Você está na página 1de 90

UNIVERSIDADE ESTADUAL PAULISTA

JLIO DE MESQUITA FILHO


FACULDADE DE CINCIAS FARMACUTICAS
CMPUS DE ARARAQUARA
Programa de Ps-Graduao em Biocincias e Biotecnologia Aplicadas
Farmcia

EFEITO DA INFLAMAO DO TORNOZELO SOBRE AS


CARACTERSTICAS HISTOLGICAS, A EXPRESSO
GNICA E NVEIS DA CREATINA CINASE NOS
MSCULOS SLEO E TIBIAL ANTERIOR DE RATOS
DIABTICOS

CLARA MARIA PINHEIRO

ARARAQUARA SP
2011

CLARA MARIA PINHEIRO

EFEITO DA INFLAMAO DO TORNOZELO SOBRE AS


CARACTERSTICAS HISTOLGICAS, A EXPRESSO GNICA E NVEIS
DA CREATINA CINASE NOS MSCULOS SLEO E TIBIAL ANTERIOR DE
RATOS DIABTICOS

Equipe de trabalho:
Orientador: Prof. Dr. Iguatemy Loureno Brunetti1
Co-Orientadora: Profa. Dra. Tania de Ftima Salvini2
Apoio Financeiro: CNPq e FAPESP.

Dissertao de Mestrado no
Programa de Ps-Graduao de
Biocincias
e
Biotecnologia
Aplicadas Farmcia da Faculdade
de Cincias Farmacuticas da
Universidade Estadual Paulista
Julio de Mesquita Filho campus
Araraquara como parte dos
requisitos para o ttulo de mestre
em Biocincias e Biotecnologia
Aplicadas Farmcia. rea de
concentrao: Bioqumica.

ARARAQUARA SP
2011

1
2

Prof. Dr., Departamento de Anlises Clnicas, UNESP Araraquara.


Profa. Titular, Departamento de Fisioterapia, Universidade Federal de So Carlos.

kl

EFEITO DA INFLAMAO DO TORNOZELO SOBRE AS


CARACTERSTICAS HISTOLGICAS, A EXPRESSO GNICA E NVEIS
DA CREATINA CINASE NOS MSCULOS SLEO E TIBIAL ANTERIOR DE
RATOS DIABTICOS

COMISSO EXAMINADORA

Prof. Dr. Iguatemy Loureno Brunetti


Orientador e Presidente da Comisso Examinadora - UNESP

Profa. Dra. Amanda Martins Baviera


Universidade Federal do Mato Grosso - UFMT

Prof. Dr. Thiago Luiz de Russo


Universidade Federal de So Carlos - UFSCar

Os teus sonhos foram muito mais alm do que os teus


ps pisaram.
Os teus sonhos iro muito mais alm de onde j
chegaram.
(Trecho da msica Dom Bosco dos Sonhos de Dalcides Biscalquin)

Dedico este trabalho minha famlia que


sempre me incentivou e apoiou na
realizao de mais um sonho.

7
AGRADECIMENTOS
A experincia vivenciada durante o perodo do mestrado, sempre esteve acompanhada
por muitas pessoas que me ajudaram e ofereceram sua colaborao, apoio e conselho
nos momentos mais difceis. Agradeo pela ajuda de todos, pessoas que foram e
continuam sendo muito importantes em minha vida, pois me ajudaram a realizar mais
um sonho. Nos momentos mais difceis que conhecemos a verdadeira amizade. Fico
muito lisonjeada em saber que sou rodeada de pessoas queridas e que me ajudaram
prontamente quando eu mais precisei.
Primeiramente agradeo a Deus, sempre presente em minha vida, dando-me coragem e
fora para seguir em frente na realizao dos meus sonhos. Sinto que estou sempre em
suas mos.
Agradeo imensamente a minha famlia, em especial meus pais, Noel e Beth, meu irmo
Guilherme, minha cunhada Karina, meu sobrinho Henrique (que me chama
carinhosamente de Tatinha) e minha madrinha Teresinha. A todos vocs obrigada de
corao por andarem comigo, pelo apoio e confiana em mim, por estarem sempre na
torcida e por me ensinarem o verdadeiro sentido do AMOR e de FAMLIA.
Ao meu orientador e professor Iguatemy Loureno Brunetti, por me aceitar em seu
laboratrio. Obrigada pela ateno, pacincia e calma, dignas de uma pessoa sria, mas
extrovertida. Obrigada pelo incentivo e apoio para a apresentao do meu trabalho em
um congresso internacional, que me acrescentou muitas experincias e permitiu
conhecer o estado da arte em msculos esquelticos. Momentos que guardarei para o
resto de minha vida, com a principal lio: nunca estamos sozinhos!
minha co-orientadora e professora Tania de Ftima Salvini pela parceria com o
Laboratrio de Plasticidade Muscular que contribuiu para a realizao dessa pesquisa,
sempre abrindo portas, pela ateno e aprendizado compartilhados.
amiga Sabrina Peviani Messa, que desde a minha iniciao cientifica sempre me
incentivou no caminho da cincia e me ajudou com tanto carinho, pacincia e
dedicao. Quanto deu devo a voc! Nunca me esquecerei que sempre acreditou em
mim. Obrigada pelas conversas e pelos momentos de descontrao durante a nossa
convivncia e principalmente na fase final desse trabalho e durante a deciso de viajar
ou no para o congresso. Que Deus continue te abenoando!
Ao Guilherme e ao Hugo por tantas caronas para Araraquara.
Aos amigos e colegas do Laboratrio de Bioqumica Vnia Ortega (Cabedal), Renata,
Juliana, Vanessa, Marciano, Ricardo, Andr e Tnia pela convivncia diria,
compreenso e auxilio, troca de experincias, aprendizado e amizade.
Vnia (Cabedal) obrigada por estar sempre disposta a me ajudar, pelas risadas,
conselhos e principalmente por me ajudar na realizao desse trabalho, com tantos
detalhes... Continue sendo essa pessoa animada e divertida! Obrigada por sempre me
acompanhar nos sorvetes do Chiquinho nas tardes quentes em Araraquara.

8
Ao pessoal do Laboratrio de Plasticidade Muscular Sabrina, Joo, Gabriel, Thiago,
Davilene, Fernanda, Rubia, Paula, Catarina, Mar, Marcela, Cris. Obrigada pela
pacincia e pela convivncia.
Ao Joo, Gabriel e Sabrina. Descobri em vocs verdadeiros amigos, sei que posso
confiar em vocs de olhos fechados, nos momentos fceis e principalmente nos difceis.
Obrigada pela pacincia e dedicao. Gostaria que soubessem que sem o apoio de
vocs, talvez eu no teria participado do congresso na Alemanha. Todas as vezes que
falava do meu medo, vocs sempre me lembravam que eu seria capaz. Obrigada pelo
incentivo e pelos pensamentos positivos para que tudo fosse maravilhoso, como
realmente aconteceu.
Aos tcnicos Marcos (Laboratrio de Bioqumica - UNESP e tambm Cabedal) e Teresa
(Laboratrio de Plasticidade Muscular), muito obrigada pela ajuda, conversas e risadas.
As minhas amigas Maria Luiza e Kamilla, tambm companheiras de ps-graduao em
outras instituies, mas que sempre se mostraram preocupadas, atenciosas e
compreensivas durante essa etapa da minha vida. Obrigada pela amizade verdadeira
durante todos esses anos. Vocs so muito especiais.
Aos meu primos, primas e familiares que me acompanharam nas fases e conquistas da
minha vida, sintam-se carinhosamente lembrados.
Rosemira pelas conversas e risadas, com um alto astral, contagiando todos ao seu
redor. Quantas histrias de tomates!!
s Professoras Maria Teresa Pepato e Regina Vendramini pelo apoio durante a
realizao desse estudo.
todos que direta ou indiretamente participaram para o desenvolvimento dessa
pesquisa.
Ao CNPq pela concesso da bolsa de estudos e a Fundao de Amparo a Pesquisa do
Estado de So Paulo - FAPESP - pelo financiamento dessa pesquisa.

9
RESUMO

O Diabetes Mellitus um dos mais importantes problemas de sade pblica,


ocasionando complicaes crnicas como a atrofia muscular e perda da qualidade de
vida do paciente. Quando ocorre uma leso articular, o msculo responde com um
processo de atrofia onde gerada uma modificao no tecido muscular funcionalmente
relacionado com essa articulao. Contudo, estudos experimentais que contribuam ao
esclarecimento da relao entre inflamao articular e as modificaes histolgicas e da
expresso gnica do msculo de animais diabticos no tm sido desenvolvidos. Outro
parmetro importante que deve ser estudado a atividade da enzima creatina cinase
(CK) uma vez que sua atividade pode ser alterada em funo de vrias causas como na
injria, distrofia, inflamao ou necrose da musculatura esqueltica ou cardaca. O
presente projeto teve por objetivo estudar o efeito da inflamao aguda do tornozelo
sobre os msculos Sleo (SO) e Tibial Anterior (TA), investigando a presena de
alteraes histolgicas, alteraes na expresso gnica dos atrogenes atrogina-1e
MuRF-1 e na atividade da creatina cinase em msculos de ratos no-diabticos e
diabticos com e sem tratamento insulnico. Foram estudados 54 ratos Wistar (150g). A
induo do diabetes foi por via intrapenitoneal com 50mg de estreptozotocina (STZ) por
Kg de peso corporal, dissolvida em tampo citrato pH 4,5. Para a inflamao a
articulao do tornozelo foi mantida em 90 localizando a fossa distal e posterior ao
malolo lateral, introduzindo nesta zona uma agulha de dimetro 26 com 0.03ml
carragenina a 3%. Os grupos de animais diabticos com terapia insulnica foram
tratados duas vezes ao dia (as 8h e 17h) com 2,5 U de insulina NPH durante 13 dias,
totalizando 5U/dia A insulina foi administrada por via subcutnea. Os animais foram
divididos em 9 grupos com 6 ratos/grupo: i) animais no diabticos: Controle (C);
Citrato (Ci); Salina (S); Inflamado (Ca); ii) animais diabticos: Diabtico (D); Diabtico
tratado com Insulina (DI); Diabtico Salina (DS); Diabtico e Inflamado (DCa);
Diabtico e Inflamado, tratado com insulina (DCaI). Os msculos TA e SO destes
animais foram avaliados aps 13 dias de diabetes e 3 dias de inflamao da articulao
tbio-tarsica direita. O diabetes juntamente com a articulao inflamada promove uma
maior expresso de genes relacionados atrofia, com diminuio de massa nos dois
msculos estudados, sendo que a insulina no foi capaz de reverter essa situao no
msculo TA. Demonstrando que a regulao diferente entre msculos de contrao
lenta (SO) e msculos de contrao rpida (TA). Houve menor atividade da CK
somente no SO do grupo DCa (p<0.05), no sendo encontrada diferena entre os grupos
no TA. Tanto a inflamao como a efuso da articulao tbio-trsica regulam a
expresso de genes relacionados atrofia nos msculos TA e SO, em ratos nodiabticos e diabticos, demonstrando maior intensidade atrofia ratos diabticos com a
articulao inflamada.
Palavras-chave: diabetes, inflamao, atrogenes, atrofia muscular, creatina cinase.

10
ABSTRACT
Diabetes mellitus is one of the most serious public health problems, which diminishes
the quality of life of the patient and leads to many chronic complications, one of which
is muscle atrophy. When a joint is injured, the muscle responds with a process of
atrophy in which a change occurs in the muscle tissue functionally related to the
joint. However, no experimental studies have been carried out to clarify the relationship
between joint inflammation and changes in the histology and gene expression of
muscles in diabetic animals. Another important variable that should be studied is the
activity of the enzyme creatine kinase (CK), since it can be altered under various
conditions, such as injury, muscular dystrophy, inflammation or necrosis of skeletal or
heart muscle. The aim of this project was to study the effect of acute inflammation of
the ankle on the soleus (SO) and tibialis anterior (TA) muscles, by noting the
histological changes, changes in the expression of the atrophy-related genes (atrogenes)
atrogin-1 and MuRF-1 and activity of CK in muscles of non-diabetic and diabetic rats,
treated and untreated with insulin. We studied 54 Wistar rats (150g). Diabetes was
induced by intraperitoneal injection of 50mg streptozotocin (STZ) per kg body weight,
dissolved in citrate buffer (pH 4.5). To induce inflammation, the ankle joint was held at
90, with the fossa located distal and posterior to the lateral malleolus, and inserting a
26-gauge needle into this region, with 0.03mL of 3% carrageenan. The groups of
insulin-treated diabetic animals were treated twice a day (at 8 am and 5 pm) by
subcutaneous injection with 2.5 IU of NPH insulin, totaling 5 IU/day, for 13 days. The
animals were divided into 9 groups of 6 rats per group: i) non-diabetic animals: control
(C), citrate (Ci), saline (S), inflamed (Ca); ii) diabetic animals: diabetic (D),
diabetic treated with insulin (DI), diabetic saline (DS), diabetic inflamed (DCa) and
inflamed diabetic treated with insulin (DCaI). The TA and SO muscles of these animals
were assessed after 13 days of diabetes and 3 days of inflammation of the right tibiotarsal (ankle) joint. Diabetes combined with an inflamed joint promoted an increased
expression of genes related to atrophy, leading to a reduction in the mass of both
muscles. Insulin was unable to reverse this situation in the TA muscle, demonstrating
that the regulation is different between slow-twitch muscles (SO) and fast-twitch
muscles (TA). CK activity was lower only in the SO muscle of the DCa group (p<0.05),
no difference being found between groups in CK activity in the TA. Both inflammation
and effusion of the ankle joint regulated the expression of atrogenes in TA and SO
muscles in non-diabetic and diabetic rats, the diabetic rats with an inflamed joint
showing atrophy of greater intensity.
Keywords: diabetes, inflammation, atrogenes, muscular atrophy, creatine kinase.

11
LISTA DE FIGURAS
Figura 1. Homeostase da glicose ............................................................................

21

Figura 2. Reao da enzima creatina cinase ...........................................................

33

Figura 3. Fluxograma para diviso dos grupos de estudo.......................................

40

Figura 4. Fluxograma do experimento ...................................................................

41

Figura 5. Mecanismos propostos de toxicidade induzida pela STZ .......................

43

Figura 6. Recipiente de vidro utilizado para medio do volume........................... 45


Figura 7. Medida de volume do tornozelo .............................................................

45

Figura 8. Diviso do msculo TA aps sua retirada ..............................................

46

Figura 9. Variao da Massa Corporal ...................................................................

54

Figura 10. Glicemia dos ratos nos diferentes grupos experimentais 1 dia aps
aplicao de STZ .....................................................................................................

56

Figura 11. Massa do msculo TA dos diferentes grupos experimentais 3 dias


aps a administrao de carragenina na articulao do tornozelo direito e 10 dias
da injeo de STZ ....................................................................................................

58

Figura 12. Massa do msculo SO dos diferentes grupos experimentais 3 dias


aps a administrao de carragenina na articulao do tornozelo direito, e 10 dias
aps a injeo de STZ..............................................................................................

59

Figura 13. Cortes transversais das fibras musculares dos msculos TA corados
com azul de toluidina ..............................................................................................

60

Figura 14. rea de Seco Transversa das fibras do msculo TA dos diferentes
grupos experimentais, 3 dias aps a administrao de carragenina na articulao
do tornozelo direito, e 10 dias aps a injeo de STZ.............................................. 61
Figura 15. Expresso Gnica da atrogina-1 no msculo TA dos diferentes
grupos experimentais 3 dias aps a administrao de carragenina na articulao
do tornozelo direito, e 10 dias aps a injeo de STZ ............................................. 62

12

Figura 16. Expresso Gnica do MuRF-1 no msculo TA dos diferentes grupos


experimentais 3 dias aps a administrao de carragenina na articulao do
tornozelo direito, e 10 dias aps a injeo de STZ .................................................

63

Figura 17. Expresso Gnica da atrogina-1 no msculo SO dos diferentes grupos


experimentais 3 dias aps a administrao de carragenina na articulao do
tornozelo direito, e 10 dias aps a injeo de STZ .................................................. 64
Figura 18. Expresso Gnica do MuRF-1 no msculo SO dos diferentes grupos
experimentais 3 dias aps a administrao de carragenina na articulao do
tornozelo direito, e 10 dias aps a injeo de STZ .................................................. 65
Figura 19. Nveis musculares da atividade de CK do msculo TA dos diferentes
grupos experimentais 3 dias aps a administrao de carragenina na articulao
do tornozelo direito, e 10 dias aps a injeo de STZ ............................................. 67
Figura 20. Nveis musculares da atividade de CK do msculo SO dos diferentes
grupos experimentais 3 dias aps a administrao de carragenina na articulao
do tornozelo direito, e 10 dias aps a injeo de STZ ............................................. 68

13
LISTA DE TABELAS
Tabela I. Primers construdos com senso e antisenso para atrogina-1 , MuRF-1 e
GAPDH ...................................................................................................................

49

Tabela II. Comparao do volume (mdia desvio padro) (ml) dos grupos ......... 66

14
LISTA DE ABREVIATURAS

ATP: trifosfato de adenosina


AST: rea de seco transversa
CK: creatina cinase
cDNA: fita de DNA complementar
DM: diabetes mellitus
DO: densitometria ptica
EDL: msculo extensor digital longo
E1: enzima de ativao
E2: enzima de conjugao transporte
E3: enzima de ligao ligases
GOD: glicose oxidase
H2O2: perxido de hidrognio
IGF-1: fator de crescimento semelhante insulina tipo 1
IMA: inibio muscular artrognica
LCA: ligamento cruzado anterior
MN : motoneurnio alfa.
MuRF-1: muscle Ring Finger-1
NO: xido ntrico
OMS: Organizao Mundial de Sade
PCR: amplificao por reao em cadeia de polimerase
POD: peroxidase
PT: protenas totais
RT: transcrio reversa
RMA: resposta muscular artrogncia
SO: msculo sleo
STZ: estreptozotocina
SOD: superxido dismutase
TA: msculo tibial anterior
TNF : fator de necrose tumoral alfa

15
SUMRIO

RESUMO
ABSTRACT
LISTA DE FIGURAS
LISTA DE TABELAS
LISTA DE ABREVIATURAS

1.

INTRODUO.................................................................................................

18

1.1

Diabetes................................................................................................................ 20

1.2

Diabetes e Msculo Esqueltico..........................................................................

23

1.3

Vias Proteolticas envolvidas na atrofia muscular...............................................

25

1.4

Processo Inflamatrio..........................................................................................

28

1.5

Modelo Inflamatrio com carragenin.................................................................

29

1.6

Resposta Muscular frente s modificaes articulares........................................

29

1.7

Atrofia Muscular por desuso................................................................................ 31

1.8

Creatina Cinase....................................................................................................

33

2.

OBJETIVOS....................................................................................................... 37

3.

MATERIAIS E MTODOS.............................................................................

39

3.1

Animais ...............................................................................................................

39

3.2

Grupos Experimentais.......................................................................................... 39

3.3

Modelo de induo do diabetes por STZ.............................................................

41

3.4

Terapia insulnica.................................................................................................

43

3.5

Modelo inflamatrio............................................................................................

43

3.6

Glicemia...............................................................................................................

44

3.7

Volume................................................................................................................. 44

3.8

Retirada dos Msculos.........................................................................................

3.9

Anlise Histolgica.............................................................................................. 46

45

3.10 Extrao de RNA total.........................................................................................

47

3.11 Transcrio Reversa.............................................................................................

47

3.12 Real Time PCR.................................................................................................

48

3.13 Oligonucleotdeos primers...................................................................................

49

16
3.14 Determinao de Protenas Totais.......................................................................

49

3.15 Determinao dos nveis de creatina cinase......................................................... 50

4.

ANLISE ESTATSTICA DOS RESULTADOS..........................................

52

5.

RESULTADOS .................................................................................................

54

5.1

Massa Corporal....................................................................................................

54

5.2

Glicemia...............................................................................................................

55

5.3

Massa dos Msculos TA e SO.............................................................................

57

5.4

rea de seco Transversa................................................................................... 59

5.5

Expresso Gnica no msculo TA.......................................................................

61

5.6

Expresso Gnica no msculo SO.......................................................................

63

5.7

Volume................................................................................................................. 65

5.8

Creatina Cinase....................................................................................................

6.

DISCUSSO....................................................................................................... 70

7.

CONCLUSO....................................................................................................

8.

REFERNCIAS BIBLIOGRFICAS............................................................. 80

67

78

17

Introduo

18
1.0 INTRODUO

O msculo esqueltico um dos tecidos que apresentam grande plasticidade no


corpo humano, sendo sua composio fundamental para a sua funo de prover
mobilidade ao sistema sseo, gerar calor em resposta ao frio, alm de captar parte da
glicose circulante no organismo. Sua funo pode ser modificada em resposta a
mudanas na carga, atividade ou condies patolgicas. Por isso perodos prolongados
de desuso, desnervao e imobilizao resultam em significativa atrofia muscular
(LIEBER, 2002; BRUTON, 2002; ZHANG et al., 2006; FERREIRA et al., 2006).
Assim os msculos esquelticos so tecidos dinmicos que podem alterar suas
caractersticas fenotpicas proporcionando uma melhor adaptao funcional frente a
estmulos variados.
O msculo esqueltico apresenta uma organizao anatmica muito bem
definida. Ele constitudo por fibras recobertas por uma bainha de tecido conjuntivo
fibroso, o endomisio. Essas fibras individuais so agrupadas por um segundo tecido
conjuntivo, o perimsio, para formar fascculos de fibras. Finalmente todos os fascculos
so agrupados para formar o msculo que rodeado por um denso tecido conjuntivo, o
epimsio. Diferente dos aspectos histolgicos e morfolgicos que so iguais para todas
as fibras do msculo esqueltico, as respostas fisiolgicas e bioqumicas podem ser
diferentes de acordo com o estmulo na qual as fibras so expostas (FLUCK;
HOPPELER, 2003).
A composio do msculo em relao aos diferentes tipos de fibras depende da
funo. As fibras musculares podem ser classificadas em dois tipos principais: I e II.
Isso se d por meio de caractersticas fisiolgicas e bioqumicas. As fibras tipo I so de
contrao lenta gerando energia atravs de processos aerbicos, com menor velocidade
de propagao do clcio, e apresentam grande nmero de mitocndrias, sendo muito
resistente fadiga; recebe maior vascularizao e contm altos nveis de mioglobina,
tem baixa velocidade de contrao, relaxamento e baixa capacidade de gerar fora. As
fibras do tipo II so de contrao rpida com maior velocidade de contrao e obtm
energia atravs de processos anaerbicos. Tem alta capacidade de conduo do
potencial de ao, rpida propagao de clcio, com alta velocidade de contrao e
relaxamento, grande capacidade de gerar fora, pouca resistncia e capilarizao, baixo
nmero de mitocndrias e reduzida quantidade de mioglobina. As fibras de contrao

19
rpida so classificadas em vrios subtipos, com base na imunohistoqumica com
anticorpos especficos para a cadeia pesada de miosina (MHC), podendo ser dos tipos
IIa, IIb, IIc e IId (BOFF, 2008). A fibra IIa uma fibra rpida intermediria, possuindo
potencial moderadamente desenvolvido para gerao de fora tanto por processos
aerbicos e anaerbicos, sendo portanto de contrao rpida porm com certa
resistncia a fadiga. A fibra IIb possui maior potencial anaerbico, sendo portanto de
contrao mais rpida porm mais fatigvel que a IIa. Existem tambm as fibras
hbridas, tipos IC, IIC, IIAC, IIAD, IIDA, IIBD e IIDB, formadas pela expresso de
duas ou mais isoformas da MHC. Elas resultam da coexpresso de pares especficos de
isoformas da MHC. Msculos posturais possuem uma maior proporo de fibras de
contrao lenta (tipo I) e resistente fadiga, enquanto que os msculos envolvidos na
locomoo so compostos predominantemente por fibras de contrao rpida (tipo II) e
menos fatigveis (LIEBER, 2002).
O principal tecido que mais utiliza a glicose o crebro, e de forma
independente da insulina; segue em importncia o msculo esqueltico que difere do
primeiro, uma vez que necessita da insulina para captao da glicose sangunea.
Indivduos diabticos apresentam ausncia ou deficincia na produo de insulina e/ou
resistncia ao hormnio, o que leva a alteraes no metabolismo dos carboidratos,
protenas e lipdeos, e a desordens musculares como a atrofia muscular e a neuropatia
perifrica. O hormnio anablico insulina sintetizado pelo pncreas mantido em nveis
plasmticos adequados devido a rigorosos mecanismos de regulao (CHONKAR et al.,
2006). H tambm mecanismos contra-reguladores, como a secreo dos hormnios:
adrenalina, nor-adrenalina, cortisol e hormnio do crescimento, cuja ao contrria
insulina para que ocorra a gliconeognese.
As fibras musculares tm capacidade de alterar suas propriedades fisiolgicas e
bioqumicas de acordo com os estmulos a que so submetidas, com o resultado
refletindo na quantidade ou tipo das protenas musculares. Esta capacidade adaptativa
envolvendo diferentes componentes da fibra reflete a plasticidade muscular
(BALDWIN; HADDAD, 2001; PILEGAARD et al., 2000; PETTE, 2002).
Alteraes nas articulaes tambm podem levar a atrofia muscular devido a
diminuio do uso da articulao afetada pelo edema e/ou por dor, sendo assim, torna-se
importante conhecer a resposta muscular esqueltica frente s diversas situaes como
as alteraes da fisiologia e biomecnica articular em msculo de ratos diabticos.

20
1.1 Diabetes

O Diabetes Mellitus (DM) um dos mais srios problemas de sade pblica,


devido ao aumento de sua prevalncia e de suas complicaes; afeta a populao de
pases em todos os estgios de desenvolvimento. De acordo com a Organizao
Mundial de Sade, o Brasil o sexto pas com maior nmero de pessoas com diabetes
(SACCO et al., 2007), sendo que no mundo 285 milhes de pessoas adultas (entre 20 e
79 anos) so diabticas e em 2030 previsto um aumento de 7,7% com 439 milhes de
adultos diabticos. Os fatores que levaro a esse aumento no nmero de pessoas
diabticas so o crescimento e envelhecimento populacional, assim como a urbanizao,
associados a mudanas no estilo de vida. Esse aumento ser maior em paises em
desenvolvimento, 69% de aumento de adultos diabticos, enquanto pases
desenvolvidos sofrero um aumento de 20% (SHAW et al., 2010).
O DM faz parte de um grupo de doenas metablicas caracterizadas por
hiperglicemia resultante de defeitos na secreo, produo e/ou resistncia tecidual a
insulina. A hiperglicemia crnica no diabetes est associada a danos de longo prazo
referente disfuno e falncia de vrios rgos e tecidos especialmente olhos, rins,
nervos, vasos sanguneos, msculos cardaco e esqueltico. Essas complicaes
crnicas contribuem para o aumento da morbidade e mortalidade, ocasionando perda da
qualidade de vida do diabtico (FERNANDES et al., 2001; COMMITTEE REPORT ,
2003; SACCO et al., 2007).

21

Figura 1. Homeostase da Glicose


(retirada de http://www.portalsaofrancisco.com.br/alfa/diabetes/diabetes-mellitus-6.php)

Os processos de captao e liberao da glicose so regulados por hormnios. A


insulina o mais importante desses hormnios, uma vez que o nico hormnio capaz
de diminuir os nveis de glicose no sangue mantendo sua homeostasia, como
apresentado na Figura 1. A insulina sintetizada e secretada pelas clulas beta (clulas
) das ilhotas de Langerhans do pncreas de acordo com a demanda do organismo, e
consegue diminuir os nveis de glicose no sangue promovendo a sua captao por vrios
tipos de clulas, entre elas micitos, adipcitos e hepatcitos. No tecido adiposo, a
insulina facilita a converso de glicose em cidos graxos (lipognese) e inibe a quebra
de lipdeos (liplise). No fgado, a insulina estimula a converso de glicose em
glicognio e cidos graxos, alm de diminuir a formao de glicose a partir de outras
fontes como a converso de aminocidos em glicose pela neoglicognese. Outros
hormnios, entre eles o glucagon, tem efeito contrrio a insulina e aumentam os nveis

22
de glicose no sangue atravs da estimulao da quebra do glicognio para liberao de
glicose (glicogenlise) e aumento da velocidade da gliconeognese (CARVALHEIRA
et al., 2002).
Com base em sua etiologia o DM classificado em dois tipos principais, a
diabetes do tipo 1 (insulino-dependente), uma condio em que as clulas beta do
pncreas no produzem ou produzem muito pouco insulina; e a diabetes tipo 2 (no
insulino-dependente), considerada como uma condio na qual existe uma deficincia
das clulas

e/ou resistncia insulina nos tecidos perifricos (SATO et al., 2006).

Indivduos com maior risco de desenvolver o diabetes tipo 1 podem, muitas vezes, ser
identificados atravs de prova sorolgica para auto-imunidade, devido ao processo
patolgico que ocorre nas ilhotas pancreticas.
O diabetes tipo 1 uma forma mais frequente entre crianas e adolescentes, e
resulta da incapacidade progressiva do pncreas em produzir insulina. A velocidade de
destruio das clulas

bastante varivel, sendo rpida em algumas pessoas

(principalmente crianas) e lenta em outras (principalmente adultos). No diabetes tipo 1


os pacientes, especialmente crianas e adolescentes, podem apresentar cetoacidose
como a primeira manifestao da doena, que um quadro grave de descompensao
diabtica com risco de vida iminente. O DM tipo 2, com a hiperglicemia moderada,
pode rapidamente evoluir para hiperglicemia grave e/ou cetoacidose na presena de
infeco ou outra condio de estresse. Muitos desses indivduos com este ltimo tipo
de diabetes podem eventualmente se tornarem dependentes de insulina para a
sobrevivncia, a fim de promover reduo da glicemia e preveno da cetoacidose,
podendo a insulina exgena ser instituda assim que o diagnstico estiver estabelecido
(COMMITTEE REPORT, 2003; MANNA, 2007).
Para o diabetes tipo 2 o grau de hiperglicemia pode causar danos patolgicos e
mudanas funcionais em vrios tecidos-alvo, sem apresentar sintomas clnicos, podendo
o diabtico no detectar a doena por um longo perodo de tempo. Durante esse perodo
possvel demonstrar anormalidade no metabolismo de carboidratos, sendo detectado
pelos nveis de glicose no plasma, estando o indivduo em jejum e tambm aps uma
carga oral de glicose (COMMITTEE REPORT, 2003).
O diabetes tipo 2 de aparecimento lento, e frequentemente passa
desapercebido. Possui fator hereditrio e relao bem estabelecida com a obesidade e o
sedentarismo. Neste tipo de diabetes h uma alterao no metabolismo de glicose e
lipdios caracterizada por hiperglicemia crnica, resistncia insulina em msculo

23
esqueltico, fgado e tecido adiposo. O organismo inicialmente compensa a resistncia
insulina com uma hipersecreo do hormnio, mas com o tempo ocorre exausto das
clulas levando a deficincia insulnica, e aumento da glicemia. Assim, ao menos
inicialmente, e muitas vezes durante toda a sua vida, esses diabticos no necessitaro
de insulina para sobreviver (VIOLLET et al., 2009; SURAMPUDI et al., 2009;
COMMITTEE REPORT, 2003).
Os sintomas caractersticos do diabetes devido hiperglicemia so: poliria
(mico freqente), polidipsia (ingesto de grandes volumes de gua) e glicosria
(excreo de glicose na urina); alm de poliastenia (perda de peso), polifagia (fome
excessiva) e viso desfocada. Com a progresso da doena iniciam as complicaes
como retinopatia com perda potencial da viso; nefropatia levando insuficincia renal;
desenvolvimento da neuropatia perifrica; lceras nos ps, amputaes, e neuropatia
autonmica que causa sintomas gastrintestinais, geniturinrio, cardiovasculares e
disfuno sexual. Pacientes com diabetes tem maior incidncia de aterosclerose
cardiovascular, vascular perifrica e doena cerebrovascular, assim como hipertenso e
atrofia muscular esqueltica (COMMITTEE REPORT, 2003; CHONKAR et al., 2006).

1.2 Diabetes e Msculo esqueltico

As desordens metablicas que ocorrem no DM afetam vrios sistemas, o que


inclui os msculos esquelticos. Estas mudanas compreendem defeitos estruturais e
metablicos (PELIT et al., 2008). Os msculos esquelticos convertem energia qumica
em movimento e fora, variando de atividades rpidas e intensas a atividades de
trabalho contnuo e de baixa intensidade (BERCHTOLD et al. 2000; HOOD, 2001;
PETTE, 2002). Msculos como o sleo (SO) realizam atividades lentas, mas estveis,
como a tenso postural. J msculos como o tibial anterior (TA) realizam atividades
mais intensas e rpidas. A maioria dos msculos contm uma mistura de tipos de fibras,
mas alguns msculos possuem maior quantidade de um tipo em relao a outro. O
msculo SO, por exemplo, possui maior quantidade de fibras de miosina de cadeia leve
I e IIa, que confere a ele caractersticas ideais para a manuteno da tenso postural
(ARANY et al., 2007). A insulina um potente estimulador do transporte de glicose no
msculo (HIGAKI et al., 2001), sendo que as aes da insulina no msculo esqueltico
so influenciados pelo tipo de fibra (HICKEY et al., 1995). Os msculos diabticos com
predominncia de fibras lentas (tipo I) exibem maior sensibilidade a insulina e maior

24
captao de glicose do que msculos com predomnio de fibras rpidas (tipo II)
(SNOW; THOMPSON, 2009).
A captao da glicose mediada pela insulina difere nos grupos musculares, pois
dependente dos transportadores de glicose muscular conhecidos como GLUT-4. As
fibras musculares do tipo I expressam mais transportadores de glicose da membrana
(GLUT-4) (HARDIN, et al., 1993) uma vez que estas fibras utilizam preferencialmente
a glicose captada, do que aquela estocada na forma de glicognio dentro do msculo.
Tanto a insulina quanto o fator de crescimento semelhante insulina (IGF-1) so
determinantes importantes de massa muscular, por promoverem o crescimento por
conseqncia de estimulao da sntese protica e tambm a supresso da degradao
protica. IGF-1 promove o crescimento muscular por estmulo e diferenciao das
clulas satlites e mioncleos (HESZELE; PRICE, 2004). importante salientar que a
manuteno da massa muscular ocorre pelo equilbrio da sntese e degradao das
protenas musculares (GOLDSPINK, 1999). Portanto, qualquer estmulo que provoque
mudana na sntese e/ou degradao das protenas musculares pode levar a um
significativo impacto sobre a massa muscular. Desse modo, quando ocorre diminuio
da sntese e/ou aumento da degradao protica, ocorre a atrofia muscular. Esta pode ser
definida como a perda involuntria de 10% da massa muscular, como consequncia de
condies catablicas como o caso do DM e da sarcopenia, est associada reduo
da qualidade de vida e aumento da morbidade e mortalidade (HESZELE; PRICE,
2004). Nessas condies catablicas a perda de massa muscular notvel, seja ela pela
protelise muscular elevada ou pela apoptose dos mioncleos estar acelerada em idosos.
No DM a ausncia de insulina gera profundas alteraes metablicas no msculo
esqueltico, como reduo da captao de glicose e aminocidos, reduo da sntese de
protenas e aumento na protelise (COTTER et al., 1989). O processo de atrofia
caracterizado pela ativao de diferentes processos proteolticos, em particular um
sistema de degradao de protenas dependente de trifosfato de adenosina (ATP)
conhecido como a via ubiquitina-proteassoma. (PEPATO et al., 1996). Entre os
marcadores genticos da atrofia muscular dois genes se destacam: a atrogina-1/MAFbx
e MuRF-1, havendo aumento em suas expresses quando h perda da massa muscular.
Chonkar e colaboradores (2006) demonstraram que em ratos diabticos tipo 1,
induzidos por estreptozotocina (STZ), aps 6 a 8 semanas, ocorreu uma perda
significativa de peso e de massa muscular nos msculos extensor digital longo (EDL) e
SO. Alm disso, foi verificada a reduo da fora de contrao muscular nos mesmos

25
msculos de ratos diabticos, quando comparados ao grupo controle. Os autores
concluram que o diabetes induzida por STZ provoca atrofia muscular associada
reduo na fora de contrao dos msculos SO (fibras lentas) e EDL (fibras rpidas).
A atrofia muscular e a neuropatia so complicaes muito importantes do DM.
A neuropatia diabtica uma complicao preocupante e responsvel por graves
desabilidades (CHONKAR et al., 2006), atingindo o sistema nervoso perifrico o que
pode levar a transtornos trficos da pele e da estrutura osteoarticular do p, com
propenso a acarretar o chamado p diabtico. Os movimentos mais afetados so
flexo, inverso e everso do tornozelo e movimentos da primeira articulao
metatarsofalangeana. A atrofia muscular observada nos pacientes com neuropatia
diabtica pode causar deformidades, diminuio da amplitude de movimento do p e
tornozelo (SACCO et al., 2007).
Os nervos sural e o fibular so os primeiros a serem acometidos no decorrer da
progresso da neuropatia diabtica, sendo este o responsvel pela inervao do msculo
TA, motor primrio da flexo do tornozelo. Desse modo o TA um dos primeiros
msculos a serem comprometidos na neuropatia diabtica (SACCO et al., 2007).
Diabticos com mais de 50 anos podem apresentar a neuropatia proximal de
membros inferiores caracterizada por um grau varivel de dor e perda sensorial com
fraqueza muscular proximal e atrofia. O aparecimento da neuropatia agudo ou
subagudo. Os pacientes queixam-se de dormncia ou dores da face anterior da coxa,
muitas vezes do tipo queimao, havendo piora noite e por contato. Dificuldade em
andar e subir escadas so comuns, devido fraqueza dos msculos quadrceps e
iliopsoas (SAID, 2007).

1.3 Vias proteolticas envolvidas na atrofia muscular

Existem quatro vias proteolticas conhecidas que quando tem suas atividades
aumentadas podem contribuir para a atrofia muscular: a via das catepsinas ou
lisossomais, via das calpanas dependentes de clcio, via das caspases e via da
ubiquitina proteassoma ATP-dependente.
Na via proteoltica lisossomal, existem as proteases catepsinas B, D, H e L e
outras hidrolases cidas, presentes nos lisossomos. Essa via apresenta uma pequena
influncia sobre a protelise total, assim como ocorre com as vias dependentes de

26
clcio. As catepsinas no degradam protenas citoslicas, como as protenas
miofibrilares, seu papel maior est na degradao de protenas de membrana como
receptores, canais de ons e transportadores, protenas endocitadas e organelas.
(JACKMAN & KANDARIAN, 2004, MACHADO, 2009, POWERS et al., 2007).
Outra via de protelise a via das calpanas, que so proteases dependentes de
Ca2+ envolvidas na organizao do citoesqueleto, ciclo celular e apoptose. As fibras
msculo-esquelticas contm as calpanas-1, -2 e -3. O aumento das concentraes de
Ca2+ intracelulares pode ativar as calpanas presentes no disco Z do sarcmero capazes
de degradarem protenas importantes da arquitetura do sarcmero como a nebulina,
titina, protena-C, vinculina. Com a clivagem da titina ocorre a liberao das miofibrilas
para

serem

ubiquitinadas

degradadas

pelo

proteassoma

(JACKMAN

&

KANDARIAN, 2004, POWERS et al., 2007, ZHANG et al., 2007).


Outra via proteoltica importante a via das caspases, responsvel pela apoptose
ou morte celular programada, de modo que as caspases tornam as protenas
miofibrilares disponveis para a ubiquitinao, uma vez que o sistema proteoltico
ubiquitina proteassoma no capaz de degradar protenas intactas. (MACHADO, 2009,
POWERS et al., 2007).
Finalmente, a via ubiquitina-proteassoma, mediadora da degradao protica no
msculo esqueltico, e tem atividade especialmente aumentada em condies de atrofia
muscular. importante observar que para a atuao dessa via necessria a ao
primria da via das calpanas e/ou caspases. A via ubiquitina-proteassoma, principal via
de protelise muscular, promove a degradao de protenas miofibrilares atravs da
atividade do proteassoma, por meio da adio de uma cadeia de poliubiquitina na
protena a ser degradada (substrato), sendo esse processo altamente modulado. Isso se
d por meio da ao de trs enzimas, E1 (enzima de ativao), E2 (enzima de
conjugao-transporte) e E3 (enzima de ligao - ligases), sendo exemplo dessa enzima
a atrogina-1 e o MuRF-1. A ativao da ubiquitina pela E1 transferida a E2, que
formando um complexo ativado, se ligam a E3, que sua vez reconhece o substrato
(ubiquitinizao), devido ao domnio FBox das molculas. Assim as ligases E3
ubiquitinam tipos especficos de protenas determinando quais so alvos para a
degradao pelo proteossoma (GOMES et al., 2001, JACKMAN & KANDARIAN,
2004, ZHANG et al., 2006).

27
Duas

ligases de ubiquitina

(E3)

especficas do

msculo

aumentam

significativamente em presena de atrofia: Muscle Ring Finger-1 (MuRF-1) e Muscle


Atrophy Fbx (MAFbx) ou atrogina-1. Os nveis de RNA mensageiro (RNAm) para
atrogina-1 aumentam rapidamente antes que a diminuio do peso seja detectada e
mantm sua elevao quando a protelise acelerada, sugerindo assim que os nveis
de RNAm da atrogina-1 so importantes na manuteno da protelise de diferentes
etiologias como desnervao, imobilizao e suspenso (SACHECK et al., 2007).
A atrogina-1 constituda por um domnio F-box, o qual caracteriza uma classe
de protenas ubiquitina-ligases (E3), chamadas de complexo SCF (protena Skp1,
protena Cal, protena Ring Fingers e protena F-Box) (GOMES et al., 2001). A
atrogina-1 um exemplo de protena F-box, e desempenha um papel primordial na
ligao da protena que ser ubiquitinada e degradada (LECKER et al., 2004).
Alm da via de degradao de mioprotenas pela atrogina-1, outra protena
ubiquitina-ligase E3 chamada MuRF-1 (Muscle RING Finger 1) tambm exerce papel
de destaque na quebra de protenas (BODINE et al., 2001; CAO et al., 2005). Os
membros da famlia MuRF-1 foram encontrados associados a componentes
miofibrilares, como a titina na linha M do sarcmero, sendo estes componentes
possveis alvos da degradao pela MuRF-1 no msculo atrfico.
Outro fato interessante a resistncia atrofia muscular demonstrada em
animais knockout para os genes da atrogina-1 e MuRF-1. Ratos normais apresentaram
atrofia nos msculos gastrocnmios, em 7 e 14 dias aps desnervao. J animais
geneticamente modificados, apresentam fentipo idntico aos normais, como
morfologia e peso normal dos msculos, quando submetidos desnervao
demonstrarando uma significativa atenuao do processo de atrofia muscular, durante
os mesmos 7 e 14 dias dos animais normais (BODINE, 2001). Sendo esses resultados
demonstrativos da importncia da via de ubiquitinao como mediadora da atrofia
muscular, possvel tambm utilizar ambos MuRF-1 e a atrogina-1 como marcadores
precoces da atrofia muscular.
Um fator de transcrio nuclear envolvidos em processos de atrofia durante
processos inflamatrios o NF-B (Nuclear Fator kappa B - dependente). Este fator
est associado perda de massa muscular na inflamao crnica, pela atividade de
citocinas como o TNF- ou a IL-1, e na ausncia dessas citocinas, ativado por

28
espcies reativas de oxignio (GUTTRIDGE, 2004; LADNER, 2003). Sua ativao se
d por meio da ubiquitinao e degradao de sua protena inibitria IkB, que em estado
normal encontra-se ligada ao NF-kB mantendo-o no citoplasma (GLASS, 2005,
SANDRI, 2008,

1.4 Processo Inflamatrio


A inflamao um processo que acompanha a maior parte das doenas
articulares e as complicaes em sua resoluo so uma limitao para o rpido retorno
do sujeito s atividades de vida diria.
Quando um estmulo endgeno ou exgeno causa uma alterao na fisiologia
normal de um tecido (COTRAN et al., 2000), inicia-se uma inflamao local. Esta
constitui uma resposta de proteo para livrar o organismo da causa inicial da agresso
tecidual e de suas consequncias (COTRAN et al., 2000). A inflamao se manifesta
clinicamente atravs de cinco sinais e sintomas dor, rubor, calor, tumor e alterao na
funo.
A resposta inicial ao agente agressor chamada de inflamao aguda ocorrendo
nesta fase alteraes no calibre vascular, com constrio arteriolar e posterior dilatao
das arterolas pr-capilares, abertura dos esfncteres capilares e dilatao das vnulas,
sendo esta seqncia responsvel pela hiperemia, o que leva a exsudao. Nesta etapa
tambm ocorre a liberao de mediadores pr-inflamatrios como a histamina,
serotonina e prostaglandinas. Devido a um aumento do fluxo sanguneo h calor e
rubor. J a resposta tardia chamada de inflamao crnica caracterizada por infiltrao
de clulas mononucleares, refletindo uma reao agresso persistente. Como a presso
osmtica intravascular diminui e aumenta a presso osmtica intersticial, juntamente
com o aumento da presso hidrosttica dos vasos, causa um desequilbrio das foras,
levando sada de clulas, macromolculas e fluidos do sistema vascular, para o tecido
intersticial, gerando o edema (COTRAN et al., 2000).
Esse acmulo de lquido piora o processo inflamatrio, resultando em um
ambiente txico, que leva a morte celular e necrose tecidual (MICHOLOVITZ, 1996),
isso pode dificultar ou interromper a troca de nutrientes, atrasando o processo de
cicatrizao e recuperao do tecido. Devido ao acmulo de lquido no interior do
interstcio celular, h o aparecimento da dor, levando a imobilizao da zona lesada.

29
Pode ocorrer fibrose, aderncias e rigidez da estrutura, trazendo sequelas e aumento do
perodo de recuperao do local inflamado (GRIFFIN et al.,1990; COTRAN et al.,
2000).
1.5 Modelo inflamatrio com carragenina
Neste estudo o modelo inflamatrio utilizado no experimento, foi o modelo da
carragenina. As carrageninas so conhecidas desde o sculo XIX, e eram extradas de
algas vermelhas e utilizadas como agente emulsificante em alimentos caseiros.
Carrageninas so classes de galactoses sulfatadas, biomolculas constituintes da parede
celular de diferentes espcies de algas marinhas vermelhas (FERREIRA, 2005).
As carrageninas so utilizadas em modelos de inflamao local aguda desde
1962. H trs tipos principais de carragenina:

(kappa),

(lambda) e

(iota). Elas

ativam um grande nmero de mediadores inflamatrios tais como produtos do


metabolismo do cido araquidnico, principalmente prostaglandina I 2, as bradicininas, o
fator de necrose tumoral alfa (TNF ), substncia P, neurocininas, citocinas, xido
ntrico, entre outros (FERREIRA, 2005).
Inicialmente na inflamao causada pela carragenina ocorre infiltrao de
neutrfilos no espao perivascular, acompanhado da liberao local de compostos como
o glutamato, aspartato, substncia P, histamina e serotonina. (SLUKA; WESTLUND,
1993, NANTEL et al., 1999; HONG, 2002; LAWANDA et al., 2000; TAN-NO et al.,
2006). Estas substncias geram edema e sensibilizam os aferentes primrios resultando
em hiperalgesia primria (HARGREAVES et al., 1988). Aps produo elevada de
xido ntrico, prostaglandinas, ERON e ciclo-oxigenases, os neurnios do corno dorsal
da medula so ativados gerando sensibilizao central, espinhal ou supra-espinhal, o
que junto com o aumento dos nociceptores perifricos, manifesta-se como hiperalgesia
secundria (SLUKA; WESTLUND, 1993; TAN-NO K. et al., 2006; SALVEMINI,
1996). Essa resposta pode ser encontrada nas reas adjacentes leso e algumas vezes
em localizaes distantes.
1.6 Resposta Muscular frente s modificaes articulares
Os resultados obtidos a partir de diversos estudos clnicos permitem associar a
presena de alteraes da estrutura e fisiologia articular, com modificaes nas
propriedades dos msculos funcionalmente relacionados articulao (PALMIERI et al,

30
2003 e 2004; HOPKINS et al., 2004; WILLIAMS et al., 2004; SUETTA et al., 2007;
PAP et al., 2004; FITZGERALD et al., 2004).
Em condies como a osteoartrite (OA), caracterizada pela degenerao crnica
da cartilagem articular, diversos trabalhos tm mostrado que alteraes na fora
muscular no esto relacionadas dor nem atrofia, o que sugere a presena de um
mecanismo muscular especfico causador da perda de fora (GR et al., 2003). Neste
tipo de pacientes no tem sido esclarecido se as mudanas musculares so produtos do
desuso gerado pela OA, ou se na realidade ocorrem por mecanismos musculares
especficos (HERZOG et al., 2003, PAP et al., 2004; SUETTA et al., 2007). Ainda em
indivduos com artrite reumatide tm sido observado mudanas musculares como
infiltrados de clulas mono-nucleares sem necrose, presena de clulas plasmticas
perto dos capilares, anormalidades mitocondriais (possivelmente por estresse oxidativo
secundrio inflamao) e expresso de MHC (Major Histocompatibility Complex) tipo
II. No entanto, nestes pacientes as mudanas musculares esto associadas miopatia
inflamatria secundria patologia ou miopatia inflamatria crnica em funo do
consumo crnico de corticoesteroides (MIR et al., 1996; LINDEHAMMAR et al.,
2004).
Outras condies articulares como meniscopatias e procedimentos como a
artroscopia de joelho, mostraram diminuio na rea de seco transversa do
quadrceps, enquanto as leses do ligamento cruzado anterior (LCA) evidenciaram
modificaes no padro de recrutamento do quadrceps em atividades estticas e
dinmicas (AKIMA; FURUKAWA, 2005; WILLIAMS et al., 2004; STOCKMAR et
al., 2006).
Uma das possveis explicaes para a diminuio de fora nas condies acima
mencionadas o mecanismo de Inibio Muscular Artrognica (IMA), embora segundo
a opinio de Palmieri e colaboradores (2004), um termo mais adequado deveria seria
Resposta Muscular Artrognica, levando em conta que alguns estudos tm mostrado
facilitao (aumento reflexo H) da musculatura analisada. A IMA pode ser definida
como inibio reflexa contnua da musculatura que rodeia uma articulao depois de
leso das estruturas dessa articulao (PALMIERI et al., 2004).
Outros autores tm mostrado tambm a relao entre a leso articular e a
alterao muscular.

Stockmar e colaboradores (2006) analisaram as mudanas no

31
msculo vasto medial do quadrceps em indivduos que sofreram ruptura do LCA e
observaram que as fibras desse msculo sofreram mudanas estruturais e metablicas
importantes, mostrando atrofia, diminuio na atividade glicoltica, mudando para uma
atividade mais oxidativa com aumento da resistncia de modo a compensar a
instabilidade do joelho. Akima e Furukawa (2005) registraram que 5,2 meses (em
mdia) depois da artroscopia de joelho ou menisectomia, ocorre atrofia no quadrceps
femoral em geral, sem modificaes significativas nos msculos isquiotibiais e adutor
maior.
Considerando estes estudos fica evidente que as mudanas articulares podem
gerar alteraes na estrutura e funo dos msculos, sobressaindo a presena de atrofia,
porm, os fatores subjacentes de tais modificaes em ratos diabticos no tm sido at
hoje, suficientemente exploradas. Portanto, torna-se importante entender os mecanismos
e vias de sinalizao envolvida na atrofia muscular de ratos diabticos expostos
inflamao do tornozelo, uma vez que no conhecido se os animais diabticos,
tratados ou no com insulina, sofrem uma adaptao muscular diferente de animais
normais nas mesmas condies de estudo.

1.7 Atrofia Muscular por desuso


Conforme os resultados de modelos animais de suspenso da pata traseira em
ratos em imobilizao, a atrofia por desuso tem sido atribuda a alteraes na regulao
do metabolismo protico envolvendo diminuio na sntese e aumento na protelise no
msculo esqueltico (SIU et al., 2005; FERREIRA et al., 2006; GUILLOT et al., 2006;
ELEY et al., 2007); sendo iniciada pela reduo na tenso e na atividade contrtil do
msculo, e no por citocinas inflamatrias (ZHANG et al., 2006).
Entre os estudos que analisaram o efeito precoce do desuso sobre o msculo est
o trabalho de Ferreira e colaboradores (2006), onde estes autores investigaram o efeito
da suspenso da pata traseira de ratos sobre a resposta de seus micitos e outras clulas
no musculares como as endoteliais e fibroblastos, e a resposta apopttica.

Os

resultados mostraram que a relao da expresso DNA/protenas mudou na primeira


semana, refletindo-se assim uma diminuio no contedo de protenas e do peso
muscular neste perodo. Tambm houve um aumento notvel (200%) na atividade
mittica de clulas no musculares nas primeiras 6 horas de suspenso. Este ltimo
dado foi relacionado com o aumento do tecido conjuntivo muscular que gera atrofia

32
adicional pela diminuio no fluxo sanguneo sobre a fibra muscular. Este trabalho
mostrou tambm aumento na quantidade de mono e oligonucleossomos do citosol 6
horas depois, sendo assim evidente a presena de apoptose celular.
O efeito agudo do desuso foi tambm estudado por Sacheck e colaboradores
(2007). Neste trabalho foram comparados os efeitos de dois modelos de desuso, a
desnervao e a isolamento da coluna vertebral (laminectomia parcial das razes T7 a
S1, com seco bilateral dessas razes), sobre a expresso de genes relacionados
atrofia, analisando tambm se os efeitos foram similares com os observados em
modelos de doenas sistmicas (como cncer e diabetes).

Os resultados obtidos

mostraram que no terceiro dia do desuso ocorreu perda do peso muscular, refletindo
assim a habilidade do msculo para reagir de forma aguda ao estmulo. Um resultado
notvel deste estudo foi o aumento no RNAm de genes essenciais na atrofia rpida,
atrogina-1 e

MuRF-1, no terceiro dia; este aumento na expresso ocorreu

concomitantemente a maior perda no peso muscular. Foi evidente tambm que 78%
dos genes expressos nas doenas sistmicas foram tambm expressos no modelo
experimental de desuso, dando suporte hiptese da existncia de um programa comum
final para mediar a atrofia, sem importar a origem ou a natureza dela.
Vrios estudos mostram que o aumento na expresso da atrogina-1 e MuRF-1
em grupos de ratos com articulao inflamada, pode ser explicado atravs da ao da
citocina TNF. Estudos anteriores mostraram que a injeo de carragenina em uma
articulao causa um processo inflamatrio complexo, que envolve um grande nmero
de mediadores, dentre eles o TNF, uma citocina inflamatria envolvida no estmulo de
processos proteolticos

na musculatura esqueltica (REID; LI, 2001; RALL;

ROUBENOFF, 2004 e DOGRA et al., 2007). Estas explicaes derivam da observao


que os nveis sricos de TNF encontram-se bem elevados aps administrao de
carragenina na pata de ratos (NISHIKORI et al., 2002).
Estudos para analisar o efeito do desuso sobre o msculo tm sido realizados em
modelos de suspenso (imobilizao) por perodos de 2 4 semanas, existindo s
alguns trabalhos que analisaram o efeito precoce do desuso sobre o tecido muscular.
Siu e colaboradores (2005) encontraram que depois de 14 dias de suspenso, o
msculo gastrocnmio (GM) de ratos perdeu aproximadamente 30% do seu peso,
aumentando em 119% a fragmentao de DNA e em 73% o contedo de Bx (protena
apopttica). Os autores concluem que estes resultados sugerem que a apoptose pode ter

33
uma participao importante na atrofia nos msculos Tipo I e Tipo II, provavelmente
mediante a eliminao de mioncleos na fibra atrofiada.
Guillot e colaboradores (2006) mostraram que aps trs semanas de suspenso
da pata de ratos o msculo SO sofreu 50% de perda no seu peso enquanto que o
Extensor Digital Longo dos dedos (EDL) perdeu s 12% do peso; alm disso no SO foi
observada uma diminuio significativa (p<0.0001) das fibras Tipo I e aumento das
Tipo IIa. Foi tambm observada a presena de estresse oxidativo principalmente no SO,
e segundo os autores, a produo de radicais livres e/ou espcies reativas de oxignio
e/ou nitrognio (ERON) oxidam a membrana lipdica da fibra muscular, produzindo
leso estrutural no msculo, contribuindo provavelmente com a atrofia.
Tem sido postulado tambm que o estresse oxidativo acelera a quebra de Heat
Shock Proteins (HSP72), as quais tm uma funo preventiva na atrofia muscular em
perodos de atividade contrtil reduzida, alm de diminuir a produo de radicais livres
e/ou ERON (KU et al., 1995).

1.8 Creatina cinase (CK)

A Creatina Cinase catalisa a fosforilao reversvel da creatina a partir de fosfato


da adenosina trifosfato (ATP) formando ADP e fosfocreatina. A fosfocreatina o
principal composto fosforilado no msculo e sua concentrao cerca de oito vezes
maior do que a do ATP. Quando o msculo contrai, o ATP consumido formando ADP
e essa enzima catalisa a refosforilao do ADP para formar o ATP, utilizando a
fosfocreatina. Altos nveis de CK so encontrados no msculo estriado, crebro e tecido
cardaco.

H+
pH = 9.0
Fosfocreatina + Adenosina Difosfato

Creatina + Adenosina Trifosfato


CK, Mg 2+
pH = 6.7
Figura 2. Reao da enzima Creatina Cinase.

34
A CK um dmero composto por duas subunidades, a B (brain) e M (muscle).
Elas so produtos de dois genes estruturais diferentes, podendo existir trs pares de
diferentes dmeros: BB, MB e MM. As isoenzimas so encontradas no citosol da clula
ou associadas s estruturas miofibrilares. Existe uma quarta isoenzima que difere das
outras imunologicamente e na mobilidade eletrofortica, conhecida como CK Mt, esta
localiza-se entre as membranas mitocondriais. Tanto a CK B, quanto a CK M
existem como homo e heterodmeros no citosol, sendo sua funo evitar flutuaes dos
nveis de ATP durante os perodos de alta demanda energtica, como na contrao
cardaca e contrao do msculo esqueltico, atividade da bomba de Clcio e, excitao
neuronal. A forma mitocondrial (CK - Mt) geralmente encontrada como octamero,
com a funo de formar fosfocreatina, esta vai para o citosol onde o fosfato de alta
energia transferido de volta para ATP pela CK - M para o consumo energtico celular.
(LIN et al., 2008; BESSMAN; CARPENTER, 1985).
Nveis elevados da CK so utilizados no auxlio-diagnstico e no monitoramento
teraputico de vrias doenas como Distrofia Muscular de Duchenne, Infarto do
Miocrdio, Doenas musculares inflamatrias e degenerativas, Doenas do Sistema
Nervoso Central como Isquemia Cerebral (LIN et al., 2008; BESSMAN;
CARPENTER, 1985; BURTIS et al., 2006).
Considerando as alteraes que ocorrem no tecido muscular de ratos diabticos e
com inflamao articular, a hiptese deste trabalho que a inflamao do tornozelo em
ratos diabticos acarreta aumento na expresso gnica de genes relacionados atrofia
muscular, reduzindo tambm a rea de seco transversa das fibras e alterando os nveis
da CK muscular sendo este aumento mais acentuado que em animais normais. Para
testar esta hiptese os msculos SO e TA de ratos diabticos foram examinados aps 3
dias de induo de inflamao articular (fase aguda).
Considerando as alteraes da musculatura esqueltica no DM e a resposta
muscular devido inflamao articular, torna-se importante conhecer os mecanismos
envolvidos no incio da atrofia muscular nessa condio de diabetes agudo (13 dias da
injeo de STZ) sem e com tratamento insulnico. Alm de que, at o presente momento
no conhecemos estudos abordando a expresso de genes relacionados atrofia dos
msculos SO e TA concomitante inflamao aguda do tornozelo em ratos diabticos
agudos.

35
Os resultados deste estudo podem ser relevantes para a clnica e cincia da
reabilitao no sentido de que novas formas de tratamento ou aprimoramento das j
existentes possam ser elucidadas e contribuir com a minimizao das consequncias da
inflamao e com reduo do perodo de recuperao, acelerando o retorno do indivduo
s suas atividades funcionais e melhora da qualidade de vida de pessoas com diabetes.

36

Objetivos

37
2.0 OBJETIVOS

Avaliar o efeito da inflamao articular aguda (3 dias) sobre a expresso de


genes de atrofia, a morfologia das fibras musculares e os nveis musculares da creatina
cinase em ratos diabticos tratados ou no com insulina.

38

Materiais e Mtodos

39

3.0 MATERIAIS E MTODOS

3.1 Animais
Para o desenvolvimento do projeto foram utilizados 54 ratos Wistar com peso
mdio de 150 gramas, os quais permaneceram em caixas (4 animais por caixa), com
livre acesso gua e a rao peletizada (Purina). Os animais foram provenientes do
Biotrio Central do Campus de Botucatu UNESP e foram mantidos em biotrio do
Laboratrio de Bioqumica Clnica do Departamento de Anlises Clnicas, UNESP Araraquara, com controle da luminosidade (ciclo claro/escuro de 12h), temperatura (2225C) e umidade de 50-55%.
O experimento foi conduzido segundo as normas internacionais de tica na
experimentao animal (National Research Council, 1996) e aps a aprovao do
Comit de tica Animal da Universidade Estadual Paulista - Faculdade de Cincias
Farmacuticas Unesp, Campus Araraquara (Protocolo CEP/FCF/CAr n 31/2009).
Todos os procedimentos experimentais foram realizados com os animais
anestesiados usando injeo intraperitonial de soluo de xilazina 12 mg/Kg/peso
corporal e quetamina 95 mg/Kg/peso por via intraperitoneal.

3.2 Grupos Experimentais

Os 54 animais foram distribudos em um dos nove grupos, aps pareamento,


utilizando como critrio a glicemia de cada animal (seis animais por grupo):
1) Controle - C: Animais normais (no-diabticos), no receberam qualquer tipo de
interveno.
2) Citrato - Ci: Animais normais (no-diabticos), receberam injeo intrapenitoneal de
tampo citrato.
3) Salina - S: Animais normais (no-diabticos), receberam somente administrao de
salina na articulao do tornozelo direito.

40
4) Inflamado - Ca: Animais normais (no-diabticos), receberam a administrao de carragenina na articulao do tornozelo direito.
5) Diabtico - D: Animais que receberam injeo intrapenitoneal de estreptozotocina
(STZ), e no receberam qualquer tipo de interveno no tornozelo.
6) Diabtico Insulina - DI: Animais que receberam injeo intrapenitoneal de STZ e
foram tratados com insulina e no receberam qualquer tipo de interveno no tornozelo.
7) Diabtico Salina DS: Animais que receberam injeo intrapenitoneal de STZ e
receberam a administrao de salina na articulao do tornozelo direito.
8) Diabtico e Inflamado - DCa: Animais que receberam injeo intrapenitoneal de
STZ e foram submetidos administrao de -carragenina na articulao do tornozelo
direito.
9) Diabtico e Inflamado, tratado com insulina - DCaI: Animais que receberam
injeo intrapenitoneal de STZ, foram tratados com insulina e submetidos
administrao de -carragenina na articulao do tornozelo direito.

54 animais

30 animais

24 animais

Induo diabetes (STZ-50 mg/kg)

Pareamento (glicemia)

Diabticos

Normais (No - Diabticos)

D
DS

DI

DCa

DCaI

Figura 3. Fluxograma para diviso dos grupos de estudo.

Ci

Ca

41

STZ
dias de tratamento
A)
B)

10

11

12

13

Inflamao ou Efuso

A) Administrao de STZ
B) Inflamao ou efuso
Figura 4. Fluxograma do experimento

3.3 Modelo de induo do diabetes por STZ

Para a induo do diabetes os animais foram submetidos a jejum prvio de 14-16


horas para administrao por via intrapenitoneal de 50mg de STZ por Kg de peso
corporal, dissolvida em tampo citrato pH 4,5 (DELFINO et al., 2002).
A STZ um antibitico e agente alquilante que capaz de inibir a secreo de
insulina e causar um estado de Diabetes Mellitus (tipo I) cerca de uma hora aps sua
administrao por via endovenosa em ratos. Isso acontece devido a sua estrutura, que
destri seletivamente as clulas -pancreticas, promovendo sua degranulao
(GOODNER, 1973; ANDERSON et al., 1974).
A STZ possui, em sua estrutura (Figura 3), um grupo glicdico derivado da 2deoxi-D-glicose que reconhecido pelos transportadores de glicose das clulas ,
permitindo sua entrada destas clulas (HERR et al.,1967; SCHEIN; LOFTUS, 1968
ANDERSON et al., 1974; GOODNER, 1973) e um grupo N-metil-N-nitrosouria
ligado ao carbono 2 da hexose, sendo este citotxico para as clulas -pancreticas; a
hexose reconhecida pelos transportadores de glicose (GLUT-2), e faz com que a STZ
se acumule nas clulas pancreticas. Clulas produtoras de insulina que no
expressam GLUT2 em sua membrana plasmtica so resistentes STZ (ANDERSON et
al., 1974; SCHEIN; LOFTUS, 1968).

42
O grupo N-metil-N-nitrosouria inibe a atividade da enzima superxido
dismutase (SOD), permitindo o acmulo de ERON, espcies txicas s clulas
(FISCHER; HAMBURGUER, 1979; GRANKVIST et al., 1981; PAPACCIO et al.,
1986). O acmulo dessas espcies reativas promove a degradao do DNA nuclear
(SANDLER et al.,1983), havendo consequentemente a ativao de uma enzima
reparadora de DNA, a poli (ADP-ribose) sintetase (PARP) (YAMAMOTO et al., 1981),
que utiliza como substrato nicotinamida adenina dinucleotdeo (NAD+). A elevao da
atividade desta enzima provoca a depleo de NAD+ intracelular (SCHEIN &
LOFTUS, 1968), levando inibio da respirao celular, da produo de ATP e da
sntese protica (consequentemente queda na sntese de pr-insulina) (YAMAMOTO et
al., 1981; UCHIGATA et al., 1982), havendo perda do balano inico celular com
posterior apoptose (SANDLER et al., 1983).
Existem outros mecanismos pelos quais a STZ causa danos em clulas pancreticas, por exemplo, a STZ, como sendo um potente agente alquilante, promove a
alquilao direta do DNA atravs de radicais metil ou ctions metil, via sua
decomposio (BENNET; PEGG, 1981; JOHANSSON; TJALVA, 1978). Essa
metilao ocorre mais especificamente nas guaninas, induzindo a apoptose nas clulas
(MURATA et al., 1999). Outra hiptese a gerao de ERON (KWON et al., 1994;
BEDOYA et al., 1996; KANETO et al., 1995; KRONCKE et al., 1995; LENZEN,
2008), que podem participar da toxicidade da molcula na promoo para a
diabetognese.

43

decomposio

CH3+ ou CH3

* metilao do DNA

decomposio e metabolizao

O2- e/ou

NO

** modificao do DNA

Figura 5. Mecanismos propostos de toxicidade induzida pela STZ.

Metilao do DNA induzida por CH3+ ou CH3.

** Modificao do DNA induzida por espcies reativas de oxignio e/ou nitrognio.

3.4 Terapia insulnica


Os grupos de animais diabticos com terapia insulnica foram tratados duas
vezes ao dia (as 8h e 17h) com 2,5 U de insulina NPH (Humulin NPH U-100 Lilly) por
13 dias, totalizando 5U/dia A insulina foi administrada por via subcutnea.

3.5 Modelo inflamatrio


Aps serem pesados e anestesiados, os animais dos grupos Ca, DCa, DCaI e
receberam 0.03ml de carragenina a 3% (Sigma Chemical Company - St. Louis, USA)
na articulao tbio-tarsica direita, dissolvida em soluo salina, seguindo o mtodo
descrito por Omote e colaboradores (2002), e Wang e colaboradores (2000).

procedimento consistiu em manter a articulao do tornozelo em 90, localizando a


fossa distal e posterior ao malolo lateral, introduzindo nesta zona uma agulha
(dimetro 26), a qual foi dirigida distalmente para a cpsula articular at a percepo da
perda de resistncia, injetando nesse momento a carragenina. Os animais dos grupos S e
DS receberam mediante o mesmo procedimento a injeo de 0.03ml de salina. Aps
tais procedimentos da injeo os animais permaneceram nas caixas sob condies j

44
descritas sem restries na sua atividade e foram eutanaziados ao trmino do
experimento.

3.6 Glicemia

Para determinar a glicemia dos animais utilizamos o mtodo da glicose-oxidase.


Foi retirado da cauda aproximadamente 1ml de sangue obtido o plasma para a anlise.
A glicose-oxidase (GOD), presente no reagente catalisa a oxidao da glicose da
amostra, em presena de H2O, originando cido glucnico e perxido de hidrognio.

GOD
Glicose + O2 + H2O

cido Glucnico + H2O2

Numa segunda etapa da reao o perxido de hidrognio reage com 4aminoantipirina e fenol, em reao catalizada por peroxidase (POD). Esta reao
oxidativa de acoplamento forma a antipirilquinonimina (com absoro mxima entre
490 e 520 nm) proporcional concentrao de glicose na amostra.

POD
2H2O2

fenol

4-aminoantipirina

antipirilquinonimina + 4H2O .

3.7 Volume
Os volumes dos tornozelos direitos foram avaliados por um mtodo baseado no
princpio de Arquimedes. Este mtodo considerado o padro-ouro e demonstrou alta
reprodutibilidade (CCI = 0,99) com um erro inferior a 1%. Um recipiente de vidro foi
especialmente produzido, com orifcio e ducto para dar vazamento ao excesso de gua e
para conter a pata e o tornozelo do animal (5 centmetros de altura e 4 centmetros de
dimetro). O recipiente foi previamente calibrado para garantir a reprodutibilidade das
medidas de volume (ICC = 0,93). Para padronizar a medida, uma marca foi feito no
tornozelo dos ratos, 1 centmetro a partir da base do calcanhar. O animal foi suspenso
por um dispositivo semelhante ao utilizado por Dolan e colaboradores (2003). O frasco
foi preenchido com gua at exceder um volume pr-estabelecido pelo orifcio com o
excesso de gua vertido at a estabilizao do fluxo. Em seguida, a pata direita do

45
animal foi colocada no recipiente at a marca no tornozelo. A gua deslocada foi
coletada e pesada, seu volume foi calculado considerando sua densidade como igual a
1g/ml. Esta medida foi realizada antes e 3 dias aps a induo da inflamao nos grupos
S, Ca, DS, DCa e DCaI (Figuras 5 e 6).

Figura 6. Recipiente de vidro utilizado para medio do volume.

Figura 7. Medida do volume do tornozelo.

3.8 Retirada dos msculos

Foram retirados os msculos SO e TA direitos com os animais vivos e


anestesiados, aps 13 dias da injeo de STZ e 3 dias aps a injeo de carragenina.
Aps a retirada, cada msculo foi pesado e dividido com um corte horizontal no seu
ventre deixando uma poro para a extrao de RNA total e determinao da atividade
da CK e outra parte foi utilizada para anlise histolgica da area de seco transversa
(AST).
Parte dos msculos TAs utilizados para anlise histolgica, foram congelados
em isopentano com nitrognio lquido e armazenados em freezer a 80C. A parte

46
destinada extrao do RNA total foi armazenada em microtubo (eppendorfe)
autoclavado e congelado em nitrognio lquido e posteriormente armazenado em freezer
a 80C at sua anlise. No foi realizada a anlise histologia no msculo SO devido a
falta de massa muscular para as outras anlises, que foram priorizadas. Para anlise da
CK o sobrenadante dos msculos triturados (0.040 gramas em 1 ml de tampo fosfato
pH 7.4) foram aliquotados em microtubos (eppendorf), congelados em nitrognio
lquido e armazenados em freezer a 80C para quantificao de protenas totais e da
enzima. Aps a retirada dos msculos, os animais foram eutanaziados com overdose de
anestesia.

AST
CK + PT

Comprimento do Msculo

RNA

Figura 8. Diviso do msculo TA aps sua retirada. Sendo AST rea de seco transversa; CK
creatina cinase; PT protenas totais e RNA extrao de RNA para expresso gnica.

3.9 Anlise Histolgica

A partir de msculos TA de todos os ratos, foram obtidos cortes histolgicos


transversais e seriados (10 m), em micrtomo criostato, mantidos 25C. As lminas

47
com os cortes histolgicos foram coradas com azul de toluidina (TB) para avaliao
morfolgica e morfomtrica.
Uma vez os cortes corados com TB, foi realizada uma anlise morfolgica geral
sobre a estrutura muscular, comparando entre os diferentes grupos, atravs do corte
histolgico transversal da regio central do ventre de cada msculo TA.

Para a

obteno das fotos dos cortes, um microscpio (Axiolab, Carl Zeiss, Jena, Alemanha)
equipado com uma cmera digital (Sony DSC S75, Tkio, Japo) foi usado. A rea de
seco transversal de cem fibras musculares, escolhidas aleatoriamente, de cada
msculo foram mensuradas a partir da imagem obtida da regio central do ventre
muscular usando o software ImageJ.
3.10 Extrao de RNA total
A extrao de RNA total de cada animal foi obtida a partir de 100 mg de
msculo, utilizando-se o reagente Trizol (Gibco) pelo mtodo descrito por
Chomczynski e Sacchi (1987). O trizol mantm a integridade do RNA enquanto rompe
as clulas e dissolve os componentes celulares. Em seguida foi adicionado o
clorofrmio, seguido de centrifugao, separando a soluo em fases aquosa onde o
RNA permanece exclusivamente e fase orgnica. Aps o isolamento da fase aquosa, o
RNA foi precipitado com isopropanol. O pellet foi lavado com etanol e
subsequentemente dissolvido em 30ul de gua livre de RNAses. A absorbncia das
amostras foi determinada em 260nm; para avaliar a qualidade do RNA isolado foi
determinada a razo entre as absorbncias a 260 e 280 nm (razo

1.8). Os estoques de

RNA foram mantidos a 80C. Tambm foi avaliada a qualidade do material por
eletroforese das amostras (2 g de RNA total) em gel denaturante de agarose-formamida
(1%), em tampo MOPS (40mM de cido morfolinopropanosulfnico). Posteriormente,
os gis foram observados com brometo de etdeo.

3.11 Transcrio Reversa (RT)

Aps o isolamento do RNA total, foram realizadas as transcries reversas (RT)


utilizando 1g de RNA total. A reao de RT foi realizada da seguinte forma:

48
Quantidades variadas de RNA total: 200 u de Transcriptase Reversa; 0,8 mM dNTPs; 1
mM MgC2; 0,02 ug/ul primer oligo dT; 4 mM DTT. A reao foi realizada em um
termociclador (Eppendorf Hamburgo, Alemanha) (10 minutos a 70C, 60 minutos a
42C e 10 minutos a 94C). A integridade do produto da RT (cDNAs) foi conferida
atravs da realizao de gel de agarose (1%) no desnaturante, corado com brometo de
etdeo.

3.12 Real Time-PCR

Em seguida, diferentes fraes das RTs foram utilizadas na amplificao em


cadeia por Polimerase (PCR) com monitoramento da gerao de amplicons em tempo
real (PCR real-time, Rotor Gene 3000, Cobert Research).
As amplificaes por PCR foram efetuadas utilizando-se 10-80ng/ l de cDNA
adicionado a uma reao contendo 25 l de SYBR Green PCR master misx, 50-900nM
dos primers (senso e antisenso) em uma soluo com volume final de 55 l , dividido em
duplicata. As condies de ciclagem ocorreram conforme a padronizao de cada
primer.
Aps a reao de PCR, foi possvel determinar o incio da fase de amplificao
exponencial (Ct, cycle threshold), sendo que os valores de cada amostra foram
utilizados como dados para a anlise da expresso gnica do GAPDH, atrogina-1 e
MuRF-1. Os dados foram analisados usando o mtodo de comparao absoluta por
meio da curva padro que possibilitou determinar a diferena entre os valores de Cts
das amostras.
A normalizao dos dados foi feita pelo gene constitutido GAPDH, usado como
controle interno. Outro gene constitutivo, o RPLPO tambm foi mensurado para
confirmao dos resultados, no entanto, no houve diferena entre as razes:
RPLPO/GAPDH ou GAPDH/RPLPO. Por este motivo o GAPDH foi escolhido como o
gene constitutivo deste estudo.

49
3.13 Oligonucleotdeos primers
Os oligonucleotdeos, que foram utilizados como primers, para as reaes de
polimerase em cadeia para atrogina-1 foram construdos utilizando-se o Primer Express
Software (Applied Biosystems, Foster City, CA), como mostrado na tabela. Os Primers
para MuRF-1 foram retirados de Granado e colaboradores (2005).
Tabela I: Primers construdos com senso e antisenso para atrogina-1, MuRF-1 e
GAPDH.
Primer

Senso

atrogina-1 TACTAAGGAGCGCCATGGATACT

Antisenso
GTTGAATCTTCTGGATCCAGGAT

MuRF-1

TGTCTGGAGGTCGTTTCCG

ATGCCGGTCCATGATCACTT

GAPDH

GATGCTGGTGCTGAGTATGTCG

GTGGTG-CAGGATGCATTGCTGA

Primers construdos com dados do GeneBank: atrogina-1 (AF441120) (J Physiol,


549(2), 409418, 2003); MuRF-1 Granado et al., 2005 (Am J Physiol Endocrinol
Metab. 289: 10071014); GAPDH (AF106860).

3.14 Determinao de Protenas Totais

Para determinao das protenas totais, foi utilizada uma alquota do


sobrenadante do extrato muscular, sendo o contedo proteco das amostras determinado
pelo mtodo descrito por Hartree (1972), usando soro de albumina bovina para
construo da curva analtica. Foram preparadas trs solues com os seguintes
reagentes:
i) Soluo A: a 2g de Tartarato de Sdio e potssio, foram misturados a 100g de
Na2CO3, dissolvidos em 500 mL de NaOH 1 mol/L e diludos com gua Milli-Q para 1
litro;
ii) Soluo B: a 2g de Tartarato de sdio e potssio, foi adicinado 1g de CuSO 4.5 H2O,
dissolvidos em 90 mL de gua e 10 mL de NAOH 1mol/L;
iii) Soluo C: 1 volume do Folin-Ciocalteau diludos em 15 volumes de gua Milli-Q.
Esta soluo (preparada diariamente) esta entre 0,15 mol/L e 0,18 mol/L quando titulada
para pH 10 com NaOH 1 mol/L.

50
Em tubos de ensaio adicionou-se 200 l de amostra diluda adequadamente em
tampo fostato de sdio pH 7,4 e 180 l da soluo A, os tubos foram levados ao banho
em 50oC durante 10 minutos. Aps estabilizao em temperatura ambiente, foi
adicionado aos tubos 20 l da soluo B e deixados em temperatura ambiente por 10
minutos. Para finalizar, foi adicionado 600 l da soluo C e levados ao banho de 50C
por 10 minutos. Resfriados a temperatura ambiente, foram retirados 300 l da reao
final para a leitura no espectrofotmetro de placa a 650 nm.
A determinao de protenas totais foi realizada para normalizao dos dados da
CK muscular.

3.15 Determinao de nveis de Creatina Cinase (CK)

Para a determinao da atividade da CK foram obtidas amostras dos msculos


TA e SO coletadas aps 3 dias de inflamao do tornozelo.
Uma amostra de 0,040g de msculo foi retirada e colocada em um microtubo
com 1ml de tampo fosfato (0,01M e pH 7,4), triturada em homogenizador (modelo
Metabo), em banho de gelo, com velocidade de 27 mil rpm, durante 1 minuto e meio.
Aps a homogenizao o tubo foi centrfugado por trinta minutos a 4C e a 12.000 g.
Uma alquota do sobrenadante foi diluda adequadamente para a determinao
enzimtica (PEREIRA et al., 1998).
Foi utilizado o mtodo cintico CK_NAC (COMMITEE ENZYMES, 1976;
OLIVER, 1955). Este mtodo acopla reao da CK as reaes enzimticas
sequenciais, hexoquinase e glicose-6-fosfato desidrogenase, que levam a formao de
NADPH, o qual quantificado por espectrofotometria no UV.

51

Anlise Estatstica

52

4.0 ANLISE ESTATSTICA DOS RESULTADOS

Inicialmente foram aplicados os testes Shapiro Wilks e Levene para avaliar a


normalidade e homogeneidade dos dados, respectivamente. O ANOVA one-way
seguido pelo Teste de Tukey foi ento usado para detectar possveis diferenas entre os
grupos. O t de Student pareado foi utilizado para a comparao entre os volumes inicial
e final do tornozelo. O nvel de significncia mnimo estabelecido foi de 0,05. Para isto
utilizou-se o software GraphPad Instat (Verso 3.00, 32 bit para Windows 95).

53

Resultados

54
5.0 RESULTADOS

5.1 Massa Corporal

Houve variao no ganho de massa corporal entre os grupos experimentais


(Figura 9). Nos grupos de ratos diabticos D, DS, DCa o ganho de massa foi
significativamente menor, em relao aos grupos C, Ci, S e Ca, para o grupo DCa foi
observado o menor ganho de massa em relao aos demais grupos. Por outro lado, os
grupos diabticos tratados com insulina tiveram o ganho de massa igual aos grupos nodiabticos (C, Ci, S e Ca), indicando eficincia do tratamento insulnico na variao da
massa corporal.

Figura 9. Variao da massa corporal. Valores apresentados em mdias DP, onde a representa diferena estatstica
com o grupo C; b: diferena estatstica com Ci; c: diferena estatstica com S; d: diferena estatstica com Ca; e:
diferena estatstica com D; f: diferena estatstica com DI; g: diferena estatstica com DS e h: diferena estatstica com
DCa (*p<0,05; **p<0,01 e ***p<0,001). Sendo, C: grupo controle sem nenhuma interveno; Ci: grupo no-diabetico
com administrao intrapenitoneal de citrato; S: grupo no-diabetico com administrao de salina na articulao do
tornozelo direito; Ca: grupo no-diabetico com administrao de -carragenina; D: grupo diabtico sem interveno na
articulao do tornozelo; DI: grupo diabtico tratado com insulina; DS: grupo diabtico com administrao de salina na
articulao do tornozelo direito; DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico com
administrao de -carragenina e tratado com insulina.

55
5.2 Glicemia

Observa-se que os nveis glicmicos dos grupos no-diabticos (C, Ci, S e Ca)
no apresentaram diferena estatstica entre os nveis glicmicos iniciais e finais. Por
outro lado, houve um aumento da glicemia nos grupos diabticos (DCa, DCaI, DI e DS)
comparado com os grupos no-diabticos (C, Ci, S e Ca) (p<0.001) logo aps 3 dias da
administrao da STZ (Figura 10). Uma vez que o pareamento dos animais foi realizado
com base na glicemia, no foi observada diferena entre os grupos no-diabticos, como
tambm no foi observada diferena na hiperglicemia entre os grupos diabticos.
Os nveis glicmicos dos grupos D, DS e DCa permaneceram elevados no
final do experimento quando comparados com os grupos no-diabticos (C, Ci, S e Ca).
Contudo, nos grupos diabticos tratados com insulina (DCaI e DI), os nveis glicmicos
foram mantidos semelhantes aos nveis dos grupos no-diabticos, demonstrando a
eficincia do tratamento insulnico na manuteno da glicemia.
importante observar que a inflamao da articulao pela administrao de
carragenina no influenciou os nveis glicmicos dos animais, diabticos ou no.

56

Figura 10. Glicemia dos ratos nos diferentes grupos experimentais 1 dia aps a administrao de STZ (glicemia inicial)
e aps 13 dias aps a administrao de STZ (glicemia final). Valores apresentados em mdias DP, onde a representa
diferena estatstica com o grupo C; b: diferena estatstica com Ci; c: diferena estatstica com S; d: diferena estatstica
com Ca; e: diferena estatstica com D; f: diferena estatstica com DI; g: diferena estatstica com DS e h: diferena
estatstica com DCa (*p<0,05; **p<0,01; ***p<0,001 e # representa a diferena inicial e final significativa p<0,05
entre o mesmo grupo). Sendo, C: grupo controle sem nenhuma interveno; Ci: grupo no-diabetico com administrao
intrapenitoneal de citrato; S: grupo no-diabetico com administrao de salina na articulao do tornozelo direito; Ca:
grupo no-diabetico com administrao de -carragenina; D: grupo diabtico sem interveno na articulao do
tornozelo; DI: grupo diabtico tratado com insulina; DS: grupo diabtico com administrao de salina na articulao do
tornozelo direito; DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico com administrao
de -carragenina e tratado com insulina.

57
5.3 Massa dos msculos TA e SO

Em relao ao msculo TA, somente no grupo Ca houve perda de massa


quando comparado aos outros grupos no-diabticos (Figura 11). Todos os grupos
diabticos apresentaram perda de massa com exceo do grupo DI que manteve sua
massa igual as massas dos grupos C, Ci, S, mostrando que a insulina reverteu a perda de
massa muscular quando comparada ao grupo D. Os grupos diabticos que tiveram
interveno no tornozelo (DS, DCa, DCaI) mostraram perda de massa em relao aos
dos grupos C e Ci. Apenas o grupo DCa apresentou diminuio de massa em relao
aos grupos C, Ci, S e aos demais grupos diabticos (D, DI, DS, DCaI). Nesse caso, o
tratamento com insulina no grupo diabtico e inflamado (DCaI) amenizou a perda de
massa quando comparado ao grupo DCa, sugerindo que o tratamento com insulina
apesar de no ser capaz de manter a massa igual aos grupos C, Ci, S, capaz de
minimizar a sua perda em relao a inflamao na diabetes.

58

Figura 11. Massa do msculo Tibial Anterior dos diferentes grupos experimentais 3 dias aps a administrao de
carragenina na articulao do tornozelo direito, e 10 dias aps a injeo de STZ. Resultados normalizados pela massa
corporal final de cada animal. Valores apresentados em mdias DP, onde a representa diferena estatstica com o grupo
C; b: diferena estatstica com Ci; c: diferena estatstica com S; d: diferena estatstica com Ca; e: diferena estatstica
com D; f: diferena estatstica com DI, g: diferena estatstica com DS (*p<0,05; **p<0,01 e ***p<0,001). Sendo, C:
grupo controle sem nenhuma interveno; Ci: grupo no-diabetico com administrao intrapenitoneal de citrato; S: grupo
no-diabetico com administrao de salina na articulao do tornozelo direito; Ca: grupo no-diabetico com
administrao de -carragenina; D: grupo diabtico sem interveno na articulao do tornozelo; DI: grupo diabtico
tratado com insulina; DS: grupo diabtico com administrao de salina na articulao do tornozelo direito; DCa: grupo
diabtico com administrao de -carragenina; DCaI: grupo diabtico com administrao de -carragenina e tratado com
insulina.

Em relao ao msculo SO, os grupos no-diabticos com interveno na


articulao do tornozelo (salina ou carragenina) tiveram a mesma perda de massa
muscular em relao aos grupos C e Ci, sugerindo que a interveno na articulao foi
mais importante do que a natureza das substncias injetadas (Figura 12).
Todos os grupos diabticos apresentaram perda de massa em relao aos
grupos C e Ci, sendo que o grupo DCa apresentou a maior perda de massa muscular
quando comparado aos demais grupos. O tratamento com insulina no grupo diabtico e
inflamado (DCaI) amenizou a perda de massa do msculo SO quando comparado ao
grupo DCa, sugerindo que o tratamento com insulina apesar de no ser capaz de manter

59
a massa igual aos grupos C e Ci, capaz de minimizar a sua perda em relao a
inflamao na diabetes, assim como observado no msculo TA. Alm disso, a
inflamao com carragenina parece ter maiores efeitos sobre a perda de massa no
msculo de ratos diabticos quando comparado aos seus efeitos no msculo de ratos
no-diabticos.

Figura 12. Massa do msculo SO dos diferentes grupos experimentais 3 dias aps a administrao de carragenina na
articulao do tornozelo direito, e 10 dias aps a injeo de STZ. Resultados normalizados pela massa corporal final de
cada animal. Valores apresentados em mdias DP, onde a representa diferena estatstica com o grupo C; b: diferena
estatstica com Ci; c: diferena estatstica com S; d: diferena estatstica com Ca; e: diferena estatstica com D; f:
diferena estatstica com DI; g: diferena estatstica com DS e h: diferena estatstica com DCa (*p<0,05; **p<0,01 e
***p<0,001). Sendo, C: grupo controle sem nenhuma interveno; Ci: grupo no-diabetico com administrao
intrapenitoneal de citrato; S: grupo no-diabetico com administrao de salina na articulao do tornozelo direito; Ca:
grupo no-diabetico com administrao de -carragenina; D: grupo diabtico sem interveno na articulao do
tornozelo; DI: grupo diabtico tratado com insulina; DS: grupo diabtico com administrao de salina na articulao do
tornozelo direito; DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico com administrao
de -carragenina e tratado com insulina.

5.4 rea de Seco Transversa (AST)

A figura 13 mostra uma intensa atrofia das fibras musculares dos msculos TA
nos grupos diabticos, assim como nos grupos que tiveram alguma interveno no
tornozelo com carragenina ou soro, quando comparados ao grupo C. A atrofia das fibras
musculares foi tambm confirmada pela diminuio da AST nos grupos S e Ca no-

60
diabticos em relao a C e Ci (Figura 14). Nos grupos diabticos tambm foi
observada uma diminuio da AST em relao a C e Ci. O grupo D apresentou a mesma
diminuio que os grupos DS, DCa, DCaI. Torna-se importante observar que como no
houve diferena entre os grupos no-diabticos S e Ca, assim como entre os grupos
diabticos DS, DCa e DCaI, a diminuio na AST deve ser dependente da distenso da
cpsula articular tanto pela salina quanto pela carragenina.
Alm disso, o tratamento com insulina no foi capaz de influenciar a
recuperao da AST no grupo DI em relao ao grupo D, nem entre os grupos DCaI e
DCa.

Ci

NI
Ca

D
DI

DS
D
S

DCa
D
I

DCaI
D
Ii

Figura 13. Cortes transversais das fibras musculares dos msculos TA corados com azul de toluidina.
Observe a atrofia das fibras musculares dos msculos TA dos grupos diabticos (D, DS, DCa e DCaI),
principalmente dos grupos DS, DCa e DCaI . Barra, 100 m.

61

Figura 14. rea de Seco Transversa das fibras do msculo TA dos diferentes grupos experimentais, 3 dias aps a
administrao de carragenina na articulao do tornozelo direito, e 10 dias aps a injeo de STZ. Resultado
normalizado pela massa corporal de cada animal. Resultados so mdia e desvio padro, onde a: representa diferena
estatstica com o grupo C; b: diferena estatstica com Ci; c: diferena estatstica com S; d: diferena estatstica com Ca e
f: diferena estatstica com DI (*p<0,05; **p<0,01 e ***p<0,001). Sendo, C: grupo controle sem nenhuma interveno;
Ci: grupo no-diabetico com administrao intrapenitoneal de citrato; S: grupo no-diabetico com administrao de
salina na articulao do tornozelo direito; Ca: grupo no-diabetico com administrao de -carragenina; D: grupo
diabtico sem interveno na articulao do tornozelo; DI: grupo diabtico tratado com insulina; DS: grupo diabtico
com administrao de salina na articulao do tornozelo direito; DCa: grupo diabtico com administrao de carragenina; DCaI: grupo diabtico com administrao de -carragenina e tratado com insulina.

Inicialmente foi proposta a anlise da AST tambm do msculo SO, mas no


houve massa muscular suficiente para sua realizao, sendo dessa forma priorizada a
anlise dos nveis de CK e da expresso gnica neste msculo.

5.5 Expresso Gnica no msculo TA

Analisando a Figura 15, observa-se que a distenso da cpsula da articulao


tbio-trsica aumentou a expresso gnica da atrogina-1 nos grupos S, Ca, DS e DCa em
relao ao C, Ci, D e DI. Oberva-se ainda que para o perodo avaliado, os grupos D e DI
no sofreram alterao da expresso da atrogina-1. Alm disso, o tratamento com
insulina foi capaz restabelecer a expresso da atrogina-1 no grupo DCaI, em relao ao
grupo DCa.

62

Figura 15. Expresso gnica da atrogina-1 no msculo TA dos diferentes grupos experimentais, 3 dias aps a
administrao de carragenina na articulao do tornozelo direito, e 10 dias aps a injeo de STZ. Resultados so mdia
e desvio padro, onde a representa diferena estatstica com o grupo C; b diferena estatstica com Ci; c diferena
estatstica com S; e diferena estatstica com D; h diferena estatstica com DCa (*p<0,05; **p<0,01 e ***p<0,001).
Sendo, C: grupo controle sem nenhuma interveno; Ci: grupo no-diabetico com administrao intrapenitoneal de
citrato; S: grupo no-diabetico com administrao de salina na articulao do tornozelo direito; Ca: grupo no-diabetico
com administrao de -carragenina; D: grupo diabtico sem interveno na articulao do tornozelo; DI: grupo
diabtico tratado com insulina; DS: grupo diabtico com administrao de salina na articulao do tornozelo direito;
DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico com administrao de -carragenina e
tratado com insulina.

Em relao a expresso gnica do MuRF-1,

houve um aumento de sua

expresso nos grupos S e Ca quando comparado aos grupos C e Ci (Figura 16). Nos
ratos diabticos, houve aumento nos grupos DI, DCa e DCaI, mostrando que o
tratamento com insulina no minimizou a expresso gnica do MuRF-1. Nota-se que
apenas a administrao de carragenina aumentou a expresso de MuRF-1 nos grupos
diabticos.

63

Figura 16. Expresso gnica do MuRF-1 no msculo TA dos diferentes grupos experimentais, 3 dias aps a
administrao de carragenina na articulao do tornozelo direito, e 10 dias aps a injeo de STZ. Resultados so mdia
e desvio padro, onde a representa diferena estatstica com o grupo C; b diferena estatstica com Ci; c diferena
estatstica com S; d diferena estatstica com Ca; e diferena estatstica com D; g diferena estatstica com DS (*p<0,05;
**p<0,01 e ***p<0,001). Sendo, C: grupo controle sem nenhuma interveno; Ci: grupo no-diabetico com
administrao intrapenitoneal de citrato; S: grupo no-diabetico com administrao de salina na articulao do tornozelo
direito; Ca: grupo no-diabetico com administrao de -carragenina; D: grupo diabtico sem interveno na articulao
do tornozelo; DI: grupo diabtico tratado com insulina; DS: grupo diabtico com administrao de salina na articulao
do tornozelo direito; DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico com
administrao de -carragenina e tratado com insulina.

5.6 Expresso Gnica no msculo SO

Os resultados mostraram um aumento da expresso da atrogina-1 nos grupos S


e Ca quando comparados aos grupos C e Ci, sendo que a maior expresso foi observada
no grupo Ca em relao ao grupo S (Figura 17). Nos grupos diabticos, houve aumento
apenas no grupo DCa, comparado aos grupos C, Ci, D, DI, DS e DCaI. Alm disso,
observou-se que apenas a administrao de carragenina aumentou a expresso da
atrogina-1 e o tratamento com insulina foi capaz minimizar sua expresso.

64

Figura 17. Expresso gnica do atrogina-1 no msculo SO dos diferentes grupos experimentais, 3 dias aps a
administrao de carragenina na articulao do tornozelo direito, e 10 dias aps a injeo de STZ. Resultados so mdia
e desvio padro, onde a representa diferena estatstica com o grupo C; b diferena estatstica com Ci; c diferena
estatstica com S; d diferena estatstica com Ca; e diferena estatstica com D; f diferena estatstica com DI; g:
diferena estatstica com DS; h: diferena estatstica com DCa (*p<0,05; **p<0,01 e ***p<0,001). Sendo, C: grupo
controle sem nenhuma interveno; Ci: grupo no-diabetico com administrao intrapenitoneal de citrato; S: grupo nodiabetico com administrao de salina na articulao do tornozelo direito; Ca: grupo no-diabetico com administrao de
-carragenina; D: grupo diabtico sem interveno na articulao do tornozelo; DI: grupo diabtico tratado com insulina;
DS: grupo diabtico com administrao de salina na articulao do tornozelo direito; DCa: grupo diabtico com
administrao de -carragenina; DCaI: grupo diabtico com administrao de -carragenina e tratado com insulina.

A expresso gnica do MuRF-1 aumentou apenas no grupo Ca em relao aos


grupos C, Ci e S, e no grupo DCa em relao aos grupos C e D (Figura 18). Esses
resultados mostram que a inflamao aumenta a expresso desse gene, tanto no
msculo de ratos diabticos como no-diabticos. O tratamento com insulina foi capaz
de reverter sua expresso no grupo DCaI.

65

Figura 18. Expresso gnica do MuRF-1 no msculo SO dos diferentes grupos experimentais, 3 dias aps a
administrao de carragenina na articulao do tornozelo direito, e 10 dias aps a injeo de STZ. Resultados so mdia
e desvio padro, onde a representa diferena estatstica com o grupo C; b diferena estatstica com Ci; c diferena
estatstica com S; d diferena estatstica com Ca; e diferena estatstica com D (*p<0,05; **p<0,01 e ***p<0,001).
Sendo, C: grupo controle sem nenhuma interveno; Ci: grupo no-diabetico com administrao intrapenitoneal de
citrato; S: grupo no-diabetico com administrao de salina na articulao do tornozelo direito; Ca: grupo no-diabetico
com administrao de -carragenina; D: grupo diabtico sem interveno na articulao do tornozelo; DI: grupo
diabtico tratado com insulina; DS: grupo diabtico com administrao de salina na articulao do tornozelo direito;
DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico com administrao de -carragenina e
tratado com insulina.

5.7 Volume

A Tabela II apresenta os valores dos volumes iniciais (pr-inflamao) e finais


(ps-inflamao) dos tornozelos direitos de todos os grupos experimentais. Constatouse aumento significativo (p<0,05) no volume aps 72h da interveno (salina ou
carragenina) na articulao do tornozelo nos grupos S, Ca, DS, DCa e DCaI. Esse
resultado demonstra que a administrao de carragenina ou salina na articulao do
tornozelo dos ratos acarreta edema local, havendo distenso da cpsula articular.

TABELA II. Comparao do volume (mdia desvio padro) (ml) dos grupos.
C
Ci
S
Ca
D
PERODO
0
2,08 0,10 2,00 0,06 1,92 0,10 2,04 0,17 1,60 0,13
72 h
1,94 0,10 2,63 0,17
p (0 Vs.
=0,005
=0,001
72h)

DI

DS

DCa

DCaI

1,70 0,18

1,4 0,20
1,5 0,15
=0,0230

1,60 0,29
2,6 0,41
=0,003

1,60 0,30
2,82 0,49
=0,0001

Valores apresentados em mdias DP. O valor de p apresentado referente ao teste T pareado. Sendo, C: grupo controle sem nenhuma interveno; Ci: grupo nodiabetico com administrao intrapenitoneal de citrato; S: grupo no-diabetico com administrao de salina na articulao do tornozelo direito; Ca: grupo nodiabetico com administrao de -carragenina; D: grupo diabtico sem interveno na articulao do tornozelo; DI: grupo diabtico tratado com insulina; DS: grupo
diabtico com administrao de salina na articulao do tornozelo direito; DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico com
administrao de -carragenina e tratado com insulina.

67
5.8 Creatina Cinase (CK)
Na avaliao da CK, este estudo no detectou alteraes em sua atividade no
msculo TA entre os grupos avaliados, como mostrado na Figura 19.

Figura 19. Nveis musculares da atividade de CK do msculo TA dos diferentes grupos experimentais, 3 dias aps a
administrao de carragenina na articulao do tornozelo direito, e 10 dias aps a injeo de STZ. Valores apresentados em
mdias
DP. Sendo, C: grupo controle sem nenhuma interveno; Ci: grupo no-diabetico com administrao
intrapenitoneal de citrato; S: grupo no-diabetico com administrao de salina na articulao do tornozelo direito; Ca: grupo
no-diabetico com administrao de -carragenina; D: grupo diabtico sem interveno na articulao do tornozelo; DI:
grupo diabtico tratado com insulina; DS: grupo diabtico com administrao de salina na articulao do tornozelo direito;
DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico com administrao de -carragenina e
tratado com insulina.

A Figura 20 apresenta os nveis da CK do msculo SO. Neste msculo, notou-se


atividade menor apenas no grupo DCa em relao aos demais grupos avaliados (p<0,001).

68

Figura 20. Nveis musculares de CK do msculo SO dos diferentes grupos experimentais, 3 dias aps a administrao de
carragenina na articulao do tornozelo direito, e 13 dias aps a injeo de STZ. Valores apresentados em mdias DP, onde
a representa diferena estatstica com o grupo C; b: diferena estatstica com Ci; c: diferena estatstica com S; d: diferena
estatstica com Ca, e: diferena estatstica com D; f: diferena estatstica com DI; g: diferena estatstica com DS e i:
diferena estatstica com DCaI (*p<0,05; **p<0,01 e ***p<0,001). Sendo, C: grupo controle sem nenhuma interveno; Ci:
grupo no-diabetico com administrao intrapenitoneal de citrato; S: grupo no-diabetico com administrao de salina na
articulao do tornozelo direito; Ca: grupo no-diabetico com administrao de -carragenina; D: grupo diabtico sem
interveno na articulao do tornozelo; DI: grupo diabtico tratado com insulina; DS: grupo diabtico com administrao de
salina na articulao do tornozelo direito; DCa: grupo diabtico com administrao de -carragenina; DCaI: grupo diabtico
com administrao de -carragenina e tratado com insulina.

69

Discusso

70
6.0 DISCUSSO

Este estudo encontrou um menor ganho de massa corporal e manuteno da


hiperglicemia nos grupos de ratos diabticos sem tratamento insulnico. Alm disso, houve
perda de massa muscular nos msculos TA e SO, demonstrando a ocorrncia da atrofia
causada pela inflamao e pelo diabetes. Assim como a perda de massa muscular houve
diminuio da AST no TA e aumento da expresso gnica da atrogina-1 e MuRF-1 tanto no
msculo TA quanto no SO. O volume das patas inflamadas revelou que houve edema
provocado pela efuso e/ou inflamao da articulao. Entretanto, a atividade da CK no
sofreu alterao no msculo TA, enquanto que no msculo SO apresentou diminuio em
sua atividade apenas no grupo DCa.
A perda de massa muscular afetou os dois msculos analisados principalmente
nos grupos diabticos e que tiveram alguma interveno da articulao do tornozelo,
mostrando que os dois tipos de fibras (TA predominantemente tipo II e SO
predominantemente tipo I) passaram pelo processo de atrofia, com alteraes em suas
propriedades fisiolgicas e bioqumicas de acordo com os estmulos a que so submetidas.
O msculo SO apresentou uma perda de massa tambm no grupo S, mostrando ser esse
msculo, em ratos no-diabeticos ou diabticos, mais sensvel a interveno no tornozelo,
seja por salina ou carragenina.
Analisando a AST do msculo TA, houve a confirmao da atrofia presente neste
msculo submetido efuso; diabetes ou inflamao da articulao. Aughsteen, e
colaboradores (2006) tambm informaram diminuio da rea de seco transversa nos
msculos reto femoral e extensor longo digital aps 4 semanas de diabetes, corroborando
com este estudo, uma vez que estes dois msculos so constitudos por fibras do tipo II,
assim como o msculo TA. Eles tambm encontraram a presena de rea de inflamao e
necrose das fibras nos dois msculos. Apesar de no realizada a AST no msculo SO,
notvel a atrofia pela perda de sua massa muscular do mesmo.
Os resultados apresentados nesse trabalho confirmam a participao de vias de
degradao protica para o processo de atrofia, uma vez que foi observada a perda de massa
muscular no SO e TA e, da AST do TA, alm de um aumento na expresso gnica da

71
atrogina-1 e do MuRF-1 nos dois msculos, principalmente nos grupos de ratos que
tiveram a articulao inflamada.
O aumento da expresso da atrogina-1 e do MuRF-1 deste estudo, intensificou a
perda de massa nos dois msculos analisados e da rea de seco transversa no msculo
TA. Entretanto, a magnitude das respostas quanto expresso gnica da atrogina-1 e do
MuRF-1 foram diferentes nos msculos TA e SO, mostrando que o tipo de fibra est
relacionado com a expresso de diversos genes no tecido muscular, como j demonstrado
tambm em estudos anteriores (CARLSON et al, 1999; WHEELER et al., 1999; HUEY et
al., 2001; CAI et al., 2004).
Em modelos de desuso, como a desnervao ou a suspenso, ocorre um aumento
na expresso de atrogina-1, levando a uma significativa atrofia muscular, sendo tal dado
bem descrito (ZHANG et al., 2006; SACHECK et al., 2007). Modelos de desuso afetam
mais as fibras oxidativas, enquanto que em doenas sistmicas as fibras mais afetadas so
as glicolticas de contrao rpida, pois de acordo com Sacheck e colaboradores (2007) a
atrofia das fibras de contrao rpida ocorre primeiramente, devido ao maior tamanho
dessas fibras, o que as tornam mais susceptveis aos efeitos catablicos dos hormnios
adrenais circulantes devido a afeces sistmicas.
Este estudo demonstrou aumento da atrogina-1 nos dois msculos analisados,
entretanto os nveis de mRNA foram maiores no grupo Ca do msculo SO do que no
mesmo grupo do msculo TA; relacionando assim o possvel efeito inflamatrio da
carragenina com a perda de massa muscular.
Os estudos de GLASS (2005) e ZHANG e colaboradores (2006) demonstraram
que a desnervao ou a imobilizao provocam um aumento dos nveis de RNAm do
MuRF-1 na primeiras 24 horas e posterior diminuio, podendo ter esse gene, uma
importncia em processos agudos, independente do modelo de atrofia utilizado. Estes
estudos corroboram com estudo tambm desenvolvido no laboratrio de Plasticidade que
tambm avaliou a inflamao aps 24h, entretanto, neste estudo houve aumento aps 72h
da inflamao, mas com um pico de expresso menor do que encontrado por Ramirez e
colaboradores (2008), com anlise feita aps 24h da inflamao.
Shackeck e colaboradores (2007) fizeram um estudo com dois modelos de desuso
e registraram um pico de expresso da atrogina-1 e do MuRF-1 no terceiro dia de

72
experimento. Eles observaram correlao desses picos da expresso gnica da ordem de 50
vezes para atrogina-1 e 20 vezes para MuRF-1, com perda de massa muscular do msculo
gastrocnmio; comparando estes dados com o da presente dissertao, notvel que a
magnitude do aumento na expresso dos genes relacionados atrofia possa ser um fator
chave na reduo da massa muscular e da AST das fibras musculares, contudo o aumento
da expresso gnica foi muito maior no estudo de Shackeck e colaboradores (2007).
A expresso do MuRF-1 dos grupos inflamados nos dois msculos estudados (Ca
e DCa), sugere que a expresso desse gene nessas condies estudadas independente do
tipo de fibra, embora o aumento tenha sido bem maior no msculo TA comparado com o
msculo SO. Esse estudo encontrou aumento na expresso da atrogina-1 e MuRF-1 nos
grupos Ca, DCa e DCaI do msculo TA e nos grupos Ca e DCa do msculo SO, que pode
ser tambm explicado atravs da via do TNF, uma vez que a injeo de -carragenina
causa um processo inflamatrio complexo, que envolve um grande nmero de mediadores,
dentre eles a uma citocina inflamatria TNF, que est envolvida na estimulao da quebra
de protena muscular (REID; LI, 2001; DOGRA et al., 2007). Os nveis sricos de TNF
encontram-se bastante aumentados aps injeo de -carragenina no tornozelo de ratos. A
ao catablica do TNF explica-se em parte, pela ativao da famlia de fatores de
transcrio NFK (JACKMAN; KANDARIAN, 2004), sendo que o principal mediador da
atrofia muscular desta via o p65. O p65 encontra-se inativo no citoplasma da clula e
quando ativado translocado at o ncleo, ligando-se em stios especficos do DNA e
regulando a expresso de MuRF-1 (ZHANG, 2006). Neste estudo, o aumento da expresso
da atrogina-1 e do MuRF-1 dos grupos DS, DCa e DCaI contribuiu para produzir perda de
massa e diminuio da AST das fibras musculares do TA direito, embora no msculo SO a
perda de massa tambm tenha ocorrido de forma significativa nos grupos que tiveram
interveno na articulao do tornozelo.
Outra molcula sinalizadora que pode ser regulada e ativada atravs do TNF- o
p38. Este um membro da famlia MAPK de protenas kinases, e ativado pelo estresse e
responde a uma variedade de estmulos, incluindo o estresse oxidativo e TNF-, sendo um
potencial sinalizador catablico no msculo esqueltico. O estudo de Li e colaboradores
(2005) mostrou que o aumento da fosforilao do p38 aumentou os nveis de atrogina-1,
uma vez que a elevao patolgica do p38 favorece a degradao de protenas musculares e

73
atrofia. Alm disso, este estudo sugere que MAPK/p38 modula a sinalizao
PI3K/Akt/FoxO, diretamente ou indiretamente. J o estudo de Koistinen e colaboradores
(2003) viram que o diabetes tipo II uma condio catablica, onde ocorre a fosforilao
do p38. Est bem descrito na literatura que o diabetes provoca estresse oxidativo, o que
levaria a via MAPK/p38 a ativar os genes de atrofia. Portanto, alm das vias conhecidas de
degradao protica, existem molculas sinalizadores que esto envolvidas com a
degradao de protenas, como a p38 que possivelmente est ativada pelo TNF- neste
estudo, devido ao uso da carragenina para provocar a inflamao. necessrio ainda
lembrar, que alm do aumento de TNF- h o estresse oxidativo nesse modelo
experimental o, que causado pela instalao do diabetes, e que tambm ativa a molcula
p38, reforando um papel importante dessa via nos resultados encontrados para a atrofia
muscular atravs do aumento da expresso dos genes ativados pela FoxO, atrogina-1 e
MuRF-1.
O fato de haver no msculo TA um aumento na expresso de genes de atrofia
como a atrogina-1 em grupos tratados com insulina como ocorreu com DCaI no TA, e
tambm aumento da expresso do MuRF-1 no DI e DCaI no msculo TA, mostra que a via
de sntese protica pode estar diminuda, uma vez que em condies catablicas que
interferem com o sinal IGF-I/insulina ocorre diminuio da fosforilao do FoxO
(Forkhead Box-containing protein, O-subfamily) e aumento da expresso desses dois genes.
A protena FoxO tambm pode ter um impacto negativo sobre a sntese de protenas com
uma resposta exacerbada de efeitos fisiolgicos da FoxO na degradao protica
(HESZELE; PRICE, 2004), uma vez que FoxO um regulador da expresso da atrogina-1
e MuRF-1 no msculo esqueltico. DEHOUX e colaboradores (2004) injetaram IGF-I em
ratos diabticos e observaram uma atenuao da expresso da atrogina-1 no msculo
gastrocnmio de ratos, sugerindo a regulao desse hormnio pelo IGF-I, alm disso esse
efeito inibitrio independente da glicemia, uma vez que os mesmos efeitos foram
observados em ratos com hipoglicemia no mesmo estudo. Em vista que o IGF-I exerce
papel to importante quanto a insulina para a sntese protica faz com que o dado do estudo
de DEHOUX colabore com o resultado desse estudo, uma vez que a insulina exgena foi
aplicada aos grupos com elevao da expresso dos genes de atrofia e mesmo assim eles
responderam com maior degradao de protenas.

74
A atrofia encontrada tanto na massa muscular do msculo TA e do msculo SO,
quanto a diminuio da AST do TA, demonstraram que a atrofia pode ter ocorrido por duas
hipteses. Como no diabetes h diminuio do IGF-1 e de insulina, a via de sntese protica
est diminuda, sobressaindo a via de degradao protica. Outra hiptese que o pico da
expresso gnica dos genes relacionados atrofia atrogina-1 e MuRF-1, anterior ao tempo
analisado nesse estudo (72h de inflamao), o que reflete na perda de massa muscular, com
nveis no muito elevados, como encontrado em estudo anterior feito por Ramirez e
colaboradores (2008), onde ratos normais com 48h de inflamao apresentaram um
aumento de 672% no TA e de 125% no SO dos nveis de MuRF-1.
Provavelmente, o diabetes e a inflamao interferem na via atrfica. Devido a
destruio do pncreas pelo diabetes, h pouca insulina, e poucos receptores tanto de IGF-1
quanto de insulina, fazendo com que a via de sntese protica esteja diminuda. Devido a
degradao dos receptores de membrana h a ativao das vias lisossomal, das calpanas,
das caspases, com o favorecimento da via de degradao protica e inibio da via de
sntese protica atravs da comunicao Akt/FoxO. Ao mesmo tempo h a presena de
inflamao, com fatores inflamatrios locais e sistmicos, fazendo com que a via de
degradao protica esteja aumentada atravs da ativao do p38 e do NF-kB. Alm disso,
h o estresse oxidativo devido ao modelo de atrofia deste estudo, o desuso. Esse estresse
oxidativo dispara a via das calpanas com desarranjo do sarcmero e degradao pelo
proteassoma. Assim, estes achados demonstram que existem alguns mecanismos que
regulam diferentemente a plasticidade muscular na presena de diabetes, com o uso
diminudo da pata e inflamao (JACKMAN; KANDARIAN, 2004; GLASS, 2005;
ZHANG, 2006).
Durante a realizao dessa pesquisa, foi observado que os ratos deambulavam
com restrio ao uso da pata com o tornozelo inflamado, provavelmente por dor, apoiando
apenas a parte anterior da pata (parte dos dedos). Como a carragenina provoca hiperalgesia
no lugar da leso (SALVEMINI, et al., 1996), pode ter ocorrido uma diminuio do uso da
pata inflamada por dor, com uma diminuio na atividade contrtil, contribuindo para a
alterao na expresso gnica observada no presente estudo, pois o uso diminudo tambm
estimula a expresso de genes relacionados atrofia.

75
A injeo de salina no gera resposta inflamatria em ratos, com uma pequena
dilatao dos vasos sanguneos, presena de poucos eritrcitos e estrutura histolgica
normal da cartilagem (SARICAOGLU et al, 2008). Assim, as mudanas na expresso
gnica observadas no TA dos grupos S e DS e no grupo S do msculo SO, podem ser
conseqncias de uma Resposta Muscular Artrognica (RMA) devida efuso da
articulao. A RMA gerada por aumento da tenso no interior da cpsula articular que
pode aumentar ou diminuir a excitabilidade dos motoneurnios

(MN ) nos msculos

funcionalmente relacionados articulao acometida, embora sem leso articular


relacionada. A inibio da excitabilidade dos MN em presena de efuso articular pode
ser devida ao aumento da atividade dos corpsculos de Ruffini de adaptao lenta
localizadas na cpsula articular. Esta atividade aumenta o estmulo dos interneurnios
inibitrios Ib, os quais inibem os motoneurnios alfa do msculo (PALMIERI et al., 2003 e
2004).
Estes resultados indicam que a efuso articular aguda regula a expresso de genes
relacionados atrofia em msculos normais e diabticos. Alm disso, pode ser considerado
que os resultados encontrados nos grupos S e DS so principalmente relacionados
distenso capsular, pois o modelo de efuso articular permite a estimulao mecnica da
articulao.
O processo inflamatrio causado pela carragenina, assim como a efuso da
articulao aps 72h, causaram neste estudo, um edema local. Estudos anteriores
mostraram um aumento do edema 24h aps a aplicao de carragenina, diminuindo
lentamente (FERREIRA, 2005; NISHIKORI et al., 2002; OMAR, 2002). Este resultado
mostra que o edema persistiu at 72h, sendo que o mecanismo de induo (carragenina ou
soro) no apresenta diferena, podendo o edema ocorrer devido disteno da cpsula
articular. O edema pode ter persistido por mais 72h devido ao processo crnico com
presena de macrfagos que persistem at 4 semanas aps a introduo da carragenina,
como mostrado nos estudos de HONG e colaboradores (2002) e KEHLA e colaboradores
(2000).
Este estudo no encontrou diferena estatstica nos nveis musculares da enzima
creatina cinase no msculo TA, havendo apenas diferena estatstica significativa no
msculo SO do grupo DCa. Esse resultado pode ser discutido pela hierarquia energtica de

76
utilizao do ATP, j que os msculos dispem de trs principais mecanismos de reposio
de ATP pela gliclise, sendo eles a reserva de fosfocreatina, o metabolismo anaerbico
ltico, e a via cadeia respiratria, durante a realizao de um exerccio. Na condio de
desuso, os estoques de fosfocreatina no so utilizados, uma vez que no h realizao de
esforo fsico, como demonstra alguns estudos em que esta enzima tm sido relacionada
principalmente em leses musculares decorrentes da fase excntrica do exerccio, podendo
permanecer aumentada no plasma sanguneo em at 7 dias aps a realizao de um esforo
(BRANCACCIO et al, 2007; BRUUNSGAARD et al, 1997). Nos grupos de ratos
diabticos que foram tratados com insulina os nveis de ATP conseguem se manter
adequados para a realizao da atividade muscular, com a entrada de glicose na clula. No
entanto no msculo SO, de contrao lenta e postural, e para o grupo DCa, ou seja, com
insuficincia de insulina e com inflamao, a atrofia pode ter conduzido ao uso muito
diminudo, pois os nveis de CK foram os nicos estaticamente menores.

77

Concluso

78
7.0 CONCLUSO

Os grupos que tiveram alguma interveno na articulao tbio-trsica direita


mostraram aumento na expresso dos genes relacionados atrofia nos investigados. Este
estudo revelou que tanto a inflamao como a efuso da articulao tbio-trsica regulam a
expresso de genes relacionados atrofia nos msculos SO e TA, tanto de ratos nodiabticos quanto em ratos diabticos. Entretanto, a atividade da enzima creatina cinase no
sofreu alterao no TA e somente o grupo DCa do msculo SO com diminuio da sua
atividade. Portanto, os msculos de ratos diabticos que tiveram a articulao inflamada
respondem diferentemente e com maior intensidade atrofia do que ratos normais.
Os resultados deste estudo tm relevncia clnica e indicam a importncia da
interveno fisioteraputica (por exemplo, uso de TENS, exerccios de fortalecimento e
para diminuir o edema local, concomitantemente ao uso do gelo) para amenizar os efeitos
deletrios que a inflamao e a efuso articular aguda causam nos msculos TA e SO
relacionados articulao acometida, principalmente em animais diabticos.

79

Referncias Bibliogrficas

80
8.0 REFERNCIAS BIBLIOGRFICAS
ANDERSON, T.; SCHEIN, P. S.; MCMENAMIM, M. G.; COONEY, D. A.
Streptozotocin Diabetes Correlation with extent of depression of pancreatic islet
nicotinamide adenine dinucleotide. J. Clin. Invest., v.54, p. 672-77, 1974.
ARANY, Z.; LEBRASSEUR, N.; MORRIS, C.; SMITH, E.; YANG, W.; MA, Y.;
CHIN, S.; SPIEGELMAN, B.M. The transcriptional coactivator PGC-1 drives the
formation of oxidative type IIX fibers in skeletal muscle. Cell Metab. v.5, p. 35-46,
2007.
AUGHSTEEN, A.A., KHAIR, A-M. B., SULEIMAN, A.A. Quantitative morphometric
study of the skeletal muscles of normal and streptozotocin-diabetic rats. J Pancreas. 4:
382-389, 2006.
AKIMA H.; FURUKAWA T. Atrophy of thigh muscles after meniscal lesions and
arthoscopic partial menisectomy. Knee Surg Sports Traumatol Arthrosc. 13:632637, 2005.
BALDWIN KM, HADDAD F. Effects of different activity and inactivity paradigms on
myosin heavy chain gene expression in striated muscle. J Appl Physiol.1:345-57, 2001.
BEDOYA, F. J.; SOLANO, F.; LUCAS, M. N-monomethyl-arginine and nicotinamide
prevent streptozotocin-induced doubl stran DNA formation in pancreatic rat islets.
Experientia. 52: 344-347, 1996.
BENNET, R. A. & PEGG, A. E. Alkylation of DNA in rat tissues following
administration on streptozotocin. Cancer Res.41: 2786-2790, 1981.
BERCHTOLD, M.W., BRINKMEIER, H., AND MUNTENER, M. (2000). Calcium
ion in skeletal muscle: its crucial role for muscle function, plasticity, and disease.
Physiol. Rev.80: 12151265, 2000.
BODINE S.C., LATRES E., BAUMHUETER S., LAI V.K., NUNEZ L., CLARKE
B.A., POUEYMIROU W.T., PANARO F.J. Identification of ubiquitin ligases required
for skeletal muscle atrophy. Science. 294:1704-1707, 2001.
BOFF S.R. A fibra muscular e fatores que interferem no seu fentipo. Acta Fisiatr., 15:
111-1169, 2008.
BURTIS, C.A.; ASHWOOD, E.R.; BRUNS, D.E. Tietz textbook of clinical chemistry
and molecular diagnostics. Ed. Evolve, 2006.
BRANCACCIO P; MAFFULLI N; LIMONGELLI FM. Creatine kinase monitoring in
sport medicine. Br Med Bull. 81:209-30, 2007.

81
BRUTON A.
Muscle Plasticity:
Physiotherapy.88:398-408, 2002.

Response

to

training

and

detraining.

BRUUNSGAARD H; GALBO H; HALKJAER-KRISTENSEN J; JOHANSEN TL;


MACLEAN DA; PEDERSEN BK. Exercise-induced increase in serum interleukin-6 in
humans is related to muscle damage. J Physiol.15: 833841, 1997.
CAI D.; FRANTZ J.D.; TAWA N.E.; MELENDEZ P.Q.; LIDOV H.; HASSELGREN
G.W.; et al. IKK/betaNF-kappaB activation causes severe muscle wasting in mice.
Cell.; 119:285-98; 2004.
CAO P.R.; KIM H.J.; LECKER S.H. Ubiquitin-protein ligases in muscle wasting. Int J
Biochem Cell Biol. 37:2088-2097, 2005.
CARLSON C.J.; BOOTH F.W. AND GORDON S.E. Skeletal muscle myostatin
RNAm expression is fiber0-type specific and increases during hindlimb unloading. Am
J Physiol Regulatory Integrative Comp Physiol. 277: 601-6, 1999
CARVALHEIRA, J.B.C.; ZECCHIN, H.G.; SAAD, M.J.A. Vias de sinalizao da
insulina. Arq. Bras. Endocrinol. Metab. 46: 419-426, 2002.
CHONKAR, A.; HOPKIN, R.; ADEGHATE, E.; SINGH, A.J. Contraction and Cation
Contents of Skeletal Soleus and EDL Muscles in Age-Matched Control and Diabetic
Rats. New York Academy of Sciences..1084: 442-451, 2006.
COMMITTEE REPORT. Report of expert committee on the diagnosis and
classification of diabetes mellitus. Diabetes Care. 1: S5-S20, 2003.
COTRAN RS, KUMAR V, ROBBINS S, SCHOEN FJ. Patologia Estrutural e
Funcional Robbins. 7 Ed. Rio de Janeiro: Guanabara Koogan S.A.;43-83, 2000.
COTTER, M.; CAMERON, N.E.; LEAN, D.R; ROBERTSON, S. Effects of long-term
streptozotocin diabetes on the contractile and histochemical properties of rat muscles.
Q. J. Exp. Physiol. 74:65-74, 1989.
DEHOUX, M., BENEDEN, R.V., PASKO, N., LAUSE, P., VERNIERS, J.,
UNDERWOOD, L., KETELSLEGERS J-M., THISSEN, J-P. Role of the insulin-like
growth factor I decline in the induction of atrogin-1/MAFbx during fasting and
diabetes. Endocrinology. 11, 4806-4812, 2004.
DELFINO, V.D.A.; FIQUEIREDO, J.F.; MATSUO, T.; FAVERO,M.E.; MATNI,
A.M.; MOCELIN, A.J. Diabetes mellitus induzido por estreptozotocina: comparao
em longo prazo entre duas vias de administrao. J Bras Nefrol. 24:31-6, 2002.
DOGRA C., CHABGOTRA H., WEDHAS N., QIN X., KUMAR A. TNF-related
inducer of apoptose (TWEAK) is a potent skeletal muscle-wasting. FASEB J. 21:185769, 2007.

82

DOLAN, M.G.; MYEHASKIW, A.M.; MEDEL, F.C. Cool-water immersion and highvoltage electric stimulation curb edema formation in rats. J Athl Train;38:225-230,
2003.
ELEY H.L., TISDALE M.J. Skeletal atrophy, a link between depression of protein
synthesis and increase in degradation. Journal of Biological Chemistry. 282:70877097, 2007.
FERNANDES, S.R.C.; FERNANDES, J.S.; TAVARES, J.S.; SILVA, R.A.N.B.;
FRAGOSO, Y.D. Neuropatia Perifrica Dolorosa no Diabetes Mellitus: Atualizao
Teraputica. Revista Neurocincias. 9: 91-102, 2001.
FERREIRA, F.R. Estudo comparativo de carragenanas comerciais Kappa, Iota e
Lambda no processo inflamatrio em ratos: edema intraplantar e pleurisia. Natal, 2005.
Dissertao (mestrado em Bioqumica) Departamento de Bioqumica, Universidade
Federal do Rio Grande do Norte.
FERREIRA R., NUEPARTH M.J., MAGALHAES A., VITORINO R., AMADO F.
Skeletal muscle atrophy increases cell proliferation in mice gastrocnemius during the
first week of hindlimb suspension. Eur J Appl Physiol. 97:340-346, 2006.
FISCHER, L. J.; HAMBURGUER, S. Inhibition of insulin secretion from isolated
pancreatic islets treates with dihydroxyfumarate. Fed. Proc. 38: 528, 1979.
FITZGERALD K., PIVA S., IRRGANG J., BOUZUBAR F., STARZ T. Quadriceps
activation failure as a moderator of the relationship between quadriceps strength and
physical function in individuals with knee osteoarthritis.
Arthritis &
Rheumatism.15:40-48, 2004.
FLCK M., HOPPELER H. Molecular basis of skeletal muscle plasticity-from gene to
form and function. Rev Physiol Biochem Pharmacol.146:159-216, 2003.
FRIER, B.C.; NOBLE E.G.; LOCKE M. Diabetes-induced atrophy is associated with a
muscle-specific alteration in NF-B activation and expression. Cell Stress and
Chaperones. 13:287-296, 2008.
GOODNER, C. J. The pancreas. In: Physicology an biophysics III. 20ed.
Philadelphia: W.B. Saunders, cap. 9, p. 213-214, 1973.
GOMES M.D., LECKER S.H., JAGOE R.T., NAVON A., GOLDBERG A.L. Atrogin1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl
Acad Sci USA. 98:14440-14445, 2001.
GUILLOT C., STEINBERG J.G., DELLIAUX S., KIPSON N., JAMMES Y., BADIER
M. Physiological, histological and biochemical properties of rat skeletal muscles in
response to hindlimb suspension. J Electromyogr Kines. 1-7, 2006.

83

GLASS D.J. Skeletal muscle hypertrophy and atrophy signaling pathways. The
International Journal of Biochemistry & Cell Biology.37:1974-84. 2005.
GRANADO M., PRIEGO T., MARTN A., VILLANA M.A., LPEZ-CALDERON
A. Ghrelin receptor agonist GHRP-2 prevents arthritis-induced increase in E3 ubiquitinligating enzymes MuRF1 and MAFbx gene expression in skeletal muscle. Am J
Physiol Endocrinol Metab.289: 10071014, 2005.
GRANKVIST, K.; MARKLUND, S.; TALJEDAL, I. B. Superoxide dismutase is a
prophylactic against alloxan Diabetes. Nature. 294: 158-160, 1981.
GRIFFIN JW, NEWSOME LS, STRALKA SW, WRIGHT PE. Reduction of chronic
posttraumatic hand edema: a comparison of high voltage pulsed current, intermittent
pneumatic compression, and placebo treatments. Phys Ther. 5:279-286, 1990.
GOLDSPINK G. Changes in muscle mass and phenotype and the expression of
autocrine and systemic growth factors by muscle in response to stretch and overload. J.
Anat. 3:323-34. 1999.
GR H., AKIN N. Muscle mass, isokinetic torque, and functional capacity in women
with osteoarthritis of the knee. Arch Phys Med Rehabil. 84:1534-41, 2003.
GUTTRIDGE D.C. Signalling pathways weigth in on decisions to make or break
skeletal muscle. Current Opinion in Clinical Nutrition and Metabollic Care.7:44350, 2004.
HARTREE, E.F. Determination of Protein: A modification of the lowry method that
gives a linear photometric response. Analytical Biochemistry 48, 422-427, 1972.
HARGREAVES, K. DUBNER, R. BROWN, F. FLORES, C. A new and sensitive
method for measuring thermal nociception in cutaneous hyperalgesia. Pain.1988;32:7788.
HERR, R. R.; JAHNKE, H. K.; ARGOUDELIS, S. D. The structure of streptozotocin.
J.Am. Chem. Soc.89: 4808-4809, 1967.
HERZOG W., LONGINO D., CLARK A. The role of muscles in joint adaptation and
degeneration. Langenbecks Arch Surg. 288:305-315, 2003.
HESZELE M.F.; PRICE S.R.. Insulin-Like Growth Fator I: The Yin and Yang of
Muscle Atrophy. The Endocrine Society.11: 4803-4805, 2004.
HICKEY, M.S.; WEIDNER, M.D.; GAVIGAN, K.E.; ZHENG, D.; TYNDALL, G.L.;
HOUMARD, J.A. The insulin action-fiber type relationship in humans is muscle group
specific. The American Physiological Society. E150- 4, 1995.

84
HIGAKI, Y.; HIRSHMAN, M.F.; FUJII, N.; LAURIE J. GOODYEAR, L.J. Nitric
Oxide increases glucose uptake through a mechanism that is distinct from the insulin
and contraction pathways in rat skeletal muscle. Diabetes. 50: 241-257, 2001.
HONG SK, HAN JS, MIN SS, HWANG JM, KIM YI, NA HS, YOON YW, HAN HC.
Local neurokinin-1 receptor in the knee joint contributes to the induction, but not
maintenance, of arthritic pain in the rat. Neurosci Lett. 322:2124, 2002.
HOOD, D.A. Invited Review: contractile activity-induced mitochondrial biogenesis in
skeletal muscle. J. Appl. Physiol. 90:11371157, 2001.
HOPKINS J., PALMIERI R. Effects os ankle joint effusion on lower leg function.
Clin J Spor Med.14: 1-7, 2004.

HUEY K.A.; ROY R.; BALDWIN K.M. E EDGERTON R.V. Temporal effects of
inativity on myosin heavy chain gene expression in rat slow muscle. Muscle and
Nerve. 24:517-26, 2001.
JACKAMAN R.W.; KANDARIAN S.C. The molecular basis of muscle atrophy. Am J
Physiol Cell Physiol. 287: C834-843, 2004.
JOHANSSON, E. B. & TJALVA, H. Studies on the tissue-disposition an fate [14 C]
streptozotocin with special reference to the pancreatic islets. Acta Endocrinol. 89: 339351, 1978.
KANETO, H; FUJII, J.; SEO, H.G.; SUZUKI, K.; MATSUOKA, T.; NAKAMURA,
M.; TATSUMI, H.;YAMASAKI, Y.;KAMADA, T.; TANIGUCHI, N. Apoptotic cell
death triggered by nitric oxide in pancreatic -cell. Diabetes. 44: 733-738, 1995.
KEHLA J, TREMPEA TM, HARGREAVES KM. A new animal model for assessing
mechanisms and management of muscle hyperalgesia. Pain. 85: 333-343, 2000
KOISTINEN, H.A., CHIBALIN, A.V., ZIERATH, J.R. Aberrant p38 mitogenactivated protein kinase signaling in skeletal muscle from type 2 diabetic patients.
Diabetologia. 46, 1324-1328, 2003.
KRONCKE, K. D.; FEHSEL, K.; SOMMER, A.; RODRIGUEZ, M. L.;
KOLBBALCHOFEN, V. Nitric oxide generation during cellular metabolization of the
diabetogenic N-methyl-N-nitroso-urea streptozotocin contributes to islet cell DNA
damage. Biol. Chem. Hoppe Seyler. 376: 179-185, 1995.
KU Z., YANG J., MENON V., THOMANSON D.B. Decreased polisomal HSP-70 may
slow polypeptide elongation during skeletal muscle atrophy. Am J Physiol.268:13671374, 1995.

85
KWON, N. S.; LEE, S. H.; CHOI, C. S.; KHOT, T.; LEE, H. S. Nitric oxide generation
from streptozotocin. FASEB. J. 8:529-533, 1994.

LADNER K.J.; CALIGIURI M.A.; GUTTRIDGE D.C. Tumor Necrosis Factorregulated Biphasic Activation of NF-Kb. The Journal Biological Chemistry. 24:
2294-2303, 2003.
LAWANDA, N. B., MCNEARNEYB, T., WESTLUNDA, K.N. Amino acid release
into the knee joint: key role in nociception and inflammation. Pain. 86:69-74, 2000.
LECKER S.H., JAGOE R.T., GILBERT A., GOMES M., BARACOS V., BAILEY J
E.T. Multiple types of skeletal muscle atrophy involve a common program of changes
in gene expression. FASEB.18:39-51, 2004.
LENZEN, S. The mechanisms of alloxan- and streptozotocin-induced Diabetes.
Diabetologia. 51, 216226, 2008.
LIEBER R. Skeletal muscle structural, function, & plasticity. Philadelphia:
Lippincott Williams & Wilkins; 2002, 2nd edition.
LINDEHAMMAR H, LONDVALL B. Muscle involvement in juvenile idiopathic
arthritis. Rheumatology. 43:1546-1554, 2004.
MACHADO J.; KRINSKI K.; ELSANGEDY H.M.; CIESLAK F.; LOPES G.;
GOMES A.R.S. Vias de sinalizao intracelular na atrofia muscular e no treinamento
resistido. Fisioter. Mov. 22:383-93, 2009.
MANNA, T.D. Not every diabetic child has type 1 diabetes mellitus. J Pediatr (Rio
J).;83:S178-183 2007.
MICHLOVITZ SL. Thermal Agents in Rehabilitation. 3 ed. Philadelphia. F.A. Davis
Company. 30-54, 1996.
MIR O., PEDROL E., CASADEMONT J., GARCA-CARRASCO M., SANMART
R., CEBRIN M., GRAU J. Muscle involvement in rheumatoid arthritis:
Clinicopathological study of 21 symptomatic cases. Seminars in Arthritis and
Rheumatism. 25:421-428, 1996.
MURATA, M.; TAKAHASHI, A.; SAITO, I.; KAWANISHI, S. Site-specific DNA
methylation and apoptosis: induction by diabetogenic streptozotocin. Biochem.
Pharmacol. 57: 881-887, 1999.
NANTEL, F., DENIS, D., GORDON, R., NORTHEY, A., CIRINO, M. METTERS,
K.M., CHAN, C.C. Distribution and regulation of cyclooxygenase-2 in carrageenaninduced inflammation. Br J Pharmacol. 128: 853 859, 1999.

86
NISHIKORI., IRIE, K., SUGANUMA T., OZAKI M., YOSHIOKA T. Antiinflammatory potency of FR 167653, a p38 mitogen-activated kinase inhibitor, in
mouse models of acute inflammation. European Journal of Pharmacology. 451:327-33,
2002.
OLIVER, I.T. A spetrophotometric method for the determination of creatine
phosphokinas and myokinase. Biochem. J. 115-122, 1955.
OMAR ME, ABDEL S. Modulation of inflammatory paw oedema by cysteamine in the
rat. Pharmacol Res. 45, 4: 275-284, 2002.
OMOTE, K., KAWAMATA, T., NAKA YAMA,
Y., YAMAMOTO, H.,
KAWAMATA, M.., NAMIKI, A. Effects of a Novel Selective Agonist for
Prostaglandin Receptor Subtype EP4 on Hyperalgesia and Inflammation in
Monoarthritic Model. Anesthesiology. 97;170176, 2002.
PALMIERI, R.M.; CHRISTOPHER, D. CORDOVA M., KINZEY S.; STONE, M.;
KRAUSE A. The Effect of a simulated knee effusion on postural control in healthy
subjects. Arch Phys Med Rehal. 64:1076-9, 2003.
PALMIERI R.M., INGERSOLL C.D., HOFFMAN M.A., CORDOVA M.L., PORTER
D.A., EDWARDS J.E. et al. Arthrogenic muscle response to a simulated ankle joint
effusion. Br J Sports Med. 38:26-30, 2004.
PAP G., MACHNER A., AWISZUS F. Strength and voluntary activation of the
quadriceps femoris muscle at different severities of osteoarthitic knee joint damage.
Journal of Orthopaedic Research. 22:96-103, 2004.
PAPACCIO, G.; PISANTI, F. A.; FRASCATORE, S. Acetyl-homocysteinethiolactoneinducedincrease of superoxide dismutase counteracts the effect of
subdiabetogenic doses os streptozotocin. Diabetes. 35: 470-474, 1986.
PELIT, A.; ZAYKAN, M.D.; TULI, A.; DEMIRKAZIK, A.; EMRE, M.; GNAY, I.
The effects of magnetic field on the biomechanics parameters of Soleus and Extensor
Digitorum Longus muscles in rats with streptozotocin-induced diabetes. Diabetes
Technol. Ther.10, 4, 2008.
PEPATO, M.T.; MIGLIORINI, R.H.; GOLDBERG, A.L.; KETTELHUT, I.C. Role of
different proteolytic pathways in degradation of muscle protein from streptozotocindiabetic rats. Amercian Physological Society. E340-47, 1996.
PETTE, D. The adaptive potential of skeletal muscle fibers. Can. J. Appl. Physiol. 27:
423448, 2002.
PILEGAARD H, ORDWAY GA, SALTIN B, NEUFER PD. Transcriptional regulation
of gene expression in human skeletal muscle during recovery from exercise. Am J
Physiol Endocrinol Metab. 4:E806-14, 2000.

87

RALL, L.C.; ROUBENOFF R. Rheumatoid Cachexia: metabolic anormalities,


mechanism and intercentions. Rheumatology. 43:1219-23, 2004.
RAMIREZ C.R. Efeito da inflamao articular aguda sobre a morfologia e a expresso
gnica dos msculos sleo e tibial anterior de ratos. 2008. Dissertao (mestrado em
Fisioterapia) Departamento de Fisioterapia Universidade Federal de So Carlos.
REID, M.B.; LI Y-P. Cytokines and oxidative signaling in skeletal muscle. Acta
Physiol Scand. 2001;171:225-32.
SACCO, I.C.N..; SARTOR, C.D.; GOMES, A.A.; JOO, S.M.A.; CRONFLI, R.
Avaliao das Perdas Sensrio-motoras do P e Tornozelo Decorrentes da Neuropatia
Diabtica. Revista Brasileira de Fisioterapia. 11: 27-33, 2007.
SACHECK J.M., HYATT J.P., RAFFAELLO A., JAGOE R.T., ROY R.R.,
EDGERTON R.V. et al. Rapid desuse and denervation atrophy involve transcriptional
changues similar to those of muscle wasting during systemic diseases. FASEB.
21:140-155, 2007.
SAID, G. Focal and Multifocal Diabetic Neuropathies. Arq Neuropsiquiatr., 65: 12721278, 2007.
SALVEMINI D, WANG Z, WYATT PS, BOURDON DM. Nitric oxide: a key
mediator in the early and late phase of carrageenan induced rat paw inflammation. Br
J Pharmacol. 118: 829 838, 1996.
SANDLER, S.; WELSH, M.; ANDERSON, A. Streptozotocin-induced impairment of
islet -cell metabolism and its prevention by a hydroxyl radical scavanger and
inhibitors of poly (ADP-ribose) synthetase. Acta Pharmacol. Toxicol,. 53: 392-400,
1983.
SNOW L.M.; THOMPSON L.V. Influence of Insulin and Muscle Fiber Type in
N -(Carboxymethyl)-Lysine Accumulation in Soleus Muscle of Rats with
Streptozotocin-Induced Diabetes Mellitus. 76: 227-234, 2009.
SARICAOGLU, F., DAL, D., ATILLA, P., ISKIT, A.B., TARHAN, O., ASAN E. et
al. Effect of intraarticular injection of lornoxicam on the articular cartilage & sinovium
in rat. Indian J Med Res. 127, 362-5, 2008.
SATO, K.L.; MIGLIACCIO V.; CARMO, J.M.; OLIVETI, M.C.D.B.B.; FERREIRA,
R.S.; FAZAN, V.P.S. Diabete como Modelo de Neuropatia Autonmica. Medicina. 39:
28-38, 2006.
SCHEIN, P. S.; LOFTUS, S. Streptozotocin: depression of mouse liver pyridine
nucleotides. Cancer Res. 28:1501-1506, 1968.

88
SHAW, J.E., SICREE, R.A., ZIMMET, P.Z. Global estimates of the prevalence of
diabetes for 2010 and 2030. Diabetes Research and Clinical Practice. 87: 4-14. 2010.
SLUKA KA. WESTLUND KN. Behavorial and immunohistochemical changes in the
experimental arthritis model in rats. Pain. 55:367-377, 1993.
SIU P.M., PISTILLO E.E., ALWAYS S.E. Apoptotic esponses to hindlimb suspensin
in gastrocnemius muscles from young adult and aged rats. Am J Physiol Regul Integr
Comp Physiol. 2005;289:1015-1026.
STOCKMAR C., LILL H., TRAPP A., JOSTEN C., PUNKT K. Fibre type related
changes in the metabolic profile and fibre diameter of human vastus medialis muscle
after anterior cruciate ligament rupture. Acta Histochemica. 108:335-342, 2006.
SUETTA C., AAGAARD P., MAGNUSSON S., ANDERSEN L., SIPIL S.,
ROSTED A. et al. Muscle size, neuromuscular activation, and rapid force
characteristics in elderly men and women: effects of unilateral long-term disuse due to
hip-osteoarthritis. J Appl Physiol. 102:942-948, 2007.
SURAMPUDI, P.N.; JOHN-KALARICKAL, J.; FONSECA, V.A. Emerging Concepts
in the Pathophysiology of Type 2 Diabetes Mellitus. Mount Sinai School of Medicine.
76:216-226, 2009.
TAN-NO K, NAKAJIMA T, SHOJI, T. NAKAGAWASAI O. NIIJIMA F. Antiinflammatory Effect of Propolis through Inhibition of Nitric Oxide Production on
Carrageenin-Induced Mouse Paw Edema. Biol Pharm Bull.; 29:96-99, 2006.
TRINDER, P. Determination of blood glucose using 4-amino phenazone as oxygen
acceptor. J. Clin. Pathol. 22:158-161,1969.
UCHIGATA, Y.; YAMAMOTO, H.; KAWAMURA, A.; OKAMOTO, H. Protection
by superoxide dismutase, catalase and poly (ADP-ribose) synthetase inhibitors against
alloxanstreptozotocin-induced islet DNA strand breaks an against the inhibition of
proinsulin synthesis. J. Biol. Chem. 257: 6084-6088, 1982.
VIOLLET, B.; LANTIER, L.; DVEIN-LECLERC, J.; HBRAD, S.; AMOUYAL, C.;
MOUNIER, R.; FORETZ, M.; ANDREELLI, F. Targeting the AMPK pathway for the
treatment of Type 2 diabetes. Front Biosci. 14: 3380-3400, 2009.
WANG, Y., HUANG, C., CAO, Y., HAN, Y. Repeated administration of low dose
ketamine for the treatment of monoarthritic pain in the rat. Life Sciences. 67: 261-267,
2000.
WELLER M.T.; SNYDER E.C.; PATTERSON M.N. E SWOAP S.L. An E-box within
the MHC Iib gene is bound by MyoD and is regulated for gene expression in fast
muscle. Am J Physiol Cell Physiol. 199;276:1069-78.

89
WILLIAMS G., BARRANCE P., SNYDER-MACKLER L, BUCHANAN T. Altered
quadriceps control in people with anterior cruciate ligament deficiency. Medicine &
Science in sport & Exercise. 1089-1096, 2004.
YAMAMOTO, H.; UCHIGATA, Y.; OKAMOTO, H. DNA strand breaks in pancreatic
islets in vivo administration of alloxan or streptozotocin. Biochem. Biophys. Res.
Comm. 103: 1014-1020, 1981.
ZHANG P., CHEN X., FAN M. Signaling mechanisms involved in disuse muscle
atrophy. Medical Hypoteses. 11: 1-12, 2006.

90