Você está na página 1de 72

HELENA ARANTES DO AMARAL

Deteco do vrus da cinomose pela tcnica de RT-PCR


em ces com sintomatologia neurolgica

So Paulo
2007

HELENA ARANTES DO AMARAL

Deteco do vrus da cinomose pela tcnica de RT-PCR em ces


com sintomatologia neurolgica

Tese apresentada ao Programa de PsGraduao em Clnica Veterinria da


Faculdade de Medicina Veterinria e Zootecnia
da Universidade de So Paulo para obteno
do ttulo de Doutor em Medicina Veterinria

Departamento:
Clnica Mdica
rea de Concentrao:
Clnica Veterinria
Orientador:
Profa. Dra. Maria Helena Matiko Akao Larsson

So Paulo
2007

Autorizo a reproduo parcial ou total desta obra, para fins acadmicos, desde que citada a fonte.

DADOS INTERNACIONAIS DE CATALOGAO-NA-PUBLICAO

(Biblioteca Virginie Buff Dpice da Faculdade de Medicina Veterinria e Zootecnia da Universidade de So Paulo)

T.1883
FMVZ

Amaral, Helena Arantes do


Deteco do vrus da cinomose pela tcnica de RT-PCR em ces com
sintomatologia neurolgica / Helena Arantes do Amaral. -- So Paulo: H.
A. Amaral, 2007.
72 f. : il.
Tese (doutorado) - Universidade de So Paulo. Faculdade de Medicina
Veterinria e Zootecnia. Departamento de Clnica Mdica, 2007.
Programa de Ps-Graduao: Clnica Veterinria.
rea de concentrao: Clnica Veterinria.
Orientador: Profa. Dra. Maria Helena Matiko Akao Larsson.
1. Amostras biolgicas. 2. Co. 3. Cinomose. 4. PCR. 5. Urina.
Ttulo.

I.

FOLHA DE AVALIAO

Autor: AMARAL, Helena Arantes do


Ttulo: Deteco do vrus da cinomose pela tcnica de RT-PCR em ces
com
sintomatologia neurolgica
Tese apresentada ao Programa de PsGraduao em Clnica Veterinria da
Faculdade de Medicina Veterinria e Zootecnia
da Universidade de So Paulo para obteno
do ttulo de Doutor em Medicina Veterinria

Data: ____/___/____

Banca Examinadora
Prof. Dr.

______________________

Instituio _______________________

Julgamento______________________ Assinatura _______________________


Prof. Dr.

______________________ Instituio _______________________

Julgamento______________________ Assinatura _______________________


Prof. Dr.

______________________ Instituio _______________________

Julgamento______________________ Assinatura _______________________


Prof. Dr.

______________________ Instituio _______________________

Julgamento______________________ Assinatura _______________________


Prof. Dr.

______________________ Instituio _______________________

Julgamento______________________ Assinatura _______________________

Neyde Curvo do Amaral (in memorian)


H momentos na vida em que sentimos tanto a falta de algum que o que mais
queremos tirar essa pessoa de nossos sonhos e abra-la (Clarice Lispector).

DEDICATRIA

Este trabalho dedicado ao meu pai Jos Roberto, Miriam, Joo, rica,
Silvia,Vera, Richard, Xandinho e Eduardo por todo amor e apoio

minha orientadora cientfica, Maria Helena Matiko Akao Larsson, pela


pacincia e confiana desde o mestrado

Agradecimentos
Ao professor Leonardo Jos Ricktzenhain pela confiana e disponibilizao do
LABMAS para realizao da parte experimental do trabalho
Ao professor Edison Luiz Durigon por toda orientao e incentivo quase paternal
Aos professores Rodrigo Martins Soares, Paulo Brando e Adriana Cortez, pela preciosa
ajuda na elaborao do projeto e pela amizade, apoio e pacincia na realizao do
experimento
Aprender a ver a mais longa aprendizagem de todas as artes(Jules Goncour)
Sandra Fernandez do laboratrio Bio-Vet pela gentileza em ceder cepa titulada
do vrus da cinomose
Aos professores do Departamento de Patologia, especialmente Maria Lcia
Zaidan Dagli e Paulo Maiorka pelas sugestes e esclarecimento de dvidas e Luciana,
Kalan, Fernando e Caio pelo processamento das amostras
Aos mdicos veterinrios do HOVET- USP especialmente Bruna, Denise, Jlia,
Khadine, Paula, Vera, Anglica, Mary, Silvana, Maria Luiza, Luciane e Audrey
Aos mdicos veterinrios Mary Marcondes Feitosa, Joo Pedro de Andrade Neto,
Wagner Sato Ushikoshi, Marcelo Zanutto e Ricardo Duarte
Aos auxiliares do Servio de Clnica Mdica e Pronto Atendimento Mdico do
HOVET -USP Antonio Carlos, Carlito, Geraldo, Gilberto e Milton
Aos funcionrios do Laboratrio Clnico do HOVET e aos funcionrios e exfuncionrios do VPS, especialmente: Clara, Claudia, Creide, Edna, Marli, Maria Helena,
Marcelo, Sheila e Hilda
A todos os ps e ex ps graduandos, residentes e estagirios dos Departamentos
de Clnica Medica, Cirurgia e VPS pelo agradvel convvio
Aos amigos do LABMAS, especialmente nio, Thais, Mikaela, Marcos e Lara,
pelas sugestes e auxlio
Aos veterinrios do Pet Care Alex, Aline, Carla, Sibele, Mauricio, Marcelo, Fbio
e da AILA, em especial Roberto e Daniela
As funcionrias da biblioteca, especialmente a Elza e s secretrias da psgraduao Adelaide e Harumi
Aos amigos Mrcia N., Mrcia H., Mere, Mrcio, Fernanda, Jun, Guilherme,
Rita, Leon, Katia, Pedro, Karina , Maurcio, Ayne, Lcia, Koga, Joseli, Sandra e Alade
Elisabeth, Paula e Dbora pela amizade e incansvel dedicao aos animais
Aos funcionrios e ps-graduandos da microbiologia do ICB, especialmente
Daniela, Carol,,Anglica, Juliana, Fabiana e Jos
CAPES pelo financiamento
Aos proprietrios e seus ces que participaram desse estudo

A todos que contriburam de forma direta ou indireta para a realizao deste


trabalho

"A grandeza de uma nao pode ser julgada pelo modo que seus animais so
tratados." (Mahatma Gandhi).

RESUMO

AMARAL, H . A. do Deteco do vrus da cinomose pela tcnica de RT-PCR


em ces com sintomatologia neurolgica. [Detection of canine distemper virus
by RT- PCR from dogs with neurological signs ]. 2007 72f. Tese (Doutorado em
Medicina Veterinria)-Faculdade de Medicina Veterinria e Zootecnia,
Universidade de So Paulo, So Paulo, 2007.

Diferentes amostras biolgicas foram avaliadas (zaragatoa ocular, genital, urina e


clulas mononucleares do sangue perifrico) pela RT-PCR em 50 ces com
sintomas neurolgicos compatveis como cinomose, na presena ou no de
outros sintomas sistmicos. O gene da nucleoprotena do vrus da cinomose foi
detectado em 43 das 50 amostras avaliadas. Considerando apenas os animais
com resultado positivos pela hemi-nested - PCR, os sintomas neurolgicos
observados com freqncia maior que 50%, foram mioclonia e alterao
locomotora (maioria dos ces evoluiu a tetraparesia); convulso e vocalizao
foram observados em 32% dos casos Outros sintomas sistmicos, sintomas
oculares, respiratrios ou digestivos, prvios ou associados aos sintomas
neurolgicos, foram observados em 82% dos ces. Tambm observou-se
hiperqueratose nasal ou de coxins em 44% dos casos. Somente 20% dos animais
positivos haviam sido vacinados contra o vrus da cinomose. Zaragatoas genitais
forneceram maior nmero de resultados positivos (40), seguidos por zaragatoas
oculares e urina (37) e clulas mononucleares do sangue perifrico (34). A coleta
associada de duas amostras biolgicas (zaragatoa genital e urina) por animal
aumentou a possibilidade de deteco de animais positivos, principalmente nos
casos de ces suspeitos que no apresentaram sintomas respiratrios,
gastrintestinais e oculares, assim como nos animais vacinados e cronicamente
infectados ou convalescentes.
Palavras-chave: Amostras biolgicas. Ces. Cinomose canina. PCR. Urina

ABSTRACT

AMARAL, H . A. do Detection of canine distemper virus by RT- PCR from dogs


with neurological signs. [Deteco do vrus da cinomose pela tcnica de RTPCR em ces com sintomatologia neurolgica]. 2007, 72 p. Tese (Doutorado
em Medicina Veterinria)-Faculdade de Medicina Veterinria e Zootecnia,
Universidade de So Paulo, So Paulo, 2007.

Using Reverse transcription-PCR assay, different biological samples were


avaliabled (conjunctival and genital swabs, urine and peripheral blood
mononuclear cells) from dogs with or with no extraneural signs prior to or
accompanying the neurologic signs. Canine distemper nucleoprotein were
detected in 43 from 50 dogs availabled by hemi-nested-PCR. Considering just
dogs with distemper confirmed by hemi-nested PCR, gait abnormalities (most
commonly tetraparesis) and myoclonus were the neurological signs observed in
over 50%; vocalizing and seizures occurred in 32%. Other systemic signs
(respiratory, gastroenteric or ocular signs). preceding or associated to neurological
signs, occurred in 82% of dogs Hyperkeratosis of the footpads or nose were
observed in 44 % of the cases.

Only (20%) were vaccinated against canine

distemper. A greater number of positive results were obtained from genital swabs
(40), followed by conjuctival swabs and urine (37) and PBMCs (33). Sensitivity of
detection positive results were increased by using

two clinical samples

association (genital swab and urine), specially in dogs that had not shown extra
neural signs, vaccinate dogs or during the convalescent and late stage of canine
distemper.

Key words: Dogs. Canine distemper. Clinical samples. PCR. Urine

LISTA DE TABELAS
CAPTULO 1

Tabela 1-

Tabela 2 -

Resultados da hemi-nested-PCR para gene da


nucleoprotena do vrus da cinomose em diferentes
amostras biolgicas (cMNs, zaragatoa ocular, zaragatoa
genital e urina), de 50 ces que apresentaram alterao
neurolgica compatvel com cinomose, So Paulo, Brasil,
2007. ......................................................................................

31

Fatores que podem estar envolvidos na deteco do vrus


da cinomose pela hn-PCR na concordncia de resultados
positivos nas quatro amostras biolgicas avaliadas por
animal: presena ou ausncia de sintomas respiratrios,
digestivos ou oculares; recuperao ou piora progressiva da
sintomatologia neurolgica; tempo de evoluo dos
sintomas iniciais at o momento da coleta das amostras
biolgicas inferior ou superior a 60 dias e presena ou
ausncia de vacinao adequada-So Paulo-Brasil2007........................................................................................

32

CAPTULO 2

Tabela 1-

Tabela 2 -

Tabela 3-

Alteraes respiratrias, gastrintestinais e oculares observadas


isoladamente ou associadas, anteriormente (no perodo mximo
de dois meses) ou no momento das coletas de amostras
biolgicas e nmero de animais em que as mesmas foram
observadas, nas diferentes idades, nos 50 ces positivos para
cinomose pela hemi-nested PCR- So Paulo-Brasil2007...............................................................................................

58

Sintomas respiratrios, gastrintestinais e oculares observados


anteriormente (no perodo mximo de dois meses) ou no
momento das coletas das amostras biolgicas e nmero de
animais de acordo com a idade que as apresentaram, dos 50
ces positivos para cinomose pela hemi-nested PCR- So
Paulo, Brasil, 2007.........................................................................

59

Sintomas neurolgicos observados isoladamente ou associados,


durante a evoluo clnica e nmero de animais acometidos
entre os 50 ces positivos para cinomose pela hemi-nested
PCR.SoPaulo,Brasil,2007............................................................

60

SUMRIO
CAPTULO 11
2
3
3.1
3.2
3.3
3.3.1
3.3.2
3.3.3
3.4
3.4.1
3.4.2
3.4.3
3.4.4
3.4.5
3.4.6
4
5

INTRODUO..............................................................................
OBJETIVOS..................................................................................
MATERIAL E MTODOS.............................................................
VRUS PADRO...........................................................................
ANIMAIS .......................................................................................
AMOSTRAS BIOLGICAS...........................................................
Zaragatoas Ocular e Genital.......................................................
Clulas Mononucleares do Sangue
Perifrico......................................................................................
Urina ............................................................................................
PROCESSAMENTO DAS AMOSTRAS........................................
Extrao do Rna .........................................................................
SNTESE de cDna.......................................................................
Oligonucleotdeos Iniciadores (Primers)..................................
Reao em Cadeia pela Polimerase
Reversa........................................................................................
Visibilizao dos Produtos Amplificados de Semi-Nested
PCR...............................................................................................
Determinao Da Sensibilidade
Analtica.......................................................................................
RESULTADOS E DISCUSSO....................................................
CONCLUSES.............................................................................
REFERNCIAS.............................................................................
APNDICES..................................................................................

16
18
19
19
19
20
20
20
21
21
22
23
23
24
25
26
27
33
34
36

CAPTULO 21
2
3
3.1
4
5

INTRODUO...............................................................................
OBJETIVOS...................................................................................
MATERIAL E MTODOS..............................................................
ANIMAIS ........................................................................................
RESULTADOS E DISCUSSO.....................................................
CONCLUSES..............................................................................
REFERNCIAS..............................................................................
APNDICES...................................................................................

46
48
49
49
50
61
62
66

Captulo 1

16
1 INTRODUO

cinomose

uma

doena

infecto-contagiosa,

de

distribuio

cosmopolita, causada por um vrus RNA envelopado, do gnero Morbillivirus,


famlia Paramyxoviridae que acomete ces e outros candeos (APPEL;
GILLESPIE, 1972). A sintomatologia clnica e a taxa de letalidade dependem
da virulncia da estirpe viral, da idade e da imunocompetncia do hospedeiro
(THOMAS; STEISS, 1993).
Ces com cinomose podem apresentar uma ampla variedade de
manifestaes sistmicas, na presena ou no de sintomas neurolgicos
(TIPOLD et

al., 1992; TUDURY et al., 1997; KOUTINAS et al., 2002). O

diagnstico clnico particularmente difcil quando mioclonia e sintomas


sistmicos, prvios ou associados a outras alteraes neurolgicas, esto
ausentes (TIPOLD et al., 1992; KOUTINAS et al., 2002). Embora a presena de
mioclonia seja altamente sugestiva de cinomose, pode estar ausente em mais
de 50% dos casos, alm de ser observada em outras meningoencefalomielites
e, esporadicamente, em intoxicao por chumbo (TIPOLD

et al., 1992;

Koutinas et al., 2002).


A RT-PCR (Transcrio Reversa seguida pela Reao em Cadeia da
Polimerase) considerada o teste de escolha para o diagnstico intra vitam da
cinomose (SHIN et al., 1995; ALCAIDE, 1999; FRISK et al., 1999; JZWIK;
FRYMUS, 2005; SAITO et al., 2005).

Apesar da elevada sensibilidade do

teste, ausncia de deteco pode ocorrer em diferentes amostras biolgicas de


um mesmo animal, sendo que a possibilidade de obteno de resultados
positivos aumenta com o aumento no nmero de coletas de diferentes

17
amostras biolgicas (FRISK et al., 1999; SHIN et al., 2004); sendo indicadas
duas ou mais diferentes amostras biolgicas por animal, independentemente
da forma clnica de apresentao da cinomose (SHIN et al., 2004). Como
secrees ocular e nasal nem sempre esto presentes, a saliva no se mostrou
uma boa amostra biolgica (ALCAIDE, 1999); urina foi, pelo menos, to
sensvel quanto lquor (SAITO et al., 2005) sendo que a coleta do mesmo
envolve riscos e custos extras.

18
2 OBJETIVOS

O presente trabalho visou avaliar o uso de zaragatoas ocular e genital,


clulas mononucleares do sangue perifrico (cMNs) e urina no diagnstico intra
vitam de cinomose em ces com sintomatologia neurolgica compatvel com
cinomose, na presena ou no de outras alteraes sistmicas, atravs da RTPCR.

19
3 MATERIAIS E MTODOS

3.1 VRUS PADRO

Para a realizao da sensibilidade analtica da RT-PCR e como controle


positivo, foi utilizada a amostra padro vacinal Lederle, cedida pelo Laboratrio
BIO-VET.

3.2 ANIMAIS

Foi utilizada uma amostragem de convenincia de 50 ces com


sintomatologia neurolgica compatvel com cinomose atendidos no Hospital
Veterinrio da Faculdade de Veterinria e Zootecnia da Universidade de So
Paulo (HOVET-FMVZ-USP), na AILA (Aliana Internacional do Animal) e no
Centro Veterinrio Pet care. Com a finalidade de evitar resultado positivo
devido vrus vacinal, foram includos apenas animais no vacinados ou
vacinados h mais de 50 dias, pois de acordo com diferentes estudos, RNA
vacinal detectado pela PCR at trs a 14 dias aps aplicao de vacina com
vrus vivo atenuado (SHIN et al., 1995; KIM et al., 2001; JZWIK; FRYMUS,
2005). Os dados de vacinao, idade, raa e sexo esto discriminados no
apndice A.

20
3.3 AMOSTRAS BIOLGICAS

3.3.1 Zaragatoas Ocular e Genital

O material foi obtido por frico em conjuntiva palpebral e mucosa


genital (prepucial ou vaginal) utilizando-se zaragatoas estreis. As amostras
foram, ento, imediatamente acondicionadas em microtubos de 1,5mL
contendo 500L de TE (10mM de TrisHCl, 1mM de EDTA, pH 8,0) estril.

3.3.2 Clulas Mononucleares do Sangue Perifrico (cMNs)

As amostras de sangue foram colhidas atravs de puno das veias


ceflica, femoral ou jugular, das quais 5mL foram dispostos em tubos de vidro,
com EDTA com tampa de borracha. As clulas mononucleares foram
separadas do sangue venoso por sedimentao, utilizando Ficoll Histopaque
1077 (Sigma) em perodos inferiores a duas horas, em relao ao momento da
coleta. Aps diluio em PBS estril (PO4 0,01M, NaCl 0,15M, pH7,2) na razo
de 1:2, realizou-se homogeneizao e sua transferncia para tubos contendo
3mL de Ficoll. Essa transferncia foi realizada delicadamente com utilizao
de pipeta Pasteur estril, para evitar refluxo. Finalmente, os tubos foram
fechados e centrifugados a uma rotao de 1250 x g, durante 30 minutos. O
Ficoll, juntamente com o plasma, foi desprezado e foi feita a colheita do anel
de linfcitos, que foi colocada num outro tubo de plstico estril e acrescentado
PBS para lavagem das clulas, centrifugando-se, em seguida, a uma rotao

21
de 1200 x g, durante 10 minutos. O sobrenadante foi desprezado e o anel
suspenso com PBS. No total, foram feitas trs lavagens das clulas, para
excluso total do Ficoll. Aps essa fase, o boto de clulas foi suspenso com
500L de TE.

3.3.3 Urina

As amostras de urina foram colhidas por cistocentese (10mL) e


dispostas em tubos plsticos estreis de 15mL, com tampa rosqueada. As
urinas foram centrifugadas a 2600 x g, durante 10 minutos, 4C. A seguir, o
sobrenadante foi desprezado e o sedimento lavado com 500 uL de PBS e
centrifugado, novamente, a uma rotao de 2600 x g, durante 10 minutos. Aps
homogeneizao e nova centrifugao a 2600 x g, desprezou-se o
sobrenadante e o sedimento foi suspenso em 500 L de TE. A extrao foi
realizada a partir desse material ou diretamente a partir da urina, sem o
processo de centrifugao e lavagem, nos casos em que no foi possvel
recuperar o sedimento.

3.4 PROCESSAMENTO DAS AMOSTRAS

As amostras foram mantidas 4C, durante o transporte ao laboratrio


de Biologia Molecular do Departamento de Medicina Veterinria Preventiva da
FMVZ- USP, SP.

22
3.4.1 Extrao do RNA
Foram utilizados 250L das amostras, incluindo os controles positivos e
negativos, adicionados a 750L TRIzol LS (Invitrogen, Carlsbad, USA), em
microtubos de 1,5mL, que foram vigorosamente homogeneizadas, e incubados
em temperatura ambiente por cinco minutos.

gua altamente purificada

(Sistema Milli-Q, Millipore), isenta de inibidores que pudessem impedir a


amplificao de produtos contaminantes de PCR foi utilizada como controle
negativo. O controle positivo constituiu-se de vacinas polivalentes, com vrus
vivo atenuado para cinomose, Octa-Cino-Vacin, Laboratrio Bio-Vet S/A,
Vargem Grande, So Paulo, diludas em 1mL de TE em intervalo inferior a 15
dias. Foram ento adicionados 200L de clorofrmio e, aps homogeneizao
por agitao durante 15 segundos, foram centrifugados a uma rotao de
12000 x g 4C, durante cinco minutos. Aps centrifugao, foram formadas
duas fases distintas: a inferior fenlica que continha protenas e debris
celulares e a superior (fase aquosa) que continha o RNA. O sobrenadante da
fase superior foi coletado e precipitado, volume a volume, com propanol,
vigorosamente homogeneizado e deixado precipitar -20C por duas horas ou
overnight. Aps esse perodo, a mistura foi novamente centrifugada a 12000 x
g durante 25 minutos 4C . O sobrenadante foi desprezado e o sedimento de
RNA foi ento lavado com 1mL de etanol (75%). A mistura foi homogeneizada
vigorosamente e centrifugado a 7500 x g, 4C, por cinco minutos,
desprezando-se o sobrenadante. Finalmente, os tubos foram invertidos e
deixados secar em temperatura ambiente por 30 minutos seguidos por banho
seco, 56C, por 10 minutos com tampa aberta, sendo a seguir suspensos
em 60L de gua DEPC. Aps vigorosa homogeneizao e centrifugao

23
foram incubados com tampa fechada, novamente, em banho seco, 56C,
durante 10 minutos. Foram ento aliquotados 50L das amostras, seguidas por
denaturao (95C por trs minutos) e incubados, a seguir, em gelo por um
perodo mnimo de dois minutos. O RNA foi extrado at o passo de
precipitao e convertido em DNA complementar (cDNA) em tempo mximo de
48 horas. Foram processadas amostras de um animal por vez, alm de duas
amostras controles, sendo, uma negativa e outra positiva.

3.4.2 Sntese de cDNA

Aps denaturao foi realizada a transcrio reversa: adicionaram-se


50L do produto extrado ao mix de volume final de 50 L, contendo 21 L
gua destilada tratada DEPC, 10 L 1X RT- tampo, 10 L de iniciadores
randmicos, 4 L dNTP (100 mM) e 5L MultiScribe Reverse Transcriptase
(50U/L Applied Biosystems, Foster City, CA, USA). Essa mistura foi preparada
no gelo e transferida ao termociclador automtico MJ Research PTC 200 DNA
engine, Watertown, MA, USA, ciclo 25C por 10 minutos, seguido por 37C por
duas horas.

3.4.3 Oligonucleotdeos Iniciadores (Primers)

Foram usados os oligonucleotdeos iniciadores que se ligam a regies


altamente conservadas do gene que codificam para a nucleoprotena,

24
desenhados com o auxlio do Programa Primer Premier 5.0

a partir das

seqncias obtidas no GenBank (gi 5733642; gi 44889612; gi 39726306; gi


38324706; gi 37654441; 9630645; gi 39938462; gi 37654450; gi 14150871; gi
11120547; gi 3335048; gi 4127626; gi 5533386; gi 5533394; gi 37626039; gi
5533392; gi 5533390; gi 5533388; gi 5533396; gi 60921; gi 99867035),
alinhados pelo CLUSTAL W. Foram utilizados dois iniciadores externos e um
iniciador interno. CDV-NP- F1 (5ATCCCCAGGRAACAAGCCTAGAA 3) e
CDV-NP-R1 (5 CCTTGGTGATGCCAAGCTCG 3) foram usados na primeira
amplificao.

Os

iniciadores

CDV-NP-

F1

and

CDV-NP-

R2

(5CGAAATTTAACCCTCCCATG 3) foram utilizados na segunda amplificao


(hemi-nested PCR). O tamanho do produto amplificado foi de 440 pares de
base, para os iniciadores CDV-NP- F1 e CDV-NP-R1, e de 331 pares de base
para os iniciadores CDV-NP-F1 e CDV-NP-R2.

3.4.4 Reao em Cadeia pela Polimerase Reversa

Para evitar resultados falso-positivos, atravs da contaminao pelo


produto amplificado, foram utilizados trs fluxos laminares apropriados, um
para extrao do cido nuclico e outro para o preparo da reao de PCR,
sendo um terceiro fluxo laminar, destinado a uma outra rea de servio para
manipulao do produto amplificado (ps PCR). Para cada espao fsico,
utilizado um jogo de pipetas automticas, minimizando, dessa forma, a
contaminao entre os trs diferentes ambientes.

25
A hnPCR foi realizada em volume final de 50L contendo 5L de cDNA
e dos controles, 8L dNTP (1,25mM), 2,5L de cada um dos dois iniciadores
(10pmol/L) CDV-NP-F1 e CDV-NP-R1, 3L MgCl2 (25mM), 5L de tampo10X
concentrado, 0,3Lda enzima AmpliTaq DNA polimerase (5U/L) (Applied
Biosystems, Foster City, CA, USA) e 23,7L de gua ultrapura q.s.p., seguida
de uma segunda amplificao com os primers CDV-NP-F1 e CDV-NP-R2, com
as mesmas condies de reao. Foi acrescentado um controle negativo a
cada trs amostras e foi mantido um controle positivo por animal. A reao foi
realizada no termociclador acima referido, sendo que as condies de reao
foram uma desnaturao inicial de dois minutos 95C, 39 ciclos de 95C por
30 segundos, 56C por 30 segundos, 72C por 30 segundos, seguidos por uma
extenso final de 10 minutos 72C, sendo ento as amostras mantidas 4C.
Ao trmino, as amostras e controles foram armazenados 4C.

3.4.5 Visibilizao dos Produtos Amplificados de Semi-Nested PCR

Os produtos da hn-PCR foram analisados em eletroforese em gel de


agarose a 2%, em tampo Tris-Borato-EDTA
EDTA), corado com

(0,045M Tris-Borato , 1mM

brometo de etdio 0, 5 g/mL (SAMBROOK et al., 1989).

Juntamente com a amostra, foi adicionado azul de bromofenol (2,0L/5L da


amostra). A eletroforese foi realizada sob corrente de 100V, durante,
aproximadamente, 40 minutos. Em seguida, os fragmentos amplificados foram
observados em transluminador de luz ultravioleta e comparados ao padro de
peso molecular.

26

3.4.6 Determinao da Sensibilidade Analtica

A fim de se avaliar a sensibilidade analtica da hn-PCR na deteco do


vrus da cinomose canina, foram feitas diluies seriadas na base 10 em TRIzol
com a amostra Lederle que foi previamente titulada em placa em cultura
primria de FEG (fibroblasto de embrio de galinha), pelo Laboratrio Bio-Vet.

27

4 RESULTADOS E DISCUSSO

A sensibilidade analtica da hn-PCR foi de 100,55 DICT 50/mL. Outros


autores obtiveram um limiar de deteco pela RT-PCR de 101 DICT

50

(JZWIK; FRYMUS, 2005) e de 102 (KIM et al., 2001) e pela nPCR 10-1 DICT 50
(JZWIK; FRYMUS, 2005) e 100 (KIM et al., 2001). Estes resultados mostram
que a hn-PCR apresenta uma sensibilidade analtica equivalente a nPCR.
O vrus da cinomose canina foi detectado pela hn-PCR em, pelo menos,
uma amostra biolgica em 43 dos 50 ces estudados. O maior nmero de
resultados positivos ocorreu em zaragatoas genitais (40), seguido de urina e
zaragatoas oculares (37) e cMNs (33) (Tabela 1, Apndice D).
As manifestaes neurolgicas observadas com maior freqncia nos
animais positivos (43) em, pelo menos, uma amostra biolgica foram: alterao
locomotora

(41), sendo que a maior parte dos animais evoluiu para

tetraparesia com incapacidade de se manter em estao; mioclonia (28);


convulso (16); vocalizao (16); nistagmo (11); alterao de estado mental
(nove); tremor de inteno (oito) e inclinao lateral de cabea (cinco casos).
J entre os sintomas extras neurais, alm de prostrao e disorexia, observouse: hiperqueratose nasal ou de coxins (22), secreo ocular purulenta (18),
secreo nasal purulenta (14), secreo ocular mucosa ou esclera congesta
(15), mese (11) e diarria (11). Os sintomas extraneurais, relatados ou
observados, esto discriminados no apndice B e os sintomas neurolgicos no
apndice C.

28
Vinte e sete animais (54%) foram positivos e sete negativos (14%), nas
quatro

amostras

biolgicas

avaliadas.

No

foi

possvel

descartar

possibilidade de que animais com resultados negativos nas quatro amostras


biolgicas pesquisadas estivessem com cinomose, especialmente em dois
ces que apresentavam mioclonia, pois de acordo com Frisk et al. (1999), o
vrus est presente somente no sistema nervoso central em alguns animais
com cinomose.
Em 16 casos (32%) ocorreu discordncia de resultados, ou seja, foram
obtidos resultados positivos e negativos nas diferentes amostras biolgicas de
um mesmo animal. Ocorreu ausncia de deteco do vrus da cinomose em
somente uma amostra biolgica na urina (quatro casos) e nas cMNs (quatro
casos), porm a urina foi a nica amostra biolgica positiva em outros trs
casos (Tabela 1). Assim, semelhante ao observado por outros autores (FRISK
et al.,1999; SHIN et al., 2004) a associao de coleta de diferentes amostras
biolgicas por animal aumentou o nmero de resultados positivos, mas no caso
especfico deste estudo, isso foi vlido somente na associao de coleta de
zaragatoas genitais e urina. No se obteve maior nmero de resultados
positivos ao acrescentar coletas de zaragatoas oculares e cMNS s coletas
associadas de zaragatoa genital e urina. Essa diferena de resultados pode ter
ocorrido devido utilizao de diferentes metodologias, amostras biolgicas,
assim como no tipo de seleo de animais em relao ao trabalho realizado por
Shin et al. (2004). No entanto, no se pode descartar a possibilidade de que,
em casos individuais, zaragatoa ocular ou cMNS possam vir a aumentar o
nmero de resultados positivos em uma populao maior de animais, utilizando
a mesma metodologia. A coleta de zaragatoa ocular menos invasiva e no

29
exige procedimentos anteriores extrao do RNA, despendendo menor gasto
de tempo e custo, sendo ambas menos invasivas que a coleta de lquor. Assim,
coleta de zaragatoa ocular preferencialmente ou associada coleta do sangue
pode ser vantajosa em casos individuais, especialmente se a coleta de urina
no for possvel.
Observou-se nmero muito maior de animais positivos nas quatro
amostras biolgicas em ces que apresentaram ou estavam apresentando
sintomas respiratrios, gastrintestinais e oculares (26/35), do que naqueles que
no apresentaram esses sintomas (1/8) (Tabela 2).

Frisk et al. (1999)

observaram produtos amplificados fracos e ausncia na deteco do vrus da


cinomose em diferentes amostras biolgicas (soro, sangue total e lquor), em
animais com diagnstico de cinomose, confirmado por imunoistoqumica do
sistema nervoso central. Amude et al. (2006) obtiveram resultados negativos de
urina de um e de lquor de trs ces com sintomatologia, exclusivamente
neurolgica, com diagnstico de cinomose confirmado pela PCR e pela
presena de leses histopatolgicas caractersticas no sistema nervoso central.
Embora no presente trabalho as amostras biolgicas utilizadas tenham sido
diferentes das dos autores supra citados, os resultados obtidos corroboram
com os dos outros autores, confirmando maior facilidade no diagnstico em
animais que tenham apresentado ou estejam apresentando sintomas
respiratrios, gastrintestinais ou oculares, pois nesses casos existe grande
probabilidade (74,3%) de detectar um animal positivo com uma nica amostra
biolgica considerando cMNs, urina, zaragatoa ocular e genital.
No tocante a forma de evoluo clinica,

ocorreu concordncia de

resultados positivos nas quatro amostras biolgicas em 24 (70,6%) animais que

30
estavam apresentando sintomatologia progressiva no momento das coletas dos
materiais biolgicos, enquanto essa concordncia de resultados positivos
ocorreu em apenas trs dos nove animais que apresentavam recuperao total
ou parcial dos sintomas neurolgicos (Tabela 2). Em relao ao tempo de
evoluo, maior nmero de concordncia de resultados positivos nas quatro
amostras biolgicas ocorreu nos animais com menos de 60 dias de evoluo
(23/33) que naqueles que apresentavam mais de 60 dias do aparecimento dos
sintomas no momento das coletas das amostras biolgicas (4/10). Estes
resultados esto de acordo com os de Shin et al. (2004), que haviam
observado que, em casos crnicos ou de animais em convalescena, o vrus
da cinomose pode ter sido eliminado ou estar presente em quantidades muito
pequenas nos tecidos epiteliais e fluidos orgnicos. Considerando a vacinao,
verificou-se maior concordncia de resultados positivos nos animais no
vacinados adequadamente (19/26) que nos animais vacinados adequadamente
(3/8).
To importante quanto o nmero de amostras biolgicas colhidas por
animal, a escolha das mesmas, levando em considerao alm da
probabilidade maior de deteco, rapidez, praticidade e ausncia de riscos na
coleta. Exame fsico e anamnese cuidadosos, principalmente no referente
apresentao prvia de sintomas respiratrios, oculares ou digestivos, tipo e
tempo de evoluo e vacina, podem ser de fundamental importncia no s na
da seleo do nmero e amostra biolgica a ser coletada, como na
interpretao de resultados. Os resultados obtidos em funo da metodologia
utilizada no presente trabalho, sugerem a coleta conjunta de pelo menos duas
amostras biolgicas (zaragatoas genitais e urina) para realizao de hn-PCR,

31
especialmente nos casos de animais suspeitos de cinomose, que no
apresentaram sintomas respiratrios, gastrintestinais e oculares, bem como
nos animais vacinados, cronicamente infectados ou convalescentes.

Tabela 1- Resultados da hemi-nested-PCR para gene da nucleoprotena do


vrus da cinomose em diferentes amostras biolgicas (cMNs,
zaragatoa ocular, zaragatoa genital e urina), de 50 ces que
apresentaram alterao neurolgica compatvel com cinomose- So
Paulo-Brasil-2007

Nmero de
ces

cMNs 1, 2

Zaragatoa
ocular 2

Zaragatoa
genital 2

Urina 2

27

Total

33

37

40

37

1: cMNs clulas mononucleares do sangue perifrico, 2: +, presena de produto amplificado, - ausncia de produto
amplificado

32
Tabela 2- Fatores que podem estar envolvidos na deteco do vrus da
cinomose pela hn-PCR na concordncia de resultados positivos nas
quatro amostras biolgicas avaliadas por animal: presena ou
ausncia de sintomas respiratrios, digestivos ou ocular;
recuperao ou piora progressiva da sintomatologia neurolgica;
tempo de evoluo dos sintomas iniciais at o momento da coleta
das amostras biolgicas inferior ou superior a 60 dias e presena ou
ausncia de vacinao adequada. So Paulo- Brasil- 2007

Fatores que podem estar envolvidos na


concordncia de resultados positivos

Total

Animais
positivos

Presena de sintomas respiratrios,


gastrintestinais ou oculares

35

26

74,3

Ausncia de sintomas respiratrios,


gastrintestinais e oculares

12,5

Animais com sintomatologia progressiva no


momento da coleta

34

24

70,6

Animais apresentando recuperao parcial ou total


dos sintomas neurolgicos no momento da coleta

33,3

Tempo de evoluo inferior a 60 dias

33

23

69,7

Tempo de evoluo maior ou igual a 60 dias

10

40,0

Animais vacinados adequadamente*

37,5

Animais no vacinados adequadamente*

26

19

73,0

* Foram considerados como animais vacinados adequadamente os ces em esquema de vacinao segundo as
recomendaes propostas pela American Veterinary Medical Association e American Animal Hospital Association, que
consiste de vacinao a cada trs a quatro semanas, entre seis e 16 semanas de idade, revacinao no primeiro ano,
seguida por revacinao em intervalo inferior a trs anos (Greene, 2006).

33

5 CONCLUSES

To importante quanto o nmero de amostras biolgicas colhidas por


animal, a escolha das mesmas, levando em considerao alm da
probabilidade maior de deteco, rapidez, praticidade e ausncia de riscos na
coleta. Exame fsico e anamnese cuidadososa, principalmente no referente
apresentao prvia de sintomas respiratrios, oculares ou digestivos, tipo e
tempo de evoluo e vacina, podem ser de fundamental importncia no s na
da seleo do nmero e amostra biolgica a ser coletada, como na
interpretao de resultados.
Os resultados obtidos em funo da metodologia utilizada no presente
trabalho, sugerem a coleta conjunta de, pelo menos, duas amostras biolgicas
(zaragatoas genitais e urina) para realizao de hn-PCR, especialmente nos
casos de animais suspeitos de cinomose, que no apresentaram sintomas
respiratrios, gastrintestinais e oculares, bem como nos animais vacinados,
cronicamente infectados ou convalescentes.

34
REFERNCIAS

ALCAIDE, R. Cinomose canina: deteco do RNA viral pela cadeia de


polimerase (RT-PCR) em ces com diagnstico clnico da doena. 1999. 67 f.
Dissertao (Mestrado-Microbiologia). Instituto de Cincias Biomdicas da
Universidade de So Paulo, So Paulo, 1999.
AMUDE, A. M.; ALFIERI, A. A.; ALFIERI, A. F. Ante mortem diagnosis of CDV
infection by RT-PCR in distemper dogs with neurological deficits without the
typical clinical presentation. Veterinary Research Communications, v. 30,
p.679-687, 2006.
APPEL, M. J. G.; GILLESPIE, J. H. Canine distemper virus. In GARD, S.;
HALLAUER, C.; MEYER, K. F. (Ed.). Virology monographs. New York:
Springer-Verlag, p. 1-96,1972.
FRISK, A. L.; KONING, M.; MORITZ, A.; BAUMGARTNER, W. Detection of
canine distemper virus nucleoprotein RNA by reverse transcription-PCR using
serum, whole blood, and cerebrospinal fluid from dogs with distemper, Journal
of Clinical Microbiology, v. 37, p. 3634-43, 1999.
GREENE, C. E.; APPEL, M. J. Canine distemper. In GREENE, C. E. Infectious
Diseases of the dog and cat, 3rd ed. Local: Saunder Elsier, p. 25-41, 2006.
JZWIK, A.; FRYMUS, T. Comparison of the immunofluorecence assay with
RT-PCR and nested PCR in the diagnosis of canine distemper. Veterinary
Research Communications, v. 29, p. 347-359, 2005.
KIM, Y. H.; CHO, K. W.; YOUN, A. Y.; YOO, H. S.; HAN, H. R. Detection of
canine distemper virus (CDV) through one step RT_PCR combined with nested
PCR. Journal Veterinary Science, v. 2, p. 59-63, 2001.
KOUTINAS, A. F.; POLIZOPOULOU, Z. S.; BAUMGAERTNER, W.;LEKKAS,
S.; KONTOS, R. Relation of clinical signs to pathological changes in 19 cases
of canine distemper encephalomyelitis, Journal of Comparative Pathology, v.
126, p. 47-56, 2002.
SAITO, T. B.; ALFIERI, A. A.; WOSIACKI, S. R.; NEGRO, F. J.; MORAIS, H.
S A.;ALFIERI, A. F. Detection of canine distemper virus by reverse trascriptasepolymerase chain reaction in the urine of dogs with clinical signs of distemper
encephalitis, Research in Veterinary Science, v. 80, p. 116-119, 2005.

35
SAMBROOK, J.; FRITSCH, E. F.; MANIATIS, T. Molecular cloning: a
laboratory manual. 2nd ed., Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory, vol.3, 1989.
SHIN, Y. J.; CHO, K. O.; CHO, H. S.; KANG, S. K.;KIM, H. J.; KIM, Y. H.;
PARK, H. S.; PARK N.Y. Comparison of one-step RT-PCR and a nested PCR
for the detection of canine distemper virus in clinical samples. Australian
Veterinary Journal, v. 82, p. 83-86, 2004.
SHIN, Y. S., MORI, T., OKITA, M., GEMMA, T., KAI, C., MIKAMI, T. Detection
of canine distemper virus nucleocapsid protein gene in canine peripheral blood
mononuclear cells by RT- PCR. The Journal of Veterinary Medical Science, v
57, p. 439-45, 1995.
THOMAS, W. B.; STEISS, J. E. A retrospective evaluation of 38 cases of
canine distemper encephalomyelitis. Journal of the American Animal
Hospital Association, v. 29, p. 129-33, 1993.
TIPOLD, A., VANDEVELDE, M., JAGGY, A. Neurological manifestations of
canine distemper virus infection. Journal of Small Animal Practice, v. 33, p.
466-70, 1992.
TUDURY, E. A.; ARIAS, M. V. B., BRACARENSE, A. P. F. L.; MEGID, J.; DIAS
JUNIOR, R. F. Observaes clnicas e laboratoriais em ces com cinomose
nervosa. Cincia Rural, n. 27, p. 229-235, 1997.

36
Apndices
Apndice A

ID
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36

Identificao dos animais, vacinao, idade (meses ou anos),


raa, sexo, - So Paulo- Brasil- 2007
Vacinao1

Nsi
No
Nsi
110m
incorreta
incorreta
Nsi
incorreta
<2a
Nsi
incorreta
Nsi
incorreta
incorreta
<3a
<2a
6m
Nsi
No
No
incorreta
<h 1,5a
incorreta
no esquema
incorreto
1,5
17m
incorreta
No
No
No
incorreta
4m
No
5m
Nsi

Idade2
2a
5a
7m
5a
3m
2,5m
ind
1,5a
ind
2,5a
2a
ind
1a2m
1a2m
7a
5a
3a
ind
6a
4a
5a
7a
11a
4m
1a5m
6a
>2a
5a
11m
4a
5a
1,7a
3,5a
4a
9a
2a

Raa3
Cocker Spaniel
SRD
Husky Siberiano
Poodle
Poodle
Pinscher
Pequins
Beagle
Dachshund
Bull Terrier
Poodle
SRD
Labrador
Fila Brasileiro
SRD
SRD
SRD
SRD
Poodle
SRD
Bull Terrier
Cocker Spaniel
Dachshund
SRD
Labrador
SRD
SRD
Dachshund
SRD
Poodle
SRD
Dachshund
Poodle
Fila Brasileiro
Buldog Ingls
Poodle

Sexo4
M
F
F
F
M
F
M
M
M
F
M
F
F
M
F
M
M
M
F
F
F
F
F
M
F
M
F
F
F
F
M
M
F
F
M
M
Continua

37

Concluso
ID
37
38
39
40
41
42
43
44
45
46
47
48
49
50

Vacinao1
incorreta
Nsi
No
No
Nsi
No
No
No
No
Nsi
no
Nsi
Nsi
incorreta

Idade2
13a
3a
2a
4a
1a
5a
2a
4a
2m
ind
2a
4a
2a
9a

Raa3
SRD
SRD
Cocker Spaniel
Poodle
Bull Terrier
Poodle
Poodle
SRD
SRD
SRD
SRD
Dachshund
SRD
Cocker Spaniel

1: a, anos; nsi, perodo superior a 2 meses da ltima vacina, mas proprietrios no souberam informar data
2: ind, informao no disponvel; m, meses; a, anos; no, vacinao inadequada
3: SRD, sem raa definica
4: F, fmea, M, macho

Sexo4
F
M
F
M
M
M
F
M
F
F
F
F
M
F

38
Apndice B-

ID

1
2
3
4
5
6

Identificao dos animais, outras alteraes sistmicas extra


neurais (respiratrios, digestivos ou oculares) menos
freqentes observadas anteriormente (no perodo mximo de
dois meses) ou no momento das coletas dos espcimes
clnicos- So Paulo- Brasil- 2007

Alteraes
Alteraes
respiratrias,
digestivas ou oculares na
respiratrias,
digestivas
ou coleta
oculares antes da
coleta 3
secreo nasal purulenta,
secreo ocular mucosa,
secreo
nasal secreo ocular mucosa
purulenta
diarria, mese, secreo
ocular mucosa
secreo ocular mucosa

7
8
9
10
11
12

mese
secreo
nasal
purulenta, mese,
diarria, secreo
ocular purulenta
mese
dispnia

13
14

15

16
17
18

secreo ocular mucosa


diarria, dispnia, secreo
nasal purulenta, secreo
ocular purulenta
mese, secreo nasal
serosa, tosse, secreo ocular
mucosa
esternutao
-

secreo ocular mucosa

Outras alteraes
extra neurais

T40C,
hiperqueratose
39,9C,
hiperqueratose,
caquexia
Caquexia

hiperqueratose, otite
hiperqueratose
hiperqueratose
hiperqueratose
40C

hiperqueratose
hiperqueratose
Continua

39

ID

19

20
21
22
23
24
25
26
27
28
29
30

31

32
33
34
35

Alteraes
respiratrias,
digestivas
ou
oculares antes da
coleta 3
mese,
secreo
ocular
purulenta,
tosse, esternutao,
secreo
nasal
purulenta
mese
tosse,
secreo
ocular purulenta
secreo
ocular
purulenta,
esternutao
-

Continuao
Alteraes
respiratrias, Outras alteraes
digestivas ou oculares na extra neurais
coleta
secreo nasal serosa

39,9C*,
hiperqueratose

diarria
-

hiperqueratose
otite

secreo nasal purulenta

hiperqueratose

pstulas abdominais

secreo nasal serosa,


secreo ocular mucosa
melena
secreo
ocular purulenta
secreo ocular mucosa
mese,
secreo nasal
purulenta,
secreo
ocular
purulenta
secreo nasal purulenta,
esternutao,
diarria,
melena,
secreo
ocular
purulenta
hematoquesia,
secreo
ocular
purulenta
melena
diarria, secreo ocular
mucosa,
secreo
purulenta

nasal -

caquexia
T 40,5C*,
pstulas
abdominais*

otite*,

40,3C,
hiperqueratose
hiperqueratose

hiperqueratose,
caquexia
40C*,
hiperqueratose
Continua

40

Concluso

ID

36
37
38

39
40
41
42
43
44
45
46
47
48
49
50

Alteraes
Alteraes
respiratrias, Outras alteraes
respiratrias,
digestivas ou oculares na extra neurais
digestivas
ou coleta
oculares antes da
coleta 3
secreo ocular mucosa
mese, melena
secreo nasal purulenta, hiperqueratose
esternutao
secreo
nasal hiperqueratose
purulenta,
tosse,
esternutao,
melena,
secreo
ocular purulenta
hematoquesia
secreo ocular purulenta
mese,
secreo
ocular hiperqueratose otite,
purulenta
pstulas
abdominais
secreo ocular purulenta
miase
tosse
hiperqueratose
tosse,
secreo
ocular
mucosa
mese, diarria, secreo
nasal serosa, esternutao,
secreo ocular purulenta
diarria
secreo nasal purulenta, hiperqueratose
esternutao, secreo ocular
purulenta
secreo ocular mucosa
secreo
nasal secreo ocular mucosa
hiperqueratose
serosa,
esternutao
secreo nasal purulenta, hiperqueratose
tosse,
secreo
ocular
purulenta
esternutao, secreo ocular hiperqueratose, otite
purulenta

*, alteraes foram observadas anteriormente (no perodo mximo de dois meses), mas no estavam presentes no
momento da coleta das amostras biolgicas.

41

Apndice C- Animais, sintomas neurolgicos observados ou relatados e


evoluo clnica. So Paulo- Brasil- 2007
ID
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30

Alteraes neurolgicas , evoluo


mioclonia, vocalizao, tetraparesia, eutanasiado
paraparesia, alterao de latido*, recuperao total
convulso, vocalizao, eutanasiada
inclinao lateral de- cabea, convulso, nistagmo, estrabismo,
vocalizao, eutanasiado
tetraparesia, nistagmo, bito
tetraparesia, tremor de inteno, hipermetria, estrabismo, nistagmo,
estupor, eutanasiado
mioclonia, tetraparesia
mioclonia*, inclinao lateral de cabea*, andar compulsivo*,
tetraparesia, estrabismo* nistagmo, atrofia msculos mastigatrios,
vocalizao, estupor, eutanasiado
tetraparesia, alterao de latido, bito
nistagmo, inclinao lateral de cabea, ataxia, convulso, cegueira
inclinao lateral de cabea, hipermetria, tremor de inteno,
nistagmo, paralisia facial
mioclonia, convulso, tremor de inteno,
tetraparesia*, andar
compulsivo, estupor, eutanasiado
mioclonia, convulso , eutanasiado
mioclonia, convulso, nistagmo, estupor, bito
mioclonia, tetraparesia, vocalizao, eutanasiada
inclinao lateral de cabea, andar compulsivo, estrabismo,
tetraparesia, bito
tetraparesia*, inclinao lateral de cabea, recuperao total
mioclonia, ataxia, eutanasiado
ataxia *, convulso, recuperao total
tetraparesia, eutanasiado
claudicao, atrofia msculos mastigatrios, paralisia facial,
megaesfago, ataxia, bito
inclinao lateral de cabea*, cegueira, midrase, melhora parcial
mioclonia, tetraparesia, vocalizao, eutanasiado
mioclonia, tetraparesia, pleurtomo, estupor, bito
mioclonia*, ataxia*, tremor de inteno*, recuperao total
mioclonia, tremor de inteno, vocalizao, hipermetria/tetraparesia,
bito
tetraparesia*/paraparesia*, tremor de inteno, convulso, vocalizao,
nistagmo*, recuperao total
mioclonia, convulso, tetraparesia, inclinao lateral de cabea,
nistagmo, eutanasiado
mioclonia, ataxia, alterao latido, eutanasiado
ataxia*, recuperao total
Continua

42

Concluso
ID
31

Alteraes neurolgicas, evoluo


mioclonia, anisocoria, tetraparesia, nistagmo, vocalizao, bito

32
33
34
35
36
37
38
39
40

andar compulsivo, estupor, eutanasiado


mioclonia, tetraparesia, alterao de latido, bito
mioclonia, bito
tetraparesia, nistagmo, estuporl, bito
mioclonia, vocalizao, bito
convulso, eutanasiado
mioclonia, convulso, tetraparesia, eutanasiado
mioclonia, vocalizao, ataxia, bito
inclinao lateral de cabea, tetraparesia, convulso, vocalizao,
estrabismo, pleurtomo, nistagmo, estupor, eutanasiado
mioclonia, melhora parcial
vocalizao, tetraparesia, nistagmo, convulso, estupor, eutanasiado
mioclonia, tremor de inteno, tetraparesia, vocalizao, bito
tremores *, recuperao total
tremor de inteno, ataxia, bito
mioclonia, tremor de inteno, tetraparesia, opsttomo, eutanasiado
mioclonia, claudicao, nistagmo, estupor, tetraparesia, eutanasiado
paraparesia*, mioclonia
mioclonia, convulso, nistagmo, tetraparesia, eutanasiado
convulso, paraparesia, eutanasiado

41
42
43
44
45
46
47
48
49
50

*, alteraes foram observadas anteriormente (no perodo mximo de dois meses), mas no estavam presentes no
momento da coleta das amostras biolgicas.

43

Apndice D-

Deteco do vrus da cinomose canina por hemi-nested-PCR


em diferentes amostras clnicas: clulas mononucleares do
sangue perifrico, zaragatoa ocular, zaragatoa genital e urina,
de 50 ces com sintomatologia neurolgica- So PauloBrasil- 2007

CMNS1, 2

n
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35

Zaragatoa
genital2
+
+

Urina2

+
-

Zaragatoa
ocular2
+
+

+
+
-

+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
-

+
+

+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
-

+
-

+
+

+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
-

+
+
+**
+**
+**
+**
+**
+**
+**
-*
+**
-**
-**
+**
+**
+**
+**
+**
+**
-**
Continua

44

CMNS1, 2

n
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50

+
+
+
+
+
+
+
+
+
+
+
+
+

Zaragatoa
ocular2
+
+
+
+
+
+
+
+
+
+
+
+
+
+

Zaragatoa
genital2
+
+
+
+
+
+
+
+
+
+
+
+
+
+

Concluso
Urina2
+**
+**
+**
+**
+**
+**
+**
+**
+**
+**
+**
+***
-**
+***
+***

1: cMNs clulas mononucleares do sangue perifrico; 2: +, presena de produto amplificado, - ausncia de produto
amplificado; ** extrao realizada a partir da urina direta.

Captulo 2

46
1 INTRODUO

cinomose

uma

doena

infecto-contagiosa,

de

distribuio

cosmopolita, causada por um vrus RNA envelopado, do gnero Morbillivirus,


famlia Paramyxoviridae (APPEL; GILESPIE, 1972), que acomete uma ampla
variedade de hospedeiros, sendo o co seu principal reservatrio (HEADLEY;
GRAA, 2000).
A sintomatologia clnica e a taxa de letalidade variam com a virulncia da
estirpe viral; espcie, idade e imunocompetncia do hospedeiro (TIPOLD et
al., 1992). A cinomose afeta ces de qualquer idade, raa e sexo (TIPOLD et
al., 1992). Embora a cinomose ocorra com maior freqncia em filhotes com
histrico de no vacinao (GREENE, 2006), pode acometer animais
vacinados (BLIXANKRONE-MOLLER et al., 1993; TIPOLD, 1996). Sintomas
respiratrios, digestivos e oculares, com intensidade varivel, podem ocorrer
previamente ou associados a sintomas neurolgicos (BRAUND, 1994). Os
sintomas neurolgicos assim como os sintomas extraneurais, podem ocorrer
isolados ou em diferentes associaes (TIPOLD et al., 1992; KOUTINAS et al.,
2002). Hiperqueratose nasal e digital tambm pode ser vista (BRAUND, 1994).
Ces com encefalomielite pelo vrus da cinomose podem apresentar
uma ampla variedade de manifestaes neurolgicas, podendo evoluir de
forma aguda, subaguda ou crnica (GREENE, 2006). Trs formas clnicopatolgicas

tm

sido

descritas:

encefalomielite

de

animais

jovens,

encefalomielite multifocal de ces adultos e encefalite do co idoso (GREENE,


2006).

47
Apesar da freqente

distribuio multifocal das leses no sistema

nervoso central (BRAUND, 1994), o quadro neurolgico pode se manifestar


clinicamente por sintomatologia focal em at 84,9% dos casos (KOUTINAS et
al., 2002). Embora a presena de mioclonia (contrao muscular rtmica e
espontnea de um ou mais grupos musculares) seja altamente sugestiva de
cinomose, a mesma pode estar ausente em mais de 50% dos casos, alm de
ser observada, com menor freqncia, em outras meningoencefalomielites e,
esporadicamente, em intoxicao por chumbo (TIPOLD et al., 1992; TIPOLD,
1995).
O diagnstico clnico difcil,particularmente nos casos de manifestao
neurolgica

focal

nos

quais

outros

sintomas

sistmicos,

prvios

ou

concomitantes, a outras alteraes neurolgicas (alm da mioclonia) esto


ausentes (TIPOLD et al., 1992; KOUTINAS et al., 2002; GREENE, 2006).

48
2 OBJETIVOS

Descrever as principais alteraes clnicas observadas ou relatadas


pelos proprietrios durante a evoluo clnica de ces positivos para cinomose
pela hemi-nested PCR, em , pelo menos uma amostra biolgica (Captula 1).

49
3 MATERIAIS E MTODOS

3.1 ANIMAIS

Utilizou-se uma amostragem de convenincia de 50 ces com


sintomatologia neurolgica, compatvel com cinomose, positivos pela heminested PCR em pelo menos uma amostra biolgica, em, pelo menos, uma
amostra biolgica (captulo1). Os animais foram atendidos no Hospital
Veterinrio da Faculdade de Medicina Veterinria e Zootecnia da Universidade
de So Paulo (HOVET-FMVZ-USP), na AILA (Aliana Internacional do Animal)
e no centro Veterinrio Pet Care, no perodo de 20/10/2004 a 31/05/2007.
Foram anotados dados de anamnese relativos raa, sexo, idade, evoluo
dos sintomas, vacinao, presena de contactantes sintomticos, assim como
presena de outros sintomas sistmicos prvios aos sintomas neurolgicos,
realizou-se anlise descritiva dos resultados obtidos.

50
4 RESULTADOS E DISCUSSO

Dos 50 ces estudados, 30 (60%) eram fmeas e 20 (40%) machos.


Vinte e nove animais (58%) tinham definio racial: Poodle (10), Cocker
Spaniel (quatro); Bull Terrier, Labrador Daschund e Fila Brasileiro (dois animais
de cada raa); Husky Siberiano, Pinscher, Pequins, Golden Retrivier,
Schnauzer, Boxer e Beagle (um animal) e os outros 21 (42%) dos ces no
tinham definio racial (Apndice A).
Foram arbitrariamente considerados como filhotes animais com menos
de um ano de idade; adultos animais com mais de um e menos de nove anos,
e idosos, os animais com mais de 10 anos de idade. Utilizando essa
classificao, a populao avaliada consistiu de 30 (60%) adultos; 14 (28%)
filhotes e dois (4%) idosos, sendo que em quatro casos a idade era
desconhecida.
Todos os animais do presente estudo apresentaram, em algum
momento da evoluo clnica, sintomas inespecficos, como disorexia e
prostrao, com durao e intensidade variveis. Os sintomas neurolgicos
surgiram simultaneamente em 15 casos (30%) ou at, no mximo, 30 dias aps
aparecimento de outras alteraes respiratrias, digestivas ou oculares (50%).
Apenas um animal apresentou sintomatologia neurolgica quatro meses aps
incio de diarria crnica, no sendo possvel comprovar se a mesma estava
relacionada cinomose. Tambm foram observadas hipertermia (sete casos) e
caquexia (sete casos, sendo cinco filhotes).

51
Manifestaes respiratrias, oculares ou digestivas, isoladas ou
associadas, foram observadas em 41(82%)

dos ces ao exame fsico ou

relatados na anamnese, tanto nos 11 filhotes (78,57%), quanto em 26 ces


adultos (86,7%) e idosos (dois casos). O sintoma no neurolgico observado
com maior freqncia (66%) foi alterao ocular (variando de esclera congesta
a secreo ocular purulenta, Tabela 1, Apndice B); seguido de alterao
respiratria (53,5%) e digestiva (44%) conforme descrito na Tabela 2. Apenas
nove ces (18%) no apresentaram sintomas gastrintestinais, respiratrios e
oculares durante toda evoluo clnica, sendo que desses animais, apenas trs
apresentaram sintomatologia exclusivamente neurolgica na ausncia de
quaisquer outros sintomas (exceto disorexia e prostrao). Em nove casos
(oito animais adultos e um filhote) havia ocorrido recuperao total dos
sintomas sistmicos, embora os sintomas neurolgicos estivessem em
progresso. Embora tenha sido relatado que a encefalomielite de ces adultos,
devido ao vrus da cinomose raramente sejam precedidos por sintomas
sistmicos (SHELL, 1990; BRAUND, 1994). Vandevelde e Cachin, (1993)
observaram sintomatologia gastrintestinal, respiratria e ocular em 50% dos
casos, enquanto Tipold et al. (1992) observaram sua presena em 66,7% dos
ces com sintomatologia neurolgica, resultados bem mais prximos aos
obtidos .
Hiperqueratose nasal ou digital ocorreu em 22 animais (44%), enquanto
apenas 4 (8%) apresentaram pstulas abdominais. Dois dos quatro animais
que apresentaram pstulas abdominais recuperaram-se. Os resultados obtidos
corroboram com o descrito pela literatura: pstulas abdominais raramente
esto associadas com envolvimento do sistema nervoso central, enquanto ces

52
com hiperqueratose nasal e digital costumam apresentar complicaes
neurolgicas (TUDURY et al., 1997; GREENE, 2006).
Os

sintomas

neurolgicos

referidos

como

mais

freqentes

na

encefalomielite pela cinomose incluem: mioclonia; convulso; ataxia cerebelar,


vestibular ou sensorial; cegueira; tetraparesia/ paraparesia e paraplegia
(VANDEVELDE; CACHIN, 1993; TUDURY et al., 1997; SILVA et. al., 2006).
Os sintomas neurolgicos observados com maior freqncia foram:
alterao locomotora (74%) (sendo que a maior parte dos casos evoluiu para
tetraparesia com incapacidade de se manter em estao) e mioclonia (54%).
Dois animais apresentaram mioclonia aps mais de dois meses de evoluo de
outros sintomas neurolgicos, enquanto que em outros quatro ces a mioclonia
era bem evidente de inicialmente, desaparecendo com o passar do tempo,
apesar da piora progressiva da doena.

Silva et al.(2006) observaram

mioclonia em 38,4%, enquanto Tudury et al. (1997) observaram sua presena


em 75,3% dos animais estudados, e Tipold et al. (1993) a relataram em menos
de 50% dos casos. Variao nas freqncias dos diferentes sintomas
neurolgicos podem estar relacionadas tanto forma de seleo de animais
estudados,

quanto

ao

tempo

de

evoluo,

cepa

viral,

idade

imunocompetncia do hospedeiro.
Vocalizao, apesar de no ser citada pela maioria dos autores, ocorreu
em 16 casos (32%); sendo juntamente com a tetraparesia e estupor a razo da
solicitao de eutansia por grande parte dos proprietrios,sendo que no foi
possvel distinguir se a vocalizao ocorria devido ansiedade, dor ou delrio.
Este sintoma foi mais freqentemente observado noite, sendo que, na maior
parte dos casos, os animais paravam de vocalizar, temporariamente, quando

53
em contato fsico com seus donos. Aparentemente, o referido sintoma no
respondeu ao tratamento base de analgsicos (associao tramal, dipirona e
gabapentina).
A maior parte dos animais, evoluiu desfavoravelmente (76%): 23 ces
foram eutanasiados devido gravidade dos sintomas neurolgicos, enquanto
outros 16 vieram a bito devido piora dos sintomas sistmicos e neurolgicos.
Dos nove animais que se recuperaram dos sintomas extraneurais (oito adultos
e um filhote), seis apresentaram piora progressiva dos sintomas neurolgicos.
Ocorreu evoluo favorvel em 10 animais: quatro manifestaram apenas
sintomas neurolgicos discretos (ataxia em dois casos, mioclonia e tremor um
caso cada), enquanto os outros seis apresentaram recuperao parcial ou total
de quadros neurolgicos mais severos (Tabela 3, Apndice C). Dentre os
animais que evoluram favoravelmente, oito eram adultos e dois filhotes (oito
meses e outro de um ano), sendo que em um caso a evoluo desconhecida.
Esses resultados esto de acordo com Tipold et al. (1992) e Vandevelde e
Cachin, (1993), que tambm observaram prognstico reservado na maior parte
dos casos de cinomose com sintomatologia neurolgica. Os resultados
sugerem prognstico reservado para animais com sintomatologia neurolgica
devido cinomose, independentemente da idade, embora adultos possam
apresentar recuperao (principalmente dos sintomas extraneurais) mais
evidente que os filhotes.
No tocante a utilizao ou no de vacina contra o vrus da cinomose, 14
no tinham sido vacinados e 17 tinham sido vacinados incorretamente, num
total de 62% dos animais. Outros 10 ces no haviam sido vacinados desde

54
que foram adquiridos, h no mnimo dois meses, sendo desconhecido o
histrico de vacinao prvia nesses casos.
Foram considerados vacinados corretamente os ces vacinados ou
aqueles que seguiam o esquema de vacinao, de acordo com as
recomendaes propostas pela American Veterinary Medical Association e pela
American Animal Hospital Association, que consiste de vacinao a cada trs a
quatro semanas, entre seis e 16 semanas de idade; revacinao no primeiro
ano de vida, seguida por revacinao em intervalo inferior a trs anos
(GREENE, 2006).
Gouveia et al. (1987) observaram que 67,4% dos ces necropsiados
com diagnstico de cinomose no haviam sido vacinados, enquanto Tudury et
al. (1997), consideram falta de vacinao um fator predisponente para
ocorrncia da doena, pois apenas 18,5% haviam sido submetidos a um
programa correto de vacinao no Brasil. Os resultados obtidos no presente
trabalho corroboram com aqueles referidos por Tudury et al. (1997), em que
grande parte da populao canina no obedece ao esquema de imunizao
adequado.
Entre os erros de vacinao encontrados, os mais freqentes ocorreram
na imunizao dos filhotes (12 casos). Foram observados: intervalo
inadequado entre as doses, trmino da vacinao antes de 16 semanas de
idade (momento em que anticorpos maternos ainda podem estar presentes
prejudicando a resposta vacinao), atraso na primeira revacinao anual e
intervalo de vacinao superior a trs anos, sendo que na maioria desses
casos os animais foram vacinados apenas quando filhotes. Embora alguns
proprietrios tenham alegado condio financeira insuficiente, a maioria

55
desconhecia a importncia de seguir o esquema adequado de vacinao. Ces
que no recebem imunizao peridica podem perder a proteo e tornaremse susceptveis infeco (GREENE e Appel, 1990). Tambm foram
observados casos de vacinao de animais doentes ou que haviam
apresentado, h pouco tempo, sintomas sistmicos (provavelmente j
infectados pelo vrus da cinomose). Foi observada falha na proteo contra
cinomose em cinco ces vacinados, em intervalo superior a um e inferior a trs
anos.
Em 10 casos (20%) a vacinao havia sido realizada de acordo com as
recomendaes da literatura, em clnicas veterinrias ou casas agropecurias,
sendo que em cinco deles a aplicao da vacina havia sido realizada h menos
de um ano. Embora vacinas sejam consideradas efetivas, existem inmeras
causas de falhas vacinais que podem estar relacionadas ao hospedeiro, a
fatores vacinais e m prxis (GREENE; APPEL, 1990). Diversos autores
questionam a necessidade de revacinao anual de ces adultos, pois
acreditam que animais vacinados mantm elevados ttulos de anticorpos contra
o vrus da cinomose vrios anos aps vacinao (GORE et al., 2005). No
entanto, Monti, (2004), em um estudo realizado no Brasil, verificou grande
porcentagem de ttulos abaixo do valor considerado protetor em ces
vacinados corretamente (tanto em clnicas veterinrias, quanto em lojas
agropecurias). Somado ao fato de que no Brasil a prevalncia da cinomose
varia de 6,1% (Gouveia et al., 1987) a 11,7% (HEADLEY; GRAA, 2000), de
acordo com a regio e metodologia empregada no seu diagnstico, sugere-se
que enquanto programas de esclarecimento para a populao no forem

56
realizados, seja mais prudente manter esquema de revacinao anual dos
animais adultos.
Em outros cinco casos, a vacinao havia sido realizada h menos de
um ms da coleta das amostras biolgicas, sendo em dois casos a vacinao
tinha sido feita a menos de 21 dias. Embora diferentes estudos experimentais
tenham sido conduzidos com a finalidade de se determinar o perodo de tempo
em que seja possvel deteco de RNA vacinal, diferentes perodos de tempo
(trs a 14 dias) foram obtidos utilizando diferentes metodologias, em pequeno
nmero de animais saudveis isolados em ambiente protegido (SHIN et al.,
1995;

KIM et al., 2001; JZWIK e FRYMUS, 2005). JZWIK e FRYMUS,

(2005) detectaram o RNA viral vacinal at trs dias aps vacinao, utilizando
nested/PCR, no sangue total de sete filhotes e de um co adulto, obtendo
resultados positivos somente. Kim et al. (2001), utilizando

Nested/PCR,

obtiveram resultados positivos dois e sete dias da vacina, no apresentando


nenhum resultado positivo aps sete dias. Por outro lado, Shin et al. (1995)
detectaram o vrus da cinomose no sangue, de sete a 14 dias da vacina, mas
no aps 21 dias (estudo realizado com trs ces). Provavelmente, em animais
de uma populao no protegida por condies experimentais, dependendo da
metodologia utilizada, esse perodo possa ser superior a 14 dias. Como no foi
possvel realizar a coleta e processamento de diferentes amostras biolgicas
em animais saudveis, utilizando a mesma metodologia empregada nos
animais suspeitos, naqueles cinco casos nos quais a vacina foi aplicada, h
menos de um ms, no foi possvel descartar a possibilidade de deteco de
vrus vacinal. J nos demais 43 animais, pode-se descartar a possibilidade de
deteco do antgeno vacinal, pois j havia decorrido mais de dois meses da

57
administrao da vacina no momento das coletas das amostras biolgicas. Em
cinco casos, os animais poderiam j estar infectados pelo vrus da cinomose no
momento em que foi realizada a vacinao, mas no foi possvel descartar a
possibilidade de encefalite ps-vacinal (sintomas neurolgicos se manifestaram
de um a 15 dias da aplicao da vacina com vrus vivo atenuado, perodo que
pode ocorrer encefalite ps- vacinal (SHELL, 1990).
Outro dado relevante na anamnese (alm do esquema utilizado na
vacinao e da ocorrncia prvia de sintomas extraneurais) a presena de
contatactes com sintomas sugestivos de cinomose em 10 casos (20%).

58

Tabela 1-

Alteraes respiratrias, gastrintestinais e oculares observadas


isoladamente ou associadas, anteriormente (no perodo mximo de dois
meses) ou no momento das coletas de amostras biolgicas e nmero
de animais em que as mesmas foram observadas, nas diferentes
idades, nos 50 ces positivos para cinomose pela hemi-nested PCRSo Paulo-Brasil- 2007

Sintomas observados
ou relatados
Secreo ocular
purulenta
Secreo ocular mucosa
ou esclera congesta
Secreo nasal purulenta
mese
Diarria
Esternutao
Tosse
Melena
Secreo nasal serosa
Hematoquesia
Dispnia

Total
N= 50
18

Filhotes
N= 14
4

Adultos
N= 30
12

Idosos
N= 2
1

Ind
N= 4
1

15

14
11
11
9
7
5
5

2
4
6
1
1
0
2

9
6
4
5
6
4
3

2
1
0
2
0
1
0

1
0
1
1
0
0
0

2
2

0
0

2
1

0
0

0
1

59

Tabela 2-

Sintomas respiratrios, gastrintestinais e oculares observados


anteriormente (no perodo mximo de dois meses) ou no momento
das coletas das amostras biolgicas, segundo faixa etria, dos 50
ces positivos para cinomose pela hemi-nested PCR- So PauloBrasil- 2007

Sintomas
Oculares
Respiratrios
Digestivos
Respiratrio ou
digestivo ou ocular

Total
(N=50)

Filhotes
(N= 14)

Adultos
(N= 30)

Idosos
(N= 2)

33
23
22
41

9
5
6
11

21
14
14
24

1
2
1
2

Idade
desconhecida
(N= 4)
2
2
1
2

60

Tabela 3-

Sintomas neurolgicos observados isoladamente ou associados,


durante a evoluo clnica, segundo faixa etria, dos 50 ces
positivos para cinomose pela hemi-nested PCR- So Paulo- Brasil2007

Sintomatologia
Neurolgica
Mioclonia
Tetraparesia
Convulso
Vocalizao
Nistagmo
Estupor
Ataxia
Tremor de inteno
Inclinao lateral de
cabea
Estrabismo
Paraparesia
Andar compulsivo
Alterao latido
Atrofia dos msculos
da mastigao
Claudicao
Hipermetria
Pleurtomo
Tetraplegia
Tremor
Paralisia Facial
Megaesfago
Midrase bilateral
Cegueira
Opsttomo
Anisocoria

Total
N= 50

Filhotes
N= 14

Adultos
N= 30

Idosos
N= 2

27
22
17
16
12
9
9
8
5

6
5
4
3
2
3
3
2
0

16
14
11
12
10
5
5
4
5

1
1
1
1
0
0
0
0
0

Idade
desconhecida
N=4
4
2
1
0
0
1
1
2
0

4
3
3
3
3

1
1
1
1
1

3
3
2
2
2

0
0
0
0
0

0
0
1
0
0

2
2
2
2
1
1
1
1
1
1
1

1
1
1
1
0
0
0
0
0
0
0

2
1
1
1
1
1
1
1
1
0
1

0
0
0
0
0
0
0
0
0
0
0

0
0
0
0
0
0
0
0
0
1
0

61

5 CONCLUSES
Apesar de sintomas extraneurais terem sido observados (ou relatados)
em 82% dos ces com sintomatologia nervosa, em muitos casos os sintomas
foram discretos, realando a importncia do exame clnico detalhado.
Os dados obtidos reforam a necessidade de esclarecimento dos
proprietrios sobre a imunizao peridica, nas diferentes faixas etrias e no
somente enquanto filhote.

62
REFERNCIAS

ALCAIDE, R. Cinomose canina: deteco do RNA viral pela cadeia de


polimerase (RT-PCR) em ces com diagnstico clnico da doena. 67 f.
Dissertao (Mestrado-Microbiologia). Instituto de Cincias Biomdicas da
Universidade de So Paulo, So Paulo, 1999.

AMUDE, A. M.; ALFIERI, A. A.; ALFIERI, A. F. Ante mortem diagnosis of CDV


infection by RT-PCR in distemper dogs with neurological deficits without the
typical clinical presentation. Veterinary Research Communications, v. 30, p.
679-687, 2006.

APPEL, M. J. G.; GILLESPIE, J. H. Canine distemper virus. In GARD, S.;


HALLAUER, C.; MEYER, K. F. (Ed.). Virology monographs. New York:
Springer-Verlag, p. 1-96,1972.

BRAUND, K.G.Clinical syndromes in veterinary neurology, 2nd edition, ed


Mosby, 1994.

FRISK, A. L.; KONING, M.; MORITZ, A.; BAUMGARTNER, W. Detection of


canine distemper virus nucleoprotein RNA by reverse transcription-PCR using
serum, whole blood, and cerebrospinal fluid from dogs with distemper. Journal
of Clinical Microbiology, v. 37, p. 3634-43, 1999.

GEBARA, C.M.S., WOSIACKI, S.R.; NEGRO, F.J.; OLIVEIRA, D.B.; BELONI,


S.N.E.; ALFIERI, A.A. Deteco do gene da nucleoprotena do vrus da
cinomose canina por RT-PCR em urina de ces com sinais clnicos de
cinomose. Arquivos Brasileiros de Medicina Veterinria e Zootecnia, v.
56, n. 4, p. 480-487, 2004.

GORE, T.C.; LAKSHMANAN, N.; DUCAN, K.L.; COYNE, M.J.; LUM, M.A.;
STERNER, F.J. Three-year duration of immunity in dogs following vaccination
against canine adenovirus type-1, canine parvovirus and canine distemper
virus. Veterinary Therapeutics, v. 6, n.1, p. 5-14, 2005.

63
GOUVEIA, A. M. G.; MAGALHES, H.H.; RIBEIRO, A. L. Cinomose canina:
ocorrncia em animais vacinados e distribuio por faixa etria. Arquivos
Brasileiros de Medicina Veterinria e Zootecnia, v. 39, n. 4, p. 9-45, 1987.

GREENE, C. E.; APPEL, M. J. Canine distemper. In GREENE, C. E. Infectious


Diseases of the dog and cat, 3rd ed. Local: Saunder Elsier, p. 25-41, 2006.

HEADLEY, S.A.; GRAA, D. L. Canine distemper: epidemiological findings of


250 cases. Brazilian Journal Veterinary Research Animal Science, v. 37, n.
2, So Paulo, 2000.

JZWIK, A.; FRYMUS, T. Comparison of the immunofluorecence assay with


RT-PCR and nested PCR in the diagnosis of canine distemper. Veterinary
Research Communications, v. 29, p. 347-359, 2005.

KIM, Y. H.; CHO, K. W.; YOUN, A. Y.; YOO, H. S.; HAN, H. R. Detection of
canine distemper virus (CDV) through one step RT_PCR combined with nested
PCR. Journal Veterinary Science, v. 2, p. 59-63, 2001.

KOUTINAS, A. F.; POLIZOPOULOU, Z. S.; BAUMGAERTNER, W.; LEKKAS,


S.; KONTOS, R. Relation of clinical signs to pathological changes in 19 cases
of canine distemper encephalomyelitis. Journal of Comparative Pathology, v.
126, p. 47-56, 2002.

MONTI, F.S. Anticorpos contra o vrus da cinomose em ces vacinados


em diferentes estabalecimentos da rea urbana do municpio de
Viosa/MG. 56f. Dissertao de Mestrado Universidade Federal de Viosa,
Minas Gerais, 2004.

SAITO, T. B.; ALFIERI, A. A.; WOSIACKI, S. R.; NEGRO, F. J.; MORAIS, H.


S A.;ALFIERI, A. F. Detection of canine distemper virus by reverse trascriptasepolymerase chain reaction in the urine of dogs with clinical signs of distemper
encephalitis. Reserch in Veterinary Science, v. 80, p. 116-119, 2005.

64
SAMBROOK, J.; FRITSCH, E. F.; MANIATIS, T. Molecular cloning: a
laboratory manual. 2nd ed., vol.3, Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory, 1989.

SHELL, L. G. Canine distemper. Continuing Education, n12, p.173-179,


1990.

SHIN, Y. J.; CHO, K. O.; CHO, H. S.; KANG, S. K.;KIM, H. J.; KIM, Y. H.;
PARK, H. S.; PARK N.Y. Comparison of one-step RT-PCR and a nested PCR
for the detection of canine distemper virus in clinical samples. Australian
Veterinary Journal, v. 82, p. 83-86, 2004.

SHIN, Y. S., MORI, T., OKITA, M., GEMMA, T., KAI, C., MIKAMI, T. Detection
of canine distemper virus nucleocapsid protein gene in canine peripheral blood
mononuclear cells by RT- PCR. The Journal of Veterinary Medical Science,
n. 57, p. 439-45, 1995.

SILVA, M.C.; FIGHERA, R.A.; BRUM, J.S.; GRAA, D.L.; KOMMERS, G.D;
IRIGOYEN, L.F.; BARROS, C.S.L. Aspectos clinicopatolgicos de 620 casos
neurolgicos de cinomose em case. Pesquisa Veterinria Brasileira Brazilian
Journal of Veterinary Research, vol.27, n.5, p. 215-220, Maio 2007.

THOMAS, W. B.; STEISS, J. E. A retrospective evaluation of 38 cases of


canine distemper encephalomyelitis. Journal of the American Animal
Hospital Association, v. 29, p. 129-33, 1993.

TIPOLD, A. Diagnosis of inflammatory and infectious diseases of central


nervous system in dogs: A retrospective study. Journal of Veterinary Internal
Medicine, v.9, n. 5, p. 304-314, 1995.

TIPOLD, A., JAGGY, A., ZURBRIGGEN, A.; VANDEVELDE, M. Neurological


signs in canine distemper encephalomyelitis a clinical study. European
Journal of Companion Animal Practice, n. 33, p. 466-470, 1996.

65
TIPOLD, A., VANDEVELDE, M., JAGGY, A. Neurological manifestations of
canine distemper virus infection. Journal of Small Animal Practice, v.33, p.
466-70, 1992.

TUDURY, E. A.; ARIAS, M. V. B., BRACARENSE, A. P. F. L.; MEGID, J.; DIAS


JUNIOR, R. F. Observaes clnicas e laboratoriais em ces com cinomose
nervosa. Cincia Rural, n. 27, p. 229-235, 1997.

VANDEVELDE, M.; CACHIN, M. The neurologic form of canine distemper. IN


Current Veterinary Therapy Xl Small Animal Practice, Saudeers,1993.

66

APNDICES
Apndice A. Identificao dos animais, vacinao, idade (meses ou anos),
raa, sexo, presena ou no de contactantes sintomticos- So
Paulo- Brasil- 2007
Vacinao1

ID
1
2
3

Nsi
No
Nsi

4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34

110m
Incorreta
Incorreta
Nsi
Incorreta
Nsi
Incorreta
Incorreta
<3a
6m
Nsi
No
No
Incorreta
<h 1,5
Incorreta
no esquema
Incorreto
1,5
17m
No
No
No
Incorreta
4m
No
Nsi
Incorreta
Nsi
No
No

Idade2
2a
5a
7m
5a
3m
2,5m
ind
1,5a
ind
12m
12m
7a
3a
ind
6a
4a
5a
7a
11a
4m
15m
6a
>2a
11m
4a
5a
1,7a
3,5a
4a
2a
13a
3a
2a
4a

Raa3

Sexo4 Contactante
sintomtico
Cocker Spaniel
M
no
SRD
F
no
Husky
F
sim
Siberiano
Poodle
F
sim
Poodle
M
sim
Pinscher
F
no
Pequins
M
no
Beagle
M
no
SRD
F
no
Labrador
F
no
Fila Brasileiro
M
sim
SRD
F
no
SRD
M
no
SRD
M
no
Poodle
F
no
SRD
F
no
Bull Terrier
F
no
Cocker Spaniel
F
no
Dachshund
F
no
SRD
M
no
Labrador
F
no
SRD
M
sim
SRD
F
no
SRD
F
no
Poodle
F
no
SRD
M
no
Dachshund
M
no
Poodle
F
no
Fila Brasileiro
F
sim
Poodle
M
no
SRD
F
no
SRD
M
no
Cocker Spaniel
F
sim
Poodle
M
sim
Continua

67

35
36
37
38
39
40
41
42
43

Nsi
No
No
No
No
Nsi
No
Nsi
incorreta

1a
5a
2a
4a
2m
ind
2a
2a
9a

Bull Terrier
Poodle
Poodle
SRD
SRD
SRD
SRD
SRD
Cocker Spaniel

M
M
F
M
F
F
F
M
F

Concluso
Contactante
sintomtico
No
Sim
Sim
No
No
No
No
No
No

44

Nsi

<4m

SRD

Ind

45

incorreta (h 24d)

6m

No

46

incorreta (h 27 d)

9m

Golden
Retrivier
SRD

No

47

8m

SRD

No

48

durante esquema
(h 25d)
incorreta (h 8 d)

3m

Schnauzer

No

49

incorreta (h 12d)

5m

Poodle

Sim

50

incorreta

7m

Boxer

No

ID

Vacinao

Idade

Raa

Sexo

1: a, anos; nsi, perodo superior a 2 meses da ltima vacina, mas proprietrios no souberam informar data
2: ind, informao no disponvel; a, anos; m, meses; no, vacinao inadequada
3: SRD, sem raa definica
4: F, fmea, M, macho

68

Apndice B

Identificao dos animais, outras alteraes sistmicas


extraneurais (respiratrios, digestivos ou oculares) menos
freqentes observadas anteriormente (no perodo mximo de
dois meses) e no momento das coletas dos espcimes clnicos
-So Paulo- Brasil- 2007

ID

Alteraes
respiratrias, Alteraes respiratrias, digestivas
digestivas
ou
oculares ou oculares
anamnese ou melhora 3

secreo nasal purulenta, secreo


ocular mucosa
secreo ocular mucosa*
diarria, mese, secreo ocular
mucosa
secreo ocular mucosa

2
3

secreo nasal purulenta


-

4
5
6
7
8
9

emese*
secreo
nasal
purulenta,
mese,
diarria, secreo
ocular purulenta*
dispnia
secreo ocular mucosa

10
11

12
13
14
15
16
17
18

secreo ocular mucosa


diarria, dispnia, secreo nasal
purulenta, secreo ocular purulenta
mese, secreo nasal serosa, tosse,
secreo ocular mucosa
esternutao
emese,
secreo
ocular secreo nasal serosa*
purulenta, tosse, esternutao,
secreo nasal purulenta *
diarria
emese*
tosse,
secreo
ocular purulenta *
Continua

69

ID
19
20
21
22
23
24
25
26

Alteraes
respiratrias,
digestivas
ou
oculares
anamnese ou melhora 3
secreo
ocular
purulenta,
esternutao
melena*
mese,
purulenta,
purulenta*
-

secreo
secreo

Continuao
Alteraes respiratrias, digestivas
ou oculares
secreo nasal purulenta

secreo nasal serosa,


ocular mucosa
secreo ocular mucosa
nasal ocular

secreo

29

secreo
nasal
purulenta,
esternutao,
diarria,
melena,
secreo ocular purulenta
hematoquesia, secreo ocular purulenta*
melena
diarria, secreo ocular mucosa,

30
31

mese, melena

27
28

32
33
34
35
36
37
38
39
40
41

secreo ocular mucosa


secreo
nasal
purulenta,
esternutao
secreo nasal purulenta, tosse, esternutao, melena, secreo
ocular purulenta *
hematoquesia
secreo ocular purulenta
mese, secreo ocular purulenta
secreo ocular purulenta
tosse*
tosse, secreo ocular mucosa*
mese, diarria, secreo nasal
serosa, esternutao, secreo ocular
purulenta
diarria
secreo
nasal
purulenta,
esternutao,
secreo
ocular
purulenta
secreo ocular mucosa
Continua

70

Concluso
ID

45

Alteraes
respiratrias, Alteraes respiratrias, digestivas
digestivas
ou
oculares ou oculares
anamnese ou melhora 3
secreo nasal purulenta, tosse,
secreo ocular purulenta
esternutao,
secreo
ocular
purulenta
secreo nasal purulenta, secreo
ocular purulenta
secreo ocular mucosa

46

esclera congesta

47

48

diarria

mese, secreo nasal serosa

49

diarria, secreo ocular purulenta

50

tosse

diarria

42
43
44

*, alteraes foram observadas anteriormente (no perodo mximo de dois meses), mas no estavam presentes no
momento da coleta das amostras biolgicas.

71
Apndice C

ID
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29

Identificao
dos
animais,
sintomas
neurolgicos
observados ou relatados e evoluo clnica- So PauloBrasil- 2007

Alteraes neurolgicas , evoluo


mioclonia, vocalizao, tetraparesia, eutanasiado
paraparesia, alterao de latido*, recuperao total
convulso, vocalizao-eutanasiada
inclinao de cabea, convulso, nistagmo, estrabismo, vocalizao,
eutanasiado
tetraparesia, nistagmo, bito
tremor de inteno, hipermetria, estrabismo, nistagmo, estupor,
eutanasiado
mioclonia, tetraparesia
mioclonia*, inclinao cabea*, andar compulsivo*, tetraplegia,
estrabismo* nistagmo, atrofia msculos mastigatrios, vocalizao,
estupor, eutanasiado
mioclonia, convulso, tremor de inteno,
andar compulsivo,
estupor, eutanasiado
mioclonia, convulso, eutanasiado
mioclonia, convulso, nistagmo, estupor, bito
mioclonia, tetraparesia, vocalizao, eutanasiada
tetraparesia*, inclinao de cabea, recuperao total
mioclonia, ataxia, eutanasiado
ataxia *, convulso, recuperao total
tetraparesia, eutanasiado
claudicao, atrofia msculos mastigatrios, paralisia facial,
megaesfago, ataxia, bito
inclinao de cabea*, cegueira, midrase, melhora parcial
mioclonia, tetraparesia, vocalizao, eutanasiado
mioclonia, tetraparesia, pleurtomo, estupor, bito
mioclonia*, ataxia*, tremor de inteno*, recuperao total
mioclonia, tremor de inteno, vocalizao, hipermetria/tetraparesia,
bito
tetraparesia*/paraparesia*,
tremor
de
inteno,
convulso,
vocalizao, nistagmo*, recuperao total
mioclonia, ataxia, alterao latido, eutanasiado
ataxia*, recuperao total
mioclonia, anisocoria, tetraparesia, nistagmo, vocalizao, bito
andar compulsivo, estupor, eutanasiado
mioclonia, tetraparesia, alterao de latido, bito
mioclonia, bito
Continua

72

35
36
37
38
39
40
41
42
43

Concluso
Alteraes neurolgicas , evoluo
mioclonia, vocalizao, bito
convulso, eutanasiado
mioclonia, convulso, tetraparesia, eutanasiado
mioclonia, vocalizao, ataxia, bito
inclinao de cabea, convulso, vocalizao, estrabismo,
pleurtomo, nistagmo, estupor, eutanasiado
mioclonia, melhora parcial
vocalizao, tetraparesia, nistagmo, convulso, estupor, eutanasiado
mioclonia, tremor de inteno, tetraparesia, vocalizao, bito
tremores*, recuperao total
tremor de inteno, ataxia, bito
mioclonia, tremor de inteno, tetraparesia, opsttomo, eutanasiado
mioclonia, claudicao, nistagmo, tetraparesia, eutanasiado
mioclonia, convulso, nistagmo, tetraparesia, eutanasiado
convulso, paraparesia, eutanasiado

44

ataxia, eutanasiado

45

convulso, vocalizao, tetraparesia, eutanasiado

46

paraparesia/tetraparesia, mioclonia, eutanasiado

47

mioclonia*, melhora parcial

48

convulso, eutanasiado

49

mioclonia, vocalizao, convulso, bito

50

tetraplegia, mioclonia, convulso tipo goma de mascar, atrofia


msculos mastigatrios, estupor, eutanasiado

ID
30
31
32
33
34

*, alteraes foram observadas anteriormente (no perodo mximo de dois meses), mas no estavam presentes no
momento da coleta das amostras biolgicas.