LS3-2, F2015

Chentao Lin,

Life Science 3 (LS3-2)

LS3-2 (F2015) Syllabus

Introduction to Molecular Biology

2:00 - 3:15pm, Tuesday and Thursday, LaKretz 110

Textbook: Molecular Biology (5th Edition, 2012) by R.F. Weaver

Fall 2015 (9/26/2013-12/09/2013)

Instructor:

Lectures
Office Hours:
Textbook:
Course Web site:

Chentao Lin, Ph.D.

Professor of Molecular, Cell & Developmental Biology
Office: 4014 Terasaki Life Science Building (TLSB)
Phone: 310-206-9576 (Cell phone # available upon request)
email: clin@mcdb.ucla.edu (preferred method of communication)
Homepage: http://www.mcdb.ucla.edu/Research/Lin/
Tueday, Thursday 2:00 pm 3:15 pm, LaKretz 110
Tuesday, Thursday 3:30 pm 5:30 pm, 4014 TLSB
Molecular Biology (5th Edition, 2012) by R.F. Weaver
https://ccle.ucla.edu/course/view/. The pdf files of notes and Bruincast Video
of lectures (http://www.bruincast.ucla.edu) will be posted online.

Week

Lecture

Thursday, 9-24

Genes and genomes

Chapter 2

Tuesday, 9-29

RNA and Proteins

Chapter 3

Thursday, 10-1

Methods in Molecular Biology I

Chapter 4-5

Tuesday, 10-6

Methods in Molecular Biology II

Chapter 4-5

Thursday, 10-8

Methods in Molecular Biology III

Tuesday, 10-13

Methods in Molecular Biology IV

Midterm I

Thursday 10-15

Exam covering lectures 1-6

5:00-6:50pm

Thursday, 10-15

Prokaryotic Transcription I

Chapter 6-9

Tuesday 10-20

Prokaryotic Transcription II

Thursday 10-22

Prokaryotic Transcription III

10

Tuesday 10-27

Eukaryotic Transcription I

Chapter 10-13

11

Thursday 10-29

Eukaryotic Transcription II

Chapter 10-13

12

Tuesday 11-3

2
3

Hornor Section (LS89 & HRNS85): 4-4:50pm Thursday, Math Sci Bidg. Rm5273,
Enroll online or by email to Jen Weill (jweill@lifesci.ucla.ed)
Exams & Grading:
Midterm I (5-6:60pm, Thursday 10/15/15, lectures 1-6)
100pts
20%
Midterm II (5-6:50pm, Thursday 11/5/15, lectures 7-14)
100pts
20%
Final Exam* (11:30am-2:30pm, Thursday,12/10/15)
300pts
60%
* The 60% portion of the Final Exam includes 20% for lectures 15-20, and 40% for lectures1-20.
Discussion Sections:
There will be Discussion sections each week in MS (room 3915H). The schedule of those sections
have been posted online. TAs will address questions regarding lectures in the discussion sections.
Teaching Assistants (TAs):
Adam Gomez, adagomez@ucla.edu, Yazan Alhadid, yalhadid@ucla.edu, David Nusbaum,
dn27800m@gmail.com, Mia Lim, mialim1992@gmail.com
Course Administration:
For all administrative questions of this class, please contact Jen Weill (jweill@lifesci.ucla.edu,
phone; 310-825-6614) of the Life Science Core Curriculum Office (Room 222, Hershey Hall).
Michelle Veintimilla (email: mveintimilla@lifesci.ucla.edu), Lily Yanez (email:
lscore@lifesci.ucla.edu) will provide additional help if needed.
Peer Learning Program: You can sign up for peer learning program through MyUCLA beginning
on Thursday, October 1st at 8:00pm by clicking the "Academics" tab on the top menu and selecting
"Peer Learning," or by https://www.lscore.ucla.edu/lsplf.php. Contact Dr. Gaston Pfluegl
(gaston@lifesci.ucla.edu) for more information.

4
5
6

8
9

Reading

Topics

Chapter 4-5
Chapter 4-5

Chapter 6-9
Chapter 6-9

Eukaryotic Transcription III

Chapter 10-13

Thursday 11-5

Exam covering lectures 7-12

5:00-6:50pm

13

Thursday 11-5

RNA processing I

Chapter 14-16

14

Tuesday 11-10

RNA processing II

Chapter 14-16

15

Thursday 11-12

Translation I

Chapter 17-19

16

Tuesday 11-17

Translation II

Chapter 17-19

17

Thursday 11-19

DNA Replication I

Chapter 17-19

18

Tuesday, 11-24

DNA Replication II

Chapter 17-19

Thursday, 11-26

Thanksgiving holiday

Midterm II

Date

10

19

Tuesday, 12-1

Genome structure

20

Thursday, 12-3

Genome analyses

Final Exam

1 to 20

Thursday,12-10

20%(I)+20%(II)+40%(III)

Chapter 20-21
Chapter 23-24
11:30am-2:30pm

All course materials are online

#0 Introduction-Review
A review of what you should have
learned in the pre-required courses
Basics of biology
Basics of Cells
Basic chemistry

Discussion sections

What is molecular biology?

An area of science that addresses questions
concerning the physical and chemical basis of life

DNA, RNA, Proteins

What are genes and gene
products?
how do proteins work?
How are genes expressed?
How are genes regulated?
......

What are you expected to

learn by Dec 10, 2015?
1. What are genes and genomes?
2. How are genes and genomes studied?
3. What are the molecular processes and
regulatory mechanisms of RNA transcription,
protein translation, and DNA replication?
4. How do those processes affect life?

Two dilemmas in
designing a gene in evolution
1. Size vs stability
Genes need to be small enough to fit into a tiny cell, but
genes also need to be very accurately copied from generation to
generation: e.g. with the estimated mutation frequency of less
than one aa (amino acid) per 200,000 years for a 400 aa
protein. The dilemma is that the smaller the molecule the
easier it is to undergo change or mutation.
2. Complexity vs simplicity
Genetic materials need to be complex enough to specify
all aspects of complex features and functions of a living
organism (e.g. to study LS3), yet they need to be simple enough
to be copied rapidly (e.g. <20 min in E. coli, <1hr in human).

1. How did we know what is a gene?

Griffith experiment (1928)
Avery experiment (1944)
Hershey experiment (1952)
Watson-Crick experiment (1953)

These four experiments addressed the question:

what was the genetic material? - DNA

Beadle experiment (1941)

Jacob experiment (1961)

These two experiments addressed the question:

how does genetic information transmitted? from DNA to
protein

#1 Genes and Genomes

1.The nature of genetic material
2.DNA structure
3.Physicochemical properties of DNA
4.The size of DNA, genes, and genome

Discovery of DNA
DNA was first discovered by a biochemist
Fredrich Miescher in 1869 in Germany. He isolated an
acid and alkali-soluble material from white blood cells
found in pus in surgical bandages, which contained
some very large acidic molecule rich in phosphorus. He
called the material nuclein (now we know they are most
likely DNA-protrein mixtures).
The term nucleic acid was coined in 1889 by one
of Mieschers student Richard Altmann
It took almost another half century for scientists to
recognize the function and importance of DNA

(1) The Griffith experiment (1928)

Frederick Griffith (1879-1941)
studied bacterium Streptococcus
peneumoniae
-The S strain causes pneumonia and it
is lethal to mouse (virulent)
-The R strain can be recognized by
the immune system, so it is avirulent.
Question: whats the difference?

R (avirulent)

S (virulent)

What did we know by the late 1920s?

1. Genetic materials are located on chromosomes in the nucleus
2. Chromosomes are composed of DNA and proteins
3. The structure of proteins are much more complex than DNA
4. Although DNA was first suggested to be the genetic
material by a botanist E. Zacharias in 1884, protein being
genetic material was the prevailing view at the time

Transformation

What was the S substance?

a) virulent S strain bacteria infected and killed the host

b) avirulent R strain did not infect the host
c) Heat-killed S strain was no longer infectious or virulent
d) When the avirulent R strain was mixed with heat-killed S strain,
some R were transformed to become the virulent S strain!
Griffiths hypothesis:
there was a S substance or
transformation principle of the
S strain. The S substance can be
released by the dead S cells,
which was taken up by R cell
(avirulent) and transformed the R
cell to the S cell (virulent).
It was shown later that bacteria
can indeed take up foreign DNA
from the environment and
incorporate the foreign DNA into
its own genome - a process also
called transformation as
discussed later in our course.

Griffith thought it might be protein as most scientists thought at the time.

(2). The Avery experiment

(Oswald Avery, Colin Macleod, and Maclyn McCarty, 1944)

Experiment: fractionated cellular
extract from S bacteria,tested each
fraction for its transformation
activity, and identified the S
substance, which:

(1) exhibited all the chemical

properties of DNA
(2) no other material (e.g.
protein, lipid, sugar. etc) was
found in the active extract,
(3) only the DNA-digesting enzyme
(DNase) could inactivate it.

Therefore, DNA was hypothesized to be the S substance

(3) The Hershey experiment

2. DNA structure

(Alfred Hershey and Martha Chase, 1952)

Was Averys hypothesis
correct?

DNA (deoxyribonucleic acid) is polydeoxyribonucleotide

composed of many deoxyribonucleotide covalently
linked by phosphodiester bonds

Bacterialphage (phage)is bacterial

virus, its genetic material can be
passed on from one generation to the
next, so it serves as a good model
system for Hershey and Chase
The T2 phage used by Hershey and
Chase contains only DNA and protein,
so phages could be labeled in only
proteins (with 35S) or in only DNA
(with 32P).

Two puzzling observations in early days:

1. The base composition of DNA is different in
different organism, but they all obey the following
rules: [A]=[T], [G]=[C], [A+T][C+G] why?

Experiments: take 32P labeled phage or 35S labeled phage to infect bacterial cell,
separately, isolated phage progenies to test which one had the radioactivity.
Results: 35S labeled proteins were mostly found in the empty coat called phage
ghost, only 32P labeled DNAs were abundantly detected in the phage progenies in
the next generation.
Conclusion: DNA was the genetic material of T2 phage,

2. DNA is longer and more stable than RNA. For

example, DNA is stable in alkaline, but RNA is
hydrolyzed in alkaline. Why?

Nucleosides
Pentose

(in RNA)

Bases

(in DNA)

In (RNA)

(in DNA)

Nucleoside:
pentose
+
base

Nucleotide:
nucleoside
+
phosphate

DNA
RNA

DNA is a polar molecule

Nucleic acids (DNA, RNA) are polynucleotides

Nucleotides are connected by the phosphodiester bonds via
condensation reactions, in which H2O is removed

DNA has polarity (5 vs

3) because each
nucleotide has polarity
(Pi at 5' vs OH at 3')

C
H

H 2O

enzymes
(A)

Watson-Crick model of DNA structure

By . J. D. WATSON, F. H. C.
CRICK

By M. H. F. WILKINS, A. R.
STOKES, H. R. WILSON

1. Rosalind Franklin
(1920-1958) and Maurice
Wilkins (1916-2004) obtained
the x-ray diffraction picture of
the DNA
2. James Watson (1928-),
Francis Crick (1916-2004), and
Wilkins proposed the 3-D
structure of DNA molecule in
1953.
3. Watson, Crick, and Wilkins
received the Noble Prize for
solving the DNA structure in
1962.

Watson-Crick model of DNA structure (cont.)

1. DNA is double-stranded molecule (dsDNA). Each DNA molecule
is composed of two strands of polydeoxyribonucleotide (ssDNA).
2. The two strands spiral around each other in antiparallele
direction (that means if one strand runs 5 3, the other
strand must run 3 5) to form a right-handed helix. Each turn
of the helix contains ~10.5 base pairs of deoxyribonucleotides.
3. The double helix is held mainly by H bonds between bases from
opposite strands, the H bonds can be broken and reformed. This
predicts the semiconservative replication of DNA. A pyrimidine
(one-ring bases: T & C) from one strand always form H bons with
a purine (two-ring bases: A & G) from the other strand. This
explains the base composition rules, and why C:G paring (3 H
bonds) is stronger than A:T paring (2 H bonds). This predicts
that a DNA with more CG is more stable.

DNA is a right-handed double helix

starting from the
5' of one strand of
a dsDNA, it goes
with a right-hand
twist to the 3'
The DNA double
helix is stabilized
by H bonds between
bases, as well as
the hydrophobic and
van der Waals
interactions
between adjacently
stacked base pairs

4. Bases are inside the double helix, sugar-phosphates backbones

are outside the helix. DNA is negatively charged.

DNA helix may have different structures, but most

cellular DNA has the B structure

B DNA is the normal

form of dsDNA found
in the genome

A form is found in
RNA:RNA or
RNA:DNA helices

The function of Z
structure remains
unknown

DNA sequence and homology

(1). A DNA sequence - the linear order of nucleotides of a DNA strand, is
usually presented as: 5 (left) to 3 (right) of the top strand and 3 (left) to
5 (right) for the bottom strand. Usually only the top strand is presented. If not
specified, it must be the top strand with the left end being the 5 end

5 ATGCATGCATGCATGCATGCATGC 3
3 TACGTACGTACGTACGTACGTACG 5
(2). DNA sequence homology similarity between the sequences of two DNA
molecules

The base-pairing rules of DNA:

A pairs with T, G pairs with C

1. Base-pairing (or complementary) rules:

in dsDNA, A always pairs with T, and C
always pairs with G. This is why in a
normal dsDNA strand, A=T, G=C, but
[A+T] = [G+C]
2. The two strands of DNA hold together
by hydrogen bonds. A-T has 2 H
bonds, G-C has 3H bonds. This is why a
dsDNA strand with higher G/C content
is more stable and less likely to be
denatured.
3. If you know the sequence of one
strand, you can easily deduce the
sequence of the opposite (or
complementary) strand.

5-TGCCAGTTCAGCTAAACTCTG-3
3-ACGGTCAAGTCGATTTGAGAC-5

3. physicochemical properties of DNA

1). soluble in water, precipitated in ethanol
2). DNA can be hydrolyzed by DNase (deoxyribonuclease),
which degrades DNA by breaking the phosphodiester bonds (H
bonds are also broken in degraded DNA).
3). DNA can be denatured (H bond broken but phosphodiester
bond intact) by heat, extreme pH, organic solvent, etc
4). DNA absorb ultraviolet light of 260nm (UV260), ssDNA
(single strand) absorbs more UV260 than dsDNA (double
strand), a phenomenon called hyperchromic shift
1 A260 = 50 g/ml dsDNA, or 33 g/ml ssDNA
e.g. a DNA solution that absorbs 0.5 unit of 260 nm UV light (A260= 0.5)
should contain 25 mg/ml dsDNA or 16.5 mg/ml ssDNA

5). dsDNA can be reversibly denatured into ssDNA

6). dsDNA can form supercoils

DNA denature and renature

Denature (melt):
-double strand (ds DNA) single strand (ssDNA)
-occur at high stringency conditions: higher temperature, lower salt
concentration, extreme pH, or in organic solvent. High stringency conditions
favor the break of the H bonds between complementary bases
Renature (anneal)
-single strand (ss DNA) double strand (dsDNA)
-occur at low stringency conditions: lower temperature, higher salt
concentration, neutral pH that favor H bond formation

Me melting temperature
Tm:
1. DNA denature
occurs at a relatively
narrow range of
temperature
2. Tm is defined as
the temperature at
which 50% of the DNA
is denatured, or when
half of the increase in
absorption at 260nm is
reached.

Tm = 85oC

Physical and chemical features of DNA denaturation

Denatured DNA has higher UVlight absorption at 260 nm

region, because ssDNA absorbs
more UV light

DNA with higher GC content

is less likely to be
denatured, so it has the
higher melting temperature
(Tm).

4. DNA shapes and Sizes

DNA Hybridization
Hybridization is the annealing of two ssDNA strands derived from
different dsDNA molecules
-In a mixture of DNAs, only the complementary strands will associate by
H bonds, so hybridization only occurs when the two DNA have sequence
similarity (homology)
-The ability of homologous DNA molecules to form hybrid is the basis of
many molecular biology techniques.
High stringency:
higher temperature
and/or low salt
DNAs that have the high
sequence homology (e.g. 100%)
will hybridize under both low and
high stringency
Low stringency:
lower temperature
and/or high salt
DNAs with low sequence homology
(e.g. 70%) only hybridize under
low stringency condition, but not
under high stringency condition

Circular DNA

DNA can be linear or circular

(Human sex chromosomes)

(E. Coli genome)

Circular DNA is
difficult to
separate,especially
if it needs to be
replicated. Because
a large circular DNA
is easily tangled or
supercoiled (wrapped
or coiled at higher
order).
How do organelle or
virus genomes solve
this problem for
their replication?
(nick it)

Plasmid DNA

Most eukaryotic genomes are linear DNA

Most plasmid, bacterial genome, mitochondrion genome,
chloroplast genome,and some virus DNA are circular DNA
Some prokaryotic virus (phages) have linear DNA

Supercoiled DNA
-When a circular plasmid DNA molecule is isolated and analyzed
by gel electrophoresis, it often migrates as two forms, one
migrates faster than the other. The fast-running form of the
circular DNA has the more compact supercoil structure.

Viewed by electromicroscopy

_
Viewed
by
ethidium
bromidestained
agarose
gel

nicked

supercoiled

Why supercoil?
-Supercoil forms because of simple
physics. Both circular DNA and long
linear DNA can form supercoil.
-The fact that DNA can form
supercoils explains how a very long
DNA molecule can be packed tightly
in the nucleus, so supercoils are part
of the structure basis for DNA
package in the cell.
-How could a tightly packed supercoil
DNA be untangled rapidly when the
cell undergoes division and DNA needs
to be replicated ?

(=10bp/turn)

(=10 bp/turn)

Size of DNA
DNA size is expressed in 3 ways:
Length ~34 per helical turn of 10.5
base pairs (bp)
Base pairs, bp (base pair), Kb (103bp),
Mb (106 bp), Gb (109bp)
Molecular weight 660 is the average
molecular weight of 1bp of DNA.
DNA size can be measured by electron
2 nm diameter
10.5 bp (3.4 nm)/turn microscopy, gel electrophoresis, but
most frequently by DNA sequencing

Size of genomes

Size of a gene

For a gene encoding a 40,000 Da (40 kD) protein, assuming the average
mass of an amino acid is about 110 Da, 40,000 Da / 110 364 amino
acids, each amino acid is encoded by a 3-nucleotide codon of DNA, the
coding sequence should be 264x3=1092bp, so the gene should be at least
1092bp.
A protein can be as small as a dozen amino acid residues (e.g. peptide
hormones) to as large as large 27,000 amino acid or 3 MD (Titin, the
largest muscle protein known). The titin gene is ~300kb, with only 9kb (3%)
coding sequence (rest are introns and regulatory sequences).

Genome size and the C-Value Paradox

C-value is the DNA content per haploid cell (equivalent
to the size of a genome).
One might expect that more complex organisms need
more genes than simple organisms, which usually holds
true especially (e.g. human vs yeast). Yet frog has 7
times more DNA than human, and the lily genome
contains about 200 times more DNA than human.
The observation that more complex organisms do not
always have larger genomes than less complex
organisms is called the C-value paradox.
One explanation for the paradox why simpler
organisms have more genomic DNA may be that they
have more repetitive DNA without having more genes.

Bacteria

Genome: collection of all genomic DNA of an organism

e.g. Phage x174 (one of smallest genome, 5375 bp, ~5 proteins);
Human genome: 3.2 x 109 bp (3.3Gb), encoding >23,000 proteins.

Gene, genome, and model

organisms
Gene: DNA sequence needed to encode a
functional protein or RNA
Genome: complete collection of genes and
non-gene sequences
Genome

The chemical nature of genes

and genomes of different
organisms are the same. Study
of model organisms allows a
general understanding of
fundamental features of life.

Model organisms

Yeast

E. Coli (Escherichia coli)

Free-living single cell prokaryote
Double every 20 minutes under optimal conditions
Single circular chromosome without nucleus (prokaryote)
Genome (complete set of DNA): 4.6 Mb (million base pair)
Proteome (complete set of proteins): ~4,300 proteins
Genomic DNA

(budding yeast)
Saccharomyces cerevisia

Single-cell eukaryote
grows in both liquid and
agar surface in lab,
16 linear chromosomes,
nuclear membrane,
organelles such as ER,
Golgi, mitochondria, etc.
Genome size: 12 Mb
Proteome size: ~6000
(<60% function known)

Cell wall

C. elegans

Drosophila melanogaster
(fruit fly)

~50,000 cells
~160 Mb Genome
~15,000 protein
The traditional
model to study
genetics and
development

97 Mb genome, 959 somatic cells

The first animal genome sequenced
~19,000 protein-encoding genes
the favorite model organism to study questions
such as cell lineage, longevity, etc

- Sequence completed
in 2000

Plants

mammals

Peas (studied by Mendel)

Corn (studied by McClintock)

Arabidopsis thaliana
~10,000 seeds per plant
- 5 pairs of chromosomes
- Genome size: ~120 Mb
- Proteome: ~26,000 proteins
- Genome sequencing
completed in 2000

Mouse (Mus Musculus)

1011 Cells
3Gb (3 billion bp) genome
~23,000 proteins
Genome Sequence
completed in 2001

Homo sapiens
1014 cells
3Gb Genome
~21,000 proteins (2010)
Genome Sequence
completed in 2001

<$1,000/human genome by ?