41 4completa

N4
VOL 41
2009
REVISTA ARGENTINA DE
MICROBIOLOGA
PUBLICACIN
DE LA
ASOCIACIN ARGENTINA
DE
MICROBIOLOGA
PUBLICACION DE LA ASOCIACION ARGENTINA DE MICROBIOLOGIA

Aparece en Biological Abstracts, Chemical Abstracts, Veterinary Bulletin, Index Veterinario, EMBASE (Excerpta Medica)
Medline (Index Medicus), Tropical Diseases Bulletin, Abstracts on Hygiene and Communicable Diseases, Literatura Latinoamericana en Ciencias de la Salud (LILACS), Peridica, LATINDEX, SciELO y Science Citation Index Expanded.
DIRECTORA
Silvia Carla Predari
SECRETARIO DE REDACCIN
Gerardo A. Leotta
COMIT EDITOR
Alicia I. Arechavala
Daniel Grasso
Ana M. Jar
Claudia I. Menghi
Elsa C. Mercado
Hctor R. Morbidoni
Vilma Savy
ASESORES CIENTFICOS
C. Bantar
J.C. Baslico
M.I. Berra
H.M. Bianchini
N. Binsztein
M.M. Bracco
R.A. Cacchione
R. Campos
G. Carballal
J.J. Cazzulo
C. Coto
M. DAquino
R. de Torres
J.E. Gonzlez
S. Gonzlez Ayala
A.H. Frade
N. Leardini
H. Lopardo
H.R. Rodrguez
A. Schudel
L. Scolaro
R. Soloaga
D. Sordelli
H. Terzolo
G. Vaamonde
M. Weissenbacher
W.P. Mac Cormack

D. Masih
E. Massouh
M.A.M. de Asconegui
R. Negroni
F. Nicola
T. Orduna
J.L. Parada
A.P. de Ruiz Holgado
ASESORES EN EL EXTERIOR
J. Arbiza (Uruguay)
E. Garca Lpez (Espaa)
M. Gottschalk (Canad)
R. Guerrero (Espaa)
M.J. Mendes Giannini (Brasil)

M. Philipp (EE.UU)
J. Pontn (Espaa)
F. Queiroz Telles (Brasil)
A. Restrepo (Colombia)
G. San Blas (Venezuela)

G. Schmunis (EE.UU)
A. Steinbchel (Alemania)
M. Tolmasky (EE.UU)
J. Vila Estape (Espaa)
Secretara: Den Funes 472, C1214AAD Buenos Aires; Tel/FAX: 54-11-4932-8858, 54-11-4932-8948; E-mail: info@aam.org.ar, http://www.aam.org.ar
SUSCRIPCIN (cuatro nmeros anuales)

Socios AAM
U$ 100
Argentina no socios U$ 200
Amrica Latina
U$S 100
Otros pases
U$S 150
Suc. 4 - B
Personera Jurdica 000908.

Registro Nacional de la Propiedad Intelectual N 269649.
I.S.S.N. 0325-7541
Correo
Argentino
Los pagos pueden hacerse por giros a la orden de Asociacin Argentina de Microbiologa.
Franqueo Pagado
Concesin N 4195
Tarifa Reducida
Concesin N 628
XII CONGRESO ARGENTINO

DE MICROBIOLOGA
24 al 27 de octubre de 2010
Palais Rouge
Jernimo Salguero 1433/49 (C1177AFA)
Ciudad Autnoma de Buenos Aires, Argentina
Presidente: Ricardo Negroni

Vicepresidentes: Isabel Bogado
Jorge Reinheimer
Marta Tokumoto
Secretarias Generales: Alicia Arechavala
Mara Alejandra Picconi
Prosecretaria: Cristina Iovannitti
Tesorera: Adriana De Paulis
Protesorera: Paula Gagetti
Secretaria de Relaciones Institucionales: Daniela Centrn
Secretaria Tcnica: Adriana Scari
Comisin Tcnica: Manuel Gmez Carrillo, Cecilia Quiroga y
Soledad Ramrez
Secretarios Cientficos: Liliana Guelfand
Horacio Salomn
Comisin Cientfica: Carlos Vay
Representantes de las Divisiones en el Comit Cientfico y Comit Organizador
Divisin Agrcola y Ambiental: Ins Garca y Susana Vzquez
Divisin DAMYC: Virginia Fernndez Pinto y Guillermo Guirn
Divisin SADEBAC: Mirta Litterio y Magdalena Pennini
Divisin SAV: Viviana Mbayed y Victoria Preciado
Vocales: Marina Bottiglieri (Filial Crdoba)
Perla Hermida Lucena (Filial Rosario)
Luis Merino (Filial NEA)
Ana Paris de Baeza (Filial Sur)
Francisco Salamone (Filial Santa Fe)
Alejandro Sturniolo (Filial Cuyo)
Ada Surez (Filial NOA)
Para ms informacin y/o sugerencias puede contactarnos a
info@aam.org.ar
ISSN 0325-7541
1
Revista Argentina de Microbiologa (2008) 40: ---
Xxxx
XXX
VOLUMEN 41 N 4 OCTUBRE-DICIEMBRE DE 2009
NDICE
EDITORIAL
Transferencia e intercambio de conocimiento a travs de reuniones cientficas. Cerca del corazn
de los amigos, lejos de las arcas del Estado
H.R. Morbidoni
203
MICROBIOLOGA BSICA
*Amplificacin del genoma completo del subtipo 2 del virus de la influenza equina
G.H. Sguazza, N.A. Fuentealba, M.A. Tizzano, C.M. Galosi, M.R. Pecoraro
207
MICROBIOLOGA CLNICA Y ENFERMEDADES INFECCIOSAS

Brote de micoplasmosis clnica por Mycoplasma ovis en ovinos de Salta, Argentina. Diagnstico
clnico, microbiolgico y molecular
D.H. Aguirre, C. Thompson, R.D. Neumann, A.O. Salatin, A.B. Gaido, S. Torioni de Echaide
*Mycobacterium bovis en Argentina: aislamientos de gatos tipificados por spoligotyping
M.J. Zumrraga, M. Martnez Vivot, D. Marticorena, A. Bernardelli, R. Fasn, R. Iachini, A.A. Cataldi
*Echinococcus granulosus: comparacin biolgica de aislados de bovinos de regiones endmicas de Argentina y Espaa
M.V. Andresiuk, F. Ponce Gordo, C. Cuesta Bandera, M.C. Elissondo, M. Dopchiz, G. Denegri
AGENTES ANTIMICROBIANOS
*Actividad antibacteriana y antioxidante del aceite esencial extrado de Artemisia echegarayi Hieron.
(Asteraceae)
A. Laciar, M.L. Vaca Ruiz, R. Carrizo Flores, J.R. Saad
MICROBIOLOGA DE ALIMENTOS
*El t de tilo como vehculo potencial de esporas de Clostridium botulinum en la transmisin del
botulismo infantil
M.I. Bianco, C. Lquez, L.I.T. de Jong, R.A. Fernndez
Modelo de contaminacin cruzada por Escherichia coli verocitotoxignica durante la elaboracin
de hamburguesas caseras y evaluacin cuantitativa de riesgos
M.L. Signorini, L.S. Frizzo
212
215
218
226
232
237
MICROBIOLOGA INDUSTRIAL Y AMBIENTAL

*Evolucin del contenido de ocratoxina A en vinos tintos argentinos durante el proceso de
vinificacin a escala piloto
M.L. Ponsone, M.L. Chiotta, M. Combina, A.M. Dalcero, S.N. Chulze
245
ARTCULO ESPECIAL
Toxinas de Clostridium perfringens
W.E. Morris, M.E. Fernndez-Miyakawa
251
IMGENES MICROBIOLGICAS
*Efecto citoptico en clulas BHK 21 (C13) inoculadas con Leptospira interrogans serovar Pomona
aislada de un aborto porcino
B. Brihuega, A. Venzano, O. Zabal, D. Funes, C. Auteri, G. Romero, L. Samartino
*Consorcio bacteriano degradador de hidrocarburos aislado de suelos de Antrtida
L.A.M. Ruberto, S.C. Vzquez, W.P. Mac Cormack
ndice general del volumen 41
ndice de temas
ndice de autores
Agradecimiento a revisores
Fe de erratas
Instrucciones para los autores
* En ingls
261
262
263
269
271
272
272
273
Revista Argentina de Microbiologa (2008) 40: ---
VOLUMEN 41 N 4 OCTOBER-DECEMBER 2009
INDEX
EDITORIAL
Exchange of scientific information through scientific meetings: close to our friends hearts, far
away from the purse of the State
H.R. Morbidoni
203
GENERAL MICROBIOLOGY
*Complete genome amplification of Equine influenza virus subtype 2
207
CLINICAL MICROBIOLOGY AND INFECTIOUS DISEASES

Clinical mycoplasmosis outbreak due to Mycoplasma ovis in sheep from Salta, Argentina. Clinical,
microbiological and molecular diagnosis
*Mycobacterium bovis in Argentina: isolates from cats typified by spoligotyping
*Echinococcus granulosus: biological comparison of cattle isolates from endemic regions of Argentina and Spain
ANTIMICROBIAL AGENTS
*Antibacterial and antioxidant activities of essential oil of Artemisia echegarayi Hieron. (Asteraceae)
FOOD MICROBIOLOGY
*Linden flower (Tilia spp.) as vehicle of Clostridium botulinum spores in the transmission of infant
botulism
Quantitative risk model for verocytotoxigenic Escherichia coli cross-contamination during
hamburger preparation
212
215
218
226
232
237
INDUSTRIAL AND ENVIRONMENTAL MICROBIOLOGY

*Fate of ochratoxin A content in Argentinean red wine during a pilot scale vinification
M.L. Ponsone, M. Combina, A.M. Dalcero, S.N. Chulze
245
SPECIAL ARTICLES
Toxins of Clostridium perfringens
251
MICROBIOLOGICAL IMAGES
*Cytopathic effect in BHK 21 (C13) cells inoculated with Leptospira interrogans serovar Pomona
isolated from a porcine abortion
B. Brihuega, A. Venzano, O. Zabal, D. Funes, C. Auteri, G. Romero, L. Samartino
*Bacterial hydrocarbon-degrading consortium from Antarctic soils
L.A.M. Ruberto, S.C. Vzquez, W.P. Mac Cormack
261
General Index of volume 41

Subject index
Index by author
Acknowledgement to reviewers
Errata
Instructions to authors
263
269
271
272
272
273
* In English
262
Editorial
EDITORIAL
203
ISSN 0325-7541
Revista Argentina de Microbiologa (2009) 41: 203-206
Transferencia e intercambio de conocimiento a travs de

reuniones cientficas: cerca del corazn de los amigos,
lejos de las arcas del Estado
Al poseedor de las riquezas no le hace dichoso el tenerlas, sino el
gastarlas, y no el gastarlas como quiera, sino el saberlas gastar.
Miguel de Cervantes
Mycobacterium tuberculosis, la bacteria causante de la tuberculosis humana, es uno de los patgenos

ms efectivos de la naturaleza, ya que una persona se puede infectar por la inhalacin de 1 a 5 bacilos.
Sin embargo, el sistema inmune puede rpidamente controlar a este patgeno e impedir la enfermedad.
An con este escenario, se estima que un tercio de la poblacin mundial est infectada, y que por ao 10
millones de personas enferman y 2 millones mueren a causa de esta bacteria (3). La incidencia de esta
patologa en la salud humana fue potenciada por los altos nmeros de casos de enfermos infectados por
vih que desarrollan Sida. Dado el efecto devastador del Sida sobre el sistema inmune, el bacilo tuberculoso encuentra un husped en el cual no existen barreras para su control y contencin. El tratamiento de
la tuberculosis es extremadamente prolongado: requiere el empleo de cinco drogas durante dos meses,
seguido por la administracin de dos drogas por espacio de cuatro meses; en otras palabras, mltiples
tomas de numerosos medicamentos. Este hecho supone una gran dificultad en la adhesin al tratamiento por parte del paciente, a lo que se suman otras circunstancias como la lejana de los centros de salud,
los efectos secundarios de una o ms drogas y, an ms grave, casos en los que el paciente comienza
a notar una mejora fsica como resultado de los frmacos y suspende el tratamiento.
Entre las estrategias implementadas por la Organizacin Mundial de la Salud se destaca aquella
conocida como tratamiento acortado estrictamente supervisado o TAES, consistente en la observacin
directa del cumplimiento del tratamiento (ingestin de los frmacos) a cargo de una persona entrenada
perteneciente al sistema formal de salud o un voluntario debidamente capacitado para ese fin. El TAES
est basado en cinco principios clave (5): intervencin organizada y sostenida, identificacin de casos
en forma temprana y precisa, quimioterapia eficaz y fcil de ser administrada, manejo eficaz de los
medicamentos y monitoreos basados en los resultados. Estos principios se cumplen a travs de los
componentes del TAES como lo son el compromiso gubernamental para asegurar acciones de lucha
antituberculosa completas y sostenidas, la deteccin de casos en pacientes sintomticos mediante tcnicas microscpicas, el tratamiento normalizado de corta duracin durante 6-8 meses, el suministro
regular de frmacos antituberculosos, un sistema de comunicacin y registro normalizado para evaluar
la deteccin de casos y el resultado del tratamiento instaurado para cada paciente.
Estas normas, junto con un plan de inversin de organismos oficiales nacionales y de organizaciones
filantrpicas, tienen como objetivo disminuir sensiblemente el nmero de casos de tuberculosis y de
muertes producidas por esta enfermedad en el mundo para el ao 2015 (3). Al presente, los resultados
fueron dispares, mientras la deteccin y el tratamiento de nuevos casos ha funcionado eficientemente,
ya que se lleg a valores cercanos a los establecidos como metas, otros componentes como el avance
en la implementacin y planificacin en algunas regiones de frica y Asia y, fundamentalmente, las
dificultades en el tratamiento de las formas resistentes a las drogas han quedado lejos de los propsitos.
Desde el punto de vista financiero, los fondos disponibles en el ao 2008 fueron de 3.300 millones de
US$ para 90 pases que concentran el 91% del total de casos de tuberculosis. Sin embargo, hubo
204
diferencias sustanciales entre los fondos requeridos y los percibidos por pases donde las actividades de
programas TB/vih y el manejo de casos de tuberculosis multirresistente (MDR-TB) requieren ms dinero.
El progreso en la deteccin de casos comenz a declinar en trminos globales en 2006, sobre todo
en China e India, y sigue siendo bajo en frica; esto indica la perentoria necesidad de acelerar los
avances en el control global de la tuberculosis si se quiere alcanzar las metas propuestas en un lapso
razonable. Sin embargo, una de las razones que impide la concrecin de estos objetivos es la diferencia
en asignacin y uso de fondos en Asia y Europa.
En Argentina, durante el ao 2007 se notificaron 10.683 casos de tuberculosis (tasa 27,14/100.000
habitantes), mientras que 805 personas fallecieron debido a esta enfermedad (tasa 2,07/100.000 habitantes) durante el ao 2006. Aunque las cifras no son necesariamente alarmantes para el lector, llev
ms de 15 aos reducir a casi la mitad (60/100.000 habitantes en 1990 contra 31/100.000 habitantes en
2007) la incidencia de esta enfermedad en nuestro pas. Al mismo tiempo, datos locales de Santa Fe
revelan la aparicin de casos de tuberculosis en los cuales las cepas aisladas fueron resistentes a
mltiples drogas (MDR-TB), definidas como resistentes a las drogas pilares del tratamiento antituberculoso
(drogas de primera lnea), isoniacida y rifampicina. Lo preocupante de esta situacin no es la
multirresistencia en s, sino la deteccin en pacientes no tratados previamente, ni encuadrados en lo que
se denomina factores de riesgo (institucionalizacin, contacto con familiar enfermo, tratamiento previo
abandonado, uso de drogas, entre otros). En definitiva, la batalla sigue y requiere medidas ms rpidas
de deteccin y control.
Siendo esta una revista cuya temtica se enfoca en la microbiologa, a esta altura del presente artculo editorial el lector posiblemente se pregunte el porqu de un comentario sobre planes mundiales para
el control de la tuberculosis. Hablemos entonces de microbiologa
Recordemos que M. tuberculosis tarda 30 das en formar colonias en medios slidos, por lo que su
deteccin se hace mediante microscopa ptica, y que la sensibilidad de este procedimiento depende
del nmero de bacilos presentes en la muestra. La otra opcin es sembrar la muestra e incubarla hasta
60 das, antes de poder informarla como bacteriolgicamente negativa. La determinacin de la sensibilidad a drogas de los aislamientos clnicos de M. tuberculosis requiere, de la misma manera, tiempos
largos. Los avances metodolgicos hicieron posible la deteccin y determinacin de la sensibilidad a
drogas en plazos ms cortos, de alrededor de 12 das, gracias al empleo de equipos especiales automatizados o semiautomatizados (2, 4). Sin embargo son costosos y, por consiguiente, no estn disponibles
en todas las unidades de diagnstico, sino slo en los centros de referencia que, al concentrar muestras
de distintas procedencias, justifican la inversin.
Uno de los temas que requieren la atencin ms urgente es el de la deteccin de cepas MDR. Ms
an, recientemente se han informado cepas resistentes a drogas de primera y de segunda lnea (1). En
consecuencia, la escasa cantidad de opciones teraputicas frente a estas cepas deja pocas posibilidades de tratamiento. En este contexto, los dos objetivos fundamentales en la lucha contra la tuberculosis
son la deteccin precoz de la enfermedad y la determinacin de la sensibilidad a drogas lo ms rpido
posible.
La Sociedad Latinoamericana y del Caribe de Tuberculosis y otras Micobacteriosis (SLAMTB) fue
fundada en Buenos Aires en setiembre de 2005. Esta institucin es producto de 10 aos de intensa
cooperacin e intercambio expresados inicialmente a travs de la Red Latinoamericana y del Caribe de
Tuberculosis (RELACTB) y luego a travs del proyecto de colaboracin financiado por la Unin Europea
denominado Improved Diagnosis, Drug Resistance Detection and Control of Tuberculosis in Latin America.
Son parte de esa institucin 50 investigadores de 10 pases de la regin, as como varios procedentes
de 4 pases de Europa. Como sociedad abierta ha generado a lo largo de los ltimos aos colaboraciones que han sido utilizadas en la implementacin de pasos concretos para el diagnstico de la tuberculosis humana y animal, y que continan teniendo un alto impacto social y econmico en varios pases.
Editorial
205
Hasta el momento, esta sociedad ha funcionado como satlite de las reuniones anuales o peridicas
de la Sociedad Latinoamericana de Microbiologa (ALAM); sin embargo, debido a la especificidad de sus
objetivos y a su crecimiento, ha comenzado su actividad en forma independiente. Por ello, luego de tres
reuniones previas (Pucn, Chile, 2006; Brasilia, Brasil, 2007 y Bogot, Colombia, 2008) lleg la hora de
organizar nuestra primera reunin independiente en 2009. Esto constituy un gran desafo logstico y
econmico, en el cual fuimos apoyados por la buena voluntad de muchos investigadores de gran prestigio internacional, deseosos de incrementar sus colaboraciones con nosotros.
La IV Reunin de la SLAMTB tuvo lugar del 5 al 8 de octubre de este ao en Rosario, y cubri desde
aspectos bsicos como la patogenicidad de las micobacterias, la epidemiologa de la distribucin de
cepas y su nivel de resistencia a drogas hasta la temtica de las nuevas herramientas de diagnstico y
las drogas para el tratamiento, entre otros tpicos. Adems de los asistentes nacionales, se hicieron
presentes ms de 40 disertantes extranjeros y 80 participantes de Latinoamrica, por lo que esta reunin se posicion como un evento cientfico de relevancia internacional, con un total de ms de 250
asistentes. Es importante destacar que contamos con la presencia de miembros de los servicios de
diagnstico microbiolgico de los hospitales de nuestro pas, en especial de Rosario y Buenos Aires, los
cuales tuvieron acceso a esta oportunidad nica de participar, aprender y debatir el uso de nuevas
tcnicas de diagnstico y de determinacin de la sensibilidad a drogas.
Con ese fin decidimos que no hubiera costo de inscripcin ni de asociacin, de modo que fue una
reunin de libre acceso. Aunque entendimos las dificultades econmicas presentes en nuestro pas,
explicitamos ante distintos sectores pblicos y privados la naturaleza del evento y su gran repercusin
cientfica y pblica. Si bien este evento increment la transferencia de conocimiento, nos dej en una
posicin financiera vulnerable al no contar con fondos propios.
Sabemos que la baja contribucin de los organismos estatales afect no slo a esta reunin, ya que
muchas otras recibieron fondos insuficientes (del orden de hasta $5.000) o escasos (por debajo de
$15.000) (6), girados en su gran mayora con posterioridad al cierre del evento cientfico.
A pesar de la falta de aportes econmicos de los sectores estatales de salud pblica, a los cuales iba
dirigida la informacin, la reunin fue un xito acadmico y cientfico que gener elogios por parte de
todos los participantes, y se llev a cabo con slo $ 15.000 aportados por el CONICET y algunas contribuciones realizadas por un puado de empresas locales.
En particular, una de las consecuencias del bajo presupuesto asignado a nuestra reunin fue que
varios estudiantes y profesionales no tuvieron cabida, ya que no se pudo cubrir el costo de salones de la
suficiente capacidad fsica. Sin embargo, entre los puntos que deben destacarse se encuentran la asistencia de profesionales de los programas de tuberculosis de distintas provincias argentinas y de pases
vecinos como Paraguay y Bolivia, as como la generosa actitud de investigadores miembros del programa CYTED Programa Iberoamericano de Ciencia y Tecnologa para el Desarrollo del Instituto Pasteur
de Francia, y de las Universidades de Alabama en Birmingham, de California San Francisco y de Pittsburgh,
EE.UU., que pagaron con fondos propios la mayora de sus gastos de viaje y estada.
El mayor mrito de esta reunin radica en haber transferido informacin relevante para el diagnstico
de tuberculosis a personal que, caso contrario, no hubiera tenido acceso a ella, ya que una reunin
similar en Europa o Estados Unidos tiene un costo promedio de inscripcin de 400 USD. Quizs hayamos pecado de ingenuos al pensar que obtendramos mayor ayuda de organismos estatales o de instituciones de naturaleza filantrpica.
Desde este lugar y como Presidente del Comit Organizador de la IV Reunin de la SLAMTB, quiero
agradecer a todos aquellos que con su ayuda hicieron posible el objetivo de difundir el conocimiento y
estimular las interacciones entre los distintos grupos de ciencia bsica y de diagnstico. Sin embargo,
cabe citar una de las frases dichas por el Dr. Manuel Carrillo: Solo sirven las conquistas cientficas
sobre la salud si stas son accesibles al pueblo (7). Al respecto, quisiera agregar que para que esto
206
suceda, primero deben hallar su camino desde el laboratorio donde se desarrollaron las tcnicas (las
conquistas) hasta los servicios que masificarn su uso en pos del bienestar de la comunidad. Slo un
apoyo econmico adecuado por parte del Estado a las reuniones cientficas permitir que las innovaciones tecnolgicas y cientficas puedan ser aprovechadas para mejorar la salud y la calidad de vida de las
personas.
HCTOR RICARDO MORBIDONI
Ctedra de Microbiologa, Virologa y Parasitologa

Facultad de Ciencias Mdicas
Universidad Nacional de Rosario, Argentina.
E-mail: morbiatny@yahoo.com
1. Abubakar I, Moore J, Drobniewski F, Kruijshaar M, Brown

T, Yates M, et al Extensively drug-resistant tuberculosis in
the UK: 1995 to 2007. Thorax 2009; 64: 512-5.
2. Lin SY, Desmond E, Bonato D, Gross W, Siddiqi SJ.
Multicenter evaluation of Bactec MGIT 960 system for
second-line drug susceptibility testing of Mycobacterium tuberculosis complex. J Clin Microbiol 2009; 47: 3630-4.
3. Organizacin Mundial de la Salud 2009. Global tuberculosis
control: epidemiology, strategy, financing. WHO report 2009.
4. Roberts GD, Goodman NL, Heifets L, Larsh HW, Lindner
TH, McClatchy JK, et al. Evaluation of the BACTEC
radiometric method for recovery of mycobacteria and drug

susceptibility testing of Mycobacterium tuberculosis from
acid-fast smear-positive specimens. J Clin Microbiol 1983;
18: 689-96.
5. Smith, I. En Frieden, T, editor. Tuberculosis: deteccin de
casos, tratamiento y vigilancia: preguntas y respuestas: (Publicacin Cientfica y Tcnica No. 617. OPS) Kurt Toman.
2 ed. Washington, D.C., 2006.
6. h t t p : / / w w w . a g e n c i a . g o v . a r / I M G / p d f / R C _ l i s t a d o _
reuniones_financiadas.pdf
7. http:///www.lagazeta.com.ar/carrillo.htm
Genome amplification of Influenza virus
207
ISSN 0325-7541
INFORME BREVE
Complete genome amplification of Equine

influenza virus subtype 2
G. H. SGUAZZA1*, N. A. FUENTEALBA1, 2, M. A. TIZZANO1, 3, C. M. GALOSI1, 3, M. R. PECORARO1.
1
Ctedra de Virologa, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata;

Consejo Nacional de Investigaciones Cientficas y Tcnicas (CONICET); 3Comisin de Investigaciones Cientficas de la
Provincia de Buenos Aires (CIC), Argentina.
*Correspondence. E-mail: sguazza@fcv.unlp.edu.ar
ABSTRACT
This work reports a method for rapid amplification of the complete genome of equine influenza virus subtype 2 (H3N8).
A ThermoScriptTM reverse transcriptase instead of the avian myeloblastosis virus reverse transcriptase or Moloney
murine leukemia virus reverse transcriptase was used. This enzyme has demonstrated higher thermal stability and is
described as suitable to make long cDNA with a complex secondary structure. The product obtained by this method
can be cloned, used in later sequencing reactions or nested-PCR with the purpose of achieving a rapid diagnosis and
characterization of the equine influenza virus type A. This detection assay might be a valuable tool for diagnosis and
screening of field samples as well as for conducting molecular studies.
Key words: Equine influenza virus, genome, diagnosis, RT-PCR
RESUMEN
Amplificacin del genoma completo del subtipo 2 del virus de la influenza equina. En este trabajo comunicamos
un mtodo rpido que permite la amplificacin del genoma completo del subtipo 2 (H3N8) del virus de la influenza
equina. Se utiliz la enzima transcriptasa reversa ThermoScriptTM en lugar de la transcriptasa reversa del virus de la
mieloblastosis aviar o la transcriptasa reversa del virus de la leucemia murina de Moloney. Esta enzima ha demostrado
tener una alta estabilidad trmica y la capacidad de hacer largas copias de ADN con una estructura secundaria
compleja. El producto obtenido por esta tcnica puede ser clonado y utilizado posteriormente en reacciones de
secuenciacin o de PCR anidada con la finalidad de lograr un diagnstico rpido y la caracterizacin del virus de la
influenza equina tipo A. Este ensayo de deteccin puede llegar a ser una valiosa herramienta para el diagnstico y el
anlisis de muestras de campo, as como para la realizacin de estudios moleculares.
Palabras clave: Virus de la influenza equina, Genoma, Diagnstico, RT-PCR
Influenza viruses belong to the Orthomyxoviridae family

and are classified into three great types: A, B, and C,
according to antigenic differences in their nucleoprotein
(NP) and matrix (M) proteins. Influenza viruses types B
and C are predominantly human pathogens that have also
been isolated from seals and pigs, respectively. On the
other hand influenza viruses type A have been isolated
from many species including humans, pigs, horses, marine mammals and a wide range of domestic and wild birds
(10). Influenza viruses type A can be further subdivided in different serologically differentiated subtypes
according to the structure and composition of two antigenic
glycoproteins located in the surface of the virion: haemagglutinin (HA) involved in binding of the virus to host cells
and neuraminidase (NA) implicated in release of virus
Ctedra de Virologa, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata 60 & 118, La Plata, CP 1900, Buenos Aires, Argentina
Telephone and fax number: 54 221 4257980
from infected cells. At present, 16 HA and 9 NA subtypes

have been identified among influenza A viruses. All these
subtypes are found in avian species. However, only two
equine influenza virus subtypes have been associated
with the disease in horses, the H7N7 subtype (equi-1)
and the H3N8 subtype (equi-2). The H7N7 subtype was
first isolated from horses in Czechoslovakia in 1956 (prototype strain: A/equine1/Prague/56); later it was isolated
in many countries of Europe and America. Although this
subtype has not been isolated since 1980, it may still circulate in subclinical form and persist at very low levels in
some parts of the world (10). The H3N8 subtype of equine
influenza virus was first isolated in 1963 during an outbreak of this disease in Miami (prototype strain: A/equine2/
Miami/63) and can be found in different parts of the world,
except in Australia, New Zealand, and Iceland. Recent
studies of the H3N8 subtype of equine influenza viruses
have demonstrated that these strains have diverged into
two distinct evolutionary lineages (2).
208
The genome of equine influenza A virus contains eight

linear segments of negative stranded RNA (about 13.6
kb). Six segments code for single proteins: the three viral
polymerases (PA, PB1 and PB2), HA, NA and NP. The
other two segments codify two proteins, one segment for
matrix 1 and 2 (M1 and M2) and the other segment for
non-structural protein 1 (NS1) and nuclear export protein
(NEP) (5).
The analysis of virion RNA from influenza A strains
indicates that all eight RNA segments contain a common
sequence of 13 nucleotides at the 3' terminus and another common sequence of 12 nucleotides at the 5' terminus (3, 9). No homologies can be found among segments. On these bases, the aim of this work was to develop a rapid method that allows the genetic characterization of the whole genome of influenza virus using a procedure of reverse transcription followed by the amplification
of all viral segments through polymerase chain reaction
(RT-PCR).
The standard method for diagnosis of influenza is the
isolation of influenza virus particles using embryonated
chicken eggs or Madin-Darby canine kidney cells (MDCK).
This system has the disadvantage of requiring 4-6 days
for completion. The complete genome amplification by
RT-PCR reported in this paper followed by subsequent
amplicon sequencing is a more versatile method because
it allows obtaining more detailed information about circulating strains and it will help in the virus surveillance.
To amplify the influenza virus genome, two primers

based on the highly conserved non-coding sequences at
the 5 and 3 end present in all viral genomic segments of
influenza A virus were used, according to the consensus
sequence regions previously reported (3, 9) and widely
used to amplify the complete genome of human and avian
influenza A virus (4) and equine influenza A virus subtype
1 (1). To confirm the presence of those conserved regions
in the genome of equine influenza subtype 2, 50 different
sequences of all segments from the viral genome retrieved
from the GenBank at the National Center of Biotechnology Information (http://www.ncbi.nlm.nih.gov) were compared by multiple alignment using the CLUSTAL X (v1.8)
software.
The consensus regions were identified as suitable
sequences for use as primers in RT-PCR, and the oligonucleotide primers were subsequently commercially synthesized (Integrated DNA Technologies, Coralville, IA,
USA). The primers used in this work were a 12-mer primer
UFLU-S 5AGCAAAAGCAGG 3 and a 13-mer primer
UFLU-AS 5AGTAGAAACAAGG 3 (Fig. 1).
An equine influenza virus strain, A/Equine-2/La Plata/
2001 (H3N8), previously isolated in our laboratory during
the year 2001, was used. The virus was propagated in
the allantoic cavity of 11-day-old embryonated hens eggs
derived from a healthy flock.
Total RNA was extracted using Trizol reagent (GIBCO
BRL, Gaithersburg, MD, USA). In brief, 500 l of allantoic
Figure 1. Alignment of non-coding terminal regions of the eight segments of Influenza A virus (A/equine-2/Kentucky/5/02. GenBank
accession numbers AY855340, AY855339, AY855338, AY855341, AY855342, AY855343, AY855344 and AY855345 respectively).
The 5 terminus of each segment has 12 conserved nucleotides (A), and the 3 terminus has 13 conserved nucleotides (B).
fluid (haemagglutination titre 1:128) were mixed with 500

l of Trizol reagent. The mixture was extracted with 220
l of chloroform. After centrifugation at 10000 x g for 10
minutes, the RNA in the aqueous solution was precipitated
by adding an equal volume of isopropanol. The precipitated RNA was collected by centrifugation at 10000 x g
for 20 minutes, washed by 70% ethanol, dissolved in 50
l of RNAse-free water and measured by spectrophotometer (SmartSpec 3000, BIO-RAD, Hercules, CA, USA).
RNA extracted from uninfected allantoic fluid was used
as negative control. Total RNA and control RNA (375.06
ng/l and 225.52 ng/l respectively) were used for following steps.
One microgram of each RNA was used to produce a
single-strand copy of DNA (ssDNA). This reaction was
carried out using the avian myeloblastosis virus (AMV)
reverse transcriptase (Promega Corporation, Madison,
WI, USA), the Moloney murine leukemia virus (M-MMLV)
reverse transcriptase (Promega) and the ThermoScript
RT-PCR System kit (Invitrogen-Life Technologies, Buenos Aires, Argentina) under conditions specified by the
suppliers, using a concentration 0.5 M of the universal
primer complementary to the conserved 3 end of all
virus segments (UFLU-S).
The single-strand DNA (ssDNA) obtained with AMV,
M-MLV and RT-ThermoScript was used directly as template in the PCR reaction whereas the cDNA generated
by RT-ThermoScript was additionally employed for making a double-strand DNA copy (dsDNA) in agreement with
the suppliers suggestion.
The second chain of DNA was synthesized using 3 l
of ssDNA previously obtained (approximately 100 ng) in
a reaction mixture containing: 75 mM Tris-HCl (pH 8.8),
20 mM (NH4)2SO4, 0.01% Tween 20, 200 M of each
dNTPs, 1.5 mM of MgCl2 and 0.5 M of UFLU-AS primer
in a final volume of 24.5 l. The mixture was incubated at
95 C during 4 minutes, followed by the addition of 0.5 l
(2.5 U) of Taq DNA polymerase (Fermentas Inc, Glen
Burnie, MD, USA) and it was incubated at 65 C during
20 minutes.
The PCR reaction was performed by adding 5 l from
the ssDNA or dsDNA to a reaction mixture containing a
final concentration of 75 mM Tris-HCl (pH 8.8), 20 mM
(NH4)2SO4, 0.01% Tween 20, 200 M of each one of
dNTPs, 0.5 M of each one of primers (UFLU-S and
UFLU-AS), a variable concentration of MgCl2 (1, 1.5, 2
and 2.5 mM) and variable percentages of dimethil sulfoxide
(0, 5 and 10% of DMSO) in a final volume of 49.5 l.
The mixture was heated at 95C during 4 minutes and
incubated with variable annealing temperatures (38, 40,
42 and 44 C) for 2 minutes, then 0.5 l (2.5 U) from Taq
DNA polymerase (Fermentas) were added. The amplification
program started with 1 cycle at 65 C for 10 minutes, followed by 40 cycles at 92 C for 2 minutes, the same annealing temperature initially used for 2 minutes, and 65 C
209
for 10 minutes; the program ended with one cycle at 72 C

for 10 minutes. The PCR product was run on agarose gel
(1.5%) at 50 V during 6 hours, and the gel was stained
with ethidium bromide and visualized with a UV transilluminator.
To evaluate the efficiency among reverse transcriptases AMV, M-MLV and ThermoScript, a protocol was
used to amplify the whole genome of equine influenza
virus. Improved results were observed when using dsDNA
generated by ThermoScript-RT. When the ssDNA template
obtained from AMV, M-MLV and ThermoScript was used,
only a few bands could be observed in agarose gel (Fig. 2)
corresponding to small size fragments of the genome.
The optimum PCR reaction was obtained by adding 5
l from the dsDNA to a reaction mixture containing a final
concentration of 75 mM Tris-HCl (pH 8.8), 20 mM
(NH4)2SO4, 0.01% Tween 20, 200 M of each dNTP, 1.5
M of MgCl2, 0.5 M of each primer, 10% of DMSO and
2.5 U of Taq DNA polymerase.
An improved PCR amplification was carried out by
heating the PCR mixture at 95 C during 4 minutes, an-
Figure 2. RT-PCR using ssDNA as template: Lanes 3, 4 and 6:

amplicon obtained from AMV, M-MLV and RT-ThermoScript;
Lanes 1, 2 and 7: negative controls (RNA from uninfected allantoic
fluid) obtained from AMV, M-MLV and ThermoScript RT,
respectively. Lane 5: molecular size marker ( EcoRI-HindIII
Marker - Promega).
210
Figure 3. RT-PCR using dsDNA as template: Lane 1: molecular

size marker ( EcoRI-HindIII Marker - Promega); Lane 2: RTPCR product.
nealing at 40 C for 2 minutes and then adding 0.5 l (2.5

U) from Taq DNA polymerase (Fermentas). The amplification program started with 1 cycle at 65 C for 10 minutes, followed by 40 cycles at 92 C for 2 minutes, 40 C
for 2 minutes, and 65 C for 10 minutes and a final extension at 72 C for 10 minutes
The eight segments of equine influenza subtype 2 were
amplified simultaneously using primers UFLU-S and
UFLU-AS (Fig. 3). No amplified DNA was observed from
the RNA negative control. Bands corresponding to basic
polymerases (PB2 and PB1, segments 1 and 2 respectively) could not be clearly differentiated from each other
because they were the same size (2341 bp each). It was
followed by a band belonging to the acid polymerase (PA)
of 2233 bp, segment 4 (HA) with 1778 bp, segment 5

(NP) of 1565 bp, segment 6 (NA) with 1413 bp, segment
7 (M) of 1027 bp and, at the end, a band belonging to
segment 8 (NS) which showed an increased PCR product amount probably due to its smaller size.
In this study, the amplification conditions for the complete EIV genome were improved. The data presented in
this paper demonstrate that this method could be a helpful tool in the surveillance of the equine influenza virus
and appropriate for cloning the eight genomic segments,
which will facilitate large-scale EIV genome sequencing
and greatly ease systematic genetic analyses of the
virus. Adeyefa et al. (1) have described a multiplex RTPCR method in which 12-mer and 13-mer oligonucleotides
complementary to the conserved regions were used,
resulting in simultaneous amplification of all of the eight
RNA segments of Equine Influenza virus subtype 1. In
this work, a ThermoScript RT instead of AMV or M-MLV
RT was used to amplify the full length genome of equine
influenza virus subtype 2 (H3N8). This enzyme has higher
thermal stability and is described as suitable to make long
cDNA with complex secondary structure.
The product obtained by this method can be cloned
and used in later sequencing reactions or nested-PCR
with the purpose of achieving a rapid diagnosis and characterization of the equine influenza virus type A (1, 8).
This test is much faster than the isolation of the virus
from nasopharyngeal swabs/washings using embryonated
eggs or cell cultures and the possibility of automation will
allow handling a large number of clinical samples more
conveniently than with serological tests (7, 8).
RT-PCR might be useful in detecting inapparent, subclinical infection in animals that contribute to the spread
of the virus. Accurate identification of infected animals
and inapparent carriers is essential for the control of this
disease.
REFERENCES
1. Adeyefa CA, Quayle K, McCauley JW. A rapid method for
the analysis of influenza virus genes: application to the
reassortment of equine influenza virus genes. Virus Res
1994; 32: 391-9.
2. Daly JM, Lai AC, Binns MM, Chambers TM, Barrandeguy
M, Mumford JA. Antigenic and genetic evolution of equine
H3N8 influenza A viruses. J Gen Virol 1996; 77: 661-71.
3. Desselberger U, Racaniello VR, Zazra JJ, Palese P. The 3
and 5-terminal sequences of influenza A, B and C virus
RNA segments are highly conserved and show partial
inverted complementarity. Gene 1980; 8: 315-28.
4. Hoffmann E, Stech J, Guan Y, Webster RG, Perez DR.
Universal primer set for the full-length amplification of all
influenza A viruses. Arch Virol 2001; 146: 2275-89.
5. McCauley JW, Mahy BW. Structure and function of the influenza virus genome. Biochem J 1983; 211: 281-94.
211
6. Oxburgh L, Klingeborn B. Cocirculation of two distinct

lineages of equine influenza virus subtype H3N8. J Clin
Microbiol 1999; 37: 3005-9.
7. Oxburgh L, Hagstrm A. A PCR based method for the
identification of equine influenza virus from clinical samples.
Vet Microbiol 1999; 67: 161-74.
8. Quinlivan M, Cullinane A, Nelly M, Van Maanen K, Heldens
J, Arkins S. Comparison of sensitivities of virus isolation,
antigen detection, and nucleic acid amplification for detection

of equine influenza virus. J Clin Microbiol 2004; 42: 759-63.
9. Skehel JJ, Hay AJ. Nucleotide sequences at the 5' termini
of influenza virus RNAs and their transcripts. Nucleic Acids
Res 1978; 5: 1207-19.
10. Webster RG, Bean WJ, Gorman OT, Chambers TM,
Kawaoka Y. Evolution and ecology of influenza A viruses.
Microbiol Rev 1992; 56: 152-79.
Recibido: 28/04/09 Aceptado: 22/09/09
212
Revista Argentina de Microbiologa (2009)

41:0325-7541
212-214
ISSN
INFORME BREVE
Brote de micoplasmosis clnica por Mycoplasma ovis en

ovinos de Salta, Argentina. Diagnstico clnico,
microbiolgico y molecular
D. H. AGUIRRE*1, C. THOMPSON2, R. D. NEUMANN1, A. O. SALATIN1, A. B. GAIDO1,
S. TORIONI de ECHAIDE2
Estacin Experimental Agropecuaria Salta, CC 228 (4400) Salta, 2Estacin Experimental Agropecuaria Rafaela,
(2300) Rafaela, Santa Fe; Instituto Nacional de Tecnologa Agropecuaria, Argentina.
*Correspondencia. E-mail: daguirre@correo.inta.gov.ar
RESUMEN
Mycoplasma ovis es un parsito obligado de los eritrocitos de los pequeos rumiantes (ovinos, caprinos), en los que
produce anemia crnica o aguda. Su distribucin es mundial, aunque se desconoce la difusin de esta bacteria en la
Argentina. Este trabajo describe un brote de micoplasmosis en un rebao ovino de la localidad saltea de Rosario de
la Frontera, ocurrido en enero de 2007. Durante ese brote result afectada la categora de ovinos adultos, con una
mortalidad del 17,8%. El diagnstico en extendidos de sangre (tincin de Giemsa) revel pequeos cuerpos basfilos,
caractersticos de la infeccin por M. ovis, en todas las muestras examinadas (n = 11), lo que indica una alta prevalencia de la infeccin en la majada. El diagnstico molecular (n = 9) confirm los hallazgos mediante la amplificacin
de dos fragmentos del gen 16S rRNA. Este representa el tercer registro del microorganismo en la Argentina y el
primero con expresin clnica a escala poblacional (rebao).
Palabras clave: Mycoplasma ovis, ovinos, brote, Argentina
ABSTRACT
Clinical mycoplasmosis outbreak due to Mycoplasma ovis in sheep from Salta, Argentina. Clinical,
microbiological and molecular diagnosis. Mycoplasma ovis is an obligatory parasite of the erythrocytes from small
ruminants (sheep, goat), wherein it causes chronic or acute anaemia. This agent shows worldwide distribution. However,
its dispersion is still unknown in Argentina. This work describes an outbreak of mycoplasmosis occurred in January
2007 in a sheep flock from Rosario de la Frontera, Salta, Argentina. Adult sheep became ill with a mortality rate of
17.8%. All blood smears (n = 11) examined by Giemsa stain showed the presence of small basophile bodies characteristic
of M. ovis infection, indicating a high prevalence of the infection in the flock. The molecular diagnosis (n = 9) confirmed
the findings through the amplification of two fragments from the 16S rRNA gene. This is the third report of M. ovis in
Argentina and the first one concomitant with clinical signs at flock level.
Key words: Mycoplasma ovis, sheep, outbreak, Argentina
Mycoplasma ovis, hasta hace poco Eperythrozoon ovis,

es una bacteria pleomrfica y un parsito obligado de los
hemates de ovinos y caprinos, no cultivable en medios
artificiales. Hoy integra el grupo de micoplasmas conocido
como hemoplasmas, con rasgos patognicos antes no
considerados entre los Mollicutes (8, 9). Este agente fue
descrito en 1934 por Neitz et al. (10) en Sudfrica, y desde entonces se lo diagnostic en todo el mundo (8, 9). En
Argentina, las nicas referencias previas de M. ovis corresponden a las regiones Noreste, provincia de Corrientes (15), y Noroeste, provincia de Salta (1).
Esta bacteria se transmite por artrpodos hematfagos y por fmites. Hasta ahora son pocas las especies de vectores comprobadas, que comprenden garrapatas (Haemaphysalis plumbeum y Rhipicephalus bursa)
y mosquitos (Aedes camptorhynchus y Culex annulirostris)

(9). Mycoplasma ovis se puede trasmitir tambin de manera artificial por el uso de instrumental comn en distintas prcticas ganaderas, como vacunaciones, esquila o
aplicacin de caravanas (2, 8).
La infeccin por M. ovis es generalmente asintomtica,
aunque se han descrito cuadros clnicos de curso crnico y agudo. La forma crnica se caracteriza por anemia
moderada, fatiga y menor produccin de carne y lana (3,
4). En animales portadores, la anemia puede eventualmente acentuarse por estrs, inmunosupresin o enfermedades concurrentes (8). La forma aguda cursa con
fiebre, anemia grave, ictericia, depresin, prdida de peso
y muerte (12, 13). Los ovinos infectados mantienen el
agente durante perodos prolongados (2, 5, 11), aun des-
Brote de micoplasmosis clnica por Mycoplasma ovis en ovinos
pus de la terapia con antibiticos eficaces (8, 9). Con la

coloracin de Giemsa, M. ovis se observa en la superficie de los eritrocitos como pequeos organismos basfilos
cocoides de 0,5 a 1,0 m de dimetro (9). El gen 16S
rRNA ha sido usado como marcador para la caracterizacin molecular y en estudios taxonmicos de Mycoplasma
spp. en diferentes hospedadores (6, 8, 9).
Este trabajo informa sobre los aspectos epidemiolgicos, clnicos y mtodos de diagnstico empleados en
un brote de micoplasmosis ovina ocurrido en cercanas
de Rosario de la Frontera (2548S, 6458O), Salta, en
una pequea majada integrada poco antes por ovinos
de origen local diverso. El rebao se compona de 39
animales, 28 adultos y 11 cras de hasta dos meses de
edad. Alrededor de un mes antes del primer deceso, la
majada haba sido vacunada contra clostridiosis y
desparasitada con ivermectina va inyectable. El rebao
soportaba una elevada incidencia de insectos hematfagos (especies no determinadas) al momento del brote.
En enero de 2007 murieron cinco animales adultos
(17,8%), uno el da 5, otro el 16, dos el 17 y uno el 18. El
da 19 se efectuaron las necropsias de dos ovejas muertas. Con sangre de una de ellas se realizaron extendidos
finos y gruesos, los que se colorearon con Giemsa al
10% y se examinaron al microscopio con objetivo de inmersin (100X) para detectar la presencia de hemoparsitos.
Los das 19, 21 y 23 de enero todos los ovinos recibieron tratamientos con tetraciclina inyectable (Oxiton,
Agropharma, Argentina) en dosis de 5 mg/kg. En los das
siguientes no ocurrieron nuevos decesos. El 26 de enero
se realizaron extendidos de sangre perifrica (oreja) y se
obtuvieron muestras de sangre con anticoagulantes
(EDTA, citrato de sodio al 5%) de 10 ovinos adultos del
rebao. Los extendidos se procesaron y examinaron
como antes se refiri. Las muestras con EDTA se utilizaron para determinar el ndice hematocrito mediante la
tcnica del microhematocrito, mientras que las muestras
citratadas se emplearon para conocer la identidad
genmica de Mycoplasma spp. por la tcnica de la reaccin en cadena de la polimerasa (PCR) y el anlisis de la
secuencia del producto amplificado.
Para realizar la PCR se utilizaron los oligonucletidos
340F y 543R, previamente descritos (9), y otros diseados ad hoc (Myc783F AGTAGTCCACGCCGTAAACGAT
y Myc764R TCAGTTATATCCCAGGTACTCGCC) a partir
de la secuencia del gen 16S rRNA de M. ovis de referencia (AF338268). Los productos amplificados se purificaron (Qiagen) y se enviaron a secuenciar. Las secuencias
resultantes se alinearon mediante el programa informtico
Bioedit y se compararon con la secuencia de referencia
de M. ovis y de Mycoplasma wenyonii (AF016546) (9). Los
anlisis filogenticos se realizaron mediante el programa
Mega 4 utilizando el mtodo Neighbor-joining (correccin
de Kimura-2 parmetros) (14).
213
0
99
0
76
0
0RYLV$)
0ZHQ\RQLL$)
$ODLGODZLL0
0.005
Figura 1. rbol filogentico obtenido mediante un anlisis de

Neighbor-joining (Kimura-2 parmetros) a partir del alineamiento de las secuencias de referencia de M. ovis y M. wenyonii.
Acholeplasma laidlawii fue usado como grupo externo. En los
nodos del rbol se aclara el valor obtenido en la prueba estadstica de bootstrap (1000 repeticiones). El anlisis se efectu con
el programa informtico Mega 4. Entre parntesis se muestra el
nmero de acceso a GenBank de cada secuencia. Las nuevas
secuencias obtenidas fueron depositadas en el GenBank (N de
acceso FJ866785).
Las necropsias mostraron alteraciones similares en

ambas ovejas: anemia, ligera ictericia subcutnea, marcada ictericia heptica, esplenomegalia, riones friables
y congestin y edema pulmonares. El estado nutricional
de los animales era ptimo, segn reflejaban gruesos
depsitos adiposos abdominales. En ninguna de las ovejas se hallaron nematodes abomasales (i.e. Haemonchus
contortus), a menudo responsables de mortalidad estivootoal por anemia en los ovinos de la regin. Tampoco
se observaron ectoparsitos (melfagos, piojos o garrapatas) fijados a la piel o lana de las ovejas.
La sangre de una de las ovejas muertas revel al examen microscpico mltiples cuerpos basfilos adheridos
a los eritrocitos, acordes con las descripciones de M. ovis.
Cuerpos idnticos se observaron tambin, en menor nmero, en todos los extendidos de sangre obtenidos de
los ovinos sobrevivientes (Figura 2). En ningn caso los
extendidos mostraron cambios significativos del cuadro
hemtico (reticulocitosis, anisocitosis, etc.). La media del
ndice de hematocrito de los 10 ovinos muestreados fue
de 33,0 (rango 24-37).
En nueve de las nueve muestras analizadas se lograron amplificar dos fragmentos del gen 16S rRNA, uno de
224 pb con los oligonucletidos Myc340F-Myc543R y otro
de 417 pb con los oligonucletidos Myc340F-Myc764R.
Slo tres secuencias del gen 16S rRNA resultaron legibles
e idnticas entre s y fueron depositadas en el GenBank
(N de acceso FJ866785). Ambas mostraron un 98% de
similitud, tanto con la secuencia de M. ovis (AF338268)
como con la de M. wenyonii (AF016546). La Figura 1
presenta un rbol filogentico con la relacin entre estas
ltimas dos secuencias y los tres fragmentos secuenciados. Estos resultados confirman la gran similitud entre M. ovis y M. wenyonii, previamente observada por
otros autores, tanto inmunolgica (7) como filogentica
(9). Como M. wenyonii es considerado especfico de los
214
argentino con abundancia de vectores (15), la primera

sospecha de su relevancia patgena a nivel local surgi
hace poco, tras la muerte de un carnero trasladado de
Crdoba a Salta (1). Pero ese caso aislado no permiti
mayores inferencias sobre el origen de la infeccin por
M. ovis y su patogenicidad. Por el contrario, el brote en
ovinos nativos de Salta que aqu se describe confirma la
presencia regional del agente y aporta evidencia contundente de su accin deletrea a escala poblacional, la que
desde ahora deber contemplarse para el diagnstico
nosolgico diferencial.
BIBLIOGRAFA
Figura 2. Extendido de sangre ovina. Glbulos rojos con presencia de formas cocoides sobre su superficie (flechas), compatibles con Mycoplasma ovis. Coloracin de Giemsa. 1000 x
bovinos (8), la hiptesis de una eventual infeccin de los

ovinos con este agente se estima improbable.
Los cambios anatomopatolgicos sumados a la
anamnesis y al diagnstico microscpico y molecular
prueban la accin patgena de M. ovis en el caso aqu
referido. Esta bacteria se diagnostica de rutina por el
examen directo de extendidos de sangre coloreados, si
bien la baja parasitemia de las infecciones crnicas puede conducir a resultados falso negativos. El diagnstico
definitivo requiere entonces la inoculacin de sangre de
animales sospechosos en ovinos o caprinos esplenectomizados, o bien el empleo de tcnicas de biologa
molecular, como la utilizada en esta investigacin (8).
Es probable que la tasa de mortalidad de este brote
de micoplasmosis hubiese sido mayor en ausencia de
las medidas teraputicas aplicadas. La mortalidad se
circunscribi a ovinos adultos, como hace poco ocurri
en un rebao de Hungra, donde muri el 5,5% de las
ovejas adultas (6). La prevalencia de la infeccin fue muy
elevada, ya que el 100% de los ovinos muestreados (n =
11) exhibieron presencia de M. ovis. La transmisin pudo
verse favorecida por la abundancia de insectos hematfagos o por iatrogenia asociada a medicaciones inyectables administradas con anterioridad en el rebao.
El presente brote result curioso dados los escasos
precedentes sobre esta infeccin. Aunque se postula que
la distribucin de M. ovis es amplia en las reas del norte
1. Aguirre D, Cafrune M, Arjona C, Venzano A. Micoplasmosis

(eperythrozoonosis) ovina en Salta, Argentina. XVII Congreso Latinoamericano de Parasitologa, Resumen 187.
Parasitol Latinoam 2005; 60: 173.
2. Brun-Hansen H, Gronstol H, Waldeland H, Hoff B.
Eperythrozoon ovis infection in a commercial flock of sheep.
Zentbl Veterinarmed B 1997; 44: 295-9.
3. Burroughs GW. The significance of Eperythrozoon ovis in
ill-thrift in sheep in the eastern Cape coastal areas of South
Africa. J S Afr Vet Assoc 1988; 59: 195-9.
4. Daddow KN. Eperythrozoon ovis a cause of anaemia,
reduced production and decreased exercise tolerance in
sheep. Aust Vet J 1979; 55: 605-6.
5. Daddow KN. The duration of the carrier state of
Eperythrozoon ovis infection in sheep (letter). Aust Vet J
1981; 57: 49.
6. Hornok S, Meli ML, Erdos A, Hajts I, Lutz H, HofmannLehmann R. Molecular characterization of two different
strains of haemotropic mycoplasmas from a sheep flock
with fatal haemolytic anaemia and concomitant Anaplasma
ovis. Vet Microbiol 2009; 136: 372-7.
7. Kreier JP, Ristic M. Morphologic, antigenic and pathogenic
characteristics of Eperythrozoon ovis and Eperythrozoon
wenyoni. Am J Vet Res 1963; 24: 488-500.
8. Messick JB. Hemotropic mycoplasmas (hemoplasmas): a
review and new insights into pathogenic potential. Vet Clin
Pathol 2004; 33: 2-13.
9. Neimark H, Hoff B, Ganter M. Mycoplasma ovis comb. nov.
(formerly Eperythrozoon ovis), an epierythrocytic agent of
haemolytic anaemia in sheep and goats. Int J Syst Evol
Microbiol 2004; 54: 365-71.
10. Neitz WO, Alexander RA, Du Toit PJ. Eperythrozoon ovis
(sp. nov.) infection in sheep. Onderstepoort J Vet Sci 1934;
3: 263-9.
11. Overas J. Studies on Eperythrozoon ovis infection in
sheep. Acta Vet Scand 1969; Suppl 28: 1-148.
12. Rouse BT, Johnson RH. Eperythrozoon ovis. Vet Rec 1966;
79: 223-4.
13. Sheriff D, Clapp KH, Reid MA. Eperythrozoon ovis infection
in South Australia. Aust Vet J 1966; 42: 169-76.
14. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version
4.0. Mol Biol Evol 2007; 24: 1596-9.
15. Vanzini VR, Somma de Fere GR, Zurbriggen MA, Homse
AC, Draghi de Bentez MG, Rochinotti D, et al. Hallazgo de
Eperythrozoon ovis en la provincia de Corrientes (Argentina). IDIA 1983; 417- 420: 105-7.
215
ISSN 0325-7541
Spoligotyping of Mycobacterium bovis isolates from cats
ARTCULO ORIGINAL
Mycobacterium bovis in Argentina: isolates from cats

typified by spoligotyping
M. J. ZUMRRAGA1*, M. MARTNEZ VIVOT 2, D. MARTICORENA2, A. BERNARDELLI 3,
R. FASN4, R. IACHINI 5, A. A. CATALDI 1.
1
Instituto de Biotecnologa, CICVyA-INTA, Castelar; 2Facultad de Veterinaria, Universidad de Buenos Aires;

3
Ctedra de Patologa de la Universidad Nacional de Ro IV, Crdoba; 4LACLIVET, Buenos Aires;
5
Instituto Pasteur, Buenos Aires, Argentina.
*Correspondence. E-mail: mzumarraga@cnia.inta.gov.ar
ABSTRACT
In the present work, 19 Mycobacterium bovis isolates from different cats were typified by spoligotyping. We detected
nine spoligotypes. There was only one cluster, which grouped 11 of the isolates (57.9%), showing the main spoligotype
from cattle from Argentina. The rest of the spoligotypes presented only one isolate each. Five of them were not found
in cattle, and were unique and exclusive of cats. The isolates studied show that tuberculosis of bovine origin in cats
constitutes a potential public health problem in Buenos Aires region. The identification of genotypes from non-natural
hosts could contribute to understand the spread of bovine tuberculosis. This is the first report showing genetic profiles
of M. bovis isolates in felines from Argentina.
Key words: tuberculosis, cats, spoligotyping
RESUMEN
Mycobacterium bovis en Argentina: aislamientos de gatos tipificados por spoligotyping. En el presente trabajo
se tipificaron por spoligotyping 19 aislamientos de M. bovis de diferentes gatos. Se detectaron 9 espoligotipos y un
nico agrupamiento o cluster integrado por 11 aislamientos (57,9%) y relacionado con el principal espoligotipo de
bovinos de Argentina. El resto de los espoligotipos detectados presentaron solamente un aislamiento cada uno; 5 de
ellos no se encontraron en bovinos y fueron nicos y exclusivos de gatos. La presencia de estos aislamientos indica
que la tuberculosis bovina en los gatos constituye un potencial problema de salud pblica en la ciudad de Buenos
Aires. La identificacin de genotipos de aislamientos de M. bovis de hospedadores no convencionales podra contribuir a la mejor comprensin de la diseminacin de la tuberculosis bovina. Este es el primer informe en el que se
muestran los perfiles genotpicos de aislamientos de M. bovis obtenidos de felinos de Argentina.
Palabras clave: tuberculosis, gatos, spoligotyping
INTRODUCTION
Bovine tuberculosis is a chronic zoonosis that affects
different wild and domestic animals, causing relevant
economic losses in livestock. The causative agent is
Mycobacterium bovis, a member of the Mycobacterium
tuberculosis complex, which also includes Mycobacterium
tuberculosis, Mycobacterium africanum, Mycobacterium
microti, Mycobacterium canetti, Mycobacterium caprae
and Mycobacterium pinnipedii (4). The main host of M.
bovis is cattle, although several mammalian species can
also be infected. In Argentina, the prevalence in cattle is
around 1.2%, estimated by detection of lesions in the
slaughterhouse (13). Among domestic animals, cats are
the most susceptible hosts of bovine tuberculosis (14).
The main pathway of tuberculosis infection in felines
is the digestive route. However, tuberculosis can also
infect by the aerogenic pathway and/or injured scratches.
Cats are more susceptible to M. bovis than dogs,
probably because a common pet owners habit is to feed
cats only with raw food such as raw lung, liver and other
viscera (3, 6, 14). The milk of infected animals is a very
important source of infection, especially in rural areas,
where milk is commercialized without pasteurization. The
evolution of the disease in cats is different from that in
bovines, reaching earlier a generalization of the infection
that leads to the death of the animal. The clinical signs of
the disease are unspecific and affect several organs or
fluids such as lymph nodes, intestines, kidneys, pleura,
lungs, liver and/or brain. The confirmation of clinical
suspicion must be carried out by culture from different
organs or fluids (7). The National Plan of Control and
Erradication of Bovine Tuberculosis does not recommend
the use of the tuberculine test in dogs and cats because
it can give negative false results (10). In Argentina, it is
mandatory to report the cases of tuberculosis to sanitary
agents. Nevertheless, the information about the incidence
of bovine tuberculosis in cats in Argentina is incomplete
and scarce (6, 11, 14). As an antecedent, 4% of the cats
necropsies at the School of Veterinary Sciences of the
216
Figure 1. Dendrogram showing the relationship between nine M. bovis spoligotypes detected among 19 cat isolates from Buenos
Aires city. The spoligotypes of reference strains of M. tuberculosis H37Rv and M. bovis BCG are also included. The numbers at the
top of the figure denote the spacers. Spo stands for spoligotype.
University of Buenos Aires (UBA) presented tuberculosis

(14).
The transmission of bovine tuberculosis can be
stopped by implementing control programs, feeding pets
with balanced food, pasteurizing milk, and cooking meat
products.
However, in the last years in Argentina, these barriers
have not been enough to protect pets from tuberculosis.
People who adopt and rear many cats, together with the
increase of immunosuppressing diseases (feline
immunodeficiency virus and feline leukemia virus), have
led to an epidemiological change. Different molecular
methods are used to type the M. tuberculosis complex.
One of them, called spoligotyping, is a PCR reverse line
blot hybridization method based on the polymorphism of
the direct repeat (DR) region (8). This method is easy to
perform and allows the differentiation of interspecies and
intraspecies variability among the M. tuberculosis complex.
However, although the method is not polymorphic enough
to identify close relationships, it can be useful for the
determination of more distant relationships between
isolates (15).
Therefore, in order to gain a deeper insight into tuberculosis in cats, we have typed M. bovis isolates from cats
from Buenos Aires city, Argentina, by spoligotyping.
MATERIALS AND METHODS

Stray cats from Buenos Aires city that had died by unknown
causes between 1998 and 2006 were submitted to the School of
Veterinary Sciences of the UBA to be necropsied. Nineteen
isolates were obtained from the lymph nodes from all the animals
except for one, which was obtained from bronchoalveolar lavage
(3) from a pet belonging to a woman that lived with 20 other cats
in her house. These cats were fed daily with raw beef lung (3).
Macerated lymph nodes and bronchoalveolar exudate samples
were cultured in LowensteinJensen and Stonebrink media for
mycobacteria after decontamination by the Petroff method (4%
sodium hydroxide) (5).
A loopfull of bacteria was suspended in 200l of distilled water
into a 2-ml screw-cap tube and boiled for 30 min. After
centrifugation at 12,000 rpm for 5 min, 5 l of supernatant was

used for PCR (polymerase chain reaction) to perform
spoligotyping according to the protocol previously described by
Kamerbeek et al. (8), and using the spoligotyping kit (Isogen
Biosolutions B.V., Ocimun Biosolutions Company, Ijsselstein, The
Netherlands). A cluster analysis of the spoligotype patterns was
performed with the BioNumerics software (Windows NT, version
2.5; Applied Maths, Kortrijk, Belgium). The categorical coefficient
was used to calculate the similarity of spoligotype patterns, and
the UPGMA (Unweighted pair-group method with arithmetic
averages) method was applied to calculate a dendrogram.
Clusters of isolates were defined as two or more M. bovis strains
with identical spoligotypes. Each of the different spoligotypes
were allocated a number. M. tuberculosis H37Rv (ATCC 27294)
and M. bovis Bacillus Calmette-Guerin (BCG) (ATCC 27289)
were included as reference strains in each spoligotyping
experiment.
RESULTS
Nine different spoligotypes were detected among the
19 M. bovis isolates from cats, eight of which were unique
(Figure 1). All the strains lacked spacers 3, 9, 16 and 39
to 43, characteristic of M. bovis isolates. There was only
one cluster that grouped 11 of the isolates (57.9%) and
showed spoligotype Spo 34, identified as SB0140 in the
international database of the University of Sussex, United
Kingdom (UK) (http://www.mbovis.org/). This spoligotype
is the most frequent among the 542 M. bovis isolates
analyzed from Argentina (15, 16), representing 46.9% of
the total collection. The remaining eight spoligotypes had
only one isolate each. Five of them (Spo 48, 70, 71, 75
and 90) were exclusive of cats because neither bovine
nor other host isolates from Argentina had been previously
detected. The other three spoligotypes (Spo 3, 21 and
29) had been found in bovine. In addition Spo 21 was
also found in human, pig and armadillo isolates and Spo
3 was also described in human isolates from Argentina.
The spoligotypes not found in the University of Sussex
database were included to perform further comparisons
between laboratories.
217
Spoligotyping of Mycobacterium bovis isolates from cats
DISCUSSION
Since cats are susceptible to the M. tuberculosis, M.
bovis and M. avium complex, the isolates must be typed
to adopt different health management programs. M. bovis
is mainly transmitted to cats by the gastrointestinal route
after the ingestion of contaminated food (6, 9, 14). It was
not possible to know the infection source of the sampled
cats, though they had probably been fed daily with raw
bovine lung. Feeding stray cats in this way is an old
custom of people from our country. This practice could
explain the probable infection source of these cats.
Moreover, the availability of contaminated bovine lungs
in the city, suggests a failure in slaughterhouse inspection.
The cluster that grouped 57.9% of the isolates from cats
showed the main spoligotype (Spo 34/SB0140) detected
in bovines from Argentina (15, 16). This spoligotype is
also predominant in the United Kingdom and other
countries that had imported cattle from the UK at the end
of the nineteenth century (2). Spoligotypes Spo 3, 21
and 29, were identified in a previous epidemiological
study, grouped at 3.3, 20.1 and 2.8% of all the isolates
(15, 16). Spo 21 is the second spoligotype in frequency
in Argentina and Spo 3 may be related to humans because
61% of the isolates with this spoligotype were from
pulmonary isolates from non-related humans (15, 16). The
presence of these spoligotypes in M. bovis isolates from
cats, demonstrates the transmission from bovines to cats.
The distribution of the different patterns could be due
to epidemiological factors and the virulence of the strain
within the population. In low prevalence areas, a high
genetic diversity is found in cattle populations, thus
implying a variety of unrelated ancestor strains (12).
Intriguingly, there were five spoligotypes that were unique
and exclusive of cats, not detected among the cattle
isolates from Argentina, differentiated by one or few
spacers from those detected in bovines. These patterns
could correspond to other genotypes from non-sampled
bovines. On the other hand, the change of host could exert
selective pressure on the mycobacterial genome, thus
giving new related patterns. Other authors have also found
spoligotypes from cats that were not found in isolates from
other animals, thus spoligotyping represents a good tool
to detect new types from different host species (1).
Further studies will be necessary to confirm the
presence of M. bovis in bovine lungs from butchers stores.
It is our belief that it is very important to be aware of the
risk of the very old custom of feeding cats with raw bovine
lung. Thus, we suggest that the best way to decrease the
incidence of bovine tuberculosis in cats is feeding them
with balanced food pellets or well cooked food, reducing
the risk of human infections.
Acknowledgements: we thank H. Gil and R. V. Rocha (Instituto de Biotecnologa, CICVyA-INTA, Castelar) and L.
Domnguez (Instituto Pasteur, Buenos Aires) for technical

assistance. This work was supported by grants from INTA. AC is
a researcher from the National Research Council of Argentina
(CONICET).
REFERENCES
1. Aranaz A, Libana E, Mateos A, Domnguez L, Vidal D,
Domingo M, et al . Spacer oligonucleotide typing of
Mycobacterium bovis strains from cattle and other animals:
a tool for studying epidemiology of tuberculosis. J Clin
Microbiol 1996; 34: 2734-40.
2. Cataldi AA, Gioffr A, Santngelo MP, Alito A, Caimi K,
Bigi F, et al. El genotipo de Mycobacterium bovis mayoritario en la Argentina lo es tambin en las Islas Britnicas: la
tuberculosis bovina provino de Gran Bretaa?. Rev Argent
Microbiol 2002; 34: 1-6.
3. Colmegna I, Ricci BG, Zumrraga M, Cataldi AA, Di Lonardo
MM, Citera G, et al . Mycobacterium bovis and septic
glenohumeral arthritis. Clin Rheumatol 2004; 23: 379-80.
4. Cousins DV, Bernardelli A, Bastida R, Cataldi A, Quse V,
Dow S, et al. Tuberculosis in seals caused by a novel
member of the Mycobacterium tuberculosis complex:
Mycobacterium pinnipedii sp. nov. Int J Syst Bacteriol 2003;
53: 1305-14.
5. de Kantor IN. Bacteriologa de la tuberculosis. Boletn
Epidemiolgico N11. Buenos Aires, CEPANZO OPS/OMS,
1988, p. 26-35.
6. Fernndez F, Morici E. Tuberculosis felina por
Mycobacterium bovis: comunicacin de dos casos. Rev
Argent Microbiol 1999; 31 Supl 1: 19-20.
7. Jorge MC, Mendivil M, Fresneda K. Perros y gatos como
huspedes susceptibles y reservorios epidemiolgicos de
la tuberculosis. XV Reunin Cientfico Tcnica de la Asociacin Argentina de Veterinarios de Laboratorios de Diagnstico, 2004, p. 167-8, Ciudad Autnoma de Buenos Aires, Argentina.
8. Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van
Soolingen D, Kuijper S, et al. Simultaneous detection and
strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 1997; 35: 907-14.
9. Kaneene JB, Bruning-Fann CS, Dunn J, Mullaney TP, Berry
D, Massey JP, et al . Epidemiologic investigation of
Mycobacterium bovis in a population of cats. Am J Vet Res
2002; 63: 1507-11.
10. Kistermann JC, Torres PM. Epidemiologa de la tuberculosis bovina. In: Actualizacin de la tuberculosis bovina, Buenos Aires, SENASA, 1999, p. 37-46.
11. Martnez Vivot M, Ritacco V, Reniero A, Barboni A, Guida
N, Moras EV. Tuberculosis felina: caracterizacin
bacteriolgica y genmica de los aislamientos en el
Conurbano bonaerense. In Vet 2001; 3: 179-82.
12. Michel AL, Hlokwe TM, Coetzee ML, Mar L, Connoway L,
Rutten VP, et al. High Mycobacterium bovis genetic diversity
in a low prevalence setting. Vet Microbiol 2008; 126: 151-9.
13. Torres P. Situacin de la tuberculosis bovina en la Repblica Argentina. Buenos Aires, SENASA, 2006, p. 1-21.
14. Underwood S, Pinto MC, Rey Moreno JC, Carfagnini SC.
Tuberculosis felina: casos diagnosticados y consideraciones sobre su posible fuente de infeccin. Rev Argent
Microbiol 1999; 31 Supl 1: 17-8.
15. Zumrraga MJ. Epidemiologa molecular de la tuberculosis bovina. Tesis doctoral, FCEyN, UBA, 2007.
16. Zumrraga MJ, Martin C, Samper S, Alito A, Latini O, Bigi
F, et al. Usefulness of spoligotyping in molecular epidemiology
of Mycobacterium bovis-related infections in South America.
J Clin Microbiol 1999; 37: 296-303.
218

41:0325-7541
218-225
ISSN
ARTCULO ORIGINAL
Echinococcus granulosus: biological comparison of cattle

isolates from endemic regions of Argentina and Spain
M.V. ANDRESIUK*1,2, F. PONCE GORDO3, C. CUESTA BANDERA3, M. C. ELISSONDO1, 2,
M. DOPCHIZ1, 2, G. DENEGRI1, 2
Laboratorio de Zoonosis Parasitarias. Facultad de Ciencias Exactas y Naturales. Universidad Nacional de Mar del Plata. Funes
3350 (7600) Mar del Plata, Buenos Aires, Argentina; 2Consejo Nacional de Investigaciones Cientficas y Tcnicas (CONICET),
Argentina; 3Departamento de Parasitologa, Facultad de Farmacia, Universidad Complutense de Madrid, Madrid, Espaa.
*Correspondence. E-mail: mandres@mdp.edu.ar
ABSTRACT
In the present study we have compared cattle isolates of Echinococcus granulosus from Argentina and Spain. The aim
was to compare and determine if there exist phenotypic and genetic differences within E. granulosus cattle isolates
between an endemic area of Spain (where the disease is mainly restricted to a sheep-dog cycle) and an endemic area
of Argentina (where cattle are the most abundant intermediate hosts). The Spanish samples were previously identified
as G1 genotype. The Argentinean samples were also identified as G1, but some variants were found for the cytochrome
c oxidase-1 (CO1) and NADH dehydrogenase-1 (ND1) mitochondrial genes. When comparing the cyst features and
the morphology of the larval rostellar hooks in both regions, some differences were found. The morphometric analyses
of the larval rostellar hooks showed the existence of two distinct clearly separated groups (one corresponding to the
Argentinean samples and the other to the Spanish ones). In conclusion, there are some genetic and phenotypic
differences within E. granulosus cattle isolates from Argentina and Spain. Probably these differences, more important
from an epidemiological point of view, are related to different steps in the disease control in both countries. Further
studies involving other epidemiological, morphometric and molecular data, including other types of livestock, would
contribute to clarify and expand the present work.
Key words: Echinococcus granulosus, epidemiology, morphology, genotypes, Argentina, Spain
RESUMEN
Echinococcus granulosus: comparacin biolgica de aislados de bovinos de regiones endmicas de Argentina y Espaa. El objetivo del presente trabajo fue determinar si existen diferencias fenotpicas y genticas entre los
aislados de Echinococcus granulosus de origen bovino provenientes de dos regiones geogrficas donde la hidatidosis
es endmica, una de Espaa (donde predomina el ciclo perro-oveja) y una de Argentina (donde el bovino es el
hospedador intermediario ms importante). Las muestras espaolas fueron previamente identificadas como
pertenecientes al genotipo G1. Las muestras argentinas tambin correspondan al genotipo G1, pero entre ellas se
registraron algunas microvariantes de los genes mitocondriales citocromo c oxidasa-1 (CO1) y NADH deshidrogenasa1 (ND1). La comparacin de las caractersticas de los quistes y de la morfologa de los ganchos rostelares del
metacestode mostr ciertas diferencias. En conclusin, existen algunas diferencias genticas y fenotpicas entre los
aislados de E. granulosus de Argentina y Espaa. Probablemente estas diferencias, ms importantes desde el punto
de vista epidemiolgico, podran estar relacionadas con diferentes etapas en los programas de control de la enfermedad
en los dos pases. Estudios adicionales que involucren datos epidemiolgicos, morfomtricos y moleculares provenientes
de otros tipos de ganado contribuirn a clarificar y ampliar la informacin aportada por este trabajo.
Palabras clave: Echinococcus granulosus, epidemiologa, morfologa, genotipos, Argentina, Espaa
INTRODUCTION
Echinococcosis-hydatidosis is a cosmopolitan zoonosis caused by the cestode Echinococcus granulosus. This
parasite shows great intraspecific variability in relation to
its host specificity, epidemiology, morphology, biochemistry, physiology and genetics (39). Various methods
based on morphology, physiology, biochemistry and immunology have been used to characterize the variants or
strains of E. granulosus (1, 2, 31, 39). These strains were

later identified as genotypes by molecular studies (G1 G10) (7-9, 24, 35). Recently some authors have proposed
a revision of the genus based on phylogenetic studies
tending to re-categorize some genotypes to the species
level (27, 34, 41). Several studies around the world that
have been carried out to characterize the strains/genotypes of E. granulosus from a region or a country, have
demonstrated the existence of genetic variation or se-
Echinococcus granulosus from Argentina and Spain
quence heterogeneity in mitochondrial DNA within some

of the recognized genotypes G1 - G10 (21, 22, 29, 33).
Haag et al. (19) gave the name of haplotypes to the
mitochondrial sequences used to discriminate strains, and
variants, to the haplotypes with minor genetic differences
within a strain. Since then, different authors have described these mitochondrial variants or microvariants
within E. granulosus (5, 6, 10, 32). Among the ten genotypes that have been described so far, the G1 genotype
is the most widespread around the world infecting sheep,
cattle, pig, goat, buffalo and humans. In general, cattle
have been considered a poor suitable host for the G1
genotype, although some recent studies have demonstrated that cattle could play a role as a reservoir of the
G1 genotype in some areas like Algeria and Tunisia, which
is a serious risk for human health (4, 25, 40).
Although E. granulosus is widespread in the whole
territory of Argentina and the hydatid disease is considered endemic in this country, the infection does not have
a homogeneous geographical distribution. The contribution of each kind of livestock (cattle, pig, sheep, etc) in
the disease transmission depends on the region: for example while sheep is the principal host in the Patagonian
and Mesopotamian region, cattle is the prevalent one in
the Pampa and northern regions of the country (14). Particularly in the south-eastern region of Buenos Aires province (located within the Pampa region), hydatidosis - echinococcosis is considered an important human and veterinary health problem, being cattle the main livestock
involved in the transmission of this disease. (3, 14, 15,
16, 20)
In Spain, E. granulosus infects sheep, cattle, pig, goat
and humans and several genotypes have been described.
However, sheep is the main host involved in the transmission of the hydatid disease (11, 13, 18, 26, 30, 36).
The aim of the present study is to compare and determine if there exist phenotypic and genetic differences
between E. granulosus isolates of cattle origin from an
endemic central area of Spain (where the disease is
mainly restricted to a sheep-dog cycle) and from an endemic area of Argentina (southern region of Buenos Aires
province) where cattle are the most abundant intermediate hosts.
Material and methods

Origin and processing of samples
The hydatid cysts were obtained from liver and lungs of
infected cattle. The Spanish samples were collected during the
period 1990-1996 at slaughterhouses from the endemic central
region of Spain (Autonomous Community of Madrid, Castilla La Mancha, Castilla - Len, Extremadura, Aragn and Navarra).
The Argentine samples were collected between 2003 and 2004
at an abattoir located in the south-eastern region of Buenos Aires province. Each cyst was processed as an individual isolate.
They were opened under sterile conditions, according to Smyth
and Davies (38). For each cyst, the external appearance and
macroscopical characteristics of the cyst wall, germinal
219
membrane and hydatid fluid (general aspect, color and

transparency, existence of calcified or degenerated areas and
contamination) were recorded. For the purposes of this study,
the cysts considered viable were those having membranes which
did not appear upset or degenerate, white, without calcified,
caseous or degenerated regions, not contaminated and with a
transparent hydatid fluid. Those cysts which had protoscoleces
were considered fertile. The vitality of protoscoleces (percentage
of alive protoscoleces) was determined by their overall aspect
(motility, flame cell activity, presence of calcareous corpuscles)
and negative methylene blue staining. Viable and fertile cysts
were further processed; germinal membranes were washed three
times in sterile phosphate buffered saline (PBS) and stored at 4
C (if to be processed within a short period of time) or at -20 C
until use. When hydatid sand was present, it was processed
according to Smyth and Davies (38) and then stored in alcohol
70-glycerine (1:1) at room temperature (for morphological
studies) or in alcohol 70 at 4 C or PBS at -20 C (for genetic
analyses).
Epidemiological data
The number and location of cysts, their size, viability and
fertility were recorded for each geographical area under study.
Comparisons between both regions were made using univariate
techniques for all the recorded variables (Fishers Exact Test,
Mann Whitney and Students t test) (39). Statistical significance
was assessed at p 0.05. Mean intensity was calculated as the
mean number of cysts/infected animals (39).
Morphological studies
The protoscoleces were processed according to Ponce Gordo and Cuesta Bandera (31). The number, shape and arrangement of rostellar hooks were recorded, and 5 variables were
used for statistical analysis: the total number of hooks per
rostellum (NUM), the blade length of large (LBL) and small (SBL)
hooks, and the total length of large (LTL) and small (STL) hooks.
All measurements were made by the same people (M.V.A. and
F.P.G. for the Argentinean samples and F.P.G. for the Spanish
samples). Comparisons between and within each region were
made by using univariate and multivariate techniques (Principal
Component Analyses) (31).
DNA analysis and sequencing

The identification of the Spanish isolates as belonging to the
sheep strain/G1 genotype had been previously carried out by
using biochemical and genetic analyses (13, 18, 26, 30, 36, 37).
All the Spanish isolates presented 100% homology with the
cytochrome c oxidase-1 (CO1) and NADH dehydrogenase-1
(ND1) sequences of the G1 genotype originally described by
Bowles et al . (7) and Bowles and McManus (9) (GenBank
Accession Numbers: M84661 and AJ237632).The genotype of
the Argentinean isolates has been identified by using the same
mitochondrial genes, following the same protocols and using the
same PCR conditions as previously described by other authors
(7, 9, 26). The gene segment considered was 366bp in length
for CO1 (7) and 471bp in length for ND1 (9). The CO1 and ND1
fragments were purified using the QIAquick PCR Purification Kit
(Qiagen). Their sequences were obtained in an automatic DNA
sequencer (ABI PRISM Model 377 Perkin Elmer) and compared
with the ND1 and CO1 sequences of the G1-G10 genotypes
available at the NCBI database (28).
RESULTS
Epidemiological analysis
A total of 22 cattle were infected with E. granulosus in
Argentina and 94 in Spain. The mean intensity of infec-
220
tion for Argentinean cattle was 18.55 (408 cysts) and 5.61
(527 cysts) for the Spanish ones. Whereas all Argentinean
cattle presented viable cysts, only 10.64% (10) of the
Spanish cattle presented them. The percentage of cattle
with fertile cysts was clearly higher in Argentina (63.64%)
than in Spain (6.38%). Percentage of cattle harboring viable and fertile cysts was significantly higher in Argentina (2 = 71.26, p < 0.00000 and 2 = 40.95, p < 0.00000
respectively). Percentages of cattle with pulmonary or
hepatic cysts were higher in Argentina (95.45% and 31.82)
than in Spain (78.72% and 29.79%) but did not show statistically significant differences between both regions (2
= 3.36, p = 0.07 and 2 = 0.03, p = 0.85 respectively).
Only 9.09% (2) of Argentinean cattle presented cysts in
other locations. Almost all the cysts were located in the
liver or lungs, being the latter the preferred organ in both
regions.
The total number of cysts, the number of viable and
fertile cysts and the distribution of cysts by location are
shown in Table 1. However, while the mean intensity of
liver infection was similar in Argentinean and Spanish
cattle, the mean intensity of lung infection was about four
times higher in the Argentinean ones. The mean lung and
liver intensity of viable and fertile cysts and the viable-tototal-cysts ratios were clearly higher in the Argentinean
samples; however the total fertile-to-viable-cysts ratio was

higher in the Spanish samples, although no differences
were found in this ratio when lung and liver cysts were
considered separately (Table 2).
The size and the external aspect of the cysts were
similar in both regions. While most of the cysts ranged
from 3 to 4 cm in diameter for both regions, there were
some up to 25 cm in diameter in the Argentinean samples. In all cases, the color of the germinative membrane
was whitish to yellowish and it was usually thin, with a
mucous aspect, and detached from the cyst wall. The
hydatid sand was whitish in fertile cysts with protoscoleces
and brood capsules in the Argentinean and Spanish samples. Few protoscoleces were present in the fertile Spanish samples with a vitality percentage (alive/not alive
protoscoleces) not higher than 80%, whereas a great
number of protoscoleces was present in the fertile
Argentinean samples with a vitality percentage between
80 and 100%.
Morphological studies
The appearance of the larval rostellum in isolates from
Argentina and Spain was similar and consisted of 2 rows
of alternating large and small hooks. The comparisons
between the measurements of the different variables for
Table 1. Characteristics of the different kinds of hydatid cysts (total and per organ) in cattle from Argentina and Spain. S.D.: standard deviation
Total cysts
Lung
Results
Per
Organ
Liver
Other
Locations
Total Viable cysts
Mean intensity s.d.
Lung
Results
Per
Liver
Organ
Other
Locations
Total Fertile cysts
Mean intensity s.d.
Lung
Results
Per
Liver
Organ
Other
Locations
% respect to total cysts

Mean intensity S.D.
Mean intensity S.D.
Mean intensity S.D.
189
8.59 16.22
Mean intensity S.D.
Mean intensity S.D.
Mean intensity S.D.
44
2.00 2.88
Mean intensity S.D.
Mean intensity S.D.
Mean intensity S.D.
Argentina
Spain
408
93.87
17.41 24.65
5.64
1.05 2.15
0.5
0.09 0.30
13
0.14 0.45
41.67
7.73 16.16
4.17
0.77 1.85
0.5
0.09 0.30
8
0.09 0.032
7.35
1.36 2.36
3.2
0.59 1.60
0.25
0.05 0.21
527
81.21
4.55 4.23
18.79
1.05 2.28
0.00
1.13
0.06 0.28
1.33
0.07 0.34
0.00
0.4
0.02 0.15
1.14
0.06 0.15
p value
0.00
0.88
0.00
0.00
0.00
0.13
221
Table 2. Ratios (total and per organ) of viable and fertile cysts in cattle from Argentina and Spain
Region
Statistical
significance
Argentina
Spain
Lung
Liver
Other locations
0.46 (189/408)
0.44 (170/383)
0.74 (17/23)
1 (2/2)
0.02 (13/527)
0.01 (6/428)
0.07 (7/99)
0
0.00
0.00
0.00
0.11
Lung
Liver
Other locations
(44/408)
0.08 (30/383)
0.56 (13/23)
0.50 (1/2)
0.01 (8/527)
0.01 (2/428)
0.06 (6/99)
0
0.00
0.00
0.00
Fertile-to-viable cyst ratio

Total
0.23 (44/189)
Per
Lung
Organ
Liver
Other locations
0.62 (8/13)
0.17 (30/170)
0.76 (13/17)
0.50 (1/2)
0.00
0.33 (2/6)
0.86 (6/7)
0
0.33
0.61
Viable to Total cyst ratio

Total
Per
Organ
Fertile-to-total cyst ratio
Total
Per
Organ
The data in parenthesis indicate the number of cysts used in the calculus.
Table 3. Rostellar-hook measurements of the protoscoleces of E. granulosus from hydatid cysts of cattle origin from Argentina and Spain. S.D: standard deviation
N of
samples
Argentina
24
Spain
Students t test
statistical significance
LBL
Average
S.D.
(Maximum-minimal)
13.52 0.37
(12.9 -14.4)
12.85 0.19
(12.6 -13.1)
t=4.876
p=0.00
Morphometric Variables
LTL
SBL
Average
Average
S.D.
S.D.
(Maximum(Maximum-minimal)
-minimal)
24.72 0.53
(24.0 - 26.2)
24.51 0.15
(24.2 - 24.7)
t=1.164
p=0.25
9.27 0.3
(8.6 - 9.9)
9 0.23
(8.8 - 9.4)
t=2.349
p=0.03
STL
Average
S.D.
(Maximum-minimal)
NUM
Average
S.D.
(Maximum-minimal)
20.10 0.30
(19.4 - 20.8)
21.06 0.19
(20.8 - 21.4)
t=8.444
p=0.00
37.61 0.79
(33 - 48)
34.25 1.16
(32 - 36)
t=9.220
p=0.00
LBL, blade length of large hooks; LTL, total length of large hooks; SBL, blade length of small hooks; LTL, total length of small hooks; NUM, number of
hooks per rostellum. Lengths in micrometers.
each of the groups (Argentina and Spain) were statistically analysed by the Students t test. All of them but one
(LTL) presented significant statistical differences (Table
3). Principal Components Analysis (PCA) was carried out
with data from 25 isolates of Argentinean cattle and the 8
fertile isolates from Spain. Significant correlations were
found, indicating that an increase in the number of hooks
correlates with a longer blade in both the large and small
hooks and with a shorter total length of the small hooks.
The criterion considered for the number of factors to be
extracted was the greatest of the 75% variance rule and
the Scree test described by Cattell (12). Two factors were
finally extracted, which represented nearly 78% of the

variance. When isolates were plotted using both factors,
two different groups became evident: one corresponding
to the Argentinean isolates and the other to the Spanish
ones (Figure 1).
Genotype identification
All Argentinean isolates (a total of 25) belonged to the
G1 genotype, but different variants of the G1 haplotype
originally described (GenBank accession no. M84661 and
GenBank accession no. AJ237632) were identified for the
CO1 and NADH1 mitochondrial genes in the present
222
Figure 1. Plot of E. granulosus isolates from cattle of Argentina

and Spain obtained by the Principal Component Analysis. ESP:
Spain, ARG: Argentina.
study. While some sequences were identical to the original one described for the CO1 gene (GenBank accession no. M84661), there were two other different variants
in the CO1 sequence with transition mutations: one variant with a mutation at position 73 (CxT) (GenBank accession no. AF458871) and the other one with a mutation at
position 111 (TxC) (GenBank accession no. AF458875).
For the NADH1 gene only one sample was identical to
the original one (GenBank accession no. AJ237632) and
3 other different variants were registered in the rest of the
sequences: one of the variable sequences showed a transition mutation at position 282 (TxC) (GenBank accession no. AF297617), another one showed mutations at 2
different positions: 282 = TxC and 342 = CxT (NADH1_a)
and the last one at 3 different positions: 27 = TxC; 181 =
TxC and 282 = TxC (NADH1_b).
DISCUSSION
The present work is the first to compare and determine if there are differences in phenotypic and molecular
features in E. granulosus cattle isolates from endemic
areas in Argentina and Spain, where the abundance of
this intermediate host as well as the importance in disease transmission are different.
In both regions, the only genotype infecting cattle was
G1 (common sheep strain), which is the most important
genotype responsible for human infection (7) and also
because of its widespread distribution and wide range of
intermediate hosts.
Although the G1, G2 and G5 genotypes have been
found to infect cattle in Argentina (19, 21), all the isolates
obtained in this study belonged to the G1 genotype. This

suggests that G1 is probably the most prevalent and the
principal genotype responsible for the hydatid disease in
cattle and also in other hosts in the Argentinean area
under study (3).
There are several studies where genetic differences
within the G1 genotype of E. granulosus have been described (5, 6, 10, 19, 21, 32, 33). Obwaller et al. (2004)
provided clear evidence that true genetic variability exists within different genotypes indicating that this heterogeneity is not artefactual.
Results show the existence of different variants or
microvariants of the G1 genotype in the Argentinean isolates but not in the Spanish ones. While the Spanish isolates presented the original sequences described for both
genes (7, 9), in Argentina there are more than one variant for each gene. The variant for the CO1 gene with a
transition mutation at position 73 found in the Argentinean
samples had been registered earlier in this country as
G1A (GenBank accession no. AF458871) in humans,
dogs, cattle and pigs from different Argentinean provinces
(19, 21), but also in cattle and sheep from Morocco
(GenBank accession no. EF367289/90). The other variant for the CO1 with the transition mutation at position
111 found in this work had been previously registered as
G1E variant (GenBank accession no. AF458875) in humans from Chile (21). This variant was also recorded in
sheep from Piedmont, Italy (10), in dogs from China
(GenBank accession no. DQ356882), in camels from
Morocco (GenBank accession no. EF367286) and in cattle from Turkey (GenBank accession no. EU178103) and
Australia (GenBank accession no. AJ508033). In the
present work both variants were found in Argentinean
cattle, being the first record of the G1E variant for the
south-eastern region of Buenos Aires province. The ND1
gene variant (transition mutation at position 282) registered in this work has been previously found in sheep
and humans in Argentina (33) (GenBank accession no.
AF297617) but not in Spain, and this is the first record in
cattle from the south-eastern region of Buenos Aires province for this variant. The other two ND1 variants were
only found in one sample and not elsewhere using the
BLAST search. Due to the low number of samples (one
from each variant), no relationship could be drawn between these variants and biological factors. The variant
with the mutation at position 282, which is the most prevalent in the Argentinean samples, was also described in
Algeria (4) where the epidemiological situation reported
is quite similar to that occurring in the endemic region of
Argentina considered in this study. The variation intra G1
described here confirms that this is the most variable genotype. This is in agreement with the lowest intermediate
host specificity and the wider geographic distribution detected for it. Also, our results confirm that the sequence
of the ND1 gene fragment is more variable than that of
the CO1 gene (9, 21, 29).
In most parts of the world G1 is mainly restricted to a

sheep-dog cycle and cattle are usually considered as poor
suitable hosts for this genotype (2, 39-41). This is the
situation that exists in Central Spain, where sheep is the
most important intermediate host for the disease. Spanish cattle were only infected with the G1 genotype and
most of the isolates were non-viable and/or non-fertile
(13, 26, 30, 36). However, in some countries like Tunisia
and Algeria, the number of cattle with fertile cysts is higher.
Therefore, this host has been considered a suitable host
for the G1 genotype in those countries, suggesting that
the parasite appears to be well adapted to the circumstances and is maintained in a cattle-dog cycle representing a source of infection to dogs and humans (4, 25). This
situation is quite similar to the one that occurs in the southeastern region of Buenos Aires province, Argentina, where
approximately 64% of the affected animals have fertile
cysts: a similar percentage to those registered in Algeria
(4). Also, the prevalence of the disease, the mean intensity of infection, the percentage of cysts by location and
the variants or microvariants of the G1 genotype are almost the same as in Algeria but quite different from those
in Spain indicating different epidemiological situations (4).
The differences registered between Argentina and
Spain were remarkable, the mean intensity of infection
was about three times higher in Argentina than in Spain
and the mean intensity of viable cysts was more than 60
times higher in Argentina. Also, the total number of cattle
considered in Argentina presented viable cysts whereas
only 10% of the Spanish did so and the number of cattle
with fertile cysts was 10 times higher in Argentina, indicating that cattle are suitable hosts and could play an
important role in the transmission of the parasite in Argentina but not in Spain. However, while the mean intensity of liver infection was similar in Argentinean and Spanish cattle, the mean lung intensity was about four times
higher in the Argentinean hosts, meaning that Argentinean
cattle are infected with a higher number of lung cysts per
host. Total mean intensity of infection and per organ (lung
and liver) of viable and fertile cysts, the viable-to-totalcysts and the fertile-to-total cyst ratios were clearly higher
in the Argentinean samples; however the total fertile-toviable-cysts ratio was higher in Spanish samples, although
no differences were found in this ratio when lungs and
liver cysts were analyzed separately. The low ratio of viable cysts in Spanish cattle indicates that the parasite
does not develop in suitable conditions and most of the
cysts die; however, the few viable ones can complete their
development and therefore become fertile in the same
proportion seen in viable cysts in the Argentinean cattle.
This suggests that the main difference between both regions is the parasites capability to infect and survive in
cattle. Lungs are the most affected organs in both regions.
Regarding the predominance of cysts in lungs rather
than in the liver, no agreement has been reached among
different authors dealing with this subject (4, 17, 32, 39).
223
According to Garca Llamazarez et al. (14), the greater

number of cysts in lungs could be related to the fact that
lungs show less organic reaction to external agents than
liver. Nevertheless, there are several studies where the
prevalence of hydatid cysts is greater in the liver, therefore, the location of cysts could depend on several factors such as the relationship between the oncosphere
sizes and the lymphatic vessel sizes in the intermediate
host (4, 17, 32, 39).
The ratios of viable-to-total cysts, fertile-to-total cysts
and fertile-to-viable cysts are clearly higher in the liver.
Another result, where the proportion of cattle fertile cysts
was similar or greater in liver than in lungs, has been
recorded in Benghazi, Libya (39). Therefore, viability and
fertility are the most important phenotypic characteristics
differentiating the Argentinean and Spanish G1 cattle isolates. The number of viable and fertile cysts registered in
Spanish cattle were lower compared to those registered
in Argentina. A possible explanation for this could be the
result obtained from treating or not treating cattle with
benzimidazole drugs, since this type of drugs interacts
with metacestode viability and consequently, these parasites could present a higher level of survival which would
reflect in a greater number of viable and fertile cysts (23).
But the usage or not of these drugs in the Argentinean
and Spanish cattle under study cannot be assured because this information was not collected for the aim of
the present study.
Another methodology for strain determination is the
use of morphological techniques, which is almost advantageous because it is a quick and cheap characterization
method, especially in the field of epidemiology, whose
results are compatible with genetic analyses (1, 2, 39).
As regards the rostella, their arrangement and external
aspect were similar in both regions and the values of the
morphometric variables analyzed were within the range
given by other authors for the common sheep strain (1, 2,
39, 40). However, there were significant differences in
almost all the variables between the Argentinean and
Spanish isolates. The results from the PCA analysis showing that all the morphological variables could be reduced
to two functional ones coincide with previous studies
where a multivariate analysis was performed (1, 3, 31).
Also the PCA showed the existence of two distinct clearly
separated groups: one corresponding to the Argentinean
samples and the other to the Spanish ones.
In conclusion, the comparison of the epidemiological
cysts features, of the larval rostellar hooks morphometry,
and of the mitochondrial genes CO1 and ND1 sequences,
showed some differences between cattle isolates from
the endemic regions of Argentina and Spain studied in
the present work. The most important phenotypic factor
differentiating the Argentinean and Spanish cattle isolates
is related to their viability and fertility features. In addition, the factorial analysis for morphometric data showed
the existence of two distinct clearly separated groups (one
224
corresponding to the Argentinean samples and the other

to the Spanish ones). In addition, the comparison of sequence data showed differences within the G1 genotype.
Since the G1 genotype microvariants for the mitochondrial genes CO1 and ND1 registered in the present study
appear in cattle as well as in sheep from the same region
of Argentina, we suggest that this genetic variability is
independent from the host species or breed (3). Probably
all the differences, from an epidemiological point of view,
are related to the effectiveness of the control programmes
of the hydatid disease in both countries. While in the southeastern region of Buenos Aires province the prevalence
of the hydatid disease in cattle has not decreased between 1999 and 2004, in Spain the decrease in the prevalence of the disease in cattle, sheep and pigs between
2000 and 2005 was achieved through efficient control
programmes (3, 11, 14, 15, 16).
Further studies involving other epidemiological,
morphometric and molecular data from cattle and other
intermediate hosts (like sheep, pigs, and horses) would
contribute to expand this investigation.
Liberato C, et al. Genetic variation within and between G1

and G3 genotypes of Echinococcus granulosus in Italy
revealed by multilocus DNA sequencing. Vet Parasitol 2007;
150: 7583.
Carmena D, Snchez-Serrano LP, Barbero-Martnez, I.
Echinococcus granulosus Infection in Spain. Zoonoses
Public Health 2008; 55: 15665.
Cattell RB. The Scree Test for the number of factors.
Multivariate Behav Res 1966; 1: 245-76.
Cuesta-Bandera C, McManus DP, Rishi AK. Characterization
of Echinococcus granulosus of Spanish origin by DNA
restriction endonuclease analysis and Southern blot
hybridization. Int J Parasitol 1988; 18: 137-41.
Denegri GM, Elissondo M C, Dopchiz MC. Situacin de la
hidatidosis-echinococcosis en la Repblica Argentina. Mar
del Plata, Buenos Aires, Argentina, Editorial Martn, 2002.
Dopchiz MC. Aspectos epidemiolgicos de la hidatidosisechinococcosis en el sudeste de la provincia de Buenos Aires.
Mar del Plata, Buenos Aires, Argentina, Editorial Martin, 2006.
Dopchiz MC, Elissondo MC, Andresiuk MV, Maiorini E,
Gutirrez AM, Muzulin PM, et al. Pediatric hydatidosis in
the south-east of the Buenos Aires province, Argentina. Rev
Argent Microbiol 2009; 41: 105-11.
Garca Llamazares JL, Alvarez de Felipe AI, Redondo
Cardea PA, Prieto Fernndez JG. Estudio de la fertilidad
y viabilidad de quistes hidatdicos ovinos. Rev Esp Salud
Pblica 1997; 5: 445-9.
Gonzlez LM, Daniel-Mwambete K, Montero E, Rosenzvit
MC, McManus DP. Further molecular discrimination of
Spanish strains of Echinococcus granulosus. Exp Parasitol
2002; 102: 46-56.
Haag KL, Ayala FJ, Kamenetzky L, Gutirrez A, Rosenzvit
M. Livestock trade history, geography, and parasite strains:
the mitochondrial genetic structure of Echinococcus
granulosus in Argentina. J Parasitol 2004; 90: 2349.
Instituto Nacional de Estadsticas y Censos. INDEC. Sector Agropecuario. Ganadera. http://www.indec.mecon.ar.
Kamenetzky L, Gutirrez AM, Canova SG, Haag KL,
Guarnera EA, Parra A, et al. Several strains of Echinococcus
granulosus infect livestock and humans in Argentina. Infect
Genet Evol 2002; 2: 129-36.
Kedra HA, Swiderski Z, Tkach VV, Dubinski P, Pawowski Z,
Stefaniak J, et al. Genetic analysis of Echinococcus granulosus
from humans and pigs in Poland, Slovakia and Ukraine. A
multicentre study. Acta Parasitol 1999; 44: 248-54.
Lahmar S, Chhida FB, Ptavy AF, Hammou A, Lahmar J,
Ghannay A, et al. Ultrasonographic screening for cystic
echinococcosis in sheep in Tunisia. Vet Parasitol 2007; 143:
42-9.
Lavikainen A, Lehtinen MJ, Meri T, Hirvela-Koski V, Meri
S. Molecular genetic characterization of the Fennoscandian
cervid strain, a new genotypic group (G10) of Echinococcus
granulosus. Parasitology 2003; 127: 207-15.
Mrad S, Filisetti D, Oudni M, Mekki M, Belguith M, Nouri A,
et al. Molecular evidence of ovine (G1) and camel (G6)
strains of Echinococcus granulosus in Tunisia and putative
role of cattle in human contamination. Vet Parasitol 2005;
129: 267-72.
Mwambete DK, Ponce-Gordo F, Cuesta-Bandera C. Genetic
identification and host range of the Spanish strains of
Echinococcus granulosus. Acta Trop 2004; 91:87-93.
Nakao M, McManus DP, Schantz PM, Craig PS, Ito A. A
molecular phylogeny of the genus Echinococcus inferred
from complete mitochondrial genomes. Parasitology 2007;
134: 713-22.
National Center for Biotechnology Information. NCBI. http:/
/www.ncbi.nlm.nih.gov.
Obwaller A, Schneider R, Walochnik J, Gollackner B, Deutz
A, Janitschke K, et al. Echinococcus granulosus strain
Acknowledgements: The authors wish to acknowledge Mr.

Oscar Chasmas help in the collection of the bovine material in
Argentina. This work was partially supported by PICT-O 02 N
08-11342, BID 1728/OC-AR and PIP N 02172, CONICET (Argentina).
11.
12.
13.
14.
15.
16.
17.
18.
19.
REFERENCES
20.
1. Ahmadi NA. Using morphometry of the larval rostellar hooks
to distinguish Iranian strains of Echinococcus granulosus.
Ann Trop Med Parasitol 2004; 98: 211-20.
2. Ahmadi N, Dalimi A. Characterization of Echinococcus
granulosus isolates from human, sheep and camel in Iran.
Infect Genet Evol 2006; 6: 85-90.
3. Andresiuk MV. Determinacin de cepas de Echinococcus
granulosus y su importancia en la epidemiologa de la
hidatidosis-echinococcosis en el sudeste de la provincia
de Buenos Aires. Tesis Doctoral, Universidad Nacional
de Mar del Plata, Mar del Plata, Buenos Aires, Argentina,
2009.
4. Bardonnet K, Benchikh-Elfegoun MC, Bart JM, Harraga S,
Hannache N, Haddad S et al. Cystic echinococcosis in
Algeria: cattle act as reservoirs of a sheep strain and may
contribute to human contamination. Vet Parasitol 2003; 116:
35-44.
5. Bart JM, Abdukader M, Zhang YL, Lin RY, Wang YH, Nakao
M, et al. Genotyping of human cystic echinococcosis in
Xinjiang, PR China. Parasitology 2006; 133: 571-9.
6. Bart JM, Morariu S, Knapp J, Ilie MS, Pitulescu M, Anghel
A, et al. Genetic typing of Echinococcus granulosus in
Romania. Parasitol Res 2006; 98: 1307.
7. Bowles J, Blair D, McManus DP. Genetic variants within
the genus Echinococcus identified by mitochondrial DNA
sequencing. Mol Biochem Parasitol 1992; 54: 165-74.
8. Bowles J, Blair D, McManus DP. Molecular genetic
characterization of the cervid strain (northern form) of
Echinococcus granulosus. Parasitology 1994; 109: 215-21.
9. Bowles J, McManus DP. NADH dehydrogenase 1 gene
sequences compared for species and strains of the genus
Echinococcus. Int J Parasitol 1993; 23: 969-72.
10. Busi M, Snabel V, Varcasia A, Garippa G, Perrone V, De
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
differentiation based on sequence heterogeneity in

mitochondrial genes of cytochrome c oxidase-1 and NADH
dehydrogenase-1. Parasitology 2004; 128: 569-75.
Ponce Gordo F. Caracterizacin biolgica de los genotipos
de Echinococcus granulosus de origen espaol. Tesis Doctoral, Universidad Complutense de Madrid, Madrid, Espaa, 1995.
Ponce Gordo F, Cuesta Bandera C. Differentiation of
Spanish strains of Echinococcus granulosus using larval
rostellar hook morphometry. Int J Parasitol 1997; 27: 41-9.
Rinaldi L, Maurelli MP, Capuano F, Perugini AG, Veneziano
V, Cringoli S. Molecular update on cystic echinococcosis in
cattle and water buffaloes of southern Italy. Zoonoses Public
Health 2008; 55: 119-23.
Rosenzvit MC, Zhang LH, Kamenetzky L, Canova S,
Guarnera EA, McManus DP. Genetic variation and epidemiology
of Echinococcus granulosus in Argentina. Parasitology 1999;
118: 523-30.
Saarma U, Jgisalu I, Moks E, Varcasia A, Lavikainen A,
Oksanen A, et al . A novel phylogeny for the genus
Echinococcus based on nuclear data challenges
relationships based on mitochondrial evidence. Parasitology
2009; 21: 1-12.
Scott JC, Stefaniak J, Pawlowski ZS, McManus DP. Molecular
genetic analysis of human cystic hydatid cases from Poland:
225
36.
37.
38.
39.
40.
41.
identification of a new genotypic group (G9) of Echinococcus

granulosus. Parasitology 1997; 114: 37-43.
Siles-Lucas M, Benito MC, Cuesta-Bandera C. Echinococcus granulosus: genomic and isoenzymatic study of
Spanish strains isolated from different intermediate hosts.
Vet Parasitol 1996; 63: 273-82.
Siles-Lucas M, Felleisen R, Cuesta-Bandera C, Gottstein
B, Eckert J. Comparative genetic analysis of Swiss and
Spanish isolates of Echinococcus granulosus by southern
hybridization and Random Amplified Polymorphic DNA
technique. Appl Parasitol 1994; 35: 107-17.
Smyth JD, Davies Z. Occurrence of physiological strains of
Echinococcus granulosus demonstrated by in vitro culture
of protoscoleces from sheep and horse hydatid cysts. Int J
Parasitol 1974; 4: 443-5.
Tashani OA, Zhang LH, Boufana B, Jegi A, McManus DP.
Epidemiology and strain characteristics of Echinococcus
granulosus in the Benghazi area of eastern Libya. Ann Trop
Med Parasitol 2002; 96: 369-81.
Thompson RCA, Kumaratilake LM, Eckert J. Observations
on Echinococcus granulosus of cattle origin in Switzerland.
Int J Parasitol 1984; 14: 283-91.
Thompson RCA, McManus DP. Towards a taxonomic
revision of the genus Echinococcus. Trends Parasitol 2002;
18: 452-7.
226

41:0325-7541
226-231
ISSN
ARTCULO ORIGINAL
Antibacterial and antioxidant activities of the essential oil of

Artemisia echegarayi Hieron. (Asteraceae)
A. LACIAR1*, M. L. VACA RUIZ1, R. CARRIZO FLORES2, J. R. SAAD2
1
rea Microbiologa, 2rea de Qumica Orgnica-INTEQUI-CONICET. Universidad Nacional de San Luis. Chacabuco y
Pedernera. 5700 San Luis. Argentina
*Correspondence. E-mail: alaciar@unsl.edu.ar
ABSTRACT
Artemisia echegarayi Hieron. (Asteraceae) is commonly known in Argentina as ajenjo. Many studies report high
efficacy of essential oils against food-borne pathogenic bacteria. The antimicrobial activity and minimal inhibitory
concentration of A. echegarayi essential oil were evaluated against seven bacterial species of significant importance
in food hygiene, by using the disc diffusion assay and the micro-well dilution method, respectively. Volatile components of the extract were analyzed by gas chromatography-mass spectrometry and major components were determined. Furthermore, the essential oil was tested for its antioxidant activity. The essential oil inhibited the growth of
gram-positive and gram-negative tested bacteria, with the exception of Proteus mirabilis. A. echegarayi essential oil
presented the lowest minimal inhibitory concentration against Listeria monocytogenes and Bacillus cereus. Two terpenes, thujone and camphor, were identified from this essential oil as the principal constituents responsible for antibacterial activity. The oil showed a free radical scavenging activity equivalent to 50% of the reference compound. These
preliminary studies showed promising results since this essential oil may provide an alternative to promote its use as
a natural food additive.
Keywords: Artemisia echegarayi, essential oil, antibacterial activity, antioxidant activity
RESUMEN
Actividad antibacteriana y antioxidante del aceite esencial extrado de Artemisia echegarayi Hieron.
(Asteraceae). Artemisia echegarayi Hieron. (Asteraceae), conocida como ajenjo, es una planta tpica de la regin
de Cuyo (Argentina). En este trabajo se evalu la actividad antimicrobiana in vitro y la concentracin inhibitoria
mnima del aceite esencial extrado de sus partes areas frente a especies bacterianas que con frecuencia contaminan
los alimentos. Se utilizaron las tcnicas de difusin con discos en agar y microdilucin en placa respectivamente.
Adems, se determin la actividad antioxidante de este aceite esencial in vitro por espectrofotometra. En general,
tanto las bacterias gram-positivas como las gram-negativas fueron inhibidas por este aceite, con excepcin de Proteus mirabilis. Listeria monocytogenes y Bacillus cereus resultaron ser las bacterias ms sensibles. El anlisis por
croma-tografa en fase gaseosa y espectrometra de masa permiti la identificacin cualitativa y cuantitativa de los
componentes mayoritarios del aceite esencial del ajenjo. Entre ellos, la tuyona y el alcanfor se destacaron como los
principales responsables de la actividad antibacteriana observada. Los datos preliminares obtenidos en el presente
estudio sugieren que el aceite esencial de Artemisia echegarayi representa una alternativa para promover su empleo
como aditivo natural en alimentos.
Palabras clave: Artemisia echegarayi, aceite esencial, actividad antibacteriana, actividad antioxidante.
INTRODUCTION
The beneficial health effects of extracts from many types
of plants have been acknowledged for centuries (13).
Essential oils (EOs) are aromatic and volatile oily liquids obtained from plant material such as leaves, bark or
fruit (22). Although the antibacterial properties of EOs have
long been known, the recent interest in alternative naturally derived antimicrobials has led to a renewed scientific interest in these substances. Many studies in vitro
have reported high efficacy of EOs against food-borne
pathogenic bacteria (11, 18, 29).
Nowadays, the excessive use of synthetic antimicrobial compounds in food manufacture as additive agents
is well known, many of which are suspected for their residual toxicity. Several EOs offer potential applications in
food preservation, and the use of EOs in the food industry can help reduce the addition of chemical preservatives as well as the intensity of heat treatments, resulting
in foods which are more naturally preserved and richer in
organic properties (16).
Because of the extraction mode, mostly by distillation
from aromatic plants, the EOs contain a variety of volatile
molecules such as terpenes and terpenoids, phenol-de-
Ford-borne bacteria and essential oil
rived aromatic components and aliphatic components. In

particular, the antioxidant capacity of these compounds
has been described to promote their use as natural food
additives (1).
Artemisia echegarayi Hieron. (Asteraceae) is commonly known as ajenjo in the Region of Cuyo, Argentina. This is a plant of about one meter high, with ashgrey green colour leaves and clustered in spherical chapters (capitula) of 34-64 flowers. A. echegarayi grows on
slopes of the Central Andes region especially in the provinces of Mendoza, San Juan and La Rioja, at a height of
2000-3000 m above sea level. Nowadays, there is not
much information of the bioactivity of A. echegarayi essential oil (EO). However, there are many reports on the
bioactivities of essential oils of other species from the
genus Artemisia. Several of them are used in folk medicine, for example: Artemisia douglassiana is used as gastric cytoprotector (20, 31) and topical bactericidal agent
on skin burns (26). A. annua is known by its antimalarial,
anti-inflammatory and anti-carcinogenic properties (19).
The purpose of the study presented here was to gain
insight on the antioxidant and antimicrobial activities of
A. echegarayi EO against a range of food-borne bacteria, including gram-negative and gram-positive bacteria.
Moreover, volatile components of the extract were analyzed by gas chromatography-mass spectrometry (GCMS) and the major components were determined.
MATERIAL AND METHODS

Plant material
Artemisia echegarayi Hieron. (Asteraceae) aerial parts were
collected in Potrerillos, province of Mendoza, Argentina, in February 2008. The plant was identified by Ing. Luis Del Vitto, and a
voucher specimen is kept at San Luis University (UNSL) herbarium, Argentina (N 492).
Extraction of essential oil
Fresh aerial parts (5,000 g) were cut into small pieces and
subjected to steam-distillation at 96 C for 3 h using a Clevengertype apparatus. The oil obtained was dried over anhydrous sodium sulphate (21).
Chemical characterization of the essential oil
The A. echegarayi EO composition was determined by GCMS through comparison of the major signals with an MS library
(20). Retention times and mass spectral data were checked with
those obtained from authentic samples and/or from the MS instrument library. Relative percentages of the major components were
calculated by integrating the registered peaks. GC-MS experiments
were performed on an ion trap GCQ-Plus (Finnigan, ThermoQuest,
Austin, TX, USA) instrument with MS-MS program using a silica
capillary column Rtx -5MS (30 m x 0.25 mm ID, 0.25 m). The
carrier gas was helium (40 cm/s-1). The port temperature was 200
C in the splitless mode with 1.0 ml injection volume. The initial
GC temperature was maintained at 40 C for 2 min, then increased
to 210 C at 2 C/min, and maintained at this temperature up to
120 min. For the analysis of low resolution MS, the ion trap mass
detector was set in full scan mode from m/z 50 to m/z 450. For the
product analysis (CID), the precursor was selected using tandem
227
mass spectrometry (MS/MS) scan standard function, with 0.5 Da

peak-widths for the parent ion and dynamically programmed scans,
as described previously (10).
Microorganisms
A total of 8 bacteria were selected for this study. Two strains
of Listeria monocytogenes were obtained from the Pasteur Institute, France, culture collection: CLIP 74903 and CLIP 74904,
while Bacillus cereus, Staphylococcus aureus, Escherichia coli,
Salmonella enterica serovar Enteritidis, Salmonella enterica
serovar Typhimurium and Proteus mirabilis were isolated at the
UNSL laboratory. These bacteria were chosen in order to represent the diversity of species responsible for food-borne diseases.
Antimicrobial activity
Disk diffusion assay. The antimicrobial activity of A.
echegarayi EO was determined by the standard disc diffusion
technique (CLSI) (25, 31). A population of approximately 108
CFU/ml of each strain was inoculated on duplicate plates containing Meller Hinton Agar (MH) (Britania, Argentina) using sterile
cotton swabs. The plates were allowed to dry for 5 min at room
temperature. Sterilised paper discs (Britania, Argentina) of 6 mm
diameter were used. Ten microlitres of A. echegarayi EO were
added to impregnate paper disks and allowed to dry for 15 min.
Commercial gentamicin discs (10 g, Britania, Argentina) were
used as positive control. The discs were then placed aseptically
over the surface of the bacterial cultures on MH plates and incubated at 37 C for 24 h. After incubation, the inhibition zones
around paper discs were measured accurately using a metric
ruler. The assays were carried out on duplicate MH plates for
each strain. The experiments were replicated at least twice.
Determination of Minimal Inhibitory Concentration (MIC).
The MICs of A. echegarayi EO and gentamicin (antibiotic
reference) were determined by the microplate method (microwell dilution) according to the CLSI method (Clinical and Laboratory Standard Institute, 2005) (formerly NCCLS) (8), in MH broth
(Britania, Argentina) pH 7.2 supplemented with 0.01% (w/v) of
2,3,5-triphenyltetrazolium chloride (TTN) as visual indicator of
bacterial growth. The inoculum of each strain was prepared from
18 h broth culture and adjusted to the tube 0.5 of Mc Farland
scale (108 bacterial cells). Then, they were diluted 100 times.
The EO was dissolved in 20% Tween 80 and then diluted with
phosphate buffer saline (PBS) to the highest concentration to be
tested (75 g/ml), and then serial two-fold dilutions were made in
concentration ranges from 75 to 2.4 g/ml. In addition, gentamicin dilutions were prepared in a concentration range from 128 to
0.25 g/ml. The 96-well plates were prepared by dispensing into
each well 95 l of nutrient broth and 5 l of the inoculum (final
concentration of 104 CFU/ml). One hundred microlitre aliquot from
the stock solutions of the EOs and their serial dilutions initially
prepared was transferred into six consecutive wells. The final volume in each well was 200 l. The plates were covered with sterile
plate sealer and then incubated at 37 C for 24 h. MIC was defined as the lowest concentration of the EO in the medium in which
there was no visible growth after incubation (no red colour signifying live growth). It is established that TTN, a water-insoluble, colorless compound, can be reduced to water-insoluble red formazan
by a variety of organisms. TTN reduction is used as a quantitative
method in the evaluation of tissue viability (33). The experiments
were replicated at least twice.
Thin-Layer chromatography (TLC)
Merck F254 plates, 10 x 10 cm, 1mm thick were used. A.
echegarayi EO was applied and the chromatogram developed
using n-hexane-ethyl acetate (95:5) as solvent. TLC plates were
run in duplicate. Spots and bands were visualized by H2SO4 spray
reagent. Thujone (Sigma-Aldrich) and camphor (Sigma-Aldrich)
were used as standards. TLC plates were dried overnight in a
sterile room for complete removal of solvent.
228
Bioautography
Plates TLC were covered with 1-2 mm layer of soft medium
(BHI with 0.6% agar) containing 0.1% (w/v) TTN (tetrazolium
red) and an aliquot of an overnight culture of L. monocytogenes
(CLIP 74903) (108 CFU/ml) and P. mirabilis (108 CFU/ml). The
plates were placed in a sterile tray, sealed to prevent the thin
agar layer from drying, and incubated at 37 C for 24 h. Where
microbial growth has been inhibited, an uncoloured area can be
seen on the deep pink-red background. The plates were run in
duplicate.
Antioxidant activity
2, 2-diphenylpicrylhydrazyl (DPPH) assay

The hydrogen atom or electron donation ability of the corresponding oils and some pure compounds were measured from
the bleaching of purpled coloured methanol solution of DPPH.
This spectrophotometer assay uses stable DPPH as reagent (5,
20). Five hundred microlitres of this solution were added to 500
l of EO methanol solution in 1 cm path length disposable
microcuvette. After a 30 min-incubation period at room temperature, the absorbance at 517 nm was read against a blank. Inhibition free radical DPPH in percent (I %) was calculated in the
following way:
I%= (ABlank- ASample)/ ABlank 100
Where ABlank is the absorbance of the control reaction (containing all reagents except the test compound), and ASample is the
absorbance of the test compound. Rutine, a quercetin glucoside
was used as reference compound. The assay was repeated twice.
RESULTS
The EO extracted from leaves of A. echegarayi plant
by hydrodistillation presented light blue colour, fragrant
smell and density of 0.915 g/ml and a yield of 0.56 g/kg of
plant material. The A. echegarayi EO on the GC-MS
analysis resulted in the identification of 15 constituents
representing 92.48% (Table 1). The major components
were 3-thujanone (49.25%) and thujone (10.72%).
These components have the following chemical groups
in their structure: hydrocarbons, alcohols, ketones and
esthers.
A. echegarayi EO showed antibacterial activity against
all tested bacteria, except for P. mirabilis. Generally, grampositive bacteria were more sensitive to A. echegarayi
EO than gram-negative bacteria, and L. monocytogenes
CLIP 74903 and B. cereus were among the most sensitive with MIC of = 2.4 g/ml (Table 2).
To obtain some information on the active components,
A. echegarayi EO was analyzed by TLC on silica gel plates
and assayed by bioautography. Figure 1 shows the appearance of the chromatogram after treatment with L.
monocytogenes, indicating the localization of the bacterial inhibition zone.
Table 1. Chemical composition of A. echegarayi EO (by GC(1) and GC-MS(2) analysis)

Compound
thujene
o-isopropyltoluene
eucalyptol
4-thujanol
3-thujanone
thujone
camphor
borneol
4-terpineol
a-terpinol
bornyl acetate
2-methyl-3-phenyl-propanoic acid
3-isopropylidene-tricycle[4.3.1.1.[2.5]undecan-10-one
elixene
3,4,4-trimethyl-3-[3-methyl-1,3-butadienyl]-bicycle[4.1.0]heptan-2-one,
Total identified
(1)
GC: gas chromatography, (2)GC-MS: gas chromatography-mass spectrometry.
Retention time (min)

19.906
23.466
23.936
25.925
30.158
30.694
32.405
34.203
34.902
35.842
42.638
47.611
55.766
56.852
67.496
Percentage
2.69
1.19
3.40
1.12
49.25
10.72
5.07
5.26
3.35
1.15
3.97
0.70
1.03
3.04
0.54
92.48
229
Table 2: Antibacterial activity of A. echegarayi EO

Bacteria
(3)
S. aureus
B. cereus
L. monocytogenes
L. monocytogenes
S. Typhimurium
S. Enteritidis
P. mirabilis
E. coli
(1)
(1)
CLIP 74904
CLIP 74903
Inhibition diameter (mm)

A. echegarayi EO (4)Gentamicin
10.0
9.70
10.0
12.5
6.30
7.70
0.00
9.00
1.4
0.6
2.0
1.1
0.6
0.6
0.0
0.0
20.5
22.5
30.2
31.8
21.0
22.0
17.5
23.5
2.0
2.0
2.7
2.4
1.4
2.8
0.7
2.0
(2)
(5)
MIC
A. echegarayi EO (6)Gentamicin
9.4
2.4
9.4
2.4
18.7
18.7
75.0
18.7
0.25
2.00
1.00
1.00
0.50
1.00
4.00
1.00
(1)
CLIP: Listeria Collection of the Pasteur Institute; (2)MIC: Minimal inhibitory concentration; (3)A. echegarayi essential oil, 10l/disc;
10g/disc; (5)g/mL; (6)g/ml; : standard deviation.
(4)
Figure 1. Thin layer chromatography plate of A. echegarayi

essential oil. (A) visual appearance. (B) Listeria monocytogenes
(CLIP 74903) bioautography overlay. Arrows indicate regions of
inhibition growth visualized with tetrazolium red. (1) A. echegarayi
essential oil. (2) Thujone (standard). (3) Camphor (standard).
The A. echegarayi EO presented moderate antioxidant

activity (50% of free radical DPPH inhibition). Its antioxidant activity was lower than that of quercetin, a powerful
natural antioxidant (100%).
DISCUSSION
The use of EOs in food industry can be an alternative
to satisfying the increasing consumers demand for freshtasting, ready-to-eat, minimally-processed foods and also
to developing novel food products (e.g. less acidic, or
with lower salt content) (17).
Determination of the inhibition zones by means of the
disc diffusion method showed that the EO of an Argentine native plant, A. echegarayi, exhibited an antibacterial effect against gram-positive and gram-negative
foodborne pathogen tested bacteria. The minor susceptibility of gram-negative bacteria may be attributed to an
outer membrane surrounding the cell wall which restricts
diffusion of hydrophobic compounds through the li-
popolysaccharide. Moreover, the periplasmic space contains enzymes, which are able to break down foreign
molecules introduced from outside (12). This can be confirmed analyzing the chemical composition of the A.
echegarayi EO; therefore we could conclude that the antibacterial activity following TLC separation of EO A.
echegarayi was found to be attributed mainly to the presence of two major constituents, thujone and camphor.
They cause leaking of cell contents due to alterations on
the membrane permeation system (6).
In the present study, an interesting finding has been
that all strains tested, except P. mirabilis, showed MICs
ranging from 2.4 to 18.7 g/ml. These values confirm
the existence of a significant activity of A. echegarayi EO
against gram-positive and gram-negative bacteria considering Barbiris reports which suggested that if the EO
displayed a MIC lower than 100 g/ml, the antimicrobial
activity is good (3).
L. monocytogenes CLIP 74903 was more susceptible
than L. monocytogenes CLIP 74904. These results are in
agreement with those reported by Barbire Holetz, who
reported that within bacterial species, EO efficacy was
dependent on the strain and in some cases on the strain
origin (27).
Moreover, the results can be explained considering
the efficacy of the main components of EO isolated from
aerial parts of A. echegarayi. The chemical composition
was investigated by GC-MS and the results showed high
contents of terpenes: 3-thujanone, thujone, borneol and
camphor were the main components, whose contents
were 49.25%, 10.72%, 5.26% and 5.07% respectively.
Among these, thujone and camphor are responsible for
the antimicrobial properties reported here. In this respect,
they have also shown to be responsible for antibacterial
activity of EOs from different Artemisia species. For example, thujone and camphor have been identified as the
major compounds with antibacterial activity in Artemisia
230
absinthium, Artemisia scoparia and Artemisia sieberiri

EOs (14, 24).
Terpenes are naturally occurring substances produced
by a wide variety of plants and animals. A broad range of
the biological properties of terpenoids has been described,
including cancer chemopreventive effects, antioxidant,
antimicrobial, antifungal, antiviral, antihyperglycemic, antiinflammatory, and antiparasitic activities (23).
Identification of terpenoid constituents as principal
agents in this plant is consistent with the results of a number of early studies on other plants. The antibacterial activity of terpenoids is generally believed to involve actions on
phospholipid membranes, where partitioning results in
destabilisation and disorder culminating in ion leakage in
bacteria and disruption of membrane-dependent energygenerating processes in eukaryotic microorganisms (28).
The EOs extracted by distillation of aromatic plants,
contain a variety of volatile molecules such as terpenes
and terpenoids, phenol- derived aromatic components and
aliphatic components. In vitro physicochemical assays
characterize most of them as antioxidants (4, 30). Thus,
in this work, terpenes, particularly those with activated
methylene groups in their molecules, could probably be
the reason of the antioxidant activity shown by A.
echegarayi EO. From this, it was inferred that it could be
beneficial for human health in line with recent findings
and common belief that many diseases are due to an
overload of oxidative stress reactions following excessive
consumption of fat, sugar, meat, etc. Antioxidants are
believed to be directly antimutagenic (7) and anticarcinogenic due to their radical scavenging properties (9,
15). However, recent work shows that in eukaryotic cells,
essential oils can act as prooxidants by intermediate of
terpenes affecting the cellular redox status. This may play
a significant protective role by removing damaged cells
by apoptosis (2, 32).
Because A. echegarayi EO was inhibitory in small
quantities to selected pathogenic microorganisms, these
preliminary results suggest it may provide alternatives to
conventional additives in food products. Furthermore, this
EO may add prooxidant effects and thus, could be employed in traditional and modern medical domains.
Nakamura C, Dias Filho B. Screening of some plants used

in the Brazilian folk medicine for the treatment of infectious
diseases. Mem. Inst. Oswaldo Cruz, Rio de Janeiro 2002;
97: 1027-31.
Basile A, Senatore F, Gargano R, Sorbo S, Del Pezzo M,
Lavitola A, et al. Antibacterial and antioxidant activities in
Sidris italica (Miller) Greuter et Burdet essential oils. J
Ethnopharmacol 2006; 107: 240-8.
Burits M, Bucar F. Antioxidant activity of Nigella sativa
essential oil. Phytother Res 2000; 14: 323-8.
Burt S. Essential oils: their antibacterial properties and
potential applications in foods-a review. Int J Food Microbiol
2004; 94: 223-53.
Clark S. The biochemistry of antioxidants revisited. Nutr
Clin Pract 2002; 17: 5-17.
Clinical and Laboratory Standard Institute (formerly NCCLS)
2005; 15th Informational Supplement. Disc Diffusion. 5:1.
Collins A. Antioxidant intervention as a route to cancer
prevention. Eur J Cancer 2005; 41: 1923-30.
Constantin M, Sartorelli P, Limburger R, Henriques A,
Steppe M, Ferreira M, et al. Essential oils from Piper
cernuum and Piper regnellii: antimicrobial activities and
analysis by GC/MS and 13C-NMR. Planta Med. 2001; 67:
771-3.
Dorman H, Deans S. Antimicrobial agents from plants:
antibacterial activity of plant volatile oils. J Appl Microbiol
2000; 88: 308-16.
Duffy C, Power R. Antioxidant and antimicrobial properties
of some Chinese plants extracts. Int J Antimicrob Agents
2001; 17: 527-9.
Elgayyar M, Draughon F, Golden D, Mount J. Antimicrobial
activity of essential oils from plants against selected
pathogenic and saprophytic microorganisms. J Food Prot
2001; 64: 1019-24.
Farzaneh M, Ahmadzadeh M, Hadian J, Tehrani A.
Chemical composition and antifungal activity of the essential
oils of three species of Artemisia on some soil-borne
phytopathogens. Commun Agric Appl Biol Sci. 2006; 71:
1327-33.
Ferguson L, Philpott M, Karunasinghe N. Dietary cancer and
prevention using antimutagens. Toxicol. 2004; 198: 147-59.
Gutierrez J, Barry-Ryan C, Bourke P. The antimicrobial
efficacy of plant essential oil combinations and interactions
with food ingredients. Int J Food Microbiol 2008; 124: 91-7.
Gutierrez J, Rodriguez G, Barry-Ryan C, Bourke P. Efficacy
of plant essential oils against food-borne pathogens and
spoilage bacteria associated with ready-to-eat vegetables:
antimicrobial and sensory screening. J Food Prot 2008; 71:
1846-54.
Hammer K, Carson C, Riley T. Antimicrobial activity of
essential oils and other plant extracts. J Appl Microbiol 1999;
86: 985-90.
Juteau F, Masotti V, Bessiere J, Dherbomez M, Viano J.
Antibacterial and antioxidant activities of Artemisia annua
essential oil. Phytother 2000; 73: 532-5.
Lopes-Lutz D, Alviano D, Alviano C, Kolodziejczyk P.
Screening of chemical composition, antimicrobial and
antioxidant activities of Artemisia essential oils.
Phytochemistry 2008; 69: 1732-8.
Norajit K, Laohakunjit N, Kerdchoechun O. Antibacterial
effect of Zingiberaceae essential oils. Molecules 2007; 12:
2047-60.
Oussalah M, Caillet S, Lacroix M. Mechanism of action of
Spanish oregano, Chinese cinnamon, and savory essential
oils against cell membranes and walls of Escherichia coli
O157:H7 and Listeria monocytogenes. J Food Prot 2006;
69: 1046-55.
Paduch R, Kandefer-Szerszen M, Trytek M, Fiedurek J.
Terpenes: substances useful in human healthcare. Arch
Immnol Ther Exp (Warsz) 2007; 55: 315-27.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Acnowledgements: We thank the UNSL (Projects 7301 and

8802), CONICET (PIP 6228) for the financial support of this study.
20.
REFERENCES
21.
1. Bakkali F, Averbeck S, Averbeck D, Idaomar M. Biological

effects of essential oils- A review. Food Chem. Toxicology
2007; 46: 446-75.
2. Bakkali F, Averbeck S, Averbeck D, Zhiri A, Baudoux D,
Idaomar M. Antigenotoxic effects of three essential oils in
diploid yeast (Saccharomyces cerevisiae) after treatments
with UVC radiation, 8-MOP plus UVA and MMS. Mutat. Res.
2006; 606: 27-38.
3. Barbiri Holetz F, Pessini G, Sanches N, Garcia Cortez A,
22.
23.
231
24. Rezaeinodehi A, Khangholi S. Chemical composition of the

essential oil of Artemisia absinthium growing wild in Iran.
Pak J Biol Sci 2008; 11: 946-9.
25. Rojas J, Ochoa V, Ocampo S, Muoz J. Screening for
antimicrobial activity of ten medicinal plants used in
Colombian folkloric medicine: a possible alternative in the
treatment of non-nosocomial infections. Complement Altern
Med 2006; 6: 2.
26. Setzer W, Vogler B, Schmidt J, Leahy J, Rives R.
Antimicrobial activity of four Artemisia species of Iran.
Phytother 2004; 75: 192-200.
27. Singh A, Singh R, Bhunia A, Singh N. Efficacy of plant essential
oils as antimicrobial agents against Listeria monocytogenes
in hotdogs. LWT Food Sci Techn 2003; 36: 787-94.
28. Smith J, Tucker D, Watson K, Jones G. Identification of
antibacterial constituents from the indigenous Australia
medicinal plant Eremophila duttonii F. Muell. (Myoporaceae). J Ethnopharmacology 2007; 112: 386-93.
29. Smith-Palmer J, Stewart J, Fyfe L. Antimicrobial properties

of plant essential oils and essences against five important
food-borne pathogens. Lett Appl Microbiol 1998; 26:
118-22.
30. Tuberoso C, Kowalczyk A, Coroneo V, Russo M, Dessi S,
Cabras P. Chemical composition and antioxidant,
antimicrobial, and antifungal activities of the essential oil
of Achillea ligustica all. J Agric Food Chem 2005; 53:
10148-53.
31. Vaca Ruiz M, Laciar A, Donadel O, Saad J, Carrizo Flores R. Anti-listerial activity of plant essential oils from
western region of Argentina. Annals Microbiol 2006; 56:
369-71.
32. Vukovic-Gacic S, Nikcevic S, Beric-Bjedov T, KnezevicVukcevic J, Simic D. Antimutagenic effect of essential oil of
sage (Salvia officinalis L.) and its monoterpenes against
UV-induced mutations in Escherichia coli and Saccharomyces cerevisiae. Food Chem Toxicol 2006; 44: 1730-8.
232

41:0325-7541
232-236
ISSN
ARTCULO ORIGINAL
Linden flower (Tilia spp.) as potential vehicle of Clostridium

botulinum spores in the transmission of infant botulism
M. I. BIANCO, C. LQUEZ**, L. I. T. DE JONG, R. A. FERNNDEZ*
rea Microbiologa, Departamento de Patologa, Facultad de Ciencias Mdicas, Universidad Nacional de Cuyo,
Centro Universitario, Parque General San Martn S/N, (5500) Mendoza, Argentina.
*Correspondence. E-mail: rfernand@fcm.uncu.edu.ar
ABSTRACT
Infant botulism is an intestinal toxemia caused principally by Clostridium botulinum. Since the infection occurs in the
intestinal tract, numerous food products have been investigated for the presence of C. botulinum and its neurotoxins.
In many countries, people use linden flower (Tilia spp) tea as a household remedy and give it to infants as a sedative.
Therefore, to help provide a clear picture of this disease transmission, we investigated the presence of botulinum
spores in linden flowers. In this study, we analyzed 100 samples of unwrapped linden flowers and 100 samples of
linden flowers in tea bags to determine the prevalence and spore-load of C. botulinum. Results were analyzed by the
Fisher test. We detected a prevalence of 3% of botulinum spores in the unwrapped linden flowers analyzed and a
spore load of 30 spores per 100 grams. None of the industrialized linden flowers analyzed were contaminated with
botulinum spores. C. botulinum type A was identified in two samples and type B in one sample. Linden flowers must
be considered a potential vehicle of C. botulinum, and the ingestion of linden flower tea can represent a risk factor for
infant botulism.
Key words: botulinum spores, linden flower tea, infant botulism
RESUMEN
El t de tilo como vehculo potencial de esporas de Clostridium botulinum en la transmisin del botulismo
infantil. El botulismo del lactante es una toxiinfeccin causada, principalmente, por Clostridium botulinum. Debido a
que esta infeccin ocurre en el tracto intestinal, la presencia de esta bacteria y sus neurotoxinas ha sido investigada
en numerosos alimentos. En muchos pases se utiliza el t de tilo (Tilia spp.) como sedante natural, el que se
administra incluso a los lactantes. A fin de contribuir al esclarecimiento de la transmisin de esta enfermedad, se
investig la prevalencia y la carga de esporas botulnicas en esta hierba. Se analizaron 100 muestras de tilo comercializado a granel y 100 muestras de tilo industralizado en saquitos. Los resultados de prevalencia fueron analizados
por el test de Fisher y la carga de esporas por la tcnica del nmero ms probable. Se hall una prevalencia de
esporas de C. botulinum del 3% en el tilo comercializado a granel, con una carga de 30 esporas/100 g de hierba. En
tanto, ninguna de las muestras en saquitos acus la presencia del patgeno. Se identificaron tres cepas de C.
botulinum, dos tipo A y una tipo B. En virtud de estos resultados, el tilo podra considerarse un potencial vehculo de
esporas de C. botulinum y la administracin de sus infusiones a menores y lactantes, un riesgo para la transmisin de
la enfermedad.
Palabras clave: esporas botulnicas, t de tilo, botulismo del lactante
INTRODUCTION
Infant botulism is an intestinal toxemia caused by
botulinum neurotoxins (BoNT) mainly produced by
Clostridium botulinum. Some unusual strains of C.
butyricum and C. baratii that produce BoNT type E and
F, respectively, were isolated from a few patients with
infant botulism (2, 5, 7, 17, 23, 32). Most cases result
from C. botulinum types A and B (2, 4); however, some
**Present address: Botulism Public Health Research and Preparedness

Unit, Centers for Disease Control and Prevention, Atlanta, Georgia, USA
rare bivalent strains, Ba and Bf, were identified in a few

cases (6, 16, 18).
Swallowed botulinum spores germinate, multiply, and
vegetative cells produce BoNT in situ (2, 32 ). Since these
spores are ubiquitous and widely distributed in soil,
environmental exposure has been identified as an
important risk factor for infant botulism (13, 22, 27). Soil
is the principal source of these spore-forming bacteria,
and botulinum spores may be present in dust; therefore,
they can contaminate agricultural products. Due to the
fact that the infection occurs in the intestinal tract,
numerous food products have been investigated for the
presence of C. botulinum spores and BoNTs. Botulinum
233
Botulinum spores in linden flower (Tilia spp) tea
spores have been found in household dust (27), honey,

corn syrup (25), and in some medicinal plants (8, 30).
However, for most cases of infant botulism, the source of
botulinum spores has not been identified (4, 13, 25, 32).
In many countries, teas prepared with medicinal plants
are frequently given to infants as household remedy;
therefore, ingestion of teas prepared with medicinal plants
contaminated with botulinum spores could represent a
risk for infant botulism. In Argentina, Tilia spp. (linden
flower) tea is commonly given to infants and some
physicians recommend this tea as a natural sedative. The
US Food and Drug Administration (FDA) places linden
flower on the generally-recognized-as-safe (GRAS) list
based on the chemical composition of this herb. However,
linden flowers could be contaminated with botulinum
spores. These spores can resist high temperatures;
therefore, boiling water to prepare linden flower tea does
not destroy the spores, but, rather, activates them. For
these reasons, our aim was to determine the prevalence
and spore-load of botulinum spores in linden flowers. This
information is important to help elucidate the transmission
of infant botulism and prevent this illness.
each pure culture was observed by using an optical microscope.

Isolated strains were characterized by biochemical tests: acid
production from sugars, reaction in milk, meat, and gelatine,
nitrate reduction, indole, lecithinase, and lipase production;
esculin hydrolysis, and volatile acids production in peptone-yeast
extract-glucose medium by gas-liquid chromatography (10).
Serologic typing of the pure cultures was carried out by
quantitative neutralization tests on toxic cultures with monovalent
and polyvalent botulinum antitoxin (15). When the levels of BoNTs
were not sufficient for a neutralization test, we cultivated strains
by dialysis in a cellophane sack immersed in toxin-production
medium (33). After incubation at 32 C for 6 days, the contents
of the cellophane sacks were centrifuged at 12,000 g for 10
min at 4 C and serially diluted twofold in buffered solution. Each
dilution was inoculated intraperitoneally into six mice (0.5 ml per
mouse). Deaths were recorded for 96 h, and the 50% lethal doses
(LD50) were calculated by the Reed and Muench method (29).
The Fisher test was used to compare the prevalence of C.
botulinum spores in the two groups of linden flowers (unwrapped
linden flowers and linden flowers in tea bags).
For the three positive samples, the spore-load was estimated
by the most probable number method (1). We use three dilutions
(1:1, 1:5, and 1:25) and three tubes for each dilution. After 10
min of heat shock at 80 C, 1 ml of each dilution was inoculated
in each tube with CMM, and these cultures were incubated for 5
days at 31 C. The presence of C. botulinum was detected by
bioassay as described previously.
RESULTS
We examined 200 samples of linden flowers that were

obtained from markets and herbal stores from Mendoza, Argentina. Two groups of 100 samples were analyzed: 1) unwrapped
linden flowers, which are delivered in large amounts to the herbal
store and sold by weight to the customer in individual paper or
plastic bags from open containers; and 2) linden flowers in tea
bags (industrialized linden flowers), which are industrially
processed, packaged in tea bags, and sold in closed boxes.
The samples were transferred to sterile recipients and stored
at room temperature until examination. Then, 4 g of each sample
of linden flower was suspended in 40 ml of saline solution (0.15
M NaCl) in a sterile recipient with hermetic closing. Suspensions
were vigorously shaken and filtered through sterile gauze; the
filtrates were centrifuged at 12,000 x g for 10 min to concentrate
the spores. The pellets were suspended in 4 ml of saline solution,
and these suspensions were subjected to 10 min of heat shock
at 80 C. The suspensions were inoculated in a chopped-meat
medium (CMM) (14) and incubated at 31 C for 5 days. After
incubation, broths were centrifuged at 12,000 x g for 20 min at 4
C. Cultures without signs of proteolysis were treated by mixing
equal volumes of the supernatant culture and 1% trypsin (1:250,
Difco) and incubated at 31 C for 1 h. We inoculated 0.5 ml of
each supernatant (each sample), in duplicate, intraperitoneally
in mice and observed the mice for 96 h for characteristic botulinal
signs and/or death (28).
We cultivated each of the toxic cultures in each of the following
three solid media by streaking the surface: 1) 1.5% agar, 2) 4%
agar (9), and 3) egg yolk agar (11). The cultures were incubated
at 31 C in BBL jars with an atmosphere of 80% N2, 10% CO2,
and 10% H2. After incubation for 24 h in the 1.5% agar media, 48
h in the 4% agar media, and 72 h in the egg yolk media, suspected
colonies were transferred to CMM and incubated at 31 C for 4
days. The presence of BoNT in each of these cultures (from
isolated colonies) was investigated by inoculating broths in mice
as previously described. To assure a pure culture, toxic broths
were cultivated in solid media, and these cultures were incubated
in aerobic and anaerobic conditions. We identified the genera
Clostridium based on the following characteristics: gram positive,
strict anaerobe, and spore-forming rods. The cell morphology of
Prevalence of botulinum spores in linden flower.

We detected C. botulinum spores in 3% (3/100) of
unwrapped linden flower samples analyzed, but none of
the industrialized linden flower samples appeared to be
contaminated with these spores (0/100). The difference
in the occurrence of botulinum spores between both types
of samples was analyzed by the Fisher test, and results
were not significant (p = 0.2462).
Spore-load of C. botulinum in linden flower. We
detected 30 spores per 100 grams of linden flower in each
of the three positive samples (95% confidence limits:
9-103 spores per 100 grams).
Phenotypic characteristics of strains of C.
botulinum isolated from linden flower. We isolated
three toxigenic strains of C. botulinum from positive
samples of linden flower. The results of serological and
biochemical test were the following:
1) Serological test. Botulinum neurotoxin type A was
identified in two of the three positive samples and type B
in only one sample.
2) Biochemical tests. All isolated strains were grampositive rods with oval and subterminal spores. The three
strains isolated from linden flower produced acid from
glucose. Mannitol, maltose, lactose, mannose, fructose,
and sucrose were not fermented and nitrate was not
reduced. Gelatine was liquefied. Indole and lecithinase
were not produced. Esculin was hydrolyzed and lipase
was produced. Milk and meat were digested. Acetic,
propionic, butyric, isobutyric, valeric, isovaleric, and
isocaproic acids were detected in peptone-yeast extractglucose medium cultures by gas-liquid chromatography.
234
According to biochemical test results, the three strains

corresponded to metabolic group I.
DISCUSSION
Prevalence of botulinum spores in linden flower.
The prevalence of botulinum spores found in unwrapped
linden flower (3%) was lower than that detected in the
following medicinal plants: Matricaria spp. (chamomile)
(9), Lippia turbinata (penny royal), Alternanthera pungens
(khakiweed), Pimpinella anisum (anise), and Senna
acutifolia (senna) (30) (Table 1). These medicinal plants
can be contaminated with botulinum spores present in
the environment (i.e. soil, dust). The soil is the principal
source of botulinum spores and the height of the medicinal plants can be an important factor in the contamination
with these spores. The linden tree is several feet high;
therefore, linden flower is less easily contaminated with
botulinum spores than other plants of minor height. On
the contrary, chamomile, khakiweed, anise, penny royal,
and senna are small shrubs growing close to the ground
(Table 1); therefore, these plants are easily contaminated
with botulinum spores. On the other hand, the high
prevalence of C. botulinum found by Satorres et al. (1999)
in penny royal, khakiweed, anise, and senna could not
be real because of the few samples analyzed for each
one of these species (Table 1).
The prevalence of botulinum spores in linden flower
was also lower than the 6-10% detected in honey (3, 13,
19, 20, 24, 31), but higher than that found in corn syrup
(0.5%) (4). These spores have been detected in honey
from various countries (3, 12, 19, 20, 24, 26, 34) and some
studies have also considered honey consumption a risk

factor for this illness. For these reasons, and because
honey is not nutritionally essential, the United States public
health agencies, all major pediatricians, and the honey
industry have recommended not to feed infants younger
than one year old with honey (4). Moreover, C. botulinum
type B spores were found in approximately 0.5% (5 of
961) of light and dark corn syrup samples (20). However,
in 1991 a FDA market survey of 738 corn syrup samples
concluded that none contained C. botulinum spores (21).
Therefore, although the possible role of corn syrup in infant
botulism has been proposed, it is not a recognized source
of botulinum spores or a risk factor for infant botulism (4).
Probably, the absence of these spores in industrialized
linden flowers is due to the fact that the industrialization
process reduces the contamination. Linden flowers in tea
bags are usually dried in closed furnaces (25-30 C), while
unwrapped linden flowers are often dried in the open air
or in sheds. Therefore, industrialized linden flowers are
less exposed to contamination with spores present in
environmental dust. In a previous study, we found similar
results when comparing the prevalence of botulinum
spores in unwrapped chamomile and chamomile in tea
bags. Unwrapped chamomile showed a prevalence of
13% whereas chamomile in tea bags of only 2% (9).
Because botulinum spores can be present in environmental dust, an important way to prevent contamination
with C. botulinum of unwrapped herbs is to optimize the
hygiene conditions in herbal stores and to keep these
herbs in closed bags.
Spore-load of C. botulinum in linden flower. The
minimum infective dose of C. botulinum spores for human
Table 1. Prevalence of C. botulinum in medicinal plants

Medicinal
plant
Linden flower
(Tilia spp.)
- Unwrapped
- In tea bags
Chamomile
(Matricaria spp.)
- Unwrapped
- In tea bags
Penny royal
(Lippia turbinata)
Anise
(Pimpinella anisum)
Khakiweed
(Alternathera pungens)
Senna
(Senna acutifolia)
Approximate
height (f)
Number of
samples
studied (f)
Number of
positive
samples
Prevalence of
botulinum
spores (%)
Reference
15-20
15-20
100
100
3
0
3
0
This study
This study
0.50
0.50
100
100
13
2
13
2
9
9
1.50
11.1
30
1.00
11.1
30
0.15
14.9
30
0.10
33.3
30
235
Botulinum spores in linden flower (Tilia spp) tea
infants is unknown; however, from estimates from

exposure to spore-containing honey, this dose may be
as low as 10 to 100 (3, 4). This value is higher than the
spore-load detected in the three positive samples of linden flowers (30 spores per 100 grams); however, a cup
of linden flower tea is prepared with several grams of this
herb, and linden flower tea may be ingested by an infant
several times a day, for many days. Therefore, repetitive
doses of this tea could accumulate the minimun infective
dose of C. botulinum necessary for infant botulism. This
spore-load is similar to that detected in chamomile (3040 spores/100g) (9) and smaller than that detected in
honey (5-80 spores/g) (3). However, infants may be more
frequently given herbal teas than honey. In Mendoza, in
western Argentina, epidemiological data of patients with
infant botulism showed that 9.6% (10/104) had ingested
herbal teas, while 4.8% (5/104) of patients were honeyfed (8). Moreover, a study about the use of alternative
medicine in Mendoza showed that children are commonly
given herbal teas (Femena, Guida, Azcurra et al., personal communication ). An 18.92% of infants had ingested
some kind of herbal teas, and linden flower tea was one
of the most common teas given to infants. This 18.9% of
infants (younger than one year old) had ingested teas
prepared with the following medicinal plants: Matricaria
spp. (64.3%), Tilia spp. (14.3%), Chenopodium ambrosioides (14.3%), Peumus boldus (7.1%), Eucalyptus spp.
(7.1%), Pimpinella anisum (7.1%), Artemisia douglasiana
(7.1%), and a mixture of Chamomilla recutita, A. pungens,
Mentha viridis, L. turbinata, and Faeniculum vulgare (t
del nio) (7.1%) (Femena, Guida, Azcurra et al., personal communication).
Phenotypic characteristics of strains of C.
botulinum isolated from linden flower. Serotypes A and
B are the most frequently identified in cases of infant
botulism around the world. In Argentina, between the
years 1982 and 2006, C. botulinum type A has been
identified in 99.75% (409/410) of patients with infant
botulism whereas C. botulinum type B was detected in
one case (9). Moreover, we observed that strains of C.
botulinum isolated from linden flower and from infant
botulism cases showed similar biochemical characteristics. These results suggest that C. botulinum strains
present in linden flower could collaborate to produce infant
botulism.
An important way to prevent the occurrence of infant
botulism results from not giving infants food products in
which the presence of botulinum spores has been
reported. Results presented in this study suggest that
unwrapped linden flowers are a potential vehicle of C.
botulinum spores. Therefore, to minimize the risk of
acquisition of infant botulism, we recommend that linden
flower tea prepared with unwrapped linden flowers should
not be given to infants under one year of age.
Acknowledgements. We thank Mara Isabel Farace (Chief

of Sanitary Bacteriology Service) and Edgardo Castelli
(Laboratory Staff) from the Administracin Nacional de Laboratorios e Institutos de Salud (A.N.L.I.S.) Dr. Carlos G. Malbrn
(Buenos Aires, Argentina), and Daniel Abdala Pacheco from
Hospital Materno Infantil Dr. Humberto J. Notti (Mendoza, Argentina). This work was supported by grants from Facultad de
Ciencias Mdicas and Secretara de Ciencia y Tcnica, Universidad Nacional de Cuyo, Mendoza, Argentina. M.I. Bianco and
C. Lquez had fellowship assistance from CONICET, Argentina.
References
1. American Public Health Association. APHA Technical
Committee on Microbiological Methods for Foods. In:
Vanderzant C, Splittstoesser DF, editors. Compendium of
Methods for the Microbiological Examination of Foods, 3rd
ed., Washington D.C., 1992, p. 105-19.
2. Arnon SS. Creation and development of the public service
orphan drug human botulism immune globulin. Pediatrics
2007; 119: 785-9.
3. Arnon SS, Midura TF, Damus K, Thompson B, Wood RM,
Chin J. Honey and other environmental risk factors for infant
botulism. J Pediatr 1979; 94: 331-6.
4. Arnon SS. Infant botulism. In: Feigen RD, Cherry JD,
Saunders WB, editors. Textbook of Pediatric Infectious
Disease, 4th ed., Philadelphia, 1998, p. 1758-66.
5. Aureli P, Fenicia L, Pasolini B, Gianfranceschi M, McCroskey
LM, Hatheway CL. Two cases of type E infant botulism
caused by neurotoxigenic Clostridium butyricum in Italy. J
Infect Dis 1986; 154: 207-11.
6. Barash JR, Arnon SS. Dual toxin-producing strain of
Clostridium botulinum type Bf isolated from a California patient
with infant botulism. J Clin Microbiol 2004; 42: 1713-5.
7. Barash JR, Tang TWH, Arnon SS. First case of infant
botulism caused by Clostridium baratii type F in California.
8. Bianco MI. Botulismo del lactante: Transmisin por plantas
medicinales y su inhibicin por probiticos. Tesis de Doctorado. Facultad de Ciencias Exactas, Fsico-Qumicas y
Naturales, Universidad Nacional de Ro Cuarto. Crdoba,
Argentina 2008.
9. Bianco MI, Lquez C, de Jong, LIT, Fernndez RA.
Presence of Clostridium botulinum spores in Matricaria
chamomilla (chamomile) and its relationship with infant
botulism. Int J Food Microbiol 2007; 121: 357-60.
10. Centers for Disease Control. Laboratory Methods in
Anaerobic Bacteriology. In: Dowell VR, Hawkins TM, editors.
CDC Laboratory Manual, Atlanta, 1981.
11. Dezfulian M, McCroskey LM, Hatheway CL, Dowell VR.
Selective medium for isolation of Clostridium botulinum from
human feces. J Clin Microbiol 1981; 13: 526-31.
12. Fenicia L, Ferrini AM, Aureli P, Pocecco M. A case of infant
botulism associated with honey feeding in Italy. Eur J
Epidemiol 1993; 9: 671-3.
13. Fox CK, Keet CA, Strober JB. Recent advances in infant
botulism. Pediatr Neurol 2005; 32: 149-54.
14. Gimnez DF, Ciccarelli AS. Studies on strain 84 of
Clostridium botulinum. Zentralbl Bakteriol [Orig] 1970; 215:
212-20.
15. Gimnez DF, Gimnez JA. Serological subtypes of botulinal
neurotoxin. In: DasGupta BR, editor. Botulinum and Tetanus
Neurotoxins, New York, 1993, p. 421-31.
16. Gimnez DF. Clostridium botulinum subtype Ba. Zentralbl
Bakteriol 1984; 257: 68-72.
17. Hall JD, McCroskey LM, Pincomb BJ, Hatheway CL.
Isolation of an organism resembling Clostridium baratii which
236
18.
19.
20.
21.
22.
23.
24.
produces type F botulinal toxin from an infant with botulism.

Hatheway CL, McCroskey LM. Examination of feces and
serum for diagnosis of infant botulism in 336 patients. J
Clin Microbiol 1987; 25: 2334-8.
Hauschild AHW, Hilsheimer R, Weiss KF, Burke RB.
Clostridium botulinum in honey, syrups, and dry infant
cereals. J Food Prot 1988; 51: 892-4.
Kautter DA, Lilly T, Solomon HM, Lynt RK. Clostridium
botulinum spores in infant foods: a survey. J Food Prot 1982;
45: 1028-9.
Lilly T Jr, Rhodehamel EJ, Kautter DA, et al. Incidence of
Clostridium botulinum spores in corn syrup and other syrups.
J Food Prot 1991; 54: 585-7.
Lquez C, Bianco MI, Sagua MD, Barzola CP, de Jong LIT,
Degarbo SM, et al. Relationship between the incidence of
infant botulism and the presence of botulinum toxinproducing Clostridia in the soil of Argentina, 1982-2005. J
Pediatr Neurol 2007; 5: 279-86.
McCroskey LM, Hatheway CL, Fenicia L, Pasolini B, Aureli
P. Characterization of an organism that produces type E
botulinal toxin but which resembles Clostridium butyricum
from the feces of an infant with type E botulism. J Clin
Microbiol 1986; 23: 201-2.
Midura TF, Snowden S, Wood RM, Arnon SS. Isolation of
Clostridium botulinum from honey. J Clin Microbiol 1979; 9:
282-3.
25. Midura TF. Update: infant botulism. Clin Microbiol Rev 1996;
9: 119-25.
26. Nakano H, Okabe T, Hashimoto H, Sakaguchi G. Incidence
of Clostridium botulinum in honey of various origins. Jpn J
Med Sci Biol 1990; 43: 183-95.
27. Nevas M, Lindstrm M, Virtanen A, Hielm S, Kuusi M, Arnon
SS, et al. Infant botulism acquired from household dust
presenting as sudden infant death syndrome. J Clin
Microbiol 2005; 43: 511-3.
28. Notermans SH, Nagel J. Assays for botulinum and tetanus
toxins. In: Simpson LL, editor. Botulinum and Tetanus
Neurotoxins, Academic Press, San Diego. 1989, p. 31931.
29. Reed LJ, Muench H. A simple method for estimating fifty
per cent end points. Am J Hyg 1938; 27: 493-7.
30. Satorres SE, Alcaraz LE, Fernndez RA, Centorbi ON.
Isolation of Clostridium botulinum in medicinal plants.
Anaerobe 1999; 5: 173-5.
31. Schocken-Iturrino RP, Carneiro MC, Kato E, Sorbara JOB,
Rossi OD, Grebasi LER. Study of the presence of spores
of Clostridium botulinum in honey in Brazil. FEMS Immunol
Med Microbiol 1999; 24: 379-82.
32. Sobel J. Botulism. Clin Infect Dis 2005; 41: 1167-73.
33. Sterne M, Wentzel LM. A new method for the large-scale
production of high-titre botulinum formol-toxoid types C and
D. J Immunol 1950; 65: 175-83.
34. Sugiyama H, Mills DC, Kuo LJ. Number of Clostridium
botulinum spores in honey. J Food Prot 1978; 41: 848-50.
Modelo de contaminacin cruzada por VTEC
237
ISSN 0325-7541
ARTCULO ORIGINAL
Modelo de contaminacin cruzada por Escherichia coli

verocitotoxignica durante la elaboracin de
hamburguesas caseras y evaluacin cuantitativa de riesgos
M. L. SIGNORINI1*, L. S. FRIZZO2
1
Consejo Nacional de Investigaciones Cientficas y Tcnicas, Estacin Experimental Agropecuaria Rafaela, Instituto Nacional
de Tecnologa Agropecuaria, Ruta 34 km 227, (2300) Rafaela, 2Departamento de Salud Pblica Veterinaria, Facultad
de Ciencias Veterinarias, Universidad Nacional del Litoral. Kreder 2805, (3080) Esperanza, Pcia. de Santa Fe, Argentina.
*Correspondencia: E-mail: marcelo.signorini@gmail.com
RESUMEN
El objetivo del presente trabajo fue generar un modelo probabilstico para evaluar cuantitativamente el riesgo de
contaminacin cruzada de E. coli verocitotoxignica (VTEC) durante el proceso de elaboracin de hamburguesas
caseras y su impacto en la salud pblica. El modelo tuvo en cuenta un grupo de prcticas culinarias corrientes y a
cada una de ellas se le asign la probabilidad asociada de transferencia de VTEC entre los alimentos y los utensilios
de cocina. Las distribuciones de probabilidad que mejor describieron cada paso del proceso fueron incorporadas en
el programa @Risk y se realizaron las simulaciones empleando el anlisis Monte Carlo. La manipulacin de alimentos crudos (en este caso, la carne picada) antes de la preparacin de alimentos que no demandan coccin (como las
guarniciones de vegetales frescos que suelen acompaarlas) (Odds ratio, OR = 6,57), as como el hbito del lavado
de manos (OR = 12,02) y de las tablas que se utilizan durante la elaboracin de estos platos (OR = 5,02), fueron los
principales factores de riesgo de contaminacin cruzada del patgeno entre la carne y las verduras. La informacin
aportada por este modelo debera considerarse durante el diseo de estrategias de comunicacin del riesgo del
sndrome urmico hemoltico para acentuar la importancia que estos factores pueden tener en la transmisin de la
enfermedad.
Palabras clave: Contaminacin cruzada, evaluacin cuantitativa de riesgos, hamburguesas, E. coli, sndrome urmico
hemoltico.
ABSTRACT
Quantitative risk model for verocytotoxigenic Escherichia coli cross-contamination during hamburger
preparation. The objective of this study was to develop a quantitative risk model for verocytotoxigenic Escherichia coli
(VTEC) cross-contamination during hamburger preparation at home. Published scientific information about the disease
was considered for the elaboration of the model, which included a number of routines performed during food preparation
in kitchens. The associated probabilities of bacterial transference between food items and kitchen utensils which best
described each stage of the process were incorporated into the model by using @Risk software. Handling raw meat
before preparing ready-to-eat foods (Odds ratio, OR, 6.57), as well as hand (OR = 12.02) and cutting board (OR =
5.02) washing habits were the major risk factors of VTEC cross-contamination from meat to vegetables. The information
provided by this model should be considered when designing public information campaigns on hemolytic uremic
syndrome risk directed to food handlers, in order to stress the importance of the above mentioned factors in disease
transmission.
Key words: Cross-contamination, quantitative risk assessment, hamburger, E. coli, hemolytic uremic syndrome
INTRODUCCIN
Escherichia coli verocitotoxignica (VTEC) y en particular el serogrupo O157:H7 es una importante causa de
diarrea en seres humanos, que puede derivar en graves
secuelas como el sndrome urmico hemoltico (SUH).
En Argentina, la tasa de incidencia del SUH en menores
de 5 aos (13,9 por 100.000 individuos) es 10 veces superior a la notificada en los pases industrializados, con
una letalidad del 2 al 5% (7). Adicionalmente, es la primera causa de insuficiencia renal aguda y la segunda de
insuficiencia renal crnica en nios. El 30% de los nios
y adolescentes que reciben trasplante renal han padecido SUH (7).
VTEC est presente en las heces y los intestinos de
animales sanos y puede contaminar la carne durante el
proceso de sacrificio y faenado de bovinos (6, 11, 12).
Dentro de los alimentos implicados en la transmisin de
238
esta enfermedad se destaca la carne bovina insuficientemente cocida; en particular, la hamburguesa es un producto asociado a los brotes de SUH (6). Recientemente,
los vegetales crudos han sido responsables de la aparicin de este tipo de brotes, lo cual puede deberse a la
contaminacin de stos con aguas de riego contaminadas o a la diseminacin del patgeno durante la preparacin de los alimentos en los hogares, por contaminacin
cruzada hacia otros productos listos para su consumo
(14). En los Estados Unidos de Norteamrica, el porcentaje de brotes de SUH que estuvieron ligados al consumo de alimentos no crnicos fue del 12,5% en el ao
1994 y del 21% en 1996. Los vegetales contaminados
como resultado de la contaminacin cruzada fueron algunos de los vehculos ms frecuentemente asociados a
la transmisin del agente (21).
A partir de una encuesta realizada en hogares del
centro de la provincia de Santa Fe (4, 13) se comprob
que alrededor de la mitad de las hamburguesas consumidas son elaboradas en ellos inmediatamente antes de
su consumo. Esto incrementara la probabilidad de contaminacin cruzada entre la carne, los utensilios de cocina y otros alimentos que no requieren coccin y que suelen acompaar a las hamburguesas a modo de guarnicin.
Dada la alta incidencia de SUH, la carencia de un tratamiento especfico y la alta morbilidad, la prevencin
primaria de las infecciones por VTEC es fundamental para
disminuir su impacto sanitario (14). Las estrategias de
control de los riesgos de infeccin por VTEC se pueden
aplicar en diferentes etapas de la cadena alimentaria y
su efectividad depender del conocimiento que se tenga
sobre el impacto que cada etapa posee sobre la probabilidad de aparicin de la infeccin.
El objetivo del presente trabajo fue generar un modelo probabilstico que describa la dinmica de contaminacin cruzada de VTEC entre la carne empleada en la
elaboracin casera de hamburguesas, los vegetales que
las acompaan habitualmente como guarnicin y los utensilios que intervienen durante la preparacin, a fin de
evaluar cuantitativamente el riesgo de transmisin de la
enfermedad y su impacto en la salud pblica.
MATERIALES Y MTODOS
Componentes del modelo
El proceso de elaboracin de hamburguesas en los hogares
fue modelado estocsticamente bajo la premisa de que las hamburguesas a menudo se sirven acompaadas por vegetales frescos (lechuga y tomate). Durante la preparacin de los alimentos
se emplean una serie de objetos que pueden contaminarse con
VTEC; adems, ciertas prcticas culinarias contribuyen a la contaminacin cruzada. Por simplicidad, slo se consider un nmero pequeo de objetos y rutinas que en conjunto reflejan la
realidad de la preparacin del alimento (Figura 1). Los objetos
considerados fueron la carne molida para la preparacin de las
hamburguesas, las manos de quien prepara la comida (de aqu
en ms, el operador), los vegetales como acompaamiento de
Figura 1. Modelo conceptual. Objetos y acciones que intervienen durante la preparacin de las hamburguesas caseras y el
acondicionamiento de los vegetales que sern utilizados como
guarnicin. Preparacin de la hamburguesa (PH), corte de los
vegetales (CV), lavado de manos (LM) y lavado de la tabla (LT).
las hamburguesas, la tabla para cortar los alimentos y el grifo
del agua. Las acciones consideradas fueron: preparacin de la
hamburguesa (PH), corte de los vegetales (CV), lavado de manos (LM) y lavado de la tabla (LT).
Para la construccin del modelo se recurri a informacin
cientfica publicada sobre las tasas de transferencia de
microorganismos entre los diferentes elementos. La informacin
sobre prevalencia y concentracin de VTEC en la carne picada
fue obtenida a partir de una evaluacin cuantitativa de riesgos
de VTEC por consumo de hamburguesas realizada en Argentina (18), mientras que los hbitos de consumo hogareos fueron
obtenidos a partir de una encuesta realizada durante los meses
de junio y julio de 2008 en hogares del centro de la provincia de
Santa Fe, Argentina (13). Las distribuciones de probabilidad que
mejor describieron cada etapa del proceso (Tabla 1) fueron incorporadas en el programa @Risk versin 4.5 (Palisade, New
York), y se realizaron las iteraciones correspondientes empleando
la tcnica de simulacin Monte Carlo para generar las variables
de resultado (ej. probabilidad de adquirir SUH). La tcnica de
Monte Carlo selecciona repetidamente valores al azar a partir
de las distribuciones de probabilidad que caracterizan a las variables de entrada del modelo y genera mltiples escenarios del
problema. Con los resultados obtenidos se estim la probabilidad de infeccin por VTEC asociada al consumo de vegetales
contaminados, producto de la contaminacin cruzada durante
la elaboracin casera de hamburguesas y se identificaron las
variables ms importantes que impactan en dicho evento.
Supuestos tcnicos del modelo
Los modelos de simulacin con frecuencia necesitan introducir supuestos subjetivos, que pueden tener un impacto sobre
los resultados de la evaluacin de riesgos. Consecuentemente,
estos supuestos deben ser tenidos en cuenta en el momento de
analizar los resultados. El presente modelo introdujo los siguientes supuestos tcnicos:
a) Aunque el grupo de VTEC es muy amplio y est compuesto por cepas patgenas y no patgenas con caractersticas
bioqumicas diferentes, se consider que el grupo en su totalidad presenta similares propiedades de adhesin a las superficies.
b) Los diferentes estados del ciclo de crecimiento bacteriano
no fueron incluidos en el modelo y, considerando que el tiempo
entre la preparacin del alimento hasta su consumo es muy corto, tampoco se modelaron los procesos de crecimiento o
inactivacin de VTEC.
239
Tabla 1. Distribuciones de probabilidad contempladas en el modelo de riesgos de contaminacin cruzada por VTEC.
Variable
Descripcin
Ph
Ch
Pesoh
Nh
Prevalencia de VTEC en carne molida

Concentracin de VTEC en carne molida
log10 UFC/g
Peso de las hamburguesas
g
Nmero de hamburguesas consumidas
por persona
Nmero de VTEC en carne molida
Probabilidad de preparar las hamburguesas
antes que las verduras
Probabilidad de que los cocineros se laven
las manos
Probabilidad de que laven la tabla
Reduccin de la contaminacin por lavado
%
de manos
Transferencia de VTEC de carne molida a
%
manos del cocinero
Transferencia de VTEC de las manos del
%
cocinero al grifo
Transferencia de VTEC del grifo a las
%
manos del cocinero
Transferencia de VTEC de las manos del
%
cocinero a las verduras
Transferencia de VTEC de la carne molida
%
a la tabla
Transferencia de VTEC de la tabla a las
%
verduras
Dosis ingerida de VTEC con las verduras
UFC
Modelo Beta-Poisson
Parmetro alfa-Poisson
Parmetro Beta-Poisson
Probabilidad de adquirir SUH dado que
enferm
Probabilidad de morir posterior a SUH
Probabilidad de adquirir SUH
Mortalidad
Ntotal
PHae
Plm
Plt
Rlm
Th-m
Tm-g
Tg-m
Tm-v
Th-t
Tt-v
D
Penf
PSUH|enf
Pmort|SUH
PSUH
Pmort
Unidad
c) Este modelo consider que la nica fuente de VTEC era

la carne molida, de modo que el riesgo de infeccin se asumi
dependiente nicamente de la transferencia de bacterias desde la carne a travs de las manos del operador, de la tabla
empleada para la preparacin del alimento y del grifo de agua
hacia los vegetales. No se consider la posible contaminacin
previa de los vegetales por el uso de aguas de riego contaminadas.
d) No se tom en consideracin la contaminacin que pudiera ocurrir por transmisin interhumana por transferencia del patgeno entre distintos operadores por deficiente lavado de las
manos.
e) Los cuchillos no fueron considerados como fuentes de
contaminacin, ya que el modelo se centr en la contaminacin
a partir de la preparacin de hamburguesas, en cuya preparacin no interviene el cuchillo. Este utensilio slo se emplea para
cortar las verduras, y se descart la posibilidad de su contacto
previo con la hamburguesa o con su materia prima.
Distribucin/Modelo
Beta General (0,29931, 0,12735, 0,000043062, 1)(18)
10 Triangular (-3,26,-2,75,2,67) (18)
Pert (60,83,105) (12)
Discreta ({0,5;1;2;3;4}, {2;7;27;7;1}) (13)
Poisson (Ch x Pesoh x Nh)
Binomial (1,Uniforme (0,1))
Binomial (1,Triangular (0, 0,5, 1))
Binomial (1,Triangular (0, 0,5, 1))
Exponencial (3,2396, Shift (-0,10699)
(1, 3, 8)
Log normal (7,7933, 7,864, Shift (0,091172)
(1, 3, 8)
Log normal (0,67538, 3,3581, Shift(0,0014066)

Exponencial (5,1095, Shift (0,04793)
(1, 3, 8)
Log normal(5,2679, 5,823, Shift (-0,37878)

Log normal (12,7, 7,0087, Shift (0,54332)
Log logistic (-0,42502, 11,002, 3,8223)
1-[1+D/]- (20)
0,0571 (20)
2,2183 (20)
Uniforme (0,03,0,09)
(1, 3, 8)
(1, 3, 8)
(1, 3, 8)
(1, 3, 8)
(10)
Uniforme (0,022,0,048)
PSUH|enf x Penf
Pmort|SUH x PSUH
(15)
Desarrollo del modelo

Las variables empleadas en la construccin del modelo, las
distribuciones de probabilidad empleadas para su simulacin y
las fuentes de la informacin utilizada se presentan en la Tabla
1. La prevalencia de carne molida contaminada con VTEC (Ph) y
la concentracin inicial del patgeno (Ch) surgieron de una evaluacin cuantitativa de riesgos de VTEC en hamburguesas en
Argentina (18).
El peso de las hamburguesas (Pesoh) y el nmero de hamburguesas consumidas por persona (Nh) fueron obtenidos a partir
de una encuesta sobre hbitos de consumo realizada en hogares del centro de la provincia de Santa Fe (13).
Las probabilidades de que las hamburguesas se preparen
antes que las verduras (PHae) y de que los operadores se laven
las manos (Plm) y laven la tabla donde prepararon las hamburguesas (Plt) fueron modeladas siguiendo una distribucin binomial
con una incertidumbre arbitraria, dada la falta de informacin al
respecto publicada en revistas cientficas.
240
Para el clculo de las tasas de transferencia del patgeno se

emplearon los estudios publicados por Luber et al. (3), Montville
y Schaffner (8) y Chen et al. (1). Si bien el primer estudio est
basado en la transferencia de Campylobacter y los dos restantes utilizaron como modelo microbiano a Enterobacter aerogenes,
se consider que VTEC presenta el mismo comportamiento en
cuanto a su adherencia a las diferentes matrices y, por ende, las
mismas tasas de transferencia.
La dosis ingerida (D) de VTEC a partir de los vegetales que
acompaan una comida de hamburguesas fue obtenida a partir
del nmero de patgenos presentes en la carne molida y considerando las diferentes tasas de transferencia entre los objetos
involucrados (manos del operador, tabla para preparar alimentos y grifo) en el modelo de riesgos.
Para incorporar la probabilidad de enfermar (Penf) en funcin
de la dosis ingerida del patgeno se emple una distribucin
Beta-Poisson publicada por Strachan et al. (20), quienes utilizaron datos sobre un brote de E. coli O157 e informacin cientfica
publicada, asumiendo ausencia de un nivel umbral para enfermar. Asimismo, se asumi que toda la poblacin tena la misma
vulnerabilidad para enfermar luego de la ingestin de VTEC. No
obstante, es sabido que los nios de menos de 5 aos y los
adultos mayores poseen una probabilidad de sufrir secuelas graves como SUH y mortalidad mayor que el resto de la poblacin.
La probabilidad de sufrir secuelas como SUH o mortalidad
fue asumida como una fraccin de la probabilidad de enfermar.
Noris y Remuzzi (10) estimaron que la probabilidad de sufrir
SUH (PSUH|enf) es de 3% a 9% (10), y Rivas inform una mortalidad por SUH (Pmort|SUH) de 2,2% a 4,8% para el perodo 1995 a
2004, a partir de informacin proveniente del Sistema de Vigilancia Epidemiolgico Argentino (15), en ambos casos para la
poblacin de menores de 5 aos.
Anlisis de sensibilidad
Para determinar el impacto que tienen las variables de entrada del modelo sobre las variables de resultado (ej. probabilidad de adquirir SUH), se realiz un anlisis de sensibilidad por
medio del cual se determin el grado de asociacin entre dichas
variables empleando la correlacin de Pearson. La probabilidad
de adquirir una infeccin por VTEC se consider sensible a
una determinada variable del modelo de riesgos cuando el coeficiente de correlacin entre estos parmetros fue elevado.
A las variables que presentaron mayor coeficiente de correlacin con el riesgo de adquirir una infeccin con el patgeno se
les realiz un anlisis de sensibilidad avanzado. Este consisti
en realizar 5000 iteraciones del modelo manteniendo fijo el valor correspondiente a los percentiles 1%, 5%, 25%, 50%, 75%,
95% y 99% (7 simulaciones con 5000 iteraciones cada una, en
total 35 000 iteraciones) de cada variable de inters, dejando
variar libremente el resto de las variables que componen el
modelo. Los valores extremos de probabilidad de adquirir la infeccin por el patgeno (riesgo de infeccin habiendo fijado el
valor de la variable de entrada en los percentiles 1% y 99%)
fueron utilizados para calcular el Odds ratio (OR) para las diferentes variables estudiadas (ej. probabilidad de adquirir SUH si
ningn operador se lava las manos / probabilidad de adquirir
SUH si todos los operadores se lavan las manos).
Tanto el anlisis de sensibilidad bsico como el anlisis de
sensibilidad avanzado fueron realizados con el programa @Risk
versin 4.5 (Palisade, New York).
RESULTADOS
La Figura 2 muestra las distribuciones de probabilidad del nmero de VTEC (UFC) en la carne molida (A),
en las manos del operador (B) y en las verduras luego de
la preparacin de las hamburguesas (C). La probabili-
dad de que dichos objetos presenten al menos una clula de VTEC fue de 68,52%, 12,22% y 13,02%, respectivamente. Como se puede observar, el nmero promedio
de patgenos tericamente presentes en las manos de
los operadores (2,7 UFC) y en la verdura (4,5 UFC) es
menor que el presente en la carne molida (920 UFC), la
cual fue considerada como la fuente desde donde se disemina al resto de los objetos.
La Figura 3 muestra la distribucin acumulada de la
probabilidad de sufrir una infeccin por VTEC, de adquirir SUH y de morir por SUH luego de una comida de hamburguesas caseras. Esta distribucin resulta de graficar
la probabilidad de cada uno de los eventos, por comida,
como resultado de cada una de las 5000 iteraciones que
se realizaron al modelo. La probabilidad de adquirir la
infeccin por consumo de vegetales en una comida de
hamburguesas fue de 1,25 x 10-4 (IC95% 1,2 x 10-8 0,11);
la probabilidad condicional de padecer SUH luego de
haber sido infectado por VTEC fue de 7,07 x 10-6 (IC95%
6,6 x 10-10 6,76 x 10-3) y la probabilidad de morir a consecuencia de SUH fue de 2,45 x 10-7 (IC95% 2,45 x 10-11
5,49 x 10-4). Es decir que por cada 10 millones de porciones de hamburguesas caseras con vegetales que se
consuman se generaran 1250 infecciones por VTEC, de
las cuales 70 evolucionaran a SUH y esto sera la causa
de muerte de 2 a 3 personas.
Se encontr una correlacin significativa entre 3 de
las variables de entrada del modelo y el riesgo de adquirir SUH tras la infeccin por VTEC. El lavado de manos
del operador luego de manipular la carne molida (r =
0,314), la elaboracin de hamburguesas antes que la
preparacin de los vegetales (r = 0,207) y el lavado de la
tabla luego de elaborar las hamburguesas (r = 0,181)
fueron aquellas variables que arrojaron mayores valores
absolutos en el anlisis de correlacin. Por otra parte, se
encontr una baja correlacin entre la probabilidad de
presentacin del SUH y la posible transferencia del patgeno entre el grifo de agua y las manos del operador (r =
0,019) (Figura 4).
Los valores de probabilidad de adquirir SUH de los
extremos de las curvas de la Figura 5 (correspondientes
a los percentiles 1% y 99%) fueron utilizados para calcular el OR para las variables que presentaron mayor correlacin. As, el OR de adquirir SUH fue 12,02 veces
mayor en caso que los operadores no se laven las manos; 6,57 veces mayor cuando se preparan las hamburguesas (a partir de carne molida cruda) antes que los
vegetales que las acompaan y 5,02 veces mayor si no
se lava la tabla donde se procesa la carne molida, mientras que fue 6,57 veces menor por el hecho de preparar
las hamburguesas (a partir de carne molida cruda) luego
que los vegetales que las acompaan. De esta manera,
el riesgo de adquirir SUH se ve sustancialmente modificado cuando estas 3 variables se incorporan en el modelo (Figura 5) y pueden considerarse los principales fac-
241
Figura 2. Distribucin de probabilidad acumulada del nmero de VTEC en: A)

carne molida, B) manos del cocinero y C) vegetales.
tores de riesgo de contaminacin cruzada de VTEC entre la carne y los vegetales. En contraposicin, ese riesgo fue solamente de 1,039 cuando se consider la transferencia del patgeno entre el grifo de agua y las manos
del operador (Figura 5). Asimismo, es interesante destacar la importancia que tiene la contaminacin cruzada
causada a travs de las manos del operador contra la
insignificancia del aporte de la interaccin entre el grifo y
esas mismas manos.
DISCUSIN
Mediante la evaluacin cuantitativa de riesgos descrita se pretendi generar un modelo que permita explorar
con mayor profundidad procesos crticos durante las etapas finales de la cadena agroalimentaria, como parte de
evaluaciones de riesgos holsticas del tipo de la granja
a la mesa. Una de las principales ventajas que tienen
los modelos que se desarrollan siguiendo esta metodo-
Probabilidad acumulada
242
Log Probabilidad
Figura 3. Probabilidad de adquirir una infeccin por VTEC, SUH

y mortalidad.
Log Probabilidad (SUH)
Figura 4. Coeficientes de regresin entre la probabilidad de adquirir SUH y los principales factores predictivos del modelo cuantitativo de riesgos.
Percentil
Figura 5. Variacin en la probabilidad de adquirir SUH en funcin del cambio en las principales variables que inciden en el
modelo.
loga es que pueden ser utilizados a posteriori, independientemente del patgeno que uno quiera estudiar, modificando solamente algunas pocas variables que le son
propias al agente etiolgico.
Los resultados muestran que las bajas cargas
microbianas en las manos del operador y en los vegetales son producto de la baja probabilidad de transferencia
entre los diferentes objetos durante la preparacin del
alimento, aunque en ciertas ocasiones puede encontrarse un nmero elevado de microorganismos producto de
la contaminacin cruzada. El solo hecho de que el nmero estimado de patgenos presentes en las manos
del operador sea relativamente bajo no descarta la importancia que stas tienen en la trasmisin del patgeno
a los vegetales y en la posterior infeccin y adquisicin
de SUH.
El presente trabajo concuerda con las conclusiones
publicadas por Mylius et al. (9) con referencia a la importancia que presentan las actividades que se desarrollan
en una cocina como medio de contaminacin cruzada
entre los alimentos. Con base en los datos publicados en
la literatura cientfica (1, 3, 8), es altamente probable que
las manos de quienes cocinan transfieran patgenos
desde diferentes alimentos, aunque no es posible descartar como una ruta de contaminacin cruzada la falta
de limpieza de las tablas donde se preparan los alimentos. A partir de un estudio de casos y controles, Rivas et
al. (14) informaron que la prctica de lavarse las manos
siempre con agua y jabn despus de manipular carne
cruda tiene un OR de 0,23 (IC 95% 0,1 0,6), es decir,
casi 5 veces menos riesgo de adquirir SUH que si no se
lleva a cabo dicha prctica, lo que representa un OR inferior al estimado por este modelo terico.
El hbito de preparar alimentos crudos antes que los
alimentos listos para su consumo, incentivado muchas
veces por el hecho de que es durante el transcurso de la
coccin de los primeros cuando se preparan los segundos, favorece la contaminacin cruzada y aumenta el riesgo de transmisin de patgenos entre alimentos. El lavado de la tabla empleada durante la preparacin de los
alimentos presenta un elevado OR, lo que pone de manifiesto su importancia para reducir la contaminacin cruzada. Otra medida que puede sugerirse es el empleo de
dos tablas diferentes, una para la preparacin de las hamburguesas y otra para manipular los alimentos listos para
su consumo, como los vegetales frescos.
Aunque el riesgo estimado de adquirir la infeccin fue
muy bajo en el presente trabajo, no puede considerarse
insignificante, ya que debe contemplarse el nmero de
porciones de hamburguesas que se sirven anualmente
(magnitud de la exposicin). Segn datos del SENASA
(17), se comercializan durante un ao alrededor de 526
millones de hamburguesas en Argentina. Considerando
los datos aportados por la encuesta realizada a hogares
en el centro de la provincia de Santa Fe (13), anualmente se preparan en forma casera una cantidad similar de
hamburguesas. Un estudio publicado por Mc Cormick et

al. (5) indica que aproximadamente un 8% de los consumidores de la provincia de Buenos Aires (Argentina)
acompaa las hamburguesas con vegetales. Teniendo
en cuenta los datos anteriores, se estim que el nmero
promedio de personas que potencialmente podran adquirir SUH a consecuencia de la contaminacin cruzada
es 88, considerando la variabilidad y la incertidumbre
presente en los factores incorporados al modelo. Esto
representa cerca del 20% del total de casos de SUH que
se producen en Argentina anualmente, dado que se registran entre 400 y 450 nuevos casos cada ao (14). La
transmisin de la enfermedad ha evolucionado y en la
actualidad ms del 20% de los casos se vinculan con
fuentes diferentes de la carne bovina (21). El nmero
promedio de casos anuales de esta enfermedad calculado mediante el presente modelo de simulacin (88 casos) avala el concepto de que el modelo escogido es
representativo de las operaciones que se realizan durante la elaboracin de estos alimentos y, por lo tanto,
que es extrapolable.
Aunque el modelo estim un nmero de patgenos
relativamente bajo en las manos del operador, el lavado
de stas tiene una influencia determinante en la trasmisin del patgeno a los vegetales, y el riesgo puede ser
disminuido sustancialmente si esa prctica se incorpora
durante el proceso de elaboracin. Por otra parte, es llamativo cmo esas mismas manos al interactuar con el
grifo no incorporan al modelo un nivel de riesgo importante y parecera que toda especulacin que pueda hacerse en cuanto a la incorporacin o no de grifos accionados con pedalera en una cocina hogarea no estara
justificada por este modelo. Sin embargo, es destacada
la funcin que cumple este tipo de equipos en las plantas
procesadoras de alimentos, en donde los grifos manipulados por un alto nmero de operarios pueden llegar a
convertirse en importantes fuentes de contaminacin cruzada. Sin duda, el nmero reducido de operadores presentes en la cocina hogarea tiene influencia sobre la
transferencia de patgenos y as, sobre el bajo riesgo de
transmisin estimado.
De todas maneras, las medidas de prevencin para
desarrollar en los hogares deberan apuntar a controlar
los factores que poseen un mayor riesgo relativo y en
donde se destacan 3 de las variables estudiadas, 2 de
las cuales estn relacionadas con procedimientos de higiene (lavado de manos y lavado de la tabla) y la restante puede verse afectada por modificaciones propias de
las rutinas, ms precisamente por el orden en que se
llevan a cabo las tareas. Estas medidas de prevencin
primaria de la salud ya haban sido destacadas por Rivero
et al. (16) y forman parte de las recomendaciones emitidas por la asociacin Lucha contra el Sndrome Urmico
Hemoltico (2) y por la Sociedad Argentina de Pediatra
(19), por lo que este modelo contribuye con la comunica-
243
cin del riesgo cuantificando el impacto que tanto las

medidas de limpieza y desinfeccin como la modificacin de las rutinas culinarias pueden tener sobre la transmisin de la enfermedad.
El presente modelo permiti descubrir reas de investigacin que deberan profundizarse para reducir la incertidumbre existente sobre ciertos parmetros crticos
de los hbitos culinarios de la poblacin, especialmente
en las variables relacionadas con la frecuencia con la
que se manipulan alimentos crudos antes que alimentos
listos para su consumo y la frecuencia de lavado de manos y de tablas, las cuales fueron asignadas arbitrariamente. Por lo anterior, el modelo deber ser revisado en
el futuro cuando se disponga de informacin que permita
reducir dichas fuentes reconocidas de incertidumbre. De
todas maneras, aunque el modelo presenta incertidumbre, aporta una base cientfica que permite corroborar la
importancia que tienen las prcticas culinarias en la transmisin de enfermedades. La informacin generada por
estos modelos cuantitativos de riesgos debera ser considerada en la elaboracin de estrategias de intervencin y comunicacin del riesgo hacia las personas que
manipulan alimentos, para acentuar la importancia que
los 3 principales factores predictivos pueden tener en la
transmisin de la enfermedad y el impacto que se generara en caso de adoptar medidas higinicas y prcticas
culinarias adecuadas.
CONCLUSIONES
El orden seguido durante la preparacin de los platos cuando se sirven alimentos que se consumen crudos combinados con alimentos con coccin previa, as
como los hbitos de lavado de manos y de las tablas
donde se elaboran los alimentos, son los principales
factores de riesgo de contaminacin cruzada de VTEC
entre la carne cruda y las verduras. Aunque se identificaron importantes fuentes de incertidumbre que deberan ser reducidas en futuros trabajos de investigacin,
el presente modelo puede ser empleado en evaluaciones cuantitativas de riesgos del tipo de la granja a la
mesa para reflejar todas las fuentes de transmisin de
patgenos al humano. La informacin aportada por este
modelo debera ser tomada en consideracin durante
el diseo de estrategias de comunicacin del riesgo del
SUH dirigida a quienes participan en la elaboracin de
comidas.
Agradecimientos: Los autores desean agradecer los aportes realizados por Sara Bertero (SENASA.- Rafaela), Mirna
Snchez (SENASA.- Santa Fe), Carlos Ameri (SENASA), Marta
Rivas (Instituto Nacional de Enfermedades Infecciosas ANLIS
Dr. Carlos G. Malbrn), Nicols Winter, Guillermo Negri y Natalia
Bonvin (Secretara de Agricultura, Ganadera, Pesca y Alimentos). L.S. Frizzo es becario del Consejo Nacional de Investigaciones Cientficas y Tcnicas (CONICET).
244
BIBLIOGRAFA
1. Chen Y, Jackson KM, Chea FP, Schaffner DW. Quantification and variability analysis of bacterial crosscontamination rates in common food services tasks. J Food
Protect 2001; 64: 72-80.
2. Lucha contra el Sndrome Urmico Hemoltico. Cmo prevenir el Sndrome Urmico Hemoltico? Disponible en:
www.lusuh.org.ar. ltimo acceso: 29 de enero de 2009.
3. Luber P, Brynestad S, Topsch D, Scherer K, Bartelt E.
Quantification of Campylobacter species cross-contamination during handling of contaminated fresh chicken
parts in kitchens. Appl Environ Microbiol 2006; 72: 66-70.
4. Marn V, Quinteros C, Tarabla H, Signorini M. Hbitos de
consumo de hamburguesas y el riesgo de exposicin a
Escherichia coli VTEC. XVII Reunin Cientfica Tcnica de
la Asociacin Argentina de Veterinarios de Laboratorios de
Diagnstico, 2008, Resumen E8, Santa Fe, Argentina.
5. Mc Cormick M, Lacaze ML, Pereyra AM, Battistini M. Selecciones alimentarias en hogares de Buenos Aires y sus
alrededores. En: Traversa O, editores. Cuadernos del Centro de Estudios del Sistema Agroalimentario. Facultad de
Ciencias Agrarias, Universidad Nacional de Lomas de
Zamora, Llavallol, Provincia de Buenos Aires (Argentina),
1999, p. 51-80.
6. Meichtri L, Miliwebsky E, Gioffr A, Chinen I, Baschkier A,
Chillemi G, et al. Shiga toxin-producing Escherichia coli in
healthy young beef steers from Argentina: prevalence and
virulence properties. Int J Food Microbiol 2004; 96: 189-98.
7. Ministerio de Salud y Ambiente de la Nacin. Diarrea aguda
en Argentina. Precauciones especiales durante el perodo
de verano. Epi-Noticias, 2005, Ao IV, Nmero 527, pp 3.
8. Montville R, Schaffner DW. Inoculum size influences
bacterial cross contamination between surfaces. Appl
Environ Microbiol 2003; 69: 7188-93.
9. Mylius SD, Nauta MJ, Havelaar AH. Cross-contamination
during food preparation: A mechanistic model applied to
chicken-borne Campylobacter. Risk Anal 2007; 27: 803-12.
10. Noris M, Remuzzi G. Hemolytic uremic syndrome. J Am
Soc Nephrol 2005; 16: 1035-50.
11. Omisakin F, MacRae M, Ogden ID, Strachan NJC.

Concentration and prevalence of Escherichia coli O157 in cattle
feces at slaughter. Appl Environ Microbiol 2003; 69: 2444-7.
12. Padola NL, Sanz ME, Lucchesi PM, Blanco JE, Blanco J,
Blanco M, et al. First isolation of the enterohaemorrhagic
Escherichia coli O145:H- from cattle in feedlot in Argentina. BMC Microbiol 2002; 2: 6-10.
13. Quinteros C, Marn V, Tarabla H, Signorini M. Hbitos de
consumo de hamburguesas en el centro de la provincia de
Santa Fe. XVII Reunin Cientfica Tcnica de la Asociacin Argentina de Veterinarios de Laboratorios de Diagnstico, 2008; Resumen E9, Santa Fe, Argentina.
14. Rivas M, Sosa-Estani S, Rangel J, Caletti MG, Valls P,
Roldn CD, et al. Risk factors for sporadic Shiga Toxin
producing Escherichia coli infections in children, Argentina. Emerg Infect Dis 2008; 14: 763-71.
15. Rivas M. Sndrome Urmico Hemoltico. En: Foro de Investigacin en Salud en Argentina. 1 Taller de Validacin
y adaptacin de metodologas de fijacin de prioridades en
la seleccin de investigaciones en salud en Argentina, 2006;
Olavarra, Argentina.
16. Rivero MA, Padola NL, Etcheverra AI, Parma AE.
Escherichia coli enterohemorrgica y sndrome urmico
hemoltico en Argentina. Medicina (Buenos Aires) 2004;
64: 352-6.
17. SENASA. Ameri C. 2008. Comunicacin personal.
18. Signorini M, Tarabla H. Quantitative risk assessment for
verocytotoxigenic Escherichia coli in ground beef
hamburgers in Argentina. Int J Food Microbiol 2009; 132:
153-6.
19. Sociedad Argentina de Pediatra. Sndrome Urmico
Hemoltico. Recomendaciones para su prevencin. Disponible en: www.sap.org.ar/index. ltimo acceso: 29 de enero de 2009.
20. Strachan NJC, Doyle MP, Kasuga F, Rotariu O, Ogden ID.
Dose response modelling of Escherichia coli O157
incorporating data from foodborne and environmental
outbreaks. Int J Food Microbiol 2005; 103: 35-47.
21. USDA-APHIS. An Update: Escherichia coli O157:H7 in
humans and cattle. Centers for Epidemiology and Animal
Health, 1997, Fort Collins, Colorado (EE.UU.), p. 30.
245
ISSN 0325-7541
Ochratoxin A content in red wine
ARTCULO ORIGINAL
Fate of ochratoxin A content in Argentinean red wine during a

pilot scale vinification
M. L. PONSONE1, M. L. CHIOTTA1, M. COMBINA2, 3, A. M. DALCERO1, 3, S. N. CHULZE1, 3*
Departamento de Microbiologa e Inmunologa, Facultad de Ciencias Exactas, Fsico, Qumicas y Naturales, Universidad
Nacional de Ro Cuarto, Ruta Nacional N 36 Km 601, (5800) Ro Cuarto, Crdoba; 2Instituto Nacional de Tecnologa
Agropecuaria (INTA), Lujn de Cuyo, Mendoza; 3 Members of the Research Career of CONICET, Argentina
*Correspondence. E-mail: schulze@exa.unrc.edu.ar
ABSTRACT
The aim of this work was to evaluate the fate of ochratoxin A (OTA) content from must to wine during the red wine
making process in a pilot scale vinification. The study was done using musts obtained from two red grape varieties
(Bonarda and Tempranillo) artificially contaminated with two OTA levels. A duplicate set of tanks of 100 l each was
established for each must (Bonarda and Tempranillo). The fermentations were initiated by inoculation of two Saccharomyces spp. strains having different fermentation performance. The must from the Tempranillo variety was spiked
with 6 g/l of OTA while that from the Bonarda variety with 0.3 g/l of the toxin. Samples were collected at different
stages of the process. Performance of the alcoholic and malolactic fermentations was monitored. Titratable and
volatile acidity, pH, ethanol, sugar and SO2 concentrations were determined following standard methods proposed by
the Office International de la Vigne et du Vin (OIV). OTA analysis was done by HPLC. Detection and quantification
limits were 0.01 and 0.1 ng/ml, respectively. The OTA levels during the vinification trials dropped to an average of
about 86.5%. The type of Saccharomyces strains used showed no effect on toxin reduction.
Key words: ochratoxin A, wine, grapes, vinification process
RESUMEN
Evolucin del contenido de ocratoxina A en vinos tintos argentinos durante el proceso de vinificacin a
escala piloto. El objetivo del presente trabajo fue evaluar la evolucin del contenido de ocratoxina A (OTA) en
mostos durante un proceso de vinificacin a escala piloto. Se utilizaron mostos de dos variedades de uvas tintas
(Bonarda y Tempranillo) contaminados artificialmente con dos niveles distintos de OTA. El ensayo fue llevado a cabo
por duplicado en tanques de fermentacin de 100 l cada uno. La fermentacin se inici mediante la inoculacin de
dos cepas de Saccharomyces spp. con diferentes caractersticas fermentativas. El mosto de la variedad Tempranillo
fue contaminado con 6 g/l de OTA y el mosto de la variedad Bonarda con 0,3 g/l de la toxina. Se colectaron
muestras durante los diferentes estadios del proceso de vinificacin. Se estableci el avance de dicho proceso sobre
la base de la evolucin de las fermentaciones alcohlica y malolctica. Se determin la acidez total y voltil, el pH y
el contenido de etanol, de azcar y de SO2 siguiendo los protocolos estndares propuestos por la Oficina Internacional de la Vid y el Vino (OIV). El contenido de OTA se evalu por HPLC. Los lmites de deteccin y cuantificacin
fueron 0,01 y 0,1 ng/ml, respectivamente. Los niveles de OTA disminuyeron alrededor del 86,5% al final del proceso
de vinificacin. El tipo de cepa de Saccharomyces spp. utilizada no tuvo efecto sobre la reduccin de OTA.
Palabras clave: ocratoxina A, vino, uvas, proceso de vinificacin
INTRODUCTION
Argentina is a major producer and exporter of wine
in the world. The wine industry plays an important role
in the Argentinean economy. Also, Argentina is concerned with producing wine with both good quality
standards and absence of fungal natural contaminants
such as ochratoxin A (OTA). OTA is a mycotoxin produced by several species of Penicillium and Aspergillus
in different food commodities, including grapes (12).
The toxin shows nephrotoxic, immunotoxic and neuro-
toxic effects on animals (13, 14). The International

Agency for Research of Cancer (IARC) has classified
OTA as a group 2 B carcinogen based on toxicity on
rats (13).
The presence of OTA in wine was reported for the first
time in 1996 (25). Later surveys in Europe, Australia, and
South America have shown OTA occurrence in wine and
grape products (3, 6, 7, 12, 18). Studies carried out in
different countries, including Argentina have demonstrated
that Aspergillus niger aggregate and Aspergillus carbonarius
are the main prevalent species on grapes (2, 6, 19).
246
Wine has been shown to be a significant contributor

for human OTA exposure together with cereals, coffee,
beer and raisins (14). During the wine making process,
OTA needs to be considered as a possible contaminant,
since OTA levels in wine have been shown to be related
to pre-harvest grape contamination.
The European Community has fixed a maximum allowed
limit of 2.0 g/l of OTA for wines, grape must and grape
juice intended for direct human consumption (8).
During the winemaking process, the Argentinean companies use different Saccharomyces spp. strains as starters. The strain selection depends on the winemakers objectives.
Information about OTA persistence and transformation during processing will be useful to establish quality
control systems based on hazard analysis and critical
control points (HACCP) and the implementation of corrective actions during the vinification process.
Studies on the fate of OTA during the vinification process have been conducted in different countries using
microvinification trials (9, 15, 16, 20). The aim of this
study was to evaluate the fate of OTA during vinification
at a pilot scale for the first time in Argentina, in order to
assess the scaling effect on OTA reduction, using two
red grape varieties commonly used in Argentina for red
wine production, and two types of Saccharomyces spp.
strains.

Winemaking trials. Winemaking trials were performed during the 2006 vintage using Tempranillo and Bonarda red grape
varieties. The pilot - scale vinification was carried out employing
technology currently used in the wine industry in Argentina.
Chemical composition of the musts to initiate the fermentation
process is shown in table 1. Due to the fact that OTA natural
grape contamination was not observed, musts for vinification
were spiked with two OTA levels (Sigma, St Luis, USA) in order
to evaluate the effects of high and low contamination levels
during the fermentation process. Tempranillo and Bonarda musts
were artificially contaminated with 6 g/l and 0.3 g/l of OTA
respectively. These levels were chosen arbitrarily, considering
higher and lower levels than the maximum limit established by
EU (2 g/l).
In order to evaluate the effect of the yeast strain used as

starter in the fermentation process on the ochratoxin A dynamic,
two strains of Saccharomyces, S. bayanus EC1118 and S.
cerevisiae ICV-D80, were assayed: The former shows good performance for barrel fermentation, it ferments well at low temperatures and flocculates well with very compact lees. Besides,
it produces a lot of SO2 (up to 30 ppm) so it can inhibit malolactic
fermentation. S. cerevisiae ICV-D80 can ferment high sugar and
polyphenol musts. Under proper nutrition conditions, aeration
and fermentation temperatures below 28 C, the strain ferments
up to 16% alcohol. S. cerevisiae ICV-D80 also brings high foremouth volume, big mid-palate mouthfeel and intense fine grain
tannin to red wines.
The fermentation trials were carried out in four 100 l tanks as
follows:
i. Must from Tempranillo grapes inoculated with a commercial S. bayanus EC1118.
ii. Must from Tempranillo grapes inoculated with a commercial S. cerevisiae ICV-D80.
iii. Must from Bonarda grapes inoculated with a commercial
S. bayanus EC1118.
iv. Must from Bonarda grapes inoculated with a commercial
S. cerevisiae ICV-D80.
Vinification trials were started by crushing-destemming grapes,
producing must pomaces (skins and seeds). 50 mg/l of SO2 was
added to each must, and inoculated with 2 x 106 CFU/ml of the
commercial Saccahromyces spp. strains. The temperature in
each tank was kept in the range of 24-28 C during maceration
and alcoholic fermentation (AF) for 7-10 days. After completion
of alcoholic fermentation, a first settling and racking was carried
out to remove the pomaces from the wine. Then, malolactic
fermentation (MLF) took place spontaneously, due to lactic acid
bacteria present in the wine. After a second racking to remove
the yeast sediment, the wine was stabilized for bottling and
storage.
Sampling of must and wine during winemaking. The samples were taken from each tank, in triplicate, after the pumpingover to obtain homogeneous samples during fermentation, at
the stages indicated in Figure 1.
OTA analysis. The OTA content was determined following
the methodology proposed by Visconti et al (1999). In brief, must
and wine were diluted with water solution containing PEG (1%)
and NaHCO3 (5%), mixed, and filtered to remove particulate
matter. Ten ml portion was taken and added to an immunoaffinity
column (OchraTestTM; Vicam, Digen Ltd, Oxford, UK). The column was washed with 10 ml PBS containing 1% Tween 20 and
then with 10 ml double distilled water. OTA was eluted from the
column with 1.5 ml of methanol (HPLC grade), at a flow rate of
1-2 drops per second.
The HPLC apparatus system was a Hewlett-Packard
(Waldbronn, Germany) chromatograph with a loop of 50 ml,
Table 1. Chemical composition of musts used for vinification

Musts
Tempranillo
Bonarda
Total Acidity
(g/l
Tartaric
Acid)
Free
SO2
(mg/l)
Total
SO 2
(mg/l)
Brix
pH
T
EAN*
(mg/l)
3.59
4.13
16.00
8.96
54.40
44.80
24.70
21.50
13.90
12.45
3.50
3.50
169.4
126.0
*EAN: Easily assimilable Nitrogen
247
equipped with a spectrofluorescence detector (excitation, 333

nm; emission, 460 nm) and a C18 column (150 x 4.6 mm, 5 m
particle size; Supelcosil LC-ABZ, Supelco, Bellefonte, PA, USA),
connected to a precolumn (20 x 4.6 mm, 5 m particle size;
Supelguard LC-ABZ, Supelco). The mobile phase was pumped
Table 2. Recoveries from blank musts fortified with ochratoxin

A at different levels (n = 3)
Spicking level
Mean Recovery (%) SD*1
R.S.Dr (%)*2
ng/ml
2
5
10
Mean of means
107.6
100.6
100.5
104.7
4.0
3.0
4.7
3.9
3.7
2.9
4.6
3.73
*1SD = Standard Deviation

*2RSDr (%) = Relative standard deviation intra-laboratory.
at 1.0 ml/min, and consisted of an isocratic system as follows:

99:99:2 acetonitrile, water and acetic acid respectively. OTA was
quantified on the basis of HPLC fluorometric response compared
with OTA standard (purity > 99%; Sigma Aldrich Co., St Louis,
MO, USA). The lowest limit of detection was 0.01 ng/ml and the
quantification limit was 0.1 ng/ml.
Recovery experiments. Recovery experiments were performed in triplicate by spiking OTA free samples of must with
OTA levels of 2, 5 and 10 ng/ml. (Table 2).
Physico-chemical analysis. Progress of the alcoholic fermentation (AF) was monitored daily by decline in total soluble
solids using a gravimetric method as density (B). pH, total sugar,
ethanol (%), SO2, volatile acidity and total acidity were determined according to the standard methods of OIV (1990) (17).
MLF was followed by malic acid detection with a commercial
ELISA kit (Roche) following the manufacturers protocol.
Statistical analysis. To determine the significance of OTA
reduction at the end of the process, an statistical analysis of the
OTA reduction percentage in bottled wines was carried out by
the analysis of variance (ANOVA; p<0.001), followed by a Tukey
test.
RESULTS AND DISCUSSION
Figure 1. Red winemaking flow-chart, showing the sampling

stages chosen for OTA analysis during the vinification process.
During the vinification process the performance of

malolactic fermentation was monitored (Fig. 2). The
characteristics of the wines were evaluated; the results
are shown in table 3. The mean ethanol content was
14.1% (v/v) with a minimum of 13.2% (v/v) and a maximum of 15% (v/v). The levels of OTA in the wines after
Figure 2. Evolution of L-Malic Acid content through a pilot scale vinification process (n=3), at each time analyzed (T: Tempranillo; B:
Bonarda; EC11 18: S. bayanus EC1118; D80: S. cerevisiae ICV-D80).
248
the vinification trial are reported in Figure 3. The mean

OTA content, reached 70 ng/l in the musts contaminated
with 0.3 g/l, while in those contaminated with 6 mg/l the
mean final value was 903 ng/l.
This study showed the fate of OTA concentration
throughout the vinification process at a pilot scale (from
must to wine). The step that showed the first OTA level
reduction, 62% and 46% for must with high (Tempranillo)
and low (Bonarda) levels of OTA contamination, respectively, occurred soon after conditioning the contaminated
musts with additional reductions upon racking from juice
and gross lees. From this point to the end of the alcoholic
fermentation process, the mean reduction of OTA reached
84 and 89% for wines obtained from Tempranillo and
Bonarda, respectively (Fig. 3 a, b). During fermentation
(either alcoholic or malolactic), the OTA content decreased
in the liquid fraction. This reduction was then further reinforced after the final stages of the process (Table 4). There
were highly significant differences (p < 0.001) between the

OTA content of the grape must and wines for all the
trials evaluated. Both yeast strains were able to noticeably
and significantly reduce the initial OTA content, but in the
Tempranillo grape variety no significant differences in the
behaviour between the strains used were observed. In
this particular case, the lack of differences among OTA
reduction according to the yeast strain used agrees with
data obtained by Scott et al. (21) and Caridi et al. (5),
which showed no differences in OTA reduction by several Saccharomyces spp. strains evaluated. The difference in the behaviour between the yeast strains observed
in Bonarda musts could be explained by the low level of
OTA used at the beginning of the process.
The significant reduction of OTA during the vinification
process could be explained by the partition of the toxin
between the liquid and the solid phase, due to an extensive adsorption of OTA onto the solid parts of the grapes
Table 3. Chemical composition of final wines

Wine
Tempranillo
S. bayanus
ICV- EC1118
Tempranillo
S. cerevisiae D80
Bonarda
S. bayanus
ICV-EC1118
Bonarda
S. cerevisiae D80
Total Acidity
g/l
Tartaric Acid
Volatil Acidity
g/l
Acetic Acid
Sugar Content Free SO2

(g/l)
(mg/l)
Total SO2
(mg/l)
Ethanol
(% v/v)
5.625
0.305
1.88
40.96
64.00
14.8
5.620
0.275
5.90
35.85
57.60
15.0
6.000
0.330
1.80
34.60
57.60
13.2
5.770
0.310
2.18
38.40
55. 04
13.4
Figure 3. Evolution of ochratoxin A content through the pilot scale vinification process in must from Tempranillo and Bonarda grapes.
The method for evaluation of OTA contamination through the process showed a mean recovery of 101.3% evaluated in the spiking
range (n=3), at each time analyzed (T: Tempranillo; B: Bonarda; EC11 18: S. bayanus EC1118; D80: S. cerevisiae ICV-D80).
249
Table 4. Removal of OTA in wines obtained from two grape varieties using two
different commercial strains of Saccharomyces after 30 days of fermentation
(p<0.001).
Wine
Tempranillo
S. bayanus ICV- EC1118
Tempranillo
S. cerevisiae D80
Bonarda
S. bayanus
ICV-EC1118
Bonarda
S. cerevisiae D80
Range of removed
OTA (%)
Media
percentage of removed OTA
(n=3) SD*
82-84
83 0.82(b)
85-88
86 1.25 (b)
99-100
100 0.47(a)
75-79
77 1.63 (c)
*SD: Standard deviation
and yeast lees as it has been demonstrated by other researchers (10, 16). An adsorption mechanism onto
biomass surface could be explained by the overall negative charge in the cell walls and the acidic nature of OTA
(4). Also, Fernandes et al. (10), Gambuti et al. (11) and
Leong et al. (16) working on vinification trials reported a
decrease in wine OTA content mainly due to the removal
of OTA by adsorption onto suspended solids in musts
and wines. Solfrizzo et al. (22) and Visconti et al. (24)
reported that, on average, between 70-95% of OTA is
retained in pressed grape pomace during micro
vinification trials.
In general, all the vinification trials showed an average
86.5% of OTA reduction. Similar results were obtained
by Leong et al. (16) during micro-vinification trials of
grapes with an initial OTA concentration, ranging from 2
to 114 g/kg. Under our experimental conditions, the OTA
reduction was dependent on the initial OTA level in the
musts.
Also, it was observed that during fermentation (either
alcoholic or malolactic) the OTA content decreased in
the liquid fraction. These data agree with Fernandes et
al. (9), who reported a decrease in the OTA content from
must to wine.
Since the risk of OTA contamination increases during
the grape ripening, a good sanitary stage of grapes at
harvest time will be essential to prevent OTA wine contamination. Therefore, this stage will be one of the critical control points in the wine production chain as it was
postulated in a previous study (1).
The results showed that under the conditions simulating the vinification process in Argentina, OTA levels can
be reduced by around 86.5% during the process.
Acknowledgements: This work was supported by a grant
from ANPCyT (PICT 25522) and SECyT Secretara de Ciencia
y Tcnica, Universidad Nacional de Ro Cuarto). We also thank

CONICET (L. Ponsone is a CONICET fellow).
REFERENCES
1. Battilani P, Giorni P, Languasco L, Pietri A, Bertuzzi AT.
Dynamic of fungi responsible fror ochratoxin A in grape.
Results from a survey on their presence in Italy in 2000.
Bioactive Fungal Metabolites-Impact and Exploitation, 2001;
p 47, Swansea UK.
2. Battilani P, Giorni P, Pietri A. Epidemiology of toxin
producing fungi and ochratoxin A occurrence in grape. Europ
J Plant Pathol 2003; 109: 715-22.
3. Burdaspal PA, Legarda TM. Ocratoxina A en vinos, mostos
y zumos de uva elaborados en Espaa y en otros pases
europeos. Alim 1999; 299: 107-13.
4. Castellari M, Versari A, Fabin A, Parpinello GP, Galassi
S. Removal of ocrhatoxin A in red wines by means of
adsorption treatments with commercial finning agents. J
Agric Food Chem 2001; 46: 3917-21.
5. Caridi A, Galvano F, Tafuri A, Ritieni A. Ochratoxin A
removal during winemaking. Enz and Microbial Tech 2006;
40: 122-6.
6. Da Rocha Rosa CA, Palacios V, Combina M, Fraga ME,
De Oliveira Rekson A, Magnoli CE, Dalcero AM. Potential
ochratoxin A producers from wine grapes in Argentina and
Brazil. Food Add Contam 2002; 19: 408-14.
7. European Commission. Commision Regulation (EC) N
1881/2006 of 19 December 2006 setting maximum levels
for certain contaminants in foodstuffs. Offic J Eur Union
2006; 364: 5-24.
8. European Commission. Commission Regulation (EC) N
123/2005 of 26 January 2005 amending Regulation (EC)
No 466/ 2001 as regards ochratoxin A. Off J Eur Union
2005; L25: 3-5.
9. Fernandes A, Venancio A, Moura F, Garrido J, Cerdeira A.
Fate of ochratoxin A during a vinification trial. Asp App
Microbiol 2003; 68: 73-80.
10. Fernandes A, Ratola N, Cerdeira A, Alves A, Venncio A.
Changes in ochratoxin A concentration during winemaking.
Am J Enol Vitic 2007; 58: 92-96
11. Gambutti A, Strollo D, Genovese A, Ugliano M, Ritieni A.
Influence of enological practices on ochratoxin A concentration in wine. Am J Enol Vitic 2005; 56: 155-62.
250
12. Hocking AD, Varelis P, Pitt JI, Cameron S, Leong S.

Occurrence of ochratoxin A in Australian wine. Aust J Grape
Wine Res 2003; 9: 72-8.
13. International Agency for Research on Cancer (IARC).
Ochratoxin A. In: IARC editors. Monographs on the
evaluation of carcinogenic risks to human: some naturally
occurring substances; food items and constituents,
heterocyclic aromatic amines and mycotoxins. Lyon, France,
1993; 56: 489-521.
14. JECFA, Joint FAO/WHO Experts Committee on Food
Additives. 2001; Vol 47.
15. Leong S, Hocking AD, Scott ES. Ochratoxin A: from grapes
to wine. In: Blair RJ, Pretorius IS, editors., Proceedings of
the Twelfth Australian wine industry Technical Conference.
Australian Wine Industry Technical Conference Inc. 2004;
p. 299. Adelaide, Australia.
16. Leong SL, Hocking AD, Varelis P, Gannikopoulos G, Scott,
ES. Fate of Ochratoxin A during vinification of semillon and
Shiraz grapes. J. Agric.Food Chem. 2006; 54: 6460-4.
17. Office International de la Vigne et du Vin (O.I.V.). Recueil
des mthodes internacionales danalyse des vins et des
mots. Edits O.I.V.: 1990; p 368. Paris, France.
18. Ospital M, Cazabeil JM, Betberder AM, Tricard C, Creppy
E, Medina B. LOchratoxine A dans les vins. Rev Franaise
dOenol 1998; 169: 16-8.
19. Ponsone ML, Combina M, Dalcero A, Chulze S. Ochratoxin
A and ochratoxigenic Aspergillus species in Argentinean

wine grapes cultivated under organic and non-organic
systems. Int J Food Microbiol 2007; 114: 131-5.
Ratola N, Abade E, Simoes T, Venncio A, Alves A. Evolution
of ochratoxin A content from must to wine in Port Wine
microvinification. Anal Bioanal Chem 2005; 382: 405-11.
Scott PM, Kanhere SR, Lawrence GA, Daley EF, Farber
JM. Fermentation of wort containing added Ochratoxin A
and fumonisins B1 and B2. Food Addit Contam 1995; 12:
31-40.
Solfrizzo, M., Panzarini, G., Visconti, A. Fate of ochratoxin
A during vinification of naturally contaminated primitivo and
neogramaro grapes. XII International IUPAC Symposium
on Mycotoxins and Phycotoxins, 2007, Abstract 1425
Istambul, Turkey.
Visconti A, Pascale M, Centonze G. Determination of
ochratoxin A in wine by means of immunoaffinity column
clean-up and high-performance liquid chromatography J
Chromatogr A 1999; 864: 89-101.
Visconti A, Perrone G, Cozzi G, Solfrizzo M. Managing
Ochratoxin A risk in the wine food chain. XII International
IUPAC Symposium on Mycotoxins and Phycotoxins, 2007,
Abstract 1421 Istambul, Turkey.
Zimmerly B and Dick R. Ochratoxin A in table wine and
grapes juice: occurrence and risk assessment. Food Addit
Contam 1996; 13: 655-68.
20.
21.
22.
23.
24.
25.
251
ISSN 0325-7541
ARTCULO ESPECIAL

W. E. MORRIS*, M. E. FERNNDEZ-MIYAKAWA
Instituto de Patobiologa, Centro Nacional de Investigaciones Agropecuarias, Instituto Nacional de Tecnologa Agropecuaria,
Los Reseros y Las Cabaas, (1712) Castelar, Pcia. Buenos Aires, Argentina
*Correspondencia. E-mail: wmorris@cnia.inta.gov.ar
RESUMEN
Clostridium perfringens es un bacilo grampositivo anaerobio con capacidad de formar esporas. Es uno de los patgenos
bacterianos con mayor distribucin en el medio ambiente, ya que puede ser aislado de muestras de suelo y de agua
y adems forma parte de la microbiota intestinal de animales y humanos. Sin embargo, en ciertas ocasiones puede
actuar como patgeno oportunista y causar enfermedades como la gangrena gaseosa, la enterotoxemia del ovino y
del caprino y la disentera del cordero, entre otras. En humanos, est asociado a enfermedades como la intoxicacin
por alimentos, la enterocolitis necrotizante en nios y la enteritis necrtica o pigbel de las tribus de Papa-Nueva
Guinea. El renovado inters que existe actualmente en el estudio de C. perfringens como patgeno veterinario y
humano, junto con el avance de la biologa molecular, han hecho posible que la ciencia tenga hoy un conocimiento
ms profundo sobre la biologa y la patogenia de esta bacteria. En esta revisin bibliogrfica se discuten y actualizan
los principales aspectos de la patogenia intestinal de C. perfringens teniendo en cuenta las toxinas con mayor importancia mdica descritas hasta el presente.
Palabras claves: Clostridium perfringens, toxinas, enterotoxemia
ABSTRACT
Toxins of Clostridium perfringens. Clostridium perfringens is an anaerobic gram-positive spore-forming bacillus. It
is one of the pathogens with larger distribution in the environment; it can be isolated from soil and water samples,
which also belongs to the intestinal flora of animals and humans. However, on some occasions it can act as an
opportunistic pathogen, causing diseases such as gas gangrene, enterotoxemia in sheep and goats and lamb dysentery,
among others. In human beings, it is associated to diseases such as food poisoning, necrotic enterocolitis of the infant
and necrotic enteritis or pigbel in Papua-New Guinea tribes. The renewed interest existing nowadays in the study of C.
perfringens as a veterinarian and human pathogen, together with the advance of molecular biology, had enabled
science to have deeper knowledge of the biology and pathology of these bacteria. In this review, we discuss and
update the principal aspects of C. perfringens intestinal pathology, in terms of the toxins with major medical relevance
at present.
Key words: Clostridium perfringens, toxins, enterotoxemia
INTRODUCCIN
Clostridium perfringens es un bacilo grampositivo
anaerobio con capacidad de formar esporas (124). Pertenece al gnero Clostridium, el cual est compuesto por
aproximadamente 150 especies, filogenticamente
heterogneas, que no representan un taxn coherente
(114). Algunos clostridios son patgenos y causan enfermedades, principalmente por efecto de potentes toxinas
extracelulares. Entre las especies patgenas ms conocidas se encuentran Clostridium botulinum, C. tetani y C.
difficile (110).
En la ltima dcada, el uso generalizado de la PCR y
el secuenciamiento genmico han producido importantes avances en el aislamiento, la identificacin y la caracterizacin de distintas bacterias, incluyendo a los
clostridios (131). Adems, la posible utilizacin de estos
microorganismos como armas biolgicas en acciones de

bioterrorismo ha incrementado el inters de muchos gobiernos en su estudio (93, 107). Tal es el caso de algunas especies de Clostridium como C. botulinum, considerado clase A por el Centers for Disease Control de EE.
UU. (CDC), y de la toxina psilon de C. perfringens tipos
B y D, que es considerada clase B por el citado organismo (61, 93, 108).
C. perfringens, previamente denominado Clostridium
welchii (74), es uno de los miembros del gnero
Clostridium que ha sido objeto de renovado inters en el
campo cientfico por sus caractersticas biolgicas y su
importancia biomdica. C. perfringens es uno de los
patgenos bacterianos ms ampliamente distribuidos en
el medio ambiente (128). Puede ser aislado de muestras
de suelo y de agua y forma parte de la flora intestinal de
animales y humanos (81). Sin embargo, C. perfringens
252
puede en ciertas ocasiones comportarse como un patgeno oportunista. En la produccin ganadera este hecho
reviste gran importancia por ser el agente causal de enfermedades como la gangrena gaseosa, la enterotoxemia
del ovino y del caprino, y la disentera del cordero, entre
otras (11, 66, 109, 121). En humanos, por su parte, est
asociado a enfermedades como la intoxicacin por alimentos, la enterocolitis necrotizante en nios y la enteritis necrtica o pigbel de las tribus de Papa-Nueva Guinea (63, 109).
La bacteria
C. perfringens no presenta motilidad y forma esporas
in vitro slo en medios de cultivo especiales (91). Crece
rpidamente en medios ricos en carbohidratos en los que
produce, mediante la fermentacin de stos, grandes
cantidades de hidrgeno y dixido de carbono, que ayudan a mantener el ambiente anaerbico. Sin embargo,
C. perfringens es relativamente aerotolerante (66). Ha
sido, adems, la primera bacteria grampositiva de la cual
fue posible obtener el mapa genmico completo (15). Este
hecho fue facilitado por su relativa tolerancia al oxgeno,
rpido crecimiento y, sobre todo, por su capacidad para
ser manipulado genticamente (91).
Las cepas de C. perfringens pueden poseer una cpsula cuya composicin en carbohidratos vara entre aislamientos; esto permite su serotipificacin capsular (117).
Este mtodo de clasificacin fue empleado con xito entre los aos 1950 y 1980 para investigar los brotes de
intoxicacin por alimentos asociados a C. perfringens en
Inglaterra (117). Sin embargo, la tcnica no fue tan efectiva durante la investigacin de brotes ocurridos en
EE.UU. y Japn. En la actualidad, la toxinotipificacin es
el mtodo ms difundido de clasificacin de C.
perfringens. Este mtodo tipifica a la bacteria en cinco
tipos (A, B, C, D y E) segn la produccin de las toxinas
alfa, beta, psilon y iota (Tabla 1). Sin embargo, la virulencia de C. perfringens se debe no solo a estas cinco
toxinas, sino tambin a un repertorio compuesto, hasta
el momento, de 15 toxinas proteicas (91, 110). Dentro
del resto de las toxinas no utilizadas en la clasificacin,
pero importantes desde el punto de vista patolgico, se
encuentra la enterotoxina de C. perfringens o CPE, responsable de diarreas en humanos y animales; la recien-
Tabla 1. Clasificacin de C. perfringens basada en la produccin de toxinas

Toxinotipo
A
B
C
D
E
Alfa
+
+
+
+
+
Toxinas
Beta
Epsilon
+
+
+
+
-
Iota
+
temente descubierta toxina NetB, relacionada con la enteritis necrtica en aves (53); y la toxina beta-2, aparentemente asociada a ciertos cuadros de enteritis (110).
Clostridium perfringens es un microorganismo con alto
grado de intercambio gentico; esto le permite la transferencia de factores de virulencia y le otorga la capacidad de producir las diferentes toxinas como resultado de
la prdida o la ganancia de los genes especficos (15,
44). Es decir que no existen grandes diferencias entre
los diferentes tipos de C. perfringens, a no ser el acarreo
de ciertos genes de virulencia. Por otro lado, cierta evidencia indica que algunos de estos factores de virulencia, codificados en plsmidos, pueden ser transferidos
horizontalmente (7, 44, 83). El movimiento gentico horizontal tambin est facilitado por transposones (12). En
definitiva, la universalidad de C. perfringens sumada a la
independencia de los factores de virulencia denota el
potencial patognico de esta bacteria, especialmente si
se tiene en cuenta que es parte de la microbiota del intestino.
La enterotoxina
La enterotoxina de C. perfringens conocida como
CPE segn su sigla en ingls fue purificada y caracterizada en la dcada de 1970 (41, 115). Desde entonces,
se ha acumulado suficiente evidencia para proponer a
esta toxina como causante principal de la intoxicacin
por alimentos producida por C. perfringens tipo A, una
de las enfermedades ms comunes relacionadas con la
ingesta de comida. En Estados Unidos, la intoxicacin
alimentaria por C. perfringens tipo A se encuentra entre
la 2a y 3a causa de intoxicacin por alimentos en humanos (103, 126). Asimismo, esta toxina se asocia con el 515% de las enfermedades gastrointestinales humanas
distintas de las intoxicaciones alimentarias; como por
ejemplo la diarrea producida por antibiticos (9). Por otro
lado, la enterotoxina tiene importancia en la medicina
veterinaria por ser la causa de diarreas en diversas especies animales como los porcinos, los ovinos, los bovinos, los equinos, las aves y los cnidos (21, 48, 56, 75,
80, 110, 128, 129).
Las cepas de C. perfringens que llevan el gen cpe
son en su mayora del tipo A, aunque todos los toxinotipos
pueden codificarla (66). La presencia del gen cpe es poco
comn: alrededor del 5% de los aislamientos globales
de C. perfringens tipo A son positivos para cpe (23). El
gen cpe puede encontrarse tanto en el cromosoma como
en un plsmido de gran tamao (20, 22), y se cree que la
ubicacin de este gen podra definir el tipo de enfermedad producida. Por ejemplo, las cepas de C. perfringens
tipo A responsables de la intoxicacin por alimentos usualmente presentan este gen en el cromosoma, mientras
que las cepas de C. perfringens tipo A causantes de
diarreas asociadas a antibiticos y diarreas espordicas
suelen presentarlo en un plsmido (20, 22). Hasta el
momento, no se han producido aislamientos de cepas
que codifiquen simultneamente el gen de la enterotoxina

en forma cromosmica y plasmdica. La causa de esta
diferencia en las enfermedades producidas podra deberse a que las cepas de C. perfringens que codifican la
enterotoxina en el cromosoma presentan una mayor resistencia a las altas temperaturas durante la coccin (126)
que las cepas de C. perfringens con el gen cpe presente
en plsmidos (102). En este ltimo caso, la asociacin
con enfermedades no relacionadas con alimentos podra
deberse a la capacidad de transferencia del plsmido que
contiene la secuencia codificante de la enterotoxina a
diferentes cepas de C. perfringens presentes en el tracto
intestinal (102).
La enterotoxina tiene actividad letal, citotxica y
enterotxica. En el intestino delgado de diferentes mamferos produce dao morfolgico y fisiolgico, lo cual
originara la diarrea observada en humanos y otras especies animales (25, 79). El mecanismo de accin de
esta toxina se inicia con la unin a un receptor celular
proteico o a varios (65), que podra incluir ciertas protenas de la familia de las claudinas. Estas protenas tienen un importante papel en la formacin de la unin estrecha de las clulas epiteliales (33, 49, 50). Luego de
esta unin, la enterotoxina se localiza en un complejo de
protenas (~90 kDa), el cual es necesario, pero no suficiente, para ejercer toxicidad (127). Este pequeo complejo proteico es el precursor de un par de complejos
mayores, uno de ~155 kDa y otro de ~200 kDa que incluye a la ocludina, otra protena de la unin estrecha, aparentemente removida desde esta ubicacin (108).
Hay evidencia que indica que la formacin del complejo de 155 kDa forma poros en la membrana celular, lo
que llevara a un aumento de la permeabilidad celular
con la consecuente citotoxicidad (40, 54, 127). El mecanismo de muerte celular es dependiente de la concentracin de toxina y de la concentracin de ciertos iones
extracelulares, como el calcio (17). La evidencia existente indica que la apoptosis sera el mecanismo predominante a bajas concentraciones y la necrosis a altas concentraciones (17). En ambos casos la enterotoxina produce dao histopatolgico en el intestino in vivo (68), lo
que lleva a la prdida de electrolitos y fluidos que se observa en modelos experimentales (79, 105, 109). Sin
embargo, no est claro si los cambios en la unin estrecha e incluso los procesos inflamatorios producidos por
la toxina tambin podran contribuir a estos cambios fisiolgicos.
Estudios recientes han demostrado que el receptor
para CPE se expresa en clulas neoplsicas, razn por
la cual se investiga su posible uso en el tratamiento del
cncer (55, 69, 100, 101).
La toxina alfa
La toxina alfa es el principal factor de virulencia de la
gangrena gaseosa en humanos y animales (66) y de la
enteritis necrtica de bovinos, equinos y pollos (3, 11,
253
58, 80, 129, 130). Todos los tipos de C. perfringens poseen los genes codificantes para esta toxina (plc); sin
embargo, no todas las cepas la producen y existen grandes variaciones en las cantidades producidas (26). Esta
toxina tiene actividad enzimtica, tanto de fosfolipasa
(fosfolipasa-C o FLC) como de esfingomielinasa (SMasa)
y, adems, es hemoltica y dermonecrtica (111).
El gen plc tiene ubicacin cromosmica (116) y su
expresin es estimulada por la disminucin de la temperatura (64). El significado biolgico de esto sera que en
condiciones adversas, como las que imperan en el suelo
o en el ambiente externo, la bacteria necesitara producir
ms FLC, para degradar membranas y otros lpidos del
ambiente y generar as fuentes de carbono y energa.
Esto no sucedera a la temperatura corporal.
La estructura cristalizada de la toxina alfa de C.
perfringens muestra que la protena madura est organizada en dos dominios, el amino terminal, que contiene la
actividad FLC, y el carboxi terminal de unin que es dependiente de calcio. Los productos de la hidrlisis son
grupos polares unidos a fosfatos solubles en agua y una
cola unida a un esqueleto de glicerol insoluble en agua.
La estructura del fosfolpido (el grupo de la cabeza polar)
y el grado de insaturacin y largo de la cola tienen profunda influencia en la eficiencia con la cual stos son
hidrolizados por ciertas FLC (77). Dependiendo de la
composicin de los lpidos de la membrana celular, la
toxina alfa puede ser hemoltica en presencia de calcio,
como sucede en los eritrocitos humanos, de ratones y de
ovejas. En cambio, esto no sucede en el caso de los
eritrocitos de conejos o de caballos (77).
La hidrlisis de fosfolpidos de membrana resulta en
la acumulacin de diacilglicerol, compuesto que puede
activar vas celulares que contribuyen al efecto citotxico
observado, como la va del cido araquidnico (77). Esta
acumulacin acta como activador de la protena-kinasa
C, enzima que a su vez puede activar las fosfolipasas C
y D de las clulas eucariticas (31, 32, 119). Asimismo,
la activacin de esta va llevara a la produccin de
tromboxano A2, un potente mediador de la respuesta
inflamatoria. Parecera que la toxina alfa imita la accin
de la FLC intracelular en la membrana de clulas
eucariotas (99).
C. perfringens tipo A produce enteritis necrtica en
pollos (3, 58, 80). Durante mucho tiempo la evidencia
acumulada hizo suponer firmemente que la toxina alfa
producida por este tipo de C. perfringens era la responsable de los principales signos de la enfermedad (2, 34).
Sin embargo, la bsqueda de vacunas eficaces muestra
que otras toxinas o factores no descubiertos an, adems de la toxina alfa, seran necesarios para proveer
proteccin contra la enfermedad (118). Un trabajo reciente
en el cual a cepas de casos clnicos de C. perfringens se
les suprimio el gen de la toxina alfa, pareceria aportar
evidencia concluyente de que la toxina alfa no es esencial en el desarrollo de la enteritis necrtica (52). Sin
254
embargo, un trabajo posterior (4) puso en duda el modelo animal utilizado en los experimentos de Keyburn et al.
(52), argumentando que los animales en estudio podran
haber estado colonizados con cepas salvajes productoras de enteritis necrtica previo al ensayo.
La accin de la toxina alfa en el intestino de especies
animales (con la excepcin de los pollos) es poco conocida, como tambin lo es su accin como factor de virulencia en casos de enterotoxemia (11, 77). Existe asociacin entre la toxina alfa de C. perfringens tipo A y la
abomasitis de los terneros (90). Tambin se considera a
C. perfringens tipo A el agente causal de la enteritis
necrotizante bovina; sin embargo, el papel que la toxina
alfa juega en esta enfermedad de los bovinos es controvertido (60). La toxina alfa inoculada en asas de intestino
delgado de ratas in vivo caus influjo de neutrfilos en la
mucosa, con incrementos en la actividad de la N-acetilbeta-glucosaminidasa intraluminal y en la permeabilidad,
lo que indica dao de la mucosa (82) y contraccin del
intestino delgado (98). En explantes intestinales de conejo incubados in vitro con toxina alfa se observ dao
en el epitelio (47). En cerdos, ovinos y bovinos inyectados por va endovenosa se observ enteritis, escaso dao
del epitelio intestinal, diarrea transitoria, hemlisis
intravascular y dao capilar (78, 79). En ovinos, la toxina
alfa caus daos morfolgicos con alteracin del transporte de agua en el intestino (25).
Estudios recientes asocian a la toxina alfa y a cepas de
C. perfringens tipo A no enterotoxignico con enfermedades humanas diferentes de la gangrena gaseosa (43, 45).
Entre stas se encuentran casos fatales de enteritis
necrtica (45) y el sndrome de muerte sbita del lactante
(47). El hecho de que sean escasos los reportes de enfermedades humanas asociadas a esta toxina puede deberse, al menos en parte, a la alta degradabilidad de la toxina
en el intestino, lo cual dificulta su deteccin. A esto se
suma el hecho de que hasta hace poco, el mtodo ms
usado para la deteccin era la seroneutralizacin en ratn
(66). Con esta tcnica, un resultado falso negativo puede
darse por insuficiente material o material no fresco. Dado
que los antisueros especficos para esta prueba no siempre estn a disposicin en el mercado y que esta toxina
posee baja letalidad en ratones, el diagnstico resulta an
ms dificultoso (66, 123). El empleo de los ELISA de captura para la deteccin de toxinas clostridiales no siempre
resuelve el problema mencionado, ya que la alta sensibilidad de estas tcnicas puede resultar en la obtencin de
falsos positivos (67, 123).
La toxina beta
La toxina beta fue originalmente purificada y parcialmente caracterizada a fines de la dcada de 1970 (92,
93). Trabajos posteriores determinaron que la toxina formaba poros (selectivos para cationes monovalentes) en
bicapas lipdicas y en membranas de clulas sensibles
(104), lo que aporta evidencia de que la toxina podra
funcionar como una neurotoxina y producir constriccin

arterial (94, 95).
Uno de los principales factores de virulencia de C.
perfringens tipos B y C es la toxina beta, que es muy
sensible a la degradacin por tripsina. Los animales recin nacidos o con deficiencias nutricionales son usualmente los ms susceptibles de ser infectados por estos
microorganismos (11). Segn estudios recientes, la toxina beta es el principal factor que contribuye a la letalidad
de C. perfringens tipo B y C (25, 30).
C. perfringens tipo B es responsable de algunas enfermedades de origen intestinal en rumiantes, principalmente ovejas, aunque tambin se han aislado cepas de
este tipo de animales clnicamente sanos (122). En
ovinos, la disentera del cordero y la enteritis hemorrgica
ocurren en animales de menos de 3 semanas de vida, si
bien tambin pueden observarse en animales de mayor
edad. El resultado de la infeccin es una enterotoxemia
acompaada de enteritis, hemorragia profusa y ulceracin
del intestino delgado (110). Tambin existe una asociacin del tipo B con casos de enteritis hemorrgica en
cabras, vacas y potrillos (110).
No se dispone de mucha informacin acerca de la
patognesis de las infecciones causadas por el tipo B, y
no se conocen los efectos individuales o sinrgicos de
las toxinas alfa, beta, psilon u otras toxinas menores
sobre los signos clnicos observados.
C. perfringens tipo C causa enteritis necrtica en corderos, terneros, potrillos y cerdos neonatos, aunque han
sido reportados casos en perros, pollos y llamas. Los
cerdos recin nacidos son comnmente ms afectados
que otros animales. En los animales infectados se observa diarrea y disentera, con materia fecal sanguinolenta, y muerte. Esta bacteria tambin produce
enterocolitis necrtica en humanos, una enfermedad potencialmente letal (46, 57). Los primeros informes de esta
enfermedad surgieron a fines de la Segunda Guerra
Mundial durante un brote que afect en Alemania a personas mal nutridas. El origen de la contaminacin fue
atribuido a carne de conejo enlatada. La enfermedad fue
nombrada darmbrand (intestinos en llamas). En la literatura ms reciente, los casos ms reconocidos y estudiados de enteritis necrtica provienen de Papa-Nueva
Guinea, donde la enfermedad es conocida como pigbel.
La ingesta de carne de cerdo obtenida en condiciones
de higiene deficientes y cocida insuficientemente, consumida junto con la batata, dio origen al alto nmero de
casos registrados. Esta costumbre tribal de ocasiones
festivas, aportaba suficiente cantidad de bacterias con la
carne y esto, sumado a los inhibidores de la tripsina aportados por la batata, evitaban la degradacin de la toxina
beta en el intestino del husped. La introduccin de una
vacuna basada en toxoide beta redujo significativamente
la incidencia de la enfermedad en esa zona geogrfica.
Adems de estos pocos reportes relacionados con brotes, se han descrito varios casos espordicos de enteri-
tis necrtica que afectaron principalmente a personas con

problemas pancreticos o intestinales (89). Una dieta
pobre en protenas y problemas en la motilidad intestinal
pueden favorecer el desarrollo de la enfermedad. El principal sntoma es dolor abdominal (46), tambin pueden
aparecer vmitos y diarrea sanguinolenta. Los casos ms
complicados pueden desarrollar obstruccin intestinal por
necrosis del intestino delgado. La muerte puede ocurrir
tambin por toxemia, la que en algunos casos se produce muy rpidamente (46).
La toxina psilon
La toxina psilon es la toxina clostridial ms potente
luego de las neurotoxinas tetnica y botulnica (85, 86).
Es producida y secretada como una prototoxina con un
peso molecular de 32,7 kDa, que al sufrir un clivaje
proteoltico especfico adquiere su mxima actividad biolgica (96). Esta activacin puede ser catalizada por
proteasas como la tripsina, la quimotripsina y una zincmetaloproteasa producida por C. perfringens (70) en el
tracto gastrointestinal (85). El gen de esta toxina (etx)
est codificado en un elemento extracromosmico, un
plsmido de gran tamao (51).
La toxina psilon es txica para clulas de la lnea
Madin-Darby canine kidney (MDCK) y, en menor medida, para la lnea G-402 de clulas de leiomioblastoma
humano (84, 106). Diversos trabajos realizados con clulas MDCK muestran que la toxina psilon induce hinchazn, formacin de burbujas, fragmentacin y lisis celular. Adems, se demostr que en las clulas MDCK la
toxina psilon forma un complejo en la membrana
citoplasmtica, aunque su ingreso a la clula no es necesario para ejercer toxicidad (87, 88). En estas clulas,
la accin citotxica se correlaciona con la formacin de
un gran complejo de membrana que causa una rpida
prdida de potasio con entrada de sodio y cloruro, mientras que la concentracin de calcio se incrementa; esto
da como resultado una prdida de la viabilidad celular
(88). La toxina psilon se une a microdominios de membrana resistentes a los detergentes (lipid raft ) y se
oligomeriza y forma un poro en membranas celulares tanto sinaptosomales como de clulas MDCK (73, 87). El
poro formado en la membrana celular permitira el pasaje de solutos hidroflicos de hasta una masa molecular
de 1 kDa. Este canal estara constituido por una
heptamerizacin de la toxina que, sugestivamente, coincide con otras toxinas citolticas como la toxina alfa de
Staphylococcus aureus (38), la aerolisina de Aeromonas
hydrophila (14, 87) y la toxina citoltica ClyA de Escherichia
coli (59, 125). La estructura cristalizada de la toxina muestra que forma un poro barril , el cual exhibe alguna similitud estructural con la aerolisina, otra toxina formadora
de poro (19).
Una baja concentracin de toxina psilon puede detener la divisin celular sin matar inmediatamente a las
clulas, y causar un descenso en su nmero y un signifi-
255
cativo aumento de su volumen medio (10). La unin especfica a este tipo de clulas se debe probablemente a
la presencia de un receptor, el que sera necesario para
la actividad biolgica de la toxina (87). En forma reciente
se demostr que la lnea de clulas epiteliales de tbulo
colector distal de rin de ratn mpkCCDcl4 es tambin
sensible a la accin de la toxina psilon (18). Estas clulas conservan ciertas caractersticas del transporte inico
de las clulas epiteliales, por lo que han sido tiles para
caracterizar los efectos de la toxina psilon en la
homeostasis celular. En estas clulas, la toxina psilon
se une principalmente a las membranas del lado apical
de las clulas y oligomeriza sobre esta superficie, sin difundir hacia el interior de la clula. Sobre la superficie
apical existen proteasas que activaran a la prototoxina
psilon.
Aunque se desconoce el receptor de esta toxina, se
sabe que es una protena de superficie anclada por
glucosilfosfatidilinositol. La toxina psilon produjo una
cada de la resistencia transepitelial y del potencial elctrico en estas clulas crecidas en monocapa. Esto estimul temporariamente la absorcin de sodio e indujo una
corriente inica entrante con el consecuente aumento de
la concentracin de calcio intracelular (24). Asimismo, la
toxina ocasion una rpida prdida del ATP celular y
activ a la protena quinasa activada por AMP (que sensa
el estado metablico). La toxina tambin produjo
permeabilizacin mitocondrial y translocacin nuclear del
factor inductor de apoptosis, un efector de muerte celular
independiente de caspasas. Adems, en las clulas
mpkCCDcl4 la toxina psilon indujo una necrosis caracterizada por la reduccin en el tamao del ncleo, pero
sin fragmentacin del ADN. Llamativamente, aunque la
eliminacin de los dominios ricos en colesterol de la membrana celular evit la oligomerizacin de la toxina y redujo el influjo de sodio y calcio, no impidi la prdida del
ATP celular ni la muerte celular. Estos hallazgos indican
que la toxina psilon produce una rpida necrosis en estas
clulas, y que la prdida de ATP interviene en el proceso
de muerte celular sin estar correlacionada con la
permeabilizacin de la membrana celular y la difusin
inica causada por la toxina (24).
La principal actividad biolgica de la toxina psilon es
la generacin de edema (11). Esta toxina es letal y
dermonecrtica, aunque no es hemoltica (66). Se ha
descrito que eleva la presin sangunea, incrementa la
permeabilidad vascular e intestinal y causa dao renal y
contraccin del leon en ratas (13, 35, 74, 76, 97). Es
capaz de pasar la barrera hematoenceflica y acumularse en el cerebro (85). Una propiedad bsica de la toxina
psilon es que incrementa la permeabilidad vascular por
la alteracin de las uniones estrechas entre las clulas
endoteliales (1); esto produce dao y edema en diversos
rganos, como pulmn, corazn, rin y cerebro (11).
En el cerebro, el dao neuronal y los desrdenes neurolgicos estn asociados con los edemas perivasculares
256
(por el aumento de la permeabilidad vascular) y con la

posible interaccin con las neuronas del hipocampo, que
lleva a una excesiva liberacin de glutamato (71, 72).
En ovejas y ratones se observ un aumento en la absorcin de inmunoglobulinas anti-toxina diftrica cuando
fueron coadministradas con la toxina psilon, lo que llev a suponer que esta toxina incrementara la permeabilidad del intestino delgado y facilitara su propia absorcin y pasaje a la circulacin general (6, 13). Se ha informado que la toxina psilon altera la permeabilidad
paracelular del epitelio del intestino delgado (6, 13). Esto
podra explicar la mayor absorcin intestinal de toxina
psilon y la acumulacin de fluido en el intestino que se
observ en animales de experimentacin (24, 120, 121),
as como en casos clnicos (28). Sin embargo, no existen
estudios experimentales sobre la capacidad de absorcin de la toxina en el intestino delgado y grueso de ovinos
y caprinos, as como tampoco existe informacin comparativa sobre las diferencias de permeabilidad paracelular
en el tracto intestinal. Tampoco se cuenta con estudios
funcionales precisos acerca de la actividad de la toxina
psilon sobre epitelios intestinales, y considerando que
en condiciones patolgicas C. perfringens puede ser aislado de diferentes secciones del tracto intestinal (66), no
se puede descartar que la toxina psilon tenga actividad
sobre este tejido.
La toxina iota
La toxina iota de C. perfringens tipo E es un miembro
de la familia de las toxinas binarias, como la toxina iota
de C. spiroforme, la toxina CDT de C. difficile, la toxina
C2 de C. botulinum y la toxina ntrax de B. anthracis
(16). Estas toxinas binarias estn formadas por un pptido
de unin (Ib) de unos 81 kDa y un pptido enzimtico
(ADP-ribosiltransferasa) de 45 kDa (Ia). El primero es
necesario para la internalizacin del segundo (62). La
toxina iota requiere de la remocin proteoltica de un fragmento propeptdico, el cual permite que la unidad Ib se
inserte en la membrana e interacte con la porcin Ia
(39). Al insertarse en la membrana celular, el segmento
Ib forma un poro heptamrico que permite la salida de
los iones K+ y Na+, adems de la entrada de la porcin Ia
a la clula. Una vez dentro de la clula, Ia ribosila la Gactina y termina por despolimerizar los filamentos de
actina, con la consiguiente destruccin del citoesqueleto
celular (39). La activacin de la toxina iota ocurre, generalmente, por efecto de las proteasas presentes en el
tracto intestinal (110).
La toxina iota es dermonecrtica, citotxica,
enterotxica e induce dao histopatolgico intestinal (16).
Sin embargo, durante mucho tiempo se dud de su efecto patgeno (110, 128); ste se confirm hace alrededor
de treinta aos (8, 16, 84). En 1978, Patton et al. (84)
informaron un brote de enterotoxemia en una colonia de

conejos. Los animales afectados presentaban enteritis
necrtica y hemorrgica aguda. Se aisl la toxina iota del
contenido intestinal de los conejos afectados; esta toxina produjo lesiones agudas en el ciego de conejos sanos inoculados, salvo en aquellos a los que se los protegi con un antisuero especfico contra la toxina (84). Aunque existen informes de enterotoxemia asociada a esta
bacteria en otras especies (112), slo se la ha podido
reproducir en conejos.
Estudios recientes han dado a las toxinas binarias, y
en especial a la toxina iota, mayor importancia, dado que
podran utilizarse como transportadoras e internalizadoras
de drogas en clulas procariotas (5).
Dos nuevas toxinas
A mediados de 1980, de una cepa de tipo C se purific y caracteriz una protena txica letal (enterotxica y
necrotizante) de 28 kDa, identificada inicialmente como
toxina beta. En 1997, Gibert et al. (36) aislaron una toxina de 28 kDa del contenido intestinal de un cerdo con
enteritis necrotizante. Esta toxina era citotxica para clulas CHO y, adems, provocaba enteritis hemorrgica
al ser inoculada en asas ligadas de cobayo (36). El gen
de esta protena de 28 kDa fue secuenciado, y se pudo
establecer que su producto no era la toxina beta, sino
una protena diferente, a la que se llam beta-2 (36).
El gen de la toxina beta-2 puede ser encontrado en
todos los tipos de C. perfringens y se halla codificado en
un plsmido en la mayora de las cepas que lo contienen.
Esta toxina ha sido asociada con diversas enfermedades intestinales en animales (36, 37, 42, 60), pero tambin se ha aislado de pacientes humanos con enfermedades gastrointestinales (29, 30, 60). Aunque en los ltimos aos ha aumentado considerablemente la cantidad
de publicaciones sobre la toxina beta-2 y su asociacin
con enfermedades entricas, la mayora de los trabajos
slo informan la presencia de bacterias con el gen
codificante de la toxina, de modo que la asociacin entre
la enfermedad y la toxina aparece como una cuestin
netamente especulativa (27, 113).
En febrero de 2008, Keyburn et al. (53) comunicaron
la existencia de una nueva toxina clostridial responsable
de la enteritis necrotizante en pollos: la NetB. El gen de
dicha toxina fue caracterizado a partir de cepas de C.
perfringens tipo A, aisladas del contenido intestinal de
aves con esta enfermedad. La NetB sera una toxina de
tipo formadora de poro. Estos autores reprodujeron la
infeccin en aves libres de patgenos, a las que se les
inocul la toxina recombinante purificada o cepas que
portaban el gen de la toxina o que carecan de ste. Slo
las aves que recibieron la toxina purificada o la cepa con
la toxina desarrollaron enteritis necrotizante (53).
CONCLUSIONES
C. perfringens es un microorganismo que reviste suma
importancia en medicina humana y veterinaria ya que,
pese a ser parte de la microbiota intestinal, es potencialmente patgeno y letal, tanto para animales como para
el hombre. Tanto es as que el uso de algunas de sus
toxinas como potenciales armas bioterroristas ha generado cierta preocupacin en algunos pases. Sin embargo y a modo de contracara, otras de sus toxinas podran
ser usadas en el tratamiento de enfermedades, como
transportadoras e internalizadoras de drogas en clulas
procariotas (toxina iota) o en ciertas terapias antitumorales
(enterotoxina).
En el mbito de la medicina veterinaria, C. perfringens
genera importantes prdidas en la produccin ganadera.
En el caso de la produccin avcola, por ejemplo, el reciente descubrimiento de una toxina (NetB), presente en
cepas de C. perfringes tipo A aisladas de aves con enteritis necrtica, abre una nueva lnea de investigacin, relevante tanto para el conocimiento de la patogenia de estos
microorganismos como para el desarrollo de nuevas vacunas. Esta toxina, o tal vez otras tambin, podran estar
involucradas en la enteritis necrtica por C. perfringens
tipo A observada en otras especies animales.
Dado el renovado inters que existe en el estudio de
C. perfringens y sus toxinas, es posible que en los prximos aos tengamos un perfil ms completo de la biologa de esta bacteria como comensal y como patgeno.
Esta informacin permitir dilucidar su papel en enfermedades entricas en las que su participacin an es
incierta.
Agradecimientos: Agradecemos la generosa ayuda de Yanil
R. Parma. M.E. Fernndez-Miyakawa es investigador del
CONICET.
BIBLIOGRAFA
1. Adamson RH, Ly JC, Fernndez-Miyakawa M, Ochi S,
Sakurai J, Uzal F, et al. Clostridium perfringens epsilontoxin increases permeability of single perfused microvessels
of rat mesentery. Infect Immun 2005; 73: 4879-87.
2. Al-Sheikhly F, Truscott RB. The pathology of necrotic enteritis of chickens following infusion of crude toxins of
Clostridium perfringens into the duodenum. Avian Dis 1977;
21: 241-55.
3. Baba E, Fuller AL, Gilbert JM, Thayer SG, McDougald LR.
Effects of Eimeria brunetti infection and dietary zinc on experimental induction of necrotic enteritis in broiled chickens.
Avian Dis 1992; 36: 59-62.
4. Barbara AJ, Trinh HT, Glock RD, Songer JG. Necrotic enteritis-producing strains of Clostridium perfringens displace
non-necrotic enteritis strains from the gut of chicks. Vet
Microbiol 2008; 126: 377-82.
5. Barth H, Stiles BG. Binary actin-ADP-ribosylating toxins and
their use as molecular Trojan horses for drug delivery into
eukaryotic cells. Curr Med Chem 2008; 15: 459-69.
6. Batty I, Bullen JJ. The effect of Clostridium welchii type D
culture filtrates on the permeability of the mouse intestine.
J Pathol Bacteriol 1956; 71: 311-23.
257
7. Billington SJ, Wieckowski EU, Sarker MR, Bueschel D, Songer

JG, McClane BA. Clostridium perfringens type E animal enteritis isolates with highly conserved, silent enterotoxin gene
sequences. Infect Immun 1998; 66: 4531-6.
8. Borriello SP, Carman RJ. Association of iota-like toxin and
Clostridium spiroforme with both spontaneous and antibioticassociated diarrhea and colitis in rabbits. J Clin Microbiol
1983; 17: 414-8.
9. Borriello SP, Larson HE, Welch AR, Barclay F, Stringer MF,
Bartholomew BA. Enterotoxigenic Clostridium perfringens:
a possible cause of antibiotic-associated diarrhoea. Lancet
1984; 8372: 305-7.
10. Borrmann E, Gnther H, Khler H. Effect of Clostridium
perfringens epsilon toxin on MDCK cells. FEMS Immunol
Med Microbiol 2001; 31: 85-92.
11. Brown CC, Baker DC, Barker IK. The alimentary system.
In: MG Maxie, editor. Jubb, Kennedy and Palmers pathology
of domestic animals. Vol. 2, 5 ed.; Elsevier, 2007, p. 771.
12. Brynestad S, Synstad B, Granum PE. The Clostridium
perfringens enterotoxin gene is on a transposable element
in type A human food poisoning strains. Microbiology 1997;
143: 2109-15.
13. Bullen JJ, Batty I. Experimental enterotoxaemia of sheep:
the effect of the permeability of the intestine and the
stimulation of antitoxin production in immune animals. J
Pathol Bacteriol 1957; 73: 511-8.
14. Cabiaux V, Buckley JT, Wattiez R, Ruysschaert JM, Parker
MW, van der Goot FG. Conformational changes in aerolysin
during the transition from the water-soluble protoxin to the
membrane channel. Biochemistry 1997; 36: 15224-32.
15. Canard B, Cole ST. Genome organization of the anaerobic
pathogen Clostridium perfringens. Proc Natl Acad Sci USA
1989; 86: 6676-80.
16. Carman RJ, Perelle S, Popoff MR. Binary toxins from
Clostridium spiroforme and Clostridium perfringens, In: Rood
JI, McClane BA, Songer JG, Titball RW, editors. The
clostridia: molecular biology and pathogenesis. London, UK,
Academic Press, 1997, p. 359-67.
17. Chakrabarti G, Zhou X, McClane BA. Death pathways
activated in CaCo-2 cells by Clostridium perfringens
enterotoxin. Infect Immun 2003; 71: 4260-70.
18. Chassin C, Bens M, de Barry J, Courjaret R, Bossu JL,
Cluzeaud F, et al . Pore-forming epsilon toxin causes
membrane permeabilization and rapid ATP depletionmediated cell death in renal collecting duct cells. Am J
Physiol Renal Physiol 2007; 293: 927-37.
19. Cole AR, Gibert M, Popoff M, Moss DS, Titball RW, Basak
AK. Clostridium perfringens epsilon-toxin shows structural
similarity to the pore-forming toxin aerolysin. Nat Struct Mol
Biol 2004; 11: 797-8.
20. Collie RE, McClane BA. Evidence that the enterotoxin gene
can be episomal in Clostridium perfringens isolates
associated with non-food-borne human gastrointestinal
diseases. J Clin Microbiol 1998; 36: 30-6.
21. Collins JE, Bergeland ME, Bouley D, Ducommun AL, Francis
DH, Yeske P. Diarrhea associated with Clostridium
perfringens type A enterotoxin in neonatal pigs. J Vet Diagn
Invest 1989; 1: 351-3.
22. Cornillot E, Saint-Joanis B, Daube G, Katayama S, Granum
PE, Canard B, et al . The enterotoxin gene ( cpe ) of
Clostridium perfringens can be chromosomal or plasmidborne. Mol Microbiol 1995; 15: 639-47.
23. Czeczulin JR, Hanna PC, McClane BA. Cloning, nucleotide
sequencing, and expression of the Clostridium perfringens
enterotoxin gene in Escherichia coli. Infect Immun 1993;
61: 3429-39.
24. Fernndez Miyakawa ME, Ibarra CA, Uzal FA. In vitro effects
of Clostridium perfringens type D epsilon toxin on water
and ion transport in ovine and caprine intestine. Anaerobe
2003; 9: 145-9.
258
25. Fernndez Miyakawa ME, Uzal FA. Morphologic and

physiologic changes induced by Clostridium perfringens type
A alpha toxin in the intestine of sheep. Am J Vet Res 2005;
66: 251-5.
26. Fernndez-Miyakawa ME, Marcellino R, Uzal FA.
Clostridium perfringens type A toxin production in 3
commonly used culture media. J Vet Diagn Invest. 2007;
19: 184-6.
27. Ferrarezi MC, Cardoso TC, Dutra IS. Genotyping of
Clostridium perfringens isolated from calves with neonatal
diarrhea. Anaerobe 2008; 14: 328-31.
28. Finnie JW. Neurological disorders produced by Clostridium
perfringens type D epsilon toxin. Anaerobe 2004; 10: 145-50.
29. Fisher DJ, Miyamoto K, Harrison B, Akimoto S, Sarker MR,
McClane BA. Association of beta2 toxin production with
Clostridium perfringens type A human gastrointestinal
disease isolates carrying a plasmid enterotoxin gene. Mol
Microbiol 2005; 56: 747-62.
30. Fisher DJ, Fernndez-Miyakawa ME, Sayeed S, Poon R,
Adams V, Rood JI, et al. Dissecting the contributions of
Clostridium perfringens type C toxins to lethality in the
mouse intravenous injection model. Infect Immun 2006; 74:
5200-10.
31. Fujii Y, Nomura S, Oshita Y, Sakurai J. Excitatory effect of
Clostridium perfringens alpha toxin on the rat isolated aorta. Br J Pharmacol 1986; 88: 531-9.
32. Fujii Y, Sakurai J. Contraction of the rat isolated aorta caused
by Clostridium perfringens alpha toxin (phospholipase C):
evidence for the involvement of arachidonic acid metabolism.
Br J Pharmacol 1989; 97: 119-24.
33. Fujita K, Katahira J, Horiguchi Y, Sonoda N, Furuse M,
Tsukita S. Clostridium perfringens enterotoxin binds to the
second extracellular loop of claudin-3, a tight junction integral membrane protein. FEBS Lett 2000; 476: 258-61.
34. Fukata T, Hadate Y, Baba E, Arakawa A. Influence of bacteria on Clostridium perfringens infections in young chickens.
Avian Dis 1991; 35: 224-7.
35. Gardner DE. Pathology of Clostridium welchii type D
enterotoxaemia. II. Structural and ultrastructural alterations
in the tissues of lambs and mice. J Comp Pathol 1973; 83:
509-24
36. Gibert, M.; Jolivet-Renaud, C.; Popoff, M.R. Beta-2 toxin, a
novel toxin produced by Clostridium perfringens. Gene 1997;
203: 65-73.
37. Gkiourtzidis K, Frey J, Bourtzi-Hatzopoulou E, Iliadis N,
Sarris K. PCR detection and prevalence of alpha-, beta-,
beta 2-, epsilon-, iota- and enterotoxin genes in Clostridium
perfringens isolated from lambs with clostridial dysentery.
Vet Microbiol 2001; 82: 39-43.
38. Gouaux E. Alpha-hemolysin from Staphylococcus aureus:
an archetype of beta-barrel, channel-forming toxins. J Struct
Biol 1998; 121: 110-22.
39. Hale ML, Marvaud JC, Popoff MR, Stiles BG. Detergentresistant membrane microdomains facilitate Ib oligomer
formation and biological activity of Clostridium perfringens
Iota-toxin. Infect Immun 2004, 72, 4: 2186-93.
40. Hardy SP, Denmead M, Parekh N, Granum PE. Cationic
currents induced by Clostridium perfringens type A
enterotoxin in human intestinal CaCO-2 cells. J Med
Microbiol 1999; 48: 235-43.
41. Hauschild AH, Hilsheimer R. Purification and characteristics
of the enterotoxin of Clostridium perfringens type A. Can J
Microbiol 1971; 17: 1425-33.
42. Herholz C, Miserez R, Nicolet J, Frey J, Popoff M, Gibert
M, et al . Prevalence of beta2-toxigenic Clostridium
perfringens in horses with intestinal disorders. J Clin
Microbiol 1999; 37: 358-61.
43. Holdsworth RJ, Parratt D. The potential role of Clostridium
perfringens alpha toxin in the pathogenesis of acute
pancreatitis. J Clin Pathol 1996; 49: 500-3.
44. Hughes ML, Poon R, Adams V, Sayeed S, Saputo J, Uzal

FA, et al. Epsilon-toxin plasmids of Clostridium perfringens
type D are conjugative. J Bacteriol 2007; 189: 7531-8.
45. Iwanaka T, Kawashima H, Kishimoto H, Kakinuma M, Arai
K, Sakurai J, et al . Enteritis necroticans caused by
Clostridium perfringens type A. J Pediatr 2004; 144: 410-4.
46. Johnson S, Gerding DN. Enterotoxemic infections. In: Rood
JI, MCClane BA, Songer JG, editors. The Clostridia:
Molecular Biology and Pathogenesis. London, UK,
Academic Press, 1997, p. 117-40.
47. Kamaras J, Murrell WG. Intestinal epithelial damage in SIDS
babies and its similarity to that caused by bacterial toxins in
the rabbit. Pathology 2001; 33: 197-203
48. Kanoe M, Inoue S, Abe T, Anzai T, Kamada M, Imagawa
H, et al. Isolation of Clostridium perfringens from foals. Microbios 1990; 64: 153-8.
49. Katahira J, Inoue N, Horiguchi Y, Matsuda M, Sugimoto N.
Molecular cloning and functional characterization of the
receptor for Clostridium perfringens enterotoxin. J Cell Biol
1997a. 24; 136: 1239-47.
50. Katahira J, Sugiyama H, Inoue N, Horiguchi Y, Matsuda M,
Sugimoto N. Clostridium perfringens enterotoxin utilizes two
structurally related membrane proteins as functional
receptors in vivo. J Biol Chem 1997b; 272: 26652-8.
51. Katayama S, Dupuy B, Daube G, China B, Cole ST.
Genome mapping of Clostridium perfringens strains with ICeuI shows many virulence genes to be plasmid-borne.
Mol Gen Genet 1996; 251: 720-6.
52. Keyburn AL, Sheedy SA, Ford ME, Williamson MM, Awad
MM, Rood JI, et al. Alpha-toxin of Clostridium perfringens
is not an essential virulence factor in necrotic enteritis in
chickens. Infect Immun 2006; 74: 6496-500.
53. Keyburn AL, Boyce JD, Vaz P, Bannam TL, Ford ME, Parker
D, et al. NetB, a new toxin that is associated with avian
necrotic enteritis caused by Clostridium perfringens. PLoS
Pathog 2008; 4: e26, 1-11.
54. Kokai-Kun JF, McClane BA. Evidence that a region(s) of
the Clostridium perfringens enterotoxin molecule remains
exposed on the external surface of the mammalian plasma
membrane when the toxin is sequestered in small or large
complexes. Infect Immun 1996; 64: 1020-5.
55. Kominsky SL, Tyler B, Sosnowski J, Brady K, Doucet M,
Nell D, et al. Clostridium perfringens enterotoxin as a novel-targeted therapeutic for brain metastasis. Cancer Res
2007; 67: 7977-82.
56. Kruth SA, Prescott JF, Welch MK, Brodsky MH. Nosocomial
diarrhea associated with enterotoxigenic Clostridium
perfringens infection in dogs. J Am Vet Med Assoc 1989;
195: 331-4.
57. Lawrence G, Walker PD. Pathogenesis of enteritis
necroticans in Papua New Guinea. Lancet 1976; 1: 125-6.
58. Long JR, Truscott RB. Necrotic enteritis in broiler chickens.
III. Reproduction of the disease. Can J Comp Med 1976;
40: 53-9.
59. Ludwig A, Bauer S, Benz R, Bergmann B, Goebel W.
Analysis of the SlyA-controlled expression, subcellular
localization and pore-forming activity of a 34 kDa haemolysin
(ClyA) from Escherichia coli K-12. Mol Microbiol 1999; 31:
557-67.
60. Manteca C, Daube G, Jauniaux T, Linden A, Pirson V,
Detilleux J, et al. A role for the Clostridium perfringens beta2
toxin in bovine enterotoxaemia? Vet Microbiol 2002; 86:
191-202.
61. Mantis NJ. Vaccines against the category B toxins:
Staphylococcal enterotoxin B, epsilon toxin and ricin. Adv
Drug Deliv Rev 2005; 57: 1424-39.
62. Marvaud JC, Stiles BG, Chenal A, Gillet D, Gibert M, Smith
LA, et al. Clostridium perfringens iota toxin. Mapping of the
Ia domain involved in docking with Ib and cellular
internalization. J Biol Chem 2002; 277: 43659-66.
63. Matsuda T, Okada Y, Inagi E, Tanabe Y, Shimizu Y,

Nagashima K, et al . Enteritis necroticans pigbel in a
Japanese diabetic adult. Path Int 2007; 57: 6226.
64. Matsushita C, Matsushita O, Katayama S, Minami J, Takai
K, Okabe A. An upstream activating sequence containing
curved DNA involved in activation of the Clostridium
perfringens plc promoter. Microbiology 1996; 142: 2561-6.
65. McClane BA, McDonel JL. Protective effects of osmotic
stabilizers on morphological and permeability alterations
induced in Vero cells by Clostridium perfringens enterotoxin.
Biochim Biophys Acta 1981; 641: 401-9
66. McClane BA, Uzal FA, Miyakawa MF, Lyerly D, Wilkins T.
The Enterotoxic Clostridia. In: Dworkin M, Falkow S,
Rosenburg E, Schleifer KH, Stackebrandt E, editors. The
Prokaryotes, Vol. 4. New York, Springer-Verlag, 2006, p.
698-752.
67. McCourt MT, Finlay DA, Laird C, Smyth JA, Bell C, Ball HJ.
Sandwich ELISA detection of Clostridium perfringens cells
and alpha-toxin from field cases of necrotic enteritis of
poultry. Vet Microbiol 2005; 106: 259-64.
68. McDonel JL, Duncan CL. Histopathological effect of
Clostridium perfringens enterotoxin in the rabbit ileum. Infect
Immun 1975; 12: 1214-8.
69. Michl P, Gress TM. Bacteria and bacterial toxins as
therapeutic agents for solid tumors. Curr Cancer Drug
Targets 2004; 4: 689-702.
70. Minami J, Katayama S, Matsushita O, Matsushita C, Okabe
A. Lambda-toxin of Clostridium perfringens activates the
precursor of epsilon-toxin by releasing its N- and C-terminal peptides. Microbiol Immunol 1997; 41: 527-35.
71. Miyamoto O, Minami J, Toyoshima T, Nakamura T, Masada T, Nagao S, et al. Neurotoxicity of Clostridium perfringens
epsilon-toxin for the rat hippocampus via the glutamatergic
system. Infect Immun 1998; 66: 2501-8.
72. Miyamoto O, Sumitani K, Nakamura T, Yamagami S, Miyata
S, Itano T, et al. Clostridium perfringens epsilon toxin causes excessive release of glutamate in the mouse
hippocampus. FEMS Microbiol Lett 2000; 189: 109-13.
73. Miyata S, Matsushita O, Minami J, Katayama S, Shimamoto
S, Okabe A. Cleavage of a C-terminal peptide is essential
for heptamerization of Clostridium perfringens epsilon-toxin
in the synaptosomal membrane. J Biol Chem 2001; 276:
13778-83.
74. Morgan KT, Kelly BG, Buxton D Vascular leakage produced
in the brains of mice by Clostridium welchii type D toxin. J
Comp Pathol 1975; 85: 461-6
75. Nabuurs MJ, Haagsma J, Van de Molen EJ, Van der Heijden
PJ. Diarrhea in one to three week-old piglets associated
with Clostridium perfringens type A. Ann Rech Vet 1983;
14: 408-11.
76. Nagahama M, Iida H, Sakurai J. Effect of Clostridium
perfringens epsilon toxin on rat isolated aorta. Microbiol
Immunol 1993; 37: 447-50.
77. Nagahama M, Nakayama T, Michiue K, Sakurai J. Sitespecific mutagenesis of Clostridium perfringens alpha-toxin:
replacement of Asp-56, Asp-130, or Glu-152 causes loss
of enzymatic and hemolytic activities. Infect Immun 1997;
65: 3489-92.
78. Niilo L. Mechanism of Action of the enteropathogenic factor of Clostridium perfringens type A. Infect Immun 1971;
3: 100-6.
79. Niilo L. Fluid secretory response of bovine Thiry jejunal
fistula to enterotoxin of Clostridium perfringens . Infect
Immun 1973; 7: 1-4.
80. Niilo L. Enterotoxigenic Clostridium perfringens type A
isolated from intestinal contents of cattle, sheep and
chickens. Can J Comp Med 1978; 42: 357-63.
81. Niilo L. Clostridium perfringens in animal disease: a review
of current knowledge. Can Vet J 1980; 21: 141-8.
259
82. Otamiri T. Phospholipase C-mediated intestinal mucosal

damage is ameliorated by quinacrine. Food Chem Toxicol
1989; 27: 399-402.
83. Parsons JA, Bannam TL, Devenish RJ, Rood JI. TcpA, an
FtsK/SpoIIIE homolog, is essential for transfer of the
conjugative plasmid pCW3 in Clostridium perfringens. J
Bacteriol 2007; 189: 7782-90.
84. Patton NM, Holmes HT, Riggs RJ, Cheeke PR.
Enterotoxemia in rabbits. Lab Anim Sci 1978; 28: 536-40.
85. Payne DW, Williamson ED, Havard H, Modi N, Brown J.
Evaluation of a new cytotoxicity assay for Clostridium
perfringens type D epsilon toxin. FEMS Microbiol Lett 1994;
116: 161-7.
86. Payne D, Williamson ED, Titball RW. The Clostridium
perfringens epsilon-toxin. Rev Med Microbiol 1997; 8: 28-30.
87. Petit L, Gibert M, Gillet D, Laurent-Winter C, Boquet P,
Popoff MR. Clostridium perfringens epsilon-toxin acts on
MDCK cells by forming a large membrane complex. J
Bacteriol 1997; 179: 6480-7.
88. Petit L, Maier E, Gibert M, Popoff MR, Benz R. Clostridium
perfringens epsilon toxin induces a rapid change of cell
membrane permeability to ions and forms channels in artificial lipid bilayers. J Biol Chem 2001; 276: 15736-40.
89. Petrillo TM, Beck-Sagu CM, Songer JG, Abramowsky C,
Fortenberry JD, Meacham L, et al. Enteritis necroticans
(pigbel) in a diabetic child. N Engl J Med 2000; 342: 1250-3.
90. Roeder BL, Chengappa MM, Nagaraja TG, Avery TB,
Kennedy GA. Experimental induction of abdominal tympany,
abomasitis, and abomasal ulceration by intraruminal
inoculation of Clostridium perfringens type A in neonatal
calves. Am J Vet Res 1988; 49: 201-7.
91. Rood JI, Cole ST. Molecular genetics and pathogenesis of
Clostridium perfringens. Microbiol Rev 1991; 55: 621-48.
92. Rotz LD, Khan AS, Lillibridge SR, Ostroff SM, Hughes JM.
Public health assessment of potential biological terrorism
agents. Emerg Infect Dis 2002; 8: 225-30. Sakurai J, Duncan
CL. Purification of beta-toxin from Clostridium perfringens
type C. Infect Immun 1977; 18: 741-5.
93. Sakurai J, Duncan CL. Some properties of beta-toxin
produced by Clostridium perfringens type C. Infect Immun
1978; 21: 678-80.
94. Sakurai J, Fujii Y, Matsuura M, Endo K. Pharmacological
effect of beta toxin of Clostridium perfringens type C on
rats. Microbiol Immunol 1981; 25: 423-32.
95. Sakurai J, Fujii Y, Dezaki K, Endo K. Effect of Clostridium
perfringens beta toxin on blood pressure of rats. Microbiol
Immunol 1984; 28: 23-31.
96. Sakurai J, Nagahama M. Amino groups in Clostridium
perfringens epsilon prototoxin and epsilon toxin. Microb
Pathog 1986; 1: 417-23.
97. Sakurai J, Nagahama M, Takahashi T. Contraction induced
by Clostridium perfringens epsilon toxin in the isolated rat
ileum. FEMS Microbiol Lett 1989; 49: 269-72.
98. Sakurai J, Fujii Y, Shirotani M. Contraction induced by
Clostridium perfringens alpha toxin in the isolated rat ileum.
Toxicon 1990; 28: 411-8.
99. Sakurai J, Nagahama M, Oda M. Clostridium perfringens
alpha-toxin: characterization and mode of action. J Biochem
2004; 136: 569-74.
100. Santin AD, Can S, Bellone S, Palmieri M, Siegel ER,
Thomas M, et al. Treatment of chemotherapy-resistant
human ovarian cancer xenografts in C.B-17/SCID mice by
intraperitoneal administration of Clostridium perfringens
enterotoxin. Cancer Res 2005; 65: 4334-42.
101. Santin AD, Bellone S, Marizzoni M, Palmieri M, Siegel ER,
McKenney JK, et al. Overexpression of claudin-3 and claudin4 receptors in uterine serous papillary carcinoma: novel
targets for a type-specific therapy using Clostridium
perfringens enterotoxin (CPE). Cancer 2007; 109: 1312-22.
260
102. Sarker MR, Carman RJ, McClane BA. Inactivation of the

gene (cpe) encoding Clostridium perfringens enterotoxin
eliminates the ability of two cpe-positive C. perfringens type
A human gastrointestinal disease isolates to affect rabbit
ileal loops. Mol Microbiol 1999; 33: 946-58. Erratum in: Mol
Microbiol 2000; 35: 249.
103. Satija KC, Narayan KG. Passive bacteriocin typing of strains
of Clostridium perfringens type A causing food poisoning
for epidemiologic studies. J Infect Dis 1980; 142: 899-902.
104. Shatursky O, Bayles R, Rogers M, Jost BH, Songer JG,
Tweten RK. Clostridium perfringens beta-toxin forms
potential-dependent, cation-selective channels in lipid
bilayers. Infect Immun 2000; 68: 5546-51.
105. Sherman S, Klein E, McClane BA. Clostridium perfringens
type A enterotoxin induces tissue damage and fluid
accumulation in rabbit ileum. J Diarrhoeal Dis Res 1994;
12: 200-7.
106. Shortt SJ, Titball RW, Lindsay CD. An assessment of the in
vitro toxicology of Clostridium perfringens type D epsilontoxin in human and animal cells. Hum Exp Toxicol 2000;
19: 108-16.
107. Sinclair R, Boone SA, Greenberg D, Keim P, Gerba CP.
Persistence of category A select agents in the environment.
Appl Environ Microbiol 2008; 74: 555-63.
108. Singh U, Mitic LL, Wieckowski EU, Anderson JM, McClane
BA. Comparative biochemical and immunocytochemical
studies reveal differences in the effects of Clostridium
perfringens enterotoxin on polarized CaCo-2 cells versus
Vero cells. J Biol Chem 2001; 276: 33402-12.
109. Smedley JG III, Fisher DG, Sayeed S, Chakrabarti G,
McClane BA. The enteric toxins of Clostridium perfringens.
Rev Physiol Biochem Pharmacol 2004; 152: 183-204.
110. Songer JG. Clostridial enteric diseases of domestic animals.
Clin Microbiol Rev 1996; 9: 2116-34.
111. Songer JG. Bacterial phospholipases and their role in
virulence.Trends Microbiol 1997; 5: 156-61.
112. Songer JG, Miskimmins DW. Clostridium perfringens type
E enteritis in calves: two cases and a brief review of the
literature. Anaerobe. 2004; 10: 239-42.
113. Songer JG, Miskimmins DW. Clostridial abomasitis in
calves: Case report and review of the literature. Anaerobe
2005; 11: 290-4.
114. Stackebrandt E, Sproer C, Rainey FA, Burghardt J, Puker
O, Hippe H. Phylogenetic analysis of the genus
Desulfotomaculum: evidence for the misclassification of
Desulfotomaculum guttoideum and description of
Desulfotomaculum orientis as Desulfosporosinus orientis
gen. nov., comb. nov. Int J Syst Bacteriol 1997; 47: 1134-9.
115. Stark RL, Duncan CL. Purification and biochemical
properties of Clostridium perfringens type A enterotoxin.
Infect Immun 1972; 6: 662-73.
116. Stevens DL, Tweten RK, Awad MM, Rood JI, Bryant AE.
Clostridial gas gangrene: evidence that alpha and theta
toxins differentially modulate the immune response and in-
duce acute tissue necrosis. J Infect Dis 1997; 176: 189-95.

117. Stringer MF. Clostridium perfringens type A food poisoning.
In: Borriello SP, editor. Clostridia in gastrointestinal disease.
Boca Raton, Florida, CRC Press Inc., 1985, p. 117-43.
118. Thompson DR, Parreira VR, Kulkarni RR, Prescott JF. Live
attenuated vaccine-based control of necrotic enteritis of
broiler chickens. Vet Microbiol 2006; 113: 25-34.
119. Titball RW. Bacterial phospholipases C. Microbiol Rev 1993;
57: 347-66.
120. Tironi-Farinati C, Morris WE, Loidl F, Goldstein J, Dunleavy
M, Uzal F, et al. La toxina epsilon de Clostridium perfringens
incrementa la permeabilidad del intestino delgado de roedores. LII Reunin Anual de la Sociedad Argentina de Investigacin Clnica, 2007, Mar del Plata, Argentina.
121. Uzal FA, Kelly WR. Enterotoxaemia in goats. Veter Res
Commun 1996; 20:481-92.
122. Uzal FA, Marcellino RM. Clostridium perfringens in clinically
healthy sheep of Patagonia, Argentina. The 6th Biennial
Congress of the Anaerobe Society of the Americas, 2002,
Park City, USA.
123. Uzal FA, Songer JG. Diagnosis of Clostridium perfringens
intestinal infections in sheep and goats. J Vet Diagn Invest
2008; 20: 253-65.
124. Vance HN. Clostridium perfringens as a pathogen of cattle:
A literature review. Can J Comp Med Vet Sci 1967; 31:
248-50.
125. Wallace AJ, Stillman TJ, Atkins A, Jamieson SJ, Bullough
PA, Green J, et al. E. coli hemolysin E (HlyE, ClyA, SheA):
X-ray crystal structure of the toxin and observation of
membrane pores by electron microscopy. Cell 2000; 100:
265-76.
126. Wen Q, McClane BA. Detection of enterotoxigenic
Clostridium perfringens type A isolates in American retail
foods. Appl Environ Microbiol 2004; 70: 2685-91.
127. Wieckowski EU, Wnek AP, McClane BA. Evidence that an
approximately 50-kDa mammalian plasma membrane
protein with receptor-like properties mediates the
amphiphilicity of specifically bound Clostridium perfringens
enterotoxin. J Biol Chem 1994; 269: 10838-48.
128. Wierup M. Equine intestinal clostridiosis. An acute disease
in horses associated with high intestinal counts of
Clostridium perfringens type A. Acta Vet Scand Suppl 1977;
62: 1-182.
129. Wierup M, DiPietro JA. Bacteriologic examination of equine
fecal flora as a diagnostic tool for equine intestinal
clostridiosis. Am J Vet Res 1981; 42: 2167-9.
130. Wojdat E, Kwiatek K, Zdrojewski H, Krupa L. Gas gangrenecase diagnosis. Przegl Epidemiol 2005; 59: 859-63.
131. Woo PC, Lau SK, Teng JL, Tse H, Yuen KY. Then and
now: use of 16S rDNA gene sequencing for bacterial
identification and discovery of novel bacteria in clinical
microbiology laboratories. Clin Microbiol Infect 2008; 14:
908-34.
Imgenes microbiolgicas
1
ISSN 0325-7541
Revista Argentina de Microbiologa (2009) 41: 261
Cytopathic effect in BHK 21 (C13) cells inoculated with Leptospira interrogans

serovar Pomona isolated from a porcine abortion
BHK 21 (C13) cells inoculated with a wild strain of
Leptospira interrogans serovar Pomona isolated from a
porcine abortion exhibited cythopathic effect (CPE)
consistent in degenerative morphological alterations
whereas no cell changes or alterations were observed in
cells infected with a non-pathogenic Leptospira biflexa
serovar Patoc strain.
BHK 21 (C13) cells were seeded on 24 well cell culture
plates containing MEM-E medium with 10% fetal bovine
serum and no antibiotics; 5 x 104 cells per ml were poured
into each well. Cell cultures were infected with one milliliter
of a suspension from each separate strain containing 1 x
107 leptospires/ml. Cells were subsequently incubated at
37 C in a 5% CO2 atmosphere and fixed with methyl
alcohol at 24 and 48 h pi. Cell morphology and leptospiral
CPE were microscopically assessed in May GrnwaldGiemsa stained smears. In this study, several CPE caused
by a wild strain of L. interrogans serovar Pomona were
observed at 24 h pi: ballooning, loss of cell structure,
vacuolization and lysis (Figures 1 and 2). This fact
demonstrated the ability of leptospires to produce cell
damage. No changes were observed in BHK 21 (C13)
cells infected with a non-pathogenic L. biflexa serovar
Patoc strain (Figure 3). Origin of Leptospira strains: La-
boratory of Leptospirosis, Instituto de Patobiologa,

CICVyA-CNIA, Instituto Nacional Tecnologa Agropecuaria, Castelar, Buenos Aires, Argentina.
Figure 1. BHK 21 (C13) cells inoculated with a wild type L.

interrogans serovar Pomona. Arrows show vacuolization. May
Grnwald-Giemsa. 400X
Figure 3. BHK 21 (C13) cells inoculated with L. biflexa serovar

Patoc. No cell changes or alterations are observed. May
Grnwald-Giemsa. 400X
Figure 2. BHK 21 (C13) cells inoculated with a wild type L.

interrogans serovar Pomona. Arrow shows ballooning and loss
of cell structure. May Grnwald-Giemsa. 400X
B. Brihuega1, A. Venzano1, O. Zabal2, D. Funes1, C. Auteri1, G. Romero1, L. Samartino1.

1
Instituto de Patobiologa. 2Instituto de Virologa. Centro de Investigaciones
en Ciencias Veterinarias y Agronmicas. INTA.
Las Cabaas y Los Reseros (1712) Castelar, Buenos Aires, Argentina.
E-mail: bbrihuega@cnia.inta.gov.ar
262

41: 262
ISSN 0325-7541
Bacterial hydrocarbon-degrading consortium from Antarctic soils

Removal of contaminants from polluted environments could be improved by taking advantage of the catabolic
capacity of some microorganisms in a process called bioremediation. Nowadays, the use of microbial associations
(also called microbial consortia) is gaining attention, because they seem to have a wider degradation spectrum
than that exhibited by isolated strains. M10 is a bacterial consortium obtained from hydrocarbon-contaminated Antarctic
soils. The members of the M10 consortium have been isolated and identified, being its main components bacteria
belonging to the Pseudomonas, Sthenotrophomonas and Sphingobacterium genera (1). The use of the M10 consortium
as a bioaugmentation tool proved to enhance phenanthrene removal from Antarctic soils (2). Transmission electronic
microscopy (TEM) images of M10 revealed the presence of morphological diversity among the cells grown in liquid
culture with phenanthrene as sole carbon and energy source (Figure1, A and B). This morphological diversity is in
agreement with the idea of M10 as a complex microbial association. Images in Figure 1, C and D are compatible with
the presence of an extracellular matrix around the cells. This matrix, that seems to be forcing or helping bacterial cells
to stay close together is associated to the surface of only some members of the consortium.
Figure 1. Transmission electronic micrography of cells from the M10 bacterial consortium. The consortium
was cultured using phenanthrene as sole carbon and energy source. A: 10.000X; B: 18.500X; C: 46.000X;
D: 70.000X.
BIBLIOGRAFA
1. Mestre MC, Vzquez SC, Ruberto L, Mac Cormack WP. Identificacin de los componentes cultivables del consorcio bacteriano
degradador de hidrocarburos M10. Actas del VI Simposio Argentino sobre Investigaciones Antrticas Disponible en:
www.dna.gov.ar/CIENCIA/SANTAR07/CD/PDF/CVRE407.PDF Cd. CVRE407 2007; p. 5.
2. Ruberto LAM, Vzquez SC, Curtosi A, Mestre MC, Pelletier E, Mac Cormack WP. Phenanthrene bioremediation in soils using
an Antarctic bacterial consortium. Bioremediation J 2006; 10: 191-201.
L.A.M. Ruberto1, S.C. Vzquez1, W.P. Mac Cormack2

CONICET - Ctedra de Microbiologa Industrial y Biotecnologa, Facultad de Farmacia y Bioqumica, UBA,
Junn 956 - 6 P (1113) CABA; 2Instituto Antrtico Argentino, Cerrito 1248 (1010) CABA, Argentina.
E-mail: lruberto@ffyb.uba.ar
ndice General del Volumen
Volumen 41 - Ao 2009
263
NDICE GENERAL DEL VOLUMEN 41
Nmero 1
EDITORIAL
Crculo vicioso vs. crculo virtuoso: como mantener a la RAM en el SCIE
H.R. Morbidoni
MICROBIOLOGA BSICA
Caracterizacin del gen de la citotoxina vacuolizante de Helicobacter pylori a partir de
biopsias gstricas de pacientes residentes en Tolima, Colombia
A.M. Lpez, M.P. Delgado, C. Jaramillo, A. Amzquita, G. Parra, M.M. Echeverry
Caracterizacin de aislamientos de Vibrio cholerae no-01, no-0139 asociados a diarrea

S. Gonzlez Fraga, A. Villagra de Trejo, M. Pichel, S. Figueroa, G. Merletti, M.I. Caffer, M. Cecilia de Castillo, N. Binsztein
11

Diagnstico molecular de histoplasmosis humana en muestras de sangre entera
A.I. Toranzo, I.N. Tiraboschi, N. Fernndez, B. Ibarra-Camou, M.C. Rivas, W. Lee, G. Davel,
C.E. Canteros
20
Esporotricosis en un gato domstico
R. Iachini
27
Toxocara canis bajo la lupa

M.V. Bojanich
28
*Prevalencia de los genes mef y ermB en aislamientos invasores de Streptococcus pneumoniae
resistentes a la eritromicina recuperados de pacientes peditricos en Argentina
A. Corso, D. Faccone, C. Gali, P. Gagetti, M. Rodrguez, J. Pace, M. Regueira, Grupo de Trabajo Argentino SIREVA
29
Uso de linezolid para el tratamiento de recin nacidos con infecciones por Enterococcus
faecium resistentes a la vancomicina.
G. Berberian, G. Castro, S. Fistolera, M. Travaglianti, H. Lopardo, A. Mastroianni, M.T. Rosanova
34
*Alteraciones de crecimiento y ramificacin en Neurospora crassa provocadas por concentraciones sub-inhibitorias de agentes antimicticos
R.C. Pereira, S. Said
39
ARTCULOS ESPECIALES
*Micobacterifagos como herramientas verstiles para la manipulacin gentica y el desarrollo de mtodos simples para el diagnstico de enfermedades micobacterianas
E.J. Stella, A.I. de la Iglesia, H.R. Morbidoni
45
264
Nmero 2
EDITORIAL
Mtodos rpidos: una herramienta til y prctica para el anlisis microbiolgico de alimentos
G.A. Leotta
63
MICROBIOLOGA BSICA
Efecto de la inoculacin de la cepa Sphingomonas paucimobilis 20006FA sobre la composicin de un consorcio bacteriano degradador de fenantreno
L. Madueo, B.M. Coppotelli, I.S. Morelli
65
*Perfil de sensores de qurum en cepas nosocomiales y ambientales de Acinetobacter

R.H. Gonzlez, L. Dijkshoorn, M. van den Barselaar, C. Nudel
73
*Amplificacin in vitro de cepas de campo de virus de la diarrea viral bovina (VDVB) aisladas en Argentina: efecto de la lnea celular y las condiciones de cultivo
A.C. Oden, M.R. Leunda, C. Favern, N. Boynak, M.M. Vena, O. Zabal
79
*Evaluacin de vacunas experimentales para la diarrea viral bovina en bovinos, ovinos y

cobayos.
F. Fernndez, V. Costantini, M. Barrandeguy, V. Parreo, G. Schiappacassi, F. Maliandi, M.
Leunda, A. Oden
86

Enterococos resistentes a vancomicina: prevalencia y factores asociados a la colonizacin intestinal en pacientes oncolgicos del Hospital de Nios de Crdoba
A.L. Reale, M.L. Depetri, C. Culasso, M. Paviolo, M.L. Cheguirin, M.C. Enrico, E.M. Ledesma,
C. Vidal, E. Glastein, L. Bertoni
92
*Estudio serolgico y bacteriolgico de brucelosis en perros de Lomas de Zamora, provincia de Buenos Aires.
G. Lpez, S.M. Ayala, A.M. Efron, C.F. Gmez, N.E. Lucero
97
*Identificacin de la fuente de infeccin de histoplasmosis de dos maras (Dolichotis

patagonum) cautivas procedentes de la misma colonia, utilizando ensayos moleculares e
inmunolgicos.
M.R. Reyes-Montes, G. Rodrguez-Arellanes, A. Prez-Torres, A.G. Rosas-Rosas, A. ParsGarca, C. Juan-Salls, M.L. Taylor
102
*Hidatidosis peditrica en el sudeste de la provincia de Buenos Aires, Argentina

M.C. Dopchiz, M.C. Elissondo, M.V. Andresiuk, E. Maiorini, A.M. Gutirrez, P.M. Muzulin, M.C.
Rosenzvit, C.M. Lavalln, G. Denegri
105

*Actinomicetos termoalcalfilos del rea subtropical de Jujuy, Argentina
L. Carrillo, M.R. Bentez Ahrendts, M.J. Maldonado
112
Microorganismos que afectan diferentes soportes de informacin
P.S. Guiamet, P. Lavin, P. Schilardi, S.G. Gmez de Saravia
117
Infestacin por Demodex spp.: un caso clnico

C.L. Gatta, E. Comunale, C.I. Menghi
118
Fe de erratas
119
ndice General del Volumen
265
Nmero 3
EDITORIAL
Ante la predictibilidad de la pandemia, lo impredecible: el virus pandmico
V. Savy
127
MICROBIOLOGA BSICA
Identificacin de antgenos inmunorreactivos (dobler) de Leptospira interrogans
A. Carrizo, B. Brihuega, I. Etchechoury, A. Arese, S. Romero, A. Gioffre, M.I. Romano, K. Caimi
129
El virus de la Lengua azul: mecanismos de apoptosis en su infeccin

E. Mortola, A. Larsen
134

*Caracterizacin fenotpica de cepas de Clostridium botulinum aislados de casos de botulismo del lactante en Argentina
M.D. Sagua, C. Luquez, C.P. Barzola, M.I. Bianco, R. A. Fernndez
141
Tungiosis adquirida en la provincia del Chaco, Argentina

C.I. Menghi, E. Comunale, C.L. Gatta
148
Evaluacin microbiolgica y epidemiolgica de los clones de Acinetobacter baumannii resistentes a los carbapenemes aislados en la unidad de cuidados intensivos de un Hospital Universitario de la ciudad de Buenos Aires
C.H. Rodrguez, K. Bombicino, G. Granados, C. Vay, A. Famiglietti
151
Serovariedades de Salmonella enterica subespecie enterica en porcinos de faena y su

resistencia a los antimicrobianos
M.P. Ibar, G. Vigo, P. Pieyro, M.I. Caffer, P. Quiroga, C. Perfumo, D. Centrn, G. Giacoboni
156
Mieles del sistema serrano de Ventania: evaluacin de la calidad microbiolgica en el circuito de la planta de extraccin
L.M. Gallez, L.A. Fernndez
163
Hbitos de consumo de hamburguesas y riesgo de exposicin a Escherichia coli VTEC:

modelo de simulacin
M.L. Signorini, V. Marin, C. Quinteros, H. Tarabla
168
*Levaduras contaminantes en vinos patagnicos: caractersticas moleculares y fisiolgicas de los aislamientos indgenas de Pichia guilliermondii
C.A. Lopes, V. Jofr, M.P. Sangorrin
177
ARTCULO ESPECIAL
Criptosporidiosis: una zoonosis emergente
V.F. Del Coco, M.A. Crdoba, J.A. Basualdo
185
Thelebolus microsporus
G.A. Leotta, E.H. Reinoso
197
Psorospermium haeckellii: pseudoparsito hallado en un vector

C.L. Gatta, E. Comunale, C.I. Menghi
198
266
Nmero 4
EDITORIAL
Transferencia e intercambio de conocimiento a travs de reuniones cientficas. Cerca del
corazn de los amigos, lejos de las arcas del Estado
H.R. Morbidoni
203
MICROBIOLOGA BSICA
*Amplificacin del genoma completo del subtipo 2 del virus de la influenza equina
207

Brote de micoplasmosis clnica por Mycoplasma ovis en ovinos de Salta, Argentina. Diagnstico clnico, microbiolgico y molecular
*Mycobacterium bovis en Argentina: aislamientos de gatos tipificados por spoligotyping
*Echinococcus granulosus: comparacin biolgica de aislados de bovinos de regiones
endmicas de Argentina y Espaa
*Actividad antibacteriana y antioxidante del aceite esencial extrado de Artemisia
echegarayi Hieron (Asteraceae).
*El t de tilo como vehculo potencial de esporas de Clostridium botulinum en la transmisin del botulismo infantil
Modelo de contaminacin cruzada por Escherichia coli verocitotoxignica durante la elaboracin de hamburguesas caseras y evaluacin cuantitativa de riesgos
212
215
218
226
232
237

*Evolucin del contenido de ocratoxina A en vinos tintos argentinos durante el proceso
de vinificacin a escala piloto
M.L. Ponsone, M.L. Chiotta, M. Combina, A.M. Dalcero, S.N. Chulze
245
ARTCULO ESPECIAL
251
*Efecto citoptico en clulas BHK 21 (C13) inoculadas con Leptospira interrogans serovar
Pomona aislada de un aborto porcino
B. Brihuega, A. Venzano,O. Zabal, D. Funes, C. Auteri, G. Romero, L. Samartino
*Consorcio bacteriano degradador de hidrocarburos aislado de suelos de Antrtida
LAM Ruberto, SC Vzquez, WP Mac Cormack
ndice general del volumen 41
ndice de temas
ndice de autores
Agradecimiento a revisores
Fe de erratas
Instrucciones para los autores
*Instructions to authors
*En Ingls
261
262
263
269
271
272
272
273
275
Indice de Temas
267
NDICE DE TEMAS
Acinetobacter
Acinetobacter baumannii
acyl homoserina lactona
adherencia
151
73
151
cepas
ambientales
nosocomiales
73
genotipos
218
zoonosis
105
Enterococos resistentes a la vancomicina

colonizacin
92
pacientes oncolgicos
92
Escherichia coli
73
contaminacin cruzada
clones
151
evaluacin de riesgos
resistencia a carbapenemes
151
hamburguesas
168, 237
sndrome urmico hemoltico
168, 237
sensores de qurum
unidad de cuidados intensivos
73
151
verocitotoxignica
237
168, 237
237
Helicobacter pylori
Actinomicetos
bagazo
112
Colombia
caa de azcar
112
deteccin
suelos subtropicales
112
Tolima
VacA
Alimentos
anlisis microbiolgicos
63
mtodos rpidos
63
Antimicrobianos
Acinetobacter
Clostridium botulinum
Enterococos resistentes a la vancomicina
Histoplasma capsulatum
DOT-Elisa
fuente de infeccin
73,151
141
34, 92
histoplasmosis
maras
PCR
Escherichia coli
168
RAPD-PCR
Salmonella enterica
156
sangre entera
Streptococcus pneumoniae
29
Artemisia echegarayi
aceite esencial
actividad
antibacteriana
226
antioxidante
226
Brucella canis
brucelosis canina
botulismo del lactante
caracterizacin fenotpica
141, 232
141
Clostridium perfringens
102
20, 102
102
20
129
Efecto citoptico
261
MALDI-TOF
129
Linezolid
enterococos resistentes a la vancomicina
recin nacidos
97
102
20, 102
Leptospira interrogans
antgenos
226
102
34, 92
34
Micobacterifagos
gentica de micobacterias
45
herramientas diagnsticas
45
tuberculosis
45
Miel
enterotoxemia
251
calidad microbiolgica
163
toxinas
251
planta de extraccin
163
Sistema de Ventania
163
Consorcio bacteriano
262
Cryptosporidium
Mycobacterium bovis
ciclo evolutivo
185
gatos
clnica
185
spoligotyping
215
diagnstico
185
tuberculosis
215
epidemiologa
185
Mycoplasma ovis
taxonoma
185
Argentina
Demodex spp.
caso clnico
118
Echinococcus granulosus
215
105, 212
brote
212
ovinos
212
Neurospora crassa
Argentina
105, 218
crecimiento apical
39
epidemiologa
105, 218
drogas antimicticas
39
Espaa
hidatidosis
218
105, 218
Ocratoxina A
uvas
245
hidatidosis peditrica
105
proceso de vinificacin
245
morfologa
218
vino
245
268
Pichia guilliermondii
botulismo del lactante
biotipo killer
177
fenoles voltiles
177
levaduras contaminantes
177
Toxocara canis
RAPD
177
Psorospermium haeckelii
pseudoparsito
RAM
adultos
141, 232
232
197
28
Tunga penetrans
198
1
Argentina
148
Chaco
148
Vibrio cholerae
Reuniones cientficas
tuberculosis
esporas botulnicas
293
Salmonella enterica
factores de virulencia
11
no-01
11
cerdos
156
no-0139
11
integrones de clase 1
156
PFGE
11
multirresistencia a los antimicrobianos
156
salud pblica
156
SCIE
Soportes de informacin
biodeterioro
117
Sphingomonas paucimobilis
consorcios bacterianos
65
Virus de la diarrea viral bovina (VDVB)

cepas de campo argentinas
cultivos celulares
79, 86
79
interaccin virus-clula
79
pestivirus
79
vacunas inactivadas
86
Virus de la influenza equina
DGGE
65
diagnstico
207
fenantreno
65
genoma
207
RT-PCR
207
Sporothrix sp.
esporotricosis
27
gato domstico
27
Virus de la Lengua azul

apoptosis
134
Bax
134
29
citocromo c
134
genes erm y mef B
29
Smac/DIABLO
134
macrlidos
29
NF-b
134
Argentina
T de tilo
Virus pandmico
127
Subject index
269
Volume 41 - 2009
SUBJECT INDEX
Acinetobacter
Echinococcus granulosus
Acinetobacter baumannii
151
acyl homoserine lactone
73
Argentina
105, 218
epidemiology
105, 218
adherence
151
genotype
218
carbapenem resistance
151
morphology
218
clones
151
pediatric hydatidosis
environmental strains
73
intensive care unit
151
nosocomial strains
73
quorum sensing
73
Equine influenza virus

207
207
112
RT-PCR
207
112
Escherichia coli
bagasse
subtropical soils
sugar cane
112
Antimicrobial agents
cross-contamination
hamburguer
73, 151
141
Escherichia coli
168
Salmonella enterica
156
105
genome
112
Vancomycin-resistant enterococci
218
zoonosis
diagnosis
Actinomycetes
Acinetobacter
105, 218
Spain
237
168, 237
hemolytic uremic syndrome
168, 237
quantitative risk assessment
168, 237
verocitotoxigenic E. coli
237
Sporothrix sp.
29
sporothricosis
27
34, 92
domestic cat
27
Artemisia echegarayi
Food
antibacterial activity
226
microbiological analysis
63
antioxidant activity
226
rapid methods
63
essential oil
Bacterial consortium
226
262
Bluetongue virus
Helicobacter pylori
Colombia
Tolima
VacA
apoptosis
134
Bax
134
cytochrome c
134
Smac/DIABLO
134
Dot-ELISA
NF-b
134
histoplasmosis
Bovine viral diarrhea virus (BVDV)

Argentinean field strains
cell culture
Histoplasma capsulatum
infection source
79, 86
detection
maras
102
20, 102
102
102
79
molecular diagnosis
20, 102
inactivated virus vaccine
86
PCR
20, 102
kinetics of viral replication
79
RAPD-PCR
pestivirus
79
whole blood sample
Brucella canis
canine brucellosis
phenotypic characterization
20
Honey
97
infant botulism
102
141, 232
141
Clostridium perfringens
enterotoxemia
251
toxines
251
Cryptosporidium
honeyhouse
163
microbiological quality
163
Ventania system
163
Leptospira interrogans
antigens
129
cytopathic effect
261
MALDI-TOF
129
Linden flower tea
diagnosis
185
botulinum spores
epidemiology
185
infant botulism
232
141, 232
Linezolid
life cycle
185
symptomatology
185
newborns
34
taxonomy
185
vancomycin-resistant enterococci
34
Demodex spp.
clinical case
Media of information
118
biodeterioration
117
270
Mycobacteriophages
antimicrobial multidrug resistance
156
45
class 1 integrons
156
mycobacterial genetics
45
pigs
156
tuberculosis
45
public health
156
diagnostic tools
Mycobacterium bovis
SCIE
cats
215
spoligotyping
215
tuberculosis
215
Mycoplasma ovis
Argentina
105, 212
outbreak
212
sheep
212
Neurospora crassa
Scientific meetings
tuberculosis
293
Sphingomonas paucimobilis
bacterial consortium
65
DGGE
65
phenanthrene
65
Argentina
29
antifungal drugs
39
erm gene
29
apical growth
39
macrolide
29
mefB gene
Ochratoxin A
245
vinification process
245
Toxocara canis
wine
245
grapes
Pandemic virus
127
Pichia guilliermondii
adults
29
197
28
Tunga penetrans
Argentina
148
Chaco
148
killer biotype
177
RAPD
177
spoilage yeasts
177
colonization
92
volatile phenols
177
oncology patients
92
Psorospermium haeckelii
pseudoparasite
RAM
Salmonella enterica
Vancomycin-resistant enterococci
Vibrio cholerae
198
1
no-01 isolate
11
no-0139 isolate
11
PFGE
11
virulence factors
11
Indice de Autores
271
NDICE DE AUTORES
Aguirre DH
Amzquita A
Andresiuk MV
Arese A
Auteri C
Ayala SM
Barberian G
Barrandeguy M
Barzola CP
Basualdo JA
Bentez Ahrendts MR
Bernardelli A
Bertoni L
Bianco MI
Binsztein N
Bojanich MV
Bombicino K
Boymak N
Brihuega B
Caffer MI
Caimi K
Canteros CE
Carrillo L
Carrizo A
Carrizo Flores R
Castillo MC
Castro G
Cataldi A
Centrn D
Combina M
Comunale E
Constantini V
Coppotelli BM
Crdoba MA
Corso A
Cuesta Bandera C
Culasso C
Cheguirin ML
Chiotta ML
Chulze SN
Dalcero AM
Davel G
de la Iglesia AI
Del Coco VF
Delgado MP
Denegri G
Depetri ML
Dijkshoorn L
Dopchiz MC
Echeverry MM
Efron AM
Elissondo MC
Enrico MC
Etchechoury I
Faccone D
Famiglietti A
Fasn R
Favern C
Fernndez F
Fernndez LA
Fernndez-Miyakawa ME
Fernndez N
212
4
105, 218
129
261
97
34
86
141
185
112
215
92
141, 232
11
28
151
79
129, 261
11, 156
129
20
112
129
226
11
34
215
156
245
118, 148, 198
86
65
185
29
218
92
92
245
245
245
20
45
185
4
105, 218
92
73
105, 218
4
97
105, 218
92
129
29
151
215
79
86
163
251
20
Fernndez RA
141, 232
Figueroa S
11
Fistolera S
34
Frizzo LS
237
Fuentealba NA
207
Funes D
261
Gagetti P
29
Gaido AB
212
Gali C
29
Galosi CM
207
Gallez LM
163
Gatta CL
118, 148, 198
Giacobone G
156
Gioffre A
129
Glastein E
92
Gmez CF
97
Gmez de Saravia SG
117
Gonzlez Fraga S
11
Gonzlez RH
73
Granados G
151
Grupo de Trabajo Argentino SIREVA
29
Guiamet PS
117
Gutirrez AM
105
Iachini R
27, 215
Ibar MP
156
Ibarra Camou B
20
Jaramillo C
4
Jofr V
177
Jong LIT de
232
Juan-Salls C
102
Laciar A
226
Larsen A
134
Lavalln CM
105
Lavin P
117
Ledesma EM
92
Lee W
20
Leotta GA
63, 197
Leunda MR
79, 86
Lopardo H
34
Lopes CA
177
Lpez AM
4
Lpez G
97
Lucero NE
97
Lquez C
141, 232
Mac Cormack WP
262
Madueo L
65
Maldonado MJ
112
Maiorini E
105
Maliandi F
86
Marn V
168
Marticorena D
215
Martnez Vivot M
215
Mastroianni A
34
Menghi CI
118, 148, 198
Merletti G
11
Morbidoni HR
1, 45, 203
Morelli IS
65
Morris WE
251
Mortola E
134
Muzulin PM
105
Neumann RD
212
Nudel C
73
Oden AC
Pace J
Pars-Garca A
Parra G
Parreo V
Paviolo M
Pecoraro MR
Pereira RC
Prez-Torres A
Perfumo C
Pichel M
Pieyro P
Ponce Gordo F
Ponsone ML
Quinteros C
Quiroga P
Reale AL
Regueira M
Reinoso EH
Reyes-Montes MR
Rivas ME
Rodrguez-Arellanes G
Rodrguez CA
Rodrguez M
Romano MI
Romero G
Romero S
Rosanova MT
Rosas-Rosas AG
Rosenzvit MC
Ruberto LAM
Saad JR
Said S
Sagua MD
Salatin AO
Samartino L
Sangorrin MP
Savi V
Schiappacassi G
Schilardi P
Sguazza GH
Signorini ML
Stella EJ
Tarabla H
Taylor ML
Thompson C
Tiraboschi IN
Tizzano MA
Toranzo AI
Torioni de Echaide S
Travaglianti M
Vaca Ruiz ML
van den Barselaar M
Vay C
Vazquez SC
Vena MM
Venzano A
Vidal C
Vigo G
Villagra de Trejo A
Zabal O
Zumrraga MJ
79, 86
29
102
4
86
92
207
39
102
156
11
156
218
245
168
156
92
29
197
102
20
102
151
29
129
261
129
34
102
105
262
226
39
141
212
261
177
127
86
117
207
168, 237
45
168
102
212
20
207
20
212
34
226
73
151
262
79
261
92
156
11
79, 261
215
272
AGRADECIMIENTO A REVISORES
El Comit Editor de la Revista Argentina de Microbiologa agradece a los seores revisores el
tiempo, esfuerzo y experiencia dedicados a mejorar la calidad de la revista.
Albanesi A
Alche L
Ambrosi A
Arabolaza A
Arakaki C
Bacci M
Bantar C
Baslico JC
Benintende G
Bianchi T
Bianchini H
Binsztein N
Bonofiglio L
Borda E
Bouzas MB
Bratanich A
Bravo A
Cadario E
Campero CM
Candurra N
Carbone C
Carrillo E
Catalano M
Cataldi A
Cavalito S
Cavallaro L
Chulze S
Colombato C
Combina M
Copotelli B
Correa O
Costamagna S
Cravero S
Crossa J
De Paulis A
de Villalobos C
de Waard J
del Panno MT
Demo M
Dionisi H
Echenique J
Eraso J
Erijman L
Escandn P
Faccone D
Famiglietti A
Fernndez Canigia L
Fernndez Pinto V
Forchiassin F
Fossati A
Frade H
Gagetti P
Gentile A
Giri A
Godeas A
Gogorza L
Gmez Carrillo M
Gonzlez Ayala S
Gonzlez Cappa S
Guerrero R
Guiamet P
Kantor I N
Kaufman S
Korol S
Kozubsky L
Larsen A
Limansky A
Liares J
Litterio M
Lopardo H
Lujan H
Marielarena A
Martino P
Masana M
Masih D
Mattioli G
Mattion N
Mersich S
Morcillo N
Mujica MT
Nicola F
Nikel P
Oteiza JM
Padola N
Pecoraro M
Pereda A
Prez S
Perfumo C
Perticari A
Petroni A
Picconi A
Pieyro P
Ramos L
Raya R
Reynaldi F
Rivera M
Sadir A
Samartino L
Sangorrn M
Santoianni J
Smayevsky J
Sosa Estani S
Stanchi N
Sutich E
Taboga D
Takiff H
Tanaro D
Terzolo H
Tolmasky M
Tosello M
Tous M
Turco M
Urcelay C
Vaamonde G
Valverde C
Wanke MM
Zorreguieta A
Fe de Erratas
Diagnstico molecular de histoplasmosis humana

en muestras de sangre entera
A. I. TORANZO1, I. N. TIRABOSCHI2, N. FERNNDEZ2, B. IBARRA-CAMOU1,
M. C. RIVAS1, W. LEE1, G. DAVEL1, C. E. CANTEROS1*
1
Departamento Micologa, INEI-ANLIS Dr. Carlos G. Malbrn. Av. Vlez Sarsfield 563 (1281) Ciudad Autnoma de
Buenos Aires; 2Divisin Infectologa, Hospital de Clnicas Jos de San Martn, Universidad de Buenos Aires.
Av. Crdoba 2351 (1120) Ciudad Autnoma de Buenos Aires. Argentina.
*Correspondencia. E-mail: ccanteros@anlis.gov.ar
Volumen 41, N 1, p. 20-26.

Los autores desean enmendar dos errores en la secuencia de los cebadores detallados en la seccin MATERIALES Y MTODOS
En la pgina 22. en el item PCR anidada
donde dice: Hcl: 5GCG TTC CGA GCC TTC CAC CTC ACC 3
debe decir: HcI: 5 GCG TTC CGA GCC TTC CAC CTC AA C 3
donde dice: Hc III: 5GAC ATC TAG TCG CGG CCA GGT TCA 3
debe decir: Hc III: 5 GAG ATC TAG TCG CGG CCA GGT TCA 3
274
INSTRUCCIONES PARA LOS AUTORES

La Revista Argentina de Microbiologa es una publicacin trimestral editada por la Asociacin Argentina de Microbiologa y
destinada a la difusin de trabajos cientficos en las distintas reas de la Microbiologa. La Asociacin Argentina de Microbiologa
se reserva los derechos de propiedad y reproduccin del material aceptado y publicado.
Tipos de contribucin. La Revista Argentina de Microbiologa acepta: artculos originales, informes breves, artculos especiales, imgenes microbiolgicas, editoriales y suplementos.
Los artculos originales son trabajos de investigacin completos y deben presentarse respetando las siguientes divisiones:
Introduccin, Materiales y Mtodos, Resultados, Discusin, Agradecimientos y Bibliografa. Se admite la presentacin de Resultados y Discusin como una seccin conjunta.
Los informes breves son trabajos de menor extensin, entre los que se incluyen casusticas, casos clnicos y descripciones de
tcnicas o dispositivos nuevos avalados por trabajos experimentales concluyentes. Se deber omitir la divisin del texto en secciones y
el manuscrito no podr exceder las ocho pginas, con un mximo de quince citas bibliogrficas y tres tablas o figuras.
Los artculos especiales son actualizaciones o consensos de grupos de trabajo acerca de temas de gran inters en el mbito regional
o internacional. Sus autores deben ser especialistas en la materia y el texto debe incluir una amplia y actualizada revisin bibliogrfica.
Recientemente la Revista Argentina de Microbiologa ha incorporado la seccin, imgenes microbiolgicas. Las contribuciones
enviadas para esta seccin pueden corresponder a fotos de bacterias, hongos, parsitos o virus, tomadas de exmenes en fresco o
con coloraciones, y observadas bajo microscopa ptica, electrnica o de fluorescencia. Tambin se admiten otras imgenes fotogrficas, por ejemplo, microorganismos en medios de cultivo, lesiones ilustrativas en pacientes o en animales de experimentacin;
imgenes radiogrficas y ecogrficas, de tomografas computadas, de resonancias magnticas nucleares, etc. Estas imgenes de
gran valor didctico y no necesariamente excepcionales, deben estar acompaadas de un texto explicativo y de flechas indicadoras,
cuando corresponda. El conjunto no debe exceder una pgina impresa.
En todos los casos se exigir excelente calidad fotogrfica, de modo que sea posible la fiel reproduccin de la imagen enviada. La
versin electrnica (que siempre se deber suministrar, adems de la impresa) se realizar en el formato JPEG, con alta resolucin.
Los editoriales abordan tpicos de gran actualidad y particular relevancia para la comunidad cientfica especializada en la
Microbiologa. La oportunidad y autora de los editoriales, as como sus lineamientos generales, quedan exclusivamente a criterio
del Comit Editor.
Los suplementos corresponden a extensas revisiones de un tema especfico realizadas por una o varias sociedades cientficas
o universidades, o a los resmenes de las contribuciones efectuadas en el marco de eventos cientficos organizados por la Asociacin Argentina de Microbiologa, o alguna de sus Divisiones o Filiales (comunicaciones orales, posters, conferencias, mesas redondas, etc.), a cargo de editores invitados.
Las propuestas temticas de los suplementos y sus lineamientos generales debern ser aceptados por el Comit Editor.
La revisin de los manuscritos correspondientes a suplementos estar a cargo de revisores elegidos por el Comit Editor (extensas
revisiones) y de los editores invitados (resmenes de eventos). El suplemento deber ser financiado en su totalidad por la entidad que ha
organizado la reunin cientfica, la que tendr en cuenta que el suplemento se deber distribuir entre todos los socios de la Asociacin
Argentina de Microbiologa y todos los participantes del evento. Con respecto a la edicin, el suplemento deber respetar exactamente el
formato y el estilo de la Revista Argentina de Microbiologa en todos sus aspectos (tapa, tipo de papel, impresin, tablas, figuras, fotos,
etc.), tal como se describe en las Instrucciones para los autores. Los suplementos correspondientes a los resmenes de los eventos
deben incluir en este orden: nmina de los miembros del Comit Editor de la Revista Argentina de Microbiologa, datos de presentacin
del evento (ttulo completo, lugar y fecha ), ndice (en espaol y en ingls), agradecimientos, nmina de las autoridades del evento y
mensaje/s del/los presidente/s. A continuacin se presentarn los resmenes numerados desde el uno con nmeros arbigos. Al final del
suplemento debe incluirse el ndice alfabtico de autores y las Instrucciones para los autores de la Revista Argentina de Microbiologa, en
espaol y en ingls. El programa esquemtico del evento slo se podr incluir en forma de trptico, suelto en el interior del suplemento.
La Revista Argentina de Microbiologa apoya las polticas para registro de ensayos clnicos de la Organizacin Mundial de la
Salud (OMS) y del International Committee of Medical Journal Editors (ICMJE), reconociendo la importancia de esas iniciativas
para el registro y divulgacin internacional de informacin sobre estudios clnicos, en acceso abierto. En consecuencia, solamente
se aceptarn para publicacin, a partir de 2007, los artculos de investigaciones clnicas que hayan recibido un nmero de identificacin en uno de los Registros de Ensayos Clnicos validados por los criterios establecidos por OMS e ICMJE, cuyas direcciones
estn disponibles en el sitio del ICMJE. El nmero de identificacin se deber registrar al final del resumen.
Presentacin de los originales. Los manuscritos debern ser enviados al Comit Editor de la Revista Argentina de Microbiologa, Den Funes 472, (C1214AAD) Ciudad Autnoma de Buenos Aires, Argentina.
El material ser analizado por el Comit Editor y sometido a la consideracin de dos rbitros cientficos designados para cada caso.
El Comit Editor se reserva el derecho de rechazar aquellos manuscritos cuyos contenidos se superponen total o parcialmente con
trabajos ya publicados, o aquellos cuya temtica no se corresponde con la de la Revista Argentina de Microbiologa. Asimismo, se reserva
el derecho de efectuar las modificaciones gramaticales o literarias que considere necesarias.
Los manuscritos podrn ser redactados indistintamente en espaol o en ingls, aunque el Comit Editor estimula a los autores a escribir
los trabajos en ingls para favorecer su difusin y lectura a nivel internacional. Los autores cuya primera lengua no sea el espaol debern
remitir los manuscritos en ingls. Los artculos originales, informes breves y artculos especiales incluirn dos resmenes de hasta 200
palabras. El primero de ellos estar redactado en el idioma empleado en el trabajo, y el segundo, en el otro idioma, estar encabezado por
el ttulo completo del trabajo. Evitar en los resmenes las abreviaturas y las citas bibliogrficas.
Los manuscritos se presentarn impresos por triplicado y en disquete o CD-ROM. Las hojas debern estar numeradas correlativamente, y el texto se escribir dejando mrgenes amplios, a doble espacio, sobre una sola cara del papel, con un tamao mnimo
de letra de 12 puntos. Las letras en negrita o itlica se usarn slo cuando corresponda.
275
En la primera pgina se indicar: ttulo del trabajo (slo la primera letra en mayscula, el resto en minscula), iniciales de los nombres y
apellidos completos de todos los autores; lugar de trabajo (nombre de la institucin y direccin postal), de haber autores con distintos lugares
de trabajo, se colocarn superndices numricos (no encerrados entre parntesis) junto a los nombres, de manera de identificar a cada autor
con su respectivo lugar de trabajo; fax y/o correo electrnico del autor responsable de la correspondencia (que se indicar con un asterisco
en posicin de superndice ubicado junto al nombre) y ttulo abreviado del trabajo, de hasta 50 letras, para cabeza de pgina.
En la segunda pgina se incluirn los dos resmenes, seguido cada uno de ellos de una lista de tres a seis palabras clave, en
el idioma correspondiente.
Introduccin. Incluir antecedentes actualizados acerca del tema en cuestin y los objetivos del trabajo definidos con claridad. Las
citas bibliogrficas debern ser elegidas muy cuidadosamente y no se deber realizar una exhaustiva revisin del tema.
Materiales y Mtodos. Contendr la descripcin de los mtodos, aparatos, reactivos y procedimientos utilizados, con el detalle
suficiente para permitir la reproduccin de los experimentos.
Resultados. Se presentarn a travs de una de las siguientes formas: en el texto, o mediante tabla/s y/o figura/s. Se evitarn
repeticiones y se destacarn slo los datos importantes. Se dejar para la seccin Discusin la interpretacin ms extensa.
Las tablas se presentarn en hoja aparte, numeradas consecutivamente con nmeros arbigos, encabezadas con un ttulo explicativo, con las leyendas y/o aclaraciones que correspondan al pie. Las llamadas para las aclaraciones al pie se harn empleando nmeros
arbigos entre parntesis y superndice. Slo los bordes externos de la primera y la ltima fila y la separacin entre los ttulos de las
columnas y los datos se marcarn con lnea continua. No se marcarn los bordes de las columnas.
Las figuras se presentarn en hoja aparte, numeradas consecutivamente con nmeros arbigos. Los dibujos debern estar en condiciones que aseguren una adecuada reproduccin. Los grficos de barras, tortas o estadsticas debern tener el formato GIF. Los nmeros,
letras y signos tendrn dimensiones adecuadas para ser legibles cuando se hagan las reducciones necesarias. Las referencias de los
smbolos utilizados en las figuras debern ser incluidas dentro de la misma figura y no en el texto de la leyenda.
Las fotografas debern ser realizadas en color o en blanco y negro, con buen contraste, en papel brillante y con una calidad
suficiente para asegurar una buena reproduccin. Los dibujos originales o las fotografas tendrn al dorso los nombres de los autores
y el nmero de orden escritos con lpiz. Las leyendas de las figuras se presentarn reunidas en una hoja aparte, ordenadas numricamente. La versin electrnica deber ser realizada en el formato JPEG, con alta resolucin.
Tanto las figuras como las fotografas debern ser legibles y no debern superar los 580 pxeles de ancho. Las abreviaturas
debern ser explicitadas despus de su primera mencin en el texto. Las unidades de medida se expresarn siguiendo las normas
del Systme International dUnits.
Discusin. Se har nfasis sobre los aspectos del estudio ms importantes y novedosos, y se interpretarn los datos experimentales en relacin con lo ya publicado. Se indicarn las conclusiones a las que se arrib, evitando la reiteracin de datos y
conceptos ya vertidos en secciones anteriores.
Agradecimientos. Deben presentarse en un tamao de letra menor y en un solo prrafo
Bibliografa. Las citas bibliogrficas se escribirn en hoja aparte y se presentarn en orden alfabtico de autores, numeradas
correlativamente empleando nmeros arbigos (no usar el formato lista, opcin de Word). En el texto, las citas aparecern con nmeros
entre parntesis, en correspondencia con el nmero con que aparecen en la bibliografa. Las referencias a comentarios personales y a
trabajos inditos debern mencionarse como comunicacin personal, escrito entre parntesis. Cuando el nmero de autores de una
cita sea superior a seis, se deber indicar los nombres de los seis primeros seguidos por el marcador et al.
Para las referencias se seguirn los siguientes modelos:
a. Publicaciones peridicas
Hritier C, Poirel L, Lambert T, Nordmann P. Contribution of acquired carbapenem-hydrolyzing oxacillinases to carbapenem
resistance in Acinetobacter baumannii. Antimicrob Agents Chemother 2005; 49: 3198-202.
Los ttulos de las revistas sern abreviados segn el Index Medicus (el listado puede obtenerse en http://www.nlm.nih.gov).
b. Captulos de libros/mdulos
Ruoff KL, Whiley RA, Beighton D. Streptococcus. En: Murray PR, Baron EJ, Jorgensen JH, Pfaller MA, Yolken RH, editors.
Manual of Clinical Microbiology. Washington D.C., ASM Press, 2003, p. 405-21.
c. Presentaciones en congresos u otros eventos cientficos
Aguilar M, Punschke K, Touati D, Pianzzola MJ. Estudios fisiolgicos y genticos en la bacteria sulfato reductora Desulfoarculus
baarsii. Terceras Jornadas Rioplatenses de Microbiologa, 1997, Resumen J2, p. 102, Ciudad Autnoma de Buenos Aires, Argentina.
d. Presentaciones en congresos u otros eventos cientficos reproducidas dentro de un suplemento publicado por la
Revista Argentina de Microbiologa
Fellner MD, Correa RM, Durand K, Teyssi AR, Picconi MA. Anlisis del ADN circulante de virus Epstein-Barr (EBV) en pacientes inmunosuprimidos con y sin linfomas asociados. VIII Congreso Argentino de Virologa, Resumen 10416. Rev Argent Microbiol
2005; 37 Supl 1: 95.
e. Institucionales
Clinical and Laboratory Standards Institute. Disk diffusion. Performance standards for antimicrobial susceptibility testing; 15th
informational supplement, 2005; M100-S15. Wayne, Pa, USA.
Presentacin del disquete / CD-ROM. El disquete o CD-ROM con la versin electrnica de la contribucin enviada deber
tener una etiqueta o rtulo que indique: el nombre del trabajo, el programa y la versin usados para confeccionar el texto, las figuras
y las fotografas; y el nombre de los archivos que contiene.
Recomendaciones. Incluir todo el texto del artculo en un slo archivo; en caso de haber imgenes, stas deben enviarse en
archivos separados; tipear las maysculas, los espacios entre palabras, las itlicas y las negritas tal como se desea que salgan
luego en el impreso; no dar espacios antes y despus de los subttulos; justificar el texto; para encolumnar las tablas, usar la tecla
de tabulacin y no la barra espaciadora. Antes de enviar un manuscrito, es recomendable consultar algn ejemplar reciente de la
RAM; de este modo se podr verificar si se han seguido las pautas de formato y estilo requeridas y, eventualmente, efectuar las
modificaciones necesarias.
Costo de la pgina. Por cada pgina publicada se cobrarn $ 50, o $ 150 si sta incluye fotos en color (Argentina, socios de la
AAM), $ 100 o $ 300 (Argentina, no socios de la AAM) y U$S 40 o U$S 120 (otros pases).
Separatas. Se suministrarn 25 separatas sin cargo.
276
INSTRUCTIONS TO AUTHORS
The Revista Argentina de Microbiologa is published by the Asociacin Argentina de Microbiologa (AAM) on a quarterly basis.
It encourages scientific papers in the field of Microbiology. The Asociacin Argentina de Microbiologa reserves the right to use,
reproduce and publish the accepted contributions.
Types of Publications. The Revista Argentina de Microbiologa will publish: original articles, brief reports, special articles,
images in microbiology, editorials and supplements.
Original Articles: they are full research papers having the following sections: Introduction, Materials and Methods, Results,
Discussion, Acknowledgements and References. Results and Discussions may be subsumed into one section.
Brief Reports: they are less extensive than Original Articles. They include case reports and descriptions of new techniques and
procedures based on experimental work. Division into sections is omitted; manuscripts must not exceed 8 pages, references will be
limited to a maximum of 15, tables and figures to a maximum of 3.
Special Articles: they are updates or workshop results which should be based on subject matter of local and international weight
and include a new and comprehensive bibliography. Their authors must be specialists in their fields.
Images in Microbiology: the Revista Argentina de Microbiologa has just incorporated this new section. Images may include: high
quality pictures of bacteria, fungi, parasites and viruses using staining or direct observation through optical, electron or fluorescent microscopy;
they may also include photographic images of microorganisms in culture media, lesions in humans and laboratory animals, x-rays and
ultrasound images, tomographies, magnetic resonance, etc. Images having instructional worth, though not necessarily breaking new
ground, should be accompanied by explanatory texts and diagrams if required. The set of images should fit one printed page at most.
Images should use photographic material of the highest possible quality to ensure very good reproduction. Electronic versions,
which should always accompany the printed version, must use JPEG in a high resolution format.
Editorials: this section is the sole domain of the Editing Committee, who will determine editorial policy and authorship. Editorials
focus upon the main topics under current discussion in the field of Microbiology.
Supplements: they will mainly consist of the reviewing in detail of both specific subjects considered by scientific organizations
and universities and abstracts of lectures, round tables and oral and visual communications from scientific meetings sponsored by
the Asociacin Argentina de Microbiologa, its divisions or branches and presided by invited editors. Subjects and overall outlines
should be approved by the Editing Committee.
The articles under Supplements will be examined by reviewers selected by the Editing Committee in the case of extensive reviewing,
and by invited editors in the case of abstracts of meetings. Supplements will be wholly financed by the body organizing the meeting,
taking into account that copies have to be distributed to all the members of the Asociacin Argentina de Microbiologa and all the
persons taking part.The style and format must conform to the standards of the Revista Argentina de Microbiologa set out in the
Instructions to Authors in all respects: cover design, paper quality, preparation of tables and illustrations and printing, for example.
Supplements of the meetings should list: the names of the members of the Editing Committee of the Revista Argentina de Microbiologa; title, date and venue of the meeting; contents of the meeting in Spanish and English; acknowledgements; organizing officers and
presidential message; the abstracts, numbered consecutively with Arabic numerals starting from 1, should follow. An alphabetical
index of authors and the Spanish and English versions of the Instructions to Authors of the Revista Argentina de Microbiologa must
be printed at the end of the Supplement. The meeting schedule will accompany the Supplement as a separate leaflet.
The Revista Argentina de Microbiologa follows the policies of the World Health Organization (WHO) and of the International
Committee of Medical Journal Editors (ICMJE) for clinical trial registration, recognizing the importance of those initiatives for international
dissemination of information on clinical research, in open access. Accordingly, only articles of trials previously registered in one of the
Clinical Trial Registries that meet WHO and ICMJE requirements will be accepted for publication, starting in 2007. The list of registries
accepted by WHO and ICMJE is available in ICMJE site. The trial registration number should be published at the end of the abstract.
Preparation of Manuscripts. Manuscripts must be addressed to the Editing Committee of the Revista Argentina de Microbiologa, Den Funes 472 (C1214AAD) Ciudad Autnoma de Buenos Aires, Argentina.
All material will be examined by the Editing Committee first and then by two scientific reviewers selected for each work. The
Editing Committee will exercise the right to refuse manuscripts the subject matter of which falls outside the field covered by the
Revista Argentina de Microbiologa, or deals partially or fully with topics already discussed in published papers. The Editing
Committee will also correct grammar and style where necessary.
Manuscripts may be written in Spanish or English; nevertheless, the Editing Committee encourages authors to use English so
that their work reaches wider international diffusion. Authors whose first language is not Spanish must submit their papers in
English. Original Articles, Brief Reports and Special Articles must be accompanied by two copies of an abstract not exceeding 200
words: one of the copies should be written in the same language as the paper, the other, in the other language: the full title of the
manuscript should be typed in this copy. Abbreviations and references are discouraged in abstracts.
The original manuscript must be sent in triplicate and on a diskette/CD-ROM; pages must be numbered, typewritten on one side
only using as a minimum size 12 characters, double-spaced and with wide margins. Bold and italics printing types may be used
when necessary.
Title page: it should include the title (using capitals only for first letters); authors names (initials of first name, full family name);
place of work: institution and mailing address. If the place of work is different the institutional affiliation of each author should be
given with superscriptions added to their names to identify each author with his/her affiliation. Fax number and e-mail address of
the corresponding author, whose name should be asterisked, must be given. A short title with up to 50 characters should also be
given for use as a running head.
Second page: the Spanish and English versions of the abstract will be printed on the second page, each version listing from 3 to
6 keywords.
277
Introduction. It should clearly state the antecedents of the study and the purpose in undertaking it. References should be
carefully chosen and the problem addressed should not be reviewed in detail.
Materials and Methods. Methods, procedures, reagents, and equipment used must be accurately described so that experiments
can be replicated.
Results. Results will be shown in one of these ways: in the text or in tables and illustrations. Repetition should be avoided by
presenting only the most important data. In-depth interpretation will be under Discussion.
Tables should be typed on separate pages and numbered consecutively with Arabic numerals; they should have a title above
and a legend and/or explanation below. Reference marks for explanations should use superscripted Arabic numerals in parentheses.
Lines will only be used for the first and the last row and to separate the headings of the columns from the data; vertical lines between
columns should not be inserted.
Illustrations should be presented on separate pages and numbered consecutively with Arabic numerals. Drawings must ensure
good reproduction. Bar graphs, pie charts and tables should use a GIF format. The size of numbers, letters and signs should be
large enough to remain legible if reductions are required. References of symbols in the figures should be given in the body of the
figures and not in the legends.
Photographs: both black and white and color photographs are accepted, their quality must be very high, with good contrast so that
reproductions are precise; a gloss finish must be used. Original drawings and photographs must have the names of the authors and the
sequence number in pencil overleaf. The legends of the illustrations should be typed on a separate page and in numerical order.
Electronic forms must use a high resolution JPEG format. Illustrations and photographs must not exceed 580 pixels in width. Abbreviations
should be defined at their first appearance in the text. Units of measure should be expressed in the Systme International dUnits.
Discussion. Emphasis should be laid on the new and most important findings of the study; experimental data should be
examined in the light of previously published work. Conclusions should be presented avoiding the repetition of what has already
been stated in the preceding sections.
Acknowledgements. They must be typed in smaller print in only one paragraph.
References. The names of the authors cited should be listed in alphabetical order and numbered in sequence with Arabic
numerals on a separate page. It should be noted that the Word list format must not be used. A citation in the text must be
accompanied by the corresponding number in the Reference list in parentheses. Unpublished work and personal comments should
be presented as: personal communication. Should the number of authors be more than six, the name of the first six must be
followed by et al.
Sample references:
a. Periodical publications
Hritier C, Poirel L, Lambert T, Nordmann P. Contribution of acquired carbapenem-hydrolyzing oxacillinases to carbapenem
resistance in Acinetobacter baumannii. Antimicrob Agents Chemother 2005; 49: 3198-202.
The abbreviated title of the journal must follow the style of the Index Medicus (the list maybe obtained in http://www.nlm.nih.gov).
b. Chapters of books/modules
Ruoff KL, Whiley RA, Beighton D. Streptococcus. En: Murray PR, Baron EJ, Jorgensen JH, Pfaller MA, Yolken RH, editors.
Manual of Clinical Microbiology. Washington D.C., ASM Press, 2003, p. 405-21.
c. Presentations in meetings
Aguilar M, Punschke K, Touati D, Pianzzola MJ. Estudios fisiolgicos y genticos en la bacteria sulfato reductora Desulfoarculus
baarsii. Terceras Jornadas Rioplatenses de Microbiologa, 1997, Resumen J2, p. 102, Ciudad Autnoma de Buenos Aires, Argentina.
d. Presentations in meetings in a supplement
Fellner MD, Correa RM, Durand K, Teyssi AR, Picconi MA. Anlisis del ADN circulante de virus Epstein-Barr (EBV) en pacientes inmunosuprimidos con y sin linfomas asociados. VIII Congreso Argentino de Virologa, Resumen 10416. Rev Argent Microbiol
2005; 37 Supl 1: 95.
e. Institutional publications
Clinical and Laboratory Standards Institute. Disk diffusion. Performance standards for antimicrobial susceptibility testing; 15th
informational supplement, 2005; M100-S15. Wayne, Pa, USA.
Preparation of the diskette/CD-ROM. The label should show: title of work, program and program version used for the text,
figures and photographs, and the title of each of the files on the diskette/CD-ROM.
Recommendations. Text format: type the whole text in only one file; images, if any, must be filed separately; capitals, spaces
between words, italics and bold types should be those to be used in the printed version; there should be no spaces before or after
subheads; the text should be justified; use tab-settings instead of spacing-bars for tables. Before submitting a manuscript one of the
latest issues of RAM should be consulted in order to comply with the Instructions to Authors.
Publishing charges. Each published page will cost $ 50, or $ 150 (pesos) when the page includes color photographs to AAM
Argentine members; or $100 or $300 (pesos) to Argentine non-member price; and U$S 40 or US$ 120 to all other contributors.
Reprints. Twenty-five off prints will be provided free of charge.
The Secretary: Den Funes 472, (C1214AAD) Ciudad Autnoma de Buenos Aires - Argentina; Tel.: (54-11) 4932-8858 and
(54-11) 4932-8948; mail: info@aam.org.ar; http://www.aam.org.ar
ANNUAL SUBSCRIPTION (4 issues)
Argentina
$ 150
Latin America
U$S 80
Other countries
U$S 100
Payment: By check or money order, to the order of Asociacin Argentina de Microbiologa. Price includes mail postage. AAM members
receive the Revista Argentina de Microbiologa free of charge.
Edicin realizada por Estudio Sigma S.R.L. - J. E. Uriburu 1252 - 8 F - Buenos Aires - Tel.: 4824-9431 / 4821-2702
E-mail: estsigma@gmail.com - www.estudiosigma.com.ar
Impreso en el mes de Diciembre de 2009

41 4completa

Enviado por

Dados do documento

Título original

Direitos autorais

Formatos disponíveis

Compartilhar este documento

Compartilhar ou incorporar documento

Opções de compartilhamento

Você considera este documento útil?

Este conteúdo é inapropriado?

Direitos autorais:

Formatos disponíveis

41 4completa

Enviado por

Direitos autorais:

Formatos disponíveis

N4

PUBLICACION DE LA ASOCIACION ARGENTINA DE MICROBIOLOGIA

W.P. Mac Cormack

M.J. Mendes Giannini (Brasil)

G. San Blas (Venezuela)

SUSCRIPCIN (cuatro nmeros anuales)

Personera Jurdica 000908.

XII CONGRESO ARGENTINO

Presidente: Ricardo Negroni

VOLUMEN 41 N 4 OCTUBRE-DICIEMBRE DE 2009

MICROBIOLOGA CLNICA Y ENFERMEDADES INFECCIOSAS

MICROBIOLOGA INDUSTRIAL Y AMBIENTAL

Revista Argentina de Microbiologa (2008) 40: ---

VOLUMEN 41 N 4 OCTOBER-DECEMBER 2009

CLINICAL MICROBIOLOGY AND INFECTIOUS DISEASES

INDUSTRIAL AND ENVIRONMENTAL MICROBIOLOGY

General Index of volume 41

Transferencia e intercambio de conocimiento a travs de

Mycobacterium tuberculosis, la bacteria causante de la tuberculosis humana, es uno de los patgenos

Revista Argentina de Microbiologa (2009) 41: 203-206

Revista Argentina de Microbiologa (2009) 41: 203-206

HCTOR RICARDO MORBIDONI

Ctedra de Microbiologa, Virologa y Parasitologa

1. Abubakar I, Moore J, Drobniewski F, Kruijshaar M, Brown

radiometric method for recovery of mycobacteria and drug

Genome amplification of Influenza virus

Complete genome amplification of Equine

Ctedra de Virologa, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata;

Influenza viruses belong to the Orthomyxoviridae family

from infected cells. At present, 16 HA and 9 NA subtypes

The genome of equine influenza A virus contains eight

Revista Argentina de Microbiologa (2009) 41: 207-211

To amplify the influenza virus genome, two primers

Genome amplification of Influenza virus

fluid (haemagglutination titre 1:128) were mixed with 500

for 10 minutes; the program ended with one cycle at 72 C

Figure 2. RT-PCR using ssDNA as template: Lanes 3, 4 and 6:

Figure 3. RT-PCR using dsDNA as template: Lane 1: molecular

nealing at 40 C for 2 minutes and then adding 0.5 l (2.5

Revista Argentina de Microbiologa (2009) 41: 207-211

of 2233 bp, segment 4 (HA) with 1778 bp, segment 5

Genome amplification of Influenza virus

6. Oxburgh L, Klingeborn B. Cocirculation of two distinct

antigen detection, and nucleic acid amplification for detection

Recibido: 28/04/09 Aceptado: 22/09/09

Revista Argentina de Microbiologa (2009)

Brote de micoplasmosis clnica por Mycoplasma ovis en

Mycoplasma ovis, hasta hace poco Eperythrozoon ovis,

y mosquitos (Aedes camptorhynchus y Culex annulirostris)

Brote de micoplasmosis clnica por Mycoplasma ovis en ovinos

pus de la terapia con antibiticos eficaces (8, 9). Con la

Figura 1. rbol filogentico obtenido mediante un anlisis de

Las necropsias mostraron alteraciones similares en

Revista Argentina de Microbiologa (2009) 41: 212-214

argentino con abundancia de vectores (15), la primera

bovinos (8), la hiptesis de una eventual infeccin de los

1. Aguirre D, Cafrune M, Arjona C, Venzano A. Micoplasmosis

Recibido: 21/04/09 Aceptado: 28/07/09

Spoligotyping of Mycobacterium bovis isolates from cats

Mycobacterium bovis in Argentina: isolates from cats

Instituto de Biotecnologa, CICVyA-INTA, Castelar; 2Facultad de Veterinaria, Universidad de Buenos Aires;

Revista Argentina de Microbiologa (2009) 41: 215-217

University of Buenos Aires (UBA) presented tuberculosis