte
trajeto:

a) segmentao
b) estrobilizao
c) fecundao
d) nidao
e) permutao

a) testculo, epiddimo, canal deferente, uretra, vagina,


tero, trompa de Falpio.
b) testculo, uretra, canal deferente, epiddimo, vagina,
tero, trompa de Falpio.
c) epiddimo, testculo, canal deferente, uretra, tero,
vagina, trompa de Falpio.
d) testculo, prstata, epiddimo, canal deferente, uretra,
vagina, tero, trompa de Falpio, ovrio.
e) canal deferente, testculo, epiddimo, uretra, vagina,
tero, ovrio.

3) (UFMG-MG). Desenhos representativos dos sistemas


genitais masculino e feminino.

6) O esperma normal composto de:


a) espermatozides unicamente.
b) espermatozides e lquido seminal.

92

Pr Vestibular Diferencial

BIOLOGIA
b) metagnese.
c) embriognese.
d) pedognese.
e) poliembrionia.

c) espermatozides, lquido seminal e lquido prosttico.


d) espermatozides, lquido seminal, plasma e lquido
prosttico.
e) espermatozides, sangue, linfa, lquido seminal e
lquido prosttico.

12) (PUC-RS) O chamado Ambystoma tigrinum um


anfbio bastante conhecido em regies pantanosas e
lagos do Mxico. Esta espcie apresenta um fenmeno
interessante: sua larva, que aqutica, atinge a
maturidade sexual sem perder suas caractersticas
larvais, entre as quais vistosas brnquias externas. E
nestas condies se reproduz normalmente.
O texto acima diz respeito ao fenmeno denominado:

7) (UFBA) A reproduo sexuada determina:


a) a manuteno da condio haplide.
b) a especializao de gametas diplides.
c) a fertilizao entre clulas indiferenciadas.
d) a invariabilidade gentica em cada gerao.
e) a variabilidade produzida pela recombinao gnica.

a) isogamia.
b) monospermia.
c) neotenia.
d) oogamia.
e) esporogamia.

8) (F.OBJETIVO-SP) Em certos animais como, por


exemplo, as abelhas, o vulo pode se desenvolver,
dividindo-se sucessivamente, dando origem a um novo
ser. Trata-se de um fenmeno conhecido por:
a) netotenia.
b) pedognese.
c) partenognese.
d) poliembrionia.
e) metagnese.

13) (F.OBJETIVO) Os gmeos monozigticos ou


idnticos originam-se:
a) da diviso de um vulo no fecundado.
b) da diviso de um zigoto originado da unio de um
vulo com um espermatozide.
c) da fertilizao de dois vulos distintos por um s
espermatozide.
d) da fertilizao de dois vulos por dois
espermatozides distintos.
e) da fertilizao de dois vulos exatamente iguais por
dois espermatozides iguais ou diferentes.

9) (FEOA-MG) Observe os desenhos a seguir:

14) (Fuvest-SP) A reproduo sexuada, do ponto de


vista evolutivo, mais importante do que a reproduo
assexuada porque:

Os desenhos representam processos de reproduo


assexuada denominados, respectivamente de:

a) assegura a perpetuao da espcie.


b) promove maior variabilidade gentica.
c) processa-se aps a meiose que produz gametas.
d) permite produzir maior nmero de descendentes.
e) ocorre somente nos animais e vegetais pluricelulares.

a) estrobilizao, brotamento e regenerao.


b) gemulao, brotamento, e regenerao.
c) brotamento, gemulao e bipartio.
d) regenerao, brotamento e bipartio.
e) estrobilizao, gemulao e conjugao

15) (Vunesp-SP) Em abelhas, o macho (zango)


desenvolve-se a partir de vulos no fecundados
(haplides). As rainhas (fmeas frteis) e operrias
(fmeas estreis) desenvolvem-se a partir de ovos
fecundados e diplides. Conclui-se da que:

10) (F.M.Santa Casa-SP) A abelha A encontra-se com a


abelha B, da mesma espcie, mas de outra colmia. Diz
A:
Ol, como vo seu pai e sua me?
Responde B:
Bem, meu pai j morreu mas minha me est tima. E
seus quatro avs, como vo?
Retruca A:
Como quatro, se eu s tenho dois?

I. Os zanges no tm filhos do sexo masculino.


II. As filhas de um zango herdam todos os genes que
seu pai possui.
III. Os zanges no possuem avs paternos.
Assinale a alternativa certa:

Por esse dilogo podemos concluir corretamente que:

a) As concluses acima esto corretas.


b) As concluses acima esto incorretas.
c) Apenas as concluses I e II esto corretas.
d) Apenas as concluses I e III esto corretas.
e) Apenas as concluses II e III esto corretas.

a) A pode ser uma rainha e B uma operria.


b) A uma rainha e B uma operria.
c) A pode ser uma operria e B um zango.
d) A um zango e B pode ser uma rainha mas no
uma operria.
e) A um zango e B uma operria ou rainha.

16) (PUC-RJ) Animais ovulparos apresentam seu


desenvolvimento embrionrio sujeito a pouca proteo,
o que compensado com uma grande produo de
gametas. Assinale a opo que caracteriza
corretamente a fecundao e o desenvolvimento de
animal ovulparo:

11) (UFMG-MG) Larvas brancas de moscas do gnero


Myastor (semelhantes ao bicho da goiaba), so capazes
de produzir vulos que se desenvolvem sem sofrer
fecundao, originando outras larvas. Este fenmeno
reprodutivo recebe o nome de:
a) neotenia.

93

Pr Vestibular Diferencial

BIOLOGIA

a) Lagartos: a fecundao e o desenvolvimento so


externos.
b) Cobras: a fecundao interna, porm o
desenvolvimento embrionrio externo.
c) Sapos: a fecundao interna, porm o
desenvolvimento embrionrio externo.
d) Pererecas: a fecundao e o desenvolvimento
embrionrio so externos.
e) Jacars: a fecundao e o desenvolvimento so
internos.
17) (UFMG) Os objetivos
anticoncepcionais so:

de

alguns

e) Os ovos da maioria dos mamferos so pobres em


vitelo.

21) (Vunesp-SP) Assinale, entre as alternativas abaixo,


a afirmao correta.
a) Tanto os animais ovparos como os ovovivparos
pem ovos com o desenvolvimento embrionrio apenas
iniciado.
b) Tanto os animais oviparos como os ovovivparos
pem ovos com o desenvolvimento embrionrio j
concludo.
c) Tanto os animais ovparos como os ovovivparos
apresentam fecundao externa.
d) Tanto nos animais ovparos como nos ovovivparos,
os embries utilizam as reservas alimentares do ovo
para seu desenvolvimento.
e) Somente nos animais ovparos o filhote eclode fora
do corpo materno.

mtodos

I. Impedir que o vulo alcance a poro superior das


trompas.
II. Impedir que os espermatozides sejam depositados
na vagina.
III. Impedir que os espermatozides depositados na
vagina cheguem ao tero.
O uso da camisinha, de diafragma e a ligadura de
trompas atingem, respectivamente, os objetivos:

22) (Fuvest-SP) Uma senhora deu luz dois gmeos de


sexos diferentes. O marido, muito curioso, deseja saber
algumas informaes sobre o desenvolvimento de seus
filhos, a partir da fecundao. O mdico respondeu-lhe,
corretamente, que:

a) I, II e III.
b) I, III e II
c) II, I e III
d) II, III e I.
e) III, II e I.

a) dois vulos foram fecundados por um nico


espermatozide.
b) um vulo, fecundado por um espermatozide,
originou um zigoto, o qual dividiu-se em dois zigotos,
formando dois embries.
c) um vulo foi fecundado por dois espermatozides,
constituindo dois embries.
d) dois vulos, isoladamente, foram fecundados, cada
um por um espermatozide, originando dois embries.
e) o uso de medicamentos durante a gestao causou
alteraes no zigoto, dividindo-o em dois.

18) (UFSC) O uso de preservativo masculino


("camisinha") tem sido amplamente divulgado e
estimulado nos dias de hoje. Vrias so suas
indicaes, como:
01. evitar doenas como sfilis e gonorria.
02. controle de natalidade.
04. bloqueio da produo de gametas masculinos.
08. preveno da Aids.
16. controle da ovulao.

23) (Cesesp-PE) Com relao a gmeos univitelinos


correto afirmar que:

D como resposta a soma dos nmeros associados s


alternativas corretas.

a) so resultantes da bipartio de vulos no


fecundados e desenvolvidos partenogeneticamente.
b) so resultantes da fecundao de dois vulos e dois
espermatozides, podendo resultar indivduos de ambos
os sexos.
c) so resultantes da bipartio de um s vulo,
fecundado por dois espermatozides, dando individuos
masculinos e femininos ao mesmo tempo.
d) so resultantes da bipartio de um s vulo,
fecundado por um s espermatozide, dando individuos
masculinos e femininos ao mesmo tempo.
e) so resultantes da bipartio de um s vulo,
fecundado por um s espermatozide, resultando
individuos do mesmo sexo.

a) 8
b) 11
c) 10
d) 14
e) 15
19) (Fuvest-SP) Qual a diferena, no desenvolvimento
embrionrio, entre animais com ovos oligolcitos e
animais com ovos telolcitos?
a) Nmero de folhetos embrionrios formados.
b) Presena ou ausncia de celoma.
c) Presena ou ausncia de notocorda.
d) Tipo de segmentao do ovo.
e) Modo de formao do tubo neural.

24) Identifique as estruturas indicadas nas setas e


assinale a alternativa correta:

20) (PUCC-SP) Qual das afirmaes abaixo, relativas a


diferentes tipos de ovos, verdadeira?
a) Ovos com muito vitelo no plo vegetativo tm
segmentao total.
b) Ovos com muito vitelo no centro tm segmentao
discoidal.
c) Ovos oligolcitos tm segmentao parcial.
d) Os ovos da maioria dos artrpodos so oligolcitos.

94

Pr Vestibular Diferencial

BIOLOGIA

a) I membrana pelcida; II corona radiata; III


glbulo polar
b) I membrana pelcida; II corona radiata; III
glbulo polar
c) I corona radiata; II membrana pelcida ; III
glbulo polar
d) I corona radiata; II membrana pelcida; III
glbulo polar
e) I espermatozides; II membrana pelcida; III
glbulo polar

1
2
1
2
2

25) (UFRN-RN) O processo de reproduo agmica,


que consiste na diviso sucessiva do ncleo seguida da
fragmentao mltipla do citoplasma, chama-se:
a) brotamento.
b) cissiparidade.
c) estrobilizao.
d) gemiparidade.
e) esporulao.
26) Identifique as estruturas indicadas e assinale a
alternativa correta:

a) cabea acrossoma cauda ncleo mitocndrias


b) cabea ncleo cauda acrossoma mitocndrias
c) ncleo cabea mitocndrias acrossoma cauda
d) acrossoma ncleo mitocndrias cabea cauda
e) acrossoma mitocndrias ncleo cauda cabea
GABARITO
Parte
I
Digesto
123C
A
D
11- 12- 13A
B
E
21- 22- 23A
A
D
Parte
II
Respirao
123A
A
E
11- 12- 13C
D
C
21- 22- 23C
B
B
Parte
III
Circulao
123B
C
E
11- 12- 13B
A
D
21- 22- 23E
C
B
31- 32- 33A
B
D

4A
14B
24A

5D
15A
25D

6E
16A
26E

7B
17A

8D
18C

9B
19C

10E
20A

4B
14D

5D
15E

6E
16A

7E
17D

8C
18C

9C
19E

10D
20A

4C
14A
24B
34D

5C
15A
25C

6A
16A
26E

7E
17D
27D

8C
18E
28A

9B
19D
29C

10C
20B
30D

95

Parte
IV
Excreo
123A
A
C
11- 12- 13C
B
C
21- 22- 23A
C
D

4A
14E
24A

5B
15B
25D

6A
16A
26B

7E
17E
27A

8D
18E
28D

9A
19D
29E

10A
20A

Parte
V

Coordenao
Hormonal
123E
B
B
11- 12- 13E
B
D

4B
14C

5D
15C

6A
16E

7E

8A

9E

10E

Parte
VI

Coordenao
Nervosa
231C
D
E
11- 12- 13E
E
D

4C
14B

5C
15D

6C

7B

8D

9E

10C

Parte VII
Reproduo
123A
C
D
11- 12- 13D
C
B
21- 22- 23D
D
E

4D
14B
24C

5A
15E
25E

6C
16D
26D

7E
17D

8C
18B

9A
19D

10E
20E

Pr Vestibular Diferencial

BIOLOGIA

EXERCCIOS DE PORFEROS E CNIDRIOS


01) (UNIRIO) Qual das alternativas abaixo justifica a
classificao das esponjas no sub-reino Parazoa?
a) Ausncia de epiderme.
b) Ocorrncia de fase larval.
c) Inexistncia de rgos ou de tecidos bem definidos.
d) Hbitat exclusivamente aqutico.
e) Reproduo unicamente assexuada.
02) (FUVEST) A caracterstica abaixo que no condiz
com os porferos :
a) respirao e excreo por difuso direta.
b) obteno de alimentos a partir das partculas trazidas
pela gua que penetra atravs dos stios.
c) hbitat aqutico, vivendo presos ao fundo.
d) clulas organizadas em tecidos bem definidos.
e) alta capacidade de regenerao.
03) (UFBA) No processo digestivo das esponjas, atuam
clulas de dois tipos: umas englobam o alimento e
fazem a digesto intracelular; outras distribuem a todas
as demais clulas o produto dessa digesto. So elas,
respectivamente:
a) solencitos e macrfagos.
d) histicitos e amebcitos.
b) coancitos e amebcitos.
e) coancitos e histicitos.
c) cnidoblastos e nematocistos.
04) (UFJF-MG) Observe as seguintes afirmativas:
I - A grande capacidade regenerativa das esponjas
revela a pequena interdependncia e diferenciao de
suas clulas.
II - A gua que circula pelo corpo de uma esponja segue
o trajeto: sculo - trio - stios.
III - Nem todas as esponjas possuem espculas
calcrias ou silicosas.
Assinale:
a) se apenas I estiver correta.
b) se apenas I e II estiverem corretas.
c) se I, II e III estiverem corretas.
d) se apenas II e III estiverem corretas.
e) se apenas I e III estiverem corretas.
05) (UFBA) No mesnquima dos espongirios,
podemos encontrar clulas com diversas funes,
exceto:
a) originar gametas.
b) transportar substncias para outras clulas.
c) produzir espculas calcrias ou silicosas.
d) transmitir estmulos nervosos.
e) contribuir na digesto intracelular.
06) (UFV-MG) O principal papel dos coancitos nos
porferos :
a) transportar substncias para todo o animal.
b) originar elementos reprodutivos.
c) formar o esqueleto do animal.
d) provocar a circulao da gua no animal.
e) dar origem a outros tipos de clula.
07) (UNIFOR-CE) A figura abaixo mostra o ciclo de vida
de um cnidrio.

A fase que ocorre logo aps a reproduo sexuada a


representada em:
a) I.
b) II.
c) III.
d) IV.
e) V.
08) (UFPR) Relacione as colunas e assinale a
alternativa correta:
( ) Cavidade central das esponjas.
(1) Coancitos
(
)
Clulas
de
defesa
dos
(2)
Clulas
celenterados.
nervosas
( ) Mesoglia, abaixo da epiderme.
(3) trio
( ) Digesto intracelular dos porferos.
(4) Mesnquima
( ) Camada mdia da estrutura dos
(5) Cnidoblastos
porferos.
a) 3 - 2 - 5 - 1 - 4.
d) 3 - 5 - 2 - 4 - 1.
b) 5 - 3 - 2 - 1 - 4.
e) 3 - 5 - 2 - 1 - 4.
c) 5 - 2 - 3 - 1 - 4.
09) (VUNESP-SP) Sobre os celenterados so feitas trs
afirmativas. Observe-as:
I - A maioria dos cnidrios tm hbitat aqutico, sendo
poucas as espcies de hbitat terrestre, as quais so
representadas por plipos.
II - Os cnidrios so urticantes e, para isso, dispem de
baterias
de
clulas
especializadas
chamadas
coancitos.
III - Alguns cnidrios se reproduzem por alternncia de
geraes, quando ento os plipos do medusas e as
medusas do plipos.
Assinale:
a) se apenas uma afirmativa estiver correta.
b) se as afirmativas I e II estiverem corretas.
c) se as afirmativas I e III estiverem corretas.
d) se as afirmativas II e III estiverem corretas.
e) se as trs afirmativas estiverem corretas.
10) (FUVEST) A Grande Barreira de Recifes se estende
por mais de 2000 km ao longo da costa nordeste da
Austrlia e considerada uma das maiores estruturas
construdas por seres vivos. Quais so esses
organismos e como eles formam esses recifes?
a) esponjas - custa de secrees calcrias.
b) celenterados - custa de espculas calcrias e
silicosas do seu corpo.
c) plipos de cnidrios - custa de secrees calcrias.
d) porferos - custa de material calcrio do terreno.
e) cnidrios - custa de material calcrio do solo, como
a gipsita.
11) (UFV-MG) A digesto dos celenterados ocorre:
a) nos meios intra e extracelulares.

96

Pr Vestibular Diferencial

BIOLOGIA

d) no meio intracelular.
b) no meio extracelular.
e) no celoma posterior.
c) no celoma anterior.
12) (ACAFE-SC) De acordo com a complexidade, as
esponjas so classificadas em trs tipos.
a) Cite os tipos.
b) Caracterize um dos tipos.
13) (UNICAMP-SP) Discuta uma estratgia para
obteno de alimentos e incorporao de nutrientes,
entre invertebrados que apresentam dois folhetos
germinativos durante seu desenvolvimento embrionrio.
14) (FUVEST-SP) Por que as medusas podem, pelo
simples contato, levar pequenos animais morte ou
provocar irritaes cutneas em seres humanos?
15) (FUVEST-SP) Existem semelhanas entre o ciclo de
vida de muitos animais cnidrios (guas-vivas, por
exemplo) e o ciclo de plantas como musgos e
samambaias:
a) Qual o tipo de ciclo de vida compartilhado por esses
seres?
b) o que caracteriza esse tipo de ciclo?

- GABARITO - PORFEROS E CNIDRIOS 01 - C


02 - D
03 - B
04 - E
05 - D

06 - D
07 - C
08 - E
09 - A
10 - C

11 - A

97

Pr Vestibular Diferencial

BIOLOGIA

EXERCCIOS ECOLOGIA
a) nicho ecolgico
d) produtividade primria
b) habitat preferencial
e) territorialidade social
c) plasticidade ecolgica

Parte I: Introduo Ecologia


1) (PUC-SP) O conjunto do ambiente fsico e dos
organismos que nele vivem conhecido como:

8) ( MED. SANTOS) Assinale a alternativa CORRETA:

a) bitopo
b) ecossistema
c) biomassa
d) bioma
e) comunidade

a) Em Ecologia, a COMUNIDADE inclui grupos de


indivduos de uma mesma espcie de organismos.
b) Em Ecologia, a POPULAO inclui todos os
indivduos de uma mesma rea, pertencentes ou no a
vrias espcies.
c) Em Ecologia, o ECOSSISTEMA a poro da terra
biologicamente habitada.
d) Em Ecologia, a BIOSFERA o conjunto formado pela
comunidade de indivduos vivos e o meio ambiente
inerente.
e) Nenhuma das anteriores.

2) (MOGI) Ao conjunto de indivduos de diferentes


espcies habitando determinada rea d-se o nome de:
a) ecossistema
b) comunidade
c) populao
d) bioma
e) biosfera

9) (CESCEM) So ecossistemas todos os exemplos


abaixo, EXCETO:

3) Com relao aos conceitos de HABITAT e NICHO


ECOLGICO, marque a opo correta relacionada
abaixo:

a) uma astronave.
b) uma lagoa.
c) um pasto.
d) uma colnia de corais.
e) o solo.

a) cobra e gavio ocupam o mesmo habitat.


b) pre e cobra esto no mesmo nicho ecolgico.
c) gavio, cobra e pre esto no mesmo nicho
ecolgico.
d) cobras neste mesmo local ocupam o mesmo nicho
ecolgico.
e) pres podem ocupar o mesmo habitat, mas tm
nichos ecolgicos diferentes.

10) (MED. ABC) Suponha duas plantas pertencentes ao


mesmo gnero e vivendo juntas na mesma rea. A
espcie A tem razes que se desenvolvem logo abaixo
da superfcie e a espcie B tem razes profundas.
Sobre as duas plantas fazemos as seguintes
afirmaes:

4) O ambiente descrito, com inmeros animais e


vegetais, beira de um charco de gua doce que,
durante o dia, sofre flutuaes de temperatura,
luminosidade, maior ou menor pH e at alteraes de
salinidade, poder ser classificado como um exemplo
de:

I - A e B vivem no mesmo nicho ecolgico.


II - A e B competem pela gua.
III - A e B formam uma populao.
Assinale:

a) biosfera
b) bitipo
c) biomassa
d) ectone
e) ecossistema

a) Apenas I correta.
b) Apenas II correta.
c) Apenas III correta.
d) I, II e III so corretas.
e) Nenhuma correta.

5) Suponha que em um terreno coberto de capim


gordura vivem savas, gafanhotos, pardais, pres e
ratos-do-campo. Nesta regio esto presentes:

11) (UERJ) Mergulhando em guas costeiras,


encontramos em uma rocha algas, cracas, anmonas,
estrelas-do-mar e ourios-do-mar. As algas produzem
seu prprio alimento. As cracas ingerem, com gua,
seres microscpios que nela vivem. As anmonas
comem pequenos peixes que ficam presos entre seus
tentculos. As estrelas-do-mar prendem seus braos
os moluscos contra a rocha e sugam o animal de dentro
da rocha. Os ourios do mar raspam a rocha com seus
dentes, alimentando-se de detritos. Em funo do que
foi descrito, pode-se afirmar que as algas e os animais
citados apresentam diferentes

a) cinco populaes.
b) seis populaes.
c) duas comunidades.
d) seis comunidades.
e) dois ecossistemas.
6) Indivduos de diversas espcies, que habitam
determinada regio, constituem:
a) um bioma.
b) uma sociedade.
c) uma populao.
d) uma comunidade.
e) um ecossistema.

a) nichos.
b) habitats.
c) mimetismos.
d) competies.
e) biomas.

7) (UA-AM) A posio de uma espcie num ecossistema


ao nvel de desempenho funcional chama-se:

12) (SANTA CASA) Os animais marinhos:

98

Pr Vestibular Diferencial

BIOLOGIA

-que flutuam e so movidos passivamente pelos ventos,


ondas e correntes;
-que nadam livremente por atividade prpria;
-que so restritos ao fundo.

a) A pre, a cobra e o gavio representam uma


populao e um exemplo de uma cadeia alimentar.
b) O conjunto de pres da regio formam uma
populao e os consumidores, entredevorando-se,
formam uma teia alimentar.
c) Pres e cobras do charco formam uma populao e,
para as cobras, as pres so produtoras de alimento.
d) Pres, cobras e gavies formam uma comunidade; as
cobras so consumidores primrios e os gavies
consumidores secundrios.
e) O conceito de produtor est associado ao
fornecimento de alimento e, de consumidor, queles que
o utilizam.

a) planctnicos, nectnicos e bentnicos.


b) planctnicos, bentnicos e nectnicos.
c) nectnicos, bentnicos e planctnicos.
d) nectnicos, planctnicos e bentnicos.
e) bentnicos, planctnicos e nectnicos.
Parte II: Cadeias alimentares
1) (UFF) Os principais produtores da cadeia biolgica
marinha so:

5) Com referncia cadeia alimentar, marque a


alternativa correta:

a) protozorios e coppodes;
b) medusas e corais;
c) diatomceas e dinoflagelados;
d) organismos da fauna planctnica;
e) organismos da fauna bentnica.

a) a energia contida no produtor diminui gradualmente,


ao passar de consumidor a consumidor.
b) a energia do produtor aumenta gradualmente nos
diferentes elementos da cadeia alimentar.
c) o potencial energtico do produtor no sofre nenhuma
alterao nos diferentes segmentos da cadeia alimentar.
d) na cadeia alimentar, como os animais so de
tamanho diferentes , a quantidade energtica do
produtor sofre oscilaes.
e) a complexidade da teia alimentar no interfere com a
quantidade de energia transferida, que permanece
inalterada.

2) (UFRJ) As espcies de capim que crescem nos


campos da Austrlia podem ser diferentes das que
existem na Amrica ou na frica, mas todas tm a
mesma funo: so produtores dos ecossistemas de
campo. Nos campos da Austrlia vivem cangurus, nos
da frica h zebras e na Amrica do Norte h bises.
Todos esses animais exercem em seus ecossistemas a
funo de:

6) (CESGRANRIO) Qual das alternativas a seguir


responde corretamente a seguinte questo: Que
resultaria se desaparecesse do mar o fitoplncton ?

a) consumidores primrios
b) consumidores secundrios
c) consumidores tercirios
d) decompositores
e) parasitas

a) o equilbrio ecolgico desse ecossistema no sofreria


alterao, visto que o fitoplncton constitudo por
seres apenas microscpios.
b) o zooplncton ocuparia o seu lugar na cadeia
alimentar, mantendo assim o equilbrio ecolgico do
ecossistema.
c) a cadeia alimentar do ecossistema perderia o elo
principal, pois do fitoplncton depende praticamente
toda a matria orgnica necessria aos demais
componentes biticos.
d) o ecossistema no seria afetado visto que o plncton
apenas um consumidor na cadeia alimentar.
e) o equilbrio ecolgico no seria alterado visto que
nem todos os organismos marinhos se alimentam do
fitoplncton.

3) (CESGRANRIO)
No ecossistema a seguir
esquematizado, esto representados, de 1 a 8, os
componentes de uma comunidade bitica. Entre eles
encontram-se: produtores, consumidores primrios,
secundrios e consumidores tercirios.

7) Com os elementos pre, capim, cobra, fungos e


bactrias do solo, observe com ateno o diagrama a
seguir. No descuidando da direo das setas e a
seqncia numrica, indique a alternativa correta na
sucesso de eventos.

No quadro abaixo, assinale a opo que


classifica
corretamente
os
componentes
do
ecossistema:

a)
b)
c)
d)
e)

Produtor
es

Consumi
dores
primrios

1e5
3e5
4e5
1e3
1e5

2e8
4e6
1e6
2e7
4e6

Consumi
dores
secundr
ios
3e4
1e8
3e7
6e8
3e7

Consumi
dores
tercirios

6e7
2e7
2e8
4e5
2e8

II

III

I
a) Produtor

4) Tendo em vista os conceitos de CADEIA e TEIA


alimentar,
bem
como
de
POPULAO
e
COMUNIDADE, podemos afirmar que:

99

II
III
Decomposito Consumidor
r
primrio

IV
Consumidor
secundrio

Pr Vestibular Diferencial
b) Produtor
c) Produtor
d) Decompo
sitor
e) Decompo
sitor

Consumidor
secundrio
Consumidor
primrio
Consumidor
primrio
Produtor

BIOLOGIA
Decomposito
r
Consumidor
secundrio
Consumidor
secundrio
Consumidor
primrio

Consumidor
primrio
Decomposito
r
Produtor
Consumidor
secundrio

8) (UBERLNDIA) O aproveitamento das algas pelo


homem torna-se cada vez mais acentuado. Em certos
pases asiticos, as algas j fazem parte da dieta
humana. Neste caso o homem comporta-se como:

a) cobra
b) gavio
c) pssaro
d) inseto
e) capim
6) (FCC) Em uma lagoa so lanados inseticidas
organoclorados. Dos organismos abaixo, os que iro
apresentar, aps algum tempo, maior concentrao
desses inseticidas so:

Parte III: Pirmides Ecolgicas


1) Considere a seguinte cadeia alimentar:
rvore  Herbvoros  Parasitas dos herbvoros
Qual
das
seguintes
pirmides
de
nmeros
correspondente cadeia considerada?

d)

5) (FUVEST) Um dos perigos da utilizao de


inseticidas clorados que eles so muito estveis e
permanecem longo tempo nos ecossistemas. Em vista
disso, dada a cadeia alimentar
capim  inseto  pssaro  cobra  gavio
de esperar que a maior concentrao de DDT por
quilo de organismo seja encontrada em:

a) consumidor primrio.
b) consumidor secundrio.
c) consumidor tercirio.
d) produtor.
e) decompositor.

a)

d) na base so pequenos e abundantes e no topo so


pequenos e pouco numerosos.
e) na base so pequenos e pouco numerosos e no topo
so pequenos e abundantes.

b)

a) os caramujos
b) as garas
c) os peixes
d) os fitoplanctontes
e) os microcrustceos

c)

7) (PUC-RS) Sabe-se que a maioria dos tubares so


animais carnvoros e predadores. No entanto, h
espcies de tubares que se alimentam do plncton,
como, por exemplo, o chamado tubaro-baleia. A
principal vantagem dessas espcies planctfagas sobre
as outras que para elas houve um:

e)

2) Com relao ao fluxo de energia em um ecossistema


correto dizer que:

a) alongamento da cadeia alimentar.


b) maior desenvolvimento do aparelho mastigador.
c) menor desenvolvimento do aparelho branquial.
d) encurtamento da cadeia alimentar.
e) processo mais lento de evoluo.

a) a quantidade de energia que um nvel trfico recebe


superior que ser transferida para o nvel seguinte.
b) o fluxo de energia na cadeia alimentar unidirecional.
c) a energia luminosa captada pelos organismos
hetertrofos.
d) em uma pirmide de energia, a base sempre
ocupada pelos consumidores primrios.
e) no pice de uma pirmide de energia esto colocados
os produtores.

8) (Cesgranrio-RJ) 0 equilbrio biolgico de uma


comunidade depende da proporo existente entre
produtores, consumidores e predadores. Assim, se:
a) o nmero de produtores e consumidores aumentar, o
de predadores diminuir,
b) o nmero de produtores diminuir, o de consumidores
e predadores aumentar.
c) o nmero de consumidores diminuir, o de produtores
aumentar e o de predadores diminuir.
d) o nmero de predadores aumentar, o de produtores e
consumidores aumentar.
e) o nmero de predadores aumentar, o de produtores e
consumidores diminuir.

3) (S. CARLOS) Em um ecossistema, com a passagem


de energia de um nvel trfico para outro, ela:
a) permanece igual.
b) aumenta sempre.
c) diminui sempre.
d) totalmente perdida.
e) totalmente aproveitada.

9) (UFMT) Leia as afirmativas abaixo:

4) (MED - MOGI) A rede alimentar numa comunidade foi


caracterizada com a "pirmide de nmeros", onde os
animais:

I. A energia introduzida no ecossistema sob a forma de


luz transformada, passando de organismo para
organismo sob a forma de energia qumica,
lI. No fluxo energtico, h perda de energia em cada elo
da cadeia alimentar.
III. A transferncia de energia na cadeia alimentar
unidirecional,
tendo
incio
pela
ao
dos
decompositores.

a) na base so pequenos e abundantes e no topo so


grandes e pouco numerosos.
b) na base so pequenos e pouco numerosos e no topo
so grandes e abundantes.
c) na base so grandes e pouco numerosos e no topo
so pequenos e abundantes.

100

Pr Vestibular Diferencial

BIOLOGIA
2) (PUC-SP) O tucunar, peixe trazido da Amaznia
para as lagoas de captao das usinas estabelecidas ou
em construo nos rios Paran, Tiet e Grande,
adaptou-se s condies locais e serviu como elemento
de controle das populaes de piranhas que
ameaavam proliferar nos reservatrios das usinas
hidreltricas de Minas Gerais e So Paulo. O mesmo
tucunar ter sua criao incrementada na barragem de
Itaipu, afastando o perigo do domnio das guas do Rio
Paran por cardumes de piranhas. A relao tucunarpiranha pode ser considerada como um mtodo de
controle utilizado pelo homem para:

IV. A energia qumica armazenada nos compostos


orgnicos dos seus produtores transferida para os
demais componentes da cadeia e permanece estvel.
Esto corretas as afirmativas:
a) I e II.
b) II e III.
c) III e IV.
d) I e III,
e) II e IV.
10) (UFSC) A pirmide de nmeros abaixo representada
diz respeito estrutura trfica de um determinado
ecossisterna:

a) aumento de taxa de mortalidade


b) competio intra-especfica.
c) variao de nicho ecolgico.
d) alterao cclica da populao.
e) controle biolgico por predatismo.
3) (CESGRANRIO) O desaparecimento dos morcegos
certamente levaria ao desestabelecimento de um
nmero considervel de ecossistemas, j que esses
animais apresentam comportamentos importantes para
a garantia desses sistemas ecolgicos.
Como exemplo desse tipo de comportamento dos
morcegos s NO se pode citar:
a) disperso de sementes
b) disperso de plens
c) predao de fungos
d) predao de insetos
e) disseminao de frutas

Assinale a seqncia correta de organismos que


corresponde seqncia crescente de algarismos
romanos da pirmide:
a) gramneas, sapos, gafanhotos, gavies, cobras.
b) gavies, cobras, sapos, gafanhotos, gramneas.
c) gavies, gafanhotos, gramneas, sapos, cobras.
d) gramneas, gafanhotos, sapos, cobras, gavies.
e) gramneas, gafanhotos, gavies, cobras, sapos.

4) (CESGRANRIO) O aumento populacional e a taxa


com que ele est ocorrendo fazem temer que, cedo ou
tarde, haver falta de alimento.
a) primrio
b) secundrio
c) onvoro
d) tercirio
e) carnvoro

11) (UA-AM) Na base das chamadas pirmides de


energia esto os:
a) decompositores.
consumidores secundrios.
b) produtores
consumidores tercirios.
c) consumidores primrios.

d)
e)

5)
(FMU)
consideremos:

Em

uma

comunidade

biolgica,

12)
(Fuvest-SP)
Cobras
que
se
alimentam
exclusivamente de roedores so consideradas:

I PRODUTORES
II HERBVOROS
III - CARNVOROS

a) produtores.
b) consumidores primrios.
c) consumidores secundrios.
d) consumidores tercirios,
e) decompositores.

correto afirmar que:


a) se I e II aumentarem, III diminuir.
b) se III aumentar, I e II diminuiro.
c) se II diminuir, I aumentar e III diminuir.
d) se I diminuir, II e III aumentaro.
e) se III aumentar, I e II aumentaro.

Parte IV: Dinmica de Populaes

6) (FCC) Considere uma cadeia alimentar constituda


por fitoplncton, peixes herbvoros e peixes carnvoros.
Qual das alternativas indica corretamente o que
acontece com as outras populaes imediatamente
aps reduo drstica dos peixes carnvoros?

1) (CESCEM) Em dois hectares de terra, foram


plantadas 3.600 mudas de eucalipto. Qual das
expresses abaixo apresenta um conceito relacionado
com essa afirmao?
a) Sucesso ecolgica.
b) Competio intra-especfica.
c) Densidade de populao.
d) Nicho ecolgico.
e) Homeostase de populaes.

FITOPLNCTON
a)
b)
c)
d)

101

crescimento
diminuio
crescimento
diminuio

PEIXES
HERBVOROS
crescimento
nenhuma alterao
diminuio
crescimento

Pr Vestibular Diferencial
e)

nenhuma alterao

BIOLOGIA

diminuio

7) (UFRN) Entre os fatores que determinam a


diminuio da densidade de uma populao, podemos
citar:
a) mortalidade e longevidade.
b) imigrao e emigrao.
c) mortalidade e imigrao.
d) imigrao e natalidade.
e) emigrao e mortalidade.
8) (FCC-BA) Para calcular a densidade de uma
populao necessrio conhecer o nmero de
indivduos que a compem e:
11) (Cesesp-PE) Leia com ateno as proposies
abaixo:
I. Potencial bitico a capacidade potencial que tem
uma populao de aumentar numericamente em
condies ambientais favorveis.
II. Os fatores que chamamos de resistncia do ambiente
impedem as populaes de crescerem de acordo com
seu potencial bitico.
III. A densidade de uma populao independe das taxas
de nascimento e mortes, assim como das taxas de
emigrao e imigrao.

a) o espao que ocupa.


b) a taxa de mortalidade.
c) a taxa de natalidade.
d) o nmero de indivduos que migram.
e) o nmero de indivduos de outras populaes da
mesma regio.
9) (UC-BA) Considere o grfico abaixo, que representa
o crescimento de uma populao. Em qual dos perodos
considerados a resistncia do meio torna-se igual ao
potencial bitico da populao?

Marque:
a) se todas forem corretas;
b) se nenhuma for correta;
c) se apenas as proposies I e II forem corretas;
d) se apenas as proposies II e III forem corretas;
e) se apenas as proposies I e III forem corretas.
12) (Univ. Fortaleza-CE) A figura seguinte mostra a
curva de crescimento de uma populao:

a) A.
b) B.
c) C.
d) D.
e) E.
10) (FGV-SP) A tabela abaixo indica o que aconteceu
com uma populao cinco anos seguidos:
Ano

1
2
3
4
5

N de
nascimento
s
200
160
150
140
130

N de
imigraes

N de
mortes

10
20
10
10

150
130
100
80
70

N de
emigrae
s
80
60
50
30
40

Com base nela, fizeram-se as seguintes afirmaes:


I . Em A a natalidade e a imigrao superam a
mortalidade e a emigrao.
lI. Em B a mortalidade e a emigrao superam a
natalidade e a imigrao.
lIl. Em C a natalidade e a imigrao equilibram a
mortalidade e a emigrao.
Dessas afirmaes:

0 grfico que representa a variao do nmero de


indivduos dessa populao :

a) apenas I est correta.


b) apenas II est correta.
c) apenas III est correta.
d) apenas I e II esto corretas.
e) I, II e III esto corretas.
13) (Cesgranrio-RJ) O grfico representa as
densidades, ao longo do tempo, de duas populaes
que vivem em determinada rea: uma populao de

102

Pr Vestibular Diferencial

BIOLOGIA

coelhos e outra de gatos-do-mato. Os coelhos servem


de alimento para os gatosdo-mato.

d) fungos e protozorios
e) plantas verdes e fungos.

3) (CESGRANRIO) O diagrama a seguir representa


etapas do ciclo do carbono num sistema terrestre.
H2O
H2O

CO2

Ecossistemas terrestres

I
II

O
exame
desse
grfico
proporcionou
trs
interpretaes:
I. A semelhana entre os ciclos das duas populaes
indica que ambos ocupam o mesmo nicho ecolgico.
lI. A no-coincidncia dos ciclos das duas populaes
mostra que a densidade da populao de coelhos no
influencia a densidade da populao de gatos-do-mato.
III. Oscilaes de populaes do tipo representado no
grfico so comuns na natureza, quando se trata de
espcies em que uma serve de presa e a outra a
predadora.

Compostos O2

orgnicos

O2
Examinando-o, pode-se dizer que:
a) os vegetais participam apenas da etapa II;
b) os animais participam apenas da etapa I;
c) os vegetais participam apenas da etapa I;
d) os animais participam das etapas I e II;
e) os vegetais participam das etapas I e II.
4) (UFRJ) Uma forma natural de aumentar a quantidade
de nitrognio, disponvel no solo sob a forma de nitratos,
alterar o cultivo de plantas no leguminosas com
leguminosas, pois as ltimas apresentam, nas suas
razes, mdulos com bactrias capazes de fixar o
nitrognio atmosfrico. Estas bactrias so pertencentes
ao grupo:

Assinale:
a) se somente I for correta;
b) se somente III for correta;
c) se somente I e III forem corretas;
d) se I, II e III forem corretas;
e) se somente II e III forem corretas.

a) Rhizobium
b) Nitrosomonas
c) Nitrobacter
d) Nitrosococcus
e) Anabaena

Parte V: Ciclos Biogeoqumicos


1) Nos ambientes aquticos o ciclo do carbono pode ser
esquematizado, simplificadamente, conforme mostra o
esquema abaixo. Estude-o com ateno e assinale a
opo que descreve a participao do plncton na(s)
etapa(s) A e B:

5) Os agricultores costumam fazer rodzio de culturas,


plantando durante certo tempo apenas leguminosas que
enriquecem o solo com produtos nitrogenados. Feita a
colheita, o agricultor passa plantar cereais (arroz, trigo,
milho) que se beneficiam destes produtos nitrogenados.
Quando estes comeam a se esgotar, o agricultor volta
a plantar leguminosas. Este procedimento justificado
porque as leguminosas:

CO2
Dissolvido

HCO3

H2 O

H2O
decompositores
O2

a) transformam o nitrognio do ar em nitratos.


b) fixam o nitrognio do ar, utilizando-o para a sntese
de aminocidos.
c) so parasitadas por bactrias capazes de converter o
nitrognio do ar em amnia.
d) possuem, em suas razes, fungos capazes de
converter o nitrognio do ar em amnia.
e) possuem, em suas razes, ndulos formados por
bactrias nitrificantes.

O2

Compostos
orgnicos

a) o zooplncton participa das etapas A e B.


b) o fitoplncton participa das etapas A e B.
c) o zooplncton s participa da etapa B.
d) o fitoplncton s participa da etapa B.
e) o fitoplncton s participa da etapa A.

6) (PUC-SP) No ciclo do carbono, quais os processos


metablicos que ocorrem em 1 e 2 ?

2) (CESGRANRIO) Apesar de quase 4/5 da atmosfera


serem constitudos de nitrognio, apenas alguns seres
tm a capacidade de aproveitar o nitrognio em forma
elementar para o seu metabolismo.
Os seres com essa capacidade so classificados entre:
a) bactrias e algas cianofceas;
b) bactrias e plantas verdes;
c) cianofceas e protozorios;

Dixidos

103

de

carbono

Pr Vestibular Diferencial

BIOLOGIA

na atmosfera
1

animais

vegetais

matria orgnica

a) respirao em 1 e fotossntese em 2
b) respirao em 1 e decomposio em 2
c) decomposio em 1 e respirao em 2
d) decomposio em 1 e fotossntese em 2
e) fotossntese em 1 e decomposio em 2
I. Os elementos qumicos, ao contrrio da energia, no
se perdem e so constantemente reciclados.
lI. Toda a energia captada pelos produtores volta para o
meio fsico sob a forma de calor, e como este no pode
ser usado na fotossntese, a energia segue em sentido
nico.
III. A biosfera um sistema de relaes entre os seres
vivos e entre a matria e a energia que os circundam.
Assinale a alternativa correta:

7) (FCC) Considere o seguinte diagrama:

nitrognio atmosfrico

nitratos

nitritos

a) todas esto erradas.


b) I e II esto corretas.
c) II e III esto corretas.
d) I e III esto corretas.
e) todas esto corretas.

amnia

A importncia das bactrias denitrificantes decorre


principalmente de sua ao em:

10) (Unirio-RJ) As chamadas bactrias fixadoras das


razes de certas leguminosas so teis agricultura
porque atuam sobre o solo, contribuindo para:

a) I
b) II
c) III
d) IV
e) V

a) aumentar a acidez.
b) facilitar o arejamento.
c) revolver a terra.
d) enriquec-lo com sais nitrogenados.
e) eliminar o humo.

8) (SO CARLOS) O plantio de leguminosas entre


outras plantas de cultura e sua posterior incorporao
ao solo importante porque:

11) (Fuvest-SP) A associao de bactrias do gnero


Rhizobium com razes de plantas leguminosas
possibilita a:

I - diminui a eroso do solo.


II- permite a fixao do nitrognio do ar.
III- contribui com nutrientes para o solo.

a) fixao de nitrognio.
b) transformao de amnia em nitritos.
c) eliminao de gs carbnico.
d) eliminao de nitrognio.
e) decomposio de tecidos mortos.

Pode-se afirmar quanto s alternativas acima que:


a) II e III so corretas, mas I incorreta.
b) I correta, mas II e III incorretas.
c) As trs so corretas.
d) As trs so incorretas.
e) II correta, mas I e III incorretas.

12) (FCC) Geralmente, os fazendeiros no usam


adubos nitrogenados nos campos em que cultivam
leguminosas porque estas:
a) no necessitam de nitrognio para crescer.
b) associam-se a bactrias nitrificantes.
c) fixam amnia do ar.
d) fixam nitratos do solo.
e) transformam nitritos em nitratos.

9) (PUCC-SP) Observe o esquema abaixo e as


afirmativas que se seguem:

13) (FCMSC-SP) Bactrias fixadoras de nitrognio so


encontradas em:
a) raizes de milho.
b) folhas de milho.
c) frutos de milho.
d) razes de feijo.
e) folhas de feijo.

104

Pr Vestibular Diferencial

BIOLOGIA

14) (Fuvest-SP) A figura abaixo um esquema


simplificado do ciclo do carbono na natureza:

a) respirao, respirao e fotossntese.


b) respirao, fotossntese e respirao.
c) fotossntese, respirao e respirao.
d) respirao, fotossntese e fotossntese.
e) respirao, fotossntese e transpirao.

Nesse esquema:
a) I representa os seres vivos em geral e II, somente os
produtores.
b) I representa os consumidores e lI, os decompositores.
c) I representa os seres vivos em geral e II, apenas os
consumidores.
d) I representa os produtores e lI, os decompositores.
e) I representa os consumidores e lI, os seres vivos em
geral.

18) (UFRS) 0 processo vital presente nos ciclos do


oxignio, do carbono e da gua o de:
a) respirao.
b) transpirao.
c) excreo.

15) (F. Objetivo-SP) O desenho anexo representa, de


maneira simplificada, o ciclo do nitirognio:

d) digesto.
e) sudao.

Parte VI: Sucesso Ecolgica


1) Suponhamos que o charco onde viva a pre e os
outros seres vivos de nossa histria, com o decorrer dos
tempos, v lentamente se modificando. O espelho
dgua diminua, pela progressiva invaso de novas
plantas, assoreamento e a instalao de plantas mais
duradouras; pelo surgimento de novos animais e
desaparecimento de outros. O cenrio se modifica. Esse
fenmeno denomina-se:
a) comunidade clmax.
b) comunidade em equilbrio dinmico.
c) comunidade em equilbrio esttico.
d) sucesso ectona.
e) sucesso ecolgica.

As bactrias dos gneros Nitrosomonas e Nitrobacter


agem, respectivamente, em:
a) I e II.
b) II e III.
c) IV e III.

2) (CESGRANRIO) Existiu, em uma determinada


regio, uma lagoa com gua lmpida contendo apenas
plncton. O acmulo de matria fornecida pelo plncton
permitiu que se formasse um fundo capaz de sustentar
plantas imersas. Surgiram depois, alguns animais que
comearam a povoar a lagoa, e o fundo acumulou
detritos e nele se desenvolveram plantas emergentes. A
lagoa ficou cada vez mais rasa. Surgiram os juncos nas
margens, que foram fechando a lagoa. Ela se
transformou num brejo, e a comunidade que o habitava
j era bem diferente. Posteriormente, o terreno secou e
surgiu um pasto que poder ser substitudo, no futuro,
por uma floresta.
Este texto apresenta um exemplo de:

d) V e IV.
e) VI e VIl.

16) (UFES) preocupao dos eclogos o fato de que


as calotas polares podem vir a sofrer um processo de
descongelamento, em virtude de um aquecimento da
atmosfera terrestre. Esse aquecimento, conseqncia
de um desequilbrio ecolgico, decorre de:
a) depsitos de lixo atmico.
b) aumento da taxa de monxido de carbono na
atmosfera.
c) emanaes de dixido de enxofre para a atmosfera.
d) reduo da taxa de oxignio na atmosfera.
e) aumento da taxa de gs carbnico na atmosfera.

a) irradiao adaptativa
b) disperso de espcies
c) sucesso ecolgica
d) pioneirismo
e) domnio ecolgico

17) (UFMT) Baseando-se no esquema a seguir, que


uma simplificao do ciclo do carbono, pode-se afirmar
que A, B e C representam, respectivamente:

3) (PUC-SP) Numa sucesso de comunidade ocorre:


a) constncia de biomassa e de espcie.
b) diminuio de biomassa e menor diversificao de
espcies.

105

Pr Vestibular Diferencial

BIOLOGIA

c) diminuio de biomassa e maior diversificao de


espcies.
d) aumento de biomassa e menor diversificao de
espcies.
e) aumento de biomassa e maior diversificao de
espcies.
4) (UFPA) Quando uma comunidade passa por
mudanas gradativas, dando origem a outras mais
complexas, tem-se:
a) um sucesso.
b) um ectono.
c) uma comunidade clmax.
d) um nicho ecolgico.
e) um bioma.
5) (FCMSC-SP) Considere o seguinte processo: numa
infuso, predominam primeiramente algas, em seguida
ciliados e finalmente rotferos. O processo considerado
um caso de:

Esse grfico exemplifica:


a) uma colnia.
b) uma associao.
c) uma sucesso.
d) uma migrao.
e) um ectone.

a) cadeia alimentar.
b) teia alimentar.
c) sucesso.
d) metamorfose.
e). pirmide de nmeros.

Parte VII: Simbioses

6) (Cesesp-PE) A zona limite entre duas comunidades


designada:

1) (PUC-SP) O tucunar, peixe trazido da Amaznia


para as lagoas de captao das usinas estabelecidas ou
em construo nos rios Paran, Tiet e Grande,
adaptou-se s condies locais e serviu como elemento
de controle das populaes de piranhas que
ameaavam proliferar nos reservatrios das usinas
hidreltricas de Minas Gerais e So Paulo. O mesmo
tucunar ter sua criao incrementada na barragem de
Itaipu, afastando o perigo do domnio das guas do Rio
Paran por cardumes de piranhas. A relao tucunarpiranha pode ser considerada como um mtodo de
controle utilizado pelo homem para:

a) nicho ecolgico.
b) comunidade clmax.
c) ecese.
d) potencial bitico.
e) ectono.
7) (UFCE) Observe as frases abaixo, relativas s
caractersticas de um ecossistema, medida que a
sucesso caminha para o clmax:
(1) A diversidade em espcies vai aumentando.
(2) H um aumento nos nichos ecolgicos, tornando a
teia alimentar mais complexa.
(4) H um aumento na biomassa total do ecossistema.
(8) O ecossistema tende a uma maior estabilidade ao se
aproximar do clmax.
(16) No h modificao do meio fsico do ecossistema
nos diferentes estgios da sucesso.

a) aumento de taxa de mortalidade


b) competio intra-especfica.
c) variao de nicho ecolgico.
d) alterao cclica da populao.
e) controle biolgico por predatismo.
2) (UFSCAR-SP) A seguir esto descritas algumas
relaes entre seres vivos:

D, como resposta, a soma dos nmeros das


alternativas corretas.
a) 3
b) 4
c) 8

I- a rmora acompanha o tubaro de perto e


fica presa a ele por uma ventosa. Ela aproveita os
alimentos do tubaro e tambm a sua locomoo, mas
no prejudica e nem beneficia o seu hospedeiro.
II- a alimentao predominante do cupim a
madeira, que lhe fornece grande quantidade de
celulose. Entretanto, ele no possui capacidade digerila. Quem se responsabiliza pela degradao da celulose
um protozorio que vive em seu intestino, de onde no
precisa sair para procurar alimento.
III- as ervas-de-passarinho instalam-se sobre
outras plantas, retirando delas a seiva, que ser
utilizada para a fotossntese.
IV- nas caravelas existe uma unio estreitas de
indivduo, cada um deles especializados em
determinadas funes como digesto, reproduo e
defesa.

d) 12
e) 15

8) (UC-MG) A sucesso, num ecossistema, pode ser


descrita como uma evoluo em direo:
a) ao aumento da produtividade lquida.
b) diminuio da competio.
c) ao grande nmero de nichos ecolgicos.
d) reduo do nmero de espcies.
e) simplificao da teia alimentar.
9) (UMA) 0 grfico abaixo registra as freqncias de
populaes de protozorios cultivados numa infuso de
feno.

106

Pr Vestibular Diferencial

BIOLOGIA
6) Podem organizar-se em sociedades:

V- as orqudeas, vivendo sobre outras plantas,


conseguem melhores condies luminosas, mas nada
retiram dos tecidos internos destas plantas.

a) aranhas.
b) besouros.
c) gafanhotos.
d) traas.
e) vespas.

Essas relaes referem-se, respectivamente, a:


a) mutualismo, comensalismo, hemiparasitismo, colnia,
parasitismo.
b) comensalismo, mutualismo, hemiparasitismo, colnia,
epifitismo.
c) comensalismo, mutualismo, epifitismo, colnia,
hemiparasitismo.
d) mutualismo, comensalismo, parasitismo, sociedade,
epifitismo.
e) hemiparasitismo, mutualismo, parasitismo, colnia,
epifitismo.

7) (UFRGS-RS) Enquanto as onas devoram a sua


presa, os urubus esperam.
Quais as relaes
ecolgicas envolvidas nesta situao?
a) predador e parasita.
predador e decompositor
b) comensal e parasita.
predador e saprvoro
c) parasita e saprvoro.

3) O quadro a seguir representa cinco casos de


interao entre duas espcies diferentes, A e B:
Tipos de
interao
I
II
III
IV
V

Espcies
reunidas
A
B
0
0

+
0

0
+
+

d)
e)

8) (PUC) Quando o relacionamento entre dois seres


vivos resulta em benefcio para ambos os associados,
dizemos que ocorre:

Espcies
separadas
A
B
0
0
0
0
0
0
0
0

a) mutualismo.
b) comensalismo.
c) hiperparasitismo.
d) parasitismo.
e) inquilinismo.
9) (CESGRANRIO) No combate s larvas dos
anofelinos ( mosquitos transmissores da malria), foi
utilizado, com eficincia, um pequeno peixe larvfago
(Gambusia affinis). A utilizao deste animal, na rea
de saneamento para o controle dessa parasitose, foi
bem sucedida em regies infestadas pelo Anopheles, e
onde era grande a incidncia da malria.
O mtodo citado, no poluente, substitui o clssico
processo de deposio de leo em superfcie da gua,
que mata as larvas por asfixia.
A ao do peixe Gambusia affinis em relao aos
anofelinos um exemplo de:

Legendas
0
= a espcie no afetada em seu
desenvolvimento
+
= o desenvolvimento da espcie
melhorado
= o desenvolvimento da espcie reduzido
ou torna-se impossvel.
Os tipos de relao apresentados so respectivamente:
a) competio, mutualismo, neutralismo, parasitismo,
comensalismo
b)
neutralismo,
competio,
comensalismo,
amensalismo, mutualismo
c) mutualismo, cooperao, neutralismo, comensalismo,
predao
d) neutralismo, competio, cooperao, comensalismo,
comensalismo
e) predao, mutualismo, neutralismo, simbiose,
competio

a) predatismo.
simbiose.
b) parasitismo.
amensalismo.
c) comensalismo.

d)
e)

10) (SANTA CASA) Observando-se cuidadosamente o


trecho abaixo:
"I um celenterado (hidra) que vive sobre a
concha vazia do molusco II, agora ocupada por um
crustceo III ( sem carapaa) e IV um peixe carnvoro.
I consegue alimento mais facilmente que quando fixado
sobre uma rocha; por sua vez, III lucra, podendo
alimentar-se dos restos de I alm de defender-se de IV
que se alimenta de III mas evita aproximar-se devido
presena de I, que ele teme".

4) (CESGRANRIO) Se duas espcies diferentes


ocuparem num mesmo ecossistema o mesmo nicho
ecolgico, provvel que:
a) se estabelea entre elas uma relao harmnica.
b) se estabelea uma competio interespecfica.
c) se estabelea uma competio intra-especfica.
d) uma das espcies seja produtora
e a outra,
consumidora.
e) uma das espcies ocupe um nvel trfico elevado.

Est certo dizer que h uma relao ecolgica de :


a) Comensalismo entre I e III.
b) Protocooperao entre I e III.
c) Predao entre I e IV.
d) Mutualismo entre II e III.
e) H duas respostas corretas.

5) A associao existente entre os ruminantes e as


bactrias que vivem em seu estmago um caso de :
a) mutualismo.
b) parasitismo.
c) comensalismo.
d) competio interespecfica.
e) competio intraespecfica.

GABARITO

107

Pr Vestibular Diferencial

Parte
I

Introduo

Ecologia
1234B
B
A
E
11- 12A
A

BIOLOGIA

5B

6D

7A

8E

5A

6C

7E

8A

5B

6B

7D

Parte IV Dinmica de
Populaes
12345C
E
C
A
C
11- 12- 13C
E
B

6D

5C
15C

Parte
VI

Sucesso
Ecolgica
1234E
C
E
A
Parte
VII

Simbioses
1234E
B
B
B

Parte
II

Cadeias
Alimentares
1234C
A
E
E
Parte
III

Pirmides
Ecolgicas
1234A
B
B
C
11- 12B
C

Parte V Ciclos
Biogeoqumicos
123B
A
E
11- 12- 13A
B
D

4A
14A

9D

10B

8C

9A

10D

7E

8A

9E

10E

6A
16E

7D
17B

8C
18A

9D

10D

5C

6E

7E

8C

9C

5A

6E

7E

8A

9A

10B

108