Food Control 60 (2016) 263e268

Contents lists available at ScienceDirect

Food Control
journal homepage: www.elsevier.com/locate/foodcont

Prevalence and antimicrobial susceptibility of Vibrio parahaemolyticus

isolated from retail shellsh in Shanghai
Qianqian Yu a, Mengya Niu a, Mengquan Yu a, Yanhong Liu b, Dapeng Wang a, **,
Xianming Shi a, *
a

MOST-USDA Joint Research Center for Food Safety, School of Agriculture and Biology, and State Key Laboratory of Microbial Metabolism, Shanghai Jiao
Tong University, Shanghai 200240, PR China
Molecular Characterization of Foodborne Pathogens Research Unit, ERRC-ARS-USDA, 600 East Mermaid Lane, Wyndmoor, PA 19038, USA

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 4 May 2015
Received in revised form
1 August 2015
Accepted 4 August 2015
Available online 7 August 2015

Vibrio parahaemolyticus is a marine and estuarine bacterium that poses the greatest threat to human
health worldwide. It has been the leading bacterial cause of seafood-borne illness. This study investigated the prevalence and drug resistance of V. parahaemolyticus isolated from retail shellsh in Shanghai.
A total of 140 shellsh samples were collected from February 2014 to February 2015. The occurrence of
V. parahaemolyticus in shellsh was 34.3%, which has increased compared to previous reports. In addition, discernible differences of total presumptive V. parahaemolyticus counts (TPVPC) were also observed
in shellsh between market A and B. The results from PCR assays indicated that thermostable direct
hemolysin (tdh) gene was positive in two isolates (2.1%), and the thermostable direct hemolysin-related
hemolysin (trh) gene was not detected in all isolates. Antibiotic resistance proles of those isolates were
as follows: ampicillin (87.5%), cephazolin (31.3%), cephalothin (6.3%), amoxicillin/clavulanic acid (6.3%),
piperacillin (6.3%), and amikacin (3.2%). Thirty-three out of 96 isolates were resistant to two or more
antimicrobial agents. It is suggested that V. parahaemolyticus in retail shellsh could be a potential risk to
consumers in Shanghai.
2015 Published by Elsevier Ltd.

Keywords:
Vibrio parahaemolyticus
Antimicrobial resistance
Shellsh
Total presumptive Vibrio parahaemolyticus
counts

1. Introduction
Seafood is recognized as a nutritious food choice, and is liked by
increasing numbers of consumers worldwide (Hellberg, DeWitt, &
Morrissey, 2012). For the last two decades, there has been a fourfold growth in commercial aquaculture worldwide (Cabello,
2006). However, the main obstacles in the consumption of seafood are their high perishability and health risk due to contamination by pathogens (Reyhanath & Kutty, 2014). Vibrio
parahaemolyticus is a halophilic bacterium, which is ubiquitous in
marine and coastal environments. Some V. parahaemolyticus strains
are pathogenic to human, and responsible for most seafood-related
human illness (Yano et al., 2014). Potentially virulent
V. parahaemolyticus strains are usually differentiated from avirulent
strains by the presence of thermostable direct hemoylsin (tdh) and/
or thermostable direct hemolysin-related hemolysin (trh) genes

* Corresponding author.
** Corresponding author.
E-mail addresses: norovirus@163.com (D. Wang), xmshi@sjtu.edu.cn (X. Shi).
http://dx.doi.org/10.1016/j.foodcont.2015.08.005
0956-7135/ 2015 Published by Elsevier Ltd.

(Bej et al., 1999). According to the ofcial surveillance system of

China, V. parahaemolyticus is the leading cause of foodborne bacterial poisoning in China (Liu, Chen, Guo, & Wang, 2008). This
bacterium is frequently isolated from a variety of raw seafood,
particularly in shellsh (Su & Liu, 2007). Consumption of raw or
undercooked
seafood
contaminated
with
pathogenic
V. parahaemolyticus may lead to acute gastroenteritis (Su & Liu,
2007). Although only a portion of V. parahaemolyticus strains is
pathogenic for humans, the time-temperature abuse in markets
provides ample scope for these strains to multiply to dangerous
levels (Sudha, Divya, Francis, & Hatha, 2012). After harvest,
V. parahaemolyticus showed an average of 790-fold increase in live
oysters when they were kept at 26
C for 24 h during April to
December (Gooch, DePaola, Bowers, & Marshall, 2002). Therefore,
failure to immediately maintain the temperature of freshly harvested shellsh at sufciently low level will ensure that
V. parahaemolyticus population easily surpass the FDA recommended maximum level of 1.0  104 organisms/mL, leading to
V. parahaemolyticus infection associated with raw shellsh consumption (FDA, 2001; Yeung & Boor, 2004).

264

Q. Yu et al. / Food Control 60 (2016) 263e268

Large-scale aquaculture is characterized by intensive cultivation

methods with high stocking density that leads to poor hygienic
conditions (Diana et al., 2013). As a consequence, the incidence of
foodborne outbreaks caused by bacterial infection is increasing in
shellsh (Wang, Duan, Zhang, & Li, 2007). Antibiotics are largely
used for therapeutic and prophylactic purposes on aquaculture
(Hirsch, Ternes, Haberer, & Kratz, 1999; Jerbi, Ouanes, Besbes,
Achour, & Kacem, 2011). The widely use of antibiotics has helped
selection for resistant bacterial strains, and increased antibiotic
resistance among the environmental bacteria, including potentially
~ a, 2001).
pathogenic Vibrio species (Tendencia & de la Pen
Antibiotic-resistant bacteria may represent a potential threat to
human health due to direct transmission through the food chain
(Dur
aN & Marshall, 2005) or by transferring the antimicrobial
resistance genes to human pathogens by mobile genetic elements
(Guglielmetti, Korhonen, Heikkinen, Morelli, & Von Wright, 2009;
Serrano, 2005).
As one of the major pathogens in seafood, V. parahaemolyticus
has been reported to be resistant to a number of antibiotics
including ampicillin, ciprooxacin, cephazolin, streptomycin,
cefuroxime sodium (Al-Othrubi, Kqueen, Mirhosseini, Hadi, &
Radu, 2014; Jiang et al., 2014; Yano et al., 2014). Notably, some
isolates even have resistant to chloramphenicol which has been
banned for many years (Jiang et al., 2014; Wong, Liu, Wan, & Chen,
2012). Due to their detrimental effects on the environment, quinolones have been totally restricted in aquaculture in industrialized
countries (Cabello, 2004; Gorbach, 2001; Srum, 2006). However,
the use of quinolones and many other antibiotics remains unrestricted in aquaculture in countries with growing aquaculture industries such as China and Chile (Cabello, 2004; Jacoby, 2005).
Shanghai is one of the largest import cities in China with overwhelming amounts of shellsh transported from other cities or
countries. The prevalence of foodborne V. parahaemolyticus is more
diverse and complex according to our previous reports (Chen et al.,
2012; Dai, Wang, Chen, & Shi, 2013). To our knowledge, there has
been little research focus on the comprehensive reports of the
isolation, identication, enumeration of V. parahaemolyticus, and
analysis the antibiotic resistant patterns of these isolates in
Shanghai. In this context, it is critical to gain a better understanding
of the contamination and antimicrobial susceptibility patterns of
V. parahaemolyticus isolated from local markets in Shanghai.
Therefore, we made an attempt to isolate, identify and enumerate
V. parahaemolyticus from various shellsh in local markets in
Shanghai and to analyze the antibiotic resistant patterns of those
isolates. These data can serve as a benchmark to monitor the
prevalence and antimicrobial susceptibility of V. parahaemolyticus,
and provide insight for the use of antibiotics in clinical treatments.
2. Materials and methods
2.1. Sample collection and processing
In this study, 140 shellsh samples were collected between
February 2014 and February 2015 in retail market A and B, whose
seafood are both from the biggest aquatic wholesale market in
Shanghai. The samples include clam (Meretrix meretrix; N 43),
oyster (Crassostrea ariakensis; N 38), razor clam (Sinonovacula
constricta; N 35), and scallop (Chlamys nobilis; N 24). Before
being sold, these shellsh were stored in ice box. After collection, all
samples were placed on ice, immediately shipped to our laboratory,
and processed under sterile conditions within 3 h. Each sample
(25.0 g) was homogenized with 225 mL alkaline peptone water
(APW; Land Bridge Technology, Beijing, China) containing 3% (w/v)
NaCl in a sterile polythene bag (Whirl-Park, Nasco, Shenzhen,
China), and samples were blended in a homogenizer (AES

Chemunex, France) at 12,000 rpm for 3 min.

2.2. Direct plate counts
After 10-fold dilution to a proper concentration with sterile
physiological saline, samples (100 mL) were plated in triplicate onto
Thiosulphate citrate bilesalt sucrose (TCBS) Agar plates (Land
Bridge Technology, Beijing, China) and incubated at 37
C for 24 h to
obtain the total presumptive V. parahaemolyticus counts (TPVPC).
Simultaneously, samples (100 mL) were plated in triplicate onto
LuriaeBertani (LB) plates to obtain the total viable bacterial
numbers. To explore the distribution of V. parahaemolyticus in
different oyster tissues, oyster samples were divided into three
parts according to our previous reports: the gills (G), digestive
glands (D; including stomach, and digestive diverticula) and residual tissues (O) (Wang, Yu, Chen, Zhang, & Shi, 2010; Wang,
Zhang, Chen, Yu, & Shi, 2010; Wang, Zhang, Cui, & Shi, 2014). The
three parts of oyster samples were enumerated separately. After
direct plate counts, samples were stored at 80
C until further use.
2.3. Bacterial isolation and identication
Three to ve typical colonies (green or bluish green color with
dark blue or green centers measuring about 3e5 mm) were
selected from TCBS plate (Land Bridge Technology, Beijing, China),
and streaked onto CHROMagar Vibrio chromogenic medium
(CHROMagar Microbiology, Pairs, France) agar. The potential
V. parahaemolyticus isolates were stored in LB liquid medium containing 3% (w/v) NaCl with 20% (nal concentration) sterile glycerol
at 80
C for further study.
Commercial biochemical identication kit DBI-08 for
V. parahaemolyticus detection (Land Bridge Technology,
Beijing, China) and polymerase chain reaction (PCR) assays were
used to identify the potential V. parahaemolyticus strains. The
biochemical tests were performed according to the manufacturer's
instructions. Species-specic gene (irgB) was used to identify
V. parahaemolyticus strains according to our previous report (Yu
et al., 2010). To determine the correlation of resistance with indicators of virulence, all isolates were screened for the thermostable direct hemolysin (tdh) and the thermostable direct
hemolysin-related hemolysin (trh) genes. All primers shown in
Table 1 were synthesized by Shanghai Sangon Biotech, China. The
detail PCR reaction mixtures and amplication conditions were as
described in the references listed in Table 1.
Total genomic DNA was extracted using the boiling method
(Scarano et al., 2014). Briey, 1 mL of broth culture (OD600 about
0.5) was centrifuged at 6000  g for 5 min and the pellets were
resuspended in 500 mL of sterile water. Samples were boiled for
10 min and centrifuged again at 6000  g for 5 min. Two hundred
mL of the supernatant were stored at 20
C for further analysis.
2.4. Antimicrobial susceptibility test
Antimicrobial susceptibility was performed by the disc diffusion
Table 1
Primers used in this study.
Target Sequence of Primers (50 e30 )
gene

Source

irgB(F)
irgB(R)
tdh(F)
tdh(R)
trh(F)
trh(R)

(Yu et al., 2010)

CGATACACACCACGATCCAG
ATACGGCCGGGGTGATGTTTCT
TCCCTTTTCCTGCCCCC
CGCTGCCATTGTATAGTCTTTATC
TTGGCTTCGATATTTTCAGTATCT
CATAACAAACATATGCCCATTTCCG

(Nordstrom, Vickery, Blackstone,

Murray, & DePaola, 2007)
(Bej et al., 1999)

Q. Yu et al. / Food Control 60 (2016) 263e268

method on Mueller-Hinton Agar (Land Bridge Technology, Beijing,

China) supplemented with 0.85% (w/v) NaCl using antimicrobial
discs (Oxoid Ltd., Basingstoke, UK) according to the instructions of
Clinical and Laboratory Standards Institute (CLSI, 2012; Jiang et al.,
2014).
Isolates were grown overnight in LB liquid medium containing
3% (w/v) NaCl and adjusted to 0.5 McFarland using sterile physiological saline, swabbed onto the Mueller-Hinton medium, and
incubated at 37
C for 18 h. A total of 18 antibiotic discs including
ampicillin (AMP-10 mg), piperacillin (PRL-100 mg), amoxicillin/
clavulanic acid (AMC-30 mg), piperacillin tazobactam (TZP110 mg), cephazolin (KZ-30 mg), cephalothin (KF-30 mg), cefotaxime (CTX-30 mg), ceftazidime (CAZ-30 mg), imipenem (IPM-10 mg),
aztreonam (ATM-30 mg), gentamycin (CN-10 mg), amikacin (AK30 mg), tetracycline (TE-30 mg), ciprooxacin (CIP-5 mg), noroxacin (NOR-10 mg), nalidixic acid (NA-30 mg), sulphamethoxazole/trimethoprim (SXT-25 mg) and chloramphenicol (C-30 mg)
were used. Escherichia coli ATCC 25922 was used as the quality
control strain.
After incubation, the zone of inhibition was measured and
compared with zone diameter interpretative chart to determine the
sensitivity of the isolates to the antibiotics. The multiple antibiotic
resistance (MAR) index was determined by taking the ratio between the number of antibiotics to which the organism was resistant and the total number of antibiotics used (Devi, Surendran, &
Chakraborty, 2009). Antibiotic sensitivity tests were performed in
triplicate for each isolate.

265

3.2. Bacterial counting

To evaluate the V. parahaemolyticus contamination in retail
oysters, local market A and B in Shanghai were monitored.
V. parahaemolyticus was detected in the gills, digestive glands and
residual tissues of oysters. Simultaneously, to evaluate the correlation between total viable bacterial numbers of shellsh and season (water temperature), the total viable bacterial numbers were
also recorded in the oysters from market A. The results are shown in
Figs. 1 and 2. Results showed that the maximum TPVPC occurs in
summer. The maximum TPVPC was 5.9  104 cfu/mL and
8.5  104 cfu/mL in market A (in June) and market B (in August),
respectively. In market A, the results indicated that TPVPC in tissue
O (oyster residual tissues) and tissue D (digestive glands) were
signicantly different (p < 0.05). The TPVPC in tissue O and G (gills)
were signicantly different (p < 0.01). In market B, the results
indicated that TPVPC in tissue O and D were not signicantly
different (p > 0.05). However, TPVPC in tissue O and G were
signicantly different (p < 0.05). The results (Fig. 2) indicated that
in market A the total viable bacterial numbers between O and D
were extremely signicant different (p < 0.01). The total viable
bacterial numbers between O and G were also signicantly

2.5. Statistical analysis

The experimental data were analyzed using SPSS software
version 19.0. Descriptive statistics were used to compare the
isolation rate of V. parahaemolyticus among different shellsh, as
well as TPVPC and total bacterial numbers in different tissues of
oyster. The signicance level was set at p-value of <0.05 or <0.01.
3. Results
3.1. Prevalence and identication of V. parahaemolyticus
Ninety-six V. parahaemolyticus isolates were isolated from 140
shellsh samples collected from Shanghai aquatic retail markets.
The isolates from 48 samples were conrmed as positive based on
the standard biochemical tests and species-specic PCR assays. The
isolation rate of V. parahaemolyticus in collected shellsh is shown
in Table 2. The positive rate of V. parahaemolyticus in shellsh was
34.3% (48/140). The positive rate of V. parahaemolyticus was 60.5%
(23/38) in oysters, 28.6% (10/35) in razor clams, 23.3% (10/43) in
clams, and 20.8% (5/24) in scallops. The positive rate in oysters was
signicantly higher than that in other shellsh (p < 0.01). In addition, the trh gene was not detected in all isolates, the tdh gene was
positive in only two isolates (2.1%). Besides, the TPVPC of the two
tdh positive V. parahaemolyticus in the oysters were 1.3  104 cfu/
mL and 2.8  103 cfu/mL, respectively.

Table 2
The isolation rate of Vibrio parahaemolyticus in collected shellsh.
Samples

Total number

Positive number

Positive rate

Oyster
Razor clam
Clam
Scallop

38
35
43
24

23
10
10
5

60.5%
28.6%
23.3%
20.8%

Fig. 1. TPVPC (total presumptive Vibrio parahaemolyticus counts) in different tissues (O,
D and G) of oyster from February 2014 to February 2015 in Shanghai local markets. (a)
Oysters were collected from market A. (b) Oysters were collected from market B. Note:
Oysters were collected in Shanghai local markets every two weeks except September
and November 2014. In the two months, oysters were only collected once.

266

Q. Yu et al. / Food Control 60 (2016) 263e268

4. Discussion

Fig. 2. Total bacterial number in different tissues (O, D and G) of oyster from retail
market A in Shanghai from February 2014 to February 2015. Note: Oysters were
collected in Shanghai local markets every two weeks except September and November
2014. In the two months, oysters were only collected once.

different (p < 0.01). In Figs. 1 and 2, there was a trend that either
TPVPC or total viable bacterial numbers were higher in summer
than in other seasons.
Besides oysters, the TPVPC in clam, razor clam and scallop were
also analyzed. In market A, the maximum TPVPC in clams was
3.3  103 cfu/mL, 1.3  103 cfu/mL in razor clams, and 5.8  102 cfu/
mL in scallops. In market B, the maximum TPVPC in clam was
5.0  103 cfu/mL, 2.5  104 cfu/mL in razor clams, and 7.9  102 cfu/
mL in scallop. The maximum TPVPC occurred in the summer or
autumn.
3.3. Antimicrobial resistance prole
In this study, 18 antimicrobials including penicillins, b-lactam
inhibitors, cephems, monobactams, penems, aminoglycosides,
quinolones, folate pathway inhibitors, phenicols and tetracyclines
were used for antimicrobial susceptibility testing. The results (Fig.
3) indicated that among 96 isolates tested, 87.5% of isolates
exhibited resistance to AMP. Fewer of the isolates were resistant to
KZ (31.3%), KF(6.3%), AMC(6.3%), PRL (6.3%) and AK (3.1%). Though
no drug resistance was shown, a large number of isolates exhibited
intermediate-resistance to ATM (40.6%). All isolates were sensitive
to CAZ, CN, NA, NOR, SXT, IPM and C.
The MAR index was determined by taking the ratio between the
number of antibiotic to which the organism was resistant and the
total number of antibiotics used (Devi et al., 2009). Thirty-four
percent of V. parahaemolyticus isolates demonstrated multiple
antimicrobial resistances to at least two antimicrobials. The MAR
indices were between 0.11 and 0.22 (Table 3). The maximum MAR
index attributed from isolates which exhibited resistance to four
antibiotics.

Table 3
Multiple antimicrobial resistance (MAR) index of Vibrio parahaemolyticus isolates.
Resistance pattern

Frequency of occurrence

MAR index

AMP,
AMP,
AMP,
AMP,
AMP,

21
3
3
4
2

0.11
0.17
0.17
0.22
0.22

KZ
KZ,
KZ,
KZ,
KZ,

PRL
AMC
AMC, PRL
AK, KF

Molluscan shellsh are lter feeders that lter large volumes of

seawater to obtain food. During the process of lter-feeding,
shellsh may also concentrate and retain human pathogens
derived from sewage contamination (Lees, 2000). Unfortunately,
little information on the contamination of V. parahaemolyticus
among shellsh in Chinese retail markets is available.
Shanghai is located in the Yangtze River estuary. The salinity of
seawater is too low to raise shellsh. Almost all shellsh sold in the
local markets were transported from other coastal provinces or
other countries (Wang et al., 2014). In this study, to evaluate the
contamination of Vibrio parahaemlyticus in retail shellsh, 140
samples were collected from retail market A and B. The
V. parahaemolyticus isolation rate in shellsh was 34.3%, which has
increased compared to previous reports (Chen, Shi, Zhou, Wang, &
Shi, in press). The positive rate of V. parahaemolyticus in oysters
(60.5%) was signicantly higher than that in any other shellsh
(p < 0.01). As molluscan shellsh are lter feeders, and oysters are
larger than other shellsh. It was reported that oysters need to lter
more seawater to feed themselves by sieving organic matter from
the surrounding water (Tian, Bates, Jensen, & Mandrell, 2006).
Hence, oysters may bio-accumulate more pathogenic organisms
from water. It may be the reason why the positive rate of
V. parahaemolyticus in oysters was higher than in other shellsh.
Vibrio parahaemolyticus is a foodborne pathogen with a worldwide distribution, but its densities in the environment and shellsh
vary depending on the season (water temperature), location,
sample type, and analytical methodology employed (DePaola,
Nordstrom, Bowers, Wells, & Cook, 2003; Martinez-Urtaza et al.,
2008; Zarei, Borujeni, Jamnejad, & Khezrzadeh, 2012). To investigate this situation, a 12-month study was performed based on the
retail shellsh from two local markets in Shanghai. The maximum
TPVPC in oysters were 5.9  104 cfu/mL and 8.5  104 cfu/mL in
market A and market B, respectively. The values were higher than
the FDA recommended maximum level of 1.0  104 organisms/mL
(FDA, 2001; ISSC, 1997), which may pose a potential threat to
consumers consuming raw or undercooked shellsh. As to the
TPVPC of clams, razor clams and scallops, the maximum TPVPC
occurred in the summer or autumn. Noteworthy, discernible differences of TPVPC were observed in shellsh between market A and
B. This discrepancy may derive from different sources, handing
methods or differences in storage temperature during capture to
the market. All these data can be used to estimate the exposure of
raw seafood consumers to V. parahaemolyticus. When the reference
values come to the TPVPC and total bacterial numbers, extreme or
moderate differences were observed among the three parts of
oyster tissues (O, D and G). Pathogenic microorganisms in the water
may be captured initially by the gills during feeding, and transferred to the digestive glands (Robertson, 2007; Wang et al., 2014).
Our results suggested that the gills or digestive glands can act as a
candidate tissue for V. parahaemolyticus detection in shellsh
(Wang, Yu, et al., 2010; Wang, Zhang, et al., 2010; Wang et al., 2014).
It has been reported that there is a strong correlation between
pathogenicity and the presence of either tdh gene or trh gene or
both of them (Miyamoto et al., 1969; Shirai et al., 1990; Takeda,
1982). All isolates were screened for the tdh and trh genes by PCR
in our study. Our results showed that trh gene was not detected in
all isolates, and that tdh gene was positive in only two isolates
(2.1%), which is consistent with former studies (Gopal et al., 2005;
Nishibuchi & Kaper, 1995). Notably, the two strains that carried the
tdh gene were isolated in June and August, respectively. It is suggested that higher environmental temperature increases the
probability of virulent strains being present in shellsh (RobertPillot et al., 2004). The TPVPC of the two tdh positive strains in

Q. Yu et al. / Food Control 60 (2016) 263e268

the samples were 1.3  104 cfu/mL and 2.8  103 cfu/mL, respectively. Such high levels of tdh positive bacteria in oysters may pose
great risks to human health.
The percentage of antibiotic resistant V. parahaemolyticus isolates from retail markets was analyzed (Fig. 3). The results showed
that 87.5% of the isolates were resistant to AMP. Resistance was also
observed in KZ, KF, AMC, PRL and AK. Our results were partially in
agreement with other studies performed in China (Jiang et al.,
2014), but were quite different when compared to the studies
abroad (Baker-Austin et al., 2008; Letchumanan, Yin, Lee, & Chan,
2015; Li et al., 1999). The discrepancy in the literature could be
due to the test methodology or geographic variation of samples
(Boinapally & Jiang, 2007; Jiang et al., 2014; Yano et al., 2014).
Surprisingly, V. parahaemolyticus showed resistance to the rst
generation cephalosporins (KZ 31.25% and KF 6.25%), but no resistance prole was detected among the V. parahaemolyticus isolates
toward the third generation cephalosporins (CTX and CAZ). This
suggests that in the past decades, the rst generation cephalosporins may be misused widely in the environment thus reducing
the susceptibility and efciency of them in treatment of
V. parahaemolyticus infection (Sudha, Mridula, Silvester, & Hatha,
2014). However, the accumulation of the third generation cephalosporins in the environment may take a longer time. Although no
drug resistance was shown, a large number of isolates exhibited
intermediate-resistance to ATM (40.63%), indicating potential
future risks. Hence, proper attention should be taken to reduce the
concerns. In this study, all isolates were highly sensitive to CAZ, CN,
NA, NOR, SXT, IPM and C, and somewhat less sensitive to TZP, CTX,
TE, AK, and CIP. Based on our ndings, these antibiotics could be
prescribed by doctors for the treatments of V. parahaemolyticus
infection.
Tanil et al. (2005) stated that MAR indices higher than 0.2 could
be due to contamination from high risk sources, thus leading to
human health risk. In our study, the isolates from retail shellsh
had different MAR indices with a range from 0.11 to 0.22 (Table 3).
The highest MAR index was attributed from isolates which
exhibited resistance to four antibiotics. Although in our study the
percentage of MAR indices higher than 0.2 is small (6.25%), it is still
worth monitoring the antimicrobial resistance which future studies
can be compared to determine whether susceptibilities varies over
time. It is imperative to study the multiple drug resistance of
V. parahaemolyticus to ensure future seafood quality from the region and also to identify effectiveness of new generation antibiotics

Fig. 3. Histogram of the 96 V. parahaemolyticus isolates resistant to 18 antibiotics. The

number indicates the percentage of resistant isolates for each antibiotic (that is, the
total percentage of strains showing a resistant and intermediate phenotype).

267

to control its pathogenicity. In addition, the two isolates harboring

the tdh gene were both resistant to two antimicrobials. Considering
our insufcient data, we can not draw the same conclusion as
previous study that there was no close correlation between antimicrobial resistance and pathogenicity (Jiang et al., 2014).
In conclusion, we present a comprehensive report about the
prevalence and antibiotic resistance prole of V. parahaemolyticus
isolated from retail shellsh in Shanghai for one year. The isolation
rate of V. parahaemolyticus in shellsh was 34.3%, which has
increased compared to previous studies. The virulence gene tdh
was found in two isolates (2.1%), which was in agreement with
former reports. Besides, the results showed that 87.5%
V. parahaemolyticus were resistant to AMP, and resistance was also
observed in KZ, KF, AMC, PRL and AK. Although the incidence of
V. parahaemolyticus from shellsh in Shanghai may not be in an
alarming situation, continued monitoring of the prevalence of
V. parahaemolyticus in retail markets and the antimicrobial susceptibility proles are still necessary to ensure shellsh safety.
Particularly, the retail surveys should be expanded to the national
level.
Conict interest
None declared.
Acknowledgments
This work was jointly supported by the grant No. 2012AA101601
from the Ministry of Science and Technology of China and the grant
No. 31000063 from the National Natural Science Foundation of
China.
References
Al-Othrubi, S. M., Kqueen, C. Y., Mirhosseini, H., Hadi, Y. A., & Radu, S. (2014).
Antibiotic resistance of Vibrio parahaemolyticus isolated from cockles and
shrimp sea food marketed in Selangor, Malaysia. Clinical Microbiology, 3,
148e154.
Baker-Austin, C., McArthur, J., Tuckeld, R. C., Najarro, M., Lindell, A. H., Gooch, J.,
et al. (2008). Antibiotic resistance in the shellsh pathogen Vibrio parahaemolyticus isolated from the coastal water and sediment of Georgia and
South Carolina, USA. Journal of Food Protection, 71(12), 2552e2558.
Bej, A. K., Patterson, D. P., Brasher, C. W., Vickery, M. C., Jones, D. D., & Kaysner, C. A.
(1999). Detection of total and hemolysin-producing Vibrio parahaemolyticus in
shellsh using multiplex PCR amplication of tl, tdh and trh. Journal of Microbiological Methods, 36(3), 215e225.
Boinapally, K., & Jiang, X. (2007). Comparing antibiotic resistance in commensal and
pathogenic bacteria isolated from wild-caught South Carolina shrimps vs. farmraised imported shrimps. Canadian Journal of Microbiology, 53(7), 919e924.
Cabello, F. (2004). Antibiotics and aquaculture in Chile: implications for human and
animal health. Revista medica de Chile, 132(8), 1001e1006.
Cabello, F. C. (2006). Heavy use of prophylactic antibiotics in aquaculture: a growing
problem for human and animal health and for the environment. Environmental
Microbiology, 8(7), 1137e1144.
Chen, Z. Y., Shi, C. L., Zhou, X. J., Wang, D. P., & Shi, X. M. (2015). The distribution of
V. parahaemolyticus in retail seafood in Shanghai. Journal of Chinese Institute of
Food Science and Technology (in Chinese; in press).
Chen, W. Y., Xie, Y. P., Xu, J. Y., Wang, Q. Z., Gu, M., Yang, J. L., et al. (2012). Molecular
typing of Vibrio parahaemolyticus isolates from the middle-east coastline of
China. International Journal of Food Microbiology, 153(3), 402e412.
Clinical and Laboratory Standards Institute (CLSI). (2012). Performance standards for
antimicrobial susceptibility testing; twenty-second informational supplement
M100-S22. Wayne, PA: NCCLS.
Dai, M., Wang, D. P., Chen, W. Y., & Shi, X. M. (2013). Serotyping for clinical Vibrio
parahaemolyticus and analysis of their virulence genes. Journal of Chinese
Institute of Food Science and Technology, 2, 159e164 (in Chinese).
DePaola, A., Nordstrom, J. L., Bowers, J. C., Wells, J. G., & Cook, D. W. (2003). Seasonal
abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters.
Applied and Environmental Microbiology, 69(3), 1521e1526.
Devi, R., Surendran, P., & Chakraborty, K. (2009). Antibiotic resistance and plasmid
proling of Vibrio parahaemolyticus isolated from shrimp farms along the
southwest coast of India. World Journal of Microbiology and Biotechnology,
25(11), 2005e2012.
Diana, J. S., Egna, H. S., Chopin, T., Peterson, M. S., Cao, L., Pomeroy, R., et al. (2013).

268

Q. Yu et al. / Food Control 60 (2016) 263e268

Responsible aquaculture in 2050: valuing local conditions and human innovations will be key to success. BioScience, 63(4), 255e262.
Dur
aN, G. M., & Marshall, D. L. (2005). Ready-to-eat shrimp as an international
vehicle of antibiotic-resistant bacteria. Journal of Food Protection, 68(11),
2395e2401.
FDA (Food and Drug Administration, USA). (2001). Draft risk assessment on the public
health impact of Vibrio parahaemolyticus in raw molluscan shellsh. URL www.
cfsan.fda.gov/dms/vprisk.html.
Gooch, J., DePaola, A., Bowers, J., & Marshall, D. (2002). Growth and survival of
Vibrio parahaemolyticus in postharvest American oysters. Journal of Food Protection, 65(6), 970e974.
Gopal, S., Otta, S. K., Kumar, S., Karunasagar, I., Nishibuchi, M., & Karunasagar, I.
(2005). The occurrence of Vibrio species in tropical shrimp culture environments; implications for food safety. International Journal of Food Microbiology,
102(2), 151e159.
Gorbach, S. L. (2001). Antimicrobial use in animal feedetime to stop. The New England Journal of Medicine, 345(16), 1202.
Guglielmetti, E., Korhonen, J. M., Heikkinen, J., Morelli, L., & Von Wright, A. (2009).
Transfer of plasmid-mediated resistance to tetracycline in pathogenic bacteria
from sh and aquaculture environments. FEMS Microbiology Letters, 293(1),
28e34.
Hellberg, R. S., DeWitt, C. A. M., & Morrissey, M. T. (2012). Risk-Benet analysis of
seafood consumption: a review. Comprehensive Reviews in Food Science and Food
Safety, 11(5), 490e517.
Hirsch, R., Ternes, T., Haberer, K., & Kratz, K.-L. (1999). Occurrence of antibiotics
in the aquatic environment. Science of the Total Environment, 225(1),
109e118.
Interstate Shellsh Sanitation Conference (ISSC). (1997). National shellsh Sanitation
Program Guide for the control of Molluscan shellsh. Washington, DC.
Jacoby, G. A. (2005). Mechanisms of resistance to quinolones. Clinical Infectious
Diseases, 41(Suppl. 2), S120eS126.
Jerbi, M. A., Ouanes, Z., Besbes, R., Achour, L., & Kacem, A. (2011). Single and combined genotoxic and cytotoxic effects of two xenobiotics widely used in
intensive aquaculture. Mutation Research/Genetic Toxicology and Environmental
Mutagenesis, 724(1), 22e27.
Jiang, Y. H., Yao, L., Li, F. L., Tan, Z. J., Zhai, Y. X., & Wang, L. Z. (2014). Characterization
of antimicrobial resistance of Vibrio parahaemolyticus from cultured sea cucumbers (Apostichopus japonicas). Letters in Applied Microbiology, 59(2),
147e154.
Lees, D. (2000). Viruses and bivalve shellsh. International Journal of Food Microbiology, 59(1), 81e116.
Letchumanan, V., Yin, W., Lee, L., & Chan, K. (2015). Prevalence and antimicrobial
susceptibility of Vibrio parahaemolyticus isolated from retail shrimps in
Malaysia. Frontiers in Microbiology, 6, 33.
Liu, X. M., Chen, Y., Guo, Y. C., & Wang, Z. T. (2008). Foodborne diseases outbreaks in
2005-report of national foodborne diseases surveillance network in China.
Chinese Journal of Food Hygiene, 6, 015.
Li, J., Yie, J., Foo, R. W., Ling, J. M., Xu, H., & Woo, N. Y. (1999). Antibiotic resistance
and plasmid proles of Vibrio isolates from cultured silver sea bream, Sparus
sarba. Marine Pollution Bulletin, 39(1), 245e249.
Martinez-Urtaza, J., Huapaya, B., Gavilan, R. G., Blanco-Abad, V., Ansede-Bermejo, J.,
Cadarso-Suarez, C., et al. (2008). Emergence of Asiatic vibrio diseases in South
~ o. Epidemiology, 19(6), 829e837.
America in phase with El Nin
Miyamoto, Y., Kato, T., Obara, Y., Akiyama, S., Takizawa, K., & Yamai, S. (1969).
In vitro hemolytic characteristic of Vibrio parahaemolyticus: its close correlation
with human pathogenicity. Journal of Bacteriology, 100(2), 1147.
Nishibuchi, M., & Kaper, J. B. (1995). Thermostable direct hemolysin gene of Vibrio
parahaemolyticus: a virulence gene acquired by a marine bacterium. Infection
and Immunity, 63(6), 2093.
Nordstrom, J. L., Vickery, M. C., Blackstone, G. M., Murray, S. L., & DePaola, A. (2007).
Development of a multiplex real-time PCR assay with an internal amplication
control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Applied and Environmental Microbiology, 73, 5840e5847.
Reyhanath, P. V., & Kutty, R. (2014). Incidence of multidrug resistant Vibrio parahaemolyticus isolated from Ponnani, South India. Iranian Journal of Microbiology,
6(2), 60e67.
nole
, A., Lesne, J., Delesmont, R., Fournier, J. M., & Quilici, M. L.
Robert-Pillot, A., Gue

(2004). Occurrence of the tdh and trh genes in Vibrio parahaemolyticus isolates
from waters and raw shellsh collected in two French coastal areas and from
seafood imported into France. International Journal of Food Microbiology, 91(3),
319e325.
Robertson, L. (2007). The potential for marine bivalve shellsh to act as transmission vehicles for outbreaks of protozoan infections in humans: a review.
International Journal of Food Microbiology, 120(3), 201e216.
Scarano, C., Spanu, C., Ziino, G., Pedonese, F., Dalmasso, A., Spanu, V., et al. (2014).
Antibiotic resistance of Vibrio species isolated from Sparus aurata reared in
Italian mariculture. The New Microbiologica, 37(3), 329e337.
Serrano, P. H. (2005). Responsible use of antibiotics in aquaculture. Fisheries Technical
Paper 469. Rome: Food and Agriculture Organization of the United Nations
(FAO).
Shirai, H., Ito, H., Hirayama, T., Nakamoto, Y., Nakabayashi, N., Kumagai, K., et al.
(1990). Molecular epidemiologic evidence for association of thermostable direct
hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with
gastroenteritis. Infection and Immunity, 58(11), 3568e3573.
Srum, H. (2006). Antimicrobial drug resistance in sh pathogens. Antimicrobial
Resistance in Bacteria of Animal Origin (pp. 213e238).
Sudha, S., Divya, P. S., Francis, B., & Hatha, A. (2012). Prevalence and distribution of
Vibrio parahaemolyticus in nsh from Cochin (south India). Veterinaria Italiana,
48, 269e281.
Sudha, S., Mridula, C., Silvester, R., & Hatha, A. (2014). Prevalence and antibiotic
resistance of pathogenic Vibrios in shellshes from Cochin market. Indian
Journal of Geo-Marine Sciences, 43, 815e824.
Su, Y. C., & Liu, C. (2007). Vibrio parahaemolyticus: a concern of seafood safety. Food
Microbiology, 24(6), 549e558.
Takeda, Y. (1982). Thermostable direct hemolysin of Vibrio parahaemolyticus.
Pharmacology & Therapeutics, 19(1), 123e146.
Tanil, G. B., Radu, S., Nishibuchi, M., Rahim, R. A., Napis, S., Maurice, L., et al. (2005).
Characterization of Vibrio parahaemolyticus isolated from coastal seawater in
peninsular Malaysia. Southeast Asian Journal of Tropical Medicine and Public
Health, 36(4), 940.
~ a, L. D. (2001). Antibiotic resistance of bacteria from
Tendencia, E. A., & de la Pen
shrimp ponds. Aquaculture, 195(3), 193e204.
Tian, P., Bates, A. H., Jensen, H. M., & Mandrell, R. (2006). Norovirus binds to blood
group A-like antigens in oyster gastrointestinal cells. Letters in Applied Microbiology, 43(6), 645e651.
Wang, S. J., Duan, H. L., Zhang, W., & Li, J. W. (2007). Analysis of bacterial foodborne
disease outbreaks in China between 1994 and 2005. FEMS Immunology &
Medical Microbiology, 51(1), 8e13.
Wang, D. P., Yu, S. J., Chen, W. Y., Zhang, D. D., & Shi, X. M. (2010). Enumeration of
Vibrio parahaemolyticus in oyster tissues following articial contamination and
depuration. Letters in Applied Microbiology, 51(1), 104e108.
Wang, D. P., Zhang, D. D., Chen, W. Y., Yu, S. J., & Shi, X. M. (2010). Retention of Vibrio
parahaemolyticus in oyster tissues after chlorine dioxide treatment. International Journal of Food Microbiology, 137(1), 76e80.
Wang, D. P., Zhang, Q., Cui, Y., & Shi, X. M. (2014). Seasonal dynamics and diversity of
bacteria in retail oyster tissues. International Journal of Food Microbiology, 173,
14e20.
Wong, M. H. Y., Liu, M., Wan, H. Y., & Chen, S. (2012). Characterization of extendedspectrum-b-lactamase-producing Vibrio parahaemolyticus. Antimicrobial Agents
and Chemotherapy, 56(7), 4026e4028.
Yano, Y., Hamano, K., Satomi, M., Tsutsui, I., Ban, M., & Aue-Umneoy, D. (2014).
Prevalence and antimicrobial susceptibility of Vibrio species related to food
safety isolated from shrimp cultured at inland ponds in Thailand. Food Control,
38, 30e36.
Yeung, P. M., & Boor, K. J. (2004). Epidemiology, pathogenesis, and prevention of
foodborne Vibrio parahaemolyticus infections. Foodborne Pathogens & Disease,
1(2), 74e88.
Yu, S. J., Chen, W. Y., Wang, D. P., He, X. H., Zhu, X. N., & Shi, X. M. (2010). Speciesspecic PCR detection of the food-borne pathogen Vibrio parahaemolyticus
using the irgB gene identied by comparative genomic analysis. FEMS Microbiology Letters, 307(1), 65e71.
Zarei, M., Borujeni, M. P., Jamnejad, A., & Khezrzadeh, M. (2012). Seasonal prevalence of Vibrio species in retail shrimps with an emphasis on Vibrio parahaemolyticus. Food Control, 25(1), 107e109.