Você está na página 1de 21

EXERCÍCIOS ÁCIDOS NUCLÉICOS/Biologia/Wellington

  • 01. (Ufrs ) O cientista britânico Francis Crick, um dos descobridores da estrutura da

molécula de DNA, morto em julho de 2004, será lembrado como um dos mais influentes cientistas de todos os tempos. Em 1958, publicou um manifesto sobre a

síntese de proteínas, apresentando suas hipóteses sobre a estrutura teórica da biologia molecular, lançando, assim, as bases para a descoberta do código genético. Entre as hipóteses apresentadas naquele texto, destaca-se o dogma central da Biologia. Segundo esse dogma,

a)

o código genético é degenerado, pois um aminoácido pode ser codificado por mais de

uma trinca.

b)

a transferência de informações genéticas ocorre do DNA para o RNA, e deste para a

proteína.

c)

cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo

gene.

d)

cada molécula de DNA é formada pela reunião de nucleotídeos, que podem ser de

quatro tipos diferentes.

e)

uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos.

  • 02. (Ufc ) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas

podemos afirmar corretamente que:

a)

a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia

polipeptídica.

b)

a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do

tRNA.

c)

o transporte de aminoácido para o local da síntese é feito pelo mRNA.

d)

a seqüência de bases do rRNA é transcrita a partir do código do mRNA.

e)

a extremidade livre dos diversos tRNA tem seqüências de bases diferentes.

  • 03. (Puccamp) Um mutante perdeu um segmento de DNA contendo todas as cópias dos

genes que codificam RNA transportador. A função celular drasticamente afetada por

essa mutação será:

  • a) a replicação do DNA.

  • b) a síntese de RNA mensageiros.

  • c) a síntese de proteínas.

  • d) o transporte de proteínas.

  • e) o transporte de RNA.

    • 04. A seqüência de aminoácidos de uma proteína é determinada pela seqüência de:

      • a) pentoses da molécula de DNA.

      • b) pentoses da molécula de RNA - mensageiro.

      • c) bases da molécula de DNA.

      • d) bases da molécula de RNA - transportador.

      • e) bases da molécula de RNA - ribossômico

        • 06. (Puc-rio ) Com relação ao código genético e à síntese de proteínas, assinale a

afirmativa FALSA.

  • a) Na molécula de DNA, encontramos sempre desoxirribose e cinco tipos de bases:

adenina, guanina, citosina, timina e uracila.

  • b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a

proteínas, compondo os cromossomos e ribossomos na forma de moléculas complexas

de nucleoproteínas.

  • c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição, que

compreende a passagem do código genético do DNA para o RNA, e a tradução, que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético.

  • d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um

segmento de DNA e pode ser provocada por radiações, por raios cósmicos, por raios-X,

ou mesmo por exposição aos raios ultravioleta do sol.

  • e) Todas as células do corpo têm a mesma coleção de genes, mas, apesar disso,

encontramos células com formas e funções diferentes. Este processo chama-se

diferenciação celular.

  • 07. (Unifesp) Em abril de 2003, a finalização do Projeto Genoma Humano foi noticiada

por vários meios de comunicação como sendo a "decifração do código genético

humano". A informação, da maneira como foi veiculada, está

  • a) correta, porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos

humanos.

  • b) correta, porque agora se sabe toda a seqüência de genes dos cromossomos humanos.

  • c) errada, porque o código genético diz respeito à correspondência entre os códons do

DNA e os aminoácidos nas proteínas.

  • d) errada, porque o Projeto decifrou os genes dos cromossomos humanos, não as

proteínas que eles codificam.

  • e) errada, porque não é possível decifrar todo o código genético, existem regiões

cromossômicas com alta taxa de mutação.

  • 08. (Uerj) É como se em cada quarto de um imenso prédio existisse uma estante

contendo os planos do arquiteto para todo o prédio. (

...

)

No homem, os planos do

arquiteto montam 46 volumes. Nessa analogia, proposta por Richard Dawkins no livro "O gene egoísta", cada página de cada volume contém um texto formado por uma seqüência de:

  • a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas

    • 09. (Fatec) O metabolismo celular depende de uma série de reações químicas

controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem

sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula.

  • a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA

mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas.

  • b) No caso de uma mutação acarretar a transformação de um códon em outro

relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada,

nem no metabolismo celular.

  • c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na

seqüência de bases do RNA mensageiro e, conseqüentemente, na produção das

proteínas.

  • d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas

moléculas e, conseqüentemente, a inativação delas.

  • e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo

celular passam a ser realizadas pelos aminoácidos.

  • 10. (Fuvest) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo

celular, isso significa que

  • a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares.

  • b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas

catalisadoras das reações metabólicas.

  • c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as

reações metabólicas.

  • d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações

metabólicas.

  • e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções

celulares, catalisando as reações metabólicas.

  • 11. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de

ácido nucléico, portanto é formado por:

I. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem, formando ligações fosfo-diéster.

II. duas cadeias polinucleotídicas paralelas e complementares entre si, através dos pareamentos de aminoácidos.

III. nucleotídeos que são compostos por uma base nitrogenada, uma pentose e um radical "fosfato".

Está(ão) correta(s)

  • a) apenas I b) apenas II c) apenas III d) apenas I e II e) apenas II e III.

    • 13. (Fuvest) Em um organismo, células musculares e células nervosas diferem

principalmente por:

  • a) possuírem genes diferentes. b) possuírem ribossomos diferentes.

  • c) possuírem cromossomos diferentes. d) expressarem genes diferentes.

  • e) utilizarem código genético diferente.

    • 14. Que papéis desempenham o RNA mensageiro e do RNA transportador no processo

de síntese das proteínas?

  • 15. Quais os papéis do gene e do ribossomo na síntese das proteínas celulares?

  • 16. (Ufrs) Considere as seguintes etapas da síntese de proteínas.

I - Transcrição do código genético do DNA em códons do RNA mensageiro.

II - Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores.

III - Fixação do RNA mensageiro aos ribossomos.

Qual a seqüência correta dessas etapas durante o processo?

  • a) I - II - III. b) I - III - II. c) II - III - I d) III - II – I e) III - I - II.

    • 17. (Puc) Com relação ao código genético, foram feitas as seguintes afirmações:

I. Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminoácido.

II. O RNA ribossômico contém as informações para as proteínas que devem ser sintetizadas.

III. O RNA mensageiro, de acordo com o anticódon que possui, liga-se a um aminoácido específico.

IV. Diversos aminoácidos são codificados por mais de uma trinca de nucleotídeos.

São verdadeiras APENAS as afirmações

  • a) I e II b) I e IV c) II e III d) II e IV e) I, III e IV

    • 18. (Unicamp) O metabolismo celular é controlado por uma série de reações em que

estão envolvidas inúmeras proteínas. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas, levando a mudanças no ciclo de vida da célula.

  • a) Explique a relação que existe entre gene e proteína.

  • b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação?

  • c) Em que situação uma mutação não altera a molécula protéica?

    • 19. (Ufrj) Em um organismo pluricelular com vários tecidos, como no caso dos seres

humanos, todas as células possuem um genoma idêntico.

Analogamente, é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta

20. (Unb) A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante. Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir, como V ou F:

a) I - II - III. b) I - III - II. c) II - III

(0) O esquema mostra a síntese protéica em uma célula procariótica.

(1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes.

(2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente.

(3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína.

21.

(Unb) Desde que Watson e Crick propuseram um modelo para a estrutura do DNA,

em 1953, tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular, do que é exemplo a recente clonagem de uma ovelha. Julgue os itens a seguir, acerca do referido ácido nucléico, como V ou F:

(1) Apesar de ser o sexto elemento mais abundante no universo e o mais versátil de todos, o carbono não faz parte da estrutura do DNA.

(2) A coloração de cromossomos com vários matizes é uma técnica atual que se baseia no uso de vários corantes para os diferentes lipídios que constituem os cromossomos.

(3) No processo de recombinação entre cromátides, ocorre a troca de, no mínimo, um segmento de DNA que corresponde a um gene funcional.

(4) As mutações gênicas implicam necessariamente a modificação do fenótipo do indivíduo.

(5) Nos processos de fecundação natural, a mãe transmite maior quantidade de DNA para o filho do que o pai.

22.

(0) O esquema mostra a síntese protéica em uma célula procariótica. (1) Os tipos de RNA

(Puc) Responder à questão com base na ilustração e afirmativas a seguir.

I. Durante o processo A, denominado replicação, o DNA se duplica.

II. Durante o processo B, denominado transcrição, ocorre a síntese de RNA.

III. Durante o processo C, denominado tradução, dá-se a síntese protéica.

IV. Nos eucariotos, os processos A, B e C ocorrem no interior do núcleo.

Considerando os processos intracelulares, todas as afirmativas corretas encontram-se na alternativa:

  • a) I, II e III

  • b) I, III e IV

  • c) I e IV

  • d) II e III

  • e) II, III e IV

  • 23. (Fuvest) Qual das alternativas se refere a um cromossomo?

    • a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie.

    • b) Uma única molécula de DNA com informação genética para algumas proteínas.

    • c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica.

    • d) Uma única molécula de RNA com informação para uma cadeia polipeptídica.

    • e) Uma seqüência de três bases nitrogenadas do RNA mensageiro correspondente a um

aminoácido na cadeia polipeptídica.

  • 24. (Uer) Num experimento, foram comparadas as características genotípicas e

fenotípicas de células retiradas de um tecido de anfíbio, ainda no estágio de girino, com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. Explique por que, entre essas células:

  • a) as características genotípicas são iguais;

  • b) as características fenotípicas são diferentes.

    • 25. De que maneira os genes determinam o fenótipo de um organismo?

    • 26. Defina os seguintes termos, usados em genética molecular:

      • a) cistron

      • b) códon

        • 27. Considere um segmento de molécula de DNA com a seguinte seqüência de bases:

AAT – CAA – AGA – TTT – CCG.

Quantos aminoácidos poderá ter, no máximo, uma molécula de proteína formada pelo segmento considerado?

  • a) 15

  • b) 10

  • c) 5

  • d) 3

  • e) 1

    • 28. Analise as alternativas abaixo, relacionadas com o código genético:

I. Um mesmo códon pode codificar mais de um aminoácido. II. Um aminoácido pode ser codificado por diferentes códons. III. O código usado na espécie humana é o mesmo dos vírus.

Estão corretas:

  • a) I e II

  • b) I e III

  • c) II e III

  • d) Apenas II

  • e) I, II e III

    • 29. Uma proteína é constituída por 350 aminoácidos. Quantos nucleotídeos apresenta a

cadeia do ADN que codificou tal proteína?

  • a) 150

  • b) 350

  • c) 450

  • d) 700

  • e) 1 050

    • 30. (FUVEST) Qual o papel do RNA mensageiro e do RNA transportador na síntese de

proteínas?

  • 31. Uma célula terminou de sintetizar uma enzima constituída por uma cadeia de 56

aminoácidos. Quantas moléculas de RNA-m e de RNA-t foram usadas na biossíntese?

  • 32. Em relação à síntese protéica é errado afirmar que:

    • a) Uma das fitas do DNA é transcrita, formando-se uma molécula de RNA mensageiro.

    • b) A tradução da fita do RNA mensageiro é feita nos ribossomos.

    • c) Os ribossomos originam-se do nucléolo.

    • d) Cada RNA mensageiro codifica uma cadeia polipeptídica.

  • e) Cada RNA de transferência possui um anticódon específico, que se prende ao

aminoácido que irá transportar até o ribossomo.

  • 33. (UF - Sergipe) A seleção de cada aminoácido que entra na composição de cadeia

polipeptídica é determinada por uma seqüência de:

  • a) 2 nucleotídeos do DNA;

  • b) 2 nucleotídeos do RNA;

  • c) 3 nucleotídeos do RNA;

  • d) 3 desoxirriboses do DNA;

  • e) 3 riboses do RNA mensageiro.

    • 34. Considerando o seguinte esquema:

e) Cada RNA de transferência possui um anticódon específico, que se prende ao aminoácido que irá

as etapas 1, 2 e 3 representam, respectivamente, os processos de:

  • a) replicação, transcrição e tradução;

  • b) replicação, tradução e transcrição;

  • c) transcrição, replicação e tradução;

  • d) transcrição, tradução e replicação;

  • e) tradução, replicação e transcrição.

TEXTO PARA A PRÓXIMA QUESTÃO:

Leia o texto a seguir para responder à(s) seguinte(s) questão(ões):

As bases nitrogenadas, quando oxidadas, podem causar emparelhamento errôneo durante a replicação do DNA. Por exemplo, uma guanina oxidada (G*) pode passar a se emparelhar, durante a divisão celular, com timina (T) e não com citosina (C). Esse erro gera células mutadas, com uma adenina (A) onde deveria haver uma guanina (G) normal.

  • 35. (Uerj 2014) Considere uma célula bacteriana com quatro guaninas oxidadas em

um trecho do gene que codifica determinada proteína, conforme mostra a sequência:

G*CG* - CCC - TG*T - ACG* - ATA

Ao final de certo tempo, essa célula, ao dividir-se, dá origem a uma população de bactérias mutantes. O número máximo de aminoácidos diferentes que poderão ser substituídos na proteína sintetizada por essas bactérias, a partir da sequência de DNA apresentada, é igual a:

  • a) 0

  • b) 1

  • c) 2

36. (Ufg 2013) Os nucleotídeos são constituídos por uma molécula de desoxirribose (D), uma molécula de ácido fosfórico (P) e uma base nitrogenada (adenina, guanina, timina ou citosina). A ligação entre os nucleotídeos ocorre pela interação entre as bases nitrogenadas específicas, resultando em uma molécula ordenada e bem definida, o DNA. De acordo com essas informações, a estrutura plana que representa um fragmento de DNA e o tipo de ligação química responsável pela interação entre as bases nitrogenadas são, respectivamente,

a)

b)

c)

d)

e)

36 . (Ufg 2013) Os nucleotídeos são constituídos por uma molécula de desoxirribose (D), uma molécula
36 . (Ufg 2013) Os nucleotídeos são constituídos por uma molécula de desoxirribose (D), uma molécula
36 . (Ufg 2013) Os nucleotídeos são constituídos por uma molécula de desoxirribose (D), uma molécula
36 . (Ufg 2013) Os nucleotídeos são constituídos por uma molécula de desoxirribose (D), uma molécula

37. (Uerj 2013) A mutação no DNA de uma célula eucariota acarretou a substituição, no RNA mensageiro de uma proteína, da 15ª base nitrogenada por uma base C. A disposição de bases da porção inicial do RNA mensageiro da célula, antes de sua mutação, é apresentada a seguir:

início da tradução AUGCUUCUCAUCUUUUUAGCU ...

Observe os códons correspondentes a alguns aminoácidos:

Aminoácido

Códon

codificado

fenilalanina

UUU

fenilalanina

UUC

leucina

UUA

leucina

UUG

leucina

CUC

metionina

AUG

valina

GUU

valina

GUA

Sabe-se que o códon de iniciação de leitura é AUG.

A probabilidade de que a proteína a ser traduzida pelo RNA mensageiro da célula que sofreu mutação não apresente alterações na disposição de seus aminoácidos é de:

a)

0

b)

0,25

c)

0,50

d)

1,00

e)

38. (Ufg 2013) A figura a seguir esquematiza as duas etapas envolvidas no processo de síntese proteica em um linfócito B.

a) 0 b) 0,25 c) 0,50 d) 1,00 e) 38. (Ufg 2013) A figura a seguir
a) 0 b) 0,25 c) 0,50 d) 1,00 e) 38. (Ufg 2013) A figura a seguir

Com base nestas informações, responda:

a)

Como se denominam as etapas 01 e 02, respectivamente?

b)

Após uma imunização ativa, como ocorre a ação do produto final desse processo?

39. (Ufsm 2013) Ao percorrerem uma trilha ecológica, os escoteiros encontraram duas plantas que eram fenotipicamente idênticas, porém tinham aromas distintos, uma exalava citral, outra canela. Com permissão do fiscal, levaram amostras para análise de DNA. A seguir, tem-se parte das sequências obtidas das plantas.

citral:

...

‘AACAAGCCAACCAGCACGCGGAAA’ ...

 

e

canela:

...

‘GGGAAAGGACCAAAACCAAAAGGC’ ...

TABELA DO CÓDIGO GENÉTICO

 

Segunda Base do Códon

Segunda Base do Códon
 

U

C

A

G

   

UUU Phe

UCU Ser

UAU Tyr

UGU Cys

U

 

U

UUC Phe

UCC Ser

UAC Tyr

UGC Cys

C

UUA Leu

UCA Ser

UAA pare*

UGA pare*

A

UUG Leu

UCG Ser

UAG pare*

UGG Trp

G

CUU Leu

CCU Pro

CAU His

CGU Arg

U

C

CUC Leu

CCC Pro

CAC His

CGC Arg

C

Primeira

CUA Leu

CCA Pro

CAA Gin

CGA Arg

A

Terceira

Base

CUG Leu

CCG Pro

CAG Gin

CGG Arg

G

Base

do

AUU Ile

ACU Thr

AAU Asn

AGU Ser

U

do

Códon

AUC Ile

ACC Thr

AAC Asn

AGC Ser

C

Códon

A

AUA Ile

ACA Thr

AAA Lys

AGA Arg

A

AUG Met

ACG Thr

AAG Lys

AGG Arg

G

GUU Val

GCU Ala

GAU Asp

GGU Gly

U

G

GUC Val

GCC Ala

GAC Asp

GGC Gly

C

GUA Val

GCA Ala

GAA Glu

GGA Gly

A

GUG Val

GCG Ala

GAG Glu

GGG Gly

G

Abreviaturas dos aminoácidos

Phe ou fen = fenilalanina Leu = leucina Ile ou iso = isoleucina Met = metionina Val = valina Ser = serina Pro = prolina Thr ou tre = treonina Ala = alanina Tyr ou tir = tirosina

His = histidina Gln = glutamina Asn = aspargina Lys ou lis = lisina Asp = ácido aspártico Glu = ácido glutâmico Cys ou cis = cisteína Trp = triptofano Arg = arginina Gly ou gli = glicina

*A abreviatura pare corresponde aos códons de parada.

Fonte: AMABIS, J.; MARTHO, G. Biologia - Biologia das Células. 3. ed. São Paulo: Moderna, 2010. vol. 1. p. 227. (adaptado)

Com base nessas informações, determinou-se que as plantas citral e canela são diferentes genotipicamente. Os aminoácidos correspondentes a elas são, respectivamente,

  • a) leu–fen–gli–trp–ser–cis–ala–fen e pro–fen–pro–gli–fen–gli–fen–pro.

  • b) asn–lis–pro–tre–tre–pro–arg–lis e gli–lis–gli–pro–lis–pro–lis–gli.

  • c) asn–lis–pro–tre–tre–pro–arg–lis e pro–fen–pro–gli–fen–gli–fen–pro.

  • d) leu–lis–gli–tre–ser–pro–ala–lis e pro–lis–pro–pro–fen–pro–pro–gli.

  • e) leu–fen–gli–trp–ser–cis–ala–fen e gli–lis–gli–pro–lis–pro–lis–gli.

40. (Unesp 2012) Em um laboratório, um pesquisador aqueceu um segmento de

dupla fita de DNA de modo que obteve duas fitas simples complementares. Ao sequenciar uma dessas fitas, encontrou a relação (A + G)/(T + C) = 0,5, ou seja, o número de adeninas somado ao número de guaninas, quando dividido pelo número de timinas somado ao número de citosinas, resultou em 0,5. Em função dessas informações, pode-se afirmar que o aquecimento foi necessário

para romper as

__________________ complementar foi de _____.

e que a relação (A + G)/(T + C) na fita

As lacunas são preenchidas correta e respectivamente por:

b)

pontes de hidrogênio e 1,0.

  • c) pontes de hidrogênio e 2,0.

  • d) ligações fosfodiéster e 1,0.

  • e) ligações fosfodiéster e 2,0.

    • 41. (Uern 2012) Em 1978, o geneticista Walter Gilbert propôs os termos exon para

designar as regiões de um gene que codifica uma sequência de aminoácidos, e

intron para designar as regiões de um gene não traduzidas, localizadas entre os exons.

b) pontes de hidrogênio e 1,0. c) pontes de hidrogênio e 2,0. d) ligações fosfodiéster e
b) pontes de hidrogênio e 1,0. c) pontes de hidrogênio e 2,0. d) ligações fosfodiéster e
b) pontes de hidrogênio e 1,0. c) pontes de hidrogênio e 2,0. d) ligações fosfodiéster e

A Ciência estima que seja de 30 mil o número de genes da espécie humana, no entanto, o número de proteínas diferentes esteja estimado entre 100 mil a 120 mil. Isso ocorre devido ao(à)

  • a) união de proteínas recém-sintetizadas, formando novos compostos.

  • b) Splicing, isto é, cortes e montagens diferentes do mesmo RNA-mensageiro.

  • c) genes que, ativos em uma célula, podem estar inativados em outra.

  • d) diferença da carga genética nos tipos de células diferenciados.

    • 42. (Ufrgs 2012) O quadro abaixo representa o código genético universal.

 

U

C

A

G

U

UUU

UUC

UUA

UUG

Fen

Leu

UCU

UCC

UCA

UCG

 

 

Ser

UAU

UAC

UAA

UAG

Tir

Fim

UGU

UGC

Cis

UGA Fim

UGG Trp

U

C

A

G

C

CUU

CUC

CUA

CUG

Leu

CCU

CCC

CCA

CCG

Pr o

CAU

CAC

CAA

CAG

His

GIn

CGU

CGC

CGA

CGG

Arg

U

C

A

G

A

AUU

AUC Ile

AUA

AUG Met/Início

ACU

ACC

ACA

ACG

Tre

AAU

AAC

AAA

AAG

Ans

Lis

AGU

AGC

AGA

AGG

Ser

Arg

U

C

A

G

G

GUU

GUC

GUA

GUG

Val

GCU

GCC

GCA

GCG

Ala

GAU

GAC

GAA

GAG

Asp

Glu

GGU

GGC

GGA

GGG

Gli

U

C

A

G

A molécula de RNA mensageiro com a sequência CGAAUGACAAAAGGAUAACGU produz o segmento de proteína

  • a) Met – Tre – Lis – Gli – Arg.

  • b) Tre – Arg – Met.

  • c) Arg – Met – Tre – Lis – Gli.

  • d) Met – Tre – Lis – Gli.

  • e) Leu – Arg – Met – Tre – Lis – Gli.

43. (Ufsc 2012) O Código Genético é universal por ser praticamente o mesmo em todos os seres vivos, embora existam raríssimas exceções a esta universalidade. Ele também é chamado de degenerado, porque para a codificação de quase todos os aminoácidos existem mais de um códon, conforme é mostrado na Tabela do Código Genético, a seguir:

1ª Base

 

3ª Base do

do

 

2ª Base do Códon

 

Códon

Códon

 


U

C

A

G

     

Tirosina

   

U

Fenilalanina

Fenilalanina

Leucina

Leucina

Serina

Serina

Serina

Serina

Tirosina

Parada

(Stop)

Parada

(Stop)

Cisteína

Cisteína

Parada

(Stop)

Triptofano

U

C

A

G

 

Leucina

Prolina

Histidina

Arginina

U

C

Leucina

Prolina

Histidina

Arginina

C

Leucina

Prolina

Glutamina

Arginina

A

Leucina

Prolina

Glutamina

Arginina

G

 

Isoleucina

Treonina

Asparagina

Serina

U

A

Isoleucina

Treonina

Asparagina

Serina

C

Isoleucina

Treonina

Lisina

Arginina

A

Metionina

Treonina

Lisina

Arginina

G

     

Ac.

   

Valina

Alanina

Aspártico

Glicina

U

G

Valina

Alanina

Ac.

Glicina

C

Valina

Alanina

Aspártico

Glicina

A

 

Valina

Alanina

Glutamina

Glicina

G

Glutamina

Ao final da tradução de um RNA mensageiro foi formado um polipeptídio que apresenta os seguintes aminoácidos em suas posições relativas:

Metionina

Triptofano

Triptofano

Arginina

Lisina

Cisteína

Fenilalani

na

1

2

3

4

5

6

7

Assinale a(s) proposição(ões) CORRETA(S). 01) O RNA mensageiro que forma este polipeptídio apresenta 7 (sete) pares de bases nitrogenadas. 02) Se o códon do RNA mensageiro que codifica o segundo aminoácido for modificado na sua terceira base (de G para A), a cadeia polipeptídica será formada faltando um aminoácido. 04) Existem no total 16 sequências possíveis de RNA mensageiro para formarem este polipeptídio. 08) Os aminoácidos da primeira e da segunda posição são exemplos da razão pela qual o código genético é chamado de degenerado. 16) A presença do códon UAA no RNA mensageiro faz com que a maquinaria de tradução (ribossomo + RNA mensageiro) seja desmontada. 32) Pela análise da tabela do código genético podemos afirmar que o aminoácido da 7ª (sétima) posição pode ser codificado por apenas um códon. 64) Uma mutação no DNA pode ou não levar a modificações na sequência dos aminoácidos deste polipeptídio.

44. (Ufg 2012) Os esquemas I e II abaixo mostram as etapas da expressão gênica em dois organismos distintos, um procarioto e um eucarioto.

  • a) Indique, com justificativa, qual esquema se refere ao eucarioto. Em qual ou quais compartimentos celulares ocorrem as etapas indicadas por 1 e 2 no esquema I, e as etapas 3 e 5 do esquema II?

  • b) A remoção diferencial de íntrons do RNA mensageiro pode resultar na produção de diferentes peptídeos. Qual das etapas indicadas nos esquemas corresponde ao processo de remoção de íntrons? Explique por que a remoção diferencial de introns pode acarretar a produção de diferentes peptídeos.

Ao final da tradução de um RNA mensageiro foi formado um polipeptídio que apresenta os seguintes
Ao final da tradução de um RNA mensageiro foi formado um polipeptídio que apresenta os seguintes

45. (Uerj 2012) O esquema abaixo representa o mecanismo de biossíntese proteica em um trecho de DNA de uma célula eucariota. Observe que sua hélice inferior será transcrita e que as bases nitrogenadas, em destaque, compõem um íntron, a ser removido no processamento do pró-RNAm.

Identifique a sequência de bases que irá compor o trecho de RNA mensageiro a ser traduzido

Identifique a sequência de bases que irá compor o trecho de RNA mensageiro a ser traduzido em proteína e determine o número de aminoácidos a serem introduzidos na proteína nascente.

  • 01. [B]

  • 02. [A]

  • 03. [C]

  • 04. [C]

  • 06. [A]

  • 07. [C]

  • 08. [D]

  • 09. [B]

  • 10. [B]

  • 11. [C]

  • 13. [D]

GABARITO:

  • 14. Os papes desempenhados são: REPLICAÇÃO - para que possa ser transmitido à

descendência; e TRANSCRIÇÃO (ou produção do RNA) - para controlar as atividades celulares através da síntese de proteínas.

15.

O gene determina a ordenação dos aminoácidos das proteínas produzidas em uma

célula. Os ribossomos fazem a tradução do código genético do DNA através da leitura do RNA mensageiro.

16.

[B]

17.

[B]

18.

  • a) Gene é um segmento do DNA localizado nos cromossomos. Possui um código

químico representado por seqüências de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases é capaz de codificar um aminoácido de uma proteína. A seqüência de trincas determinará a seqüência dos aminoácidos de um polipeptídeo.

  • b) Mutações são modificações na seqüência ou na composição das bases do DNA (gene)

que podem causar a produção de uma proteína alterada, ou mesmo a não produção da proteína.

  • c) A substituição de uma base nitrogenada no DNA pode não causar nenhuma alteração

na proteína produzida pela célula porque o código genético é degenerado, ou seja, um

mesmo aminoácido pode ser codificado por diferentes trincas de bases.

19.

Não. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes proteínas

que contêm. Assim, a diferenciação dos tecidos resulta principalmente da transcrição de genes diferentes, o que naturalmente produz uma composição de RNAm qualitativamente diferente de tecido para tecido.

20.

F F F V

21.

F F F F V

22.

[A]

23.

[B]

24.

  • a) As células possuem DNA idênticos.

  • b) Embora essas células possuam o mesmo DNA, diferentes genes podem ser ativados

ou não durante as etapas do desenvolvimento do indivíduo.

25.

Codificando a síntese de proteínas que, produzindo estruturas celulares ou

funcionando como enzimas, determinam as características de um organismo.

26.

  • a) Cistron ou gene é o segmento de DNA que, através das bases nitrogenadas,

codifica a seqüência de aminoácidos de uma proteína.

  • b) É a seqüência de três bases que codificam um aminoácido.

27.

C

  • 28. C

  • 29. E

  • 30. RNA-m leva a mensagem genética ao ribossomo. RNA-t transporta aminoácidos para os ribossomos.

  • 31. Uma molécula de RNA-m e 56 moléculas de RNA-t.

32. E

Gabarito:

33. C

Resposta da questão 35:

34. A

[C]

De acordo com as informações, as guaninas oxidadas serão substituídas por adeninas. Desse modo, no DNA das células mutadas, dos três códons modificados, dois serão iguais:

G * CG*

ACA

TG * T

TAT

ACG*

ACA

Como o código é degenerado, duas consequências são possíveis:

1ª. Os códons alterados podem codificar para o mesmo aminoácido. Neste caso, não haverá alteração na proteína. 2ª. Dos três códons alterados, dois são iguais. Logo, no máximo dois aminoácidos podem ser diferentes.

Resposta da questão 36:

[A]

No DNA, a estrutura plana revela o pareamento de adenina (A) com timina, (T) e de guanina (G) com citosina (C). As interações que unem as duas cadeias polinucleotídicas são pontes de hidrogênio.

Resposta da questão 37:

[D]

A substituição da base U (uracila) pela base C (citosina) no quinto códon muda a sequência UUU para UUC. Devido à degeneração do código genético, o aminoácido codificado será o mesmo. Portanto, a probabilidade de que não ocorra alteração nos aminoácidos da proteína codificada será igual a 1.

Resposta da questão 38:

a) Etapa 01: transcrição; etapa 02: tradução. b) A imunização ativa estimula os linfócitos B à produção de anticorpos (produto final), moléculas proteicas capazes de se ligarem ao antígeno, inativando-o e tornando-o mais fácil de ser fagocitado por macrófagos, neutrófilos e eosinófilos (células de defesa).

Resposta da questão 39:

[A]

DNA (citral):

...

AAC

AAG

CCA

ACC

AGC

ACG

CGG

AAA

RNAm:

...

UUG

UUC

GGU

UGG

UCG

UGC

GCC

UUU

aminoácidos:

...

leu

fen

gli

trp

ser

cis

ala

fen

...

DNA (canela):

...

GGG

AAA

GGA

CCA

AAA

CCA

AAA

GGC

RNAm:

...

CCC

UUU

CCU

GGU

UUU

GGU

UUU

CCG

aminoácidos:

...

pro

fen

pro

gli

fen

gli

fen

pro

Resposta da questão 40:

 

[C]

O aquecimento é capaz de romper as pontes de hidrogênio, as quais mantêm unidas as duas cadeias polinucleotídicas do DNA. Caso em uma das cadeias do DNA a relação A+G/T+C = 1/2, na cadeia complementar dessa mesma molécula, a relação é igual a 2. Na molécula de DNA de cadeia dupla, a relação A+G/T+C é igual a 1.

 

Resposta da questão 41:

 

[B]

Devido ao número muito menor de genes da espécie humana frente ao número superior de proteínas diferentes, somente o corte e montagem de diferentes RNAs será possível à constituição das diferentes proteínas encontradas.

 

Resposta da questão 42:

 

[D]

O RNA mensageiro será traduzido a partir do códon de iniciação AUG e terminará no códon terminal UAA. Dessa forma, o peptídeo formado apresentará a seguinte sequência de aminoácidos: metionina – treonina – lisina – glicina.

Resposta da questão 43:

16 + 64 = 80.

(01) Falso. O RNA mensageiro é formado por uma cadeia simples. (02) Falso. O códon UGA determina o fim da tradução. (04) Falso. Existem no total 48 sequências possíveis de RNA mensageiro para codificar o polipeptídeo considerado, (08) Falso. Os aminoácidos metionina e triptofano são codificados, respectivamente, por códons únicos, ou seja, AUG e UGG. (32) Falso. O aminoácido fenilalanina é determinado por dois códons distintos: UUU e UUC.

Resposta da questão 44:

a) O esquema II refere-se a um organismo eucarioto. Nos procariotos (esquema I) o genoma não contém íntrons. Nos organismos procariotos a transcrição (1) e a tradução (2) ocorrem simultaneamente no citoplasma celular. Em eucariotos, a transcrição (3) ocorre no núcleo e a tradução (5) se passa no citoplasma. b) A remoção diferencial dos íntrons ocorre na etapa 4. O agrupamento alternativo dos íntrons (regiões codificantes) pode dar origem a diferentes tipos de RNAs mensageiros que serão traduzidos em peptídeos distintos.

Resposta da questão 45:

Sequência: A-U-G-G-A-A-A-A-A-U-A-C Número de aminoácidos: 4