Você está na página 1de 867

THE 21st INTERNATIONAL BIOHYDROMETALLURGY

SYMPOSIUM (IBS XXI) 2015

PROCEEDING

Editor

Dr. Mont. M. Zaki Mubarok, ST., MT.


Siti Khodijah Chaerun, Ph.D
Wahyudin Prawira Minwal, ST., MT.
Fadhli Muhammad, ST., MT.
Killang Pratama, ST., MT.

ii

21st IBS International


Scientific Committee
Edgardo Donati (CINDEFI (CONICET, UNLP) La Plata, Argentina)
Chris du Plessis (Metalobus Program Manager, AMIRA International, Australia)
Anna Kaksonen (CSIRO, Perth, Australia)
Elizabeth Watkin (Curtin University, Perth, Australia)
Helen Watling (CSIRO, Australia)
Marjorie Valix (University of Sydney, Australia)
Versiane AlbisLeo (Universidade Federal de Ouro Preto, Brazil)
Monica Teixeira (Universidade Federal de Ouro Preto, Brazil)
Stoyan Groudev (University of Mining and Geology, Sofia, Bulgaria)
Cecilia Demergasso (Universidad Catlica del Norte, Chile)
Nicolas Guiliani (Universidad de Chile, Chile)
Carlos Jerez (Universidad de Chile, Chile)
Tomas Vargas (Universidad de Chile, Chile)
David Holmes (Fundacin Ciencias para la Vida, Chile)
Jianshe Liu (Donghua University, China)
Xueduan Liu (Central South University, China)
Guanzhou Qiu (Central South University, China)
Hongxu Li (University of Science and Technology Beijing, China)
Chengying Jiang (Chinese Academy of Sciences, Beijing, China)
Jaakko Puhakka (Tampere University of Technology, Finland)
Violane Bonnefoy (Aix-Marseille Universit, France)
Eric Guibal (Ecole des Mines d'Als, France)
Dominique Morin (BRGM, France)
Sabine Willscher (Technische Universitt Dresden, Germany)
iii

Marios Tsezos (National Technical University of Athens, Greece)


M. Zaki Mubarok (Institut Teknologi Bandung, Indonesia)
Siti Khodijah Chaerun (Institut Teknologi Bandung, Indonesia)
K.A. Natarajan (Indian Institute of Science, India)
Tsuyoshi Sugio (Okayama University, Japan)
Keiko Sasaki (Kyushu University, Japan)
Naoko Okibe (Kyushu University, Japan)
Rosa Rivera-Santillan (Universidad Nacioinal Autnoma de Mxico, Mexico)
Mariekie Gericke (Mintek, South Africa)
Sue Harrison (University of Cape Town, South Africa)
Jochen Petersen (University of Cape Town, South Africa)
Jan van Niekerk (Biomin South Africa (Pty) Ltd, South Africa)
Douglas E. Rawlings (University of Stellenbosch, South Africa)
Ricardo Amils (Universidad Autnoma de Madrid, Spain)
Antonio Ballester (Universidad Complutense de Madrid, Spain)
Mark Dopson (Linnaeus University, Sweden)
D. Barrie Johnson (Bangor University, UK)
Lynne Macaskie (University of Birmingham, UK)
Henry L. Ehrlich (Rensselaer Polytechnic Institute, New York, USA)
Kwadwo Osseo-Asare (The Pennsylvania State University, USA)
Olli Tuovinen (The Ohio State University, USA)
Frank Roberto (Newmont Mining Corporation)
Wolfgang Sand (Universitat Duisburg-Essen, Germany)
Axel Schippers (BGR, Germany)

iv

21st IBS Local Organizing


Committee
M. Zaki Mubarok (ITB, as Chairman)
Siti Khodijah Chaerun (ITB, as Co-chairman)
Edy Sanwani (ITB)
Ismi Handayani (ITB)
Akhmad A. Korda (ITB)
Muhammad Hanafi (Association of Indonesian Mining Professional/PERHAPI)
Wahyudin Prawira Minwal
Fikri Irsyad
Dinni Nurhayani
Fadhli Muhammad
Nurulhuda Halim
Killang Pratama

Organized by,
Department of Metallurgical Engineering
Faculty of Mining and Petroleum Engineering
Institut Teknologi Bandung (FTTM-ITB)
Ganesha 10, Bandung 40132, Indonesia
www.metallurgy.itb.ac.id

vi

Honouring Henry L. Ehrlich

The IBS community would like to congratulate Professor Henry Lutz Ehrlich on his 90 th
birthday and recognize him for his many contributions to the field of Geomicrobiology.
Dr. Ehrlich was born in 1925 in Stettin, Germany which, after the war, became the town of
Szczecin in Poland. In 1940 he emigrated with his family to the United States, developing an
interest in microbiology as a high school student. Early recognition of his potential led to his
attending and majoring in Biochemical Sciences at Harvard College, where he graduated in
1948 with a BS. He later earned his MS degree at the University of Wisconsin in Madison,
where in 1951 he also completed his PhD in Agricultural Bacteriology with a minor in
Biochemistry. He then joined the faculty of the Department of Biology at Rensselaer
Polytechnic Institute (RPI) in Troy, New York where, until he retired in 1994, he taught and
conducted research on topics ranging from sulfide biooxidation, manganese oxidation and
reduction, chromium reduction and bauxite beneficiation.
Testifying to the interdisciplinary collaborations so critical to geomicrobiology, his initial
scientific research with Acidithiobacillus (then Ferrobacillus) ferrooxidans began in 1958 as
a discussion with a colleague from the Faculty of Geology. Thus, it was as an assistant
professor at Rensselaer that he was to begin pioneering work in geomicrobiology, when
column biooxidation experiments with pyrite, pyrrhotite and sphalerite were carried out in his
laboratory. In the early 1960s, he examined the association of acidophilic microbial
populations with sulfide minerals and then expanded his investigations to include copper
vii

leaching from chalcocite and chalcopyrite, as well as demonstrating by 1963 that orpiment
could be microbially oxidized and by 1964 that this was also true for enargite and
arsenopyrite. This led his lab to later investigate microbial arsenite oxidation. In 1986, he
described microbial leaching of silver from a mixed sulfide ore. His lab continued to
investigate selective silver leaching from manganese ore and mixed sulfides until 1988 and
1990, respectively.
Since the 1960s, he also did continuous research work on the microbial formation of
manganese nodules and ferromanganese concretions in the deep sea, as well as manganeseoxidizing bacteria from hydrothermal vents and biogeochemical cycling of manganese in
freshwater and marine environments. Requiring fresh nodule samples for growth dependent
studies, he was not content to remain in the lab but participated in four oceanographic
expeditions. Nodules were found to be associated with both manganese-oxidizing and
manganese-reducing populations. Manganese accretion was demonstrated to occur at
hydrostatic pressures related to the depth at which marine nodules were known to exist.
Oxidation was demonstrated for manganese sorbed to certain clays or manganese oxide. His
current model for oxidation of manganese sorbed on ferromanganese solids or certain clays is
consistent with a direct microbial role in their formation. Cell free-studies performed by his
group linked manganese oxidation to ATP production.
Beginning in 1977, he and a number of students examined aspects of microbial chromate
reduction.
Finally, in 1992, he began examining biogeochemical maturation of lateritic bauxitic ore
microbially augmented mobilization of silica and reduction and mobilization of ferric iron
associated with contaminating iron-bearing minerals. While the biobeneficiation was of great
practical interest, the study also revealed a new conceptual area of investigation - how iron
was being reduced and mobilized beneath the mineral surface.
In addition to his own research activities, Dr. Ehrlich worked on several fronts to expand
scientific knowledge. In 1966, he began teaching a course in geomicrobiology at Rensselaer.
He continued to teach the course until his retirement in 1994. In 1981 he published the first
edition of a textbook on this subject and this and later editions became standard literature for
scientists working in the fields of geomicrobiology and microbial leaching. Together with
some others, he initiated the very first International Symposium on Environmental
Biogeochemistry in 1971 and this has since continued biannually. From 1983 to 1997, Dr.
Ehrlich worked as editor-in-chief of Geomicrobiology Journal, then co-editor from 1997 to
2011 and now as an editor emeritus.
Its difficult to do justice to such a productive scientific career. In contrast, he himself truly
does justice to the word Scientist justice to the words Scholar and Teacher justice to
the word Mentor. And so, on this occasion, we wish to honour him as a revered member
of our large group of researchers from all over the world in the fields of geomicrobiology and
biohydrometallurgy.

viii

Table of Contents
21ST IBS INTERNATIONAL SCIENTIFIC COMMITTEE ...................................................................................... III
21ST IBS LOCAL ORGANIZING COMMITTEE ....................................................................................................... V
HONOURING HENRY L. EHRLICH ....................................................................................................................... VII
TABLE OF CONTENTS ............................................................................................................................................... IX
CHAPTER 1: FUNDAMENTAL & APPLICATION OF BIOLEACHING .............................................................. 1
Factors Affecting the Selection of BIOX as the Preferred Technology for the Treatment of a Refractory
Gold Concentrate .............................................................................................................................................................. 2
Base Metal Tank Bioleaching: From Laboratory Test Work to Commercialization ................................................. 9
Geobiotechnical Recovery of Metals from Manganese Nodules: First Experiments ............................................... 14
Saline Water Bioleaching with Thermophilic Fe(Ii) Oxidizing Microorganisms ...................................................... 19
Role of Microbial Activity in Bioleaching of a Pyritic and a Pure Chalcopyrite Concentrate ................................ 24
Oxygen-Enriched Gas in Bioleaching Stirred Reactors and Its Impact on The Consortium Behaviour................ 29
Organic Carbon Utilisation by Iron(II)-Oxidising Bacteria Sulfobacillus Thermosulfidooxidans and
Alicyclobacillus Strain FP1 that Inhabit Copper Sulfide Leaching Heaps ................................................................ 34
Effect of Different Solvent Extractants on the Activity and Community Structure of Acidophilic
Microorganisms .............................................................................................................................................................. 39
Ferrous Iron Oxidation in Packed-Bed Reactors at Elevated Temperatures ........................................................... 44
Microbially Supported Recovery of Precious Metals and Rare Earth Elements from Urban Household
Waste Incineration Slag ................................................................................................................................................. 49
Iron Oxidation and Jarosite Precipitation in a Continuous Two-Stage 70C Archaeal Bioreactor ........................ 53
Use of Phosphate Solubilizing Bacteria to Leach Rare Earth Elements from Monazite-Bearing Ore ................... 58
Optode-based Oxygen Measurements In Bioleaching Reactors ................................................................................. 63
Aspergillus Niger PSSG8 Mediated Bioleaching of Monazite for the Recovery of Rare Earth and Other
Metal Constituents .......................................................................................................................................................... 68
Bioleaching of Complex Refractory Gold Ore Concentrate of China: Comparison of Shake Flask and
Continuous Bioreactor ................................................................................................................................................... 73
Comparative Experiments on Acid Leaching and Bioleaching to a Sandstone Type Uranium Ore ....................... 78
Utilization of metabolic citric acid from Aspergillus niger using corn starch in the nickel leaching of
Indonesian saprolitic ore ................................................................................................................................................ 83

ix

Development of a Strategy for Selective Metal Recovery from Pregnant Leach Solutions of
Kupferschiefer Bioleaching............................................................................................................................................ 87
Interactions between Chalcopyrite and Marmatite during Bioleaching Process ...................................................... 92
Overcoming the Bacteriostatic Effects of Heavy Metals on A. Thiooxidans Direct Bioleaching of Saprolitic
Ni Laterite Ores .............................................................................................................................................................. 97
An In Situ Characterization for the Bioleaching Process of Natural Pyrite Using Electrochemical Noise
Technique ...................................................................................................................................................................... 103
Organic Acid Biogeneration by Aspergillus niger and Its Utilization for Indirect Bioleaching of Nickel
Laterite Ore ................................................................................................................................................................... 108
Influence of Carbonate Solubilisation on Copper Leaching From Kupferschiefer with Organic Acids .............. 114
Evolution of Leaching Products on the Surface of Chalcopyrite by Mesophiles and Thermophiles Based
on Sr-Xrd and Xanes Spectroscopy ............................................................................................................................ 119
Iron Oxidized Acidophiles Distribution and Activities in an Uranium In-Situ Bioleaching Site .......................... 124
Solution Ph and Jarosite Management during Ferrous Ion Biooxidation in A Novel Packed-Column
Bioreactor ...................................................................................................................................................................... 129
Metal Recovery and Exploitation of Lignite Ashes by Combined Physicochemical and Biotechnological
Approaches .................................................................................................................................................................... 134
Bioleaching of a Molybdenite Concentrate by Thermophilic Microorganisms in a New Relva-Rbal 1 Air
Lift Bio-Reactor ............................................................................................................................................................ 139
Physical Peeling of Passivating Layers on Chalcopyrite Leached with Ferric Ion Using Small Alumina
Balls................................................................................................................................................................................ 144
Utilisation of Inorganic Substrates by Alicyclobacillus-Like Strain FP1 ................................................................. 149
Systems Biology of Acidophile Biofilms for Efficient Metal Extraction .................................................................. 153
A Study of Permeability and Diffusion at The Agglomerate-Scale in Heap (Bio)Leaching Systems .................... 157
Bioreactor Process Optimization for Bioleaching of Fine-Grained Residues from Copper Smelting .................. 163
Microstructure Evolution of Ore Particles during Bioleaching Based on ............................................................... 168
Biooxidation of a Gold-Arsenic Sulphide Concentrate by a Two-Stage Oxidation Using Consecutively
Acidophilic and Neutrophilic Bacteria ....................................................................................................................... 173
Blue-Copper Proteins: Expression of Coding Genes from Sulfobacillus Spp. and Iron Oxidation in
Column Bioleaching Tests ............................................................................................................................................ 178
Bioleaching of Chalcopyrite by Thermophilic Archaea ............................................................................................ 184
Comparative Study of Iron and Sulfur Speciation Transformation of Pyrite and Marcasite by Extreme
thermophilic Archaea Acidianus manzaensis ............................................................................................................. 189
Natural Organic Matter Affects the Treatment of Mine Tailings through Bioleaching Processes ....................... 194
Acid Leaching of Cu and Zn from a Smelter Slag ..................................................................................................... 200

Reductive Dissolution of Iron Oxides and Manganese Bioleaching by Acidiphilium Cryptum JF-5...................... 205
Reductive Dissolution of Ferric Iron in Laterite Overburden using Acidithiobacillus Spp. and
Neutrophilic Iron-Reducing Consortia ....................................................................................................................... 210
Primary Copper Ore Leaching by Leaching Solution Adjusted Oxidation-Reduction Potential in Column ...... 215
Bioprocess for Leaching of Copper Concentrate ....................................................................................................... 220
Bioleaching of Orpiment (As2S3) in Absence of Fe3+.................................................................................................. 225
Insights into the Active Carbon Fixation Pathways of a Microbial Community in a Chalcopyrite
Bioleaching Column ..................................................................................................................................................... 229
Study on Bioleaching of Sulfur in Iron Ore by Mixed Culture ................................................................................ 235
Effect of Particle Size on the Column Bioleaching of Tibet Yulong Copper Ore ................................................... 240
Study on the Gold Recovery of Double Refractory Gold Ore Concentrate by Biological Oxidation
Pretreatment ................................................................................................................................................................. 244
Sp ectro s co p ic a n d M ic ro sco p ic I nv e stig a t io n fo r B io hy d ro me ta l l urg y ......................................... 249
Influence of Biological and Environmental Factors on Leaching Efficiency during Chalcopyrite
Bioleaching Process ...................................................................................................................................................... 254
Indium Extraction from Reiche Zeche Sphalerite and Community Analysis of Acidic Mine Water .................... 260
Chalcopyrite Bioleaching at High Sulfate Concentrations ....................................................................................... 265
The Relationship between Metabolic Pathways of Bacteria and Pyrrhotite Bioleaching Behavior ...................... 270
Enhanced Column Bioleaching of Copper Sulfides by Forced Aeration ................................................................. 275
Fluoride Toxicity in Bioleaching of Fluorapatite ....................................................................................................... 282
Roles of Oligotrophic Acidophiles (Alicyclobacillus) in Chalcopyrite Bioleaching System: Shake Flask
Evaluation ..................................................................................................................................................................... 287
Bioleaching of Aluminum Slags with Thermophilic Bacteria ................................................................................... 292
Bioleaching of Copper Sulphide Ore by A Microbial Consortium Isolated From Acid Mine Drainage:
Influence of [Fe2+] ......................................................................................................................................................... 297
Bioleaching vs. Chloride leaching: Real Advantages and Drawbacks for Primary Sulfides ................................. 302
Biotechnological Recovery of Valuable Metals from Lignite Ash ............................................................................ 307
The Microbial Ecology of Moderately Thermophilic Mineral Leaching Reactors: The Effect of Solids
Loading and Organic Carbon Supplementation on Reactor Performance ............................................................. 312
Different Leaching Efficiency and Microbial Community Structure Variation in Chalcopyrite
Bioleaching Process Based on Different Initial Microbe Proportions ...................................................................... 317
Enhance Column Bioleaching of Uranium Embedded In Brannerite by A Mesophilic Acidophilic Bacteria ..... 324

xi

Biooxidation of Carbonaceous Refractory Gold Ores by an Iron-Sulfur-Oxidizing Mixotrophic Bacterium


at Neutral pH ................................................................................................................................................................ 329
Gold Biodissolution from Electronic Scrap and Biomineralization of Bacterial Gold Nanoparticles ................. 335
Process Parameter Study of Ferric Production in An Immobilization Bioreactor ................................................. 342
Reductive Leaching of Jarosites by Shewanella Putrefaciens. Influence of Humic Substances and
Chelators in Mineral Dissolution................................................................................................................................. 348
Additions of Pyrite or Chalcopyrite Alters the Microbial Community Diversity, Composition and
Function in Sphalerite Bioleaching Systems............................................................................................................... 353
Column Bioleaching of Refractory Gold Ores ........................................................................................................... 359
Differential Surface Properties and Iron Distribution of Acidianus manzaensis YN25 Grown on Four
Different Energy Substrates ........................................................................................................................................ 363
Novel Filamentous Fungi for Metal Removal from Spent Catalyst ......................................................................... 368
Study of Microorganism Trench-Leaching of a Chinese High Fluorine-Bearing Uranium Ore ........................... 373
Microbial Leaching of Copper from Tailings of Low Grade Sulphide Ores in Zambia ........................................ 379
Research Progress on Recovering Valuable Metals from Wasted Circuit Board by Bio-Hydrometallurgy
Technology .................................................................................................................................................................... 384
CHAPTER 2: GEOMICROBIOLOGY, BIOGEOCHEMICAL CYCLES, GENETICS AND
MOLECULAR BIOLOGY .......................................................................................................................................... 388
Geomicrobiology of Ro Tinto, a Model of Interest in Biohydrometallurgy ........................................................... 389
New Insights into Salt-Tolerance in Acidophilic Iron-Oxidising Bacteria .............................................................. 394
Microbial Communities in Sediments in Acidic, Metal-Rich Mine Lakes: Results from a Study in SouthWest Spain ..................................................................................................................................................................... 399
Influence of Different Growth Conditions on the Composition of Extracellular Polymeric Substances of
Acidithiobacillus ferrooxidans and Acidithiobacillus ferrivorans Species ................................................................. 404
Comparative Genomics Underlines the Functional and Taxonomic Diversity of Novel Ferrovum
Related Iron Oxidizing Bacteria .................................................................................................................................. 409
Screening and Isolation of Bacterial Strains with the Biotechnological Potential to Destruct CyanideBearing Compounds under the Conditions of Extreme Continental Climate ......................................................... 414
Dyp-Type Peroxidase (DypA) from the Bioleaching Acidophilic Bacterium Leptospirillum
ferriphilum DSM 14647 ................................................................................................................................................ 419
Global Transcriptional Responses of Acidithiobacillus Ferrooxidans Wenelen under Different Sulfide
Minerals ......................................................................................................................................................................... 425
Comparison of Microbial and Geochemical Conditions of Lignite Coal Spoil and Overburden Areas and
Their Environmental Impact ....................................................................................................................................... 430
Characteristics of Acidibacillus spp.: a Novel Genus of Acidophilic Iron-Oxidising Firmicutes ........................... 435

xii

Microarray-Based Characterization of Microbial Community Functional Structure and Heterogeneity


Associated with Acid Mine Drainages ........................................................................................................................ 440
Microbial Community Structure Analysis of Blood Pond Hell Hot Spring in Japan and Search for MetalReducing Microbes ....................................................................................................................................................... 447
Thermodynamic Modelling of Geo-Biometallurgical Oxidation of Sulfide Ores .................................................... 454
Diversity of Bioleaching Microorganisms in Interfacial Emulsion of Copper Solvent Extraction ........................ 460
Neutrophilic Microbial Community with High Rate of Elemental Sulfur Oxidation ............................................ 464
Organotrophic and Mixotrofic Sulfur Oxidation in An Acidic Salt Flat in Northern Chile .................................. 469
Theoretical Model of the Structure and the Reaction Mechanisms of Sulfur Oxygenase Reductase in
Acidithiobacillus Thiooxidans ....................................................................................................................................... 474
Physiological and Genetic Characteristics of Psychrotolerant Acidophile Acidithiobacillus Ferrivorans
ZB-1 and DX-1 .............................................................................................................................................................. 480
CHAPTER 3: MICROBE-MINERAL INTERACTIONS ........................................................................................ 484
The Production of Soluble Ferric Sulfate via Biological and Chemical Processing of Iron Sulfides .................... 485
Apparent Absence of Microbial Life inside an Alkaline Slag Dump ....................................................................... 490
Changes in Acidithiobacillus ferrooxidans Ability to Reduce Ferric Iron by Elemental Sulfur ............................. 494
Effect of Cu(II) on Bio-Scorodite Crystallization Using Acidianus brierleyi ........................................................... 499
Interspecies Interactions of Metal-Oxidizing Thermo-Acidophilic archaea Acidianus and Sulfolobus ................ 505
Bio-modification of carbonaceous matters in gold ore: Model experiments using powdered activated
charcoal and cell-free extracts of Phanerochaete chrysosporium .............................................................................. 510
Industrial Views to Microbe-Metal Interactions in Sub-Arctic Conditions ........................................................... 515
Reactive Oxygen Species Influence Biofilm Formation of Acidophilic Mineral-Oxidizing Bacteria on
Pyrite.............................................................................................................................................................................. 520
Characterization of Microbe-Mineral Interface Interaction Based on Synchrotron Radiation Techniques ....... 525
Initial Attachment and Biofilm Formation of a Novel Crenarchaeote on Mmineral Sulfides ............................... 530
Microbial & Mineralogical Dynamics during Copper Sulfides Bioleaching, the Search for the Missing
Link ................................................................................................................................................................................ 535
Antimicrobial Activity and Hardness of as Cast and as Homogenized Cu-Ti Alloys ............................................. 540
Biofilm Formation of Sulfobacillus thermosulfidooxidans on Pyrite in the Presence of Leptospirillum
ferriphilum .................................................................................................................................................................... 546
Insight into the Sulfur Metabolism by Thermoacidophilic Archaeon Metallosphaera Cuprina with
Genomic, Proteomic and Biochemical Tools .............................................................................................................. 550
A Feasibility Study of Arsenopyrite-Bearing Gold Bioleaching and Its Characterization .................................... 555

xiii

Biofilm Formation and Extracellular Polymeric Substances (Eps) Analysis by New Isolates of
Leptospirillum, Acidithiobacillus and Sulfobacillus From Armenia .......................................................................... 559
High Copper Tolerant P. Lilacinum Strain Isolated From a Rich Environment in Copper, Ro Tinto (Sw,
Spain) ............................................................................................................................................................................. 564
Influence of Oxidation-Reduction Potential on Bio-Oxidation of Olimpiada Flotation Concentrate with
High Content of Pyrrhotite .......................................................................................................................................... 569
Effects of Ion Stress on the Oxidation Activity of Acidithiobacillus Ferrooxidans .................................................. 573
Effect of Phanerochaete Chrysosporium on Graphite Degradation during Pre-Treatment of Simulated
Gold Preg-Robbing Ore ............................................................................................................................................... 577
CHAPTER 4: MINING IMPACT, BIOREMEDIATION OF METALS AND MINE WASTES ......................... 583
Biometal Demonstration Plant for the Biological Rehabilitation of Metal Bearing-Wastewaters (Biometal
Demo) ............................................................................................................................................................................. 584
Dynamic Modelling of Biofilm Reactors with Immobilised Sulfate-Reducing Bacteria ........................................ 589
Biorecovery of Rare Earth Elements: Potential Application for Mine Water Remediation .................................. 594
Passive System for Bio-recovery of Copper from Acid Mine Drainage ................................................................... 599
Bioremediation and Metal Resistant Bacteria in A Closed, Cold Northern Mine .................................................. 604
Biosynthesis of Zinc Sulfide Quantum Dots Using Waste Off-Gas from Metal Bioremediation Process ............. 611
Enhancing ARD Mitigation by Application of Benign Tailings to Reduce the Permeability of Waste Rock
Dumps ............................................................................................................................................................................ 617
Metal Removal from Spent Catalyst using Microbacterium liquefaciens In Solid Culture .................................... 622
Study on As Uptake and Rhizobacteria of Two As Hyperaccumulators Forward to As Phytoremediation ........ 626
Phytoremediation of Heavy Metal Contaminated Soil by Selection of Plant Species ............................................. 632
Ruthenium Recovery from Acetic Acid Waste Solution by Using Pei-Coated Biomass-Chitosan
Composite Fiber ............................................................................................................................................................ 637
Enrichment and Isolation of Acidophilic Microorganisms from Sediments of Gold Mine Waste Leachate ........ 642
Isolation and Characterization of Toxic Metal Removing Bacterial Bioflocculants ............................................... 648
Culture/Co-Culture Dependent and Independent Identification of Bacterial Communities along A
Chronosequence of Spontaneous Reclamation on Gold Mine Spoils In Peru ......................................................... 653
pH and Concentration Dependent Heavy Metal Uptake by Helianthus tuberosus in Phytoremediation
Experiments .................................................................................................................................................................. 658
The Effect of Streptomyces Sp. Isolated From Acidic Cultures of Minerals on Plant Development in
Environments Polluted with Mercury ........................................................................................................................ 663
Prevention of the Generation of Acid Mine Drainage in a Dump Rich-in Pyrite Uranium Ore ........................... 667

xiv

Combined Recovery of Copper and Mitigation of Pollution Potential of a Synthetic Metal-Rich Stream
Draining a Copper Mine in Brazil .............................................................................................................................. 673
Effects of Mining Pollution on the Longjiang River in China .................................................................................. 678
Analysis of the Microbial Community Associated With a Bioprocess System for Bioremediation of
Thiocyanate- and Cyanide-Laden Mine Water Effluents ......................................................................................... 683
Biogeotechnology Application in the Recovery of Metals from the Wastes of Processing Plants ......................... 688
Potential for Conversion of Waste Platinum Group Metals in Road Dust Into Biocatalysts for Cracking
Heavy Oil ....................................................................................................................................................................... 694
Potentials of Some Waste Biomaterials as Sorbents for Gold- and Silver-Cyanide Removal from Aqueous
Matrices ......................................................................................................................................................................... 699
Sorptive Removal of Cadmium Ions from Solution Phases Using Textile Fiber Waste Coated with
Carboxymethyl Cellulose ............................................................................................................................................. 704
Assessing Environmental Risks Associated with Ultrafine Coal Wastes Using Laboratory-Scale Tests .............. 710
A Novel Biological Strategy for the Management Industrial Effluents with Simultaneous Recovery of
Metal Resource ............................................................................................................................................................. 720
Mining Impacts on the Environment - Water Footprint Assessment of Copper Cathode and Copper
Concentrate ................................................................................................................................................................... 725
Bioremediation of Steel Plant Wastewater and Improved Electricity Generation in Bio-Electrochemical
Desalination Cell ........................................................................................................................................................... 730
CHAPTER 5: BIOFLOTATION, BIOBENEFICIATION, BIOSORPTION AND BIOACCUMULATION ..... 736
Influence of Bacterial Detachment on the Bioflotation of Malachite ....................................................................... 737
The Re-Usability of Ecklonia Maxima (Brown Seaweed) in the Treatment of Mine Effluent ............................... 742
Biopolymer Encapsulation of Pei-Derivatives for Heavy Metal Sorption ............................................................... 747
New Technology of Base Metals Precipitation with Hydrogen Sulfide Obtained using Desulfurella
Acetivorans and Desulfurella Kamchatkenis ............................................................................................................... 753
Isolation and Selection of Halophilic Ureolytic Bacteria for Biocementation of Calcium and Magnesium
from Seawater ............................................................................................................................................................... 759
Possible Role of the Biosurfactant-Producing- and Fe-S-Oxidizing Bacterium in Silicate and Sulfide
Bioflotation Processes ................................................................................................................................................... 764
Uranium (VI) Sorption Using Functionalized-Chitosan Magnetic Nano-Based Particles ..................................... 771
Removal of Cd(Ii) from Water System Using Novel Biosorbent Derived from Persimmon Fallen Leaves .......... 777
Biosorptive Removal of Hexavalent Chromium from Aqueous Industrial Solutions by A Novel Wood
Apple Shell Powder Biomass ....................................................................................................................................... 782
Adsorption and Desorption Potential of Cadmium using Green Algae: Equilibrium and Kinetic Studies.......... 787

xv

FTIR Analysis on Organic Sulfur Distribution: Aliphatic Mercaptans in Lignite, Prior and after
Multistage Artificial Biotreatment Process ................................................................................................................ 792
An Innovative Model of Managing Silver Metal from Electronic Scrap Using a Combination of Chemical
Leaching Followed by Biosorption and Biodegradation ........................................................................................... 797
Biopolymers as Encapsulating Agents for the Immobilization of Prussian Blue and Analogues for the
Sorption of Cesium ....................................................................................................................................................... 803
Selective Recovery of Au(Iii) From Binary Metal Solution Using Aliquat-336-Impregnated Alginate
Capsule .......................................................................................................................................................................... 808
Assessment of Surface Properties of Silica-Bacterial Cell Complex: A Potential Application for Silicate
Bioflotation Processes ................................................................................................................................................... 814
Adsorption Kinetics and Surface Characterization of Microorganisms Grown under Different Conditions ...... 819
Organic Sulfur Reduction on Lignite Coal Using Multistage Artificial Biotreatment (A-Bmt) ............................ 825
CHAPTER 6: MICROBIAL CORROSION AND BIO-ELECTROCHEMISTRY ............................................... 830
Microbially Induced Corrosion in Deep Bedrock ...................................................................................................... 831
Biofilm Formation and Stainless Steel Corrosion Analysis of Leptothrix discophora ............................................. 837
Electrochemical Research on N-Type and P-Type Semiconductor Pyrite .............................................................. 842
In Situ Characterization of Relevance of Surface Microstructure and Electrochemical Properties of
Chalcopyrite to Adsorption of Acidianus manzaensis ................................................................................................ 846

xvi

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Chapter 1:
Fundamental & Application
of Bioleaching

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Factors Affecting the Selection of BIOX as the Preferred


Technology for the Treatment of a Refractory Gold Concentrate
Jan van Niekerk
BIOMIN South Africa Proprietary Limited, Building 14, Woodlands Office Park,
Woodlands Drive, Woodmead, South africa
janv@biomin.co.za
Keywords: BIOX, biooxidation, refractory gold, testwork, capital cost, operating
coat, feasibility.
Abstract. The BIOX process was developed in the late 1980s for the treatment of
refractory gold concentrates. The process has since developed into a commercially proven
process with 12 successful installations of which 6 are currently still in operation. During this
time development of the technology continued to improve the efficiency of the process,
improve the reliability of the equipment used and to reduce the capital and operating cost for
the implementation and operation of the process.
This paper will look at some critical aspects in the selection of the BIOX as the preferred
technology for the treatment of a refractory gold. Process selection will include technical
criteria, for example the amenability of a concentrate to biooxidation and process design
criteria, but will also include the overall project economic evaluation, a study of the project
risks, the impact of the project and technology on the environment and local communities,
operability of the process and implementation strategy.
It is important that these aspects be taken into consideration in the design of any testwork
program, be it fundamental research in the biooxidation field or in the development of a
specific project. The impact of decisions taken during the execution of the program must also
be tested continuously to gauge the impact on the overall process viability.
The selection of biooxidation as the preferred process route for any projects, be it of gold,
copper or any other mineral, will in most cases be based on the overall project economics
compared to other processes, rather than technical considerations.
Introduction
The BIOX process was developed in the late 1980s for the treatment of refractory gold
concentrates. The process has since developed into a commercially proven process with 12
successful installations of which 6 are currently still in operation. During this time
development of the technology continued to improve the efficiency of the process, improve
the reliability of the equipment used and to reduce the capital and operating cost for the
implementation and operation of the process.
This has led to the development of the third generation of BIOX design, focussed on the
ease of operation of the process through focussing on the implementation strategy in the
development of a new project, the mechanical design and reliability of the equipment used
and ensuring that proper maintenance programs are implemented and maintained during
operation. The fourth generation of BIOX design, still under development, will focus on
reducing the capital and operating cost for the process by at least 10 % compared to the
current technology.
2

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
The Runruno BIOX project in the Philippines will be the first demonstration of the GEN
III BIOX design, while already incorporating some of the cost saving initiatives developed
under the GEN IV design. Construction of the Runruno plant is near complete with
commissioning of the plant already well underway.
Although the BIOX Process is now a well-established technology and accepted by
industry as a viable treatment option for refractory gold ores, there are a number of
alternative technologies. The development of any refractory project will include a number of
testwork and feasibility study phases to select the most appropriate technology for each
specific concentrate based on a number of factors including technical suitability, economic
viability and impact on the environment.
It is important that these factors must be understood and taken into consideration when
research and development work is done by a technology supplier or in fact any researcher in
the field.
Alternative Technologies. There are a number of alternative technologies for the
processing of refractory gold ores [1,2] of which the roasting and pressure oxidation
processes are best known and widely used in industry. The table below was developed by
BIOMIN internally and indicates the main refractory treatment processes as well as a high
level comparison of the technologies.
Process
Roasting

Biooxidation

Pressure Oxidation

Albion

Ultrafine Grinding

Heap Biooxidation

Table 1: Alternative refractory gold process options


Description
Advantages/Disadvantages
(+) Complete oxidation
Temp: elevated
(+) Well proven technology
Pressure: atmospheric
(-) Environmental issues
Air
(-) Limited operating window
(+) Simplistic process
Temp: low
(+) Low capex and opex
Pressure: atmospheric
(-) High cyanide consumption
Air
(-) Potential for bacterial poisoning
(+) Established technology
Temp: elevated
(+) High gold recovery
Pressure: elevated
(-) High capex and opex
Oxygen
(-) Technically challenging
(+) Simplistic design
Temp: elevated
(+) Turn-key package
Pressure: atmospheric
(-) Complex process chemistry
Oxygen
(-) Emerging technology
(+) Simplistic process
Temp: low
(+) Reduced capital cost
Pressure: atmospheric
(-) Low recovery
(-) Unstable CIL tails
(+) Lower capex and opex
Temp: low
(+) Lower Au:S2- grade required
Pressure: atmospheric
(-) Low recovery
Air
(-) Technically challenging

Process Selection Criteria. In determining which processes are appropriate for any
specific project or concentrate the following points need to be considered [3]:
3

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Technical Amenability of the process, recovery, integration with rest of circuit,


availability of water, power, reagents
Economics Capital and operating cost, gold recovery, NPV/IRR, sensitivity to cost
drivers and recovery
Risk Track record of technology, technology supplier, critical factors, geographical
risks
Operability Scalability, operability and maintainability
Impacts Environmental, footprint, noise and dust, impact on communities
Project implementation permitting required, implementation and construction time,
infrastructure available, local skill levels
In any process development program, be it fundamental research to improve the
knowledge and understanding of the process, improving the technical or financial parameters
of a process or evaluating the amenability of a concentrate to a process, it is important to take
into consideration the impact of decisions taken on the factors listed above. What may seem
like a small change at bench scale may have a large impact on the capital or operating cost of
a process or may negatively impact downstream processing, affecting the viability of the
process.
This paper will review the factors affecting the selection of BIOX as the preferred
technology for a refractory gold concentrate, referring where appropriate to experiences from
recently completed projects. The impact of certain factors on the process selection will be
discussed and future technology development needs to be identified.
Process Development Framework
The development of most refractory gold projects follow the same steps from first bench
scale testwork through process selection to implementation as shown in Table 2.
Batch amenability tests
[bench scale tests]
Pre-feasibility study

BIOX pilot plant run

Table 2: BIOX process development framework


Rate of S2- oxidation
Gold recovery vs S2- oxidation
Order of magnitude of reagent consumption
Conceptual flow diagram
Preliminary equipment list
OoM capital and operating cost estimates
Process design parameters
Optimised reagent consumptions
Operating strategy
BIOX process design package

Process design
development
Detailed feasibility study
Design, construction &
commissioning
Post commissioning
assistance

Project techno-economic evaluation


Implementation strategy
Construction plan & verification
Plant inoculation and commissioning
Operator training
Ongoing technical support
Process optimization
Maintenance program review
4

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Batch and Continuous BIOX Testwork
A review of important factors to take into consideration during the BIOX testwork phase
is discussed based on experiences from a number of BIOX batch and continuous testwork
programs recently completed by BIOMIN. Reference will be made to the concentrate to be
treated, bacterial performance during the testwork programs, factors that affected the
testwork and remedial action taken and impact on downstream processes. The case studies
will focus on the effect of a number of factors on the successful completion of a testwork
program: Bacterial adaptation, laboratory vs on-site testwork and the importance of a wellplanned and properly executed testwork program.
The case studies show the importance of testwork and the impact it can have on the
selection of BIOX as the preferred technology. A well executed testwork program will
generate the necessary design criteria and reagent consumption rates to be used for the
feasibility study. An onsite program can also demonstrate the stability and ease of operation
of the process firsthand to various stakeholders and interested parties.
However, mistakes made during the testwork phase of the development of a project can
have a very negative impact on the viability of the project:
A concentrate can be prematurely discounted as not amenable to biooxidation
when a proper adaptation program could have resulted in a positive outcome;
Using the wrong testwork conditions could result in:
o Lower sulphide oxidation and/or gold dissolutions;
o Longer BIOX retention times and/or lower solids concentrations in the
BIOX slurry;
o Increased reagent consumptions, either in BIOX or in the downstream
CCD, neutralisation or CIL sections;
A poorly executed program can also result in a perception that the technology is
unnecessarily complex and difficult to control.
Capital and Operating Cost
The biggest factor in the selection of a technology for the treatment of a refractory gold
concentrate is the return on investment realized. The ROI will be expressed as an NPV or
IRR number and takes into consideration the life of mine capital and operating costs as well
as revenue generated. The capital and operating cost of the BIOX plant is dependent on a
number of factors including concentrate characteristics, climate and environmental factors,
country and regional factors and client preferences. Understanding the cost drivers for each
project is critical during the test phase already as decisions made during the execution of the
testwork program can have a significant impact on the capital and/or operating cost and can
influence the feasibility of the project.
Capital Cost. A breakdown of the capital cost for a BIOX plant to treat a typical
refractory gold concentrate is shown in Figure 1 below, showing the cost breakdown as a
function of the equipment type.

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
WRT Thickener Pumps
4% General
5%
2%
CCD Thickeners
11%

Tanks

Tanks
28%

Agitators
SS piping
Blowers

Cooling towers
2%

Cooling towers
CCD Thickeners
WRT Thickener

Blowers
23%

Pumps

Agitators
19%

SS piping
6%

General

Figure 1: Breakdown of the capital cost for a typical BIOX project


The BIOX tanks, BIOX agitators, blowers and CCD thickeners are the largest components
of the capital cost. This confirms the importance of determining the appropriate retention
time and BIOX slurry density. Most Commercial BIOX plants operate at a BIOX slurry
retention time of 5 days and a slurry density of 20 % solids. BIOMIN has been doing work on
a number of projects to increase the solids concentration in BIOX from 20 % to 25 % and
even 30 % resulting in a significant reduction in the BIOX tankage required, with the
resultant reduction in both the plant footprint and capital cost.
The BIOX agitators and blowers, required to supply oxygen to the process are also
significant cost items. A good understanding of the oxidation profile will result in an
optimum design for each BIOX reactor, reducing safety factors and overdesign. Similarly, an
understanding of the variability of the concentrate and the effect thereof on the process
performance will also allow optimization of the design.
Operating Cost. While most projects are sensitive to the upfront capital investment it is
most often the operating cost that will determine if the project is feasible. For any BIOX
plant the largest two operating cost components are power, for the BIOX agitators and
blowers, and limestone and lime for neutralization. Cyanide can also be a significant
operating cost on operating BIOX plants.
Development of alternative agitator and impeller designs has led to significant savings in
the power required for the BIOX agitators and blowers while maintaining the same process
performance. Further optimization is possible through liking the instantaneous process
oxygen demand with the air supply.
The understanding and potential reduction of cyanide consumption following mesophile
biooxidation continue to be a focus point for BIOMIN. The continued increase in world
cyanide process, combined with the increased limitations on the transport of cyanide and
need for complete detoxification of tailings are significant considerations for any potential
biooxidation project. Reducing the cyanide consumption from the current average of 10 to
20 kg/t for the operating BIOX plants to levels below 10 and even 5 kg/t will have a
significant impact on the process economics.
Understanding the cost drivers for any project and the trade-offs between capital and
operating cost specific to each project will result in better testwork planning and improved
overall project economics.
Operability

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Concentrate variability. Most refractory ore deposits does have some variability in terms of
ore mineralogy, and resulting concentrate analyses, while for some orebodies the variability
can be extreme. Understanding the variation in ore feed to the plant over the short and long
term is important to determine blending and surge capacity in the plant but also to understand
the impact of the change in mineralogy and chemical composition on the process and
bacterial performance.
Scalability. The ease of expansion of the plant is a major consideration for some project,
while the turndown capacity, or the lowest capacity the plant can be operated may be
important for other projects.
Risks. This is a major consideration for any new projects and can vary considerably
depending on the deposit and location. Risks can vary from consistency and reliability of
power supply, delivery of reagents and availability of technical skills for operation and
maintenance. The potential for bacterial poisoning is a major consideration for most
operating BIOX plants and a thorough assessment of the risk and remedial actions is
imperative. An understanding of the potential sources of poisoning and the impact of various
levels of poisoning on bacterial performance and recovery is critical and an area where there
are significant opportunity for fundamental studies.
Maintenance. The importance of maintenance on the performance of a BIOX plant cannot
be overstated. Maintaining the optimum conditions for the bacteria will improve overall
process performance. However, it is often seen that poor maintenance can result in low
cooling circuit availability, blocked or partially blocked sparge rings or low equipment
availability and unstable plant operation. Although there issues need to be addressed at the
plant, understanding the impact thereof on the bacterial activity and process performance is
important to be able to implement remedial strategies.
Conclusions
This paper highlighted some of the critical aspects affecting the selection of BIOX as the
preferred process route for the treatment of a refractory gold concentrate. It is important that
these aspects be taken into consideration in the design of any testwork program, be it
fundamental or in the development of a specific project. The impact of decisions taken during
the execution of the program must also be tested continuously to gauge the impact on the
overall process viability.
Although mesophile biooxidation has been around for a long time and is now a well
proven commercial process, there are still many areas requiring further fundamental research.
These include process optimization and reagent cost reduction, but also include better
understanding the impact of toxins on bacterial performance and recovery and importantly on
overall process performance. It is critical that research programs, where possible and
applicable, include testwork done at conditions actually simulating the operation of a
commercial BIOX plant, and the impact is not only measured at a bacterial level, but also in
terms of the overall process performance.
The selection of biooxidation as the preferred process route for any project, be it gold,
copper or any other mineral, will in most cases be based on the overall project economics
compared to other processes, rather than technical considerations.
References
[1] R. Dunne, Challenges and opportunities in the treatment of refractory gold ores,
7

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[2] M. Aylmore and A Jaffer, Evaluating process options for treating some refractory gold
ores, ALTA 2012 International Conference.
[3] D.E. Rawlings and D.B. Johnson (Eds.), Biomining, Springer, Verlag Berlin Heidelberg,
2007

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Base Metal Tank Bioleaching: From Laboratory Test Work to


Commercialization
Mariekie Gericke
Biotechnology Division, Mintek, Randburg, South Africa
mariekieg@mintek.co.za
Keywords: bioleaching, base metals, polymetallic, chalcopyrite, pentlandite,
commercialization.
Abstract. The tank bioleaching of metal sulphides is an established technology. Commercial
success started with the treatment of refractory gold concentrates using mesophilic microorganisms, followed by the development of tank bioleaching processes for the treatment of
base metal concentrates. This was initially a mesophilic process treating secondary copper
sulphides, pentlandite and cobaltiferous pyrite. There was though limited potential for
recovery of copper from chalcopyrite concentrates due to low copper extractions and slow
leach kinetics. Over the past decades the optimization of bioleaching processes for the
treatment of chalcopyrite ores and concentrates has been the subject of numerous research
programmes. The use of bioleaching for the treatment of pure chalcopyrite concentrates has,
however, not found commercial application mainly due to competitive smelter technologies.
With this in mind, Minteks base metal bioleaching development over the past few years
focused on the treatment of complex polymetallic concentrates containing contaminants such
as As, Bi, Pb and Sb as a niche application for tank bioleaching processes. These
contaminants pose problems when processed via the smelting route. This paper reviews
Minteks involvement in the development of base metal tank bioleaching processes for the
treatment of chalcopyrite and polymetallic concentrates. Examples of laboratory-scale test
work as well as larger scale demonstration and commercialization of the technology are
highlighted.
Introduction
The worlds first commercial refractory gold bioleach plant was commissioned at the
Fairview Gold Mine in 1986 [1]. Today bioleaching is the technology of choice for the
treatment of refractory gold concentrates and since 1986, 12 BIOX plants using Goldfields
technology [1] and two BacoxTM plants using Bactech-Mintek technology have been installed
words-wide[2].
Development work on base metal concentrate bioleaching began in earnest during the
1990s, partly motivated by the success of the commercial gold bioleach technology. The use
of mesophilic bacteria to oxidize sulphide minerals such as cobaltiferous pyrite, pentlandite,
sphalerite, chalcocite and covellite has been successfully demonstrated [1]. In the early
1990s, Billiton demonstrated the BioNIC process using mesophiles in a demonstration
plant with a design capacity of 300 kg/d of concentrate [3] and in 1999 the worlds first
commercial bioleaching plant treating a cobaltiferous pyrite concentrate was established at
the Kilembe Copper Mine in Uganda. The plant was owned by the Kasese Cobalt Company
and the technology was supplied by BRGM [4]. The plant designed to produce around 1,000
t/a of Co cathode was operated until 2013.
9

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Bioleaching of chalcopyrite containing concentrates. Successful recovery of copper
from chalcopyrite, was however, considered to be the holy grail of bioleaching and the
optimization of bioleaching processes for the treatment of chalcopyrite has been the subject
of numerous research programmes and the debate over the mechanisms involved in the
passivation of chalcopyrite continues [5]. Minteks approach was aimed at developing
practical solutions to circumvent this problem. Numerous test work programmes has been
performed in laboratory-scale continuous bioleach reactor systems with total volumes of
between 4 and 6 L. Larger-scale integrated piloting campaigns, incorporating downstream
unit operations, were conducted to provide detailed design information for the bioleaching
process as well as the downstream metal recovery unit operations.
Various approaches to overcome the passivation of chalcopyrite which include operation
at increased temperatures, fine grinding of the concentrate, the addition of catalysts such as
Ag and control of the redox potential level were evaluated [1]. Much emphasis has been
placed on the development of thermophile bioleach processes [6,7]. Cu extractions from
chalcopyrite concentrates in excess of 95% could be achieved using thermophiles operating at
70C in laboratory-scale multi-stage continuously operated pilot plants, where the key
parameters were delivery of sufficient oxygen and carbon dioxide and management of the
increased microbial sensitivity to solids concentration and particle size distribution [6]. The
technical feasibility and the readiness of thermophilic bioleach technology for commercial
implementation was confirmed during integrated pilot plant work treating low-grade
chalcopyrite and chalcopyrite-pentlandite containing concentrates respectively [8].
The effect of redox potential on the leaching of chalcopyrite has been investigated
extensively as an alternative process option. It has been shown that chalcopyrite dissolution at
low to moderate temperatures is highly dependent on redox potential levels with Cu
extractions greater than 97% observed when operating at redox levels around 410-440 mV
(vs Ag/AgCl). In addition, selective leaching of the chalcopyrite could be achieved, leaving a
final bioleach residue composed almost entirely of pyrite. A key advantage of the process is
that operating costs are reduced since the pyrite is not oxidized and the pyrite-rich bioleach
residue can be sold for acid production [9].
Despite the successful demonstration of the technology, stirred tank bioleaching of
chalcopyrite concentrates has not been realized yet, mainly because bioleaching does not
offer a sufficiently favourable economic marginal benefit over smelting to warrant deviation
from the known and trusted smelting route. However, in the case where sulphide concentrates
contain significant quantities of impurities that incur penalties at a smelter or are too lowgrade for acceptance by a smelter, bioleaching might be a more suitable and cost-effective
treatment option.
Treatment of polymetallic concentrates. With this in mind, Minteks base metal
bioleaching development over the past few years has focused on the treatment of complex
copper-polymetallic concentrates as a niche application for tank bioleaching processes [10,
11] The laboratory-scale test work programmes performed on polymetallics led to the
construction of a pilot plant and commercial plant for the treatment of Cu-polymetallic and
Ni-polymetallic concentrates respectively.
Cupolymetallic concentrates. In 2001, the technology progressed to demonstration
scale when Mintek and its partners, Industrias Peoles S.A. de C.V. of Mexico and BacTech,
successfully demonstrated the bioleaching of a complex copper-polymetallic concentrate
containing chalcopyrite at an operating temperature of 45C in an integrated demonstration
plant with a total capacity of 170 m3 that was commissioned and operated in Monterrey,
10

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Mexico (Figure 1) [10,11]. Because of the high levels of Ag contained in this concentrate the
use of thermophiles was not feasible due to their sensitivity to Ag. Recoveries of >93% Cu
(as cathode) and 96% Zn (as precipitate) could be obtained at a concentrate feed rate of 2.7
t/d, provided the concentrate was milled to 100% <30 m (Figure 1). Around 85% of the Ag
could consistently be recovered from the bioleach residue using hot lime treatment followed
by cyanidation. On completion of the demonstration trial, a feasibility study was conducted
for a commercial scale bioleach plant with an initial capacity of 25,000 t of Cu with an option
to increase the capacity in the future [10].
TYPICAL LEACH PROFILE

100
95

EXTRACTION %

90
85
80
75
70
Copper

65

Zinc

60
0

REACTOR STAGE

Figure 1. (A) Bioleach tanks and (B) leach profile for Cu and Zn recoveries achieved.
Ni-polymetallic concentrates. Extensive research has been undertaken showing the
technical viability of stirred-tank bioleaching of nickel sulphide concentrates. These studies
have included the use of mesophilic, moderately thermophilic and thermophilic microbes [3]
and typical Ni extractions greater than 90 % were achieved at solids concentrations of up to
20 %. Again, despite these technical successes the technology found limited commercial
application because of the same reasons mentioned in the previous section.
An opportunity, where smelting was not an attractive treatment option, was identified for
the treatment of a nickel sulphide concentrate produced as a by-product of Mondo Minerals
talc operations. Mondo is the worlds second-largest talc producer with mining operations
located at two sites in Finland, namely Sotkamo and Vuonos. This high-grade flotation
concentrate containing pentlandite, pyrrhotite, pyrite and gersdorffite has previously been
sold to toll smelters. This is, however, not an attractive option due to the As content and
stockpiling of the material is not preferred as it would create an unacceptable environmental
liability. Mondo has therefore elected to use bioleaching to produce a value-added Ni product
to enhance its revenue and simultaneously avoid environmental liabilities. The application of
Minteks bioleaching technology for the recovery of Ni and Co from the concentrate was
successfully demonstrated in a laboratory-scale metallurgical test work programme [12].

Stage
1
2
3
4
5

Table 2. Extractions achieved in the laboratory-scale test work


S2- [%]
Acc. residence time
Redox
Ni [%] Co [%]
[d]
[mV]
3
560
69.4
74.5
80.4
4
615
87.4
90.0
92.8
5
640
91.9
94.0
95.5
6
640
93.5
95.2
96.5
7
655
97.2
98.0
98.3

11

As

Fe

[%]

[%]

91.4
96.1
95.8
97.4
97.2

65.3
82.6
82.9
87.0
87.1

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
The laboratory-scale continuous bioleach test work was conducted on a 1:1 blend of the
concentrates from the Sotkamo and Vuonos mine sites at 45 C, using a moderately
thermophilic culture. Prior to bioleaching, the concentrate was upgraded using magnetic
separation to reject the pyrrhotite, followed by flotation to reject the talc and magnesite
present in the concentrate. Ni and Co extractions of >95% could be achieved at an overall
residence time of 7 days and a feed particle size of d80=20 m (Table 2).
Very high soluble metal concentrations were measured, with the total metal concentration
of Fe, Ni, Co and As reaching levels approaching 65 g/L in the primary stage reactors. The
maximum recommended feed solids concentration for the process was therefore set at 15%.
Fe removal of >99 % could be achieved in a five-stage neutralisation plant, with minimal Ni
and Co losses. Stable Fe/As residues suitable for impoundment and good quality nickel
hydroxide product could be produced. The results delivered sufficient data to provide process
design specifications for the commercial-scale plant design.
The feasibility study showed that bioleaching, combined with a Ni- and Co-precipitation
process, is an economically-viable option for Mondo to derive value from the concentrate.
The commercial plant is currently under construction at Mondos Vuonos mine site and
commissioning is scheduled to begin during August 2015. At full production, the plant will
treat approximately 12,000 tonnes of Ni concentrate per annum and produce around 1,000
tonnes of Ni annually. The product is a mixed hydroxide precipitate containing both Ni and
Co [13]. This is only the second commercial implementation of base metal concentrate
bioleaching process and it is anticipated that the successful completion of this project could
lead to the development and processing of other nickel sulphide reserves that are currently
unexploited because of their arsenic content.

Acknowledgements
This paper is published with permission from Mintek.
References
[1] J.van Niekerk, C.van Buuren, W.Olivier, Industry Delivery of BIOMINs BIOX and
ASTER Processing Technologies, Proceedings of the Biohydrometallurgy 14
Conference, Falmouth, Minerals Engineering International (2014) 13 pp.
[2] M.Gericke, J.W.Neale, P.J.van Staden, A Mintek perspective of the past 25 years in
minerals bioleaching. J. S.Afr. Inst. Min. Metall., 109 (2009) 567585.
[3] H.R.Watling, The bioleaching of nickel-copper sulphides, Hydrometallurgy 91 (2008)
70-88.
[4] D.H.R.Morin, P.DHugues, P., Bioleaching of a cobalt-containing pyrite in stirred
reactors: a case study from laboratory scale to industrial application. Biomining.
Rawlings, D.E., and Johnson, D.B. (eds.). Springer- Verlag, Berlin (2007) 35-54.
[5] C.Klauber, A critical review of the surface chemistry of acidic ferric sulphate dissolution
of chalcopyrite with regards to hindered dissolution, International Journal of Mineral
Processing 86 (2008) 117.
[6] M.Gericke, A.Pinches, J.V.van Rooyen, Bioleaching of a chalcopyrite concentrate using
an extremely thermophilic culture. Int. J. Min. Process., 62 (2001) 243255.
[7] J.D.Batty, G.V.Rorke, Development and commercial demonstration of the BioCOP
Thermophile Process, Hydrometallurgy, 83 (2006) 8389.
12

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[8] J.W.Neale, S.W.Robertson, H.H.Muller, M.Gericke, Integrated piloting of a
thermophilic bioleaching process for the treatment of a low-grade nickel-copper sulphide
concentrate. Proceedings of the SAIMM Southern African Hydrometallurgy Conference
2009. Johannesburg, The Southern African Institute of Mining and Metallurgy
(2009)119-154.
[9] M.Gericke, Y.Govender, A.Pinches, Tank bioleaching of low-grade chalcopyrite
concentrates using redox control, Hydrometallurgy 104 (2010) 414419.
[10] P.J.van Staden, The Mintek/Bactech copper bioleach process, ALTA Copper
Hydrometallurgy Forum. Brisbane, 1921 Oct. (1998).
[11] M.Gericke, H.H.Muller, P.J.van Staden, A.Pinches, Development of a tank bioleaching
process for the treatment of complex Cu-polymetallic concentrates, Hydrometallurgy 94
(2008) 2328.
[12] M.Gericke, C.Pawlik, D.W.Dew, P.van Aswegen, S.C.C.Barnett, T.Mikkola,
Bioleaching of nickel-cobalt-arsenic containing flotation by-products of the talc industry.
Proceedings of the Biohydrometallurgy 14 Conference. Falmouth, Minerals
Engineering International (2014) 22 pp.
[13] J.Neale, M.Gericke, C.Pawlik, P.van Aswegen, S.Barnett, J.Seppl. The Mondo
Minerals nickel sulphide bioleach project: From test work to design, ALTA 2015
Nickel-Cobalt-Copper Proceedings, ALTA Metallurgical Services, Melbourne (2015)
376-396.

13

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Geobiotechnical Recovery of Metals from Manganese Nodules:


First Experiments
Christina Hellera and Axel Schippersb
Federal Institute for Geosciences and Natural resources (BGR), Stilleweg 2, 30655
Hannover, Germany
achristina.heller@bgr.de; baxel.schippers@bgr.de

Keywords: bioleaching, nodules, manganese-iron oxides.


Abstract. Marine polymetallic nodules represent an important resource of the metals Ni, Co,
Cu, Mn, Zn, Li, Mo, V and Zr. Nodules consist mainly of Mn-Fe oxy-hydroxide
precipitations with valuable metals mostly present within the structure of these host minerals.
To recover the favoured metals via hydrometallurgy it is necessary to dissolve the Mn-Fe
oxy-hydroxides. To test nodules processing via bioleaching, nodules were sampled during a
ship cruise to the German license area located in the Pacific Ocean in 2013. They were
ground in a mortar, washed to remove seawater chloride, and afterwards sieved to obtain the
particle size fraction of 63 to 315 m. Bioleaching experiments were conducted under
aerobic conditions in shake flasks at 2 % pulp density at 30C in a basal medium. A mixed
culture of acidophilic chemolithotrophic iron- and sulfur-oxidizing bacteria (Acidithiobacillus
thiooxidans, At. ferrooxidans, Leptospirillum ferrooxidans, L. ferriphilum) and Acidiphilum
cryptum was inoculated. Elemental sulfur was used as substrate for acid leaching via sulfuric
acid production. At pH values between 1.5 and 2.2 during the experiment, 40 % Ni, 25 % Cu,
1.2 % Mn, 0.3 % Co, 1 % Fe, 70 % Zn and 70 % Zr were leached from the Mn-nodules after
56 days. In preparation for future reductive bioleaching under anaerobic conditions, chemical
kinetic reaction experiments were conducted. Different amounts of Fe(II) were added to a
certain amount of the Mn nodules. These experiments showed that Fe(II) chemically reduced
Mn(IV) to Mn(II) at a stoichiometry of 2 to 1. This reaction is prerequisite for anaerobic
leaching based on biological reduction of Fe(III) to Fe(II) coupled to sulfur oxidation
(Ferredox process). Up to 82 % Ni, 98 % Co, 68 % Cu, and 97 % Mn were leached in these
chemical experiments indicating that anaerobic reductive bioleaching of manganese nodules
should be possible.
Introduction
Deep Sea polymetallic deposits such as manganese nodules and crusts are considered as an
important resource of various valuable metals like copper, nickel and cobalt as well as
molybdenum and vanadium [1]. The nodules consist mainly of manganese oxides
(phyllomanganates/ tectomanganates) and iron oxides (vernadite interwoven with an
amorphous iron oxide-hydroxide). The valuable metals are generally present in the interlayer
between or within the structure of the host minerals [2, 3, 4]. Therefore, a significant
recovery of the metals requires the prior reduction of the manganese and iron oxides [5, 9].
Besides conventional hydro- and pyrometallurgical processes, bioleaching of the manganese
nodules is another possible process [6, 7]. In a first step, a mixture of acidophilic bacteria was
used to conduct the experiments under aerobic conditions. Under this condition, the bacteria
(e.g. the acidophilic At. thiooxidans) produce sulfuric acid via the oxidation of elemental
14

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
sulfur [10], which then solubilizes metals:
S0 + H2O + 1.5 O2 H2SO4

(1)

Another option could be bioleaching under anaerobic conditions. In this process, bacteria
catalyse the dissimilatory reduction of Fe(III) to Fe(II). Sulfur acts as electron donor, Fe(III)
in the minerals acts as electron acceptor. Manganese oxides are solubilized via the chemical
reduction of Mn(IV) by Fe(II) [9]:
S0 + 6 FeO(OH) + 10 H+ 6 Fe2+ + SO42- + 8 H2O

(2)

Mn3O3(OH)6 + 6 Fe2+ + 12 H+ 3 Mn2+ + 6 Fe3+ + 9 H2O

(3)

In preparation of future reductive bioleaching experiments, chemical kinetic reaction


experiments with different amounts of Fe(II) and a certain amount of manganese nodules
were conducted in this study as well.
Material and methods
Manganese nodules. The manganese nodules used in this study were collected during the
BGR KM 2013 ship cruise to the Eastern German license area in the Clarion and Clipperton
fracture zone (CCFZ) of the Eastern Pacific. The nodules were crushed and ground in a
mortar, sieved to obtain the particles size fraction of 63 to 315 m, and afterwards washed
with water to remove sodium chloride. To determine the initial chemical composition nodule
material was analysed by X-ray fluorescence analysis at BGR (Table 1).
Table 1. Main and trace element concentration of manganese nodules from the Eastern
German license area in the CCFZ.
Mn
33

Fe
6

Mg
1.9

Main elements [%]


Al
Si
Co
2.2
5.5
0.1

Cu
1.3

Ni
1.5

Trace elements [mg kg-1]


Mo
V
Zr
630
450
300

Bacteria. The acidophilic microorganisms At. thiooxidans, At. ferrooxidans, L.


ferrooxidans, L. ferriphilum and Acidiphilum cryptum were selected for the bioleaching
experiment. The mixed culture was grown aerobically at 30C in a basal medium that was
described by Starkey [11] in shake flasks. Elemental sulfur was added and the initial pH was
adjusted to 2.5 by using 2.5 M H2SO4.
Bioleaching experiment. For the experiment under aerobic conditions, the acidophilic
mixed culture was incubated until a sufficient cell count (> 107 / mL) and a pH ~ 1.8 were
reached. Then, an accurately weighed amount of nodule material (2% w/v) was added. Three
parallel assays with bacteria were performed. A periodic sampling of supernatant was
conducted; fresh medium was afterwards added to compensate for the loss. The liquid
samples were analysed for the pH using an electrode and the metal content using inductively
coupled plasma optical emission spectrometry (ICP-OES). A chemical control assay without
bacteria was run in parallel.
Number of living cells. The most-probable-number technique (MPN) with three parallels
was used to enumerate the living sulfur-oxidizing acidophiles. Tubes were incubated for four
15

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
weeks at 30C; enrichments were counted positive if the pH dropped below 2.1.
Chemical kinetic reaction experiment: Mn(IV) reduction by Fe(II). The experiment
was carried out with ground and washed manganese nodule material. Different amounts of a
Fe(II) sulfate heptahydrate solution (0 up to 100 mmol Fe(II)) were added to accurately
weighed amounts of nodule material (~0.5% w/v). The experiments were carried out under
anaerobic conditions in a nitrogen atmosphere. After defined time intervals liquid samples
were taken and analysed for pH and metal content (ICP-OES).
Results and discussion
Aerobic bioleaching. Throughout the experiment the pH values were between 1.8 and 2.3
(Fig. 1). The number of living sulfur-oxidizing acidophiles was 1010 / mL at the end of the
experiment indicating active and growing sulfur-oxidizing bacteria during the experiment.
Fig. 1 shows the metal leaching results for the aerobic bioleaching experiment and for the
chemical control experiment. The results indicate bioleaching activity.

1.5
60
1.0
40
0.5

20
0

Metal released [mg/)

2.0

80
pH value

Metal released [mg/)

100

80

0.0
0

20

40

2.0

60

1.5
40
1.0
20

0.5

60

0.0
0

20

Time [d]
120

40

60

Time [d]
2.5

Copper

120

80
60
1.0
40

pH value

1.5

0.5

20

Metal released [mg/)

2.0

2.5

Nickel

140

100
Metal released [mg/)

2.5

Iron

pH value

2.5

Manganese

2.0

100
1.5
80
60

1.0

40

pH value

120

0.5
20

0.0
0

20

40

60

0.0
0

Time [d]

20

40

60

Time [d]

Figure 1. Results of the aerobic bioleaching experiment. Metals leached by a mixed culture of
acidophilic bacteria grown on elemental sulfur over time (dashed line without dots: pH; solid
black line: metal leached by bacteria; dashed grey line with dots: metal leached in the
chemical control experiment.

Figure 2. Metal recovery (wt.-%) in solution after 56 days experimental time.


16

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Fig. 2 shows the calculated recovery of the metals based on the concentrations in solution
at the end of the aerobic bioleaching experiment. Besides Zn and Zr, only Cu and Ni were
leached to a considerable amount. About 27 wt.-% Cu and 40 wt.-% Ni were recovered. One
reason for the low recovery of several metals could be that the manganese and iron oxides
were not solubilized to a great extent under aerobic conditions.
Chemical kinetic reaction experiment: Mn(IV) reduction by Fe(II). Chemical kinetic
reaction experiments were conducted in preparation for future anaerobic reductive
bioleaching experiments.

Figure 3. Anaerobic chemical kinetic reaction experiment for leaching of nodules at different
initial Fe(II) concentrations. The amount of leached Mn is shown as mean of two parallel
assays per initial Fe concentration.
Fig. 3 shows the amount of leached Mn at different Fe(II) concentrations over time. The
amount of leached Mn increased with increasing Fe(II) concentration. With 100 mM Fe(II),
97 % Mn were leached at 72 hours. Calculations showed that ~ 2.5 mol Fe(II) reduced 1 mol
of Mn(IV). This stoichiometry has been described in the literature [12, 13, 14]. During the
experiment, the pH value was always below 2.6, thus Fe and Mn remained in solution.
Therefore, an anaerobic bioleaching of nodules should be possible.
Conclusion
The experiments have shown that the aerobic and the anaerobic bioleaching of manganese
nodules is possible. Ni and Cu could be recovered in significant amounts by aerobic
bioleaching. An increase of Mn and Fe solubilisation should increase the recovery of the
valuable metals. In preparation of future anaerobic bioleaching (Ferredox process), chemical
kinetic reaction experiments have shown that up to 97% Mn could be dissolved from
manganese nodules.
References
[1] S.B. Kanungo and R.P. Das: Hydrometallurgy (1988) Vol. 20, p.135.
[2]

S. Bodei, A. Mancceau, N. Geoffrey, A. Baronnet, M. Buatier: Geochimica et


Cosmochimica Acta (2007) Vol. 71, p. 5698.

[3]

A. Wegorzewski, T. Kuhn: Marine Geology (2014) Vol. 357, p. 123.

[4]

K. Liu, Q. Chen, H. Hu: Hydrometallurgy (2009) Vol. 98, p. 281.

[5]

A. Kumari, K.A. Natarajan: Minerals Engineering (2003) Vol. 15, p. 103.


17

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[6]

H.L. Ehrlich: Minerals and Metallurgical Processing (2000) Vol. 17, p. 121.

[7]

A. Schippers, S. Hedrich, J. Vasters, M. Drobe, W. Sand, S. Willscher: Geobiotechnology (2014) Vol. 141.

[8] Y. Konichi, S. Asai, Y. Sawada: Metallurgical and Material Transaction (1996) Vol. 28B,
p. 25.
[9]

C.A. du Plessis, W. Slabbert, K.B. Hallberg, D.B. Johnson: Hydrometallurgy (2011)


Vol. 109, p. 221.

[10] M. Dopson, D.B. Johnson: Environmental Microbiology (2012) Vol. 14, p. 2620.
[11] R.L. Starkey: Journal of Bacteriology (1925) Vol. 1, p. 135.
[12] D.A. Crerar, H-L. Barnes: Geochimica et Cosmochimica Acta (1974) Vol. 38, p. 279.
[13] D. Postma, D: Geochimica et Cosmochimca Acta (1985) Vol. 49, p. 1023.
[14] A. Schippers, B.B. Jrgensen: Geochimica et Cosmochimica Acta (2001) Vol. 65, p.
915.

18

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Saline Water Bioleaching with Thermophilic Fe(Ii) Oxidizing


Microorganisms
Melissa K Corbett 1a David Collinson2b Denis Shiers2c Anna H
Kaksonen3d Helen Watling2e Elizabeth LJ Watkin1f*
1School

of Biomedical Sciences, Curtin University, Kent St, Perth, WA 6102,


Australia

2CSIRO

Mineral Resources Flagship,7 Conlon Street, Waterford, WA, 6152,


Australia

3CSIRO

Land and Water, 147 Underwood Ave, Floreat WA 6014, Australia

amelissa.corbett@curtin.edu.au; bDavid.Collinson@csiro.au;
cDenis.Shiers@csiro.au;
dAnna.Kaksonen@csiro.au; eHelen.Watling@csiro.au;
f*E.Watkin@curtin.edu.au,

+61 (0) 8 9266 2955

Keywords: acidophile,bioleaching,chloride,salinity,thermophile, tolerance


Abstract. The chloride tolerance of three Fe(II)- and sulfur-oxidizing thermophiles and the
effect of chloride on metals extraction from mineral sulfideswere studied. Initially, 10-day
bioleaching tests (60 C) were conducted using pyrite (FeS2), chalcopyrite (CuFeS2) or
pentlandite ((Ni,Fe)9S8) concentrates as substrate in basal salts medium (BSM), and the
activities of Sulfolobus metallicus, Acidianus brierleyi and Metallosphaera hakonensis were
compared. Fe(II) oxidation,as indicated by an increase in oxidation reduction potential,was
observed in all combinations except A. brierleyi growing on chalcopyrite. The presence of
added NaCl resulted in lower ORP after 10 days of bioleaching in all cases, indicating
reduced Fe(II) oxidation. In ancillary tests using BSM-Fe(II) growth medium with added
NaCl,it was found thatcell counts at the end of Fe(II) biooxidation provided the most reliable
estimate of tolerance to NaCl. On this basis, the rank order of NaCl tolerance is S.
metallicus>>>A. brierleyi>M. hakonensis.
Introduction
Bioleaching has already been successfully applied to a number of sulfide ores and it has
great potential for the processing of low grade ores which cannot be processed economically
using traditional methods or ores which contain impurities such as arsenic. However,
chalcopyrite is difficult to bioleach due to its low dissolution rate [1]. One strategy
proposed to improve the bioleaching efficiency of this mineral is to increase the temperature
of the leaching environment and use thermophilic microorganisms. Bioleaching
microorganisms are generally resistant to high concentrations of metals. However, many of
the commonly used bioleaching species have relatively low tolerance to chloride, which
restricts their use in bioleaching operations located in arid regions, such as Western Australia
or Chile where freshwater resources are limited, or for ores that contain high concentrations
of chloride[2, 3]. There have been a number of studies on the effect of elevated chloride
levels on mesophilic bioleaching microorganisms [2] but few data are available for
19

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
thermophiles. In this study, the chloride tolerance of three bioleaching thermophilic archaeal
species and the effect of chloride on the extraction of metals from mineral sulfide
concentrates were investigated.
Materials and Methods
The following type strains from the German Collection of Microorganisms and Cell
Cultures (DSMZ) were used:Sulfolobus metallicusDSM6482T, Acidianus brierleyiDSM
1651Tand Metallosphaera hakonensisDSM 7519T. The strains were grown inBasal Salts
Medium (BSM) containing (g L-1) (NH4)2SO4(1.5), KH2PO4 (0.25), and MgSO4.7H2O
(0.25)at pH 1.8 for A. brierleyiand S. metallicus and pH 2.5 for M. hakonensis.The cultures
were grown at 60Cwith shaking at 200rpm.
Fe(II) oxidation by thermophiles under chloride stress. The BSM was supplemented
with 0.02% yeast extract(YE) and 22gL1 FeSO47H2O for NaCl tolerance tests. The initial
cell density was 5106cells mL1. Cells were counted using a Helber counting chamber
(Hawksley) and 400 by phase contrast microscopy.The effects of NaCl on Fe(II)
biooxidation at 60 C and initial pH 1.8 by the three species wereinvestigated using an
electrochemical monitoring method [4]. NaCl (015 g L1) in growth media had no effect on
measured ORP (data not shown).
Bioleaching of mineral sulfides by thermophiles under chloride stress.Concentrates of
FeS2, CuFeS2 and (Ni,Fe)9S8 were milled (-0.75m) and gamma irradiated. The element
compositions of the concentrates were determined usinginductively coupled plasma atom
emission spectroscopy (ICP-AES) after borax flux and re-dissolution in 5% HNO3(Table 1).
Table 1.Element compositions of mineralsulfides used in this study.
Concentrate
FeS2
CuFeS2
(Ni,Fe)9S8

Fe [%]
36.6
26.6
40.7

Cu [%]
0.239
26.8
0.730

Ni [%]
0.044
0.004
7.01

S [%]
39.8
29.8
35.4

The three archaeal species were incubated in BSM (minus YE) containing 0, 3.5 or 5 g L1
NaCl, and0.5% of a concentrate. The cultures were incubated at 60C with shaking at
130rpm. Leachates were assayed for pH, ORP (vs Ag/AgCl), Fe, Cu and Ni. Fe(III) was
estimated using spectrophotometry [5].Fe, Cu and Ni were determined in leachatesusing
flame atomic adsorption spectrophotometry (Avanta) with standards supplied by FLUKA
chemicals.
Results and Discussion
Fe(II) oxidation by thermophiles under chloride stress.Typical Fe(II)-oxidation curves
are illustrated for S. metallicus in Fig 1. Comparison of the abiotic data with the biooxidation
data (any concentration) indicated that Fe(II) oxidation by S. metallicus started after a short
lag time but that the rates of oxidation declined with increased NaCl concentration. At 6 g L1
NaCl, a plateau was reached at ~0.005 M Fe(II) after which no further oxidation occurred. As
this is not an effect of NaCl on the measurement of ORP and the subsequent calculation of
Fe(II) concentration, the plateau was attributed to inhibition of bioactivity by NaCl. The
plateau effect was more pronounced for A. brierleyi and M. hakonensis in some tests.

20

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
0.0400

0g
4g
5g
6g

0.0350
0.0300

Fe(II) (M)

0.0250

L-1
L-1
L-1
L-1

NaCl
NaCl
NaCl
NaCl

0.0200

0.0150
0.0100
0.0050
0.0000
0

10

20

30

40

50

60

70

Time (h)

Figure 1. Data from the electrochemical monitoring of Fe(II) oxidation by S. metallicus in


media with 06 g L1 NaCl. Tests conducted at 60 C, initial pH 1.8.

Cells in final solution


(cells mL-1) X 10^6

Overall, the estimated Fe3+ doubling times and lag times became longer and more
variable as the NaCl concentration was increased, necessitating repeated experiments. Cell
counts at the end of biooxidation gave the most reliable estimate of tolerance to salt. On this
basis, it was concluded that the rank order of salt tolerance is S. metallicus>>>A.
brierleyi>M. hakonensis.
200

S. metallicus, A. brierleyi,

M. hakonensis

150
100
50
0
0 4 5 6

0 1 2 3 4 5
NaCl (g L-1)

0 2 3.5 5

Figure 2.Cell density of cultures when Fe(II) was exhaustedor biooxidation plateau was
observed . Initial cell concentrations: 5106 cells mL1.
Bioleaching of mineral sulfides by thermophiles under chloride stress. Typically, in
the absence of chloride, the solution ORP in culturesincreased from 400 mV to 600650 mV
(Fig 3).In saline media, ORP in all cultures after 10 days of leaching were either in the range
500550 mV,indicative of moderate Fe(II) oxidation, or remained at ~400 mV (no Fe(II)
oxidation). For A. brierleyi, the solution ORP remained at ~400 mV for both pyrite and
chalcopyrite testsin the presence of NaCl but increased to 500 mV after 8 days with
pentlandite.Fe(II) oxidation, as measured by increasing Fe(III) levels was observed in the
absence of chloride for all combinations exceptA. brierleyiwith pyrite. Fe(II) oxidation was
not affected by increased chloride with M. hakonensisand S. metallicusin the presence of
pyrite and pentlandite.

21

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
700
1400

600

700
1400

b
600

1200
500

1200
500

ORP (mV)

800

300

600

200

400

100

200

0
0

100
200
Time (h)

1200
500

1000

1000
400

1400

c
600

400

800

300

600

1000

400

800

300

600

200

400

200

400

100

200

100

200

0
0

200
Time (h)

0
0

100
200
Time (h)

Figure 3: Changes inORP and Fe(III)concentration during bioleaching for: (a)A.


brierleyigrown with 0.5% pyrite as substrate;(b)M. hakonensis with 0.5% chalcopyrite;
and(c) S. metallicus with 0.5% pentlandite. ORPsolid line, Fe(III) dashed line. 0 g L1;3.5
g L1, and 5.0g L1NaCl.
The extraction of Fe from pyrite was unaffected by the presence of NaCl.However, the
overall Fe leaching rates were low for both A. brierleyi (8%) and M. hakonensis(7%) with S.
metallicusbeing more effective at 33%.In the absence of NaCl, all strains extracted Cu from
CuFeS2in 10-day tests, in rank order:S. metallicus(63%) >M. hakonensis(49%) A. brierleyi
(42%), consistent with cell numbers (Fig 2). Increased salinity impacted the ability of all
strains to extract Cubut the process was never halted and, even at 5 g L1NaCl concentration,
the Cu2+ liberated with A. brierleyi was 90% of that recorded at 0 gL1 NaCl, 76% for M.
hakonensisand 63% forS. metallicus.How much of the effect can be attributed to the
increased Cu concentration (approximately 1 g L1) and how much to the chloride component
is unknown, but there is evidence that thermophiles can adapt and tolerate up to30 g L1 Cu in
leachate [6].
Overall, Ni extractionsfrom (Ni,Fe)8S9were greater than Cu extractions from CuFeS2 under
similar conditions, consistent with the comparatively higher (Ni,Fe)8S9reactivity. In the
absence of NaCl, extractions in rank order were: M. hakonensis (84%) >A. brierleyi (80%)
>S. metallicus (68%).The impact of NaCl was greatest for A. brierleyi,for which Ni2+
liberated at 5.0 gL-1was 50% of that released in the absence of NaCl; M. hakonensis was
intermediate with 82% Ni2+ extracted at 5.0 gL-1compared with that in the control, and S.
metallicus was largely unaffected by the presence of NaCl. . The data were consistent with
those for cell growth (Fig 2) and Fe(II) oxidation. Final Ni concentrations in leachate (up to
0.5 g L1) were much lower than reported data for nickel concentrate leaching (up to 23 g L1
Ni) [7].
Conclusions
A varying response to increasing levels of chloride on Fe(II) oxidation and metal extraction
was seen with all archaeal strains tested. However, the greatest impact was seen on the
22

Fe 3+ mg.L-1

700

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
leaching of Cu from CuFeS2. This study demonstrates that the aim of bioleaching copper
from chalcopyrite under saline conditions remains challenging.
Acknowledgements
The funding from CSIRO Mineral Resources Flagship, provision of cultures by Christina
Morris and Naomi McSweeney (CSIRO) and valuable comments from Christina Morris,
Naomi McSweeney and Geoffrey Puzon (CSIRO) are gratefully acknowledged.
References
[1] H.Watling:Hydrometallurgy (2006) Vol. 84, p. 81
[2] M. Dopson, A.-K. Halinen, N. Rahunen, D. Bostrm, J.-E. Sundkvist, M. RiekkolaVanhanen, A.H. Kaksonen andJ.A. Puhakka:Biotechnology and Bioengineering
(2008)Vol. 99, p. 811
[3] C.M. Zammit, S. Mangold, V. rao Jonna, L.A. Mutch, H.R. Watling, M. Dopson
andE.L.J.Watkin: Applied Microbiology and Biotechnology (2012)Vol. 93, p. 319
[4] H.R. Watling, F.A. Perrot and D.W. Shiers: Hydrometallurgy (2008) Vol. 93, p. 57
[5] E. Govender, S.T.L Harrison andC.G. Bryan:Minerals Engineering (2012) Vol.35, p. 46
[6] C.A.du Plessis, J.D. Batty and D.W. Dwew: InBiominingedited by D.E. Rawlings and
D.B. Johnson. Springer, Berlin (2007), p. 57
[7] Heinzle T, Miller D, Nagel V:In Proceedings Biomine '99 and Water Management in
MetallurgicalOperations. AMF, Glenside, South Australia,(1999).p. 16

23

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Role of Microbial Activity in Bioleaching of a Pyritic and a Pure


Chalcopyrite Concentrate
Mohammad Khoshkhoo1,a, Mark Dopson2,b and ke Sandstrm1,c
1MiMeR

2Centre

Minerals and Metallurgical Research Laboratory, Lule University of


Technology, 97187 Lule, Sweden

for Ecology and Evolution in Microbial Model Systems, Linnaeus University,


39182 Kalmar, Sweden

amohammad.khoshkhoo@ltu.se, bmark.dopson@lnu.se, cake.sandstrom@ltu.se

Keywords: chalcopyrite, bioleaching, passivation, redox potential, moderate


thermophiles.
Abstract. Leaching of a pyritic and a pure chalcopyrite concentrate was carried out in stirred
tank reactors in the absence and presence of a mixed culture of moderately thermophilic
microorganisms at 45C and pH 1.5. To study the effect of microbial activity on copper
dissolution, the abiotic experiments were performed under accurately controlled redox
potential conditions to reproduce the same oxidising conditions recorded during the
bioleaching experiments. X-ray photoelectron spectrometry (XPS) was used to study the
surface of chalcopyrite chips leached for different durations. The results showed that the
microorganisms in cases of both concentrates did not have any effect in the copper leaching
efficiency other than oxidation of ferrous to ferric ions. Biooxidation of elemental sulphur did
not improve the leaching efficiency and bulk and surface jarosite had no negative effect on
dissolution. A composite layer composed of mainly elemental sulphur and iron-oxyhydroxide was found to be responsible for the hindered dissolution.
Introduction
Leaching and bioleaching of chalcopyrite has been an attractive research area for decades.
Simple and efficient heap bioleaching of secondary copper sulphide minerals, i.e. chalcocite
and covellite, suggests that a similar process should also be viable for chalcopyrite treatment.
However, chalcopyrite bioleaching has proved to be more complicated than leaching of other
copper sulphides. The major challenge is the slow dissolution in common bioleaching
systems, which makes chalcopyrite heap bioleaching a less attractive process option
compared to the well-established pyrometallurgical route. The slow dissolution (termed
passivation or hindered dissolution) is said to be due to formation of a barrier layer on the
surface of the mineral that inhibits the transport of ions. Despite much research, the nature of
the possible hindering layer is still under debate with elemental sulphur and jarosite as the
most accepted candidates [1,2].
In chalcopyrite leaching systems, redox potential is an influential factor in affecting the
rate of dissolution. In practice, redox potential is mainly determined by the concentration
ratio of ferric to ferrous ions and it is decreased when chalcopyrite reacts (Eq. 1) and
increased when oxidation of ferrous to ferric occurs (Eq. 2).

24

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
CuFeS2 + 4Fe3+ Cu2+ + 5Fe2+ + 2S0
(1)
Fe2+ + 0.25O2 + H+ Fe3+ + 0.5H2O
(2)
If the results of bioleaching experiments are compared to abiotic experiments, the abiotic
experiments must be carried out under the same redox potential conditions. This is not an
easy task by using conventional chemical methods during a long leaching experiment.
However, it can be achieved using an electrochemical cell [3] or with a controlled and
automatic addition of an oxidising agent. In this research, both systems were used to
reproduce redox potential conditions in the abiotic experiments, similar to those recorded
from bioleaching of a pyritic and a pure chalcopyrite concentrate.
Experimental
Material. A pyritic chalcopyrite concentrate (Kristineberg concentrate) and a relatively
pure chalcopyrite concentrate (Aitik concentrate) both from Boliden Mineral AB, Sweden
were used (see Table 1). The concentrates were ground to a d80 of -45 m and a mean
diameter of 27 m immediately before addition into the reactors. Chalcopyrite massive
samples from Aitik were cut into chips with an approximate size of 333 mm. The chips
were polished and rinsed with ethanol before immersing into the reactor.
Table 1. Chemical analyses and calculated mineralogy of the pyritic chalcopyrite concentrate
(Kristineberg) and the high-purity chalcopyrite concentrate (Aitik).
Concentrate
Kristineberg
Aitik

Cu
23.6
32.4

Fe
34.7
30.9

Chemical analyses [%]


S
Zn
Pb
37.5
2.1
0.7
34.1
0.11
0.05

SiO2
1.1
0.53

Calculated mineralogy [%]


CuFeS2
FeS2
ZnS
PbS
68
26
3.2
0.8
94
5
0.16
0.06

Microorganisms. A mixed culture of moderately thermophilic acidophiles was grown in


mineral salt medium (MSM) containing, per litre, 3 g (NH4)2SO4, 0.1 g KCl, 0.01 g
CaNO34H2O, 0.5 g MgSO47H2O, 0.05 g K2HPO4 and 3.3 g Na2SO4 at 45 C. The copper
concentrate was gradually added to the adaptation bioreactor up to a solid content of 2.5%
(wt/vol). The culture contained strains related to Acidithiobacillus ferrooxidans,
Acidithiobacillus caldus C-SH12, Sulfobacillus thermosulfidooxidans AT-1, Sulfobacillus
montserratensis L15 and an uncultured thermal soil bacterium YNP [4].
Bioleaching. Batch bioleaching experiments were performed in a 2 L baffled reactor at
45C. Air at a rate of 1 L/min was blown into the reactor. The bioleaching experiment with
the pyritic concentrate (Kri-Bio) was inoculated with 10% (vol/vol) of the active microbial
culture and 2.5% (wt/vol) of the concentrate giving an initial copper and iron concentration of
90 mg/L and 140 mg/L, respectively. To obtain a similar iron concentration in the
bioleaching experiment with the pure concentrate (Ait-Bio), the reactor was inoculated with
5% (vol/vol) of the culture. The redox potential was regularly recorded using a platinum
electrode with an Ag/AgCl reference electrode (Metrohm). The pH was frequently checked
and adjusted to 1.5 by addition of 5M sulphuric acid or 5M sodium hydroxide solution.
Samples were taken at regular intervals for analysis of dissolved copper and iron as well as
total iron. Chalcopyrite chips samples were immersed in Ait-Bio experiment reactor.
Abiotic leaching. Two controlled redox potential leaching experiments were carried out
with the pyritic concentrate by reproducing the redox potential conditions recorded during the
25

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Kri-Bio experiment (Kri-Abio1 and Kri-Abio2). With the pure concentrate, one abiotic
experiment was performed (Ait-Abio). The redox potential was adjusted by controlled
addition of diluted hydrogen peroxide solution. All the leaching conditions in the abiotic
experiments were similar to the bioleaching experiments. Chalcopyrite chips were also used
in Ait-Abio experiment.
Analyses. Solution analyses for copper and iron were carried out by atomic absorption
spectroscopy (AAS). Total iron was analysed by mixing representative pulp samples with
HCl to a concentration of 6 M for dissolution of precipitated iron and then analysed by AAS.
Cyanolysis was used for determination of elemental sulphur in the residues [5]. Methods for
XPS analyses and data interpretation are described elsewhere [6]. The microbial community
was analyzed by total DNA extraction, PCR amplification, and second generation sequencing
of partial 16S rRNA genes. The resulting sequences were annotated against the SILVA
database and aligned in the software Explicet.

Results and Discussion


The simulations of redox potential in the abiotic experiments closely matched the data
recorded during the bioleaching experiments (Fig. 1). The redox potential control was lost at
two moments during Kri-Abio1 experiment (days 21 and 27) and at day 25 in Ait-Abio
experiment. The loss of control resulted in precipitation of iron as jarosite (data not shown).

Figure 1. Redox potential during (a) experiments with pyritic concentrate and (b) experiments
with the pure chalcopyrite concentrate.
The copper recoveries were more or less equal in the presence and absence of
microorganisms in both the pyritic and the pure concentrate leaching experiments (Fig. 2).
The dissolution rates depended solely on the solution redox potential conditions and it did not
matter if the redox potential was governed by microbial activity or via
chemical/electrochemical processes. The equal recoveries occurred despite the precipitation
of iron as jarosite in experiments Kri-Abio1 and Ait-Abio. This clearly means that bulk
jarosite did not have a negative effect on copper recoveries. The linearity of the curves also
shows that the leaching never passivated. Considering the slow reaction rates, the leaching
was considered as hindered, instead of passivated.

26

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 2. Copper recoveries during (a) experiments with pyritic concentrate, and (b)
experiments with pure concentrate
No elemental sulphur was detected in the bioleaching residues by cyanolysis while
considerable amounts of elemental sulphur were found in the abiotic leaching residues with
the pyritic and the pure concentrate. Evidently bulk elemental sulphur present during the
abiotic experiments did not cause any hindrance in the copper dissolution.
Table 2. Presence or absence of iron compounds and jarosite on the surface of chalcopyrite
chips leached for different durations.
Sample
Ait-Bio-3
Ait-Bio-7
Ait-Bio-72
Ait-Abio-3
Ait-Abio-7
Ait-Abio-43

Fe-O-OH

Fe-SO4

K-jarosite

The surface of the chips used in the Ait-Bio experiment were analysed at days 3, 7 and 72
by XPS. Samples from Ait-Abio experiments were analysed at days 3, 7 and 43. Table 2
summarises the presence or absence of iron compounds and jarosite on the samples surface
while Fig. 3 shows the speciation of sulphur on the surface of the samples. Considering the
equal recoveries of copper in the two experiments, the similar Fe-oxy-hydroxide and
elemental sulphur features on the surfaces are most probably responsible for hindered
dissolution. Surface jarosite found in sample Ait-Abio-43 did not cause hindrance, since
recoveries of copper were similar in this experiment compared to Ait-Bio experiment where
no surface jarosite was found. More detailed discussion on the surface analyses can be found
elsewhere [6].

Figure 3. Surface sulphur speciation of the chalcopyrite chips leached in (a) Ait-Bio and
(b)Ait-Abio experiments.
27

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
The microbial community at the start of the Ait-Bio experiment and when the redox
potential reached 600 mV consisted of a large number of species including known
acidophiles (Fig. 4). By the end of the experiment, acidophiles present in the inoculum from
the Acitihiobacillus, Ferroplasmacaea, and Sulfobacillus were selected and represented
>98% of the detected sequences.

Figure 4. 16S rRNA community sequencing at the start of Ait-Bio experiment, when the
redox potential reaches 600 mV, and the end point.

Summary
Bacterial leaching was found to have no extra effect on chalcopyrite dissolution compared
to the abiotic experiments that were performed under identical redox potential conditions for
a pyritic chalcopyrite concentrate and a relatively pure concentrate. Bulk jarosite and
elemental sulphur were shown to have no effect on hindered leaching, while a composite
compound of surface elemental sulphur and Fe-oxy-hydroxide was the only common phase
on the surface of samples leached for different durations. Surface jarosite was not responsible
for hindered dissolution.
References
[1]
[2]
[3]
[4]
[5]
[6]

F. K. Crundwell. Hydrometallurgy (2013) Vol. 139, p. 132-148.


C. Klauber. International Journal of Mineral Processing (2008) Vol. 86, p. 1.
P. I. Harvey, F. K. Crundwell. Applied and Environmental Microbiology (1997) Vol.
63, p. 2586.
M. Dopson, E. B. Lindstrm. Microbial Ecology (2004) Vol. 48, p. 19.
W. Hazeu, d. V. Batenburg-van, P. Bos, R. K. Pas, J. G. Kuenen. Archives of
Microbiology (1988) Vol. 150, p. 574.
M. Khoshkhoo, M. Dopson, A. Shchukarev, Sandstrm. Hydrometallurgy (2014)
Vol. 149, p. 220.

28

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Oxygen-Enriched Gas in Bioleaching Stirred Reactors and Its


Impact on The Consortium Behaviour
Catherine Jouliana*, Jrme Jacoba, Mickal Beaulieub, Patrick
dHuguesa and Anne-Gwnalle Guezenneca
a

Water, Environment & Ecotechnologies Division, b Laboratory Division

BRGM, 3 avenue Claude Guillemin, BP 36009, 45060 Orlans Cedex 2, France


* correspondance : c.joulian@brgm.fr, +33(0)2 3864 3089
Keywords: bioleaching, community dynamics, CE-SSCP, oxygen, cobalt .
Abstract. In bioleaching processes, gas transfer is often considered as one of the key
mechanisms that will influence the leaching efficiency and more precisely the leaching rate.
Oxygen can be a limiting factor in bacterial leaching because of its low solubility. One way
to overcome this phenomenon consists in increasing the oxygen partial pressure in the gas
stream supplied to the leach pulp. The primary objective of this work was to investigate the
use of oxygen-enriched gas in bioleaching stirred reactors and its impact on the consortium
dynamics. First tests were performed at lab scale in four successive series of 2-L bioreactors
alimented either with air or with oxygen enriched gas. The microbial consortium used has
proven its efficiency on several ores such as cobaltiferous pyrite and polymetallic ores in
former research projects (BioMine, BioShale, ProMine). The community diversity was
remarkably reproducible irrespective of the type of gas supply, in each of the successive
series of reactors. Only minor changes occurred after subculturing from one batch series to
the next one, highlighting the high stability of the established consortium. Different oxygen
partial pressures (from 20% to 50%) were then tested in a 20-L continuous reactors pilot
experiment. There was no impact on the community diversity, showing the high tolerance to
oxygen of the bioleaching strains and their capacity to easily survive 50% oxygen input. The
bioleaching efficiency in terms of rate and metal leaching did not seem to be changed. The
use of enriched oxygen gas is not detrimental to the bioleaching strains and may be used in
order to improve process operation (gas transfer, heat management).
Introduction
In the frame of the European FP7 PROMINE project, research focused on the
demonstration of the reliability of new (bio)technologies for an ecoefficient production of
strategic metals. It was chosen to develop an innovative bioleaching technology targeting
sub-economic European tailings (low metal-grade) that cannot be treated in conventional
stirred tank reactors. Pyritic tailings from a copper mine in Sweden were identified as a good
case study for developing such a new process. The constraints of such a process were
identified during BIOMINE project [1,2]. Initially named LDBO2 (Low Duty Bioreactor
O2), this new concept for bioleaching reactor is based on a new type of agitation-aeration
system that has been developed for waste water treatment processes (large outside ponds
arranged in cascade or a large pond with baffles operating as a plug flow reactor). In order to
optimize both heat transfer and gas transfer, this concept has the particularity to use pure
oxygen injection instead of air. In bioleaching processes, gas transfer is often considered as
one of the key mechanisms that will influence the leaching efficiency and more precisely the
29

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
leaching rate. Oxygen can be a limiting factor in bacterial leaching because of its low
solubility. One way to overcome this phenomenon consists in increasing the oxygen partial
pressure in the gas stream supplied to the leach pulp.
In this context, bioleaching using pure oxygen or air was compared, with the objective to
confirm the capacity of bacteria to grow and dissolve iron, copper and cobalt from the tailings
in oxygen-rich atmosphere and to investigate the impact on the consortium dynamics.

Material and methods


Ore. The ore material was copper- and cobalt-containing pyritic tailings, containing close
to 53% pyrite, 600 mg/kg cobalt and 1800 mg/kg copper.
Medium. The nutritive medium 0Km was used for all bioleaching experiments, its
standard composition in g.L-1 is (NH4)2SO4 3.7; H3PO4 85% 0.81; MgSO4.7H2O 0.52; KOH
0.48.
Batch experiments. The inoculum was a mix of four bioleaching cultures, the KCC one
maintained at BRGM on the Kasese cobalt-rich pyrite, a batch culture on the pyritic tailings,
and two cultures from previous pilots operation on pyrite and copper concentrate. All were
first grown separately in 100-mL batch on the pyritic tailings at 3% followed by 5% solids, at
40C and 1.8 initial pH. They were pooled and grown in a 2-L stirred batch reactor at 10%
solids and 1%-CO2 enriched air (120L/h), to produce the consortium which was used to
inoculate the experiment. Four successive series were run in 2-L batch reactors at 10% solids
with air or oxygen at various flow and gas compositions (Table 1). Water lost through
evaporation was replaced from distilled water prior to daily monitoring of pH, Eh, dissolved
oxygen (for Ox batch only) and sample collection for total dissolved Cu, Co and Fe analysis
by atomic absorption spectroscopy. pH was adjusted daily to 1.8 using H2SO4 until microbial
acidification had started. pH was regulated by CaCO3 in order to avoid a decrease below pH
0.9.
Table 1. Gas mixture flow, carbon dioxide, oxygen and nitrogen partial pressure during batch
tests.
Batch tests

Flow L.h-1

PCO2

PO2

PN2

Air 1, Air 2 and Air 3


Air 4
Ox 1
Ox 2
Ox 3
Ox 4

121
126
3.0
4.5
2.9
7.9

1
5
40
27
20
5

21
20
60
73
50
68

78
75
0
0
30
27

Continuous pilot. The inoculum came from the KCC culture subcultured in batch on the
pyritic tailings at 10% solids, then inoculated in a 50-L reactor first operated in batch at 20%
solids on air. When the biomass reached 109 cells/ml, continuous bioleaching was started in
the pilot-scale unit composed of a 50-L (R1) and three 20-L (R2, R3 and R4) stirred tanks in
series. The effect of 21%, 30%, 40% and 50% O2 partial pressure in R1 on bioleaching was
30

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
studied. Temperature was 40C. pH was regulated in each tank between 1.2 and 1.5 by
adding limestone slurry of 500 g.L-1 CaCO3.
Community analyses. Community diversity monitoring was performed by CE-SSCP
(Capillary Electrophoresis-Single Strand Conformation Polymorphism) molecular
fingerprinting. Genomic DNAs extraction from 2 mL of homogenous bioleaching pulp pretreated with Tris buffer to neutralize acidity and fingerprinting analyses were performed as
previously described [3]. Samples were taken at the end of the bioleaching phase for the
batch experiments and during the stable phase for the continuous reactors. Profiles were
compared to that of the strains usually found in the mixed cultures obtained at BRGM, i.e.
Leptospirillum (L.) ferriphilum BRGM1, Acidithiobacillus (At.) caldus BRGM3,
Sulfobacillus benefaciens BRGM2, and Sulfobacillus thermosulfidooxidans.

Results and discussion


Air and Ox 2L-batch tests. Diversity profiles did not show significant differences
irrespective of the gas supply condition in each of the successive series of reactors (Fig. 1).
The consortium has evolved concomitantly in the two conditions showing that supply of
oxygen instead of air was not detrimental. Furthermore, only slight diversity changes
occurred from one series to the next one, showing a high stability of the established
consortium when subcultured. Minor fluctuations were observed for the smallest peaks (on
the right of the profiles), and Air 4 and Ox 4 profiles revealed an increase of the abundance of
Sb. benefaciens BRGM2 and a decrease of At. caldus BRGM3.
Most of the detected strains could be identified by comparing CE-SSCP migration patterns
with that of strains usually colonizing BRGM bioleaching reactors. Throughout the
experiment, the iron oxidizer L. ferriphilum BRGM1 was found in large ratio (44 to 58%), as
well as At. caldus BRGM3 (24 to 55%, sum of the two peaks). Except in series 4 where its
ratio reached 16%, Sb. benefaciens BRGM2 accounted for less than 5% of the diversity. One
minor (max. 5%), more sporadic peak remained unidentified; it could correspond to a strain
carried by the pyritic tailings, but more work would be needed to confirm the presence on the
ore of indigenous strains that may have a role in bioleaching even though they never
overcome the inoculated ones.
Figure 1. Evolution of CE-SSCP diversity
profiles in the successive batch reactors (1 to
4) supplied with air (left profiles) or oxygen
(right profiles).
Batch tests Air 1, Air 2 and Air 3, were
very similar in terms of pH, Eh, O2d, metals
concentrations (Fe, Cu and Co). Co
dissolution rates, directly linked with pyrite
dissolution and thus representative of
bioleaching efficiency, reached about 50%
after 8 days (Table 2). Dissolved oxygen
concentrations were not really high (< 6
mg/L). Bioleaching was enhanced in batch
test Air 4 performed at 5% CO2 partial
31

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
pressure. Higher metal concentrations were unexpected since a CO2 partial pressure of 1% is
a widely accepted value for bioleaching [4] and is theoretically more than enough to provide
carbon for autotrophic growth of bacteria. Ox batch tests were very different from one batch
to another. Compared to Air batch tests, Co dissolution rates after 8 days were significantly
lower during batch tests Ox 1, Ox 2 and Ox 3 (respectively 37% 11% and 45%). Dissolved
oxygen concentrations were higher, especially during batch test Ox 2 (> 12 mg/L), and redox
potential increases and pH decreases were slower and lower. These low bioleaching
performances are probably due to fluctuating operating conditions, especially excessive CO2
and O2 partial pressure. High dissolved oxygen concentrations might have been toxic for the
aerobic acidophilic bacteria [5]. During all the batch tests, free bacteria counts were similar
which indicate that viability of bacteria was not affected. As well, no effect on diversity was
observed as described above. However, their activity may have been affected. During batch
test Ox 4, pH, redox potential and Co dissolution rate after 8 days reached values similar to
those of the Air batch tests, but reaction kinetics were slightly slower. This improvement of
bioleaching efficiency may be due to the optimization of the gas mixture composition and
possibly to bacterial adaptation to high oxygen partial pressure.
Table 2. Dissolved cobalt in %, after 8 days of bioleaching.
Batch test
Ox 1
Ox 2
Ox 3
Ox 4
Air 1
Air 2
Air 3
Dissolved Co 37%
11%
45%
50%
53%
49%
50%
(%)

Air 4
63%

Continuous pilot. Partial pressures increase from 21% to 50% of O2 in the R1 50-L reactor
had no impact on the community diversity (Fig. 2). Here, the continuous mode impose that
the detected bacteria are the one active in the process, as they are not washed out. They are
thus all highly tolerant to high concentration of oxygen and have the capacity to easily
survive and be active at 50% O2 partial pressure. As observed in the 2-L Air and Ox batch
tests, L. ferriphilum BRGM1 and At. caldus BRGM3 were well represented, L. ferriphilum
being dominant throughout the monitoring and in all tanks. Sb. benefaciens BRGM2 was
only very sporadically observed. The diversity profiles are generally not affected by the
increase in O2 supply and are remarkably stable in the successive operations. Only Sb.
benefaciens ratio increased significantly in tank R3 operated at 21% O2. This strain has
usually been found in previous batch reactors and continuous pilots on air performed at
BRGM, at low or high ratios depending on the conditions [3,6]. However, since Sb.
benefaciens BRGM2 was also poorly detected in the R2, R3 and R4 reactors at 21% O2
(equivalent to air condition) and represented only a minor ratio of the community in the Air
batch tests, one hypothesis is that this strain does not develop easily on the tested tailings. Its
absence here can thus not be linked to the supply of O2.
Preliminary data treatment did not reveal significant impact of O2 partial pressure increase on
the bioleaching efficiency in terms of rate and metal leaching.

32

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 2. Evolution of CE-SSCP diversity profiles in the continuous pilot supplied with
oxygen.
Conclusion
Only minor community changes occurred when applying oxygen in batch or continuous
mode, which highlights the high stability of the established consortium. Oxygen supply,
when well controlled, does not seem detrimental to the bioleaching efficiency and the
survival and activity of the bioleaching strains (L. ferriphilum BRGM1, At. caldus BRGM3)
even at 50% partial pressure in continuous mode. The use of enriched oxygen gas may be
used for improving process operation (gas transfer, heat management).
References
[1]
[2]
[3]
[4]
[5]
[6]

P. Spolaore, Y. Mnard, M. Save, P. dHugues and D. Morin: Contribution to


Deliverable DIV7C BioMinE project (FP6) BRGM/RP56206FR (2008).
P. Spolaore, Y. Mnard, C. Bryan, C. Joulian and D. Morin: Contribution to
Deliverable DIV8C BioMinE project (FP6) BRGM/RP56712FR (2008).
P. dHugues, C. Joulian, P. Spolaore, C. Michel, F. Garrido and D. Morin:
Hydrometallurgy (2008) Vol. 94, p. 34.
P. dHugues (1996) PhD thesis
B. Halliwell: Biochem. J. (1984) Vol. 219, P. 1.
P. Spolaore, C. Joulian, J. Gouin, A. Ibez, T. Aug, D. Morin and P. d'Hugues:
Hydrometallurgy (2009) Vol. 99, p. 137.
33

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Organic Carbon Utilisation by Iron(II)-Oxidising Bacteria


Sulfobacillus Thermosulfidooxidans and Alicyclobacillus Strain
FP1 that Inhabit Copper Sulfide Leaching Heaps
Denis W. Shiers1, a, David M. Collinson1, b and Helen R. Watling1, c
1CSIRO

Mineral Resources Flagship, P.O. Box 7229, Karawara, WA 6152, Australia

a Denis.Shiers@csiro.au, b David.Collinson@csiro.au, c Helen.watling@csiro.au

Keywords: Sulfobacillus thermosulfidooxidans, Alicyclobacillus, organic carbon,


heap leaching
Abstract. Strains of Sulfobacillus (S.) and Alicyclobacillus species have been
identified/detected in managed bioleaching heaps and agitated tanks using culture-dependent
and culture-independent methods. S thermosulfidooxidans oxidises both iron(II) and reduced
inorganic sulfur compounds (RISC). Several strains were isolated from a copper sulfide heap
in North Western Australia. Alicyclobacillus strain FP1 (FP1) was also isolated from the heap
and oxidises iron(II) but not RISC. However, the species exhibit differentiating
characteristics
during
growth
on
D-glucose, which has been explored using a suite of monitoring and measurement techniques.
As examples, a growth factor (yeast extract) is essential for FP1 but not for S.
thermosulfidooxidans, although yeast extract is beneficial to the latter. FP1 grows well on
glucose, compared with the poor-to-no growth of S. thermosulfidooxidans on the substrate.
Solution pH strongly influences the activity of both species when grown on organic
substrates, suggesting a pivotal role for solution acidity in the growth and activity of
heterotrophs or mixotrophs in heap leach systems. This research forms part of an ongoing
development of a data base with which to interpret the impacts of leaching conditions in
heaps on microbial activity without having to disrupt metal production by invasive sampling
campaigns. The insights gained will assist in understanding the effects that changing
conditions in heaps due to acid consumption and/or increased element concentrations in
process water may have on microbial activity.
Introduction
During copper sulfide heap bioleaching, acidophilic micro-organisms catalyse the
dissolution of sulfidic minerals through regeneration of ferric ions and oxidation of reduced
inorganic sulfur compounds [1]. As a consequence of these processes and other chemical
reactions, large variations in solution pH, redox potential, temperature and metal ion
concentrations can be encountered. A number of studies have focussed on the effects of these
physico-chemical parameters on the growth and oxidation activity of individual microorganisms, when cultured on either ferrous ions, inorganic sulfur compounds, or
combinations of the two [2 and references therein]. In addition to these substrates, organic
compounds can also build up in a heap environment and these may be utilised by mixotrophic
or heterotrophic organisms. There are comparatively few data on the effects of physicochemical parameters on acidophiles utilising organic compounds. In the current study, the
utilisation of an organic substrate (D-glucose) at different initial solution pH by two bacterial
species was quantified using a range of experimental techniques. These were Alicyclobacillus
34

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
strain FP1, isolated from a copper sulfide heap in north-Western Australia and S.
thermosulfidooxidans DSM 9293T, the type strain of the species that was ubiquitous in
process water samples from the same heap. The results are discussed in respect of the impacts
of variable acidity in heaps of sulfide ores.
Materials and methods
All chemicals used in this study were analytical grade reagents (AR) and all solutions
were prepared with de-ionised water. Preparation and transfer of sterile solutions, subculturing and inoculation of test flasks took place in a laminar flow hood using aseptic
technique. pH measurements were made using an Ionode PBFC glass membrane electrode
connected to a 'Smartchem' pH/Eh meter. The pH probe was calibrated using 1.68, 4.00 and
7.00 buffers. Cell counts were performed using a Helber Bacteria Counting Chamber (Thoma
ruling, 0.02 mm cell depth) and a Nikon model Eclispse Ci phase contrast microscope. It
was assumed that planktonic biomass represented the bulk of the bacterial population with no
significant sessile cell population [3].
Cultures of Alicyclobacillus strain FP1 and S. thermosulfidooxidans (DSM 9293T) were
maintained at 35 and 45 C, respectively, with routine sub-culturing. Micro-organisms were
cultured in sterile basal salts medium (BSM) containing per litre: 1.5 g (NH4)2SO4, 0.25 g
MgSO47H2O, 0.25 g KH2PO4. BSM was sterilized at 121 C, 100 kPa for 20 min. Cultures
of S. thermosulfidooxidans were grown in BSM supplemented with 0.75 g L-1 K2S4O6 and 0.1
g L-1 yeast extract as an energy source, with a final pH of 2.5 (adjusted with concentrated
H2SO4). Strain FP1 was maintained in BSM supplemented with 1.0 g L-1 glucose and 0.1 g L1
yeast extract. Tetrathionate, glucose and yeast extract were dissolved in a 30 mL portion of
medium, before solutions were filter sterilised back into their respective stock bottles.
Cultures were grown on their respective media for up to five sub-cultures (4 weeks) before
inoculation into test flasks.
Test flasks were prepared by adding 100 mL of sterile BSM media supplemented with 1 g
-1
L of D-glucose and 0.1 g L-1 of yeast extract. Starting pH was varied between experiments.
Solutions were inoculated to give a starting cell concentration of approximately 13 107
cells mL-1. Substrate utilisation was analysed through pH monitoring, cell counting and
chemical oxygen demand analysis. For the chemical oxygen demand (COD) tests, samples
were removed from test flasks and passed through a 0.45 m membrane filter. A 5 mL
aliquot was placed into a 500 mL Schott bottle. Blank solutions were prepared using distilled
water and controls using test medium. Solutions had 10 mL of K2Cr2O7 (10 g L-1) and 2 mL
of concentrated H2SO4 added, after which bottles were sealed, solutions mixed and heated for
5 h in a polyethylene glycol bath at 110 C. Samples were cooled to room temperature before
a back-titration was performed to an electrochemical end point using acidified Fe(SO4)7H2O
(30 g L-1) solution.
Results and discussion
Experiments investigating the growth behaviour of S. thermosulfidooxidans and FP1 were
undertaken at varied initial solution pH. The effect of starting pH on glucose utilisation and
growth patterns for culture FP1 is presented in Figure 1. COD measurements indicated that
minor glucose utilisation took place in cultures starting at pH 1.8 and 3.0 (Fig. 1A and B). In
cultures started at pH 5.0 and 7.0 organic substrate was utilised (Fig.1C and D), with the
period required for significant usage shorter in cultures starting at pH 5.0, compared to pH
35

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
7.0. In cultures starting at pH 5.0 or 7.0, a decrease in pH was measured. This took place
ahead of the reduction in reduced material present at pH 5.0, but lagged slightly behind at pH
7.0. A decrease in pH during utilisation of D-glucose and other sugar substrates has
previously been reported for acidophilic micro-organisms [4]. Initially, an increase in cellular
density took place over the first 24 hours, with a minor change in COD concentration. This
increase could be attributed to utilisation of yeast extract, added as a 'growth factor' to
mixotrophic cultures. At pH 1.8 no further increase in cell numbers was measured, but in the
culture at pH 3.0 cell numbers increased to 2.1 108 cells mL-1. Higher final cell numbers
were estimated for cultures starting at pH 5.0 and 7.0.

2.0E+08

0.8

1.5E+08

0.6

1.0E+08

0.4

5.0E+07

0.2

50

100

4.5
3.5
2.5

0.0

0.0E+00

1.5

5.5

2.5E+08

1.0

2.0E+08

0.8

1.5E+08

0.6

1.0E+08

0.4

5.0E+07

0.2
0.0

0.0E+00

1.5

150

2.5

1.5

2.5E+08

1.0

6.5

2.0E+08

0.8

1.5E+08

0.6

1.0E+08

0.4

5.0E+07

0.2

50

100

5.5
4.5

3.5
2.5

1.5

0.0

0.0E+00

100

3.0E+08

Cell density (cells mL-1)

3.5

7.5

pH

4.5

1.2

COD (g L-1 glucose)

pH

5.5

Cell density (cells mL-1)

6.5

50

150

Time (hours)

Time (hours)
3.0E+08

7.5

1.2

COD (g L-1 glucose)

6.5

2.5E+08

1.0

2.0E+08

0.8

1.5E+08

0.6

1.0E+08

0.4

5.0E+07

0.2

0.0

0.0E+00

150

50

100

150

Time (hours)

Time (hours)

Figure1. Batch cultures of Alicyclobacillus FP1 on BSM-Ye supplemented with 1 g L-1 of


glucose starting at pH 1.8 (A), 3.0 (B), 5.0 (C) and 7.0 (D). Cell counts are the
average of duplicate measurements. Symbols: cells mL-1, COD concentration,
pH.
The influence of starting pH on glucose utilisation and growth patterns for cultures inoculated
with S. thermosulfidooxidans is presented in Figure 2(A-D). Analysis of total reduced carbon
content indicated that minor amounts of glucose utilisation took place in all cultures,
regardless of starting pH. A decrease in pH was measured in cultures starting at pH 5.0 and
7.0 although, compared to FP1, the rate was significantly slower, and less acidity was
generated. Possibly this indicates that small quantities of glucose were utilised. A substantial
increase in cell density was observed at pH 3.0, with cells increasing to a final concentration
of approximately 2.9 108 cells mL-1. These final cell numbers were similar to those
estimated for cultures of FP1 at starting pH of 5.0 and 7.0 (Figure 1C and D). Cell numbers
were observed to increase slightly in other cultures, but those increases were attributed
primarily to the utilisation of yeast extract.

36

1.2

COD (g L-1 glucose)

2.5

1.0

3.0E+08

Cell density (cells mL-1)

3.5

2.5E+08

pH

4.5

7.5

COD (g L-1 glucose)

pH

5.5

Cell density (cells mL-1)

6.5

1.2

3.0E+08

7.5

2.5

1.5

1.0

6.5

2.0E+08

0.8

1.5E+08

0.6

1.0E+08

0.4

5.0E+07

0.2

0.0E+00

0.0

50

100

5.5
4.5

3.5
2.5

1.2

2.5E+08

1.0

2.0E+08

1.5E+08

0.6

1.0E+08

0.4

5.0E+07

0.2

0.0E+00

1.5

150

0.0

Time (hours)

4.5
3.5
2.5

1.5

1.2

7.5

2.5E+08

1.0

6.5

2.0E+08

0.8

1.5E+08

0.6

1.0E+08

0.4

5.0E+07

0.2

0.0E+00

0.0

50

100

100

150

5.5
4.5
3.5
2.5

1.5

3.0E+08

Cell density (cells mL-1)

pH

5.5

Cell density (cells mL-1)

6.5

50

150

Time (hours)

COD (g L-1 glucose)

3.0E+08

7.5

0.8

COD (g L-1 glucose)

3.5

2.5E+08

3.0E+08

2.5E+08

1.0

2.0E+08

0.8

1.5E+08

0.6

1.0E+08

0.4

5.0E+07

0.2

0.0E+00

0.0

Time (hours)

50

100

150

Time (hours)

Figure2. Batch cultures of S. thermosulfidooxidans on BSM-Ye supplemented with


1 g L-1 of glucose starting at pH 1.8 (A), 3.0 (B), 5.0 (C) and 7.0 (D).
Cell counts are the average of duplicate measurements. Symbols: cells mL-1,
COD concentration, pH.
Ore mineralogy is a key parameter regarding acid consumption or generation. Solution pH
in heaps can vary widely depending upon the extents of acid consuming and acid-generating
reactions occurring within a defined environment. Further, heaps are unsaturated systems,
with only a thin film of solution contacting mineral surfaces during passage through the ore
bed, creating a large array of pH-micro-environments within which the microorganisms live.
These experimental data indicate that mixotrophic and heterotrophic species can tolerate, or
adapt to, pH gradients in heaps when suitable organic substrates are present. Thus, a heap in
which the solution pH has increased to the point where ferrous ion is oxidised chemically and
precipitates as iron(III) compounds, and where microbial iron(II)-oxidising activity is
minimal, may not have to be re-populated if mixotrophic species are present that can resume
iron(II) oxidation when acidic conditions are restored.
Conclusions
Changes in pH had a marked effect on the utilisation of organic substrates by strain FP1
and
S. thermosulfidooxidans. Alicyclobacillus strain FP1 utilised greater quantities of D-glucose
over a broader range of pH compared to S. thermosulfidooxidans. Optimal growth for FP1
occurred in cultures starting at pH 5 and 7, compared with pH 3 for S. thermosulfidooxidans.
Neither culture utilised significant quantities of glucose at pH 1.8, indicating that the
utilisation of organic substrates is favoured at higher pH, but is also species dependent.
Curiously, the utilisation of sugars, such as D-glucose, provides a mechanism to restore an
37

1.2

COD (g L-1 glucose)

4.5

7.5

pH

pH

5.5

Cell density (cells mL-1)

6.5

1.2

COD (g L-1 glucose)

3.0E+08

7.5

Cell density (cells mL-1)

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
acidic (micro)environment where soluble ferrous ion is more prevalent and can be utilised by
iron-oxidising micro-organisms.
Acknowledgments
The financial support of the Australian Government through CSIRO Mineral Resources
Flagship is acknowledged.
References
[1] H.R.Watling: Hydrometallurgy Vol. 84 (2006), 81108.
[2] H.R. Watling, E.L.J. Watkin, D.E. Ralph: Environmental Technology Vol. 31 (2010),
915933.
[3] D.W. Shiers, D.E. Ralph, H.R. Watling: Biochemical Engineering Journal Vol. 54
(2011), 185191.
[4] G. Deinhard, J. Saar, W. Krischke, K. Poralla: System. Appl. Microbiol. Vol 10 (1987),
6873.

38

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Effect of Different Solvent Extractants on the Activity and


Community Structure of Acidophilic Microorganisms
Bowei Chena*, Wenjuan Lib, Guiying Zhouc, Xingyu Liud and Jiankang
Wene
National Engineering Laboratory of Biohydrometallurgy, General Research Institute
for Nonferrous Metals, No.2 Xinjiekouwai Street, Beijing 100088, China
a,*correspondence:biohydrometallurgy@163.com,

+86-(010)82241312, b

juanzi88888@126.com,
c zhouguiying2001@163.com, d wellwoodliu@gmail.com, e kang3412@126.com

Keywords: bioleaching, acidophile, solvent extractant.


Abstract. The effect of solvent extractants, such as M5774, Cyanex 272, P204, P507 and
N235, on the activity and community structure of acidophilic microorganisms were tested.
Cobalt extractant Cyanex 272 did not show much inhibition effect on the growth of
acidophiles, while iron extractant N235 had great inhibition effect. When the culture solution
contacted with iron extractant P204, nickel extractant P507 and copper extractant M5774, the
inhibition effect increased gradually. 16S rRNA gene clone library were used to analyze the
initial and extractant contacted final microbial community structure. The initial inoculation
microbial populations were mainly composed by Leptospirillum ferriphilum and
Acidithiobacillus ferrooxidans. After cultivated in solution containing extractant M5774,
Cyanex 272, P204 and P507, the number of the two species decreased, while heterophilic
Acidiphilium cryptum became the dominant population. When cultured by M5774 and
Cyanex 272, the proportion of Acidithiobacillus ferrooxidans was higher than Leptospirillum
ferriphilum, while when cultivated by P204 and P507, the number of Leptospirillum
ferriphilum was higher.
Introduction
Nowadays, biohydrometallurgy is becoming more and more important for extraction of
metals, such as copper, nickel and cobalt. In these processes, leaching solution is recycled, so
microorganisms was inevitably contacted with extractant. Previously, researchers mainly
studied copper extractant LIX 84IC, LIX 984N, LIX 64 and ZJ988 on the growth and activity
of acidophiles [1-4]. But for widely used copper extractant M5774, cobalt extractant Cyanex
272, nickel extractant P507, iron extractant N235 and P204, their effect on the activity and
community structure of acidophilic microorganisms were none of knowledge.
Materials and Method
Bacteria and extractant. The acidophilic microorganisms were sampled from the
bioleaching plant of Zijingshan Copper Mine and maintained on sterilized 9K medium, which
was composed of the following mineral salts: (NH4)2SO4 3.0 gL-1, K2HPO4 0.5 gL-1,
MgSO47H2O 0.5 gL-1, KCl 0.1 gL-1, Ca (NO3)2 0.01 gL-1, 45 gL-1 of FeSO47H2O. The
pH of the medium was adjusted at 1.8 using 1N H2SO4. M5774 and Cyanex 272 are produced
39

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
by Cytec, Canada. P204, P507, N235 and sulfonated kerosene are produced by Shanghai
Rare-earth Chemical, China. M5774 is mainly composed of 5-nonylsalicyaldehyde oxime.
Cyanex 272 contains 85% bis (2, 4, 4-trimethypentyl) phosphinic acid. P204 contains 95% di
(2-ethylhexyl) phosphate. P507 contains 95% phosphonic acid ( 2-ethylhexyl )-mono( 2ethylhexyl ) ester. N235 is a mixture of trioctylamine/decylamine.
Procedure. 180 mL 9K medium and 20 mL bacteria culture were loaded in a separating
funnel. Then 2mL extractant and 8 mL sulfonated kerosene were loaded. The mixture was
vibrated for 5 min and then stranded for 30min to make the organic phase and aqueous phase
separate. This allows the extractant in the aqueous phase in the saturation concentration. The
aqueous phase was put into 300mL conical flask and cultured at 30 C. The pH, Eh and cell
number were monitored every 24h.
Clone library construction and analysis. When cell concentrations reached stationary
phase, a modified nucleic acids extraction method was used [5] to extract DNA from samples
of innocula and final culture solution. 16S rRNA genes were amplified with universal primers
27F and 1492R. The amplified 16S rRNA genes were gel purified and inserted into pGEM-T
easy vectors (Promega, USA) and transformed into Escherichia coli DH5. At least 50 white
clones were randomly selected from the library and sequenced by Sangon Corp. (Shanghai,
China). Chimera sequences were detected by the chimera function at the RDP site
(http://rdp.cme.msu.edu/), and all chimera sequences were eliminated. Sequences were
analyzed using BLAST at the NCBI database (http://ncbi.nlm.nih.gov/BLAST). Alignments
of 16S rRNA gene sequences were performed with the CLUSTAL_X program, version 1.64b
[6]. A phylip-generated distance matrix was used as the input file to distance-based OTU and
richness (DOTUR) [7], which assigns sequences to operational taxonomic units (OTUs) for
every possible distance. Rarefaction analysis and the Chao1 non-parametric diversity
estimator were applied to the clone library to estimate whether the library had been
sufficiently sequenced to extrapolate the total sequence diversity. Other diversity indices
were calculated by using SPADE (http://chao.stat.nthu.edu.tw) [8]. A neighbour-joining
phylogenetic tree was constructed based on evolutionary distances that were calculated with
the Kimura two-parameter model using MEGA4 [9].
Results and discussion
Figure 1 shows solution pH, Eh and cell number during contacting with extractant. It can
be seen that different solvent extractants had different inhibition effect on the growth of
acidophiles. Cobalt extractant Cyanex 272 did not show much inhibition effect on the growth
of acidophiles, while iron extractant N235 had great inhibition effect. It needed 25 days for
the solution Eh to reached 550 mV. When N235 concentration of 10, 20, 50 mg/L was used,
it needed 12, 15 and 30 days. The inhibition effect increased gradually when the culture
solution contacted with iron extractant P204, nickel extractant P507 and copper extractant
M5774. When cultivated with 9K medium, the solution pH usually went upwards and then
reduced, but it was opponent when contacted with P204 and P507. The two extractants
belong to phosphorus acid extractant, which can ionize H+ in water, resulting the decrease of
pH. The pH value in all experiments went upwards and then reduced. In the first period, the
main reaction is the oxidation of Fe2+, which is an acid consuming reaction, raising the pH.
With the increase of Fe3+ concentration, the hydrolysis of ferric iron to ferric species such as
jarosite and Fe(OH)3 became dominant, so the pH began to decrease. N235 is a kind of
tertiary amines basic extractant, which can react with H+ in water, resulting alkaline local
microenvironments. In addition, tertiary amines usually was used as anaesthetic, which could

40

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
inhibit (Na+, K+)-ATPase and Mg2+-ATPase on membrane and influence the normal
metabolism of microorganisms.
800

2.1
2.0

(a)

700

(b)
Eh/mV

pH

1.9
1.9
1.8
1.8

(c)

600

2.0

control
P204
N235

500
400
300

control
P204
N235

200

M5774
P507
Cyanex272

100

M5774
P507
Cyanex272

1.7

0 1 2 3 4 5 6 7 8 9 10 11 12

0 1 2 3 4 5 6 7 8 9 10 11 12
Time(days)

Time(days)

35
Cell number/E+06

30
25
20
15
10
5

control
M5774
P204
P507
N235
Cyanex272

0
0 1 2 3 4 5 6 7 8 9 10 11 12
Time(days)

Figure 1. Effect of extractants on the (a) pH, (b) Eh and (c) cell number.
For the six clone libraries constructed, a total of 268 sequences were grouped into four
OTUs with a distance level of 2%. Rarefaction curve, which plots number of sequences
screened versus the number of OTUs observed are shown in Figure 2. Results suggested that
diversity at genus/species level was fully detected in the three samples, and also supported by
the high estimated sample coverage of six clone library (Table 1). The 4 OTUs fell into three
phylogenetic divisions: Alphaproteobacteria, Nitrospira and Gammproteobacteria (Figure 3).
Alphaproteobacteria were predominant in the clone libraries (54.48% of clones), and
Nitrospira were represented in relatively high amount (28.73% of clones). Of all the
identified sequences, 4 genus were represented. Among these genus, genus Acidiphilum,
Leptospirillum and Acidithiobacillus accounted for a high proportion; each presented 145, 77,
44 clones, respectively.

Unique OTU

4.5
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
0

50

100

150

200

Number of clones sequenced

41

250

300

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Figure 2. Collection curves of clones and unique OUT.
Table 1. Estimated diversity indices for bacterial communities in 6 clone libraries.
NDO
d=0.02
Innocula
M5774
Cyanex272
P204
P507
N235

2
4
3
3
3
2

Shannona)

1/Db)

ESC

0.442 (0.246, 0.638)


0.985 (0.768, 1.202)
1.048 (0.971, 1.125)
0.736 (0.524, 0.948)
0.568 (0.341, 0.795)
0.151 (0.283, 0.874)

1.365(3.737,0.835)
2.129(4.678,1.378)
2.906(4.452,0.879)
1.693(4.125,1.065)
1.410(12.671,0.747)
1.625(2.470,1.211)

1.000
1.000
1.000
1.000
1.000
1.000

Estimated OTUs
ACE
Chao1
2.0 (2.0, 2.0)
4.0 (4.0, 4.0)
3.0 (3.0, 3.0)
3.0 (3.0, 3.0)
3.0 (3.0, 3.0)
2.0 (2.0, 2.0)

2.0 (2.0, 2.0)


4.0 (4.0, 4.0)
3.0 (3.0, 3.0)
3.0 (3.0, 3.0)
3.0 (3.0, 3.0)
2.0 (2.0, 2.0)

NDO, Number of distinct OTUs; ESC, estimated sample coverage; d, distance level. Values in parentheses
represent the 95% confidence intervals.
a
Maximum likelihood estimator.
b
Reciprocal of Simpson's index, maximum likelihood estimator.

The distribution of acidophilic microbes in the six samples was showed in Figure 4. The
16S rRNA gene inventory revealed that the major bacterial population in the six samples
contained three species: Acidiphilum cryptum, Leptospirillum ferriphilum and
Acidithiobacillus ferrooxidans. The innocula was mainly composed of Leptospirillum
ferriphilum and Acidithiobacillus ferrooxidans. When cultivated with M5774, Cyanex272,
P204 and P507, the proportions of the two speciecs decreased, while heterophilic
Acidiphilium cryptum became the dominant population. This result is consist with our
previous studies that the sensitivity order of the three bacteria to the extractant ZJ988 from
the most to the least was L. ferriphilumAt. ferrooxidansA. organovorum [1].When
cultured with M5774 and Cyanex 272, the proportion of Acidithiobacillus ferrooxidans was
higher than Leptospirillum ferriphilum, while when cultivated with P204 and P507, the
number of Leptospirillum ferriphilum was higher. The microbial community of culture
contacted with N235 is similar to the innocula, maybe due to the strong inhibition effect.
69
100

Acidiphilium cryptum ATCC33463 (D30773)


Acidiphilium organovorum ATCC 43141 (D30775)
OTU1,145

96

Acidiphilium acidophilum ATCC 27807 (D86511)


100

Acidiphilium rubrum ATCC 35905 (D30776)

99

Alphaproteobacteria

Acidosphaera rubrifaciens HS-AP3 (D86512)


OTU4,2

99

Uncultured Acidisphaera sp. clone MB34 (FJ984549)

100

Acidithiobacillus caldus DSM 8584 (Z29975)


100

Acidithiobacillus albertensis DSM 14366 (AJ459804)

100

Acidithiobacillus thiooxidans ATCC 19377 (AY552087)


Acidithiobacillus ferrivorans NO-37 (AF376020)

99

Gammaproteobacteria

OTU3,44

55
100

Acidithiobacillus ferrooxidans ATCC 23270 (AF465604)


Leptospirillum ferrodiazotrophum UBA1 (EF065178)
Leptospirillum ferrooxidans DSM 2705 (X86776)

100

Leptospirillum ferriphilum ATCC 49881 (AF356829)

99
100
96

OTU2,77
Leptospirillum ferriphilum FTH(EF025342)

0.02

42

Nitrospirae

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Figure 3. Unrooted phylogenetic tree based on comparative analysis of 16S rRNA gene
sequence data from 6 OTUs and their close relatives. Cloned 16S rRNA sequences from 6
clone libraries are arranged as: OTU name, clone numbers. Bootstrap values=1000.
Bacteria percentage in the library

90%
80%
70%
60%
50%
40%
30%
20%
10%
0%
Innocula

M5774

Cyanex272

P204

P507

N235

Leptospirillum ferriphilum

Acidithiobacillus ferrooxidans

Acidiphilium cryptum

Acidisphaera sp.

Figure 4. Distribution of the abundance of the 16S rRNA gene in three samples.
References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]

[B.W. Chen, W.J. Li, X.Y. Liu, G.Y. Zhou and J.K. Wen: J. Cent. South Univ.
Technol. (2010) Vol. 17, p.1196
H.R. Watling, F.A. Perrot, D.W. Shiers, A. Grosheva and T.N. Richards:
Hydrometallurgy. (2009) Vol.95, p. 302
C.S. Davis-Belmar, I. Gallardo, C. Demergasso and G. Rautenbach: Hydrometallurgy.
(2012) Vol. 129-130, p. 135
C.S. Davis-Belmar, M. Acosta, V. Schoen, G. Rautenbach and C. Demergasso: Adv.
Mater. Res. (2013), Vol.825, p. 340
T. Oved, A.Shaviv and T. Goldrath: Appl. Env. Microbiol. ( 2001) Vol. 67, p. 3426
J. D. Thompson, T. J. Gibson and F. Plewniak: Nucleic Acids Research (1997) Vol. 24,
p. 4876
P. D. Schloss and J. Handelsman: Appl. Env. Microbiol. (2005) Vol. 71, p. 1501
Chao: Scand. J. Stat. (1984) Vol.11, p. 265
K. Tamura, J. Dudley, M. Nei: Molecular Biology and Evolution (2007) Vol. 24, p.
1596

43

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Ferrous Iron Oxidation in Packed-Bed Reactors at Elevated


Temperatures
Aleksandr G. Bulaev
Winogradsky Institute of Microbiology, Russian Academy of Sciences, 60-let
Oktyabrya ave. 7/2, 117312, Moscow, Russia
bulaev.inmi@yandex.ru
Keywords: iron oxidation, leaching, Sulfobacillus, Acidiplasma.
Abstract. The ferrous iron oxidation by mixed culture of moderately thermophilic
microorganisms (Sulfobacillus thermosulfidooxidans Sh 10-1 and Acidiplasma MBA-1) was
investigated in continuous experiments in three packed-bed reactors connected in series at
temperature 55C, and a pH of 1.0. Two solutions were used in the experiments. The first one
contained (g L-1) 59 Fe2+, the second one contained (g L-1) 59 Fe2+, 16 Fe3+, 2 Cu2+, 2 Zn2+.
The hydraulic retention time was 120 hours. Iron oxidation rates in the experiment with the
first solution were 0.5, 0.35, and 0.2 g L-1 h-1 in first, second and third reactor, respectively.
The oxidation rates in the experiment with the second solution were 0.3, 0.2, and 0.185 g L-1
h-1 in first, second and third reactor, respectively. Iron oxidation efficiencies in the
experiments with the first and second solutions were 77% and 47%. Stable continuous iron
oxidation at high temperature was successfully demonstrated, but further investigations are
required for improving the rate and efficiencies of oxidation.
Introduction
The ability to oxidize Fe2+ is widely distributed among acidophilic microorganisms.
Phylogenetically diverse acidophiles conserve energy for growth from Fe2+ oxidation. Due to
the high stability of ferrous iron at low pH, the acidophilic microorganisms face no
competition from the abiotic oxidation of Fe2+. Acidophilic iron oxidizers play a dominant
role in the oxidation of sulfide minerals and the extraction of metals from sulfide ores.
Sulfide minerals such as pyrite react much more rapidly with ferric iron than with O2 and the
acidophilic iron oxidizers stimulate oxidation of sulfides by reoxidizing the ferrous iron [1]:
FeS2 + 14Fe3+ + 8H2O 15Fe2+ + 16H+ + 2SO42-

(1)

4Fe2+ + 4H+ + 2 4Fe3+ + 2H2O

(2)

Besides, biooxidation of Fe2+ is important unit of the varied hydrometallurgical processes


(iron removal from mine waters, ferric leaching of different types of raw materials). In our
previous works, we demonstrated that high-temperature (50-80oC) leaching with solutions
containing ferric iron is a suitable technique for extracting of base metals from sulfidecontaining material, including sulfide ores, concentrates, and metallurgical slags [2, 3]. In the
first step, the metals are leached with ferric iron solutions, and pregnant solutions containing
iron and base metals are produced. In the second step, ferric iron should be oxidized by
microorganisms [2]. The major challenge to practical application of this technique is low rate
of oxidation of ferrous iron. Pregnant solutions produced by ferric iron leaching of sulfide
44

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
raw usually contain very high concentration of metals ((g L-1) 20-60 Fe2+, 10-20 Fe3+, 1-3
Cu2+, 2-4 Zn2+). The high concentrations of metal ions can inhibit biooxidation of ferrous iron
[4]. The application of packed bed reactors with immobilized microbial biomass is a
potentially promising technique to oxidize ferrous iron in pregnant solution [5, 6].
Most of the studies on Fe2+ oxidation kinetics have been conducted at low temperatures
with mesophilic microorganisms. At the same time, the successful results of ferric leaching
have been reached at high temperatures. Therefore biooxidation of ferrous iron at high
temperatures could be prospective from the point of view of biotechnology. In the present
work, the biooxidation of ferrous iron in packed-bed reactors in solutions containing high
concentrations of iron at 55oC was investigated.
Materials and methods
Two strains of acidophilic moderately thermophilic microorganisms were used for the
experiments (Sulfobacillus thermosulfidooxidans Sh 10-1 (JN180088) and Acidiplasma
MBA-1 (KC 432649)). Two solutions were used (Table 1). The initial pH of the solutions
was 1.0. The solutions contained basal nutrient salts ((g L-1) 0.4 MgSO47H2O, 0.2
(NH4)2SO4, 0.1 g KCl, 0.1 K2HPO4) and yeast extract (0.02%).

Solution 1
Solution 2

Table 1. Contents of metal ions in the solutions (g L-1).


Fe3+
Fe2+
Cu2+
0
59
0
16
59
2

Zn2+
0
2

pH and Eh were measured with a pH-150MA pH metermillivoltmeter. The pH was


continuously monitored, but was not controlled. The concentrations of the Fe3+ and Fe2+ ions
in the solutions were determined by reacting a sample with potassium thiocyanate and
measured the resultant reaction spectrophotometrically at a wavelength of =475 nm.
Microbial populations were monitored routinely by phase contrast microscopy.
Microorganisms in the liquid phase were quantified by Q-PCR targeting their 16S rRNA
genes. Q-PCR was carried out using SYBR Green I as a fluorescent dye. Specific 16S rRNA gene
primers
were
designed
using
NCBI
Primer-BLAST
tool
(http://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 2).
Table 2. Primers used for Q-PCR. Primers are named with respect to the target strain, their
orientation (f or r), and position.
Strain
Name
Sequence (53)
Acidiplasma sp. -1 (KC432649) Acdpl52F
CCATGCGAGTCAAGGTATCGT
Acdpl138R TTCCGAGGTTATCCCTTTCCCA
S. thermosulfidooxidans Sh 10-1 Slbc603F
TTTTAAGCCTCCGGCTCACC
(JN180088)
Slbc1070R ACCCAACATCTCACGACACG
A preliminary batch experiments with pure cultures were conducted in 250 mL
Erlenmeyer flasks containing 100 mL of solutions on a rotary shaker at 200 rpm and 55oC.
Continuous experiments were carried out in three packed bed reactors that were connected
in series at 55oC (Fig. 1).
45

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 1. Schematic representation of the packed-bed reactors.


The bioreactors were aerated with compressed air (1.5 L min-1).A mixed culture of S.
thermosulfidooxidans Sh 10-1 and Acidiplasma MBA-1 was used as inoculums. Raschig
tubes were used as the biomass carrier. The first and second reactors received 200 g and the
third reactor received 100 g of the carrier. The working liquid volumes were 200 mL within
the first and second reactors, and 100 mL within the third reactor. The hydraulic retention
time was 120 hours (48 h in the first and second reactors, 24 h in the third reactor).
Results and discussion
The results of the batch experiments are presented in the the Fig. 2. The rates of ferrous
iron oxidation by both strains were slower in the solution 2 than in the solution 1 due to the
inhibition of biooxidation by Cu2+, Zn2+, and Fe3+ cations. Ferrous iron was completely
oxidized by the strain MBA-1 within 100 and 150 hours in solution 1 and solution 2,
respectively. The strain Sh 10-1 did not oxidized ferrous iron completely within 480 hours.
The results of the batch experiments indicated that the strain MBA-1 was more tolerant to
high concentration of ferric iron and base metals ions than the strain Sh 10-1. The low pH
could also inhibit the representative of Sulfobacillus but at the start of the experiments, when
pH was low, oxidation rates were comparatively high and began to decrease after oxidation
of significant fraction of ferrous iron. In the same time, pH increased during iron oxidation
(data not shown) and reached approximately 1.4 after 240 hours of oxidation.

Figure 2. Ferrous iron oxidation in batch experiments by the strains Acidiplasma sp. -1
(A) and S. thermosulfidooxidans Sh 10-1 (B).
Solution 1 Solution 2.

46

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
A summary of the continuous experiments in the packed bed reactors is shown in Table 3.
The overall iron oxidation rates were 0.38 g L-1 h-1 and 0.23 g L-1 h-1, and overall iron
oxidation efficiencies were 77% and 47 %, in the experiments with the first and second
solutions, respectively. The ferrous oxidation rate decreased from first to third reactor
probably due to increasing of ferric iron concentration. The ferrous oxidation rates and
efficiencies in the continuous trials were significantly slower in the experiment with solution
2 than in the experiments with the solution 1 as well as in batch trials.
Q-PCR revealed that number of microorganisms in liquid in the experiment with solution
2 was an order of magnitude lower than in the experiment with solution 1. S.
thermosulfidooxidans Sh 10-1 was not detected after 10 days after the beginning of the
continuous trials in all reactors in both experiments. The results of Q-PCR were confirmed by
direct counting using the phase-contrast microscope. Cell counts in liquid were
approximately 107 and 106 cells mL-1 in the experiments with solution 1 and 2, respectively.
The elimination of S. thermosulfidooxidans Sh 10-1 in continuous trials and the results of the
batch experiments suggest that Acidiplasma sp. -1 was the main iron oxidizer in the
conditions of the experiments.
Table 3. Process performance parameters in the packed bed reactors.

Solution

Solution 1

Solution 2

Parameter
hydraulic
retention time
(h)
2+
Fe oxidation
rate
(g L-1 h-1)
Fe2+ residual
concentration
( g L-1)
Fe2+ oxidation
(%)
2+
Fe oxidation
rate
(g L-1 h-1)
Fe2+ residual
concentration
(g L-1)
Fe2+ oxidation
(%)

Reactor 1

Reactor 2

Reactor 3

Total

48

48

24

120

0.50

0.35

0.2

0.38

34.64

17.7

12.75

12.75

41.3

29

77

0.30

0.20

0.185

0.23

44.7

35.1

30.66

30.66

24

16

47

Conclusions
The ferrous iron oxidation using moderately thermophilic microorganisms was
investigated in continuous culture. The results suggest that Acidiplasma sp. -1 was the
dominating iron oxidizer. Stable continuous iron oxidation at high temperature was
successfully demonstrated, but further investigations are required for improving the rate and
efficiencies of oxidation.
47

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Acknowledgments
The work was supported by the Russian Foundation for Basic Research, project no. 14-0431210 mol_a.
References
[1] A. Shippers and W. Sand: Appl. and Environm. Microbiol Vol. 65 (1999), p. 319-321.
[2] M. Muravyov, A. Bulaev and T. Kondrateva: Min. Eng Vol. 64 (2014), p. 63-66.
[3] M. Muravyov and A. Bulaev. Min. Eng Vol. 45 (2013), p. 108-114.
[4] D.E. Rawlings, H. Tributsch and G.S. Hansford: Microbiology Vol. 145 (1999), p. 5-13.
[5] S. Grishin and O. Tuovinen: Appl. and Environm. Microbiol Vol. 54 (1988), p. 30923100.
[6] P. Kinnunen and J. Puhakka: Biotech and Bioeng Vol. 85 (2004), p. 698-705.

48

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Microbially Supported Recovery of Precious Metals and Rare Earth


Elements from Urban Household Waste Incineration Slag
E. Marie Muehe1,2,a*, Caroline Schmidt1,b , Jing He1,c, Thomas Helle3,d
and Andreas Kappler1,e
1Geomicrobiology

Group, Center for Applied Geosciences, Hoelderlinstr. 12,


University of Tuebingen, 72074 Tuebingen, Germany

2Soil

and Environmental Biogeochemistry Group, Environmental Earth System


Science, 473 Via Ortega, Stanford University, Stanford, CA 94305-4015, USA
3Novis

GmbH, Vor dem Kreuzberg 17, 72070 Tuebingen, Germany

a,*correspondence:

mmuehe@stanford.edu, bcaroline.schmidt@uni-tuebingen.de,
cjhe11@foxmail.com, dthomas.helle@novis.com, eandreas.kappler@unituebingen.de

Keywords:
leaching,
bioleaching,
biotic,
acidophilic,
biohydrometallurgy, metal recovery, society, waste management.

biogeochemistry,

Abstract. The use of precious metals and Rare Earth Elements in electronic, medical, and
automobile industries is drastically increasing. To meet this demand and to escape the
financial pressure of the global metal market, not only mining activities but recently also the
recovery of these elements from industrial and urban household waste is in the focus of
research. It has been shown that the application of extracting solutions with pH values lower
than 4 lead to an economically feasible recovery of industrially precious metals. It is unclear,
however, whether and to which extent this abiotic extraction efficiency can potentially be
increased by using microorganisms capable of dissolving more stable minerals at low pH.
The goal of this project therefore is to first view urban household waste as a resource for
metals and evaluate combined abiotic and biotic extraction procedures for an increase in
metal extraction efficiency.
Introduction and Motivation
Currently, the market and price level of metal raw materials are dominated by single states
(i.e. China) that own monopole rights on most precious metal and Rare Earth element mining
areas worldwide [1]. Thus, to ensure independence from these monopoles, alternative
resources for (precious) metals and Rare Earth elements need to be exploited to meet the
increasing societal demand for these elements [2].
One of these alternatives are urban household wastes, which originate from a wide range
of metal-containing residuals based on plastics, paper and woods, metals, and organics. By
incinerating the waste to carbon-poor slags, metals-fractions in the slag are concentrated in
the slag and make up several weight percent therein (Table 1). These waste incineration slags
are usually buried at waste disposal sites or are used as construction agent (see Fig. 1) [3]; at
higher expense of the company as slags are often categorized as metal-containing, and thus,
hazardous materials. Such waste deposition not only causes a potential threat to the
environment in case of metal leaching [3] but also translates into a direct loss of metals for
use in industry and into financial and trade dependences on metal monopole states.
49

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Thus, the effective recovery of
(precious) metals and Rare Earth
elements from urban household
waste should be considered as
potential
alternative
for
sustainable, economic, and ecofriendly metal resource.
Conceptual Approach
Instead of viewing urban
household waste as a final product
only suitable for deposition, it
should be viewed as a resource for
metals and construction material
(Fig. 1).
A
regional
waste
incineration plant in Southwest
Germany produces approximately
Figure 1. Comparison of the classic approach for
170 000 tons of urban household
waste flow after its production compared to the
waste incineration slag per year.
here proposed novel view of seeing waste as a
The amounts of common (Fe, Al,
resource for metals and eco-friendly construction
Cr, Ni, Cu), precious (Ag, Pt,
material.
Au) and Rare Earth (Tm, Nd)
metals in these wastes add up to several thousand tons per year (Table 1). Considering the
current market values of these metals shows that 170 000 tons of slag per year contain
approximately 48 million Euros worth of metals (Table 1). Assuming a global production of
300 million tons of urban household waste per year (equals approximately 80 million tons of
incineration slag), the value of metal present in the slag can be extrapolated to approximately
20 trillion Euros. Thus, the recovery of these metals from household waste incineration slag
and their subsequent re-feeding into industries would meet our societal metal requirements
with fewer industrial, economic, and financial ties to metal monopoly nations (Fig. 1).
Furthermore, the residual slag contains significantly less metal after leaching, thus
transforming the residual slag into an eco-friendly resource for construction material used in
road and building works. So overall, urban household waste needs to be viewed as a resource
that enters the cycle from societal disposal to societal use (Fig. 1).
Table 1: Selected metals and Rare Earth elements (content and their value in Euros)
present in urban household waste incineration slag produced in a waste incineration plant in
Southwest Germany. Approximately 170 000 tons of slag are produced annually

50

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
To achieve this, innovative and effective strategies for (precious) metal and Rare Earth
element recovery from urban household waste needs to be developed. For materials with a
low metal content microbial leaching strategies seem most economically and ecologically
feasible for the effective recovery of (precious) and Rare Earth metals [4,5].
Experimental Approach
Bioleaching of different mineral ores
and mine materials was shown to be
effective with different types of
autotrophic
and
heterotrophic
microorganisms oxidizing Fe(II) and/or
sulfur compounds [5]. However,
incineration slags are geochemically
very different to highly defined mineral
ores and mine materials. Incinerations
slags are high in pH (pH of
approximately 12) and very diverse in
their mineralogy, bearing all kinds of
metals in very low concentrations.
Efficient chemical leaching (defined as
leaching of at least 20% of the total
amount of an element) of urban
household waste incineration slag was
achieved in our laboratory when the pH
of the slag was adapted to below 4. For
example, Cr was leached up to 40% of
its total content from household waste
Figure 2: Microbial enrichments from
incineration slag after 24 hours by
sediments of the Rio Tinto, Spain, in the
applying analytical-grade sulfuric acid to
presence of urban household incineration
the slag setting the pH to 2.5 (data not
slag. (A) Enrichment bottles with elemental

shown). Similar efficiency could for


sulfur and 10 mM ferrous sulfate. (B) Syto 9
example be obtained for Al (~50%), Mn
DNA stain of cells of an enrichment (seen in
(~70%), Co (~45%), Tm (~30%) (data
green) associated with the slag (seen in
not shown). To further increase the
bright-field grey).
leaching efficiency of the slag material,
microorganisms are considered for bioleaching. A number of different cultivated and in the
literature well-described Bacteria (including Acidithiobacillus ferrooxidans [6,7] and
Acidiphilium sp. SJH [8]) were investigated for high leaching efficiency of urban household
waste incineration slag adapted to a pH of 3 to 4. In order to maximize the bioleaching
efficiency of the slag, microbial consortia were also enriched from sediments of the highly
acidic and metal-contaminated river Rio Tinto in Spain [9]. These enrichments were
performed in the presence of the incineration slag with the purpose to only enrich
microorganisms able to thrive under the geochemical properties of the slag. Microbial
enrichment cultures were successfully cultivated in the presence and absence of electron
donors such as FeIISO4 and elemental sulfur (Fig. 2A). Microscopic localization of enriched
microbial consortium using a DNA stain showed that the cells are associated with the slag
material (Fig. 2B).
51

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Summary
Urban household waste holds a lot of potential for recovering precious metals and Rare
Earth elements. Since the incineration product slag is mineralogically very diverse and
contains low quantities of metals, microbially supported leaching is the strategy of choice to
recover these elements. Once the metals are removed from the slag, the slag becomes also a
valuable resource for urban construction. Thus, a smart, sustainable and economically
valuable concept is here developed to convert urban waste via effective recycling into a
precious resource contributing to zero waste management.
References
[1] G. Haxel, J. Hedrick and J. Orris, Rare Earth Elements Critical Resources for High
Technology, in: United States Geological Survey, USGS Fact Sheet 08702, VA, 2006.
[2] E. Alonso, A.M. Sherman, T.J. Wallington, M.P. Everson, F.R. Field, R. Rot and R.E.
Kirchain, Environ. Sci. Technol. 46-6 (2012) 3406
[3] C.H.K. Lam, A.W.M. Ip, J.P. Barford and G. McKay, Sustainability 2-7 (2010) 1943
[4] H. Brandl, Rec. Res. Dev. Microbiol. 6 (2002) 571
[5] A. Schippers, F. Glombitza and W. Sand, Geobiotechnology 1 Metal-related Issues, in:
T. Scheper (Eds.), Advances in Biochemical Engineering/Biotechnology 141, Springer,
2014.
[6] C. Remsen and D.G. Lundgren, J. Bacteriol. 92 (1966) 1765.
[7] D.R. Rawlings and D.B. Johnson, Biomining, Springer, 2007.
[8] D.B. Johnson and T.A.M. Bridge, J. Appl. Microbiol. 92-2 (2002) 315
[9] R.A. Davis Jr, A.T. Welty, J. Borrego, J.A. Morales, J.G. Pendon and J.G. Ryan,
Environ. Geol. 39-10 (2000) 1107

52

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Iron Oxidation and Jarosite Precipitation in a Continuous TwoStage 70C Archaeal Bioreactor
Anna H Kaksonen1,a, Christina Morris1, Jason Wylie1, Jian Li2, Kayley
Usher1, Felipe Hilario3,b, Chris du Plessis4
1CSIRO

Land and Water Flagship, 147 Underwood Avenue, Floreat, WA 6014,


Australia

2CSIRO

3Vale

Mineral Resources Flagship, 7 Conlon Street, Waterford, WA, 6152,


Australia

- Mineral Projects and Technology Department - BR381 Km 450, Distrito


Industrial Simo da Cunha Santa Luzia, Minas Gerais, Brazil
4Metalobus

Pty Ltd, Perth, Australia

aanna.kaksonen@csiro.au

Keywords: archaea, bioreactor, contaminant, iron, jarosite, oxidation, precipitation.


Abstract. This study is the first demonstration of a continuous culture bio-catalysed iron
oxidation and jarosite precipitation reactor using thermophilic archea, for use in
hydrometallurgical process flow sheets. A two-stage continuous stirred tank reactor (CSTR)
system comprised of two CSTRs, each with its own settler, was operated for biological iron
oxidation and precipitation at 70C. The two-stage design was to allow the growth of
microorganisms that prefer various redox regimes. The bioreactors were inoculated with a
mixed culture of extreme thermophilic iron oxidisers from genera Acidianus, Metallosphaera
and Sulfolobus. The influent (pH 1.5) contained (g L-1) 15 Fe2+, 1.5 Cu, 1.5 Ni (all as
sulfates), nutrients and trace elements. At a hydraulic retention time (HRT) of 6-7 h in each
CSTR, the overall iron oxidation rate was 1.00.1 g L-1 h-1 and percent 972%. The pH
values were 1.380.16 and 1.570.05, and redox potentials (Ag/AgCl reference) were
47447 mV and 5751 mV, in CSTR1 and CSTR2, respectively. The percentages of influent
Fe, Cu and Ni removed as precipitates from settlers were 52%, 0.46% and 0.03%,
respectively. The precipitates were comprised of jarosite (100%), potassium jarosite being the
dominant form (38-51%), followed by hydronium (30-35%), ammonium (13-18%) and
sodium jarosites (6-9%). The precipitates had a sludge volume index of 5.8-19 mL g-1,
indicating good settling properties facilitating easy removal through settling. The
simultaneous and instantaneous addition of contaminants (g L-1: 2.0 Al, 0.05 As, 0.05 F, 0.2
Co, 5.0 Mg and 0.4 Mn), potentially contained in hydrometallurgical processing streams, into
the influent decreased the iron oxidation (50% overall oxidation with HRT of 26-29 h in each
CSTR) and jarosite content in precipitates (85-87%). In conclusion, the two-stage hightemperature CSTR system allowed iron oxidation and precipitation of the oxidised iron in the
form of well settling jarosite with only minor loss of Cu and Ni via co-precipitation.
However, the bioreactor performance was hampered by the introduction of other transition
metals, fluoride and arsenic.

53

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Introduction
Biologically catalysed Fe2+ oxidation (reaction 1) is preferred over abiotic oxidation for
the regeneration of Fe3+ as a lixiviant for sulphide oxidation and excess iron removal, as it is
several orders of magnitude faster than abiotic oxidation at low pH [1].
Fe2+ + H+ + 0.25 O2 Fe3+ + 0.5 H2O
(1)
Jarosite (AFe3(SO4)2(OH)6) formation (reaction 2) is common at low pH (< 2) [2] and
involves the incorporation of a monovalent cation A, such as ammonium (NH4+),
potassium (K+), sodium (Na+) or hydronium (H3O+) [2].
A+ + 3 Fe3+ + 2 SO42- + 6 H2O AFe3(SO4)2(OH)6 + 6H+
(2)
Bioleaching microorganisms have been reported to have a varying tolerance to high redox
potentials and/or Fe3+ concentration [3]. du Plessis et al. [4] proposed a two-stage reactor
configuration for biological Fe2+ oxidation and Fe3+ precipitation. Partial Fe2+ oxidation is
achieved in the first reactor which is maintained at a relatively low redox potential (c.a. 450
470 mV vs. Ag/AgCl). Complete iron oxidation can then be achieved in the second reactor at
a higher redox potential by species that favour higher redox potentials and have a higher Fe3+
tolerance. Kaksonen et al. [5-6] recently demonstrated the two-stage bioreactor concept using
mesophilic cultures in a CSTR system at room temperature (23C). The aim of this work was
to determine performance parameters at extremophile temperature conditions (70C) using
archaea, in contrast to earlier mesophilic conditions using bacteria [5-6]. Determination of
these parameters is important for the evaluation of Fe2+ oxidation and jarosite precipitation in
a two-stage CSTR which could be used for a variety of hydrometallurgical flow sheets where
Fe3+ may be required as an oxidant, or where ferric iron removal is required at elevated
temperatures.
Materials and methods
A two-stage CSTR system comprised of two 0.7 L CSTRs, each with its own settler (0.652 L), was operated to achieve iron oxidation and precipitation at 70C. The bioreactors were
aerated with compressed air (4.5 L min-1) moisturised with Dreschel bottles filled with water.
The reactors did not contain any biomass growth-support media, thereby facilitating ease of
aeration and mixing, and allowing for jarosite precipitate to be continuously removed from
the system. Jarosite precipitate sludge from settlers 1 and 2 was recycled back into
bioreactors 1 and 2 at a flow rate of 100-300 mL min-1. Excess sludge was intermittently
removed from the settlers using a peristaltic pump as previously described [5-6]. The
bioreactors were inoculated with a combination of extreme thermophilic archaea strains of
Acidianus (A.) ambivalens, A. brierley, A. infernus, Metallosphaera (M.) sedula, M.
hakonensis, Sulfolobus (S.) shibatae and S. metallicus. The influent (pH 1.5) contained (g L-1)
15 Fe2+, 1.5 Cu, 1.5 Ni (all as sulfates) nutrients and trace elements. At a later stage
contaminants (g L-1: 2.0 Al, 0.05 As, 0.05 F, 0.2 Co, 5.0 Mg and 0.4 Mn) were
simultaneously and instantaneously added to the influent to evaluate their effect on the
process. The bioreactor influents and reactor solutions were sampled for pH (TPS smartCHEM meter with pH TPS sensor), redox potential (mV versus Ag/AgCl reference)
(IONODE ORP Comb Electrode, Model PRFO), Fe2+ (colorimetric ortho-phenanthroline
method, according to standard method 3500-Fe [7]) and soluble Fe, Ni, Cu and S analysis (by
inductively coupled plasma atom emission spectrometry (ICP-AES)). Solid contents were
quantified by total suspended solids (TSS) by standard method 2540 D [8]. The elemental
54

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
composition of the precipitates was analysed by Leco (S), Kjehdahl nitrogen (N), and ICPAES (other elements) and mineralogical composition by quantitative X-ray diffraction
(QXRD). With respect to jarosite composition, inferred abundance of monovalent cation A
as H3O+ was calculated based on the elemental composition of the precipitates assuming that
mol-% of [H3O+] = 1 [K+] [Na+] [NH4+]. The particle sizes of the precipitates in the
absence of contaminants were analysed by laser diffraction based analysis using Malvern
2000 mastersizer, and sludge settling characteristics by sludge volume index (SVI) [9].
Precipitates and microorganisms were visualised by scanning electron microscopy (SEM)
using Zeiss 1555 VP-FESEM. Microbial cells were counted by phase contrast microscopy
using Leica DM-4000 and a Helber bacteria counting chamber (Thoma ruling).
Results and discussion
A summary of the process performance of the two-stage high-temperature CSTR system is
shown in Table 1. With a HRT of 6-7 h in each CSTR, the overall iron oxidation rate and
percent were 1.0 0.1 g L-1 h-1 and 97 2%, respectively, which were similar to those
observed in the 23C CSTR system (1.0-1.1 g L-1 h-1 and 96-99%, respectively) [5]. The
addition of contaminants into the influent decreased the archaeal cell numbers, and iron
oxidation rate and percent (Table 1). Contents of selected elements in the precipitates formed
in the 70C CSTRs are shown in Table 2. The percent of influent Fe, Cu and Ni removed as
precipitates in bleed from settlers as calculated based on the TSS concentration in the settler
underflow and concentrations of various elements in the removed solids were 52%, 0.46%
and 0.03%, respectively. A high iron removal rate and low Cu and Ni loss (i.e. <1%) is a
desirable feature. The precipitates were predominantly jarosite with a general formula of
(A)Fe3(OH)6(SO4)2 (Table 3). Potassium jarosite was the dominant form of jarosite, followed
by hydronium, ammonium and sodium jarosites (Table 3). The addition of contaminants into
the influent decreased the jarosite content in precipitates (Table 3).
Table 1. Key process performance parameters for the 70C CSTR system.
Parameter
Reactor
Without contaminants
With contaminants
HRT11.50
= 7 h;
HRT1=1.54
26 h;
HRT
0.07 2 = 6
HRT
0.01 2 = 29
Influent
h;
HRT
=
13
h
h;
HRT
= 55 h
1.38 total
0.16
1.56 total
0.02
pH
CSTR-1
1.57 0.05
1.55 0.01
CSTR-2
387 1
374 1
Influent
474 47
424 0
Redox potential (mV)
CSTR-1
575 1
442 0
CSTR-2
62 36
46 1
CSTR-1
35 34
49
Fe oxidation (%)
CSTR-2
Overall
97 2
50 9
1.3 0.7
0.24 0.01
CSTR-1
Fe oxidation rate (g L-1 h0.7 0.7
<0.01
CSTR-2
1)
Overall
1.0 0.1
0.12 0.02
191 15
33 19
CSTR-1
TSS (g L-1)
0.5 0.7
12.1 0.1
CSTR-2
4.3108 3.8 108
9.5106 7.8106
CSTR-1
Cell count (cells mL-1)
8
8
2.410 0.8 10
2.5107 0.1107
CSTR-2

55

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
The removal of contaminants in the CSTR system by co-precipitation was estimated to be 28
1% Al, 67 1% As, 25 1% Co, 26 1% Mg and 26 1% Mn relative to that contained in
the solution influent. The high removal rate of As is particularly noteworthy and
demonstrates the potential use of the method removal of typical solution contaminants prior
to the addition of neutralizing reagents. Results from the particles size distribution of the
precipitates removed from the settlers is shown in Table 4. The SVIs for the precipitates were
5.8 mL g-1 and 19 mL g-1 in CSTR1 and CSTR2, respectively, indicating good settling
characteristics important for larger scale industrial processes. Examples of SEM images for
precipitates and microorganisms obtained from the CSTR system are shown in Fig. 1.
Table 2. Contents (weight %) of selected elements in the precipitates formed in the 70C
CSTRs.
Contaminants
Element
Fe
S
K
N
Na
Cu
Ni
No
CSTR1
31.5
11.9
4.01
0.371 0.297 0.027 <0.002
No
CSTR2
30.7
11.6
3.04
0.516 0.427 0.032 <0.002
Yes
CSTR1
30.5
11.4
5.23
0.697 0.172 0.020 <0.002
Yes
CSTR2
32.2
9.1
3.42
0.844 0.309 0.018 <0.002
Table 3. Mineralogical composition (weight %) of the precipitates formed in the 70C
CSTRs.
Jarosite Unaccounted
Type of jarosite (%)
Contaminants
Reactor
(%)
(%)
K
H3O
NH4+
Na
No
CSTR1
100
0
51
30
13
6
No
CSTR2
100
0
38
35
18
9
Yes
CSTR1
87
13
76
0
a*
b*
Yes
CSTR2
85
15
50
7
35
8
*(a+b) = 1-0.76 (The precipitates likely contained N and Na additionally in other forms than
jarosite and hence it was not possible to determine the distribution of these elements in the
jarosites).
Table 4. Particle size analysis results for precipitates formed in the 70C CSTR system.
Parameter
CSTR1
CSTR2
Volume weighed mean assuming particle sphericity (m)
13.9
21.2
Surface weighed mean (m)
6.57
4.13
Specific surface area (m2 cm-3)
0.913
1.45
d(0.5) (m)
12.9
9.85
P80 (m)
19.2
17.3
B

1 m

1 m

Figure 1. SEM images of precipitates (A) and microbial cells (B) from the 70C CSTR
system. The white arrows point out examples of lobed cells.
56

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Conclusions
Laboratory-scale experiments provided the first demonstration of the key process
performance parameters for a two-stage CSTR system for archaea-catalysed biological iron
oxidation and precipitation at elevated temperatures. The system enabled the removal of
ferric iron as jarosite with only minor loss of Cu (0.46%) and Ni (0.03%) via co-precipitation.
The iron oxidation rate and extent at 70C were similar to those observed at 23C. The
inhibitory effect of the suite contaminants was significant, although prolonged exposure to
the contaminant conditions may result in adaptation. The introduction of contaminants
decreased the iron oxidation percent from 97% to 50% and the jarosite content in precipitates
from 100% to 85-87%. The results demonstrate that high temperature ferrous iron oxidation
can be used in higher temperature hydrometallurgical process flow sheets where ferric iron is
required as an oxidant and/or where ferrous iron removal is required.
Acknowledgments
Financial support from Vale and CSIRO Mineral resources Flagship, technical support
from Naomi McSweeney and helpful comments from Denis Shiers and David Collinson are
acknowledged.
References
[1] D.E. Rawlings, Annual Reviews of Microbiology Vol. 56 (2002) 65.
[2] J.P. Gramp, F.S. Jones, J.M. Bigham and O.H. Tuovinen, Hydrometallurgy Vol. 94 (2008)
29.
[3] D.E. Rawlings, H. Tributsch and G.S. Hansford, Microbiology Vol. 145 (1999) 5.
[4] C. du Plessis, W. Slabbert, K.B. Hallberg and D.B. Johnson, Hydrometallurgy Vol. 109
(2011) 221.
[5] A.H. Kaksonen, C. Morris, S. Rea, J. Li, J. Wylie, K. Usher, M.P. Ginige, K.Y. Cheng,
F. Hilario and C. du Plessis, Hydrometallurgy Vol. 147-148 (2014) 255.
[6] A.H. Kaksonen, C. Morris, S. Rea, J. Li, K. Usher, R.G. McDonald, F. Hilario, T.
Hosken, M. Jackson and C. du Plessis, Hydrometallurgy Vol. 147-148 (2014) 264.
[7] 3500-Fe, Standard methods for the examination of water & wastewater 18th Ed APHA
AWWA WEF 1992.
[8] 2540 D, Total Suspended Solids Dried at 103105C Standard methods for the
examination of water & wastewater 20th Ed. APHA, AWWA, WEF,1998.
[9] 2710 D, Sludge volume index, Standard Methods for the Examination of Water &
Wastewater 20th Ed. APHA, AWWA, WEF, 1998.

57

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Use of Phosphate Solubilizing Bacteria to Leach Rare Earth


Elements from Monazite-Bearing Ore
Doyun Shina*, Byung-su Kimb, Jinki Jeongc, and Jae-chun Leed
Mineral Resources Resource Division, Korea Institute of Geoscience and Mineral
Resources (KIGAM), Gwahangno 124, Yuseong-gu, Daejeon 305-350, Republic of
Korea
Korea University of Science and Technology, Gajeongno 217, Yuseong-gu, Daejeon
305-350, Republic of Korea
a,*correspondence:

doyun12@kigam.re.kr, +82-42-868-3616

b bskim@kigam.re.kr, c

jinkiz@kigam.re.kr, d jclee@kigam.re.kr

Keywords: rare earth element; phosphate solubilizing bacteria; monazite;


bioleaching.
Abstract. In the present study, the feasibility to use phosphate solubilizing bacteria (PSB)
was determined to develop a biological leaching process of rare earth elements (REE) from
monazite-bearing ore. To predict REE leaching capacity of bacteria, the phosphate
solubilizing abilities of 10 species of PSB were determined by halo zone formation on Reyes
minimal agar media supplemented with bromo cresol green and phosphate solubilization test
in Reyes minimal liquid media as the screening studies. Calcium phosphate was used as a
model mineral phosphate. Among the test PSB strains, Pseudomonas fluorescens, P. putida,
P. rhizosphaerae, Mesorhizobium ciceri, Bacillus megaterium, and Acetobacter aceti formed
halo zones, with the zone of A. aceti being the widest. In the phosphate solubilization test in
liquid media, Azospirillum lipoferum, P. rhizosphaerae, B. megaterium, and Acetobacter
aceti caused the leaching of 6.4%, 6.9%, 7.5%, and 32.5% of calcium, respectively. When
PSB were used to leach REE from monazite-bearing ore, ~5.7 mg/L of cerium and ~2.8 mg/L
of lanthanum were leached by A. aceti, and Azospirillum brasilense, A. lipoferum, P.
rhizosphaerae, and M. ciceri leached 0.51 mg/L of both cerium and lanthanum, as measured
by concentrations in the leaching liquor. These results indicate that determination of halo
zone formation was found as a useful method to select high-capacity bacteria in REE
leaching. However, as the leaching efficiency determined in our experiments was low, even
in the presence of A. aceti, further studies are underway to enhance leaching efficiency by
selecting other microorganisms based on halo zone formation.
Introduction
Biohydrometallurgical technology is an attractive alternative emerging green technology
for the recovery of metals due to its environmental friendly, simple, and economic process.
However, very few works have been published in biological recovery of rare earth elements,
in particular, from monazite. Recently thorium, uranium, and rare earth elements (REE)
extraction by microorganisms from monazite concentrate was reported [1, 2]. The authors
used Aspergillus ficuum, organic acid producing fungi, and Pseudomonas aeruginosa,
organic acid/siderophore producing bacteria. Another study on REE leaching from phosphate
58

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
minerals apatite and monazite by organic acids such as citrate, oxalate, phthalate, and
salicylate was also published, even though chemical organic acids were used in this study,
which were not biologically produced [3]. Organic acid producing microorganisms secrete
organic acids such as malic, gluconic, or oxalic acids [4, 5], and the mechanism of metal
dissolution by the microorganisms is both of acidolysis (protons dissociated from the organic
acids) and complexolysis (metal-complexing anions from the acids) [6].
In a soil improvement process, phosphate solubilizing bacteria (PSB) have been widely
used because they affect the release of phosphorous (P) from inorganic and organic P pools
through solubilization and mineralization [7-9] by organic acid production. In the present
study, we investigated the feasibility to use PSB in REE leaching from monazite-bearing ore
as an exploratory study. Screening studies were performed by determining halo zone
formation on agar media and phosphate solubilization in liquid media to predict REE
leaching capacity of bacteria. The REE leaching abilities of the PSB from monazite-bearing
ore were determined and compared with the screening data.
Experimental setup
Bacteria. Ten PSB strains, Pseudomonas rhizosphaerae DSM 16299T [10], P. putida
DSM 291T, P. fluorescens DSM 50090T [11], Bacillus megaterium DSM 32T [12],
Paenibacillus polymyxa DSM 36T [8], Ensifer meliloti DSM 30135 [13], Azospirillum
brasilense DSM 1690T, A. lipoferum DSM 1842 [11], Mesorhizobium ciceri, and Acetobacter
aceti DSM 2002 were selected, purchased from Deutsche Sammlung von Mikroorganismen
und Zellkulturen, and maintained on nutrient agar (NA) at 30C. For a phosphate
solubilization test and the REE leaching study, Reyes minimal medium (in 1 L: 0.4 g NH4Cl;
0.78 g KNO3; 0.1 g NaCl; 0.5 g MgSO4.7H2O; 0.1 g CaCl2.2H2O; 0.5 mg FeSO4.7H2O; 1.56
mg MnSO4.H2O; 1.40 mg ZnSO4.7H2O) [14] was used.
Comparison of halo zone formation, organic acid production, and phosphate
solubilization by phosphate solubilizing bacteria. Halo zone formation by test PSB strains
were tested using Reyes minimal medium supplemented with 1.5% agar, 5.39 g/L Ca3(PO4)2
as a mineral phosphate, 30 g/L glucose or sucrose as a carbon source, and bromocresol green
(BCG) as a pH indicator. The total halo diameter and colony diameter were measured; halo
size was calculated by subtracting the colony diameter from the total halo diameter. A
quantitative estimate of organic acid production by the PSB was measured in Reyes minimal
medium supplemented with 0.45 g/L KH2PO4 and 30 g/L glucose. Phosphate solubilization
by the test PSB in liquid media was determined in Reyes minimal medium supplemented
with Ca3(PO4)2 (5.39 g/L) and glucose (30 g/L).
Monazite-bearing ore leaching by phosphate solubilizing bacteria. The monazitebearing ore was ground and then sieved below 150 m. A solution of 30 mL Reyes minimal
medium (prepared as above) containing 30 g/L of glucose and the PSB was added to 50-mL
conical tubes containing 5 g of the autoclaved ore. Total cerium and lanthanum
concentrations in the residue and the liquor were determined by ICP and the mineralogical
change of the residue was analyzed by SEM-EDS and XRD.

59

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Results and discussion
The halo zone formation was determined as a screening study to investigate the phosphate
solubilizing ability of the 10 test PSB strains (Table 1). Due to the production of organic
acids into surrounding medium, the halo zone on the agar plate is formed by converting
insoluble into soluble phosphate [15]. Ca3(PO4)2 was used this study as a mineral phosphate.
The test PSB formed different sizes of distinct halo zones on the media depending on the
bacterial strain and carbon source. The widest halo zone was observed in the presence of A.
aceti (diameter, 41.0 mm) on media supplemented with glucose; P. rhizosphaerae, P.
fluorescens, B. megaterium, and M. ciceri also formed halo zones, while P. polymyxa, E.
meliloti, A. brasilense, and A. lipoferum did not form halo zones on the media supplemented
with either glucose or sucrose. The phosphate solubilization test in liquid media was also
performed using Ca3(PO4)2. The highest leaching efficiencies after 3 days of leaching were
presented by A. lipoferum, P. rhizosphaerae, and B. megaterium (6.4%, 6.9%, and 7.5%,
respectively, for calcium; and 3.7%, 6.8%, and 5.7%, respectively, for phosphate; leaching
efficiencies by A. brasilense and E. meliloti were less than 2% for calcium; as expected, A.
aceti showed the highest leaching efficiency of calcium (~32.5%).

Table 1. Comparison of tricalcium phosphate solubilization by phosphate solubilizing


bacteria (PSB) in Reyes minimal agar medium supplemented with bromocresol green (BCG)
and 30 g/L of glucose or sucrose, associated with microbial growth for 24 h.
Halo size (mm)*
Bacterial species
Glucose
Sucrose
T
P. rhizosphaerae DSM 16299
13.5
13.4
T
**
P. putida DSM 291
7.2
P. fluorescens DSM 50090T
5.6
7.8
T
B. megaterium DSM 32
4.7
12.1
P. polymyxa DSM 36T
T
E. meliloti DSM 30135
A. brasilense DSM 1690T
A. lipoferum DSM 1842
M. ciceri
5.1
4.4
A. aceti DSM 2002
41.0
12.58
* The total halo diameter and colony diameter were measured; halo size was calculated by
subtracting the colony diameter from the total halo diameter.
** - represents no halo zone formation
The test PSB strains showed organic acid production below ~0.2 mmol, except for A. aceti.
The maximum malic acid produced by A. brasilense, A. lipoferum, M. ciceri, and P.
rhizosphaerae occurred at 0.07 mmol at 6 days, 0.09 mmol at 9 days, 0.06 mmol at 8 days,
and 0.18 mmol at 6 days, respectively (maximum production). Acetic acid was produced by
A. aceti, with concentrations reaching a maximum of 15.8 mM (0.48 mmol) at 4 days of
incubation. The pH of the media during incubation showed similar trends with organic acid
production.
Ten PSB were introduced to leach REE from monazite-bearing ore. We detected ~5.7
mg/L of cerium (0.13% of leaching efficiency) and 2.8 mg/L of lanthanum (0.11%) in the
60

Concentration of cerium in the leachi

P. polymyxa
E. melioti
A. brasilens
A. lipoferum
M. ciceri
A. aceti

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
2
Inna Grand Bali Beach Hotel
Bali, Indonesia
1

Concentration of lanthanum in the leaching liquor (mg/L)

Concentration of cerium in the leaching liquor (mg/L)

0
leaching liquor of A. aceti, and approximately 0.5 1 mg/L
of cerium and lanthanum (0.005 0
2
4
6
10
0.01%) in the leaching liquors of A. brasilense, A. lipoferum, P.
rhizosphaerae,
and8M. ciceri
Incubation time (day)
(Figure 1).

Ce

P. rhizosphaerae
P. fluorescens
P. putida
B. megaterium
P. polymyxa
E. melioti
A. brasilens
A. lipoferum
M. ciceri
A. aceti

0
0

10

Concentration of lanthanum in the leaching liquor (mg/L)

Incubation time (day)

La

P. rhizosphaerae
P. fluorescens
P. putida
B. megaterium
P. polymyxa
E. melioti
A. brasilens
A. lipoferum
M. ciceri
A. aceti

0
0

10

Incubation time (day)

6
Figure
1. The concentrations of leached cerium and lanthanum from monazite-bearing ore by
La
P. rhizosphaerae
phosphate solubilizing
bacteria (PSB) in Reyes basal liquid medium.
P. fluorescens
5

P. putida
B. megaterium
P. polymyxa
E. melioti
A. brasilens
A. lipoferum
M. ciceri
A. aceti

Differently from the phosphate solubilization test in liquid media, P. fluorescens, P. putida,
4
B. megaterium,
and P. polymyxa did not leach REE from the monazite-bearing ore. In the
case of A. brasilense and A. lipoferum, even though they leached REE from the ore in spite of
small3 leaching efficiency and produced similar amounts of malic acid with M. ciceri and P.
rhizosphaerae, they did not form halo zones. This discrepancy sometimes happens because of
2
the difference
between cultivation in liquid media and on agar media. A liquid medium is
preferred for the production of such organic acid because excreted products are readily
1
available
from a liquid culture and the cells are uniformly exposed to conditions of the
medium [16]. However, the strongest leaching of REE was observed in the presence of A.
aceti,0 0 as expected
by the 6 both results
of the halo zone formation and the phosphate
2
4
8
10
solubilization test.
In
the
case
of
lowcapacity
bacteria, some errors may occur as stated
Incubation time (day)
above in determination of halo zone formation, but this method is still useful to roughly
estimate phosphate solubilizing and organic acid producing abilities, as well as REE leaching
capacities. Because phosphate solubilization test for each bacterial strain takes long
experimental time and expensive procedures, if a simple and rapid screening method is
needed to select high-capacity bacteria in REE leaching, determination of halo zone
formation can be used. However, even though A. aceti showed the highest leaching efficiency
of the PSB tested, the efficiency of extraction was only ~0.13% (at least in batch-type
experiments), which is still very low. Thus, further studies are underway to explore the use of
other microorganisms with good organic acid producing abilities for REE extraction
applications, as well as to design continuous leaching systems.
Conclusions
The present study was conducted to use PSB to leach REE from monazite-bearing ore and
predict REE leaching ability of PSB by determining halo zone formation on agar media and
61

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
phosphate solubilization in liquid media. Among the ten test PSB strains, the phosphate
solubilizing ability of A. aceti was the highest, based on results of halo zone formation and
the phosphate solubilization test. Based on REE leaching data from the raw monazite-bearing
ore by the test PSB, halo zone formation was found as a useful method to select high-capacity
bacteria in REE leaching.
References
[1]
[2]
[3]
[4]
[5]
[6]

[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]

O.A. Desouky, et al.: Arabian J. Chem. (2011) Vol. p.


W.A.G. Hassanien, O.A.N. Desouky, and S.S.E. HussienN: Walailak J Sci Tech
(2014) Vol. 11, p. 809-823
K.W. Goyne, S.L. Brantley, and J. Chorover: Chem. Geol. (2010) Vol. 278, p. 1-14
H. Chung, et al.: Soil Biol Biochem (2005) Vol. 37, p. 1970-1974
R.S. Gadagi and T. Sa: Soil Sci Plant Nutr (2002) Vol. 48, p. 615-618
G.M. Gadd, Fungal Production of Citric and Oxalic Acid: Importance in Metal
Speciation, Physiology and Biogeochemical Processes, in Advances in Microbial
Physiology, R.K. Poole, Editor. 1999, Academic Press. p. 47-92.
Y.P. Chen, et al.: Appl Soil Ecol (2006) Vol. 34, p. 33-41
H. Rodriguez and R. Fraga: Biotechnol Adv (1999) Vol. 17, p. 319-339
S. Jeong, et al.: Chemosphere (2012) Vol. 88, p. 204-210
A. Peix, et al.: Int J Syst Evol Micr (2003) Vol. 53, p. 2067-2072
A. Gholami, S. Shahsavani, and S. Nezarat: World Academy of Science, Engineering
and Technology, International Science Index (2009) Vol. 25, p. 11-16
K.V.B.R. Tilak, et al.: Curr Sci India (2005) Vol. 89, p. 136-150
A.K. Halder and P.K. Chakrabartty: Folia Microbiol (1993) Vol. 38, p. 325-330
I. Reyes, et al.: FEMS Microbiol Ecol (1999) Vol. 28, p. 291-295
H. Katznelson, E.A. Peterson, and J.W. Rouatt: Can J Bot (1962) Vol. 40, p. 11811186
L. Pine, et al.: J Clin Microbiol (1979) Vol. 9, p. 615-626

62

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Optode-based Oxygen Measurements In Bioleaching Reactors


Fabian Giebnera*, Sebastian Eisenb, Michael Schlmannc, and Simone
Schopfd
Institute of Bioscience, Environmental Microbiology, TU Bergakademie Freiberg,
Leipziger Strae 29, Germany
a,*correspondence:

fabian.giebner@ioez.tu-freiberg.de, bsebastian.eisen@ioez.tu-

freiberg.de, cmichael.schloemann@ioez.tu-freiberg.de, dsimone.schopf@ioez.tufreiberg.de


Keywords: bioleaching tank bioreactor, optode, oxygen measurement
Abstract. Tank bioleaching promises high yields due to controllability of the leaching
process. For that various parameters like pH, EH and pO2 have to be measured regularly.
However, especially the measurement of oxygen is difficult to realise, since oxygen probes
are very expensive and posses only a low durability. With optode measurements we propose
an easy and less expensive, but still very accurate alternative. Since we were able to fix the
optode sensor spot at the lower end of a glass tube, this system is applicable with various
reactor designs and hence allows non-invasive in-situ oxygen measurements between each
second and every hour.
In order to show the principal applicability of this system inside a bioreactor, Escherichia coli
was cultivated at a defined oxygen level. Both optode and oxygen probe showed similar
concentration values. In the following, a cultivation of Acidithiobacillus ferrooxidans was
performed in a 2 L bioreactor with different oxygen levels set by controlling the air flow.
Again, both systems showed similar concentrations. This demonstrates the optode to be a
reliable tool for oxygen measurements during the cultivation of iron-oxidisers in bioreactors.
Furthermore, we performed leaching tests with fine grained residue from copper smelting in
order to show the durability of the optode in terms of mechanical wearing and hence a
suitable alternative to oxygen probes.
Introduction
Tank bioleaching becomes more and more relevant in mineral processing. However, it is
mainly applied for the exploitation of gold or cobalt [1, 2]. Recovery of less valuable metals
like copper, is done by heap leaching, although tank leaching promises not only by far higher
rates but also a higher total recovery. One of the main problems with copper leaching are
minerals like chalcopyrite which are poorly dissolvable compared to other Cu-minerals like
chalcocite [3]. In order to leach these minerals, it may be helpful to set the redox potential to
a certain value (less than 500 mV for chalcopyrite [4]). By adjusting the oxygen
concentration to a certain level, it might be possible to influence the Fe2+/Fe3+-ratio and hence
to achieve a redox potential in the desired range [5]. Therefore a fast, easy and particularly
robust method for oxygen determination is needed. So far, the most common method for O2measurement is the use of amperometric electrodes (i.e. clark-electrodes). However, these
63

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
electrodes are on the one hand very expensive and on the other hand they are influencing the
system by a steady oxygen consumption [6]. Furthermore these systems have proven
themselves prone to iron precipitates and mechanical wearing caused by fine particles e. g.
fine-grained minerals or fly ashes [7]. Another method for measurement of relative O2concentrations is given by the optode system, which is based on fluorescence quenching.
Here we propose the optode as an equivalent or even better alternative for application in
bioleaching-reactors.
Experimental setup
Reactor and optode system. For all experiments 2 L Infors 5HF bioreactors (Labfors, Germany),
German), were used. Excitation and
detection of the optode system was perfomed with a Fibox 3 (PreSens - Precision Sensing
GmbH, Regensburg, Germany). Data acquisition was achieved by the respective proprietary
software. The optode spot was fixed at the lower end of a hollow glass tube (Figure 1), which
was easily installable inside the reactors. Prior to each experiment, both optode and oxygenelectrode were calibrated according to the manufacturers instructions. For each experiment
the reactor vessel was filled with 1 L of the respective medium and stirred with 100 rpm at
30 C. If necessary, aeration was achieved with compressed air.
equipped with amperometric oxygen electrodes (Mettler-Toledo,

Figure 1. Scheme of the optode system which can be fixed through the reactor lid.
Preliminary abiotic test. The principal application of the optode system as well as the
comparability to the electrodes was tested abiotically with saline (0.9% NaCl). Consumption
of oxygen was achieved by dropwise addition of 1 mL 10 mM sodium sulfite solution. This
test was repeated three times.
Cultivation test. Cultivation of E. coli was performed in LB-medium [8]. Inoculation
took place with 10 mL of a culture grown. Acidithiobacillus ferrooxidans DSM14882 was
cultivated in DSMZ medium no. 882 [9], with a Fe2+-concentration lowered to25 mM. For
inoculation 100 mL of a 2-day old culture was used 24 hours prior to the addition of ferrous
iron. During both cultivations the air flow was regulated aiming at a constant oxygenconcentration.
Long-term leaching test. A 22-day leaching assay was performed with 9K medium [10]
with a mo-dified ferrous iron concentration of 25 mM and 4 g fine grained residue from
copper smelting. An At. ferrooxidans culture served as inoculate. An additonal durability test
was performed by another 22-day cultivation of Rhodococcus erythropolis B7G in minimum
salt medium [11] containing 15 % copper shale. As carbon source served 10 mM ntetradecane.
Results and Discussion
Preliminary abiotic test. A first general comparison between the oxygen electrodes with
which the reactors were equipped and the optode system was done abiotically with saline.
Due to the lack of respiring organisms an oxygen-decrease had to be achieved by the addition
64

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
of sodium sulfite which is rapidly oxidised to sulfate under oxygen consumption. With this
procedure it could clearly be demonstrated, that only minor variances between both systems
occurre (Figure 2). While the optode system showed a higher oscillation, the electrode was
relatively stable. However, this can easily be neglected, since the variances are less than 0.6%
oxygen. Furthermore the optode seems to be either more sensitive or faster responding
compared to the electrode. In the repetitions of this experiment the same results were
achieved. Thus, the optode showed general comparability to the electrode.
Cultivation test. Providing a high growth rate as well as a high metabolic activity, E. coli
was chosen for the first biotic assays. By coupling the aeration flow to the oxygen
concentration, it was possible to control the oxygen level in the medium. Again with
electrode and optode similar results were achieved with respect to O2 concentrations (Figure
3A). However, the optode again showed a more distinctive curve progression. Especially
between minute 25 and 35 the maximum O2 concentration is much more pronounced.

Figure 2. Curve progression for oxygen-saturation after stepwise sodium sulfite


supplementation measured by electrode (---) as well as optode ().
Based on the promising results of the E. coli cultivation, experiments went on with the
cultivation of an iron oxidising culture. Instantly after the addition of ferrous iron the oxygen
concentration decreased drastically without further aeration (Figure 3B). At approximately
50% oxygen the aeration was turned on in order to keep a constant O2 level. However, it was necessary to
adjust the air-flow several times to compensate the respiration rate. The aeration was finally adjusted to approximately 0. 1 Ln/min.
The optode showed, in contrast to the electrode, an oscillating behaviour, which reflects the
flux in air-flow quite well. This confirms the assumption made above that the optode reacts
either more sensitively or faster to changes in the oxygen concentration.
Long-term leaching test. In a 22-days leaching experiment with fine particles the
robustness and accuracy of the optode system was tested. While the electrode started to drift
after several days, the optode measured constantly high oxygen values. As indicated by the
optode measurements, no cell growth was detectable and hence the experiment was aborted.
However, it was still necessary to check the correctness of the optode. In order to do so, the
used electrode was replaced with a new and freshly calibrated one. Afterwards the medium
was supplemented with sodium sulfite. Both, electrode and optode, showed at first similar
high O2 concentration between 90 and 98% and, following the supplementation of sulfite, a
rapid oxygen decrease. In the durability test with 15 % copper shale the optode displayed
over the whole cultivation, with only minor variances, an O2 saturation of the medium.
65

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
However, this was expected, since the degradation of complex and high molecular weighted
compounds results in lower growth rate. As previously, the correctness of the optode was
proven by the addition of sulfite, showing similar results as before.
Finally this experiment confirmed the possibility of an optode application in a bioreactor
under leaching conditions. Furthermore, the optode was proven to be more durable against
mechanical wearing caused by fine-grained particles than the standard electrode. Although
these results are very promising, the actual period of maximum applicability has still to be
tested within the next months.

Figure 3. Progression of O2-saturation for the E. coli culture (A) and the At. ferrooxidans
culture (B). In both cases the electrode (---) and optode () signal as well as the air-flow (...)
was determined.
Conclusion
It was possible to apply the optode-system in bioleaching reactors. Compared to
amperometrie-electrodes the optode has shown to be either more sensitive or faster in
response. In a 22-days leaching experiment a higher durability against mechanical wearing
compared to the electrode was proven. Finally, it was shown that aeration coupled to oxygen
measurement provides a way to control the O2 level in the medium and hence might be
suitablefor influencing the redox potential.
Acknowledgements
This paper originated from the Ecometals project, which is funded by the German Federal
Ministry of Education and Research (BMBF under the grant ID 033RF001A).
References
[1]

C. Brierley and J. Brierley: Appl. Microbiol. Biot. (2013) Vol. 97 p. 7543

[2]

S. Brochot, M.V. Durance, J. Villeneuve, P. d Hugues and M. Mugabi: Miner. Eng.


(2004) Vol. 17, p. 253260

[3]

H.R. Watling: Hydrometallurgy (2014) Vol. 146, p. 96


66

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[4]

K. Yoo, S. Kim, J. Lee, M. Ito,M. Tsunekawa and N. Hiroyoshi: Miner. Eng. (2010) Vol.
23, p. 471

[5]

D.B. Johnson: Curr. Opin. Biotech. (2014) Vol. 30, p. 24

[6]

H.J. Atkinson and L. Smith: J. Exp. Biol. (1973) Vol. 59, p. 247

[7]

C.A. Du Plessis, P. Barnard, K. Naldrett and S.H. de Kock: J. Microbiol. Met. (2001)
Vol. 47, p. 189

[8]

information on
http://www.dsmz.de/microorganisms/medium/pdf/DSMZ_Medium381.pdf

[9]

information on
http://www.dsmz.de/microorganisms/medium/pdf/DSMZ_Medium882.pdf

[10] M.P. Silverman and D.G. Lundgren: J. Bacteriol. (1959) Vol. 77, p. 642
[11] E. Dorn, M. Hellwig, W. Reineke, H.J. Knackmuss: Arch Microbiol (1974) Vol. 99,
p.6170.

67

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Aspergillus Niger PSSG8 Mediated Bioleaching of Monazite for the


Recovery of Rare Earth and Other Metal Constituents
Kishor Kumar Keekana* and Jayesh C. Jalondharab
Yeneopoya Research Centre, Yenepoya University, University Road,
Deralakatte, Mangalore, Karnataka -575 018. INDIA
a*Corresponding

author: keekank@gmail.com, Phone: +91-824-2204668/69/70,

Fax: +91-824-2204667, bjayesh.jalondhara@gmail.com


Keywords: bioleaching, monazite, aspergillus niger, organic acids, siderophore,
cerium.
Abstract. Aspergillus niger PSSG8 is assisted bioleaching of monazite to recover the
constituent metals were investigated. Bioleaching was carried out using Bromfield (BM1/10P
& BM-P) and sucrose media (SM1/10P & SM-P) with different levels of Phosphate under
rotary and stationary conditions. The growth of the A. niger PSSG8 significantly reduced the
media pH to acidic. However, the media pH changed later in rotary shake flasks and were
stable in roux bottles. A similar trend was observed for ORP. ORP increased as leaching
progressed, but in rotary shake flasks ORP started decreasing after 15 days in Bromfield and
30 days in sucrose media. Fungal growth was maximum in SM when comparing to BM. The
reduction and the omission of phosphate in both media did not significantly influence the
culture parameters including the yield of biomass. ICP-AES analysis of leach liquor showed
highest recovery of cerium (Ce) (1419 g/L in BM-P) and thorium (Th) (182 g/L in
SM1/10P) in rotary conditions when comparing to the stationary conditions (229 g/L Ce in
BM 1/10P & 159 g/L in SM-P). Reduction in the metal concentration was observed in the
rotary shake flasks after 15 days of incubation. It was due to the biosorption of released
metals by the fungal mycelium. Uranium was not detected in any of the media tested. SEM
studies of the partially bioleached and control mineral particles show no changes in the
surface features.
Introduction
Increasing global demand for energy, depletion of natural resources, stringent
environmental regulations strongly demands an economically feasible, eco-friendly
sustainable process for metal extraction from ores and minerals. Monazite minerals are the
primary ore of several rare earth elements (REE), including thorium (Th) and uranium (U).
There is a huge industrial demand for REEs and are used extensively in aerospace and
defense, health care, clean energy, electronics, transportation and vehicles, chemicals, oil
refining etc, because of their unique nuclear, metallurgical, chemical, catalytic, electrical,
magnetic and optical properties [1]. Thorium can be used as a fertile material for breeder
reactors [2]. Currently monazite is leached chemically to recover REEs and other metals
such as Th is either by a basic process using sodium hydroxide or acid process using
concentrated sulphuric acid [3]. Chemical processing of monazite minerals is an expensive
affair due to too much energy consumption. In addition it generates large quantities of
different types of wastes such as solid wastes, liquid effluents and gaseous
68

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
effluents/particulate emissions leading to considerable environmental problems [4].
Alternatively, biohydrometallurgy or mineral bio-processing is a microbiological process to
recover valuable metals from their ores and is considered one of the most promising,
sustainable, eco-friendly, cheaper method to recover metals. It uses microorganisms to
enhance the dissolution of metals from mineral ores, by making them more amenable to
dissolution in aqueous solutions [5, 6, 7]. Biohydrometallurgy has been exploited for
extracting copper, uranium, gold, nickel, cobalt [8]. In this context, this paper summarizes the
heterotrophic bioleaching of monazite, one of the most water-resistant minerals known, with
an age of approximately 2.5-3 billion years old.
Materials and Method
Aspergillus niger PSSG8 isolated from soil was used as bioleaching agent, based on its
superior performance in the biochemical assay such as organic acid and siderophore
production, phosphate and silicate solubilization. Bioleaching experiments were carried out
using Bromfield media (BM) and Sucrose media (SM). Two subsets of culture media were
prepared for each culture medium. In one of the set, phosphate was omitted (BM-P & SM-P)
and in another phosphate was reduced to one-tenth of the original composition (BM1/10P &
SM1/10P). Bioleaching of monazite minerals were carried out under both, agitated (in 150 ml
Erlenmeyer flask containing 75 ml medium + 1 % (w/v) monazite powder incubated at
321C, 130 RPM) and Stationary (375 ml Roux bottles containing 50 ml Media + 1 % (w/v)
monazite powder incubated at 321C on culture racks with illumination by cool white
fluorescent lamps (36 Watts) with alternative 12 hours of light and darks cycles) conditions
for 60 days. Sterile culture medias were inoculated with a known concentration of A. niger
PSSG8 spores. Uninoculated bottles/flasks served as control. All experiments were
performed at least in duplicate. Representative samples withdrawn at various intervals (0, 15,
30 and 60 days) from both the flasks were analysed for pH, ORP, concentration of cerium
(Ce), Th, U using ICP-AES. Morphological characteristics/surface features of mineral
powders were assessed using scanning electron microscopy (SEM). The dry weight of
mycelium was determined at the end of the experiment.
Results and discussion
Growth of A. niger PSSG8 in roux bottles (stationary condition) were in the form of
mycelial mats; whereas under agitated/submerged conditions it was in the form of clumps.
The yield of mycelia was almost same in both the subsets containing a different level of
phosphate, indicating the consumption of phosphate obtained from monazite in the media
without phosphate. The yield of mycelium was maximum in agitated cultures when
comparing to the stationary cultures. SM supported the maximum growth of the A. niger
PSSG8 when comparing to BM (Fig.1). Formation of mycelial mat on the surface in
stationary cultures results in oxygen limitation to the cells under the surface and the medium
creating oxygen deficiency for growth. However, the problems are overcome in agitated
cultures. Agitated culture ensures uniform distribution of oxygen, good mixing of nutrients,
mass and heat transfer [9]. It also ensures the proper contact of fungal metabolites such as
organic acids, siderophores and other leaching agents with the mineral, thereby enhancing the
efficiency of bioleaching.
Following two weeks of incubation, the pH of both culture media turned to acidic.
However, the change in media pH was observed after 15 days in BM and 30 days in SM in
69

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
agitated cultures. The acidic conditions in stationary cultures were constantly maintained
even up to 60 days of incubation with a gradual reduction in media pH. Almost same pH
values were recorded in both culture media with lowest pH of 1.5 in BM-P & 1.75 in
BM1/10P and 1.84 in SM-P & 1.87 in SM1/10P in stationary cultures. A similar trend was
observed for ORP values in both culture media. Highest ORP values were recorded in
stationary cultures (282.65 mV in BM P, 289.55 mV in BM 1/10P, 281.8 mV in SMP and
279.55 mV in SM 1/10P). ORP indicates the redox state of the culture media. Redox potential
is a measurement of the ability of compounds to be oxidized or reduced. While pH is a
measurement of the concentration of free hydrogen ions in a system, redox potential is a
measurement of the activity of electrons in a system [10]. The presence of oxidants may
enhance the leaching of minerals.

Figure 1. Effect of agitation and


stationary conditions on mycelium
yield of A. niger PSSG8 in phosphate
deficient and phosphate omitted culture
media.

Figure 2. The influence of rotary and


stationary conditions on pH and ORP of
culture media ( BMP, BM 1/10P,
SM-P, SM 1/10P, Control BM,
Control SM).

Figure 3 presents the concentration of metals released in the media as a function of leaching
time. Concentration of Ce was maximum in BM (1419 g/L in BM-P & 583 g/L in
BM1/10P) under agitated conditions. However under stationary conditions the same media
yielded only 212 g/L in BM-P and 229 g/L in BM1/10P. The yield of Th was maximum in
SM (174 g/L in SM-P & 182 g/L in SM1/10P) under rotary conditions and was negligible
in BM-P and BM1/10P. Only the yield of Th was comparable between two types of culture
conditions. Uranium was not detected in the leach liquors of both media. A gradual reduction
in the concentration of Ce and Th was observed in the leach liquor of rotary cultures after 15
days of bioleaching and was attributed to biosorption of metals by mycelium [11, 12].
Bioleaching of monazite may be due to organic acid production, siderophore production (data
not shown) or other metabolic products. Heterotrophic bioleaching is an indirect process,
where microbial metabolites such as organic acids, siderophores and other metabolites
dissolve metals from minerals by displacement of metal ion from the ore matrix by hydrogen
ions or by the formation of soluble metal complexes and chelators [13].

70

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 3. Concentration of Ce and Th in the culture media during bioleaching of


monazite powder ( BM P, BM 1/10P, SM-P, SM 1/10P, Control BM,
Control SM).
Dissolution/leach pits are normally observed on bioleached minerals [14]. However,
similar features were not observed in the present study. SEM images (Fig. 4) of the partially
bioleached mineral crystal shows no difference in the surface features.

Figure 4. Scanning electron microscopic images showing the size and morphological
characteristics/surface features of monazite mineral particles (A & a: Control, B & b:
1/10th Phosphate, C & c: without phosphate).

Conclusions
Bioleaching of monazite is evident with the release of Ce and Th in leach liquor. The
metal concentration was highest in agitated cultures when compared to the stationary
cultures. The abundant growth of A. niger PSSG8 in media devoid of phosphate shows the
utilization of phosphate from monazite, indicating the dissolution of monazite mineral. Slow
71

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
rates and low yields of metal constituents can be improved through optimisation of
physicochemical parameters of culture conditions. This study demonstrates the susceptibility
of monazite, one of oldest and the most water resistant mineral to heterotrophic bioleaching.

References
[1]

P. Koltun and A. Tharumarajah: ISRN Metallurgy Vol. 2014 (2014), 10 pages

[2]

J. C.B.S. Amaral and C.A. Morais: Miner. Eng. Vol. 23 (2010), p. 498

[3]

R.D. Abreu and C.A. Morais: Miner. Eng. Vol. 23 (2010), p 536

[4]

P.M.B. Pillai, Naturally Occurring Radioactive Material (NORM) in the extraction and
processing of rare earths. Proceedings of the 5th International symposium on naturally
occurring radioactive material, Seville, Spain. 2007, p 197.

[5]

H. Deveci, A. Akcil and I. Alp, In: Process Control and Optimization in Ferrous and
Non Ferrous Industry edtied by F. Kongoli, B. Thomas and K, Sawamiphakdi.
Chicago, USA (2003), p. 9

[6]

D.E. Rawlings, in: Biomining, edited by D.E. Rawlings and D.B. Johnson, SpringerVerlag, Berlin Heidelberg (2007), p. 186

[7]

C.L. Brierley: Trans. Nonferrous Met. Soc. China Vol. 18 (2008), p. 1302

[8]

L.B. Sukla, J. Esther, S. Panda and N. Pradhan: J. Microbiol. Biotechnol. Vol. 3 (2014),
p. 1

[9]

T. Hadibarata and R.A. Kristanti: J. Chil. Chem. Soc. Vol. 57, N 2 (2011), p.1095

[10] L. Kjaergaard: Adv Biochem Eng Biotechnol. Vol. 7(1977), P. 131


[11] Z. Filipovi-Kovacevic, L. Sipos and F. Briski: Food technol. biotechnol. Vol. 38
(2000), p. 211
[12] R. Dhankhar and A. Hooda: Environ. Technol. Vol. 32 (2011), p. 467
[13] W. Burgstaller and F. Schinner: J. Biotechnol. Vol. 27 (1993), p. 91
[14] H.L. Buss in Biogeochemical weathering of iron-silicate minerals. Thesis, The
Pennsylvania State University, United States (2006)

72

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Bioleaching of Complex Refractory Gold Ore Concentrate of China:


Comparison of Shake Flask and Continuous Bioreactor
Yan Songa, Hongying Yangb*, Linlin Tong
School of Materials and Metallurgy, Northeastern University, 3-11 Wenhua Road,
Shenyang, P. R. China 110004
a 1249262760@qq.com, b*Correspondence:

yanghy@smm.neu.edu.cn

Keywords: bioleaching; complex refractory gold ore; shake flask; continuous


bioreactor.
Abstract. The laboratory tests of biooxidation and cyanidation were carried out by using
samples of the complex refractory gold ore from China. The elemental composition was
16.8 % iron, 18.6 % sulfur, 4.88 % arsenic2.30 % carbon and 3.49 % antimony. Gold is
assayed at 46 g/t. The arsenic oxidation of 88.11 %carbon removal rate of 32.34 % and
antimony oxidation of 23.92 % over 16d was achieved in shake flasks in the presence of the
mixed culture (HQ0211: Thiobacillus ferrooxidans Leptospirillum ferrooxidans and
Thiobacillus thiooxidans). The continuous bioreactor tests resulted in greater dissolution rates
for arsenic, carbon and antimony, which led to a greater extent of sulphide oxidation within a
shorter period of time. The maximum oxidation of arsenic and antimony was 90.72 % and
40.09 % respectively and the removal rate of carbon is 63.48% after 8d in the continuous
bioreactor tests. After bioleaching, the gold recovery of the oxidation residue was 98.02 %
with the cyanidation method, which was showed the biological pretreatment was applicable
to the complex refractory gold ore.
Introduction
Refractoriness in gold ores may be caused by several factors including the presence of
suldes, cyanicides, carbonaceous matter, and tellurides[1]. When it is due to the presence of
suldes, tellurides and carbonaceous matter, the ore is said to be complex refractory gold ore.
Sulfides in the complex refractory gold ores may occur as pyrite, chalcopyrite, arsenopyrite.
Tellurides mainly occur as stibnite. Carbonaceous matter in the ores may occur as
hydrocarbons, humic acid and/or activated elemental carbon[2]. Submicroscopic gold, which
is typically trapped in a matrix of arsenopyrite/pyrite, cannot be effectively recovered. Gold
particles may sometimes be occluded or included in the sulde minerals. And preg-robbing is
a result of the adsorption of gold by Carbonaceous matter. Pretreatment is necessary to
decompose the mineral structure to liberate gold for subsequent recovery. The pretreatment
processes used for such complex refractory ores include roasting, pressure oxidation and
bacterial oxidation[1, 3]. Instead of using the first two methods, which are expensive or, in
the case of heating, causes environmental problems, a biooxidation pretreatment process was
used[4].
In our study, biooxidizing the complex refractory ores using mixed culture of moderately
thermophilic to enhance gold recovery is investigated. To increase the gold recovery
efciency of the direct cyanide leaching procedure, the biooxidation process was performed
in Erlenmeyer flasks or in the continuous bioreactor before the cyanide leaching
procedure[5]. The oxidation ability and the performance of bacterial/archaeal cultures used in
the biooxidation process of a refractory gold ore were investigated at different pulp density in
Erlenmeyer flasks. The biooxidation process in the continuous bioreactor was performed.
73

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Experimental setup
Materials. The complex refractory gold ore was obtained from a plant of China. After
milling, the particle size was 93.05% passing 38 m. Sulfur and carbonaceous matter in the
samples were determined using the Leco combustion volumetric method. Fire assay methods
for gold and silver analysis and ICP-ES and X-ray fluorescence spectrometry(XRF) methods
for the analysis of other elements were performed to determine the content of the ore
samples. The grade of some important constituents of the gold concentrate used is shown in
Table 1.
Table 1. The grade of some important constituents of the gold concentrate.
Component
As
C
Sb
S
Ag
Au
Content/%
333.9
46.0
4.88
2.30
3.49
18.6
-1
gt

Fe
16.8

Mineralogical phases observed in


the XRD analysis of the ore are shown
in Figure 1. The main sulde minerals
were pyrite, arsenopyrite and stibnite.
In addition to sulphide minerals,
quartz(SiO2) and some carbonate
compounds were found in the gold ore.
Bacteria. The bacteria used in our
laboratory tests was a mixed culture
composed
by
Thiobacillus
ferrooxidans(CCTCC NO: M2011203),
Thiobacillus thiooxidans (CCTC
Figure 1. XRD pattern of the ore.
CC NO: M2011204) and Leptospirillum ferrooxidans(CCTCC NO: M2011202), which were
maintained at Northeastern University. The mixed cultures were maintained in 9K medium
containing 3.00 gL-1 (NH4)2SO4 0.10 gL-1 KCL0.50 gL-1 K2HPO40.50 gL-1
MgSO47HO0.01 gL-1 Ca(NO3)244.3 gL-1 FeSO47HO.
Erlenmeyerflask experiments. During this stage, laboratory-scale experiments were
performed in 500 mL Erlenmeyer flasks that contained 180 mL of 9K medium, 20 mL of
inoculum and 5%, 10% or 15% (w/v) ore. All of the flasks were sterilised by autoclaving at
1.0 atm and 121 C for 25 min to maintain sterile conditions before inoculation. Analyticalgrade chemicals and ultra-pure water were used in all experimental studies. The initial pH
was adjusted to 1.80 with 2N sulphuric acid (H2SO4). Shake flasks were placed into a HZQQX constant temperature oscillation box that was operated at 180 rpm under the constant
temperature of 44.
Continuous bioreactor experiments. The continuous bacterial oxidation in the system of
continuous bioreactor is different from that in a single bioreactor. It is a continuous dynamic
process of bacterial oxidation, which connects a surge tank with a series of bioreactors. Pulp
from surge tank flows into bioreactors in turn(Figure 2). During the experiment, the control
parameters are shown in Table 2.
74

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Table 2. Control parameters of continuous bacterial oxidation process.
Parameters
Number
Pulp density(w/v)/%
10
44
Temperature /
3 -1
Ventilation volume /(m h )
1.0
Stirring Speed /rpm
750
pH
1.8
Pulp residence time /h
192
Feed speed /(mLh-1)
260
Cyanide leaching experiments. Cyanide leaching tests were applied for 48h to the
oxidised ores after the continuous biooxidation experiments were completed. Cyanide
leaching tests were performed by a 500mL tank that contained 15%(w/v) ore solution. The
pH of the leaching solution was kept in the range between 10.5 and 11.0 through the addition
of 10M NaOH. Analytical-grade sodium cyanide (NaCN) was used for cyanide leaching
experiments, which was kept 0.03%(w/v).
Results and discussion
The biooxidation degree of complex refractory gold ore was found to be very high with
mesophilic mixed culture Thiobacillus ferrooxidans(CCTCC NO: M2011203), Thiobacillus
thiooxidans(CCTCC NO: M2011204) and Leptospirillum ferrooxidans(CCTCC NO:
M2011202) as shown by the leaching rate of arsenic, carbon and antimony with 5%, 10% and
15% (w/v) solids in Figure 3. As
shown in Figure 3, the presence
of the mixed culture resulted in
the highest leaching rate of
arsenic, carbon and antimony in
the experiment with 5% (w/v).
Biooxidation tests at 515%
(w/v) showed that increasing pulp
density adversely influenced the
leaching rate of arsenic, carbon
and antimony.
100

As
C
Sb

Metal leaching rate/%

80

60

40

20

5%

10%

15%

Pulp density(w/v) in biooxidation

Figure 3. Metal leaching rate


after shake flask tests.
75

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
After leaching for 192h, the result of continuous bacterial oxidation was shown in Figure
4. In the end(Fourth Stage), the presence of the mixed culture resulted in the highest leaching
rate of arsenic, carbon and antimony in the experiment with 10% (w/v). Compared with direct
cyanide leaching to original ores, Cyanide leaching tests were applied to oxidised ores after
the continuous biooxidation experiments were completed. After bioleaching, the gold
recovery of the oxidation residue was 98.02 % with the cyanidation method(Figure 5).
100
100

As
C
Sb

80

60

Gold recovery/%

Metal leaching rate/%

80

40

20

60

40

20

First Stage

Second Stage Third Stage Fourth Stage

Figure 4. Metal leaching rate in every stage.

original ores

oxidised ores

Figure 5. Gold recovery after cyanidation.

Conclusions
The mixed bacteria/archaea cultures showed high biooxidation performance in the
biooxidation of the complex refractory gold ore. The greatest degree of arsenic oxidation
during the shake-flask tests occurred in the presence of the mixed culture, where arsenic
oxidation of 88.11%, carbon removal rate of 32.34 % and antimony oxidation of 23.92 % was
achieved after 384 h. The continuous bioreactor tests resulted in greater dissolution rates for
arsenic, carbon and antimony, which led to a greater extent of sulphide oxidation within a
shorter period of time. The maximum oxidation of arsenic and antimony was 90.72 % and
40.09 % respectively and the removal rate of carbon is 63.48% after 192h in the continuous
bioreactor tests. After bioleaching, the gold recovery of the oxidation residue was 98.02 %
with the cyanidation method, which was showed the biological pretreatment was applicable
to the complex refractory gold ore.
Acknowledgements
The authors acknowledge the financial support of the National Natural Science Foundation
of China (51174062 and 51374066); Fundamental Research Funds for the Central
Universities, China(N110602005).
References
[1] R.K. Amankwah, W.-T. Yen and J.A. Ramsay: Minerals Engineering (2005) Vol. 18, p.
103-104.
[2] B. Nanthakumar, C.A. Pickles and S. Kelebek: Minerals Engineering (2007) Vol. 20, p.
1110.

76

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[3] Yingbo Dong, Hai Lin, Xiaofang Xu and Shanshan Zhou: Hydrometallurgy (2013), doi:
10.1016/j.hydromet.2013.05.009
[4] H. Ciftci and A. Akcil: Minerals Engineering (2007) Vol. 46-47, p. 25-27.
[5] Ramon Gonzalez, Juan C. Gentina and Fernando Acevedo: Biochemical Engineering
Journal (2004) Vol. 19, p. 33.

77

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Comparative Experiments on Acid Leaching and Bioleaching to a


Sandstone Type Uranium Ore
Liu Jinhui1,a, Shi Weijun2,b, Liu Yajie3,c, Zhou Yipeng4,d and Sun
Zhanxue5,e
1-5East

China Institute of Technology, No.56 XueFu RD, Fuzhou, Jiangxi, 344000,


China

aliujh1961@163.com, bwjshi@ecit.cn, clyj008@126.com, dypzhou@ecit.cn,


ezhxsun@ecit.cn

Keywords: acid leaching, bioleaching, comparative experiments, in-site leaching


uranium.
Abstract. To compare the efficiency of uranium recovery in 512 uranium deposit in
northwest of China, in which the uranium recovery rate was less than 40% by acid leaching
in more than 10 years, acid leaching and bioleaching experiments in laboratory were carried
out respectively with a native mix cultures isolated and domesticated with the raffinate from
this uranium ore in this paper. The experiments mainly focused on the influences of acidity
and ferric ion concentration of the solution to uranium recovery. 12 flasks tests were set up
with acidity of 2g/L, 3.5 g/L and 5 g/L , while ferric ion concentration of 0 g/L, 2g/L, 3.5 g/L,
and 5 g/Lrespectively. The results showed that the average bioleaching rate was 9.8%
higher than that of acid leaching. And when the Residues after acid leaching was leached by
bacteria culture with ferric ion, uranium concentration in the solution was 63.0% higher than
that when in acid leaching. The average leaching rate of uranium was increased by 5.7%. It
concluded that bioleaching is better than acid leaching to this type of minerals.
Introduction
512 uranium deposit, located in the northwest of China, is one of the largest in-situ
leaching uranium mine in China. In the last 2 decades, 11 mining areas in the 5th Cyclothem
Depositwere successively mined by acid in-situ leaching. The uranium recovery in the roll
body was higher than that in the wing body. For example, the uranium recovery rate in 11-3
mining area was less than 40% by acid leaching during last decade.
AcidiAcidithiobacillus ferrooxidans is one of the most widely being employed
microorganisms in the bioleaching process. At. ferrooxidans can oxidize Fe2+ and reduced
sulfur compounds to get energy for growth. It is well known that uranium bioleaching mainly
based on the indirect mechanism. The mechanism of uranium extraction from uraninite
facilitated by the indirect oxidation function is as the following reactions [1,2]:
At . ferrooxidans
4 FeSO4 O2 2 H 2 SO4
2 Fe2 ( SO4 ) 3 2 H 2O

UO2 Fe2 ( SO4 ) 3


UO2 SO4 2 FeSO4

78

(1)
(2)

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Oxidation of ferrous ion into ferric is one of the characteristic properties of At.
ferrooxidans. The ferric ion acts as an electron acceptor and converts U+4 to U+6, which is
soluble in water, hence the metal is leached out to the liquor solution [3].
To compare which was efficiency, laboratory experiments were set up with acid leaching
and bioleaching to a sand stone type uranium sampled from 11-3 mining area of 512 uranium
deposit. The experiments mainly focused on the influences of acidity and ferric ion
concentration of the solution to uranium recovery.
Material and methods
Samples. Samples were taken from the drill cores in 11-3 mining area which located the
depth around 178m underground. The samples lithology is mainly of middle grain
sandstone. Uranium grade in average of mixed minerals (mixed all the minerals from cores as
a whole firstly, then screened the test samples evenly) was 0.0416%. shown in Table1.
Bacteria. A native mixed culture isolated and domesticated with raffinate from the
uranium ore was used in this experiment. Dominant bacteria in the culture were At.
ferrooxidans and Leptospirillun sp.. Culture was incubated with modified basal salts medium
(with 2.0 g/L, 3.5g/L and 5g/L ferrous ion) at 30 with 120rpm in shaker till more than 85%
ferrous ion was oxidized for the use of indirect bioleaching.
Mineral ores acidification. Before bioleaching and acid leaching experiments, 12200g
mixed minerals without sterile in 12 of 1L flasks were set up and acidified with 400mL 10.0
g/L sulfuric acid solution till pH was stable in 1.8-1.9 for 1 day.
Experiments of acid and bioleaching. Replace the acidified leachate with basal salts
solution and bacterial cultures of different acidity and ferric ion concentrations as Table 2.
Liquid to solid ratio was 2:1. The Acidity was adjusted by H2SO4. Acid tests (1, 5 &9 test)
were controls without bacteria at each acidities, as 2.0 g/L, 3.5 g/L and 5.0g/L. Solution
volume in each flasks was 400mL.All the flasks were covered with plastic cover in static
state at room temperature. Replace the leachates with the same solutions at the beginning
when uranium concentration did not increase and ended the test while uranium concentration
was lower than 2.0mg/L. All the tests were shown in Table 2.
Tabel 1. Uranium content for samples of experiment.
Serial No.

Sample name

U grade%

PS-1

0.0418

PS-2

0.0414

Average U content%

* Uranium content was analyzed by fluorescent spectrometry methods.

79

0.0416*

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Table 2. Experiment design of uranium bioleaching and acid leaching by flasks.
Test No.

1*

5*

9*

10

11

12

Test name

PS-1

PS-2

PS-3

PS-4

PS-1

PS-2

PS-3

PS-4

PS-1

PS-2

PS-3

PS-4

200

200

200

200

200

200

200

200

200

200

200

200

400

400

400

400

400

400

400

400

400

400

400

400

0.0

2.0

3.5

5.0

0.0

2.0

3.5

5.0

0.0

2.0

3.5

5.0

2.0

2.0

2.0

2.0

3.5

3.5

3.5

3.5

5.0

5.0

5.0

5.0

Mineral weight
(g)
Leaching
solution
(mL)
Fe3+
( gl-1)
Acidity (gl-1)

* Referred to acid leaching as well as control for bioleaching. When the 3 tests finished,
replaced the leachate with bacteria culture of 3.5g/L Fe3+.
Bioleaching for residues after acid leaching. In order to confirm the advantages of
bioleaching, replaced the acid leachate with bacteria culture with 3.5g/L ferric ion after the
end of acid leaching for flasks 1, 5 and 9 and continue to leach as the procedure 2.3.
Parameters analysis methods. Uranium concentration analysis by spectrophotometric
method. Iron concentration analysis by EDTA titrate method. PH value was detect by 990-pH
meter.
Results and discussion
The experiment was divided into acidification stage, bioleaching and acid leaching stage and
bioleaching stage of residues after acid leach. Results are shown in Table 3, Fig.1 and Fig. 2.
Tabel 3. U leaching rate in different conditions of each leaching tests.
Serial
No.

1
2
3
4
5
6
7
8

Test

PS-1
PS-2
PS-3
PS-4
PS-1
PS-2
PS-3
PS-4

Acidity
(g/L)

Fe3+
(g/L)

U leaching rate in
acidification stage
(%)

Cumulative
U leaching
rate (%)

U bioleaching
rate after Acid
leaching
%

Cumulative U
bioleaching
rate after acid
leaching (%)

26.62

71.47

7.0

78.47

37.44

82.36

38.24

85.05

5.0

84.35

0.0

44.85

2.0

44.92

3.5

46.81

5.0

45.96

37.87

83.83

0.0

46.92

32.43

79.35

2.0

47.34

37.45

84.79

3.5

48.02

39.55

87.57

5.0

49.18

38.79

87.97

2.0

3.5

U leaching
rate in acid
leaching and
bacterial
leaching
( %)

45.64
(in
average)

47.87
(in
average)

80

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
9
10
11
12

PS-1
PS-2
PS-3
PS-4

5.0

0.0

51.18

2.0

50.11

3.5

53.12

5.0

49.47

50.97 (in
average)

31.1

82.28

42.87

92.98

36.73

89.85

41.21

90.68

5.0

87.28

Leaching rate in acidification stage. Uranium concentrations in leaching solution of all


the 12 tests were more than 100mg/L after acidification (Data not shown). It inferred that
U() was of a higher percentage in the total uranium. From table 3, the lowest uranium
leaching rate was tests of PS-I-1-4 as acidity of 2g/L, and the highest was tests of PS-III-1-4
with acidity of 5g/L. It indicated that higher acidity could increase the uranium recovery.

Figure 1. Comparison of uranium leaching rate at different acidity and ferric ion
concentration. At each acidity, ferric ion concentration was 0.0g/L (no bacteria), 2.0g/L,
3.5g/L and 5.0g/L from the left to the right columns, respectively.
Leaching rate in bioleaching and acid leaching stage. Uranium concentration of
leachate in acid leaching tests (as tests PS-I-1, PS-II-1, PS-III-1) was less than 3.2mg/L while
that of 13mg/L in bioleaching tests after 21 days (data not shown). Uranium leaching rate in
each group of the 3 acidities was increased with both acidity and ferric ion concentration
increased from figure1. It is obviously that acid leaching was less effective than that of
bacteria culture with different iron concentrations. It resulted that acidity of 5g/L was the
primary factor to extraction of this uranium mineral ores and the ferric ion in bacteria
culture was the next. It suggested that we could select 3.5% iron as total iron concentration to
culture bacteria in order to satisfy bacteria growth and low cost in industrial experiment
because uranium leaching rate had no obvious differences in the tests of 3.5g/L and 5.0g/L
iron concentrations.
Leaching rate in residues bioleaching stage. The average uranium concentration was
increased great as shown in figure 2 when the Residues (samples after acid leaching) was
leached by bacteria culture for 2 days. It was inferred that most U was leached by acid and
the uranium in residues should be U and some U wrapped by quartz when in acidified
stage. Again, it indicated obviously that uranium bioleaching was better than that of acid
leaching.

81

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Fig.2 Change of uranium concentration of tests PS-I-1(), PS-II-1and PS-III-1


after 17.5d acid leaching with time. () acidity=2gL-1, Fe3+=3.5g/Lacidity =3.5gL-1,
Fe3+=3.5g/Lacidity =5gL-1, Fe3+=3.5g/L.
Conclusions
In summary, the following conclusions can be obtained from the uranium leaching
experiment:
1) The objected uranium ores was partially oxidized by comparison of leaching rate from
both acidified stage and acid & bioleaching stage.
2) Acidity was the key factor to uranium extraction for this type of uranium minerals with
no shaking, and ferric ion concentration in bacteria culture was the second.
3) Uranium leaching rate could be raised by bacteria culture greatly. Consequently,
bioleaching was effective in this sandstone type of uranium ores.
References
[1] Mishra, A., Pradhan, N., Kar, R.N., Sukla, L.B., Mishra, B.K., Hydrometallurgy 95
(2009) 175-177.
[2] Xu, T.J., Ting, Y.P., Enzyme Microbiol. Technol. 35 (2004) 444-454.
[3] Choi, M.S., Cho, K.S., Kim, D.S., Ryu, H.W., World J. Microbiol.Biotechnol. 21 (2005)
377-380.

82

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Utilization of metabolic citric acid from Aspergillus niger using corn


starch in the nickel leaching of Indonesian saprolitic ore
Widi Astuti1,2,a,*, Tsuyoshi Hirajima1,b, Keiko Sasaki1,c, Naoko Okibe1,d
1Department
2Mineral

of Earth Resources Engineering, Kyushu University, Fukuoka, Japan

Processing Division, Indonesian Institute of Sciences (LIPI), Indonesia

a,*correspondence:

widi@mine.kyushu-u.ac.jp, tel: +81 92-802-7780,

bhirajima@mine.kyushu-u.ac.jp, ckeikos@mine.kyushu-u.ac.jp,
dokibe@mine.kyushu-u.ac.jp

Keywords: metabolic citric acid, aspergillus niger, corn starch, metal leaching,
saprolitic ore.
Abstract. Citric acid has been proved to be the most effective organic acid for nickel
extraction from nickel lateritic ores. Citric acid can be produced from fungal metabolism by
utilizing several types of carbon source as fungal nutrient. In the current experiment,
production of metabolic citric acid from metabolism of Aspergillus niger by using corn starch
as a carbon source was investigated. The application of the citric acid produced in the
leaching of nickel from Indonesian saprolitic ore under atmospheric pressure was also
conducted. The optimum citric acid concentration (i.e. around 0.05 M) can be produced by
using 5% w/v of corn starch after 5 days incubation of A. niger, 30oC of temperature, shaker
speed of 120 rpm, and 3% v/v of methanol as an additive. The metal leaching of Indonesian
saprolitic ore was conducted using <75m of ore particle size, 5% w/v of pulp density and
200 rpm of shaker speed at different leaching temperatures (30oC, 40oC, and 60oC). The
results showed that the optimum nickel recovery (around 40%) can be reached after 3 days of
leaching process at 40oC. It was also found that the use of metabolic citric acid was more
effective for nickel leaching compared to the use of chemical citric acid at similar citric acid
concentration (i.e. 0.05 M). It can be concluded that the metabolic citric acid produced from
corn starch by A. niger will be an excellent leaching reagent for extracting nickel from lowgrade Indonesian saprolitic ore.
Introduction
Indonesia, one of the largest producers of nickel ore in the world, has approximately 16%
of total world nickel resources in the form of lateritic ores that are distributed and spread in
some islands such as Kalimantan, Sulawesi, Halmahera, Gag and Papua [1].
Hydrometallurgical methods is emerging as the primary technology for the recovery of nickel
and other metals from nickel laterite ores especially low-grade laterite ores because of its
advantages that some valuable metals such as nickel, cobalt, iron, magnesium, chromium and
aluminum can be extracted comprehensively. Employing organic acids especially citric acid
in the metals dissolution of nickel laterite ores provides alternative technology especially
related to the environmental issues. The use of citric acid for leaching of saprolitic ore from
Indonesia has been reported by Widi Astuti et al. [2]. This study showed that citric acid could
extract nickel very effectively from low-grade Indonesian saprolitic ores [2]. Moreover, citric
acid can be produced from fungal metabolism particularly from Aspergillus niger by
employing various agricultural products and wastes as carbon sources. Since Indonesia is a
83

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
tropical country with a varied agricultural products as well as agricultural wastes, the
possibility to produce citric acid from agricultural products with low costs are very attractive
in order to prepare the leaching reagent for nickel laterite processing. However, there is no
report regarding on the utilization of bio-citric acid produced from agricultural product in the
nickel leaching experiments from Indonesian saprolitic ore. Corn is one of the biggest
agricultural products in Indonesia [3]. The products and wastes from corn processing have
been found as the excellent carbon sources in citric acid production by A. niger [4]. In the
current experiment, corn starch was used as carbon source in the metabolic citric acid
production by A. niger. The effectiveness of using metabolic citric acid produced in the
nickel extraction from Indonesian saprolitic ore was investigated.
Experimental set-up and procedures
Saprolitic ore characterization. Saprolitic ores from Sulawesi Island (Indonesia) was
used in the current study. The sample was mineralogically and chemically characterized. Xray fluorescence (XRF; ZSX Primus II, Rigaku, Tokyo, Japan) and inductively coupled
plasma-optical emission spectroscopy (ICP-OES; Perkin Elmer 8500, Waltham, MA, USA)
were used to determine the chemical composition. The mineral phases of the ore sample were
analyzed using X-ray diffraction (XRD; Ultima IV, Rigaku, Tokyo, Japan). To gain
additional information about the mineral composition of these ores, Fourier transform
infrared spectroscopy (FTIR; 670 Plus spectrophotometer, JASCO, Tokyo, Japan) spectra of
the ores samples was also measured. Scanning electron microscopy/energy-dispersive X-ray
spectroscopy (SEM/EDS; VE-9800 SEM, Keyence, Osaka, Japan, and EDAX Genesis,
Ametek, NJ, USA) analysis was also applied to determine metal mapping in the ore.
Microorganism. A strain of fungal A. niger used in this study obtained from School of
Life Sciences and Technology, Bandung Institute of Technology (Indonesia). The strain was
grown in potato dextrose agar (PDA) medium (3.9% m/v), maintained in nutrient agar at 4oC
and subcultured at intervals of 1-2 months.
Metabolic citric acid production and analysis. Metabolic citric acid was produced
separately with the leaching processes by utilizing of A. niger. Experiments were conducted
in 250 mL flasks, each containing 5 g corn starch with 100 mL medium adjusted to pH 3.5.
The medium used in this experiment contained (per 1000 mL of solution): 10 g KH2PO4; 2.0
g NH4NO3; 250 mg MgSO4.7H2O; 14 mg MnSO4.5H2O; 21 mg FeCl3.6H2O; deionized water.
All flasks containing these medium were sterilized at 121C for 15 min, cooled and
inoculated with test organisms, all experiments were done in duplicates. 3% v/v of methanol
was added in each flask as an additive to improve the citric acid concentration produced. All
flasks were incubated at 30C and shaker speed of 120 rpm with 5 days incubation. The citric
acid was determined using the colorimetric method of Marrier and Boulet [7]. The optimum
citric acid concentration (i.e. approximately 0.05 M) can be produced by using 5% w/v of
corn starch after 5 days incubation of A. niger, 30oC of temperature, shaker speed of 120 rpm,
and 3% v/v of methanol as an additive. The metabolic acid produced was used directly in the
further leaching experiments.
Nickel leaching experiment. Leaching tests were performed in the shaker equipment with
the constant shaker speed of 200 rpm using metabolic acid produced from the metabolism of
A. niger. Mixtures of screened samples (ore particle size of <75m) and metabolic citric acid,
with the pulp density of 5% (w/v), were put in 100 ml-flasks. Three types of leaching
temperature (30oC, 40oC, and 60oC) were used in this experiment to investigate the effect of
leaching temperature on the nickel recovery and other metal dissolutions. Leaching process
84

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
was monitored by sampling the slurry periodically (1, 3, 5, 7, and 15 days) and measuring the
dissolved metals by inductively coupled plasma optical emission spectrometer (ICP-OES)
using standard procedures.
Results and discussion
Saprolitic ore. Chemical content of the ore from ICP-OES and XRF analyses indicated
that the ore is a typical low-grade saprolitic laterite, containing 1.76 wt% Ni (less than 2 wt%
Ni), 21.64% Fe, 2.04% Al, 1.76% Ni, 0.06% Co, 8.44% Mg, 1.07% Cr, 0.43% Mn and
36.30% SiO2. According to the results from the X-ray diffraction (XRD) analysis, serpentine
(Mg3Si2O5(OH)4) and goethite (FeOOH) were found to be the predominant mineral, while
quartz (SiO2), talc (Mg3Si4O5(OH)2) and chromite (FeCr2O4) were observed as the main
components of the minor phase.
Nickel extraction. To investigate the effect of leaching temperatures on the nickel
recovery from saprolitic ore at atmospheric pressure, several leaching experiments were
carried out using metabolic acid produced in the previous experiment. Fig. 1 shows that the
leaching process at 40oC tends to produce highest nickel recovery than the leaching process at
30oC and 60oC. It can also be seen that around 40% of nickel recovery can be achieved at 3
days of leaching period and 40oC of leaching temperature. After 3 days leaching process,
nickel leaching rate did not increase more. It is predicted that citric acid contained in culture
filtrate is only adequate to leach 40% nickel from the ore. To enhance nickel leaching rate, it
is necessary to improve citric acid yield in the metabolic acid production. In addition, it was
also found, as demonstrated in Fig. 2, that the use of metabolic citric acid was more effective
for nickel leaching compared to the use of chemical citric acid. Moreover, mineral dissolution
behavior was also observed by XRD analysis of solid residue. It was proposed that metabolic
acid produced in the current experiment may only dissolve serpentine mineral, while goethite
and talc is more difficult to be leached. Hence, most nickel in pregnant leaching solution may
originate from serpentine mineral. Finally, it was concluded that the metabolic citric acid
produced from corn starch by A. niger has an excellent potential as a reagent for metal
leaching of saprolitic ore from Indonesia.

40

40

Nickel recovery, %

50

Nickel recovery, %

50

30

30

20

20

30 C

40 C

60 C

10

Chemical citric acid


Metabolic acid

10

0
0

10

12

14

16

Leaching time, days

0
0

10

12

14

Leaching time, days

Figure 1. Nickel recovery in the


leaching by metabolic citric acid
(0.05 M) at different temperatures;
30oC( ), 40oC ( ), 60oC ( ).
85

16

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Conclusions
1. The optimum citric acid concentration (i.e. approximately 0.05 M) can be produced by
using 5% w/v of corn starch after 5 days incubation of A. niger, 30oC of temperature,
shaker speed of 120 rpm, and 3% v/v of methanol as an additive.
2. The metal leaching of low-grade Indonesian saprolitic ore was conducted using <75m of
ore particle size, 40oC of leaching temperature, 5% w/v of pulp density and 200 rpm of
shaker speed. The results showed that around 40% of nickel can be extracted at 3 days
leaching process. Most nickel dissolved may originate from serpentine minerals.
3. The leaching rate of metabolic citric acid is slightly faster and higher than that of
chemical citric acid at similar conditions.
4. Metabolic citric acid produced from corn starch by A. niger has an excellent potential as a
reagent for metal leaching of saprolitic ore from Indonesia.
Acknowledgements
The authors gratefully acknowledge a Grant-in-Aid for Science Research (No. 15H02333)
of the Japan Society for the Promotion of Science (JSPS), the Ministry of Education, Culture,
Sports, Science, and Technology (MEXT) Japan for supporting of financial and other, and Dr.
M. Zaki Mubarok from Bandung Institute of Technology (Indonesia) for supporting of
saprolitic ore samples.
References
[1]
[2]
[3]

[4]

[5]

A, Supriyadi: Kolokium Pertambangan 2008. Bandung. Puslitbang Tekmira.


W. Astuti, T. Hirajima, K. Sasaki, N. Okibe: The Minerals and Metallurgical
Processing Journal, Vol. 32, No. 3 (August 2015).
Ashour, A., El-Sharkawy, S., Amer, M., Marzouk, A., Zaki, A., Kishikawa, A.,
Ohzono, M., Kondo, R., Shimizu, K., 2014, Production of citric acid from corncobs
with its biological evaluation. Journal of Cosmetics, Dermatological, Sciences, and
Application, 4, 141-149.
Wright, T., and Meylinah, S., 2014, Indonesia Grain and Feed Annual Report 2014,
from
http://gain.fas.usda.gov/Recent%20GAIN%20Publications/Grain%20and%20Feed%20
Annual_Jakarta_Indonesia_4-23-2014.pdf
Marrier, J. R. and M. Boulet: J. Dairy Sci. 41 (1958), pp. 1683-1692.

86

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Development of a Strategy for Selective Metal Recovery from


Pregnant Leach Solutions of Kupferschiefer Bioleaching
Sabrina Hedrich1,a*, Axel Schippers1,b, D. Barrie Johnson 2,c
1Federal

Institute for Geosciences and Natural Resources, Resource Geochemistry,


Stilleweg 2, 30655 Hannover, Germany

2School

of Biological Sciences, College of Natural Sciences, Bangor University,


Deiniol Road, Bangor LL57 2UW, U.K.

a*correspondence:

sabrina.hedrich@bgr.de, baxel.schippers@bgr.de,
cd.b.johnson@bangor.ac.uk

Keywords: sulfate reduction, pregnant leach solution, acidophiles, Kupferschiefer.


Abstract. Pregnant leach solutions (PLS) resulting from bioleaching of copper concentrate
from Kupferschiefer are characterized by low pH values and high concentrations of mainly
ferric iron, copper, zinc and sulfate, as well as significant amounts of nickel and cobalt. In
order to recover the valuable metals for further processing, a novel technique that promotes
selective metal recovery and sulfate removal from acidic liquors, described in this study, is
proposed.
Introduction
Bioleaching of ores and residues has become increasingly attractive over recent years as
an effective technique to recover metals with high efficiency from low-grade ores and
mineral wastes. Pregnant leach solutions (PLS) resulting from these processes often have low
pH and contain high concentrations of various transition metals, metalloids and sulfate. In
industrial processes, often only the target metals are recovered, using techniques such as
solvent extraction coupled to electrowinning (SS-EW). These techniques usually suffer from
high costs and are not effective when metals are present in relatively low concentrations.
Another approach harnesses the abilities of acidophilic, sulfate-reducing bacteria (SRB)
which use sulfate as electron acceptor to produce H2S and HS. The sulfide generated reacts
with chalcophilic metals (such as Cu or Zn) and has been used to selectively recover valuable
metals and to remove sulfate from acidic liquors [1, 2]. The design and application of
biosulfidogenic systems can vary with the nature of the water being treated, and can also be
used in tandem with other selective bio-mineralisation reactors to, for example, remove iron
from mine-impacted waters [3]. The approach had previously mostly been applied with mine
drainage waters, which tend to have much lower concentrations of metals and sulfate than
most commercial PLS. This paper describes the development of a system for recovering
metals from PLS generated by bioleaching of a copper concentrate, using sulfidogenic
bioreactors.
Experimental considerations
PLS chemistry. The synthetic PLS tested in this study was based on the chemistry of that
generated by the bioleaching of copper concentrate from Kupferschiefer (a black shale ore,
found throughout central Europe) using acidophilic, moderate-thermophilic bacteria
87

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
(Guezennec et al., unpublished, Table 1). The pH of the PLS is usually between 1.2 and 1.7,
depending on the ore material, leach period etc.. Metals were added to the synthetic liquor as
sulfate salts, and NaCl was included to give the equivalent amount of chloride as in actual
PLS. The pH was set to 1.7 for first trials.
Potential value of the PLS. The PLS is rich in copper which is one of the main targets of
recovery in this study and accounts with 252 US$/m3 (Table 2). Also cobalt and nickel occur
in the PLS in smaller concentrations than copper, iron and zinc, but have significant value
when recovered from the PLS due to their currently high prices on the market (Table 2). Zinc
is the second most abundant metal in this PLS with the lowest market price of the target
metals.
Table 1. Composition of PLS from copper concentrate bioleaching (Guezennec et al.,
unpublished).
Concentration
mM
Element
g/L
As
Cu
Fe (mostly Fe3+)
Zn
Ni
Co
SO42--S
NH4+-N
Mg
Cl

0.4
28
6.3
3.1
0.17
0.32
37
0.23
4.3
0.39

0.005
566
113
37
3
6
1,114
0.02
0.18
0.01

Table 2. Economic value of metals in the PLS (source: DERA, September 2014).
Metal
Market price
Value from PLS
(US$/kg)
(US$/m3)
Cu
7
252
Co
33
11.6
Ni
18
3.4
Zn
2.3
5.5
Sulfidogenic system. Chalcophilic metals (Cu, Zn, Co and Ni) will be recovered as
sulfides via controlled biomineralization. The system consists of an acidic sulfidogenic
upflow biofilm reactor which contains a mixed microbial community of acidophilic, sulfatereducing and other bacteria immobilized on porous glass beads (Poraver Dennert GmbH,
Germany). The bioreactor uses a low cost electron donor (glycerol) and has the additional
advantage of lowering the sulfate content of the liquor as sulfate serves as electron acceptor
for the sulfidogens and is converted to hydrogen sulfide which then reacts with the metals to
form metal sulfides.

88

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Table 3. Solubility products of target metal sulphides.
Metal
log Ksp
Cu2+
Zn2+
Co2+
Ni2+
Fe2+

-35.9
-24.5
-22.1
-21.0
-18.8

The design and operation of the system is similar to that described by ancucheo and
Johnson [1]. The working volume of the system was 2.3 L, temperature was set to 30C and a
continuous stream of nitrogen (200 mL/min) was used to maintain a slight positive pressure
within the reactor vessel and to remove excess H2S present. The bioreactor was operated in
continuous mode and pH was varied between 2 and 4.5. The bioreactors were fed with (ironfree) PLS additionally containing glycerol as electron donor and yeast extract (at 0.01%, w/v)
as a source of growth factors for the bacteria and a pH around 2.0. Selective metal
precipitation with the sulfidogenic system is achieved by controlling the pH of the process as
the metal sulfides concerned have different solubility products (Table 3), and form at
different pH values since the relative concentration of the reacting sulfide species (S2-) is pHdependent. The optimum operational conditions for the selective recovery of target metals
(Cu, Zn, Co and Ni) from the PLS using the sulfidogenic system was investigated. The
recovery of iron ahead or downstream of the metal sulfide precipitation was also a special
point of discussion.
Results and discussion
Iron recovery. The high ferric iron concentrations in the PLS interferes in the
sulfidogenic system, as most of the hydrogen sulfide reacts with ferric iron, reducing it to
ferrous iron and generating elemental sulfur. This would mean that the sulfidogenic system
needs to produce a lot more H2S (113 mM) than required for the metal sulfide precipitation.
Also an additional treatment step would have to be integrated in the process scheme to
oxidize the ferrous iron again and precipitate it in order to recover it from the PLS, which
would increase costs of the process. Therefore we suggest that in a first step soluble ferric
iron is precipitated selectively as the mineral schwertmannite by controlled addition of
alkaline to a pH of 3.5 (Figure 1). Previous studies showed that schwertmannite can be
precipitated from mine-impacted waters without co-precipitation of most other metals [4].
Schwertmannite is a potential valuable product which can especially be used for the removal
of arsenic (and other toxic metals) ahead of the iron removal step [5].
Copper sulfide precipitation. In the second stage of the metal recovery chalcophilic
metals (Cu, Zn, Co and Ni) are recovered as sulfides via controlled biomineralization. As
copper sulfide is the least soluble of the target metals, it needs to be recovered first to avoid
co-precipitation with other metals that have larger solubility products and which form at
higher pH values. Due to the high concentrations of copper in the PLS, precipitating CuS
within the sulfidogenic bioreactor is not a practical option, since: (i) > 350 mM glycerol
would need to be oxidised to produce enough sulfide to precipitate all the copper with
consequent hydraulic retention times (HRT) of several days; (ii) CuS produced within the
bioreactor vessel would be relatively impure (mixed with biomass and biofilm-colonised
89

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Poraver beads). On the other hand, this would be, in theory a pH-neutral reaction (equation
1). An alternative, and more pragmatic, configuration would be to precipitate CuS off-line in
a separate reactor vessel, using H2S generated in the sulfidogenic bioreactor (Figure 1).
4 C3H8O3 + 7 Cu2+ + 7 SO42- 12 CO2 + 7 CuS + 16 H2O

(1)

This way the HRT of the copper recovery vessel is only determined by the rate of excess
H2S production in the sulfidogenic bioreactor (see below). However, a consequence of this is
that the pH of the PLS would become very acidic due to the release of protons during copper
sulfide precipitation (to a projected pH of <1; eq. 2) and therefore addition of alkali would be
necessary to make the Cu-depleted PLS suitable for further downstream metal recovery using
sulfide precipitation.
Cu2+ + H2S CuS + 2 H+

(2)

Zinc sulfide recovery. Zinc is recovered online within the sulfidogenic bioreactor which
is fed with partly-neutralised copper-free PLS resulting from the copper sulfide precipitation
vessel (Figure 1). The inflow medium is pH 2.0 and glycerol is added at this stage as the
electron donor for the acidophilic sulfate-reducing bacteria in the reactor vessel. In order to
assure efficient zinc sulfide precipitation and operation of the system the bioreactor pH and
glycerol concentration is varied until complete zinc removal is achieved. The rate of glycerol
oxidation thereby influences the HRT of the system.
Also under test is, if by controlling the bioreactor pH (~3.2 4.0), zinc can selectively be
precipitated without co-precipitation of CoS and NiS. This could also be achieved by fine
tuning of parameters as the bioreactor pH and the glycerol concentration.

Figure 1. Proposed treatment scheme for PLS resulting from copper concentrate bioleaching
The sulfate concentration in the synthetic PLS (> 1.1 M; Table 1) is more than that required,
in theory, to precipitate all of the target metals (copper, zinc, cobalt and nickel) as sulfide
phases (0.61 M) if quantitatively reduced to H2S. Removal of ferric iron as schwertmannite
(Fe8O8(OH)6SO4) ahead of metal sulfide precipitation would remove, in theory, only about 14
90

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
mM sulfate. A major issue is whether the high osmotic potential of the feed used for the
bioreactor would have a negative impact on the sulfidogenic bacteria. Currently, the sulfate
used in the feed liquor for the bioreactor has been increased to 100 mM with no observable
negative impact.
Nickel and cobalt recovery. If cobalt is not co-precipitated during zinc recovery within the
bioreactor vessel, an offline precipitation with nickel is proposed. This will be carried out in
the same way as for the copper recovery in a separate vessel flushed with biogenic H2S from
the reactor (Figure 1). The starting pH of this liquor will be between 3.2 and 4.0 depending
on the pH at which the bioreactor is operated, but will also become acidic (pH of ~ 2) as a
consequence of metal sulfide precipitation. No pH-control is required at this stage of metal
recovery as further processing of the PLS with the sulfidogenic system is not considered.
Summary
A multi-stage system, mostly involving sulfidogenesis, for selectively recovering metals from
a copper-concentrate PLS is proposed. The scheme describes the efficient and selective
recovery of iron as schwertmannite, and copper, zinc, cobalt and nickel as metal sulfides. The
modular arrangement of the system allows an independent operation of the units and the
integration of further modules, depending on the nature of the leach solutions.
References
[1] I. ancucheo and D.B. Johnson: Microb. Biotechnol. Vol. 5 (2012), p. 34
[2] I. ancucheo and D.B. Johnson: Hydrometallurgy Vol. 150 (2014), p. 222
[3] S. Hedrich and D.B. Johnson: Environ. Sci. Technol. Vol. 48 (2014), p. 12206
[4] S. Hedrich and D.B. Johnson: Bioresource Technol. Vol. 106 (2012), p. 44
[5] E. Janneck et al. In: Proceedings IMWA 2010 , edited by C. Wolkersdorfer and A.
Freund/ CBU Press, Sydney, Canada (2010)

91

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Interactions between Chalcopyrite and Marmatite during


Bioleaching Process
Hongbo Zhaoa*, Jun Wangb*, Yansheng Zhangc, Guanzhou Qiud
School of Minerals Processing & Bioengineering, Central South University,
Changsha 410083, Hunan, PR China
aalexandercsu@126.com, bwjwq2000@126.com,
czhangyansheng405@126.com, dqiuguanzhoucsu@126.com

Keywords: bioleaching, chalcopyrite, marmatite, interactions.


Abstract. Chalcopyrite (CuFeS2) and marmatite [(Zn, Fe) S] are associated together most of
the time in the raw ores and flotation concentrates. In this work, the interactions between
chalcopyrite and marmatite during bioleaching by moderately thermophilic bacteria were
investigated by electrochemical measurements and bioleaching experiments. In the initial
stage of bioleaching of mixture of chalcopyrite and marmatite, the dissolution of marmatite
was preferential, and was significantly accelerated with the addition of chalcopyrite because
of the galvanic effect and catalytic effect of Cu2+ ions, while the dissolution of chalcopyrite
was inhibited mainly due to the galvanic effect before the accomplishment of marmatite
dissolution. Chalcopyrite dissolves fast when the dissolution of marmatite is finished, and
small amount of marmatite cannot inhibit the final copper extraction of chalcopyrite if
leaching time was long enough. Therefore, stepwise or selective bioleaching was feasible in
processing mixture of chalcopyrite and marmatite to avoid complex flotation process in
separating chalcopyrite and marmatite.
Chalcopyrite (CuFeS2) is the most abundant copper-bearing minerals in the world, accounting
for about 70% of the whole copper resources [1,2]. Marmatite [(Zn, Fe) S] is an important
zinc-bearing resource, which is difficult to be processed effectively by traditional
technologies as its high content of iron and low content of zinc [3-5]. Chalcopyrite and
marmatite are associated together most of the time in the raw ores. Moreover, as the
activation effect of copper ions on the flotation of marmatite, chalcopyrite and marmatite are
difficult to be separated effectively through flotation, so they also co-exist in flotation
concentrates most of the time [6-8]. Therefore, their interaction and relationship during
bioleaching process is an important topic. Moderately thermophilic bacteria are widely
considered to be effective in bioleaching of sulfide minerals, and are suitable to grow during
heap bioleaching due to the relatively high temperature in the heap [9-11]. In this work,
interactions between chalcopyrite and marmatite during bioleaching by moderately
thermophilic bacteria were studied.
Methodology
The chalcopyrite mineral was obtained from geological museum of Guangxi Province of
China, and the marmatite mineral was obtained from Dachang Mine of Guangxi Province of
China. They were of extremely high purity. Chalcopyrite contained 37.58% Cu, 27.88% Fe,
and 34.54% S (wt%), and marmatite contained 48.28% Zn, 14.67% Fe, and 33.78% S (wt%),
respectively. Ore samples were ground and sieved to -0.038 mm before used for leaching
experiments. All chemicals used were of analytical grade in this work. Bioleaching
experiments and electrochemical testes were carried out according to the previous study [12].
92

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Results and discussion
Bioleaching behaviors. Bioleaching experiments by mixed culture of A. caldu, S.
thermosulfidooxidans and L. ferriphilum verified the feasibility of stepwise or selective
bioleaching process for processing mixed minerals containing chalcopyrite and marmatite
(Fig. 1). In the initial stage of bioleaching, the dissolution of marmatite was preferential and
accelerated with the addition of chalcopyrite, and the dissolution of chalcopyrite was slow
before the accomplishment of dissolution of marmatite. Chalcopyrite started to dissolve fast
when the dissolution of marmatite finished, and small amount of marmatite cannot inhibit the
final copper extraction of chalcopyrite if leaching time was long enough. Therefore, stepwise
or selective bioleaching of mixture of chalcopyrite and marmatite is feasible, especially of the
mixture containing high grade of chalcopyrite and low grade of marmatite.
110
b 55 m(chalcopyrite)+m(marmatite)
c650
a 100
50
80
70
60
50

m(chalcopyrite)+m(marmatite)
0 g+2 g
2 g+0.5 g
2 g+1.5 g
2 g+3 g

40
30
20
10
0

10

15

20

25

30

35

600

2 g+0 g
2 g+0.5 g
2 g+1.5 g
2 g+3 g

45
40
35

550

Redox potential/mV

Copper extraction rate/%

Zinc extraction rate/%

90

30
25
20
15
10

450
400

2g+0g
0g+2g
2g+0.5g
2g+1.5g
2g+3g

350
300

5
40

500

10

15

Time/day

20

25

30

35

40

250

10

15

20

25

30

35

40

Time/day

Time/day

Figure 1. Results of bioleaching tests with different fractions of chalcopyrite and marmatite
(mass of chalcopyrite +mass of marmatite): (a) zinc extraction; (b) copper extraction; (c)
redox potential.
Electrochemical behaviors. Fig.2 presents the cyclic voltammograms of marmatite,
chalcopyrite, and mixed electrodes containing different fractions of marimatite and
chalcopyrite. Peak potential indicates the oxidation of marmatite according to Eq. (1) [7-13].
The oxidation reaction can be accelerated with the addition of chalcopyrite. Obviously, it can
be found that the addition of marmatite did not change the oxidation and reduction reactions
of chalcopyrite, and the addition of chalcopyrite can accelerate the oxidation reaction of
marmatite mainly as the galvanic effect.
(1)
Zn1x FexS (2 x)H 2O (1 x)Zn(OH) 2 xFe(OH)3 S0 (2 x)e (2 x)H
6

Current density (mA/cm )

4
2

bc

f
marmatite
chalcopyrite
chalcopyrite:marmatite=1:1
chalcopyrite:marmatite=5:2
chalcopyrite:marmatite=6:1
chalcopyrite:marmatite=2:5
chalcopyrite:marmatite=1:6

-2

-4

-6
-1000 -800 -600 -400 -200 0 200 400 600 800 1000
Potential (mV)

Figure 2. Cyclic voltammograms of electrodes with different ratios of chalcopyrite and


marmatite.

93

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Influences of metal ions on electrochemical behaviors. Fig. 3(a) presents the cyclic
voltammograms of chalcopyrite at the presence and absence of Zn2+ ions. It clearly reveals
that Zn2+ has no obvious effect on electrochemical dissolution of chalcopyrite. Fig. 3(b)
shows that the corrosion potential of chalcopyrite decreased just slightly with the addition of
Zn2+ ions, but no obvious shift of the corresponding parameters took place, indicating that the
effect of Zn2+ ions on chalcopyrite can be very small.
Fig. 3(c) presents the results of cyclic voltammetry tests of marmatite at the presence
and absence of Cu2+ ions. It obviously reveals that new anodic and cathodic peaks appeared
by the addition of Cu2+ ions. Fig. 3(d) shows that the corrosion potential of marmatite
increased significantly with the addition of Cu2+ ions. Additionally, the corrosion current
density increased from 5.7A/cm2 to 61.1 and 119.4A/cm2 when the concentrations of Cu2+
ions were 0.5 and 3.0 g/L, respectively, indicating that the surface of marmatite has been
changed to another new material, which was easier to be oxidized or corroded. Some
researchers have reported that Cu2+ can substitute zinc ions and inlay the crystal lattice of
marmatite, thus improving the potential and conductivity of mineral surface [14-16].
7
6
5
4
3
2
1
0
-1
-2
-3
-4
-5
-1000 -800

800

2+

3g/L Zn
2+
6g/L Zn
2+
0 g/L Zn

-600 -400 -200 0


200
Potential (mV)

400

600

400

1E-8

1E-7
1E-6
2
Current density (mA/cm )

1E-5

800

d 700

0 g/L Cu
2+
0.5 g/L Cu
2+
3.0 g/L Cu

600

Potential (mV)

Current density (mA/cm )

500

200

800 1000

2+

600

300

12

2+

0 g/L Zn
2+
3 g/L Zn
2+
6 g/L Zn

700

Potential (mV)

Current density (mA/cm )

-4

2+

0 g/L Cu
2+
0.5 g/L Cu
2+
3 g/L Cu

500
400
300
200
100

-8
-1000 -800 -600 -400 -200 0
200 400 600 800 1000
Potential (mV)

1E-7

1E-6
1E-5
1E-4
2
Current density (mA/cm )

1E-3

Figure 3. Effects of Zn2+ ions on the electrochemical behaviors of chalcopyrite: (a) cyclic
voltammograms, (b) tafel curves; Effects of Cu2+ ions on the electrochemical behaviors of
marmatite: (c) cyclic votammograms, (d) tafel curves.
Conclusions
Marmatite was preferentially dissolved during bioleaching of mixed minerals containing
chalcopyrite and marmatite. Dissolution of marmatite was significantly accelerated with the
addition of chalcopyrite mainly due to the galvanic effect and catalytic effect of Cu2+ ions.
Chalcopyrite dissolved extremely slowly before the accomplishment of dissolution of
marmatite mainly due to the galvanic effect, and dissolved fast when the dissolution of
marmatite finished. Therefore, stepwise or selective bioleaching process is feasible for mixed
minerals containing chalcopyrite and marmatite, especially for mixture containing high grade
of chalcopyrite and low grade of marmatite. The highly selective and efficient bioleaching
technique of raw ores and flotation concentrates containing chalcopyrite and marmatite needs
to be further studied.

94

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Acknowledgments
This work was supported by the National Natural Science Foundation of China (project
No. 51374248).
References
[1] Y. Li, N. Kawashima, J. Li, A.P. Chandra, A.R. Gerson, A review of the structure, and
fundamental mechanisms and kinetics of the leaching of chalcopyrite, Adv. Colloid.
Interfac. 197-198 (2013) 1-32.
[2] H.R Watling, The bioleaching of sulphide minerals with emphasis on copper sulphides
a review, Hydrometallurgy 84 (2006) 81-108.
[3] S.Y Shi, Z.H Fang, Bioleaching of marmatite flotation concentrate by Acidithiobacillus
ferrooxidans, Hydrometallurgy 75 (2004) 1-10.
[4] S. Shi, Z. Fang, Bioleaching of marmatite flotation concentrate by adapted mixed
mesoacidophilic cultures in an air-lift reactor, Int. J. Miner. Process. 76 (2005) 3-12.
[5] J.R Ban, G.H Gu, K.T Hu, Bioleaching and electrochemical property of marmatite by
Leptospirillum ferrooxidans, T. Nonferr. Metal. Soc. 23 (2013) 494-500.
[6] R. Liu, W. Sun, Y. Hu, D. Wang, Surface chemical study of the selective separation of
chalcopyrite and marmatite, Mining Science and Technology (China) 20 (2010) 542-545.
[7] W. Qin, F. Jiao, W. Sun, M. He, H. Huang, Selective Flotation of Chalcopyrite and
Marmatite by MBT and Electrochemical Analysis, Ind. Eng. Chem. Res. 51 (2012)
11538-11546.
[8] W. Qin, F. Jiao, W. Sun, X. Wang, B. Liu, J. Wang, K. Zeng, Q. Wei, K. Liu, Effects of
sodium salt of N, N-dimethyldi-thiocarbamate on floatability of chalcopyrite, sphalerite,
marmatite and its adsorption properties, Colloid. Surf. A-Physicochem. Eng. Asp. 421
(2013) 181-192.
[9] W. Zeng, G. Qiu, H. Zhou, J. Peng, M. Chen, S.N. Tan, W. Chao, X. Liu, Y. Zhang,
Community structure and dynamics of the free and attached microorganisms during
moderately thermophilic bioleaching of chalcopyrite concentrate, Bioresource. Technol.
101 (2010) 7068-7075.
[10] N.P Marhual, N. Pradhan, R.N. Kar, L.B. Sukla, B.K. Mishra. Differential bioleaching of
copper by mesophilic and moderately thermophilic acidophilic consortium enriched from
same copper mine water sample, Bioresource. Technol. 99 (2008) 8331-8336.
[11] K.Q. Jiang, Z.H. Guo, X.Y. Xiao, X.Y. Wei, Effect of moderately thermophilic bacteria
on metal extraction and electrochemical characteristics for zinc smelting slag in
bioleaching system, T. Nonferr. Metal. Soc. 22 (2012) 3120-3125.
[12] H. Zhao, J. Wang, C. Yang, M. Hu, X. Gan, L. Tao, W. Qin, G. Qiu, Effect of redox
potential on bioleaching of chalcopyrite by moderately thermophilic bacteria: An
emphasis on solution compositions, Hydrometallurgy 151 (2015) 141-150.
[13] S.Y Shi, Z.H. Fang, J.R. Ni, Electrochemistry of marmatitecarbon paste electrode in the
presence of bacterial strains, Bioelectrochemistry 68 (2006) 113-118.
[14] J. Liu, S. Wen, X. Chen, S. Bai, D. Liu, Q. Cao, DFT computation of Cu adsorption on
95

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
the S atoms of sphalerite (110) surface, Miner. Eng. 46 (2013) 1-5.
[15] S.H. Yin, A.X. Wu, G.Z. Qiu, Bioleaching of low-grade copper sulphides, T. Nonferr.
Metal. Soc. 18 (2008) 707-713.
[16] L. Quan, Electrochemical flotation separation of marmatite from pyrrhotite in the
presence of copper ion, T. Nonferr. Metal. Soc. 10 (2000) 90-92.

96

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Overcoming the Bacteriostatic Effects of Heavy Metals on A.


Thiooxidans Direct Bioleaching of Saprolitic Ni Laterite Ores
Hee-Chan Janga and Marjorie Valixb*
School of Chemical and Biomolecular Engineering, University of Sydney, NSW,
2006, Australia
a

hee-chan.jang@sydney.edu.au, b* correspondence: marjorie.valix@sydney.edu.au

Keywords: Acidithiobacillus, acidophiles, nickel, laterite, bioleaching


Abstract. In this study, the adaptation of A. thiooxidans to heavy metals leached from
saprolitic Ni laterite ores was performed by gradual acclimatisation. The bacteria was
cultivated in heavy metals (Ni, Co, Fe, Mg, Cr and Mn) with total concentrations of 2400 to
24000 ppm equivalent to total dissolution of 1 to 10% (w/v) pulp densities of the saprolitic Ni
laterite ore. Adaptation evolution mapped from its tolerance index was found to be dependent
on metal concentration, acid generation, and period of adaptation. Bio-stimulation of cell
growth and acid production was promoted by heavy metal stress on the bacteria. Preestablished heavy metal tolerance of the bacteria improved the leaching rate in its early phase;
20% and 7% increase in Ni and Co metal recoveries were observed in using adapted bacteria.
However heavy metal tolerance was also achieved by the bacteria during the leaching process,
albeit delayed by a lag phase. These results confirm the robust nature and suitability of A.
thiooxidans in direct biomining of Ni ores.
Introduction
Bio mining is considered a promising technology in the extraction of metallic values from
Ni laterite ores in particular when grades are sub-economic for conventional technologies.
Acidithiobacillus thiooxidans is a key micro-organism that has found application in
biomining Ni laterite ores; this chemoautotrophic bacteria however must be supplemented
with inorganic compounds containing reduced S and Fe2+ to derive their energy. Management
of microbiology within the leaching process continues to be a key area of research in this
field [1]. Achieving stable populations of microbes with the required functionality is crucial
for efficient bioprocessing. This, however, is challenged by the many possible inhibitory
factors, foremost is the bacteriostatic and in some cases biocidal effects of leached heavy
metals [2]. This study examined and compared the evolution of heavy metal adaptation of A.
thiooxidans in two environments: sequential acclimatisation to predetermined heavy metal
concentration steps and in the bioleaching of saprolitic Ni laterite ores. This was performed to
establish the potential merit of pre-established adaptation of the bacteria to heavy metals on
its growth, acid production and its ability to dissolve the metallic fractions of Ni ores.
Experimental setup
Ore preparation and characterisation. The saprolitic Ni laterite ore was obtained from
Riverina, Australia, and prepared in-house. In brief, the ore was milled and screened to a size
fractions from 63 to 180 m. Elemental analysis of the ore was performed using PANalytical
PW2400 Sequential WDXRF: 17.09% Mg, 5.81% Fe, 0.92% Ni, 0.18% Mn, 0.056% Co, and
0.02% Cu.
97

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Table 1. Elemental concentrations (ppm) of various
pulp densities of saprolitic ores.
Pulp Density
(%, w/v)
Metal
components
Mg
Fe
Ni
Mn
Co
Cu
Total

10

Equivalent heavy metal concentration


(ppm)
1709
3418
8545
17090
581
1162
2905
5810
92
184
460
920
18
36
90
180
5.6
11.2
28
56
2
4
10
20
2407.6
4815.2
12038
24076

Heavy metal adaptation. A. thiooxidans (DSM-622) was obtained from German


Collection of Microorganisms and Cell Cultures, Braunschweig, Germany. The bacteria was
grown aerobically in modified ATCC Medium 125, consisting of 1L distilled water, 0.5 g/l
MgSO4.7H2O, 0.25 g/l CaCl2, 0.2 g/l (NH4)2SO4, 3.0 g/l KH2PO4, 5.0 mg/l FeSO4, 25 g/l S0.
The pH of the medium was adjusted to 1.5 with H2SO4. The inoculated culture was then
incubated in a shaker at 30C, 150 rpm for 35 days. The bacteria were adapted by
subculturing and gradually exposing them to growth medium containing higher metal
concentrations from 2400 to 24000
Cell Count (cell/mL) with HM
ppm (Table 1). The adaptive evolution TI
(Eq. 1)
Cell Count (cell/mL) without HM
of bacteria was mapped by measuring
growth tolerance index (TI) with time
(Eq. 1) [3].
Direct bioleaching. Two separate one-step bioleaching of 10% (w/v) saprolitic Ni laterite
was conducted by inoculating the growth medium with 11011 cell/L of heavy metal adapted
and unadapted bacteria. The pH of medium was adjusted to 1.0. Bioleaching was performed
aerobically at 30oC, 150 rpm for 35 days. The metal dissolution was monitored by taking
subsamples of the slurry at intermittent time intervals, filtered and analysed using Varian
720-ES Inductively Coupled Plasma Optical Emission Spectrometers (ICP-OES) using
standard procedures.
Results and discussion
Growth during adaptation. The exposure to heavy metals at various pulp densities
inhibited early growth phase (< 10 days) of A. thiooxidans, reflected by TI of less than 1.0
(Fig. 1). The TI decreased progressively with increasing pulp density. However with time, it
was evident that bacteria began to adapt to higher pulp densities to exceed those at the lower
pulp densities. At day 35, the TIs were 1.14, 0.71, 1.03, and 0.77 at 1%, 2%, 5%, and 10%,
respectively (Fig. 2). Chaperone proteins are known to stimulate growth after stress
acclimatisation in plants, however their occurrence in bacterial cells does not appear to be
well established [4]. The results in this study appear to be consistent with Chaperone activity;
however this needs further analysis for confirmation. It has been shown that exposure to 29293 ppm of Ni2+ can progressively inhibit A. thiooxidans [5, 6]. Such tests, however, were
only carried out for 8 days. Fig. 1 shows that the period of adaptation has an important
98

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
bearing on the cell response to heavy metals. With time, the initial inhibition was overcome
and after 10 days this was followed by rapid growth then mild decline in growth and
stationary growth phase, then again rapid growth; particularly in 1% and 10% pulp densities,
where TI exceeded 1.0 after 30 days of
growth. These results are evidence of ongoing adaptation of A. thiooxidans,
emphasising the importance period of
adaptation. Far more interesting was the
ability of the bacteria to adapt to 920 ppm
of Ni2+, which is three times that of
previously observed and in the presence of
other soluble metals that are also known to
inhibit acidophiles to different extents [7].
It would be expected that in combination,
the mixed metals would have had a greater
bacteriostatic effect. It appears that the use
of longer adaptation enabled exceptionally
high heavy metal tolerance to be achieved
in A. thiooxidans. Previous reports of the
effect of solution pH may shed further light
Figure 1. The growth phases of A. thiooxidans in the on this effect. Maeda et al. (1996) inferred
presence of heavy metals relative to control grown in that increasing solution pH from 3.0 to 7.0
absence of heavy metals. Legend: a rapid growth;
promoted the binding of Ni2+ on cells,
b retarded growth; c similar growth; d enhanced
resulting in the disruption of enzyme
catalysed sulfur oxidation and cell growth
[5]. Fig. 3 shows pH with bacterial cultivation that was driven from pH 1.5 to about pH 0.5. It
is presumed that the generation of such low pH may have contributed in reducing metal
binding on cell walls and bacterial inhibition over time.
0% HM

1% HM
5% HM
10% HM

b
a

Figure 2. Development of relative heavy metal


tolerance of A. thiooxidans with growth phase:
() a - retarded growth (Day 13); () b - similar
growth (Day 15); () c - enhanced (Day 35).

Figure 3. Development of pH of A. thiooxidans


exposed heavy metals (Table 1): () 0%; () 1%;
() 5%; () 10%.

99

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Effect of adaptation on acid production. Fig. 3 shows that exposure of A. thiooxidans to


heavy metals (HM) have resulted in greater rate of acid production. At day 10, the pHs of
0.89, 1.13, 0.55 and 0.57, were achieved at 0%, 1%, 5% and 10% HM pulp densities,
respectively. This is consistent with the stimulation of growth of the bacteria resulting from
the post-stress acclimatisation period from heavy metal exposure observed in TI map (Fig. 1
and Fig. 2).

Figure 4. Cell growth of heavy metal unadapted and


adapted A. thiooxidans in media containing 10% (w/v)
saprolitic Ni laterite ore: () adapted; () unadapted.

Figure 5. pH of heavy metal unadapted and adapted


A. thiooxidans in media containing 10% (w/v)
saprolitic Ni laterite ore: () adapted; () unadapted.

Effect of adaptation on bioleaching. Bacteria that have been adapted at 10% pulp density
were used in the following bioleaching tests. The cell growth of adapted and unadapted
bacteria in Fig. 4 shows cell response to heavy metals. The adapted strains continued to grow
with time, whilst the unadapted strains showed initial lag phase of 8 days, followed by
rapidly increasing growth rate that exceeded adapted cells. These results provide further
evidence of cell stimulation by heavy metals. The pH during bioleaching in Fig. 5 shows that
pre-establishing heavy metal tolerance has resulted in faster rate of acid production in initial
growth phase (< 10 days), but in time, both showed similar rates. The rise in pH for the
unadapted bacteria leaching is due to its inability to adapt and maintain pH against
dissolution of acid consuming minerals (e.g., magnesium rich serpentine, see Table 1). The
effect of pre-establishing heavy metal tolerance on kinetics of Ni and Co recoveries is shown
in Fig. 6 and Fig. 7. It was shown that adapted A. thiooxidans resulted in 20% more Ni and 7%
more Co after 35 days of leaching. These results show that adaptation can affect the early
phase of metal recoveries and improve the overall kinetics of biomining of Ni laterite ores.

100

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 6. Nickel recovery of heavy metal unadapted


and adapted A. thiooxidans from 10% (w/v)
saprolitic Ni laterite ore: () adapted; () unadapted.

Figure 7. Cobalt recovery of heavy metal unadapted


and adapted A. thiooxidans from 10% (w/v)
saprolitic Ni laterite ore: () adapted; () unadapted.

Conclusions
Overcoming bacteriostatic effects of heavy metals on A. thiooxidans have been attributed
to both intracellular and extracellular behaviour of the bacteria. In this study, the process for
overcoming this effect was not established; however the production of acids would have
increased the stability of the metals in solution and reduced the binding of metals on the cell
walls and potentially their toxic effects. The merits of adaptation are further reflected from
the stimulation of cell metabolism and leaching performance. The stimulation of bacterial
growth and acid production were evident with exposure to increasing heavy metal
concentrations. This behaviour is consistent with activity of the chaperon proteins that
activate growth stimulation after stress acclimatisation, which needs to be confirmed. Preestablishing heavy metal tolerance resulted in 20% and 7% increase in Ni and Co recoveries
after 35 days of leaching, demonstrating the potential benefit of adaptation. A. thiooxidans
adaptation was also achieved by its gradual exposure to heavy metals during leaching,
although the adaptation evolution was slightly delayed by a lag phase of 8 days.
References
[1] D.B. Johnson: Transactions of Nonferrous Metals Society of China, (2008) Vol 18,
1367-1373.
[2] H.M. Li, J.J. Ke: Hydrometallurgy, (2001) Vol 61, 151-156.
[3] H.R. Watling: Hydrometallurgy, (2008) Vol 91, 70-88.
[4] M. Valix, L.O. Loon: Minerals Engineering, (2003) Vol 16, 193-198.
[5] P. Castiglioni, D. Warner, R.J. Bensen, D.C. Anstrom, J. Harrison, M. Stoecker, M.
Abad, G. Kumar, S. Salvador, R. D'Ordine, S. Navarro, S. Back, M. Fernandes, J.
Targolli, S. Dasgupta, C. Bonin, M.H. Luethy, J.E. Heard: Plant Physiology, (2008) Vol
147, 446-455.

101

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[6] T. Maeda, A. Negishi, Y. Nogami, T. Sugio:
Biochemistry, (1996) Vol 60, 626-629.

Bioscience Biotechnology and

[7] Y. Nogami, T. Maeda, A. Negishi, T. Sugio: Bioscience Biotechnology and


Biochemistry, (1997) Vol 61, 1373-1375.

102

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

An In Situ Characterization for the Bioleaching Process of Natural


Pyrite Using Electrochemical Noise Technique
CHEN Guobao1, a, YANG Hongying1, b, LI Haijun1, c
School of Materials & Metallurgy, Northeastern University, Shenyang 110819,
China

chengb@smm.neu.edu.cn, yanghy@smm.neu.edu.cn, cl.831127@gmail.com

Keywords: bioleaching process, pyrite, electrochemical noise, biooxidation.


Abstract. An in situ characterization has been carried out for several active systems (sulfuric
acid, ferric iron, 9k medium and bioleaching solutions) to investigate the bioleaching process
of natural pyrite using electrochemical noise (ECN) technique. Spectral noise impedance
spectra obtained from power spectral density (PSD) plots for the different systems were
compared. It has been observed that the bioleaching system obtained the lowest noise
resistance Rsn 0.101M. The reaction mechanism was proposed based on experimental data
analysis. The bioleaching process of natural pyrite has been identified as the main function of
bio-battery reactions, which distinguishes from the chemical oxidation reaction for the ferric
ion and 9k solutions.
Introduction
The growing world demand for raw minerals has led to the increased exploitation of low
grade sulphide ores, necessitating processing of ores with complex mineralogy, particularly
for base metals. Bioleaching is a process of dissolution of metal sulfides due to the oxidative
activity (direct or indirect) of some microbial species. Though the bio-oxidation of mineral
sulfides has been investigated for many years, there is still not a generally accepted
mechanism and the kinetics are not yet defined in terms of rate equations which can be used
to predict the performance of the bioreactors used for bio-oxidation.
Pyrite is one of the most common sulphide mineral. During the past six decades, many
studies have been carried out on pyrite oxidation mechanism [1]. These studies find that
Acidithiobacillus ferrooxidans, an acidophilic sulfur and iron-oxidizing microorganism
deriving energy from Fe2+ oxidation or sulfur compounds reduction, plays an important role
in the oxidation of FeS2 at pH below 4.0. However, the interfacial mechanism of
bacteria/sulfide interaction is still poorly understood [2]. Pyrite oxidation in bioleaching
processes has been studied by electrochemical mechanisms. In the previous reports,
traditional electrochemical techniques such as cyclic voltammetry, polarization curve and
electrochemical impedance spectroscopy have been performed [3]. However, these methods
require an external signal and often are relatively long.
Electrochemical noise (ECN) analysis is a relatively new technique, which finds growing
application in corrosion monitoring, investigation of general and localized corrosion.
Electrochemical noise technique is not necessary to apply a perturbation on the test system by
an externally imposed polarization which will lead to inevitable changes of the system
specific properties such as the surface structure and roughness, adhesion of bacteria.
In this work, the ECN technique was applied to monitor the bacterial and chemical
dissolution of pyrite continuously. The electrochemical linear sweep voltammetry was also
103

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
used to confirm the changes of pyrite before and after oxidation. The ECN analysis results
have been utilized to evaluate the bioleaching of sulfide minerals. These analyses also
provide information about kinetic and electrochemical of different processes occurring during
bacterial and chemical dissolution of pyrite.
Materials and Method
Natural pyrite was used as electrode material. The chemical composition analyzed by Xray fluorescence (XRF) showed the purity of pyrite is 95.56 % and main impurities were SiO2
(3.32%).
Bacteria named HQ0211 were used in this work. A mixed bacterial culture HQ0211
dominated by Acidithiobacillus ferrooxidans was used in the bioleaching test. The bacteria
were domesticated like this for three times and finally 100 ml of the cell suspension was
transferred to an electrochemical cell. The three different mediums, which contain sulfuric
acid solution (pH=1.8), sterile 9k solution [2] and 9 gL-1 ferric iron solution (pH=1.8)
respectively were also served as comparisons during the electrochemical tests.
The electrochemical cell was equipped with the paste electrode as the working electrode, a
platinum foil electrode as the counter electrode and a reference electrode using saturated
calomel electrode (SCE) with a salt bridge (capillary). All potentials quoted in this study are
referenced to SCE. The electrochemical measurements were performed by an electrochemical
workstation (Autolab, PG302N). Prior to the electrochemical study, the paste electrode was
maintained in the electrolyte solution for 10 min in order to obtain reproducible results. All
the experiments were conducted at 298 K for three times.
In a noise experiment the potentials and currents were measured at a fixed rate for a
chosen time interval. The power spectrum is illustrated by power spectral density plots as the
power per unit of frequency. In this technique, the ECN data in time domain is transformed to
frequency domain using fast Fourier algorithm transform(FFT) and identified as the PSD plot.
This plot gives much information about type, mechanism and rate of corrosion. Potential and
current PSD plots have the general frequency dependence:
logPSD = + logf
(1)
logPSD = + logf
(2)
where SE and SI are the roll-off slopes of the potential and the current PSD plots
respectively, and AE is the noise intensity of potential of PSD plots expressed as log (V2 Hz-1).
The noise resistance Rsn (f) was obtained by elimination of ECN data at the higher
frequencies resulting in lower fmax values while maintaining fmin. Spectral noise resistance
plot has the general frequency dependence:
logPSD = + logf
(3)
where SRsn is the slope of the noise resistance plot.
Results and discussion
Noise data were analysed into the frequency domain using FFT algorithm and identified as
the power spectral density. The high frequency region reveals the characteristics of fast
reaction step, while the low frequency region relates to the low phase. Analysis of
electrochemical noise data in the frequency domain of pyrite anodes in various leaching
solutions gives three PSD plots presented in Fig. 1. A common feature of these plots was that
the white noise, which was independent of the frequency, appeared in the lower frequency
104

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
region; in the higher frequency region, it was 1/fn noise. The slope of the 1/f n noise is defined
as the roll-off slope (n). The roll slopes of the potential and current are calculated, as shown
in Table 1. PSD slopes can be considered as a source of mechanistic information and they are
utilized to discern between general and localized corrosion. It has been suggested the roll-off
slope of PSD current curve would be steeper when pitting corrosion initiated, as compared to
the passive state and general corrosion. From Table 1, a slope of -2.17 for the sulfuric acid
solution, and -0.260 for the bioleaching solution could be attributed to pit initiation and
passivation processes, respectively. This result was consistent with the statistical analysis of
pitting initiation rate in the time domain. The general corrosion in the bioleaching system
may be due to the high reaction rate of biological metabolic reactions.
The current limit of PSD plots IPSDL reveals the extent of whole reactions. The system of
9k solution obtained the largest IPSDL 303x10-12 A2Hz. The reason may be that the reaction
current was the sum current of the oxidation of ferrous ion and pyrite. Compared to that
exposed to the system of ferric iron (15.1x10-12 A2Hz), it can be inferred that the chemical
oxidation of pyrite is the dominant process for the 9k system. The IPSDL in sulfuric acid
solution was only 0.610x10-12A2Hz, and it may be due to the low reaction rate of oxygen
dissolution and pyrite oxidation.

Figure 1. Potential and Current PSD of pyrite exposed to different leaching solution.
Table 1. Electrochemical noise data calculated in the frequency domain for pyrite exposed to
different medium at initial stage. All the potentials quoted are referenced to SCE.
Medium

SV

SI

SRn

Sulfuric acid
Ferric iron

-1.62
-1.28

-2.17
-0.712

0.275
-0.284
105

IPSDL
/10-12A2Hz
0.610
15.1

Rsn (m)
/M
194
0.551

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
9k
Bioleaching

-1.33
-2.06

-1.24
-0.260

-0.0450
-0.900

303
2.28

3.84
0.101

Noise resistance is a statistical parameter, which is inversely related to corrosion rate and
this inverse relationship has been exploited to qualitatively assess the corrosion behavior. Fig.
2 shows the frequency dependence of Rsn, and the mean noise resistances Rsn (m) were also
calculated and shown in Table 1. The value for bioleaching system obtained the lowest Rsn
0.101M, which clearly indicate that the addition of bacteria increased the dissolution of
pyrite. The average corrosion resistance Rsn for sulfuric acid system was 194 M, much
higher than the other systems. It indicates that the dissolution of pyrite is the most difficult in
these solutions. It is worth noting that the over trend of noise resistances in the ferric iron and
9k systems were more constant, and the mean value in the former solution was only 14.3% as
that in the later solution. This may be due to the main processes for these two solutions are
both chemical oxidation reactions and the less amount of ferric iron existed in the 9k solution.

Figure 2. Noise resistances of pyrite exposed to different leaching solution.


Conclusions
A directed research on the bioleaching process of natural pyrite using electrochemical
noise analysis was successfully conducted. From the test results, the stability of interface
material exposed to the ferric iron and bioleaching systems were found better than that for the
sulfuric acid and 9k systems at the initial stage. A PSD current slope of -2.17 for the sulfuric
acid solution is obtained and its oxidation process is considered as pitting corrosion. The
bioleaching system obtained the lowest noise resistance Rsn 0.101M.

106

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Acknowledgements
The authors acknowledge the financial support of National Natural Science Foundation of
China (51304047 and 51374066), Ph.D. Programs Foundation of Ministry of Education of
China (20130042120040), and Fundamental Research Funds for the Central Universities of
China (N110302002).
References
[1] Garcia, O., Oxidation of isochemical FeS2 (marcasitepyrite) by acidithiobacillus
thiooxidans and Acidithiobacillus ferrooxidans, Minerals Engineering, 20 (2007), 98-101.
[2] Gu, G.H., Sun, X.J., Hu, K.T., Electrochemical oxidation behavior of pyrite bioleaching
by
[3] Acidthiobacillus ferrooxidans, Trans. Nonferrous Met. Soc. China, 22 (2012) 1250-1254.
[4] Yun, L., Zhi, D., Guining, L., Utilization of electrochemical impedance spectroscopy for
monitoring pyrite oxidation in the presence and absence of Acidithiobacillus
ferrooxidans. Minerals Engineering 24 (2011), 833-838.

107

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Organic Acid Biogeneration by Aspergillus niger and Its Utilization


for Indirect Bioleaching of Nickel Laterite Ore
M.Z. Mubarok1,a, Robi S. Sulistyo2,b, S.K. Chaerun1,3,c, W.P. Minwal1,d
1Department

of Metallurgical Engineering, Institute Technology of Bandung, Jl.


Ganesha10, Bandung, 40132, Jawa Barat, Indonesia

2Research

Center for Mineral and Coal, Ministry of Energy and Mineral Resources,
Jl. Jenderal Sudirman, 623, Bandung, 40211, Jawa Barat, Indonesia

3Geomicrobiology-Biomining

& Biocorrosion Laboratory, Microbial Culture Collection


Laboratory, Biosciences and Biotechnology Research Center, Institute Technology
of Bandung, Jl. Ganesha, 10, Bandung, 40132, Jawa Barat, Indonesia
a,*zaki@mining.itb.ac.id, brobisuryaning@yahoo.com,
cskchaerun@metallurgy.itb.ac.id, dwahyudinp@gmail.com

Keywords: biogeneration, Aspergillus niger, bioleaching, nickel laterite, extraction.


Abstract. This paper discusses the results of indirect bioleaching test works of nickel laterite
ore by the assistance of Aspergillus niger. Series of metabolic acid biogeneration shake-flask
experiments were performed to investigate the effects of substrate type, nitrogen and
phosphate dosages, the presence of magnesium and manganese salts, as well as aeration of
the culture media on the effectiveness of the metabolic acid biogeneration. The investigation
results showed that after 16 days of incubation, the solution pH of 1.44 was obtained from the
acid biogeneration using cassava starch as carbon source in the presence of 0.1% (w/w)
KH2PO4, 1% (w/w) (NH4)2SO4 and 0.25 g/L of MgSO4 under aerated condition. Leaching
experiments of limonite and saprolite ore samples were carried out by using the generated
metabolic acids at various ore particle size distributions, solid to liquid ratio and temperature.
The highest nickel extraction percentage of 88.9% was obtained from the leaching of
saprolite ore at 95C, stirring speed of 400 rpm, particle size distribution of -80+100 mesh,
solid to liquid ratio of 4.65 g/mL after 240 minutes, while that of 84.9% was obtained from
the leaching of limonite ore at 95C, stirring speed of 400 rpm, particle size distribution of 80 +100 mesh and solid-liquid ratio of 5.2 g/ml after 1440 minutes. The leaching of saprolite
ore by using the biogenerated acids was selective to magnesium, with co-extracted Mg of
only 1.5% after 24h of the agitation leaching test.
Introduction
Hydrometallurgical processes for nickel laterite ore treatment in industries are commonly
utilizing inorganic acids as leaching agents such as sulfuric, hydrochloric and nitric acids
[1,2]. In this regard, establishments of acid plant and acid regeneration facilities contribute to
main components of capital expenditure. Despite the effectiveness of inorganic acid
utilization in terms of nickel recovery and leaching kinetics, the use of these kinds of strong
inorganic acids requires special care on corrosion of the reactor and supporting equipments,
leaching selectivity to iron and magnesium, and environmental impact from the acidic
residues. Bioleaching is one of process alternatives for extraction of nickel from laterite ore
which utilizes microorganisms that can be grown up by a cheap biotechnology [3,4]. The
waste generated is in organic form; thus it is regarded as an eco-friendly process. The
previous investigations that have been conducted for extracting nickel from laterite ores are
108

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
mostly implementing a direct bioleaching, in which acid biogeneration and leaching of ores
being done in the same reactor [5,6,7]. The main challenge of direct bioleaching of nickel
laterite ore is how to control the growth of microorganisms that are aimed at generating acids
and simultaneously maintaining process parameters required for valuable metals dissolution
from the ore. In the present work, indirect bioleaching of nickel laterite ore from Indonesia by
using metabolic organic acids that was generated by heterotrophic fungus of Aspergillus
niger is discussed.
Materials and Methods
Ore Sample. The ore sample was taken from a nickel mine area in Pomalaa, South-East
Province of Indonesia. The types of nickel laterite ore samples used were low-grade saprolite
and limonite. Chemical composition of major elements for both ore samples was presented in
Table 1 and Table 2, respectively. The differences between these ore types were the contents
of magnesium and iron, where the saprolite ore had much higher magnesium with lower iron
contents than the limonite ore. XRD analysis revealed that the dominant minerals in the
limonite sample were goethite and quartz, while vermiculite and orthochrysotile were
identified as the most dominant minerals in the saprolite ore sample.
Table 1. Major elemental content of
ore sample.
Element
% wt.
Ni
1.56
Fe
33.88
Mg
3.26
Co
0.11
Si
12.89
Al
2.15
Mn
0.81

Table 2. Major elemental contents of limonite


saprolite ore sample.
Element
% wt.
Ni
1.59
Fe
6.50
Mg
19.82
Co
0.015
Si
18.58
Al
0.23
Mn
0.12

Culture Media. The fungus Aspergillus niger was obtained from Mycology Laboratory,
Biosciences and Biotechnology Research Center (BBRC), Institute Technology of Bandung,
Indonesia. Potato dextrose agar (PDA) was used to grow the fungus. The PDA was prepared
by boiling 200 g potato and 20 g dextrose in 1 litre of distilled water followed by filtration
and additions of 20 g agar and various nutrients for the growth of fungus into the filtrate (i.e.,
K2HPO4, (NH4)2SO4, MgSO4 and MnSO4). The solution was then sterilized in an autoclave at
121oC for 20 minutes.
Organic Substrate. The organic substrates used for metabolic acid biogeneration process
were molasses, liquid waste of tofu processing (LTP) and cassava starch. Molasses was
heated on a hot plate in order to remove sulfur content and diluted with LTP to have certain
level of sugar content. Diluted molasses was sterilized in an autoclave at 121oC for 20
minute. Cassava starch powder was sterilized under similar condition, separately, to avoid the
coagulation of the starch. Mixing of the sterilized LTP, molasses and cassava was carried out
in a laminar room by aseptic method.
Metabolic Acid Biogeneration and Leaching Experiments. Shake-flask biogeneration
test works were carried out under aerobic condition with varying sources of phosphate and
nitrogen (i.e., (NH4)2SO4 and KH2PO4) and two types of substrate (i.e., molasses and cassava
starch) supplemented with MgSO4 and MnSO4. The sterilized medium, 10% (vol/vol)
109

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
inoculum Aspergillus niger and organic substrates were mixed in 250 mL shake-flasks. The
shake-flask cultures were incubated in a rotating shaker at 230 rpm with temperature of 25oC
for 30 days. The cultures were sampled at a 2-day interval for pH measurements. A series of
leaching tests were carried out by using biogenerated organic acids that was performed at the
best condition obtained from the previous acid bio-generation testworks. The metabolic acids
were separated from the biomass by using a centrifugal filter. The volume of organic acids
used for the leaching testworks was 300 ml. The leaching tests were conducted in a five-neck
glass reactor equipped with a reflux condenser. The leaching experiments were carried out by
using a magnetic stirrer under varying parameters of ore type (i.e. limonite and saprolite), ore
particle size distributions (-60+80 mesh, -80+100 mesh and -100+200 mesh), solid to liquid
ratio and temperatures (25oC, 65oC and 95oC) at rotation speed of 400 rpm for 24h. The
weight of ore sample was determined according to stoichiometric molar ratio of the main
oxide contents in the ore and H+ ions in the organic acids. Samplings of solution were made
at 10, 20, 30, 60, 120, 240, 480, 720 and 1440 minutes after starting agitation for dissolved
metal concentrations measurements by using Atomic Absorption Spectrophotometer (AAS).
Results and Discussion
Acid Bio-generation. Effects of dosages of phosphate and nitrogen source additions in the
forms of KH2PO4 and (NH4)2SO4, the presence of metal cations in the forms of MgSO4 and
MnSO4 as well as the influence of aeration during acid biogeneration shake-flask experiments
are illustrated in Fig 1.a-d. The experimental results (Fig. 1a and Fig. 1.b) demonstrated that
higher dosages of phosphate and nitrogen sources of up to 0.3% (w/w) and 1% (w/w),
respectively, gives lower pH of solution after 30d of acid bio-generation test. Molasses needs
lower dosage of (NH4)2SO4 to give the same level of lowering pH during acid biogeneration
due to higher initial nitrogen content in this material in comparison to cassava starch.
Phosphate is a key macronutrient for the formation of nucleate acid and cell walls. Phosphate
plays an important role in Krebs cycle for citric acid generation and important energy source
in the form of ATP (Adenosine Tri-Phospate). Meanwhile, nitrogen is an important
macronutrient that forms cell protein and nucleate acid [8].
Dissolved metals have decisive influence on citric acid fermentation. Citric acid synthesis
performs through condensation of acetyl-CoA dan oxaloacetate. In this regard, Mg2+ plays a
role as a catalyst for oxaloacetate formation [9]. Results of the acid bio-generation shakeflask experiments revealed that Mg2+ had positive effect on the acid generation as indicated
by remarkable lowering pH in comparison with the condition without MgSO4 addition. In
contrast, Mn2+ did not give notably influence on the pH alteration during 30 days of the
biogeneration experiment. Fig. 1.d demonstrates that aeration of the media leads to
significant lower pH in comparison to the condition without aeration. Aspergillus niger is an
aerobic microorganism which needs oxygen for its fermentation [10]. A reduction of
dissolved oxygen level in culture media would diminish ATP formation and result in the
decrease of metabolic acid generation. Cassava starch as a substrate for carbon source gives a
better acid generation, indicated by lower pH of the solution than that of molasses. The
cassava starch suspension has lower viscosity than the culture media with molasses that leads
to a higher dissolved oxygen concentration. Aerated media with 70 g/l cassava starch at the
presence of 0.1% (w/w) KH2PO4, 1% (w/w) (NH4)2SO4 and 0.25 g/L of MgSO4 under
aerated condition was found as the best condition for the acid biogeneration, indicated by the
lowest pH of the solution. At this condition, solution pH decreased to 1.5 after 16d of shakeflask experiment as can be seen in Fig. 1.d.
110

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Leaching Experiments. Profiles of extracted nickel from limonite ore as a function of
time at various temperatures using biogenerated acid are presented in Fig. 2.a. The highest
extracted Ni of 74.4% was obtained after 24h of agitation at temperature of 95oC, solid to
liquid ratio of 3.5 gram/liter and ore particle size distribution of -80+100 mesh. Fig. 2b
shows profiles of extracted Ni, Fe and Mg from leaching test of saprolite ore with particle
size distribution of -80+100 mesh at 95oC. In contrast to the leaching behavior of nickel from
limonite ore, the decrease of extracted Ni was observed for leaching of saprolite ore after 20
minutes. This phenomenon is believed to be associated with the formation of Ni-oxalic and
Ni-Mg-citrate complexes which have low solubility [11]. Ni-citrate complex will bind two
arms of carboxylic and give 1 free carboxylic functional group. Magnesium can react with
citrate and forms a complex of trimagnesium citrate with low solubility. This behaviour leads
to a good selectivity of leaching to magnesium. For saprolite ore, the highest Ni extraction of
88.9% was obtained from the leaching experiment at 95oC, ore particle size distribution of 80+100 mesh with co-extracted Mg of about 1.5% during 24h of the leaching experiments.
5.5

7.5

(a)

(b)

6.5
6

4.5
pH

pH

5.5

KH2PO4 added (w/w):

4.5

0
0,10%
0,20%
0,30%

3.5
3
0

10

5
(NH4)2SO4 added (w/w):

0,20%
0,60%

3.5

0,40%
1%

20

30

Time (day)

(c)

10

20

30

Time (day)

(d)

Figure 1. Changes in solution pH during acid biogeneration: a) effect of KH2PO4 dosage, b)


effect of (NH4)2SO4 dosage, c) effect of Mg2+ and Mn2+, and d) effect of aeration.

111

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

(a)

(b)

Figure 2. (a) Profiles of extracted Ni from limonite ore sample (b) Profiles of extracted Ni, Fe
and Mg from saprolite ore sample.
Conclusions
Metabolic acids can effectively be generated by Aspergillus niger in a culture medium of
cassava starch, nitrogen and phosphate under aerated condition. The best condition obtained
was at 70 (g/l) cassava starch, 1% (w/w) (NH4)2SO4, 0.1% (w/w) KH2PO4 dan 0.25 g/L
MgSO4. Cassava starch gives a better acid biogeneration than molasses with pH levels of up
to 1.44 after 16 days. The highest nickel extraction of 88.9% was obtained from indirect
leaching experiment using saprolite ore at temperature of 95oC, rotation speed of 400 rpm,
ore particle size -80 +100# and solid to liquid ratio of 4.65 g/ml after 240 minutes. The
leaching using metabolic acids of Aspergillus niger is selective to magnesium with coextracted Mg of only 1.5% after 24h of agitation leaching of saprolite ore. The investigation
results give remarkable insights into nickel extraction from laterite ore through indirect
bioleaching.
References
[1] R.G. Mc.Donald and B.I. Whittington, Atmospheric Acid Leaching of Nickel Laterites
Review: Part I. Sulphuric Acid Technologies. Hydrometallurgy Vol. 91 (2008), p. 35-55
[2] Mc.Donald and B.I. Whittington, Atmospheric Acid Leaching of Nickel Laterites
Review: Part II. Chloride and Bio-technologies. Hydrometallurgy Vol. 91 (2008), p. 5669
[3] N. Jain and D.K. Sharma, Biohydrometallurgy for non-sulfidic minerals - A review,
Geomicrobiology Journal, Vol. 21 (2004), p. 135-144.
[4] J. Tang and M. Valix, Leaching of Low-Grade Nickel Ores by Fungi Metabolic Acids,
ECI Conference on Separation Technology VI: (2004), Vol. RP3, Article 5.
[5] M.Z. Mubarok, H. Kusuma, W.P. Minwal, S.K. Chaerun, Effects of Several Parameters
on Nickel Extraction from Laterite Ore by Direct Bioelaching using Aspergillus niger
112

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
and Acid Rock Drainage from Coal Mine as an Organic Substrate, Advanced Materials
Research Vol. 825 (2013) p. 356-359.
[6] L. Le, J. Tang, D. Ryan, M. Valix, Bioleaching Nickel Laterite Ores using Multi-Metal
Tolerant Aspergillus foetidus Organism, Minerals Engineering 19 (2006), p. 1259-1265
[7] M.Z. Mubarok, W. Astuti, S.K. Chaerun, Effects of Individual Use, Mixed Culture and
Sulfur Addition on the Effectiveness of Nickel Laterite Ore Bioelaching with Penicillium
verruculosum and Galactomyces geotrichum, Advanced Materials Research Vol. 825
(2013) p. 380-383.
[8] Shuler and Kragi, Bioprocess Engineering, (1992), Prentice Hall Publishing Co.
[9] W.A. de Jongh, Organic Acid Production by Aspergillus niger, PhD. Tesis, (2006),
Technical University of Denmark.
[10] M.T. Madigan and J.M. Martinko, Brock Biology of Microorganisms, 11th edition,
(2006), New Jearsey Pearson Education, p. 178-185.
[11] K.A.K. Alibhai, A.W.L. Dudeney, D.J. Leak, S. Agatzini and P. Tzeferis, Bioleaching
and Bioprecipitation of Nickel and Iron from Laterites, FEM Mirobiology Reviews, Vol.
11, (1993), p. 87-96.

113

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Influence of Carbonate Solubilisation on Copper Leaching From


Kupferschiefer with Organic Acids
Sophia Kostudis*, Kai Bachmann, Sabine Kutschke, Katrin Pollmann,
Jens Gutzmer
Helmholtz-Zentrum Dresden-Rossendorf, Helmholtz Institute Freiberg for Resource
Technology, Bautzner LandstraBe 400, 01328 Dresden, Germany
*s.kostudis@hzdr.de, +49-(0)351-260 3138
Keywords: leaching, copper minerals, carbonate, organic acid, automated
mineralogy.
Abstract. The European Kupferschiefer deposits offer potential for regional resources of
base metals such as copper. Because of its chemical and mineralogical complexity the
Kupferschiefer ore is still investigated regarding sustainable exploiting strategies such as
(bio)leaching with organic acids. The current study examines different processing parameters
investigating types of organic acids at pH 4 and 7 in order to reveal the influence of carbonate
decomposition onto copper leaching performance. Obtained results show superior leaching
performance of organic acids at neutral to alkaline pH range.
Introduction
The Central European Kupferschiefer deposits constitute one of the largest sedimenthosted accumulations of copper ores in the world [1]. Their exploitation is of great interest
and hence the subject of biomining research [2, 3, 4] to provide sustainable and
environmentally benign strategies. However there is still no biotechnological process applied
at industrial scale. Due to organic load, contained carbonates and finely dispersed copper ores
processing of Kupferschiefer ore is still challenging. The Kupferschiefer from Polkowice
Mine, Lubin, Poland, bears carbonate like dolomite CaMg(CO3)2, ankerite CaFe(CO3)2 and
calcite CaCO3 up to 18 wt.% [5]. Despite this carbonate content acidic (bio)leaching of
Kupferschiefer samples has been proven to be feasible but is dependent on acidic
pretreatment [3, 6] or requiring regulation of pH at low levels [4]. Good results in enhanced
flotation performance due to carbonate decomposition using sulfuric acid [7] were already
obtained. Alternatively studies of heterotrophic bioleaching of black shale in more moderate
conditions are pursued. In this context the use of mainly citric acid-producing fungi [8, 9]
showed good results of about 50 % and 70 % copper extracted, respectively. Furthermore,
chemical leaching using glutamic acid at neutral to alkaline pH [5] is achievable due to
complexolysis, although copper extraction rates of about 44 % after 28 days of leaching are
in need of improvement. The intended range of final copper extraction is at 90 to 95 %. This
study investigates the copper solubilisation from Kupferschiefer with glutamic and citric acid
at pH 4 and 7, respectively.
Experimental setup
Experiments were performed to investigate the effects of carbonate decomposition on the
solubilisation of copper from Kupferschiefer. After a leaching period of seven days metal
114

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
content and pH solution samples were analysed. Quantitative mineralogical analyses of feed
material and solid leach residues were performed.
Kupferschiefer sample. Ore samples were obtained as hand specimens from the
Polkowice Mine, Lubin, Poland, and were crushed (jaw and flat-cone crusher) and milled
(cylinder and screen ball mill). The mill product was sized. Experiments were carried out
using the fraction of 0.08-0.1 mm. This feed material was characterised for its mineralogical
composition. Subsample aliquots for leaching experiments and analysis of solid leach
residues were obtained by using a sample splitter. Bulk and mineral specific recoveries were
determined based on the results obtained.
Leaching batches. Copper leaching performance of glutamic and citric acid (table 1) was
investigated as a function of initial pH of the leaching agent (4 and 7). Experiments were
carried out in duplicate in sealed reaction vessels using an overhead shaker (80 rpm).
Table 1. Parameters of leaching batches.
Parameter
Concentration
[w/v %]
Particle size [mm]
Pulp density [%]
Temperature [C]
Initial pH

Glutamic
acid

Citric
acid
1

0.08 - 0.1 mm
5
21/room temperature
4
7
4
7

Chemical data. Quantitative chemical data were obtained by ICP-MS (Perkin Elmer
ELAN 9000). Prior to analysis solid residues and leaching broth samples were separated by
filtration (pore size 0.2 pm) and acidified. Analyses were carried out at the laboratories of the
Institute for Resource Ecology at Helmholtz-Zentrum Dresden-Rossendorf.
Mineralogical data. Feed material and solid leach residues were prepared as epoxy blocks
in the Erzlabor. Quantitative mineralogical analyses were carried out at the Geometallurgy
Laboratory at Technische Universitat Bergakademie Freiberg by using a mineral liberation
analyser (MLA). The MLA system comprises a scanning electron microscope (SEM) FEI
Quanta 650F equipped with two Bruker Quantax X-Flash 5030 energy-dispersive X-ray
spectrometers and specific software for automated data acquisition (MLA Suite 3.1.4).
Consistent operating conditions were applied. These are listed in table 2. All mineralogical
data reported in this study pertain to inorganic compounds as kerogen cannot be determined
as a distinct solid phase in epoxy grain mounts.
Table 2 Summary of MLA parameters of measurements of feed and solid leach residue
samples.
SEM parameters
MLA parameters
Mode
GXMAP
Pixel size (pm/px)
0.6
Voltage (kV)
25
Stepsize (px)
6x6
Probe current (nA)
10
GXMAP trigger
25
HFW (m)
600
Particle count
>25000
BSE calibration
Au 254
GXMAP grain-based X-ray mapping HFW horizontal field width
EDX energy dispersive X-radiation
BSE back scattered electron
115

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Results and discussion
Leaching results. Copper concentration in the pregnant liquors increases in all four
batches (Fig. 1) with citric acid providing higher contents than glutamic acid. Citric and
glutamic acid yield higher copper contents at an initial pH of 7 (406.9 mg/l and 338.0 mg/l or
26 % and 23 % Cu leached, respectively) than at pH 4 (190.6 mg/l and 160.6 mg/l or 12.7 %
and 10.9 % Cu leached, respectively). At neutral to alkaline pH ranges acid groups are
deprotonated resulting in enhanced complexolytic impact [10] and higher copper
solubilisation rates.

Cu

pH

Oo

glutamic acid pH4


glutamic acid pH7

. k citric acid pH4


citric acid pH7

Figure 1. Copper content (black symbols) of pregnant liquor of after seven days of leaching
and according pH values and pH changes (grey symbols) as related to the initial pH of
leaching solutions.
The pH of the pregnant liquors increases in all batches. Expectably decreases in carbonate
content and increase of pH can be assigned to calcite (CaCO3) and ankerite (CaFe(CO3)2 in
the pH 4- batches. Especially calcite is reduced by 94.6 % after treatment with citric acid at
pH 4. Dolomite (CaMg(CO3)2) which is known to be rather recalcitrant towards acidic
decomposition shows a slight decomposition, but increases in the batch with glutamic acid at
pH 7. This is trend is also true for calcite. As reaction vessels were sealed effects of partial
pressure of carbon dioxide may influence solubilisation of carbonates and lead to
recrystallisation processes.

116

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
In case of the pH 7-batches the increase of copper content of the pregnant liquors
conforms to decrease in chalcocite content in the leach residues (Fig. 2). This is also true for
citric acid at pH 4. However, the low copper content in the pH 4 batch with glutamic acid is
not proven by mineralogical data showing a trend of increasing chalcocite abundance by 6.6
% in the leach residues. Pending examination of dissolved leach residues and evaluation of
further datasets are expected to clarify this contradiction. Secondary copper minerals
(covellite) are formed congruently with enhanced copper leaching performance of the single
batches. This has been reported in previous studies [5].

Figure 2. Comparison of mineral abundances in feed sample and solid leach residues after seven
days of leaching. Data are normalized to quartz content.

Figure 3. Changes of the abundances of copper and carbonate minerals in solid leach residues
towards feed sample after seven days of leaching. Data are normalized to quartz content.
117

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Conclusions
In leaching batches with lower initial pH values decomposition of calcite and ankerite is
determined. Resulting liberation effects with respect to copper minerals [7] do not exceed
enhanced leaching performance of neutral acid batches. Probably acid consumption during
carbonate decomposition reduces leaching activity of the acids. However, increase in
dolomite content in leach residues from glutamic acid at pH 7 compared to the feed gives
raise to several questions and may be caused by recristallisation processes.
In the pH 7 batches solubilisation of copper from chalcocite seems probable. However,
chemical and mineralogical data of the pH 4 glutamic acid batch are not congruent.
Nevertheless leaching of organic acids at initially neutral pH is preferable to slight acidic
conditions.
Further chemical analyses of dissolved leach residues are pending.
References
G. Borg, A. Piestrzynski, G.H. Bachmann, W. Puttmann, S. Walther, M. Fiedler: Soc.
Econ. Geol. (2012) 16, p. 455
[2] P. dHugues, P.R. Norris, K.B. Hallberg, F. Sanchez, J. Langwaldt, A. Grotowski, T.
Chmielewski, S. Groudev, Bioshale consortium: Min Eng (2008) Vol. 21, p. 111
[3] Z. Sadowski, A. Szubert: Chem. Process Eng. (2010) Vol. 31, p.107
[4] M. Sethurajan, R. Aruliah, O.P. Karthikeyan, R. Balasubramanian: Env. Eng. Man. J.
(2012) Vol. 11 (10), p. 1839
[5] S. Kostudis, K. Bachmann, S. Kutschke, K. Pollmann, J. Gutzmer: Min Eng (2015)
[6] T. Chmielewski: Physicochem. Prob. Min. Process. (2007) Vol. 41, p. 323
[7] A. Luszczkiewicz, T. Chmielewski: Int. J. Miner. Process. (2008) Vol. 88, p. 45
[8] F. Anjum, H.N. Bhatti, M.A. Ghauri, I.A. Bhatti, M. Asgher, M.R. Asi: Afr. J Biotech.
(2009) Vol 8 (19), p. 5038
[9] F. Anjum, H.N. Bhatti, M. Asgher, M. Shahid: Appl. Clay. Sci. (2010) Vol. 47, p. 356
[10] F. Anjum, M. Shahid, A. Akcil: Hydromet. (2012) Vol. 117-118, p. 1
[1]

118

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Evolution of Leaching Products on the Surface of Chalcopyrite by


Mesophiles and Thermophiles Based on Sr-Xrd and Xanes
Spectroscopy
Hong-chang Liu1,a, Jin-lan Xia1,b*, Zhen-yuan Nie1,c, Hong-rui Zhu1,d, Yidong Zhao2,e, Chen-yan Ma2,f, Lei Zheng2,g
1 School of Minerals Processing and Bioengineering, Central South University,
Changsha 410083, China; Key Lab of Biometallurgy of Ministry of Education of
China, Central South University, Changsha 410083, China
2 Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese
Academy of Sciences, Beijing 100049, China
a

hongch_liu@csu.edu.cn, b jlxia@csu.edu.cn, c zynie@csu.edu.cn, d


437416667@qq.com, e zhaoyd@ihep.ac.cn, f macny@ihep.ac.cn, g
zhenglei@mail.ihep.ac.cn* Correspondence to be addressed

Keywords: bioleaching; chalcopyrite; SR-XRD; XANES; speciation transformation;


product evolution.
Abstract. The bioleaching experiments of chalcopyrite were conducted with single and
mixed mesophiles (30 C) and moderate thermophiles (45 C) and extreme thermophile (65 C),
respectively, and analyzed by synchrotron radiation (SR) based X-ray diffraction (XRD) and
X-ray absorption near edge structure (XANES) spectroscopy. The results showed that the
copper extraction of chalcopyrite could be significantly promoted by bioleaching
microorganisms, and the promotion effects for both the mixed cultures grown at different
temperature and the different cells grown at the same temperature were significantly
different. The surface of chalcopyrite became strongly corroded and complex after
bioleaching by single or mixed cultures. More S0 was found to form in the single cultures of
specific iron-oxidizing microorganism L. ferrooxidans and L. ferriphilum and sulfuroxidizing microorganisms A. thiooxidans and A. caldus cultures. Jarosite and secondary
minerals (chalcocite and covellite) were detected for the mixed cultures and single cultures of
iron/sulfur-oxidizing microorganisms. The evolution of chalcocite and covellite were just
relevant to the potential of leaching solution, no matter which cultures were used, where
chalcocite could be formed at lower Eh value (<500 mV) and then converted to covellite at
higher Eh value (~550 mV).
Introduction
The bio-oxidation of chalcopyrite is very complex, involving in the chemical speciation
transformation and dissolution of three different elements (i.e. Cu, Fe, S). The surface
chemicals of chalcopyrite during bioleaching have been proposed containing elemental sulfur
(S0), jarosite and the metal-decient secondary minerals [1, 2]. However the metal-decient
secondary minerals are difficult to analyzed because they are less abundant and could be
unstable transition states. This problem could be resolved with emerging of synchrotron
radiation (SR), which is an ideal X-ray source with high spatial resolution and high
119

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
sensitivity for probing trace metallic elements. SR-based XRD and X-ray absorption near
edge structure (XANES) spectroscopy have been proved to be efficient for analyzing
composition and speciation transformation on surface of minerals with higher signal/noise
ratio and spatial resolution [1, 3].
In the present study, in order to reveal the evolution of leaching products during
biooxidation of chalcopyrite at different temperatures, the bioleaching experiments of
chalcopyrite were conducted with single and mixed mesophiles (30 C), single and mixed
moderate thermophiles (45 C) and extreme thermophile (65 C
), respectively, and analyzed by
SR-XRD and XANES spectroscopy.
Experimental
The bioleaching microorganisms used in the present study were provided by School of
Minerals Processing and Bioengineering, Central South University, Changsha, China. The
mesophiles (Acidithiobacillus ferrooxidans ATCC 23270, Leptospirillum ferrooxidans ZTS
and Acidithiobacillus thiooxidans A01), the moderate thermophiles (Sulfobacillus
thermosulfidooxidans St, Acidithiobacillus caldus S1 and Leptospirillum ferriphilum YSK)
and the extreme thermophile (Acidianus manzaensis YN-25) were cultured at 30, 45 and
65 C, respectively, with 250 mL Erlenmeyer flasks containing 100 mL culture media on a
rotary shaker. For mixed mesophiles and moderate thermophiles, the ratio of each bacteria
initially was the same.
During cultivation, the cell densities, pH values, Eh values (Pt vs. Hg/Hg2Cl2), and [Cu2+]
of the leaching solution were determined. The surface morphologies of the leaching residues
were observed by the scanning electron microscopy (SEM) (Nova NanoSEM 230, FEI,
USA). The SR-XRD was carried out at beamline BL14B1 in Shanghai synchrotron radiation
facility (SSRF), Shanghai, China. The SR-XRD data were recorded at a step of 0.01 and a
dwell time of 0.5 s at each point with the energy of 10 KeV and the spot size of 0.50.5 mm2.
The S K-edge XANES spectroscopy and Cu, Fe L-edge XANES spectroscopy were
performed according to previous descriptions [3, 4].
Results and discussion
Leaching experiments. The [Cu2+] curves (not shown) showed the copper extraction of
chalcopyrite promoted by bioleaching microorganisms, meanwhile the promotion effects
were enhanced by the mixed cultures at the same temperature. On the other hand, the copper
extraction rate also increased when temperature increased. The pH value curves (not shown)
showed that for the bioleaching of mixed mesophiles and mixed thermophiles or single A.
ferrooxidans, S. thermosulfidooxidans and A. manzaensis, the pH first increased and then
decreased, while for single A. thiooxidans, L. ferrooxidans, A. caldus and L. ferriphilum, the
pH just increased with time. The Eh curves (not shown) showed Eh values of the leaching
solution increased with time and then basically unchanged, which were similar to the [Cu 2+]
curves.
Surface morphologies and SR-XRD analysis. The surface morphologies of chalcopyrite
leached by mesophiles and thermophiles showed the mineral gradually eroded by bioleaching
microorganism (not shown). However, the corrosion was more stronger for mixed cultures
than single cultures. In addition the corrosion was also affected by temperature. By contrast,
the surface of chalcopyrite particles slightly changed in the sterile at 30, 45 and 65 C.
120

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
The SR-XRD patterns of chalcopyrite leached by mixed mesophiles and mixed moderate
thermophiles (Fig. 1a, b) became much more complex, which showed the composition
contained chalcopyrite, covellite, jarosite and elemental sulfur, so as to the SR-XRD patterns
of the residues by single A. ferrooxidans, S. thermosulfidooxidans and A. manzaensis (not
shown). While for single A. thiooxidans, L. ferrooxidans, A. caldus and L. ferriphilum, new
elemental sulfur and chalcocite and jarosite produced (not shown). By contrast, only little
elemental sulfur produced after chemical leaching at 30, 45 and 65 C
.
(a)

(b)

Chalcopyrite
Covellite
Jarosite

Chalcopyrite
Covellite
Jarosite

Figure 1. SR-XRD
patterns of chalcopyrite
leached by (a) mixed
mesophiles at day 20 and
(b) mixed moderate
thermophiles at 16 days

Elemental sulfur

Normalzied intensity

Normalzied intensity

Elemental sulfur

10

15

20

25

30

35

40

45

2 ()

50

55

60

65

10

15

20

25

30

35

40

45

2 ()

50

55

60

65

Cu and Fe L-edge XANES analysis. It can be seen from Fig. 2a1 and Fig. 2b1 that the
spectra of standard copper- and iron- containing compounds showed significant difference in
the peaks position and relative intensity, which could be used to identify the unknown spectra
of chalcopyrite bioleached at different time. Results in Fig. 2a2-a4 and Fig. 2b2-b4 showed
the copper species and iron species changed with time, but significantly different between
different leaching microorganisms. It should be noted that the iron speciation analysis
indicated that the surface iron changed gradually from Fe(II) to Fe(III), at the same time irondeficiency bornite- like species formed.
(a3)

(a2)
931.0 eV

(a4)

Mix-12
Mix-20

Chalcocite

Mix-8

Mix-16

A. m-8

Mix-4

Mix-12
Mix-8

Mix-2
S.t-16

931.5 eV

Bornite
932.2 eV

Chalcopyrite

A. m-6
S.t-12

A.f-20
A.f-16
A.f-12
A.f-8
A.f-4
L.f ZTS-20
L.f ZTS-16
L.f ZTS-12
L.f ZTS-8
L.f ZTS-4
A.t-20
A.t-16
A.t-12
A.t-8
A.t-4
Sterile 30

S.t-8
S.t-4
S.t-2
L.f YSK-16
L.f YSK-12
L.f YSK-8
L.f YSK-4
L.f YSK-2
A.c-16
A.c-12
A.c-8
A.c-4
A.c-2
Sterile 45

A. m-4

A. m-2

Energy (eV)

Energy (eV)

Bornite
b

Chalcopyrite

700

Energy (eV)

a
Mix-16

Mix-16
Mix-12

Mix-12
Mix-8

Mix-8

Mix-4

710

720

Energy (eV)

S.t-16

A.f-16

S.t-12

A.f-12

S.t-8

b
a
A. m-10

A. m-8

A.f-8

S.t-4

A.f-4

S.t-2

L.f ZTS-20

L.f YSK-16

L.f ZTS-16

L.f YSK-12

A. m-6

L.f ZTS-12

L.f YSK-8

L.f ZTS-8

L.f YSK-4
L.f YSK-2

A.t-20

A.c-16

A.t-16
A.t-12

A.c-12

A. m-4

A. m-2

A.c-8
A.c-4

A.t-8
A.t-4

A.c-2

Sterile 30

Sterile 45

730 700

(b4)

Mix-2

A.f-20

L.f ZTS-4

Sterile-65

920 930 940 I 950 960 970 920 930 940 950 960 970 920 930 940 950 960 970 920 930 940 950 960 970

Energy (eV)

Jarosite

a
Mix-20

Mix-4

Mix-4

Covillite

A.m-1

Normalized absorption

931.3 eV

A. m-10

(b3)

(b2) b

(b1)

Mix-16

Normalized absorption

(a1)

710

720

Energy (eV)

730 700

Sterile-65

710

720

Energy (eV)

730 700

710

720

730

Energy (eV)

Figure 2. Normalized (a1-a4) Cu and (b1-b4) Fe L edge XANES spectra of standard (a1)
copper-containing compounds and (b1) iron-containing compounds, and chalcopyrite
residues leached at (a2, b2) 30 C, (a3, b3) 45 C and (a4, b4) 65 C at different time.
S K-edge XANES analysis. It can be seen from Fig. 3a that the S K-edge XANES spectra
of standard samples show significant difference in the position intensity and width of the
absorption peaks, which are in accordance with previous descriptions. Compared with the
spectra of original chalcopyrite, the XANES spectra of chalcopyrite residues (Fig. 3b-d)
during bioleaching changed overtime. For mixed mesophiles and thermophiles and single A.
121

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
manzaensis, A. ferrooxidans, S. thermosulfidooxidans and L. ferriphilum, the peak at 2470 eV
become weaker overtime, and the peak at 2483 eV gradually appear and finally become the
main peak. Interestingly, for mixed mesophiles and A. ferrooxidans, the new peak at 2472.7
eV gradually appeared. However, little change is found from the spectra of chalcopyrite
residues for single A. thiooxidans, L. ferrooxidans, A. caldus and in the sterile control
experiment.
(b)

(a)

(c)

(d)

Figure 3. Normalized S K-edge


XANES spectra of (a) standard
sulfur- containing compounds and
chalcopyrite residues leached at
(b) 30 C, (c) 45 C and (d) 65 C
at different time.

Mix-16

Mix-20

Mix-12

Normalized absorption

Chalcopyrite

Bornite

Mix-16

Mix-8

Mix-12

Mix-4

Mix-8

Mix-2

Mix-4

S.t-16

A.f-20

S.t-12

S.t-4
S.t-2

A.f-8

2470

2480

2490

2460

Energy (eV)

2470

A. m-4

L.f YSK-4
L.f YSK-2
A.c-16
A.c-12
A.c-8
A.c-4
A.c-2

A.t-20
A.t-16
A.t-12
A.t-8
A.t-4
Sterile 30

Jarosite
2460

L.f YSK-12
L.f YSK-8

L.f ZTS-12
L.f ZTS-8
L.f ZTS-4

S0

A. m-6

L.f YSK-16

A.f-4
L.f ZTS-20
L.f ZTS-16

Covellite

A. m-8

S.t-8

A.f-16
A.f-12

Chalcocite

A. m-10

A. m-2

Sterile-65

Sterile 45
2480

Energy (eV)

2490

2460

2470

2480

Energy (eV)

2490

2460

2470

2480

2490

Energy (eV)

By combining the leaching process, the fitted results of these unknown spectra indicated
that chalcocite appeared initially with Eh value lower than 500 mV, and then gradually
converted to covellite with Eh value ~550 mV. The species iron- deficiency bornite and new
elemental sulfur was also found. Meanwhile jarosite increased with time, however, no
inhibition was found when jarosite formed and accumulated. In short, based on previous
publications, the evolution of chalcopyrite during bioleaching can be summarized as Fig. 4.
Figure 4. The diagram of
leaching product evolution
during bioleaching of
chalcopyrite by mesophiles
and thermophiles based on
SR-XRD and XANES
spectroscopy

Conclusions
The surface of chalcopyrite became strongly corroded and complex after bioleaching by
single or mixed cultures. More S0 was found to form in the single cultures of specific ironoxidizing microorganism and sulfur-oxidizing microorganism. Jarosite and secondary
minerals (chalcocite and covellite) were detected for the mixed cultures and single cultures of
iron/sulfur-oxidizing microorganisms. The evolution of chalcocite and covellite were
correlated with the leaching solution potential, no matter which cultures were used, where
chalcocite could be formed at lower Eh value (less than 500 mV) and then converted to
covellite at higher Eh value (~550 mV).
122

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Acknowledgement.
This work is supported by NSFC (No.U1232103, 51274257, 50974140), Open Funds of
BSRF (No. VR-12419) and SSRF (Z13sr0026, 13SRBL15U15653, 13SRBL14B15648) and
Hunan Provincial Innovation Foundation For Postgraduate (CX2014B092).
References
[1]

D. Majuste, V.S.T. Ciminelli, et al.: Hydrometallurgy (2010) Vol. 111-112, p. 114.

[2]

W. Zhu, J.L. Xia, Y. Yang, et al.: Bioresour. Technol. (2011) Vol. 102, p. 3877.

[3]

H. He, J.L. Xia, Y, Yang, et al.: Hydrometallurgy (2009) Vol. 99, p. 45.

[4]

C.L. Liang, J.L. Xia, Y. Yang, et al.: Hydrometallurgy (2011) Vol. 107, p. 13.

123

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Iron Oxidized Acidophiles Distribution and Activities in an Uranium


In-Situ Bioleaching Site
Liu Yajie1,2a, Li Jiang2b, Zhou Yipeng2c, Xu Lingling2d, Xu Weiyun2e, Wang
xuegang2 f , Yang Guobin2g , Liu Jinhui2h, Zhaxue Sun2i , Liu Jianshe1j*
1School

of Environmental Science and Engineering, Donghua University. No. 2999,


Renmin North Road. Shanghai,China. 201620

2Department

of Water Resources and Environmental Engineering, East China


Institute of Technology. No.418, Guanglan Aveneu, Nanchang, Jiangxi.China.330013
alyj008@126.com, blij@ecit.cn, cypzhou@ecit.cn, cllxu@ecit.cn, ewyxu@ecit.cn,
fxgwang@ecit.cn, g2453799769@qq.com, hliujh@ecit.cn, izhxsun@ecit.cn, j*

correspondence liujianshe@dhu.edu.cn +8618007947236


Keywords: iron oxidized acidophiles, uranium in-situ bioleaching, metabolic activity,
microbial community.
Abstract. Iron oxidized acidophlies are important in uranium extraction for it mainly
depends on the indirect mechanism of bioleaching. Taking indirect field In-Situ bioleaching
experiment in a uranium deposit as an example, several strains of acidophiles were isolated
from the acid leachate. Bacteria compositions of the samples taken different stages were
analyzed by 16SrDNA PCR-RFLP method. Results showed that the dominant bacteria in the
leachate were Acidithiobacillus ferrivorans, At. ferrooxidans and Leptospirrilum ferrooxidans
from the beginning to the middle stage of bioleaching process. With the process carried on,
ferric ion concentration increased in the oxidation tanks, L. ferrooxidans became predominant
bacteria. Again confirmed that in this in-situ bioleaching site, iron oxidized bacteria were
dominant.
Introduction
The unconventional mining technique of in-situ leach (ISL) has been applied in the
uranium recovery world widely since 1960s[1]. Acid in-situ leach has been widely used in
sand stone uranium ores since 1990s in China with low cost and less workforce, while it was
stopped in the USA more than 10 years ago for its pollution to underground water. With the
increasing of low-grade uranium ores, uranium recovery decreased greatly. In-situ
bioleaching is becoming a preferred technique to solve the problems. 512 uranium deposit is
located in the northwest of China and have been carried on acid in-situ leaching for about 20
years. For the lower recovery of uranium and the effort to increase the uranium concentration
in leachate, in-situ bioleaching experiment was carried on in the mining sections where
uranium concentration in leachate was lower than 15mg/L 4 years ago. According to the
indirect mechanism, ferric ion which is produced by iron oxidized acidophiles is the most
effective oxidant to oxidize UIV (insoluble) to UVI (soluble) in uranium bioleaching[2],
although many researches implied that the direct mechanism was functioned[3,4]. Then iron
oxidized aciophiles activities and distributions in the in-situ process are the key issues for the
commercial application. The iron oxidative activities and compositions of microbial
community are always change with the environment they live. Therefore, taking the 2-stage
124

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
in-situ field bioleaching experiment as example, leachates in different period of in-situ
leaching were sampled for bacterial community and ferrous ion oxidation activities analysis
to investigate the correlation between acidophiles and leaching environment.
Samples and methods
Sampling Samples for bacteria isolation were taken from leachate of the Mines normal
production process (data not showed). Samples for microbial ferrous ion oxidized activities
and community analysis were taken from the seeding tank, oxidation tank, injection well and
product well in different leaching stages of the field experiment, respectively. Samples
descriptions showed in Table 1.
Table 1. Samples descriptions for the acidophiles communities in the in-situ sites both of acid
leaching and bioleaching.
Serial Sample
Stage of
Origination
Description
Remark
No.
name
leaching
Fe3+=0.55g/l,Fe2+=0.8g/l,
Product
1
SCK1
Acid
leachate
well
pH=1.77T=19,U6+=12mg/L
Fe3+=2.45gFe2+=2.25 g/l
Seeding
2
737-Z1
Acid
Culture
tank
pH=1.67T=15
Fe3+=4.2g/LFe2+=0.06g/L
Seeding
14th day of
3
737-Z2
Culture
tank
bioleach
pH=2.1T=20
Fe3+=4.12g/L.Fe2+=0.11g/
Oxidized 14th day of
4
YHC2
Culture
tank
bioleach
pH=2.01T=20
Fe3+=4.0g/L,Fe2+=0.23g/
Injection
4th day of
Injection
5
ZYC2
well
bioleach
solution
pH=1.35T=17
3+
2+
th
Fe =0.60g/L,Fe =1.55g/
Product
4 day of
6
SCK2
leachate
well
bioleach
pH=1.70T=19, ,U6+=19mg/L
Seeding
99th day of Fe3+=4.06g/L,Fe2+=0.14g/L,pH=2.01
7
737-Z3
Culture
tank
bioleach
T=17
Fe3+= 4.38g/L,Fe2+=0.17g/
Oxidized 99th day of
8
YHC3
leachate
tank
bioleach
pH=2.18,T=19
Fe3+=4.26g/L,Fe2+=0.20g/L,
Injection 99th day of
9
ZYC3
Culture
well
bioleach
pH=1.68,T=17
Fe3+=0.98g/L,Fe2+=1.17g/
Product
99th day of
10
SCK3
leachate
well
bioleach
pH=1.99T=17, ,U6+=45mg/L
Bacteria enrichment and isolation Enrichment, isolation of acidophilic microorganisms
was performed by modified 9K medium and double layer agarose solid media plates (iFeO,
FeO, FeSO and YF )[5]. Colonies and cells were pictured by stereoscopic microscope and
Nova Nano SEM450, respectively.
PCR-RFLP for microbial composition analysis alongside with the procedures of DNA
extraction, 16SrRNA genes PCR, clone library construction, restriction enzyme fragment
analysis and plasmids DNA sequencing.
125

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Iron oxidized activities Iron oxidized activities were checked by 20% inoculation of
each samples to 9K medium with 3g/L Fe2+ (FeSO4) and incubating at 20 in 130rpm
shaker. Fe2+ and Fe3+ ion concentration was determined by EDTA titration at an interval of
every 4 hours.
Results
Isolates from the acid leachate Several strains of acidophiles such as At. ferrivorans,
At.ferrooxidans, L. ferrooxidans, Sb. sp. and Ac. sp. were isolated from the leachate and
identified by 16s rDNA PCR sequencing. Colonies and cells image showed in Fig.1. All the
isolates were combined together as a consortium and inoculated to the raffinate incubated
from 20-15 for domestication in laboratory. This consortium was used as the inoculum in
the seeding tank in field experiment.
Iron oxidized activities It indicated that all the samples had a relative high ferrous
oxidized activities (Table 1) at 20except the one of ZYC2 with very low pH(1.35). From
the beginning of in-situ bioleaching, ferrous oxidized activities increased in all samples (Fig.
2) and the uranium concentration went up with the ferrous oxidized activity. It implied that
uranium recovery rate can be raised by improving the iron oxidized bacteria activities in-situ.

Figure 1. Colonies and SEM images of enrichments by double layer plates (from left to right:
first line is At. Ferrooxidans on FeO(45x), and Sulfrubacillus sp. on FeSO(20x) . The second
line is Acidimicrobium sp. (20x) On YF and Leptospirrillum ferroxidans on FeO(45x)).

126

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 2. Comparision of ferrous oxidized activities on samples taken from the uranium insitu site both in acid and bioleaching process.
Acidophiles compositions Analysis of bacteria compositions resulted that dominant
bacteria were At .ferrivorans, At. ferrooxidans and L. ferrooxidans both in acid leaching and
bioleaching. By the increase of ferric ion concentration in the oxidation tanks, L. ferrooxidans
became the dominant bacteria than that of At.sp.. From the point of temperature of samples,
At. ferrivorans was relatively more resistant than that of At. ferrooxidans at lower
temperature.

Figure 3. Comparison of acidophiles compositions on each sample taken from the uranium
in-situ site both in acid and bioleaching process.
Conclusion
The dominant bacteria in the indirect uranium in-situ bioleaching were iron oxidized
acidophiles. The acidophiles compositions from both of acid leaching and bioleaching
127

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
process were of similarity and the species predominance changed evidently with processing.
The relative dominance of iron oxidized bacteria changed with the operation process and the
temperature, pH and chemical components (Fe3+/Fe2+). Uranium concentration went up
greatly with the iron oxidized bacteria activeness. Again confirmed that in in-situ bioleaching
site, iron oxidized bacteria were dominant.
Acknowledgement
Thanks for the supports of Chinese National 973 Project (2012CB723101), National
Science Foundation of China (50974043).
References
[1] Gaivn M. mudd. Environmental Geology (2001) Vol.41.p.404.
[2] Tsezos, M., McCready, R.G.L., Salley, J. and Cuif, J.P.. In: J. Salley, R.G.L. McCready
and P.L. Wichlacz (Editors), Biohydrometallurgy. CANMET Spec. Publ. 91989)
Vol.10:p. 279.
[3] Moon-Sung et al. e.g. World J. Microbiol. & Biotechnol. (2005)Vol.21. p.377.
[4] Alexey Borisovich Umanskii, Anton Mihaylovich Klyushnikov.(2012) J Radioanal Nucl
Chem, DOI 10.1007/s10967-1816-9
[5] Johnson, D. B. (1995). J. Microbiol. Methods Vol.23,p.205.

128

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Solution Ph and Jarosite Management during Ferrous Ion


Biooxidation in A Novel Packed-Column Bioreactor
M. Wanjiyaa, F. Chowdhuryb and T.V Ojumuc*
1Department

of Chemical Engineering, School of Mines and Mineral Sciences,


Copperbelt University, P.O BOX 21692, Kitwe, Zambia.

2Department

of Chemical Engineering, Cape Peninsula University of Technology,


Cape Town 8000, South Africa.
amwanjiya@yahoo.com,bchowdhuryfaysol@yahoo.com
c,*

Corresponding author: ojumut@cput.ac.za

Keywords: pH, jarosite, ferrous ion biooxidationkinetics, Acidithiobacillusferroxidans.


Abstract. Jarosite formation is undesirable in bioleaching processes as it depletes the needed
ferric reagent for the oxidation of most sulfide minerals. Although it creates kinetic barriers
thereby retarding the leach rates of most minerals, jarosite serves as support for the
attachment of bioleaching microbes, facilitating biooxidation rate. Microbial ferrousoxidation by mesophilic microbewas studied in a recently reported novel packed-column
bioreactor with a view to investigate the potential of using solution pH to manage jarosite
accumulation in the bioreactor in addition to establishing a base case data for the
bioreactor.Experiments were conducted in the bioreactor packed with glass balls (15mm
diameter) at constant temperature of 38.6 oC, residence time of 18 hours, airflow rate of 20
mL.s-1 and pH values of 1.3, 1.5 and 1.7. The results showed that the amount of jarosite
accumulation is proportional to the solution pH, and to the duration of operation of the
bioreactor. Jarosite precipitation concentrations of 4.95, 5.89 and 7.08 g. L-1 were obtained
after 10 days of continuous operation at solution pH values of 1.3, 1.5 and 1.7 respectively,
while after 15 days the precipitations concentrations increased to 5.50, 7.90, 9.98 g. L-1
respectively. The results also showed that 33% and 52% precipitate reduction could be
achieved by gradual decrease in the bioreactor solution pH to 1.5 and 1.3 after being
continuously operated for 10 days at pH 1.7 respectively after an addition of 5 days. A
-1 -1
maximum ferrous oxidation rate ( rFemax
and the affinity kinetic constants (
2 ), 6.85 mmol.L .h
2 , K Fe2 ), of 0.001 and 0.006 for Hansford and Monod models respectively. Although a
K Fe

directly relationship exists between jarosite formation and pH, the results of this study may
be relevant in bioleach heaps or at least in column bioreactors to manage/control jarosite
accumulation thereby improving the leach kinetics of mineral sulfides.

Introduction
The availability of ferric-iron reagents plays a vital role in bioleaching of base metals from
their sulfide minerals. Ferric-ion is the critical reagent for oxidation of sulfide minerals in
biohydro- and hydrometallurgical processes, and also for removal of hydrogen sulfide from
flue gases. In these processes, the formation of ferric ion precipitate, jarosite, poses a
challenge on the solution iron balance. Jarosite is represented as XFe3(SO4)2(OH)6, where X
is a monovalent ion such as K+, Na+, NH4+and H3O+. The type of jarosite in a typical
129

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
bioleach system depends on the most dominant ion in the growth medium[1]. There are
numerous scientific debates on jarosite accumulation in bioleach system; it deprives the
system of the needed ferric ions (obtained from the accompanied pyrite biooxidation) for
sulfide mineral oxidation, the precipitate forms a kinetic barrier on the surface of mineral
sulfide preventing leach reaction to take place, it can form clogs between inter-particle
spaces which could render heap bed blocked or impervious. Hence, the resultant low
availability of the ferric ions within the leaching solution could give rise to an unsustainable
recovery of the desired metals in a long term.
On the other hand, it has been shown that jarosite plays a key role in the formation and
stability of biofilm[2, 3]. Recently, it has been shown that jarosite precipitate enhanced
microbial ferrous ion oxidation[4]. Therefore, it may be advantageous to choose conditions
that promote jarosite precipitation in the process of biofilm formation with the view to
increasing biooxidation rate.Although, a negligible amount of jarosite precipitate was
reported at pH of less than 1.0, it is clear that the precipitate may be significant if a system
was allowed to operate for a prolonged period such as in packed bed column bioreactors. The
objective of this study was to investigate the effect of solution pH on jarosite precipitate
accumulation during microbial ferrous ion oxidation byAcidithiobacillusferroxidans, in a
recently developed novel packed column bioreactor[4] with a view was to provide an
understanding on how to manage jarosite precipitate in a typical bioleach system or at least
the bioreactor systems. This study also aimed at developing a database for ferrous ion
biooxidationkinetics in the novel bioreactor at a solution pH 1.3 which was the pH of
minimal jarosite precipitate[5].
Methodology
Growth medium. Analytical grade of 5 gL-1 of ferrous-iron (added as FeSO4.7H2O)were
used and other reagents as reported in Ojumu et al. [5] were used. The inoculum used for this
study was identified to contain 99.9% Acidithiobacillusferroxidansat the Centre for
Bioprocess Engineering Research at the University of Cape Town, South Africa.
Microbial ferrous-iron oxidation: jarositeaccumulation and control experiment.A
series of continuous culture experiments was conducted and repeated in identical doublewalled packed-bed bioreactors packed with 15 mm glass balls as the packing materials. The
working volume in the bioreactor was 500 mL (Figure 1)[4].The experiments were conducted
at temperature, 38.6 C, aeration rate,20 mL.s-1, and the dilution rate, 0.05 h-1. The solution
pH of each experiment was controlled atpH 1.3, 1.5 and 1.7by using the feed solution pH
which was adjusted using concentrated sulfuric acid (98%) only. The solution redox
potentials and pH were monitored using the CRISON GLP 21 meter. In a separate
experiment, the bioreactor pH was reduced to a lower pH after 10 days of continuous
operation in order to investigate the effect of solution pH on jarosite accumulation.
Accumulated jarosite precipitated was dissolved in HCl prior to analysis using Atomic
Absorbance Spectrometer (AAS)
Kinetic of microbial ferrous ion oxidation.The kinetic experiments were conducted as
described previously [4], exceptthat the bioreactor solution pH that was kept constant at pH
1.3 0.05, and five different dilution rates ranging from0.05 0.10 h-1 was investigated.
Steady data were recorded only when the bioreactor achieved a steady state operation, i.e.
when the pH and redox potential in the culture liquor was constant for at least three residence
time. Steady state was maintained for at least one residence time in order to allow for the
130

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
chemical analysis of the influent and effluent samples. The jarosite precipitate accumulation
was minimised in the bioreactor by cleaning the bioreactor and the packing after every
dilution rate with concentrated HCl (32%) and distilled water. Ferrous-iron and total iron
concentrations were determined by titration with potassium dichromate solution using the
BDS indicator. The measurement of redox potential using redox electrode (Ag/AgCl) allowed
the determination of ferric-to-ferrous ion ratio from a calibration curve for the electrode
derived using aNernst equation as described previously[5].

rFe2

rFe2

rFe2 max [ Fe 2 ]

(1)

K Fe2 [ Fe 2 ]
rFe2 max

1 K ' Fe2

[ Fe 3 ]
[ Fe 2 ]

(2)

Figure 1. (a)Schematic diagram of the


experimental rig [4]
12

8.0

10 days

100

15 days

rFe2+ (mmol.L-1h-1)

pH1.5 change to 1.3 at the


day for addi on 5 days

10th

pH 1.3

pH1.5

pH1.7

pH1.3*

95

Oxidation rate

pH1.7 change to 1.5 at the 10th


day for addi on 5 days

8
Jarosite (g.L-1)

7.0
6.0

90

5.0
85

4.0

80

3.0
2.0
0.03

Conversion

Conversion (X)

pH1.7 change to 1.3 at the 10th


day for addi on 5 days

10

0.05

pH1.3**

0.07

0.09

Dilution Rate

75
0.11

(h-1)

Figure 2. Jarosite precipitation at various pH [* Figure 3. The plot of biooxidation rate and
represents change from 1.7 and 1.5, and **
conversion versus bioreactor dilution rate
represents change from 1.5]
650

10
Experimental Data

rFe2+ (mmol.L-1h-1)

Eh (mV)

600

550

500

Hansford model

8
7
6
5
4
3
2

450
0.03

0.05

0.07

0.09

10

100

1000

10000

[Fe3+]/[Fe2+]

0.11

Dilution Rate (h-1)

Figure 5. The fit of Hansford model (Eq.1)


Figure 4. The plot of redox potential versus to experimental data
bioreactor dilution rate
131

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Table 1. Jarosite accumulation obtained from the experimental trials at different pH levels
Days
1.3

10
15

Mass of
jarosite
4.95
5.50

pH
1.7

1.5
mV Mass of
jarosite
678
5.89
711
7.90

This study

Chowdhury and Ojumu 2014

mV Mass of
jarosite
630
7.08
645
9.98
=6.85
mmol/L/h
max
rFe
2

=15.00
mmol/L/h

max
rFe
2

pH change from pH change from


1.7-1.3
1.7-1.5
mV Mass of
mV Mass of
mV
jarosite
jarosite
610
634
4.78
635
6.60
625
K Monods
K Hansfords
affinity
apparent affinity
constant =
constant=0.001
0.006
K Monods
K Hansfords
affinity
apparent affinity
constant = 3.91 constant=0.047
Fe2

Fe2

Fe2

Fe2

Results and Discussions


The expected increasing trend of jarosite precipitate accumulation with increasing solution
pH was observed (Figure 2)[2]. An increase of 11, 34 and 41% were obtained for solution pH
of 1.3, 1.5 and 1.7 respectively when the bioreactorswere left to run at these conditions for
additional 5 days. Although this trend was consistent with the result obtained with
geochemical simulation package, Visual Minteq (data not shown), the observed increase in
the redox potential (oxidation rate)can be attributed to increase in the number of the
immobilized microbes on the jarosite matrixes.A decrease in jarosite accumulation of 33 and
52% was observed (Figure 2) by decreasing the solution pH after 10 days of continuous
operation from pH 1.7 0.05 to 1.5 0.05 and pH 1.7 0.05 to 1.3 0.05 respectively (using
concentrated sulfuric acid), and allowing the bioreaction to continue for additional 5 days of
operation. This reduction was linked to the chemistry of dissolution of jarosite precipitation at
low pHsby Mazuelos et al.[3].The expected relationships between oxidation rate, conversion,
solution potential and dilution rate were observed (Figure 3& 4). The decreasing trend of the
conversion and the redox potential with the dilution rate were observed (Figure 3 & 4), as
previously reported[4], with the corresponding increasing overall oxidation rate towardthe
maximum. Both the simplified competitive inhibition model proposed Hansford (Eq.1)and
Monods (Eq.2)[4]could be used to describe the kinetics of ferrous ion biooxidation fairly
accurately, Figure 5 shows the fit of the experimental date to the Hansford model. However,
the maximum overall microbial ferrous ion oxidation rate obtained in this study is much
lower than that obtained by Chowdhury and Ojumu[4] in a similar study(Table 1), the main
differences between these studies were the type of microbe used, the temperature and pH
conditions of the both experiments; Acidithiobacillusferrooxidans was used in this study
while Chowdhury and Ojumu[4] used Leptospirillumferriphilum. The lower values of the
132

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
affinity constants in this study suggest that Atferrooxidans has higher affinity for the substrate
in the bioreactor than L. ferriphilum.

Conclusion
This study shows that jarositeaccumulation during microbial ferrous ion oxidation can be
managed and/or controlled by manipulating solution pH and about 50% reduction in jarosite
accumulation can be achieved manipulating operating solution pH from 1.7 to 1.3. The
kinetics of microbial oxidation of ferrous ion at pH 1.3 and 38.6 oC, in the bioreactor was
described by the simplified competitive inhibition models. The results of this study could
provide an understanding of the management and control of jarosite precipitate in a typical
bioleach heap system or at least packed bed column bioreactor, it would also find application
in the design of such systems.
Acknowledgement
The authors wish to acknowledge the support of CPUT and NRF for providing the running
cost of this project through University Research Fund and Incentive Fund programmes
References
[1] Grishin SI, Bigham JM, Tuovinen OH. Applied and environmental microbiology
1988;54:3101.
[2] Kinnunen PHM, Puhakka JA. Biotechnology and Bioengineering 2004;85:683.
[3] Mazuelos A, Carranza F, Romero R, Iglesias N, Villalobo E. Hydrometallurgy
2010;104:186.
[4] Chowdhury F, Ojumu T. Hydrometallurgy 2014;141:36.
[5] Ojumu TV, Petersen J. Hydrometallurgy 2011;106:5.

133

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Metal Recovery and Exploitation of Lignite Ashes


by Combined Physicochemical and Biotechnological Approaches
R. Kermer1a, S. Hedrich2, B. Brett3, D. Schrader3, K. Ruchle3, P.
Schnherr4, A. Schippers2, S. Reichel1, F. Glombitza1, E. Janneck1,b,*
and project partners
1G.E.O.S.

2Federal

Ingenieurgesellschaft mbH, Schwarze Kiefern 2, 09633 Halsbrcke,


Germany
Institute for Geosciences and Resources (BGR), Stilleweg 2, 30655
Hannover, Germany

3Freiberg

University of Mining and Technology, Institutes of Technical Chemistry,


Leipziger Str. 29, Freiberg, Institute of Mineralogy, Brennhausgasse 14, Freiberg,
Germany
4Loser

Chemie GmbH, Bahnhofstr. 10, 08134 Langenweibach, Germany

a r.kermer@geosfreiberg.de, b,*correspondence:

e.janneck@geosfreiberg.de, +49(0)3731-369 129

Keywords: lignite ash, carbonation, bioleaching, ash exploitation, water treatment


products
Abstract. Ashes from lignite combustion for power generation contain strategic metals,
metalloids and rare earth elements and may thus be a potential source of industrially
demanded metals. The presented project focuses on the assessment and exploitation of this
potential raw material. Lignite ash assessment showed that largest ash amounts for potential
exploitation are available in the Lusatia district, Saxony. Mechanical ash pre-treatment in
principle provided enriched fractions by different methods but still suffered from low yields
of enriched fractions. Thermal ash processing showed multiple significant phase changes
compared to original ash. Subsequent chemical leaching using HClaq resulted in high metal
extraction. Alternatively, bioleaching was applied using acidophilic Fe(II) and S-oxidizing or
Fe(III)-reducing microorganisms (MO) as well as heterotrophic MO. The results indicated
likewise high and partly specific metal mobilizations. Industrial ash exploitation was
accomplished by direct reaction with acids resulting in Al-Fe-solutions which potentially can
be applied in water treatment.
Introduction
In recent years the intensified worldwide demand and utilization of metal resources and
the partly existing dependence on a low number of producing countries lead to uncertainties
in supply and prices [1]. Several EU countries and the European Commission (EC) have
undertaken steps to guarantee a proper supply with mineral resources for Europe and to
maintain international economic competitiveness. In addition, more economic resource
utilization and more efficient exploitation and recycling of metals are needed. Following this
idea, strategy documents were published and a number of R&D projects were approved
which concentrate on the exploitation of secondary raw materials still containing different
134

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
amounts of residual critical and strategic elements [2]. Among these are low grade ores, ores
hard to process by conventional technology, as well as dumps, heaps, slags, and also ashes.
Ashes from lignite combustion for power generation contain varying amounts of critical and
strategic metals, metalloids and rare earth elements and may thus be a potential source. The
presented project focuses on this potential raw material. The project consortium involves 4
universities, 1 federal institute and 5 companies and has the aims to i) assess the amounts of
available lignite ashes in Germany, ii) quantify valuable metal contents in considered ashes
(annually produced and deposited ashes) and iii) develop a processing technology for
comprehensive recovery and exploitation of raw materials from lignite ashes.
Experimental setup
Assessment of ash amounts and sample material. The assessment of lignite ash
amounts was based on data from all relevant lignite mining districts in Germany (Rhenish,
Lusatian, Middle-German, Helmstedt). It included annually generated ash quantities but also
amounts already deposited or used for recultivation purposes (land filling/forming). In
cooperation with Vattenfall Europe Mining 2 t of stabilized ash material from the landscape
building Spreyer Hhe was sampled for comminution, homogenization and subsequent
distribution to all project partners.
Mechanical and thermal pre-treatment. Mechanical ash processing was applied to
produce ash concentrates with specific metal enrichments. The methods included density
sorting, magnetic sorting, electromagnetic sorting and flotation, partly with fine-ground ash
material. Generated fractions were analysed for metal composition.
Thermal ash processing targeted a specific metal enrichment on the particle surfaces due
to re-crystallization processes after tempering. Different temperature-duration variants were
investigated. Mineral phase analyses were carried out by XRD and REM.
Chemical leaching. Experiments included pressure-leaching with supercritical (sc-) CO2
which was conducted either separately or in combination with a subsequent mineral acid
leaching. Leaching approaches with sc-CO2 were conducted in a temperature adjustable
pressure autoclave. For prior method establishment a number of different experimental
variants (time, temperature) were evaluated and different leaching acids (HClaq, H2SO4,
HNO3) were tested. Metals in the leaching solution were analysed by AAS. Leaching
residues were analysed by XRD (Institute of Mineralogy, TU Freiberg).
Bioleaching. Approaches were conducted with acidophilic chemolithoautotrophic MO as
well as acidophilic or neutrophilic heterotrophic bacteria (for more details on bioleaching
approaches in the project, please refer to abstract Biotechnological recovery of valuable
metals from lignite ash [3]). Leaching experiments with chemolithoautotrophs used mixed
cultures of acidophilic mesophilic Fe(II)- and S-oxidizing or Fe(III)-reducing MO.
Approaches were carried out in 2L-stirred bioreactors in mineral medium supplemented with
sulfur and either under aerobic or anaerobic (N2) conditions. Due to the alkaline reaction of
the ash, the pH had to be adjusted by H2SO4 addition to 2.0. Experiments were carried out
with 10% (w/v) fly ash over 28 days. Finally, mobilized metals in the supernatant were
analysed by ICP and residues were analysed by XRF and XRD.
Leaching with heterotrophs took place in a 7L-stirred bioreactor containing glucose (165
g/L) dissolved in distilled water. The mixture was inoculated to a final cell number >109
cells/mL with a pre-cultured Acetobacter methanolicus strain (pre-culture in mineral
medium). Subsequent conversion of glucose to gluconic acid was followed by measurement
of free gluconic acid in the culture medium by titration and by means of an enzyme assay
135

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
(Megazyme, Ireland). After reaching ~85% conversion, ash was stepwise added up to 10 %
(w/v) within 3d. Further incubation took place for 8d. Finally, mobilized metals in the
supernatant were analysed by ICP-MS.
Exploitation. Industrial ash exploitation was accomplished by a two-step acidic
conversion. The first step involved stirring at room temperature and used HClaq in a
concentration of 0.27 mmol/g ash (corresponding to a HClaq solution between 1 to 5 %). In
the second step concentrated HClaq or H2SO4 were used under reflux at normal pressure or
autoclave reaction at 155 C. Ash residues that had not reacted were separated from the
solution by filtration.
Results and discussion
Assessment of ash amounts and sample material. Lignite ash assessment showed that
the largest ash amounts for potential exploitation are available in the Lusatia district, Saxony.
Over 10 million tons of lignite ashes are generated in this region per year. About half of this
amount is deposited or used for re-cultivation due to a lack of suitable processing technology.
Elemental analysis of the sampling material from landscape building Spreyer Hhe in the
Lusatia district showed high contents of Al, Ca, Fe, Mg, Mn, Ti and Si. In addition, metals
like Cr, Cu, V, Zn and Zr were found to be present in lower but still elevated abundances.
Mechanical and thermal pre-treatment. Mechanical pre-treatment in principle enabled
the generation of enriched fractions by several different techniques. However, low yield of
enriched fractions is still challenging. Ongoing experiments therefore were carried out with
original ash (not mechanically treated). Investigations on thermal pre-treatment showed so far
that targeted tempering resulted in a number of mineral phase changes compared to original
ash (Fig. 1).
Chemical leaching. The experiments showed that silicatic, sulfatic and oxidic ash
components could be changed into acid soluble carbonates and hydrogen carbonates by scCO2 treatment (150bar, 100C, 24h). Comparative approaches using original and thermally
pre-treated ash indicated improved carbonation and acid solubility of the tempered ash
(1000C, 1h). A coupling of sc-CO2 treated ash to chemical leaching with HClaq (31%, 100C,
4h) resulted in considerably increased mobilisation of Fe, Al, Mg and Ca (Fig. 2).

Figure 1. Mineral phase analysis (XRD) of original ash, tempered ash and residues after
sc-CO2 extraction and HClaq leaching of original and thermally treated ash, respectively.
136

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Beside amorphous remains and quartz the residues only contained minor parts of rutile,
diopside and mullite (Fig. 1). An additional prior thermal pre-treatment did not result in a
significantly increased metal extraction.

Figure 2. Metal concentrations in liquid phase after sc-CO2-extraction and/or HClaqleaching of


A) original ash and B) thermally pre-treated ash (1000C, 1h).
Bioleaching. Application of chemolithoautotrophic acidophilic and heterotrophic MO lead
to increased solubilization of several elements analysed. By using acidophilic, iron-reducing
bacteria under anaerobic conditions good metal extractions were obtained for Al, Cr, Mg, Mn,
V, Zn, Zr (Tab. 1) and several rare earth elements. However, also chemical leaching partly
showed high extraction values. Heterotrophic leaching with the gluconic acid-producer A.
methanolicus resulted in an increased mobilization of the metals Ca, Ce, Mg, Sr and V (Tab.
1). Remarkably, Ce and V showed an extraction of ~80% and ~60%, respectively, at
simultaneously low chemical extraction (~15% and ~0%). Also Al, Fe, Ti and Zr were
leached up to ~20-30% during bioleaching and were not or negligible in chemical approaches
[3].
Table 1. Metal extraction [%] after bioleaching with i) chemolithoautotrophic acidophilic
microorganisms in pH-controlled 2 L stirred bioreactors after 28 d at pH 2.0 and ii) with the
gluconic acid-producing A. methanolicus after 8 d. All approaches contained 10% (w/v) fly
ash.
element
Al
Ca
Ce
Cr
Cu
Fe
Mg
Mn
Si
Sr
Ti
V
Zn
Zr

extraction [%], chemolithoautotrophic acidophiles


aerobic bioleaching reductive bioleaching chem. control
48
54
44
28
48
20
32
46
25
20
68
16
29
31
26
20
33
23
61
67
46
58
73
42
25
29
19
33
42
32
*)
*)
*)
48
55
32
37
60
35
29
66
11

extraction [%], A. methanolicus


bioleaching
chem. control
31
1
83
56
79
15
29
16
*)
*)
33
0
56
37
42
30
10
2
82
63
28
0
58
0
*)
*)
22
1
*): not determined

137

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Exploitation. Industrial ash exploitation has been accomplished by a two-step acidic
conversion. After reaction of the ash with HClaq (1 to 5 %) in the first step, Ca-Mg-solutions
were obtained as products. In the second step the residues were subjected to concentrated
HCl or H2SO4 resulting in Al-Fe-solutions. Both solutions potentially can be applied in water
treatment. Substitution or partly substitution of original raw material by ashes/fractions
and/or bioleached Al-solutions is desired and currently investigated. Further exploitation of
ash, enriched fractions and/or leaching residues in concrete and/or gypsum industry is also
investigated.
Conclusions
The investigations showed so far that metals can be mobilized from the original lignite ash
and that the same can also be directly applied for industrial exploitation. The generation of
ash fractions with enriched metal contents by mechanical and thermal pre-treatment steps in
principle is possible but still challenging. Low yields of the concentrates and a rather
homogenous distribution of desired elements in the ash particles are major issues that may
only be improved by a more intense thermal pre-treatment. According to the obtained results
a metal extraction from the original ash is possible by chemical but also biological leaching
methods. Due to the partly very low metal contents in the original ash, the corresponding
metal contents in the resulting solutions were quite low, too. The separation of such small
amounts of mobilized metals has shown to be a challenge. A promising way to utilize ash is
its direct reaction with acids (without mechanical or thermal pre-treatment) which enables the
production of water treatment agents.
Acknowledgement
The project Lignite ash has been funded by the German Federal Ministry for Education
and Research (BMBF), funding number is 033R099A.
References
[1] German Resource Agency (DERA): German Resource Situation (2013).
[2] European Commission, Ad-hoc Working Group on defining critical raw materials (2014).
[3] Hedrich, S., Bellenberg, S, Kermer, R. et al. (2015), Abstract IBS 2015.

138

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Bioleaching of a Molybdenite Concentrate by Thermophilic


Microorganisms in a New Relva-Rbal 1 Air Lift Bio-Reactor
R. E. Rivera-Santillan1,*, F. Patricio Ramirez1, F. A. Lopez Lopez 1.
1

Facultad de Qumica. Universidad Nacional Autnoma de Mxico, Ciudad


Universitaria 04510, Mxico, D. F. Mxico.

* E-Mail: relva@unam.mx; Tel.: +52-55-56-225-241; Fax: +52-55-56-225-228.


Keywords: molybdenite bioleaching, hydrometallurgical bio-reactor, sulfides,
concentrate, thermophiles.
Abstract. In this paper bioleaching of molybdenite concentrate (MoS2) with extreme
thermophilic microorganisms at constant temperature (65C) was studied using a new
RELVA-RBAL1 bioreactor, designed at the Faculty of Chemistry of the National
Autonomous University of Mexico (UNAM). The equipment keeps homogeneous medium
creating physical, chemical and biological conditions that lead to optimal growth of
microorganisms, improving its resistance and tolerance to molybdenum significantly, thus
achieving high extraction. The RELVA-ARBAL1 AIR LIFT bioreactor allows us the control
of necessary conditions for a growth more efficient of the microorganisms. This will allow
leach more rapidly the ore, increasing the molybdenum extraction kinetics. The results of
extraction from bioleaching molybdenite in an orbital incubator were <1% Mo. The new
RELVA-RBAL 1 AIR LIFT bioreactor showed hight efficiency, 98.84% of extracted
molybdenum, most reported in the shortest time.
Introduction
Hydrometallurgical molybdenum obtaining presents some problems concerning the
reagents and reaction conditions used. On the dissolution of metal values, although H2SO4
leaching is not efficient, the mixture with HNO3 solubilizes completely MoS2 or attacks
selectively CuFeS2 obtaining MoS2 concentrate, but this method is not economically viable.
Existing information on bioleaching of molybdenite is escarsely given that it has a high
resistance to biological attack. The literature shows that molybdenite bioleaching is
impractical because of the low extraction of Mo from a molybdenite concentrate with
mesophilic and thermophilic microorganisms [1-3]. Due to the refractory nature of
molybdenite in the conventional methods of extraction, besides the high cost of leaching
reagents as they require quite acidic or alkaline oxidizing conditions, because of this it is
necessary to look for new alternatives for the extraction of molybdenum. Bioleaching tests
made in orbital incubator present a kinetic too slow, so this new RELVA-RBAL1 AIR LIFT
equipment seeks to increase the extraction kinetics reducing stage adaptation of
microorganisms as it can control some system variables: maintaining homogeneous nutrients,
which leads to exponential growth of microorganisms, thus increasing their capacity for
extraction of molybdenum. The used bioreactor is an equipment of low energy consumptions.

139

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Materials and Method
The ore used was a molybdenum sulfide concentrate MoS2 (molybdenite, 325 m), with a
chemical composition of 53.52 % Mo and 1.35 % Fe. In this research a mixed strain of
extreme thermophilic microorganisms at 65C was grown in nutrient medium MKM.
Bioleaching incubator tests were developed in a mineral pulp of 5% w/w inoculated 1 v/v.
The bioreactor RELVA - RBAL1 AIR LIFT, with capacity 1L, designed and built in the
laboratories of the Faculty of Chemistry, was operated with a liter of mineral MKM media
pulp at controlled temperature of 65C and an initial pH of 1.86. The pH, redox potential (PtAgAgCl electrode) and biological growth were measured periodically as well as the dissolved
molybdenum was quantified. The cell growth was measured by direct counting in Neubauer
chamber. The determination of molybdenum in solution it was held by spectrophotometry,
measuring absorbance of the complex formed with potassium thiocyanate in acidic medium,
[MoO(SCN)5], to a wavelength of 500 nm [4].
Results and Discussions
The role of microorganisms performing the bioleaching process is catalyze the reaction of
dissolution of metal sulphide, which can be represented as follows: [5]
MS + 2 Fe3+ M2+ + S + 2 Fe2+

(Eq. 1)

The molybdenite bioleaching occurs only by the indirect mechanism, as they are only
susceptible to adverse attack through an oxidizing agent such as Fe3+ [5]. The general form is
represented as follows:
Fe3+ + MS M2+ + S2O32- SO42- + H+

(Eq. 2)

The overall reaction related to the process of molybdenite bioleaching is represented by


the following equation [6]:
MoS2 + 4.5O2 + 3H2OH2MoO4 + 2H2SO4

(Eq. 3)

Sulfur oxidation is very important, not only ferric leaching. Ferric ion was not supplied in
the media.
The following results are obtained by bioleaching of a molybdenite concentrate in the
bioreactor RELVA-RBAL 1 AIR LIFT. The results of bioleaching tests were negligible and
do not report. In Fig. 1 we can see that within the first five days the biological strain is in a
latency phase. From the day 6, it can be seen exponential growth of the microorganisms
strain since the design of this equipment is able to obtain an adequate supply of nutrients
(carbon, nitrogen, hydrogen, etc.). On the day 29 a decline in the growth of microorganisms
occurs, this decay may be due to a change in pH. But from day 34, population growth is
observed again. Day 42 to 74, the number of cells remains constant, the microorganisms
growth enters the stationary phase, because a large number of cells are reached for the space
available, also in this time the most extraction of molybdenum is presented. The figure shows
that the pH has slight variations that due to the low activity of the microorganisms in the
adaptation phase. From the sixth day when the strain finishes the adaptation, begins to acidify
of the medium and the molybdenum is solubilized. At day 42 when the cell growth is at the
140

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
maximum, the pH tends to decrease dramatically due to the production of H 2SO4 this is given
by the bacterial oxidation of S2- ion, where the molybdenum is solubilized as molybdic acid.
Overall reaction:
MoS2 + 4.5 O2 + 3 H2O H2MoO4 + 2 H2SO4

(Eq. 4)

In Figure 2, it can observed that the optimal potential of 600 mV is reached, because in the
RELVA - RBAL 1 AIR LIFT reactor they have controlled conditions of temperature in
addition to the necessary nutrients which influences the metabolism of the microorganism.
You can also see that there is a lineal cell growth and the redox potential increased slightly to
day 41, since 41 to 44 days an exponential biological growth is present. , the increase of
number of cells and the consequent lack of space can probably stop cell growth.
.
1,60E+08

1,40E+08

2,5
B/mL

1,20E+08

pH

B/mL

pH

1,00E+08
8,00E+07

1,5

6,00E+07

4,00E+07
0,5

2,00E+07
0,00E+00

0
0

20

40

Days

60

80

2,00E+08

800

1,50E+08

600

1,00E+08

400

mV

B/mL

Figure 1. Evolution of the bacterial growth and pH during molybdenite bioleaching.

B/mL

5,00E+07

mV

200

0,00E+00

0
0

20

40

60

80

Days

Figure 2. Evolution of potential and biological growth in molybdenite bioleaching.


In Figure 3 shows that in the first 5 days molybdenum extraction is zero, because the
bacterial strain is in the adaptation phase to medium. After day 12, shows that the extraction
of molybdenum increases slowly, but from day 41 the microorganisms begin to grow more
141

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
rapidly, which favor the formation of hexavalent molybdenum compound (H2MoO4) and
therefore it can accelerate the kinetics of dissolution of molybdenite, reaching the higher
extraction of molybdenum reported in the shortest time.
This shows that this reactor is very viable for application in the industry and for the extraction
of metal values.
100

% Mo

80
60
40
20
0
0

20

40

60

Days

80

Figure 3. Molybdenum extraction in the bioleaching of molybdenite.


Conclussion
Bioleaching of molybdenite in an orbital incubator were <1% Mo. In the RELVA-RBAL 1
AIR LIFT reactor, the microorganisms were adapted and leaching MoS 2 in less time that
reported, because this equipement it allows a closer control of process variables to achieve
increased molybdenum extraction kinetics. They were obtained molybdenum tolerant
microorganisms and more efficient molybdenite dissolution, extracting a 96.86% of Mo in 74
days through. The RELVA-RBAL 1 AIR LIFT new reactor could be implemented in the
mining industry as a viable alternative for the mining and metals industry, its implementation
involves the application of new, cleaner, more efficient and cheap technologies, not only for
molybdenum, but also to other metal values.
References
[1]

C. L. Brierley, L. E. Murr (1973). Leaching: use of a thermophilic chemoautothrophic


microbe. Science 179, 488-90.

[2]

P. Romano, M.L. Blazquez, A. Ballester, F. Gonzalez, F. J. Alguacil (2001b).


Reactivity of a molybdenite concentrate against chemical or bacterial attack. Miner.
Eng. 14(9) 987-996.

[3]

Askari Zamani (2005) Bioleaching of Sarcheshmeh molybdenite concentrate for


extraction of rhenium. Hydrometallurgy 80 [1-2] 23-31

[4]

Gua de anlisis mediante mtodos de espectrometra molecular en el UV-VIS


Universidad Central de Venezuela, Facultad de Ciencias, Mayo 2013.

[5]

Acevedo B. Fernando, Fundamentos y Perspectivas de Tecnologas Biomineras, Chile,


Ediciones Universitarias Valparaso, 2005, pp. 9-23.

142

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[6]

Gregory J. Olson, Thomas R. Clark: Bioleaching of molybdenite, Hydrometallurgy,


2008, pp. 10-15.

143

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Physical Peeling of Passivating Layers on Chalcopyrite Leached


with Ferric Ion Using Small Alumina Balls
Seongjin Joe1, a,*, Chihiro Inoue1, b ,Tadashi Chida2, c

1Graduate

School of Environmental Studies, Tohoku University, Aoba 6-6-20,


Aramaki, Aoba-ku, Sendai. 980-8579, Japan
2Japan Oil, Gas and Metals National Corporation, 2-10-1 Toranomon, Minato-Ku
Tokyo 105-0001, Japan
a,*lhee20@hotmail.com, bchida-tadashi@jogmec.go.jp,
cinoue@er.kankyo.tohoku.ac.jp
Keywords: chalcopyrite, physical peeling, passivating layer, alumina ball, leaching.
Abstract. Chalcopyrite is the most abundant copper mineral but notorious as its slow
dissolution kinetics in hydrometallurgical processes due to the formation of passivating layers
on the surface of the mineral. We tried to improve chalcopyrite leaching rate through adding
small alumina balls in a shake flask to peel off physically the passivating layers. Leaching
experiments were carried out in shake flasks at 333 K in anaerobic condition. Each flask
contained ferric sulfate solution (pH 0.7), chalcopyrite concentrate, and alumina balls (5-mm
diameter). The effects of the alumina ball addition on the chalcopyrite leaching were
outstanding. About 97 % copper dissolution was achieved after 30 hours leaching period,
while only 12 % of copper was dissolved from the control experiment. In the former case,
elemental sulfur was detected clearly as a reaction product. These facts indicate that
elemental sulfur formed by ferric leaching did not obstruct copper dissolution in case of
alumina ball addition in leaching system. Our findings show that the passivating layers on
chalcopyrite surface can be peeled off effectively by physical method and high copper
extraction can be achieved.
Introduction
Chalcopyrite is the most important mineral source for copper in the world. Numerous
attempts have been made by researchers to develop technical methods to obtain copper from
chalcopyrite hydrometallurgically, especially in ferric sulfate media. But so far it has not
been successful on both chemical or biological leaching, because its slow kinetics results in
low copper dissolution [1]. There is no disagreement on this point that the main reason for
this low dissolution is the formation of a passivating layer on the mineral surface [2]. Four
candidates were most often proposed for the passivating layer: metal-deficient sulfides,
elemental sulfur (S8), polysulfides (XSn) and jarosites (XFe3(SO4)2(OH)6, X=K, Na, NH4, H,
etc.). Of them, polysulfides and metal-deficient sulfides were rejected or questioned by C.
Klauber [2]. Elemental sulfur as a thin film or jarosites precipitation formed on chalcopyrite
surface is considered as the main reason causing to slow mass transport [2,3,4]. It is worth
noting that formation of jarosites is limited by decreasing the pH of leaching solution, though
jarosites are reported to be formed even at low pH in case of high ferric sulfate solution.
However, it is natural and inevitable for sulfur to be formed on chalcopyrite surface in the
process of chalcopyrite leaching; therefore, the sulfur layer should be treated properly during
leaching for enhanced copper recovery.
144

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
It is well known that silver ion has catalytic role on chalcopyrite leaching. In the absence
of silver ion, sulfur layer acts as a diffusion barrier since it is dense, impermeable and nonconductive, while in the presence of silver ion, a mixed product layer of sulfur and silver
sulfide is formed, which is porous and conductive [5].
The purpose of this work is to improve chalcopyrite leaching rate and find a clue to
improve its slow kinetics on both chemical and bioleaching. To prevent jarosite precipitation
and peel off elemental sulfur layer from chalcopyrite surface, we conducted leaching tests
with 1.25 wt % pulp density in ferric sulfate solution at a low pH of 0.7 and 333 K in the
presence of 50 g of small alumina balls (5-mm diameter) in anaerobic condition.
Materials and methods
Chalcopyrite sample. A chalcopyrite concentrate from Atacama copper mine in Chile
was used in the experiment. The concentrate, having the size fraction under 100 micrometers,
was washed with HNO3 (1 mol/dm3) for a minute and three times with pure water and once
pure ethanol and dried under vacuum [6,7]. The Atacama concentrate contained 28.9 wt.% of
Cu, 28.9 wt.% Fe, 31.9 wt% S, 1.76 wt.% Si, 0.63 wt.% A1, 0.5 wt.% Zn, and 7.9 wt% of
other impurities. As the result of X-ray diffraction analysis, chalcopyrite was the main
component and the other miner minerals were not detected due to their small amounts.
Shake-flask leaching tests. All leaching tests were conducted using 300 cm3 Erlenmeyer
flasks containing 50 cm3 of 0.6 mol/dm3 ferric sulfate solution (pH 0.7) with 0.625 g of
Atacama concentrate and 50 g alumina balls (5-mm diameter) in an anaerobic condition,
unless otherwise specified. Nitrogen was introduced into the solution to remove oxygen and
the flask was capped with a silicon rubber plug and incubated in a rotary shaker at 120 rpm
and 333 K. The leaching tests were carried out during different leaching time intervals ranged
from 3 h to 30 h, respectively, where, after one test is finished, another test was started,
recycling a flask and alumina balls
Analysis. After each leaching test, leach solution and residue were centrifuged for 20 min.
at 10,000xg. Then the supernatant was filtered using 0.2 m membrane filter for measuring
metal ions (Cu and Fe), pH and ORP. The copper concentration and the total iron
concentration were determined by inductively coupled plasma atomic emission spectrometry
(ICP-AES). Ferrous ion was measured by potassium permanganate titration method. Ferric
ion was calculated by subtracting ferrous iron from total iron result. The residue was
recovered by filtration using No.5A filter paper (Toyo Roshi Co. Ltd., Japan) and washed
with pure water well and dried in oven at 323 K overnight for determining sulfur
concentration. Elemental sulfur was extracted to benzene from the dried residue using
Soxhets extractor and the sulfur concentration was determined from the light absorbance at
330 nm [8]. Also, crystallized minerals in the residue were measured by XRD analyzer.
Results and Discussion
Effect of alumina ball addition Leaching tests were carried out with 0.625 g chalcopyrite
concentrate (1.25% pulp density) in 50 cm3 of 0.6 mol/dm3 ferric sulfate solution (pH 0.7) at
120 rpm and 333 K in anaerobic condition in the presence or absence of small alumina balls.
As a preliminary experiment, the effect of 20 g of alumina balls having diameter ranged from
5 mm to 15 mm was investigated (Figure 1). The copper dissolution after 12 hours of
incubation, increased with the decrease of the diameter. One may imagine galvanic contact
145

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Fraction of Cu reacted [-]

between the balls and the chalcopyrite particles, but it should be noted that the alumina balls
are non-conductive. Therefore, it is likely that the smaller balls could conflict the
chalcopyrite particles and peel off the sulfur layer on the chalcopyrite surface effectively. In
our study, the alumina balls having 5 mm diameter was selected and then the effect of the
amount of alumina balls was investigated and it was best at 50 g of alumina balls although
the difference of chalcopyrite leaching, with the 5mm diameter balls ranged from 20 g to 100
g, was not so significant (data not shown). Therefore, we carried out all tests in the presence
of 50 g of alumina balls having 5 mm diameter except for the control condition for
comparison.
In the presence of alumina balls, copper dissolution dramatically progressed and reached
about 97% in 30 h, while in the absence of alumina balls only about 12% as shown in Figure
2. The effect of alumina ball addition was maximal and outstanding in the initial stage of
leaching, where the initial ferric ion concentration was very high (0.6 mol/dm3) and the initial
pH was low (pH 0.7), after that the effect became weaker as time passed. It has been known
that elemental sulfur layer forms on chalcopyrite surface during chemical or biological
leaching, playing a negative role hindering mass transport through the layer. If it is true, the
alumina balls added could break the layer by collision occurring between concentrate
particles and balls though the colliding power by small alumina balls seems not to be
significant. It suggests that the layer can be easily peeled off even by relatively small
colliding power, though it may need to be proved by direct observation evidence
morphologically whether the sulfur layer was peeled off by the balls from concentrate
particles or not. It may support Majimas findings that ferric sulfate resulted in the formation
and peeling-off of an aggregate of plate-like crystals of elemental sulfur [9]. In our work, the
balls may play the role of accelerating the peeling-off.
Figure 3 shows XRD analysis results of residue samples after tests in the presence of
alumina balls, where the plots indicate that of chalcopyrite concentrate, residues after 6, 18
and 30 h leaching test, and reagent sulfur from the bottom, respectively. As shown in the
figure chalcopyrite peaks are getting weaker and weaker in intensity as time passed and
diminished in 30 h, while sulfur peaks clearer and clearer and remained only in 30 h. Sulfur
peaks in 30 h were almost the same as sulfur reagent other than its intensity due to other
miner minerals remained in residues. Sulfur was only reaction product detected by XRD
analysis throughout leaching tests.

0.6

Figure 1. Effect of 20 g of alumina balls having


diameters ranged from 5 to 15 mm at 333 K during
12 h incubation: initial pH (0.6), initial ferric
concentration (0.53 mol/dm3).

0.4
0.2
0.0
0

5
10
15
Diameter [mm]

20

146

Fraction of Cu reacted [-]

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 2. Changes in copper extraction in the


presence (cross sign) and absence (plus sign) of
alumina balls where tests in the presence of
alumina balls (50 g) were conducted three times,
and average values and standard deviation were
denoted: initial pH (0.7), initial ferric ion
concentration (0.6 mol/dm3).

1.0
0.8
0.6
0.4
0.2
0.0
0

10
20
Time[hours]

30

Intensity[cps]

reagent (sulfur)

Figure 3. XRD analysis results of


residue samples after tests in the
presence of alumina balls, where the
plots present that of chalcopyrite
concentrate, residues after 6, 18 and
30 h leaching test, and reagent sulfur
from the bottom, respectively.

residue (30h)
residue (18h)

residue (6h)

concentrate(Chalcopyrite)

10

20

30
40
Position[2]

50

60

Chemical reactions Figure 4 shows changes in elemental sulfur in residue samples and
ferric ion in leaching solutions in the presence of alumina balls. Elemental sulfur was formed
during leaching process and hindered transport of chemical products but peeling off the
elemental sulfur layer by alumina balls made leaching kinetics dramatically enhanced.
However, as shown in Fig. 4 (left), only about 60% of elemental sulfur could be recovered
and the rest of elemental sulfur was missing. The main chemical reaction in the presence of
the addition of alumina balls is thought to be Eq. 1; in our work ferric ion is the sole oxidant
by which cupric ion, ferrous ion and elemental sulfur are produced.
CuFeS2 + 4Fe3+ Cu2+ + 5Fe2+ + 2S0

(Eq. 1)

The reason is speculated that sulfur existing in solution as colloid phase may not be
recovered. Sasaki et al. [4] observed that some elemental sulfur was released into solution as
colloid phase produced during leaching process. The elemental sulfur in the presence of
alumina balls may be accelerated to release into solution as colloid phase and may not be
recovered. On the other hand, In Fig. 4 (right) two types of ferric ion concentrations were
compared: one calculated from measured iron data and the other calculated on the basis of
measured copper data, according to Eq. l. They seem not to correspond each other; there was
a difference more or less between them.
However, considering high ferric ion is apt to precipitate as jarosite even at a low pH, in
the initial stage of leaching some ferric ion seems to be precipitated. Thus, in our study with
147

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
alumina balls, leaching mechanism can be explained using Eq. 1, where alumina balls played
a significant role in removing sulfur layer, likewise directly removing sulfur layer seems a
very useful method for high copper recovery. Our findings suggest that the hindrance of
chalcopyrite leaching is mainly due to elemental sulfur layer and enhancement of leaching
kinetics depends on how effectively to remove the layer. Bioleaching is a very promising
technology in heap leaching, where sulfur layer is capable to remove through the activity of
microorganisms having ability oxidizing elemental sulfur.
0.8

1.0
3

Fe[mol/dm ]

Sulfur [-]

0.8
0.6
0.4
0.2

0.6
0.4
0.2
0.0

0.0
0

10
20
Time[hours]

30

10
20
Time[hours]

Conclusions

30

Figure 4. Changes in
elemental sulfur (left) in
residue samples and ferric
ions (right) in leaching
solution, in the presence
of alumina balls:
elemental sulfur (plus
sign), ferric ion (white
diamond) calculated from
measured iron data, ferric
ion (dash line) calculated
on the basis of measured
copper ion data,
according to Eq. 1.

Chalcopyrite concentrate was leached in the presence of alumina balls in ferric sulfate
solution in an anaerobic condition. About 97% of copper was extracted in 30 h, the effect of
alumina ball addition was more outstanding in the initial stage of leaching, suggesting that
alumina balls peeled off the elemental sulfur layer effectively and catalyzed copper
dissolution.
References
[1] D.E. Rawlings, D. Dew and C. du Plessis: Trends in Biotechnology Vol. 21 (2003) p. 38.
[2] C. Klauber: Int. J. Miner. Process., Vol. 86 (2008) p. 1.
[3] T. Hirato, H. Majima and Y. Awakura: Metallurgical Transactions B, Vol. 18B, (1987), p.
489.
[4] K.Sasaki,K.Takatsugi,O.H.Tuovinen: Hydrometallurgy, Vol. 127-128, (2001) p. 116.
[5] G. Nazari, D.G. Dixon and D.B. Dreisinger: Hydrometallurgy, Vol. 113-114, (2012) p.
62.
[6] S. Joe, T. Chida, M. Sakoda, H. Nakamura, M. Tamura and N. Sato: Proc. of MMIJ
Annual Spring Meetings D, (2008), p. 137.
[7] J. Vilcez, R. Yamada and C. Inoue: Hydrometallurgy, Vol. 96, (2009) p. 62.
[8] N. Hiroyoshi, H. Miki, T. Hirajima and M. Tsunekawa: Hydrometallurgy, Vol. 60, (2001)
p. 185.
[9] H. Majima, Y. Awakura, T. Hiroto and T. Tanaka: Canadian Metallurgical Quarterly, Vol.
24, (1985), p. 283.

148

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Utilisation of Inorganic Substrates by Alicyclobacillus-Like Strain


FP1
Helen R. Watling1,a, David M. Collinson1,b, Felicity A Perrot1 and
Denis W. Shiers1,d
1CSIRO

Mineral Resources Flagship, P.O. Box 7229, Karawara, WA 6152, Australia

aHelen.watling@csiro.au, bDavid.Collinson@csiro.au, dDenis.Shiers@csiro.au

Keywords: alicyclobacillus, ferrous oxidation, risc, heap leaching.


Abstract. As Alicyclobacillus-like strain FP1 was isolated from copper heap process water
(pH 1.5), this research was directed towards its bioleaching attributes, specifically ferrous ion
(Fe(II)) and reduced inorganic sulfur compound (RISC) oxidation, and bioleaching of sulfide
minerals. Strain FP1 oxidised iron(II) but not tetrathionate or elemental sulfur in growth
media containing yeast extract as growth factor. The addition of tetrathionate (2.5 mM)
suppressed iron(II) oxidation. Strain FP1 grew on pyrite, arsenopyrite, chalcopyrite,
sphalerite and pentlandite in BSM-YE medium at 30 C and pH 1.8 (35 days), enhancing Zn,
Co (in cobaltiferous pyrite), Fe and As recovery, but not Cu or Ni, relative to abiotic controls.
Introduction
Alicyclobacillus-like strain FP1 was isolated from process water at a copper sulfide heap
leach operation in north Western Australia. Based on the 16S rRNA gene, strain FP1 had 97
% sequence similarity to A. cycloheptanicus [1, 2]. Although Alicyclobacillus spp. are
obligate heterotrophs [3], five of the 21 validated Alicyclobacillus species [4] and three
informally-named Alicyclobacillus strains [3,5,6] grow on inorganic substrates.
As strain FP1 was isolated from process water at a copper heap bioleach operation, the
research was directed towards its bioleaching attributes, specifically iron (II) and reduced
inorganic sulfur compound (RISC) oxidation, bioleaching of mineral sulfide, and its roles in a
heap leach system. In the present study, cell lines were established for strain FP1 in media
containing yeast extract and either ferrous sulfate or potassium tetrathionate as substrate, with
the intent to examine growth in dual-substrate media, as described in [7].
Methods
Basal salts medium with yeast extract (BSM-YE) was prepared by adding 1.5 g L1
(NH4)2SO4, 0.25 g L1 KH2PO4 and 0.25 g L1 MgSO4 to distilled water, adjusting the pH to
1.8 with concentrated H2SO4 and sterilizing at 121 C, 100 kPa for 20 min. The medium was
supplemented with 0.1 g L1 yeast extract. Ferrous ions in test solutions were monitored,
bioleaching tests conducted and cells counted, according to methods in [8]. A calibrated pH
meter with glass membrane electrode was used to measure pH. Tetrathionate and
polythionate concentrations were quantified using high performance liquid chromatography
(HPLC) [9] and elemental sulfur utilisation was estimated gravimetrically by mass loss. All
chemicals used were AR-grade reagents and solutions prepared with de-ionised water.
Cell lines of strain FP1 were maintained in BSM-YE with iron (II) (9.71 g L1
FeSO4.7H2O) or tetrathionate (0.75 g L1 K2S4O6) at 30 C for more than a year by
149

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
subculturing at 12 weekly intervals. A solution pH 2.5 was chosen for the tetrathionate
medium to facilitate the measurement of acid production (lower pH) and the use of solution
pH 1.8 for iron (II) media avoided iron(III) compound formation during tests. For
comparative tests, BSM-YE media was prepared with Fe2+ and/or S4O62, inoculated with
iron(II)- or tetrathionate-cell lines and incubated at 30 C. Aliquots for analysis and bacterial
enumeration were removed periodically.
Bioleaching of sulfide minerals was evaluated individually on concentrates of pyrite,
arsenopyrite, chalcopyrite, sphalerite and pentlandite (1% w/v) in BSM-YE medium at 30 C
and pH 1.8 over a period of 35 days. Flasks were adjusted weekly for evaporation with deionised water and aliquots removed for solution analysis periodically. Elemental sulfur
utilisation was conducted in 100 mL of BSM-YE medium supplemented with 0.5 g of
substrate. Cultures were incubated at 30C over a 45 day period before sulfur mass loss was
measured.
Results and discussion

2.00E+08

40

1.50E+08

30

1.00E+08

20

5.00E+07

10

0.00E+00

0
0

10

20

30

40

Ferrous ion [mM]

Cells [mL-1]

The two established cell lines were readily maintained in BSM-YE with single substrates.
When the iron (II)-cell line was subcultured into fresh BSM-YE with iron (II) (pH 1.8), 35
45 hours were required for numbers to increase from the initial 5106 cells mL1 to 1108
cells mL1. Ferric ion generation and cellular growth were coupled (Fig. 1).

Cells
Fe(II)

50

Time [hours]
Figure 1. Correlation between iron (II) oxidation and growth for Strain FP1 in BSM-YE with
iron (II) (pH 1.8, 30 oC, triplicate tests); cells mL1.
When the tetrathionate-cell line was sub-cultured into fresh BSM-YE tetrathionate
medium (pH 2.5), it required 710 days for numbers to increase from 2106 to 93107
cells mL1 but cell numbers decreased thereafter to 73106 cells mL1 at 20 days. The
changes in both pH (2.52 to 2.49) and tetrathionate concentration (2.50.1 mM) during a 20day experiment were minimal. Pentathionate (0.05 mM) and thiosulfate (0.004 mM) were
detected after 100 h. When the tetrathionate-cell line (pH 2.5) was subcultured into BSM-YE
iron (II) medium (pH 1.8) it grew as rapidly as the iron (II)-cell line, requiring only 3545
hours to attain 1108 cells mL1.
150

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Ferrous ion (mM)

Iron (II) oxidation tests were undertaken at pH 1.8 with added tetrathionate in the range 0
2.5 mM (Fig. 2). The results indicated both an increased lag time and a slower rate of iron(II)
oxidation with increased tetrathionate concentration. The doubling times derived from
iron(III) generation increased from 5.3 hours without tetrathionate to 8.8 hours with 2.5 mM
tetrathionate. In a 70-hour experiment, the tetrathionate decreased by 57 % regardless of
starting concentration with the concomitant formation of low but persistent pentathionate
concentrations, from 10-5 to 10-2 mM for all tests. The minor changes in speciation are
consistent with a low amount of abiotic tetrathionate oxidation in acidic conditions.
Cell numbers reflected two parameters, the lag times before iron (II) oxidation and the
amount of tetrathionate present. For the tests containing 0 and 0.5 mM tetrathionate, numbers
increased from 1106 to 1.6108 cells mL1 with complete iron(II) oxidation, but declined
rapidly thereafter. At 1 mM tetrathionate, there was an increase from 1106 to 8107 cells
mL1 at 50 h, corresponding to complete iron(II) oxidation, followed by a rapid decline. At
2.0 and 2.5 mM tetrathionate, cells did not increase from their initial concentrations (1106
cells mL1) although the iron(II) was completely oxidised at 75 h.
35
30

25
20
15
0

0.7 1.1

2.0

10

2.5 mM S4O62-

5
0
0

20

40

60

80

100

Time [hours]

Figure 2. Inhibition of ferrous ion biooxidation by Strain FP1 in iron(II) media containing
different tetrathionate concentrations.
In cultures growing on elemental sulfur, FP-1 cell numbers increased initially from
9.6106 to 6107 cells mL1 but then declined to 1.60.2107 cells mL1; the maximum
reduction in the mass of sulfur in 45 days was 3 %. The decline in cell numbers was
attributed to a lack of substrate, with the yeast component utilised initially, followed by a
long duration without elemental sulfur utilisation. In BSM-YE (1.0 g L1 YE as sole
substrate), cell numbers increased from 4.1106 to 1.60.1108 in 7 days. The tetrathionate
cell line of strain FP1 also grew on yeast extract in the presence of tetrathionate (2.5 mM),
cell numbers increasing from 2106 to 60.1106 cells mL1 in 3 days but the addition of 0.1
g L1 ferrous ion to BSM-YE with tetrathionate (2.5 mM) suppressed growth.
Strain FP1 grew on pyrite, arsenopyrite, chalcopyrite, sphalerite and pentlandite,
enhancing the extractions of Zn, Co, Fe and As, but not Cu or Ni, relative to abiotic controls
(Table 1). The low extractions of copper from chalcopyrite were attributed to the low
temperature employed; the sphalerite used is particularly low in iron content, thus limiting the
amount of iron(III) available to oxidise the mineral. As solution pH was controlled during the
151

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
tests, precipitation of iron(III) compounds is not expected to have contributed to the low
extractions.
Table 1. Extractions [%] after 35 days of bioleaching: Zn from sphalerite, Co from
cobaltiferous pyrite, Fe from pyrite, As from arsenopyrite, Cu from chalcopyrite and Ni from
pentlandite.
Zn

Co

Fe

As

Cu

Ni

bioleach

70

35

2.5

100

abiotic

2.5

30

2.5

100

Summary
In summary, strain FP1 was shown to readily oxidise ferrous ion; however, the apparent
ability of strain FP1 to oxidise tetrathionate or elemental sulfur was refuted by quantifying
RISCs during tests. Tetrathionate suppressed iron(II) oxidation. Minimal iron(II) in
tetrathionate medium did not promote tetrathionate utilisation. Strain FP1 grew on several
mineral sulfides and enhanced metal extraction from some. The inorganic substrate utilisation
profile of strain FP1 is different to the profiles of the eight Alicyclobacillus strains for which
comparative data are published. Strain FP1 is likely to contribute to heap bioleaching in
mixed microbial communities of iron(II) and sulfur-oxidising species, through its abilities to
grow on mineral sulfides and to oxidise iron(II) in strongly acidic process water.
Acknowledgements
We thank Dr D. Morin for providing the cobaltiferous pyrite used in this study. The
financial support of the Australian Government through CSIRO Mineral Resources Flagship
is gratefully acknowledged.
References
[1] G. Deinhard, J. Saar, W. Krischke, K. Poralla: Syst. Appl. Microbiol. Vol 10 (1987),
6873.
[2] J.D.Wisotzkey, P. Jurtshuk, G.E. Fox, G. Deinhard, K. Poralla: Int. J. Syst. Bacteriol.
Vol 42 (1992), 263-269.
[3] A. Yahya, K.B. Hallberg, D.B. Johnson: D.B: Arch. Microbiol. Vol 189 (2008), 305312.
[4] X. Guo, X.-Y. You, L.-J. Liu, J.-Y. Zhang, S.J. Liu, C.Y. Jiang: Int. J. Syst. Evol.
Microbiol. Vol 59 (2009), 2415-2420.
[5] Z. Huang, X. Zhang, C. Zheng, D. Wen, Y. Han, Chinese Patent 102161977-A. (2011)
[6] S. Liu, C.Y. Jiang, P.S. Tang, X. Guo, M. Zhang, Chinese Patent 103667131-A. (2014)
[7] D.W. Shiers, D.E Ralph, H.R. Watling: Hydrometallurgy Vol 104 (2010), 363-369.
[8] H.R. Watling, F.A. Perrot, D.W. Shiers: Hydrometallurgy Vol 93 (2008), 57-65.
[9] D.W. Shiers, D.E. Ralph, H.R. Watling: Biochem. Eng. Vol 54 (2011), 185-191.
152

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Systems Biology of Acidophile Biofilms for Efficient Metal


Extraction
Stephan Christel1,*, Mark Dopson1, Mario Vera2, Wolfgang Sand2, Malte
Herold3, Paul Wilmes3, Antoine Buetti-Dinh4, Igor Pivkin4, Christian
Trtschel5, Ansgar Poetsch5, Jan Nygren6, Mikael Kubista6
1Linnaeus
2Universitt
3University
4Universit

University, Sweden

Duisburg-Essen, Germany

of Luxembourg, Luxembourg

della Svizzera italiana, Switzerland

5Ruhruniversitt
6TATAA

Bochum, Germany

Biocenter AB, Sweden

*Author to whom correspondence should be addressed; E-Mail:


stephan.christel@lnu.se;
Tel.: +46-480-446156; Fax: +46-480-447305
Keywords: Biofilm, Acidophiles, Chalcopyrite, Heap Bioleaching, Copper, Lag
Phase, Omics
Abstract. The objectives of a recently funded European Union (ERASysApp) are to
understand and provide solutions to the problem of the long lag period typically encountered
in new mineral heap bioleaching operations of the copper containing mineral chalcopyrite. In
practice, this lag phase can be up to three years and the long time period adds to the operating
expenses of bioheaps for chalcopyrite dissolution. One of the major time determining factors
in bioleaching heaps is suggested to be the speed of mineral colonization by the acidophilic
microorganisms present. By applying confocal microscopy, metatranscriptomics,
metaproteomics, bioinformatics, and computer modeling the study aims to investigate the
processes leading up to, and influencing the attachment of three moderately thermophilic
sulfur- and/or iron-oxidizing model species: Acidithiobacillus caldus, Leptospirillum
ferriphilum, and Sulfobacillus thermosulfidooxidans. Stirred tank reactors containing
chalcopyrite concentrate, inoculated with these species, allows investigation of the effects of
various inoculation orders and proportions on the lag phase and rates of metal release.
Meanwhile, confocal microscopy studies of cell attachment to chalcopyrite mineral particles,
as well as metatranscriptomics and metaproteomics of the formed biofilms further increases
the so far limited understanding of the attachment process and help develop a model thereof.
By fulfilling the projects goal to decrease the length of the lag phase in chalcopyrite
bioleaching operations it is hoped to increase their economic feasibility and thereby, raise
industrial interest in bioleaching as a suitable technology to extract copper from chalcopyrite
mineral.
Introduction
Presently there is an increase in the European demand for metals. Consequently,
preferably environmentally friendly techniques must be developed to meet this demand.
153

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Despite the need to dig the ore and crush it for both biomining and conventional metal
extraction processes, biomining is suggested to partially uphold this criteria as it exploits
acidophilic microorganisms for metal solubilisation from sulphide ores in tanks, heaps and
dumps [1, 2]. Bioleaching of copper sulphide minerals such as chalcopyrite (CuFeS 2; the
largest copper resource in the world) is usually conducted in engineered heaps and accounts
for approximately 15% of the present world copper production. In comparison with the
traditional roasting and smelting processes used for metal extraction of sulphide ores,
bioleaching reduces the release of toxic compounds, such as sulphur dioxide, associated with
these techniques. The major role of microbial populations in biomining is to catalyse the
regeneration of ferric iron from ferrous iron and generate protons by oxidation of sulphuric
acid species. Although heap bioleaching is a low cost method, it is a slow process that can
take up to several years to achieve economic metal recoveries.
One factor that strongly influences the economics of an industrial bioheap plant (Fig. 1) is
the lag time between addition of acid to the top of the heap and metal recoveries. An example
is a test heap constructed for metal recovery from a black schist in Talvivaara, Finland where
nickel and zinc recoveries were >80% after 480 days while copper recovery from
chalcopyrite did not proceed until after 500 days [3]. The duration of this lag time is
suggested to be determined predominantly by the speed of microbial colonization of the
mineral and the mineralogy of the ore. However, to date no optimisation has been achieved in
terms of biofilm formation for enhanced bioleaching of industrially relevant metal sulphides.
Microorganisms in biofilm communities thrive when attached to substrates by extracellular
polymeric substances (EPS). A fundamental question in microbial ecology is to understand
the interaction(s) among the different species present in natural and/or industrial or
engineered biofilm systems. This is especially the case in bioleaching, since successional
processes, such as attachment of microbes to the mineral, play important roles in biofilm
formation [4].
Consequently, fundamental knowledge on the mechanisms of biofilm formation is central
for the design of heap inoculation strategies to increase the efficiency of ore processing, in
particular by reducing the lag time between heap initiation and metal recovery.

Figure 1. The top of a bioheap showing irrigation of the mineral (A) and copper precipitates
formed as a result of chalcopyrite dissolution (B).

154

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Study of acidophile biofilm by omics
Examination of biofilm formation by omics and microscopy serve as a way to model the
rate and influence of microbial species on the biofilm formation, as well as the time required
for copper to be released from the mineral matrix. However, one of the issues of multispecies microbial biofilms is that they are inherently heterogeneous and community-wide
networks are expected to be more than merely sums of their respective parts. In order to
meaningfully integrate omics datasets, obtained biomolecular fractions have to be
representative of the sampled microbial assemblages before high-resolution molecular
analyses. For this reason, appropriate laboratory methods have been developed which allow
the isolation of concomitant RNA and protein from single unique microbial community
samples. The resulting omics data fulfil the premise of standardised systematic
measurements and can be meaningfully integrated. In particular, the RNA sequencing and
protein data can be mapped onto the genomes of constituent community members with high
accuracy which in turn, forms the basis for formulating community-wide multi-scale models.
A second issue is that the application of omics techniques for the investigation of
acidophilic biofilms during bioleaching is highly limited. However, many studies have been
carried out for other types of acidophile biofilms [5, 6]. Although metatranscriptomics and
metaproteomics (i.e. RNA transcript and protein complement analysis of microbial
communities, respectively) is rapidly evolving, the field is still in its infancy and for many
tasks no established, robust tools are available. In this study, some of the most important
moderately thermophilic bioleaching bacteria on chalcopyrite surfaces, Acidithiobacillus
caldus, Leptospirillum ferriphilum and Sulfobacillus thermosulfidooxidans are used to
investigate the biofilm formation [7, 8]. Therefore, a unique feature of the experimental setup
is the use of well-defined microbial communities of limited diversity and known cultivation
conditions. Consequentially, despite the described challenges of acidophile omics
techniques, establishing and testing novel approaches for measuring and modelling a mixedmicroorganism biofilm formation process is possible. In particular, the following analyses
assist in meeting this goal: i. integrative analysis using microscopy and high throughput
omics of temporal and spatial biofilm development on the species and molecular network
level; ii. exploitation of large data sets for extensive bioinformatic analysis; and iii.
processing of the resulting data for the formulation of multi-species biological network
models (based on metaomics data) alongside multi-species particle-based models (based on
imaging data) to define the key factors affecting biofilm formation.
Modelling of omics data
Modelling biological processes at the molecular level is usually based on idealised
network models that represent interacting components in a simplified fashion. Efficient tools
are available to deduce causal links between biological components from omics
experiments. This allows the assimilation of metatranscriptomic and metaproteomic data into
network models which can subsequently be analysed with appropriate mathematical tools.
Bayesian networks, regression and simulated annealing allow inference of network topology
from quantitative, omics data [9]. Network analysis tools consist of a diversified set of
methods such as bifurcation and sensitivity analysis which have a long tradition in
engineering and more recently, have been applied to biology. These tools allow the
identification of important control points and parameters for the studied system. Further,
155

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
models describing cells at the molecular level can be integrated into particle-based methods
and consequently account for the interactions between different cells, and allow the study of
bacterial communities.
Planned outcomes
The models will valorise systems biology knowledge and will be used to predict and
manipulate biofilm development to reduce the lag time between heap initiation and onset of
copper solubilisation. These improved biofilms will be iteratively evaluated to connect the
model development with mineral oxidation rates, as well as their tolerance to changes in
environmental conditions. Decisively, the project will transfer systems biology knowledge
into an application by including end user companies actively carrying out biomining and
other biotechnological applications. Thereby, we are maximising the industrial application of
the data and hopefully make this environmentally friendly technique more attractive to
mining companies.
References
[1] N. Pradhan, K.C. Nathsarma, K. Srinivasa Rao, L.B. Sukla, B.K. Mishra, Heap
bioleaching of chalcopyrite: A review, Minerals Engineering 21 (2008) 355-365.
[2] H.R. Watling, The bioleaching of sulphide minerals with emphasis on copper sulphides
A review, Hydrometallurgy 84 (2006) 81-108.
[3] M. Riekkola-Vanhanen, Talvivaara mining company From a project to a mine,
Minerals Engineering 48 (2013) 2-9.
[4] P. Wilmes, J.P. Remis, M. Hwang, M. Auer, M.P. Thelen, J.F. Banfield, Natural
acidophilic biofilm communities reflect distinct organismal and functional organization,
ISME J 3 (2009) 266-270.
[5] M. Vera, B. Krok, S. Bellenberg, W. Sand, A. Poetsch, Shotgun proteomics study of
early biofilm formation process of Acidithiobacillus ferrooxidans ATCC 23270 on
pyrite, Proteomics 13 (2013) 1133-1144.
[6] C. Baker-Austin, J. Potrykus, M. Wexler, P.L. Bond, M. Dopson, Biofilm development
in the extremely acidophilic archaeon Ferroplasma acidarmanus Fer1, Extremophiles
14 (2010) 485-491.
[7] J.J. Plumb, N.J. McSweeney, P.D. Franzmann, Growth and activity of pure and mixed
bioleaching strains on low grade chalcopyrite ore, Minerals Engineering 21 (2008) 9399.
[8] M. Dopson, E.B. Lindstrom, Analysis of commuinity composition during moderately
thermophilic bioleaching of pyrite, arsenical pyrite, and chalcopyrite, Microbial Ecology
48 (2004) 19-28.
[9] D. Hurley, H. Araki, Y. Tamada, B. Dunmore, D. Sanders, S. Humphreys, M. Affara, S.
Imoto, K. Yasuda, Y. Tomiyasu, K. Tashiro, C. Savoie, V. Cho, S. Smith, S. Kuhara, S.
Miyano, D.S. Charnock-Jones, E.J. Crampin, C.G. Print, Gene network inference and
visualization tools for biologists: application to new human transcriptome datasets,
Nucleic Acids Res 40 (2012) 2377-2398.
156

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

A Study of Permeability and Diffusion at The Agglomerate-Scale in


Heap (Bio)Leaching Systems
Elaine Govender1,a, Athanasios Kotsiopoulos1,b and Susan T. L.
Harrison1,c
Centre for Bioprocess Engineering Research (CeBER), Department of Chemical
Engineering,
University of Cape Town, Rondebosch 7701, South Africa.
aElaine.Govender@uct.ac.za, bAthanasios.Kotsiopoulos@uct.ac.za,
cSue.Harrison@uct.ac.za

Keywords: heap bioleaching, solution transport, microbial colonisation, microbial


attachment.
Abstract. Multiple mini-column reactors, loaded with identically constructed ore samples
representing grab samples of a larger heap, were used to study the behaviour of solution
tracers to elucidate solution diffusion, dispersion and transport. The tracers were either
introduced to the ore bed as a pulse, included during agglomeration of the ore or introduced
to the system by submerging the ore bed. These methods of tracer introduction allowed for
the characterisation of flow interchange in unsteady state systems. The resulting
concentration-time distribution curves were analysed to allow characterisation of flow
dispersion and diffusion, which facilitates exchange between the fast flowing and largely
stagnant liquid phases. Preliminary results support the presence of distinct stagnant and
flowing regions within the agglomerated ore bed. Agglomeration with the tracer promotes
increased retention on the ore; potentially enhancing microbial transport via increased
solution exchange after the initial period of attachment.
Introduction
Conceptual understanding of the heap bioleaching environment proposes that
agglomeration of crushed ore provides a niche micro-environment for solution hold-up,
regeneration of leaching agents, metal dissolution and transport [1, 2]. In a recent study of
microbial colonisation of the whole ore environment, microbial abundance in the pregnant
leach solution (PLS), interstitial solution and attached to the ore was quantified [3]. The
observed significant differences in microbial population in these regions suggested that the
stagnant interstitial phase provides a niche environment for microbial growth and activity,
stimulating microbial colonisation and associated leach reactions [4].
Solution flow dynamics in unsaturated packed beds has been studied previously for
application to pathogen removal in soils [5] and solute flow in heaps [6]. The extension of
this knowledge to inform microbial growth and transport may improve colonisation of the
heap during the start-up phase. Most recently, the advection-dispersion equation, used
previously to model pathogen transport in soil beds [7], was modified to account for
microbial growth and transport in agglomerate-scale ore beds [8]. However, the solution flow
properties and exchange of solution between the regions of high solution hold-up and the
bulk flowing solution, has not been established. In a previous study, residence time
157

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
distribution experiments were performed to characterise steady state solution behaviour
within the agglomerate-scale heap [9]. Although characterisation of solution flow dynamics
at steady state conditions provides insight into performance of a reactor, initial solution flow
through the reactor is inherently transient. Characterisation of transient flow behaviour is
therefore necessary to understand how unsteady state flow dynamics facilitates microbial
colonisation during heap start-up.
This study aims to use simple and rapid tracer studies to characterise solution flow
behaviour in unsaturated ore beds. The chemical tracers are introduced to the packed bed
reactor as a pulse, included in the agglomeration of the ore and introduced into the bed by
submerging the ore bed. A comparison of the solution flow behaviour under the
aforementioned conditions provides insight into the contacting between the ore, stagnant
solution and bulk flowing solution during start-up. Introduction of the microbial tracer using
the same techniques inform initial microbe-mineral interaction and subsequent microbial
transport through the ore bed, as facilitated by solution flow dynamics.
Materials and Method
Experimental setup. The experimental system used in this study consisted of multiple
mini-column reactors, each loaded with ca. 150 g of low-grade chalcopyrite ore [9]. The
equal mass and particle size distributions of the ore samples together with equal irrigation
rates, represented agglomerate-scale grab samples of a larger heap. The irrigation solution,
composed of acidified deionised water containing 0.2 g L-1 Fe3+ (Fe2(SO4)3.4H2O),
autotrophic basal salts (ABS) medium and trace element solution, at pH of 1.7 (96% H2SO4)
was distributed in a fine mist over the top of each reactor at 10 mL h-1 (2 L m-2 h-1). Minicolumn reactors were setup in triplicate for each set of experiments.
Chemical tracer solution. A standard solution of cobalt sulphate heptahydrate
(CoSO4.7H2O) of 50 g L-1 Co2+ was used as a chemical tracer. The chemical tracer solution
was made up to the required tracer volumes using acidified distilled water at pH 1.7 (96 %
H2SO4). The intensity of the red-pink colour of the chemical tracer solution was measured at
510 nm using a HELIOS UV-vis spectrophotometer to determine the Co2+ concentration in
the effluent solution.
Microbial tracer solution. The microbial tracer was composed of an Acidithiobacillus
ferrooxidans culture, grown on -irradiated pyrite concentrate (1% w/v), supplemented with
autotrophic basal salts (ABS) medium, trace element solution and 0.5 g L-1 Fe2+
(FeSO4.7H2O) at pH 1.7 [9]. Acidified distilled water and ABS medium were used to prepare
the microbial tracer solutions to ensure an initial microbial population of 109 cells in the ore
bed. Microbial concentrations were quantified using a Thoma counting chamber and phase
microscopy.
Tracer experiments. For the pulse experiment, the ore bed was agglomerated with
acidified distilled water (pH 0.6) to obtain a moisture content of 5.0%. After 1 h, a 2 mL
pulse of tracer was introduced to the top of the ore bed. One hour later, feed solution was then
irrigated over the bed. For the steady state pulse tracer experiment, the 2 mL slug of tracer
was introduced after 24 h of continuous irrigation. In the agglomeration experiments, 8.05
mL of tracer solution was introduced to the ore bed during the agglomeration step, providing
the specified moisture content of 5.0%. After 1 h, feed was initiated. For the submerged
tracer experiments, the ore was agglomerated with acidified distilled water, as per the pulse
experiments. After 1 h, 100 mL of tracer solution was fed to each mini-column reactor, which
158

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
allowed for complete submersion of the ore bed. One hour later, the column was drained and
feed was initiated. Effluent samples were collected every 8 min and analysed for tracer
concentration.
Results and discussion
Steady state solution behaviour within the mini-column reactor was found previously to
simulate that of a well-mixed continuous stirred tank reactor with a mean residence time of
75 min [9]. Using compartment models, the volumes of stagnant and bulk flowing solution
within the ore bed were estimated to be 2.3 and 11.7 mL respectively. In the current study,
pulse tracer experiments were performed at unsteady state conditions. A comparison of the
flow dynamics of tracer solution as a result of steady and unsteady state test conditions is
presented in Error! Reference source not found.. The tracer concentration-time curves were
normalised with respect to the total mass of tracer that exited the reactor over the duration of
the experiment. For both sets of experiments, a bimodal distribution of the mass of tracer
exiting the reactor was translated into two distinct rates of tracer dissipation within the
unsaturated ore bed. This type of solution behaviour suggests the presence of fast and slow
moving solution within the ore bed.
The pulse input represented a plug of tracer dispersing through the ore bed from the bulk
solution to the mineral surface followed by migration to the interstices between clusters of
particles. The initial lag period of ca. 40 min in solution break-through for the unsteady state
system, was attributed to the formation of stagnant pools within the agglomerate-scale ore
bed. Thereafter, the transport of tracer out of the steady state system was slower than for the
unsteady state system. During this stage, the higher dispersion of tracer from the bulk flowing
solution to the established stagnant solution resulted in a smaller fraction of tracer exiting the
steady state system (~50%) as compared to the unsteady state system (~80%). Beyond the
steady state mean residence time interval (75 min), the difference in solution flow behaviour
between the tracer experiments was due to the greater advection transport of bulk solution
that is present within the ore bed operated at steady state. In contrast, the solution flow
dynamics within the unsteady state mini-column reactor is governed predominantly by
capillary dispersion transport phenomena from the mineral surface and stagnant solution over
bulk advection transport.

159

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

cumulative fraction of tracer


leaving reactor

1,0
0,8
0,6
0,4
Steady state pulse

0,2

Unsteady state pulse


0,0
0

100

200 time [min] 300

400

500

Figure 1. Exit tracer distributions for pulse experiments performed at steady [-x-] and
unsteady state [] conditions.
The agglomeration of the ore particles with the tracer was assumed to simulate the
transport characteristics of solute from the mineral surface to the stagnant interstitial solution
associated with the cluster of particles and then into the bulk flowing solution. With the
uniform distribution of tracer within the ore bed, the lag in tracer solution break-through of ca.
24 min was less than that observed for the pulse study (Error! Reference source not found.).
Whilst the 2 mL pulse under unsteady state conditions resulted in the accumulation of
stagnant solution in the interstices with subsequent feed solution promoting further
accumulation followed by transport along the ore bed, bulk solution-ore contacting facilitated
more immediate tracer transport through the bed in the agglomerated tracer system.

cumulative fraction of tracer


leaving reactor

1,0
0,8
0,6
0,4
Pulse
0,2

Agglomerated
Submerged

0,0
0

100

200

300
400
time [min]

500

600

700

Figure 2. Comparison of the tracer solution behaviour for the pulse [], agglomerated [] and
submerged [] tracer experiments performed at unsteady state conditions.
The initial rate of tracer dispersion from the agglomerated mineral surface, through to the
stagnant solution and into the bulk flowing solution was observed to be less than that for the
pulse of tracer, with less than 20% of the tracer leaving the reactor during this stage.
Thereafter, the rate of tracer transport showed a slope of 0.0013 for agglomerated tracer. This
was greater than the observed slopes of 0.0008 and 0.001 in the pulse and submerged tracer
experiments, respectively. This result may be due to the larger concentration gradient
obtained when the ore was agglomerated with tracer solution. When the ore bed was
160

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
submerged in the tracer solution, no delay in tracer output was observed after the reactor was
drained. The initial rate of tracer transport from the already established stagnant solution to
the bulk flowing solution was greater than that observed for the agglomerate tracer
experiment but less than that of the pulse tracer. During this initial stage, tracer transport out
of the submerged system behaved similarly to that of the steady state pulse system.
The behaviour of the microbial tracer when introduced to the ore bed as a 2 mL pulse,
agglomerated onto the ore or used to submerge the ore bed is compared in Error! Reference
source not found.. At the termination of the experiments, the retention of the inoculum
within the ore bed for the pulse, agglomerated and submerged experiments were ca. 74, 99
and 45 %, respectively. The microbial populations in the effluent were normalised with
respect to the total microbial population that exited the reactor in the time interval studied.
Two stages of tracer transport out of the reactor were observed. Over the first 120 min,
microbial transport through the ore bed was highest in the submerged experiment, where the
already established stagnant solution promoted dispersive transport of micro-organisms to the
bulk solution. Agglomeration of the ore with the microbial tracer facilitated increased
microbial attachment to the mineral, with microbial transport out of the ore bed due to
advective properties of the bulk solution. Introducing the microbial tracer as a pulse also
promoted high inoculum retention since the pulse was initially dispersed to the mineral
surface before establishment of the stagnant solution.
cumulative fraction of microbial
tracer leaving reactor

1,0
0,8
0,6
0,4
Pulse

0,2

Agglomerated
Submerged

0,0
0

100

time [min]

200

300

Figure 3. Comparison of microbial tracer behaviour for the pulse [], agglomerated [] and
submerged [] tracer experiments.
Conclusions
Varied tracer input methods have provided insight into the solution flow behaviour of the
chemical tracer within the unsaturated ore bed. In particular, the importance of establishing
the stagnant regions to enhance tracer dispersion from the mineral surface. In contrast,
microbial retention within the ore bed is better facilitated by increasing initial inoculum-ore
contacting, as in agglomerated and submerged studies. In addition, agglomerating with
inoculum may enhance microbial colonisation of larger heaps as a result of the lower initial
dispersion rates followed by increased tracer transport from the mineral surface as observed
for the chemical tracer.
References
161

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[1]. D.W. Kappes, Precious metal heap leach design and practice, 2002, Kappes, Cassiday
& Associates: Reno, Nevada.
[2]. S.C. Bouffard: Miner. Process Extr. M. Vol. 26 (2005), p. 233.
[3]. E. Govender, C.G. Bryan, S.T.L. Harrison: Miner. Eng. Vol. 48 (2013), p. 108.
[4]. E. Govender, C.G. Bryan, S.T.L. Harrison: Miner. Eng. Vol. (2015), p. accepted.
[5]. K.C. Marshall: Interfaces in microbial ecology, (Harvard University Press, Cambridge,
Massachusetts 1976).
[6]. S.C. Bouffard, D.G. Dixon: Metall. Mater. Trans. B. Vol. 32 (2001), p. 763.
[7]. N. Tufenkji: Adv. Water. Resour. Vol. 30 (2007), p. 1455.
[8]. E. Govender, A. Kotsiopoulos, C.G. Bryan, S.T.L. Harrison: unpublished.
[9]. E. Govender, C.G. Bryan, S.T.L. Harrison: Biochem. Eng. J. Vol. 95 (2015), p. 86.

162

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Bioreactor Process Optimization for Bioleaching of Fine-Grained


Residues from Copper Smelting
Cindy Klink1, a, Juliane Heim1, b, Birgit Daus2, Sebastian Eisen1, c, Michael
Schlmann1, d and Simone Schopf1, e *
1Institute

of Biosciences, Department Environmental Microbiology, TU Bergakademie


Freiberg, Leipziger Strasse 29, 09599 Freiberg, Germany
2Department of Analytics, Helmholtz Center for Environmental Research,
Permoserstr. 15, 04318 Leipzig, Germany
acindy-klink@web.de, bjuliane.heim@ioez.tu-freiberg.de, 2birgit.daus@ufz.de,
csebastian.eisen@ioez.tu-freiberg.de, dmichael.schloemann@ioez.tu-freiberg.de,*,
ecorrespondence: simone.schopf@ioez.tu-freiberg.de

Keywords: strategic elements, fly ashes, acidophiles, bioleaching.


Abstract. Theisen sludge, a fine-grained by-product from copper smelting is a secondary
resource for the winning of strategic elements by metal-oxidizing acidophilic bacteria.
Screening for cultures, that grew in presence of the toxic heavy metals containing fly ash was
successfully performed. Small scale experiments in shaking flasks with subsequent analysis
of the pregnant leaching solution (PLS) revealed biological extraction of the major (zinc and
copper) and minor metals (cobalt and rhenium). Results were confirmed by XRF analyses of
the leaching residue. The bioleaching approach was up-scaled in stirred tank bioreactors
under controlled conditions. Optimization of metal-extraction rates will be achieved by
regulation of process-parameters, predominantly the redox-potential.
Introduction
High-tech products nowadays often contain an increasing number of elements, some of
them in trace concentrations in corresponding alloys. Due to this fact and to politically
controlled markets, the price of some elements is steadily increasing which raises the
question, whether these elements can be obtained from complex ores or secondary resource in
Germany. Among the elements of interest are germanium (e. g. for infrared optics), rhenium
(e. g. for alloys in aircraft engines), vanadium (for durable steels), and antimony (for various
alloys). All these elements occur in Theisen sludge, a fine-grained by-product from copper
smelting with high toxicity. It is estimated that 220000 tons of Theisen sludge have been
deposited in a central pond in the Mansfeld area in Germay until mining activities have been
stopped in the 1990s. Due to high contents of heavy metals and toxic organic compounds [1]
Theisen sludge is an enormous threat to the environment. Bio-hydrometallugy can offer a
solution to meet the twin objectives of resource recycling and pollution reduction. The
microbial treatment of Theisen sludge has advantages to be more environmental friendly and
cost effective due to the use of naturally occurring biocatalysts [2]. Sulphide minerals, which
are the main mineral phases in Theisen sludge are applicable to bioleaching [3].

163

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Experimental setup
Screening for bacteria. Water samples from a mine water treatment plant were inoculated
in different acidic liquid media and growth was controlled via light microscopy. After growth
occurred, the cultures were transferred into fresh medium containing thyndalized Theisen
sludge. Cultures were identified by DNA-fingerprinting (T-RFLP).
Small scale experiments. Experiments in small scale were performed in buffled flask at
30C under shaking with a pulp density of 1% thyndalized Theisen sludge. PLS was analyzed
by ion chromatography, ICP-MS, and ICP-OES, the leaching residue by XRF.
Bioreactor experiments. Bioleaching in stirred tank bioreactors (Labfors 5) was
performed at 30C with online-measurement of pH, redox-potential and dissolved oxygen.
The process parameters were controlled by regular external measurement.
Results
Mineralogy. According to literature [1], the main mineral phases in Theisen sludge are
wurtzite (19.5%), sphalerite (15.5%) and galena (7.0%). This has been confirmed by XRF
analyses of the fly ash, showing that zinc, sulfur and lead are major elements (data not
shown).
Bioleaching in small scale. 9K [4] medium containing 25 mM ferrous sulfate supported
growth of Theisen sludge leaching acidophilic bacteria best, resulting in a mixed species
culture comprising Acidithiobacillus and Acidiphilium (referred to as Nochten 2).
Furthermore, A. ferrooxidans Ram 6F was applied to bioleaching in shaking flasks. In biotic
tests a zinc extraction rate of 75 % was achieved after three weeks of incubation, whereas in
abiotic sterile controls without addition of ferrous no zinc was recovered (Fig. 1).
80

zinc extraction [ %]

60
40
20
0
0

10

15

20

time [d]

25

Figure 1. Zinc extraction in


shaking flasks with a solid
loading rate of 1% Theisen
sludge. Biotic samples were
inoculated
with
A. ferrooxidans Ram 6F
() and Nochten 2 ().
Abiotic controls comprises
thyndalized Theisen sludge
with () and without
25 mM ferrous sulfate ()
and
non-thyndalized
material with 25 mM ferrous
sulfate ().

In the non-thyndalized sample with ferrous sulfate added growth occurred directly from
Theisen sludge, explaining zinc extraction as shown in Fig. 1. Diversity analyses revealed the
presence of Acidithiobacillus (referred to as Helbra18 strain). Zinc extraction from the abiotic
control with thyndalized fly ash (+ferrous sulfate) was a result of chemical leaching due to
164

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
relatively high initial pH
of 4.5 after suspension
of Theisen sludge (Fig.
5
2).
Under
those
condition ferrous iron is
not stable and oxidizes
4
spontaneously to ferric,
which acts as strong
3
oxidant [3].
Figure 2. Developement
2
of pH during
0
5
10
15
20
25
bioleaching of Theisen
time [d]
sludge in shaking flasks.
Biotic samples were inoculated with A. ferrooxidans Ram 6F () and Nochten 2 ().
Abiotic controls comprises thyndalized Theisen sludge with () and without 25 mM
ferrous sulfate () and non-thyndalized material with 25 mM ferrous sulfate ().
pH

In the biotic samples significantly higher amounts of major metals (zinc, copper) and
target elements (cobalt, rhenium) were in solution compared to the abiotic approach without
addition of ferrous sulfate (Tab. 1). As aforementioned, leaching in the control with ferrous
sulfate was chemically due to the starting pH.
Table 1. Analyses of the PLS after bioleaching of Theisen sludge in shaking flasks.

Mo [mg/]
S [mg/]
Zn [mg/]
Fe [mg/]
Cu [mg/]
Mn [mg/]
Pb [mg/]
As [mg/]
Sb [mg/]
Co [g/]
Ge [g/]
Re [g/]
Ag [g/]

A. ferrooxidans
Ram 6F
<0.06
2168
1710
121
53
3.5
2.90
1.0
0.60
0.50
0.25
0.20
0.001

Thyndalized
+Fe(II)
<0.06
1760
1285
73.5
28.5
3.00
2.70
2.00
1.45
0.40
0.30
0.15
0.001

Nochten 2
<0.06
1950
1640
154
53.5
3.40
2.90
1.20
0.60
0.50
0.25
0.20
0,001

165

Thyndalized
-Fe(II)
0.12
1090
140
0.04
<0.05
0.80
0.50
11,0
2.50
0.15
0.20
0.10
<3.310-4

Method
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-MS
ICP-MS
ICP-MS
ICP-MS

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Interestingly, after leaching dissolved antimony was less in biotic samples compared to the
abiotic sample without ferrous sulfate. This indicates co-precipitation of antimony with iron,
which is emphasized by analysis of the leaching residue (data not shown). In all samples the
dominating species are pentavalent antimony ions (data not shown). The adsorption behavior
of pentavalent antimony to iron oxyhydroxides has been described elsewhere [5]. In case of
arsenic, the dominant ions are trivalent, which co-precipitate with ferric minerals, too [6,7].

Up-scaling in bioreactors. Two stirred tank bioreactors with a pulp density of 4%


Theisen sludge were inoculated with adapted cultures determined in the small scale
experiments. Non-inoculated medium with addition of ferrous iron and thyndalized fly ash
served as abiotic control in the third reactor. An increase of the redox potential within 15
days and decrease of the pH in the same period (data not shown) indicated a more rapid
dissolution of minerals in comparison to bioleaching in shaking flasks. Compared to the
abiotic control dissolution of zinc, copper, antimony, cobalt, germanium, and rhenium was
significantly higher in the biotic samples (Tab. 2). Additionally, the adapted enrichment
culture Nochten 2 had a greater potential of metal-extraction from Theisen sludge than the A.
ferrooxidans Ram 6F pure culture.
Table 2. Analyses of the PLS after bioleaching of Theisen sludge in bioreactors.

Zn [mg/L]
S [mg/L]
Cu [mg/L]
Sb [mg/L]
Mn [mg/L]
Pb [mg/L]
As [mg/L]
Mo [g/L]
Co [g/L]
Ge [g/L]
Re [g/L]

A. ferrooxidans
Ram 6F
1.900
2.550
20
6.30
6.10
2.95
1.5
10
790
380
260

Nochten
2
3.150
2.900
61.5
7.60
7.20
2.90
1.9
18
990
440
390

Abiotic
control
1.530
1.900
0.45
1.20
5.0
2.80
0.30
6
640
90
220

Method
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-OES
ICP-MS
ICP-MS
ICP-MS
ICP-MS

Conclusion
Bioleaching of fine-grained fly ashes with metal-oxidizing bacteria under acidic
conditions is possible although Theisen sludge contains remarkable amounts of toxic
compounds. Bioleaching experiments have been established in shaking flask and successfully
up-scaled to 2L stirred tank bioreactor operation, resulting in faster metal recovery with an
adapted mixed species culture. Nevertheless, the process needs to be optimized further in
terms of recovery rates. Therefore, studies are in progress comprising i) the characterization
166

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
of the Helbra 18 strain, ii) the control of the redox potential via dissolved oxygen and, iii)
continuous mode operation in a cascade bioreactor.
References
[1] H. Weiss, M. Morency, K. Freyer, J. Bourne, D, Fontaine, M. Mder, P. Morgenstern, P.
Popp, H.C. Treutler and R. Wennrich: Physical and chemical characterization of the
Theisenschlamm slurry, a complex contaminated scrubber dust from copper smelting.
Sci. Tot. Environment Vol. 203 (1997), p. 65
[2] J.L. Lee and B.B. Pandey: Bio-processing of solid wastes and secondary resources for
metal extraction A review. Waste Management Vol. 32 (2012), p. 3
[3] T. Rohwerder, T. Gehrke, K. Kinzler and W. Sand: Bioleaching review part A: Progress
in bioleaching: fundamentals and mechanisms of bacterial metal sulfide oxidation. Appl.
Microbiol. Biotechnol Vol. 63 (2003), p. 239
[4] M.P. Silverman and D.G. Lundgreen: Studies on the chemoautotrophic iron bacterium
Ferrobacillus ferrooxidans. I. An improved medium and harvesting procedure for
securing high cell yields. J. Bacteriol Vol. 77 (1959), p. 642
[5] Y.M. Nakamaru and J. Altansuvd: Speciation and bioavailability of selenium and antimony in non-flooded
and wetland soils: A review. Chemosphere Vol. 111 (2014), p. 366

[6] S. Paikaray, J. Gttlicher and S. Pfeiffer: Removal of As(III) from acidic waters using
schwertmannite: surface speciation and effect of synthesis pathway. Chem. Geol Vol.
283 (2011), p. 134
[7] S. Regenspurg and S. Pfeiffer: Arsenate and chromate incorporation in schwertmannite.
Appl. Geochem Vol. 20 (2005), p. 1226

167

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Microstructure Evolution of Ore Particles during Bioleaching Based


on
X-Ray Micro-Computed Tomography Images
Bao-hua Yang1,2*, Ai-xiang Wu2, Xiu-xiu Miao2Hong-bing Liu1
1Information

2Civil

Science and Engineering School, Hunan International Economics


University, Changsha 410205, China.

and Environment Engineering School, University of Science and Technology


Beijing, Beijing 100083, China.
*correspondence: yangbaohuar2004@126.com

Keywords: ore particle, microstructure, bioleaching, micro-computed tomography,


3D image analysis.
Abstract. Microstructure of ore particle has significant influence on the efficiency of bioheap leaching, because it affects such processes as microscale fluid flow, mass diffusivity,
bacteria growth, chemical reaction, etc. The micropores and microcracks in ore particles
evolve continuously during bioleaching. To obtain crucial quantitative information on
structural evolutions, non-destructive techniques become necessary. In this study, a
cylindrical ore sample of 5mm diameter was scanned with X-ray micro-CT before and after
bioleaching test. The sample is mixed ore that composed of oxide copper and sulfide copper.
By using an in-house developed image analysis program based on MATLAB, 3D information
about the total porosity, the pore size distribution, the pore connectivity, and the pore fractal
dimension of the ore sample before and after bioleaching were calculated and analyzed. The
results obtained in this study are promising for a better understanding of microstructure
evolution mechanisms on ore particles during bioleaching. Results also show that 3-D image
analysis is a powerful technique to characterize the morphological, structural and topological
differences due to bioleaching.
Introduction
The physical and chemical properties of bio-heap leaching systems are influenced by the
micro-pore structure of ore particles. The micro pore structure affects mass transfer, which
leads to the change of leaching characteristics, on the other hand, affects the strength of ore
particles, which may cause the inner spatial structure of ore particles to change. During the
process of bio-heap leaching, solution percolates in the micro-pores. The property parameters
of micro-pores, such as morphology and structure, influence the diffusion and percolation of
solution into ore particles, and the transport and deposition of bacteria as well. As a result, the
leaching speed and leaching ratio are affected significantly. So it is very important to
investigate the micro-pore structure of ore particles so as to understand the leaching
mechanism.
Ore particles are discontinuous, inhomogeneous, and anisotropic. Since the distribution of
micro-scale pores and fractures in ore particles are complex and random, common
168

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
microscopy cannot meet the requirement of detecting depth. Recently, with the microcomputed tomography being used widely in many research fields, some researchers began to
use this technology to explore the micro-scale pores and fractures of ore particles during heap
leaching and have made some progress[1-4]. However, there are still some problems. The
first is that the resolution of micro-CT scanners used in some research work is too low, the
second is that the parameters of pore structure are not quantified completely, and the last one
that the principles by which micro-pores evolve during leaching are not yet well understood.
So there is much work that needs to be done in many respects.
In this study, a high resolution micro-CT scanner was used to explore the inner pore
structure of mixed copper ore sample during bioleaching. 3D information about the total
porosity, the pore size distribution, the pore connectivity and the pore fractal dimension of the
sample were calculated by using 3D image analysis. Based on this, the evolvement of inner
pore structure of ore particles are explored further. This study will provide important
reference basis for the quantitative description of the change of pore structure in single ore
particle caused by the leaching activity.
Experimental
Ore sample. The ore comes from a copper mines in Yunnan province in China. It is a
mixed copper ore, including chalcopyrite, pyrite, limonite, malachite, chrysocolla, gangue
minerals and a small amount of native copper.
CT scanner. The high resolution micro CT scanner used to detect the inner pore structure
in this study comes from the CT Laboratory of Taiyuan University of Technology in China.
The CT scanning system can conduct three dimensional analyses for different metal or
nonmetal materials. Its magnification is from 1 to 400 times. The highest spatial resolution
can reach 0.485 m.
Experiment. The ore sample is cylindrical. Its diameter is 5mm and its length is 5mm.
Before the leaching experiment, the sample was scanned for the first time. By adjusting the
system repeatedly, the magnification was confirmed as 40 times and the spatial resolution
was 4.85 m. So the size more than 4.85 m can be distinguished. After scanning, 1500
sectional images with a thickness of of 4.85 m were obtained. After the first scanning, the
ore sample was put into a flask with dilute sulphuric acid solution for leaching 60 days. The
pH value was maintained as 2. Then the solution was added bacteria and the leaching
processed for another 60 days. The used bacterium was Acidithiobacillus ferrooxidans. Its
concentration was 7.7107 bacteria per millilitre. The ore sample was scanned for the second
time after the end of bioleaching with the same scanning parameters and position. The size of
each sectional image is 20412041 pixels. Fig. 1 shows one of the original sectional images.
(a)

(b)

Figure 1. 2D sectional images of the ore sample before and after bioleaching.
169

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
(a) before bioleaching; (b) after bioleaching.
Results and discussion
Image pre-processing and 3D reconstruction. All of the original CT images were
preprocessed to eliminate the noise and enhance image feature, including the following
procedures: (1) Cropping. Each original CT images was cropped into a new square image,
with the size of 600600 pixels; (2) Enhancing. The cropped images were filtered so as to
make the image information clearer; (3) Segmentation. With a suitable threshold value
obtained by using the Otsu method, the filtered images were segmented to binary images,
only including pore matrix and solid matrix. After image pre-processing, the sectional images
were reconstructed into a three dimensional volume before and after leaching, shown in Fig.
2. The size of the volume is 600600600 pixels, and its real size is 2.912.912.91 mm3.
With this 3D volume, porosity, pore size distribution, pore connectivity degree, and fractal
dimension were calculated and analysed [5].
3D porosity analysis before and after bioleaching. 3D porosity is defined as the ratio of
the number of voxels occupied by pores and the total voxels of the reconstructed 3D volume.
Before bioleaching, the porosity was 6.25%, while it became 6.63% after bioleaching. The
volume porosity increased by 6.08% after leaching process.
(a)
(b)

Figure 2. 3D volumetric reconstruction of ore samples before and after bioleaching.


(a) before bioleaching; (b) after bioleaching.
3D pore size distribution analyses. 3D pore size was characterized by equivalent
diameter, namely the diameter of the maximum inscribed sphere of each pore. Fig. 3 shows
the pore size distribution of the ore sample before and after bioleaching. The smallest pore
diameter is 29.1m. The largest pore diameter is 620.8 m (occupied too small amount, so
not shown in Figure 3). The amount of pores with diameter of 29.1m is 39.92% and 39.87%
respectively and the pores smaller than 97m occupied by 80.54% and 80.01% respectively
before and after leaching. It indicates the amount of small pores after bioleaching decreased a
little. With detailed data analysis, after leaching, the amount of pore ranges from 97m to
320m increased by 3.2% and the large pores with diameter larger than 582m increased by
57% than before leaching. Comprehensive analysis indicates that the pore size increased a
little during leaching process since the rate of large pores increased.

170

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

preleaching
postleaching

40

Frequency/%

35
30
25
20
15
10
5
0

50

100

150

200

250

300

Equivalent pore diameter/m

Figure 3. Pore size distributions of ore sample before and after bioleaching.
3D pore connectivity analyses. 3D pore connectivity degree is defined as the ratio of the
number of voxels of the pore paths connecting the up interface and the low interface of the
volume and the total voxels of the volume. In this study, for the calculation of connectivity
degree, the whole volume 600600600 pixels was divided into six layers firstly, and then
each layer was divided into 36 subdomains. The size of each one was 100100100 pixels.
The data of each subdomain was calculated, which then were composed of a 3D data set of
666. With this 3D set, the change of connectivity degree was investigated. The results
shows before bioleaching, the mean connectivity degree of the whole volume is 0.0324, while
after bioleaching, the mean connectivity degree of the whole volume is 0.0421, increased by
29.94% than before leaching. The main reason is that the size and amount of large pores
increased, which made the tortuosity of pore network decreased. Fig. 4 shows the change of
connectivity degree along the height of the sample. It can be seen that the pore connectivity
has spatial variation before and after bioleching.
preleaching
postleaching

Connectivity degree

0.08

0.06

0.04

0.02

0.00

100

200

300

400

500

600

Height (pixel)

Figure 4. The degree of pore connectivity of the ore sample.


3D pore fractal dimension analysis. There are several approaches for estimating fractal
dimension. One of the widely used techniques is box-counting approach based on image
analysis. It is proposed to assign the smallest number of boxes to cover the entire image at
each selected scales required. For two dimensional images, the square boxes were used[7-9].
For the three dimensional reconstructed volume in this study, cube boxes were need to
use[10,11]. By using Matlab software, the fractal dimension of the 3D reconstructed volume
171

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
of pore network before and after leaching were estimated. It was 2.7524 and 2.7692
respectively. The fractal dimension increased after bioleaching indicates that pore
morphology evolved continuously and the micro-scale pores distributed more complexly and
irregularly, since the corrosion of valuable components under the physical and chemical
reactions, such as dissolution, adsorption, desorption, oxidation, reduction, etc. It can be
known that pore fractal dimension can reflect the leaching degree of ore particles.
Conclusion
(1) High resolution micro-CT technology can collect the images of the pores in ore particles,
and 3D image analysis can help to characterize the pore structures quantitatively. The
combination of the two is an important approach to investigate bioleaching mechanism at
micro-scale.
(2) Micro-scale pore structure in ore particle evolves continuously during bioleaching.
Porosity, mean pore diameter, pore connectivity increased obviously. There occurred
some larger pores, so the pore size distributed more widely. Local connectivity improved
to some extent, but it was anisotropic in different directions.
(3) The pore fractal dimension increased after bioleaching significantly, which indicates that
pore morphology became more complex and irregular with the increase of leaching time.
References
[1]
[2]
[3]
[4]
[5]

Ghorbani Y, Becker M, Petersen J, et al., Minerals Engineering Vol. 24 (2011) 1249.


Nosrati A, Quast K, Xu D F, et al., Hydrometallurgy Vol.146 (2014) 29.
Garcia D, Lin C L, Miller J D, Minerals Engineering Vol. 22 (2009) 236.
Dhawan N, Safarzadeh M S, Miller J D, et al., Minerals Engineering Vol. 35 (2012) 75.
Yang B H, Wu A X, Miao X X, et al., Trans. Nonferrous Met. Soc. China Vol. 24 (2014)
833.
[6] Dathe A, Tarquis A M, Perrier E, Geoderma Vol.134 (2006) 318.
[7] Liu Y, Chen L Y, Wang H M, et al., Journal of Visual Communication and Image
Representation Vol. 25 (2014) 1102.
[8] Li J, Du Q, Sun C X, Pattern Recognition Vol. 42 (2009) 2460.
[9] Wu A X, Yang B H, Zhou X, Trans. Nonferrous Met. Soc. China Vol. 18 (2008) 1523.
[10] Mao L T, Lian X Y, Hao L N, Journal of China University of Mining & Technology Vol.
43 (2014) 1134.
[11] Yang Y C, Peng R D, Zhou H W, Journal of China University of Mining & Technology
Vol.38 (2009) 251.

172

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Biooxidation of a Gold-Arsenic Sulphide Concentrate by a TwoStage Oxidation Using Consecutively Acidophilic and Neutrophilic
Bacteria
A.Belyi.a, N. Solopova.b, V.Sekachev.c, A.Teleutov.d, A.Malashonok.i, G.
Krasilnikov.f
Polyus Research Center,
Tsymlyanskaya Str.

Krasnoyarsk,

Russia,

660061,

Krasnoyarsk,

37

a BelyiAV@polyusgold.com, b

SolopovaNV@polyusgold.com, c
SekachevVS@polyusgold.com, d TeleutovAN@polyusgold.com, i
MalashonokAP@polyusgold.com, f KrasilnikovGS@polyusgold.com,
+7 391 2191 358
Keywords: neutrophilic association of chemolithotrophic microorganisms, biooxidation, bio cake, sulphide minerals, elemental sulphur.
Abstract. This research work has developed a processing technology for full oxidation of the
biocake from gold-arsenic flotation concentrate with high pyrrhotite content by neutrophilic
association of microorganisms, which oxidiz elemental sulphur and antimony sulphide at a
high rate. Biocake, which is produced as a result of oxidizing the sulphides in the flotation
concentrate at pH 1,7 1,9 by acidophilic bacteria of chemolithotrophic microorganisms and
containing around 3%-5% of elemental sulphur, is then fully oxidized by association of
neutrophilic bacteria at 7,0-8,0.
Introduction
Microbiological oxidation of iron and elemental sulphur are two key processes of
biotechnology of metals. Oxidation kinetics of iron by bacteria is explored in more detailed
way, than oxidation kinetics of elemental sulphur[1]. Oxidation of elemental sulphur by the
bugs is quite a complicated issue, and it has two aspects: what impact do the bugs have on
this insoluble compound and how does the oxidation process occur. There are two basic
opinions regarding the impact of microorgaisms on sulphur [2]:
1. In order to oxidize sulphur the bacteria need to be in direct contact with its cells;
2. The sulphur is utilized by the bacteria after preliminary dissolution in lipidic components,
emitted in the environment.
Elemental sulphur and other intermediate sulphur compounds, residual in biocake,
interreact with cyanide within cyanide leaching, as a result rhodinides, resistant to oxidation,
appear, and it causes increase of cyanide consumption.
Therefore, one of the challenging issues in biohydrometallurgy of gold is reducing the
amount of sulphide and elemental sulphur in biocake of the mineral concentrates, because the
residual grade of elemental sulphur and underoxidized sulphide minerals influences gold
recovery rate and cyanide consumption.

173

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Experimental setup
In the present research work we consider staged biooxidation process. On the first stage of
the process the sulphides are oxidized within conventional acidic conditions - 1,7-1,9.
These conditions intensify iron-oxidizing bacteria, which first oxidize sulphide minerals with
accumulation of elemental sulphur. This microbial association is represented by three species
of moderately thermophilic chemolithotrophs: Sulfobacillus olympiadicus, Leptospirillum
ferrooxidans , and Ferroplasma acidiphilum present in proportions 60-80%, 10-20%, and 1017%, respectively [3, 4]. On the second stage the acid content in the slurry is increased up to
7,0-8,0 in order to oxidize antimony sulphides and elemental sulphur to the full rate with
special associations of neutrophilic and alcalophilic microorganisms, which intensively
oxidize sulphur in neutral and weakly alkaline conditions.
We have performed laboratory-scale and industrial-scale testwork of neutrophilic
association of microorganisms. Laboratory-scale testwork has been performed in laboratory
reactors in 3:1:1 circuit, temperature was 35 C, slurry density was 150g/l, nutrient salts were
added, aeration rate was 2 l/min. pH rate of the slurry was maintained at the level of 7.0-8.0
within the experiment. Process conditions were defined by physiological parameters:
concentration of biomass in the liquid phase of the slurry and oxidative activity of the cells of
microorganisms in the slurry. Concentration of biomass was defined by centrifuge method,
respirometric activity was defined by manometric method, according to oxygen consumption.
Moment of termination the experiment at certain feed rate was defined according to
stabilization of bacteria concentrate in the slurry liquid phase.
Industrial-scale testwork was performed in order to confirm laboratory-scale results
regarding reducing the amount of residual cumulative grade of sulphide and elemental
sulphur in biocake when utilizing neutrophilic association of microorganisms under certain
processing parameters, defined in the laboratory.
Results and discussions
Laboratory testwork. Polyus Research Center Laboratory of biotechnologies for
primary mineral products has developed and adapted the association of microorganisms that
is oxidizing sulphide and elemental sulphur in neutral culture conditions. The association
consist is the chemolithotrophic microorganism to Thermithiobacillus tepidarius, and
organotrophic microorganisms as Parapedobacter sp., Nocardioides nitrophenolicus, and
Nocardioides sp. This culture was developed in series of consequential subcultivations on the
bio-oxidised product of flotation concentrate by the culture of microorganisms, used at
Olimpiada gold-recovery plans (Table 1)
Table 1. Chemical composition of flotation concentrate and products of its biooxidation.
Samples
Au, g/t
Grade, % of mass
As
Sb
Fe
S total
S
S
Flotation
concentrate
Bio cake

sulph

sulph

sulph

110,0

7,37

7,35

28,5

24,2

20,9

3,17

115,0

1,0

5,5

1,5

13,3

2,1

5,5

174

sulph

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
When there is a stage of full oxidation of the concentrate in neutral conditions, the grade
of elemental sulphur in the cake is reduced in 2-3 times, at the same time consumption of
sodium cyanide is reduced in 50%.
In laboratory conditions we have defined biooxidation parameters of these culture
depending on the feed rate. The results of full oxidation of biocake by association of
neutrophilic microorganisms at the rate of 25, 42, 50, 58 ml/h and density of slurry 150 g/l
and process temperature 35C have demonstrated, that the most optimum processing
parameters are reached at42 ml/h feed flow rate:
- oxidation rate of antimony sulphides increases up to 56,65-88,69%,
- grade of elemental sulphur in biocake is reduced up to 1,7% mass.,
- consumption of sodium cyanide within CIL circuit is reduced in 50%.
Industrial-scale testwork. The works have been performed at experimental pilot plant at
Olimpiada Mine Site.
Table 2. Chemical composition of the feed for adaptive culture.
A
Grade, % of mass
u,
As
Sb
Fe
S
S
g/t
sulph
sulph
sulph
total
sulph
66
14,6
7,2
BIO feed
,9
0,92
1,79
4,34
0
2
0
Sample

S
1,9
6

The feed for adaptive culture was bio oxidized cake from operating circuits of BIO-1, 2, 3
from the centrifuging stages (table 2).
The testwork was carried out in the flowing mode in the 2,5 m3 reactors, with aeration and
mechanical agitation, agitation was performed with an impeller at the rate of 350 rmp. The
volume of slurry within the reactor was 2,0 m3. The feed rate within the testwork was 28 l/h.
Biocake, neutralized with lime milk ( 6,8 - 7,0), density 150 g/l and with nutrient salt
was fed to the feed reactors. Reactor feeding circuit is in Fig. 1. Bold arrows show the feed
of the reactors.

Figure 1. Feed reactor circuit.


As a result of applying neutral full oxidation of biocake the following results were achieved:
- reduction of Sb(S2-) grade from 1,79% to 0,47%;
- reduction of S grade from 1,96% to 0,30%;
- reduction of S(S2-) grade from 7,22% to 4,00% (Table 3).

175

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Table 3. Chemical composition of the product, biooxidised by the neutrophilic association.


Sample
A
Grade, % of mass
u,
As
Sb
Fe
S
S
S
g/t
sulph
sulph
sulph
total
sulph
62
Biocake sample
12,5
4,5
0,4
,1
0,59
1,04
3,04
R-1
0
5
1
0
Biocake sample
64
0,55
0,52
4,32
12,5
4,6
0,4
62
R-2
,1
012,2
84,2
40,5
Biocake sample
,1
0,48
0,90
2,63
0
R-3
0
8
2
0
61
Biocake sample
11,6
4,0
0,4
,3
0,41
0,49
2,13
R-4
0
7
4
0
61
Biocake sample
13,1
4,0
0,3
,4
0,61
0,47
2,11
R-5
0
0
0
0

AU recovery, %. NaCN consumption, kg/t

The results of research work about impact of biocake leaching period on the gold recovery
rate from biocake and cyanide consumption are shown on Fig. 2. When leaching time is 20h.,
gold recovery is 91,58%, and cyanide consumption - 18,2 kg/t. When leaching time is
extended up to 48h., gold recovery is 91,75%, and cyanide consumption - 29,7 kg/t.

Neutrophilic association
110
100
90
80
70
60
50
40
30
20
10
0
0

10

20

30

40

50

Time, h
CIL Au Recovery, %

60

Figure 2. Gold
recovery
and
cyanide
consumption
within CIL of
biocake, oxidised
with neutrophilic
association
of
microorganisms
depending on the
duration of the
process.

NaCN consumption, kg/t

Full oxidation of biocake by association of neutrophilic microorganisms within the


operating production allows to reduce CIL residence time to 20h and reduce cyanide
176

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
consumption to approximate rate of 20 kg/t. At the same time, multiple testworks have
demonstrated, that gold recovery rate is increased in 1,0 1,5%.
Conclusions
The technology developed for processing flotation concentrate of gold-arsenic ores with
high grade of pyrrhotite allows to reduce the grade of elemental sulphur in biocake from 3%5% to 0,3%-0,5%, and reduce the amount of antimony sulphides to 1,0%. At the same time
the CIL residence time is reduce to 20h., cyanide consumption is reduced in 50%, and gold
recovery rate is increased in 1,0 1,5%.
References
[1] Processing of gold-bearing ores using bioleaching under Far North conditions / V.K.
Sovmen, V.N. Guskov, A.V. Belyi et al Novosibirsk: Nauka, 2007. 144 p.
[2] Information on http://aem.asm.org/content/67/7/2873.full
[3] V.K. Sovmen, G.I. Karavaiko, T.F. Kondrateva, V.N., T.A. Pivovarova, A.V. Belyi,
T.V. Lipatova, A.A. Gish RU Patent 2332445 (2006).
[4] V.K. Sovmen, V.N. Guskov, A.V. Belyi, T.V. Lipatova, T.F. Kondrateva, A.A. Gish
RU Patent 2346063 (2007).

177

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Blue-Copper Proteins: Expression of Coding Genes from


Sulfobacillus Spp. and Iron Oxidation in Column Bioleaching Tests
Mauricio Acosta1, 4, Pedro A. Galleguillos2, 1, Sabrina Marn1, Clement
Chibwana3, Hannes Strauss3, Cecilia Demergasso1, 2
1Centro

de Biotecnologa Universidad Catlica del Norte, Av Angamos 0610,


Antofagasta, Chile.
2Centro Cientfico y Tecnolgico para la Minera (CICITEM), Av Jos Miguel Carrera
1701, 4 piso Antofagasta, Chile.
3BHP Billiton, Antofagasta, Chile.
4Facultad de Ciencias de la Salud, Universidad de Antofagasta, Av Universidad de
Antofagasta 02800, Antofagasta, Chile.
Keywords: iron oxidation, cupredoxin, sulfobacillus, RNA seq.
Abstract. In bioleaching, the chemiolithotrophic community plays an important role as
oxidizers of sulfur compounds and ferrous iron. Ferrous iron oxiding microorganisms are key
players in the process, as ferric iron is absolutely required to solubilize metal sulfide ores.
Members of the Sulfobacillus genus (able to oxidize ferrous iron) were predominant (22 95%) in a chalcopyrite bioleaching columns test. In order to obtain new insight about the
mechanism of iron oxidation in Sulfobacillus we investigated the presence and expression of
genes potentially related to iron oxidation by Sulfobacillus, especially the group of the socalled blue-copper proteins rusticyanin (rus) and sulfocyanin (soxE) in the course of the
experiment. The physicochemical parameters and the population dynamics were monitored
periodically in the columns and the metatranscriptome was analyzed by using pyrosequencing. The average temperature inside the column ranged from 22 to 57 C and the
Fe(II) oxidation rate at 45 C varied between 8 and 42 mg L-1h-1 along 300 days of operation.
The metatranscriptomic analysis reveals an over-expression of 9-13 folds of the putative rus
and soxE genes in four strains of Sulfobacillus spp. when the Sulfobacillus proportion in the
column was > 80% and the Fe(II) oxidation rate measured at 45 C reached 10 mg L-1h-1.
Some cytochromes from the electron transport chain were also over-expressed, on a range of
7 - 10 folds under those operational conditions. These results support the hypothetical
participation of blue-copper proteins in the iron oxidation pathway of Sulfobacilli. Culture
assays and more specific expression analysis are necessary in order to confirm this
hypothesis. In addition, we attempt to establish the relationship between rusticyanin and
sulfocyanin genes and perform a protein sequence analysis that allows us to infer the actual
function of these proteins in Sulfobacillus species.
Introduction
Microorganisms show a great ability to harvest energy from substrates usually inaccessible to
others living forms. Some of them are lithotrophic iron oxidizers, meaning that they are able
to extract energy and reducing power by oxidizing Fe2+ and reducing O2 to H2O. This energy
pathway requires a proton motive force (PMF) across the cytoplasmic membrane to generate
ATP, by coupling a reverse ATP synthase, and to energize other cellular machinery like
transporters and flagella [1]. Also, the PMF is used to drive some electrons against the redox
178

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
potential to generate the reductive power (NAD+) necessary for CO2 or N2 fixation [2, 3].
Numerous works investigated the ferrous iron oxidation pathway in Acidithiobacillus
ferrooxidans [4] and, recently, some research reported similar mechanisms in Sulfolobus
acidocaldarius and other archaea [5, 6, 7]. The participation of rusticyanin in the Fe2+
oxidation pathway of At. ferrooxidans is well documented and appears to be the traffic
controller of electron flux to feed the uphill or downhill pathways [4, 8]. In recent years,
SoxM supercomplex, a component of the archaeal respiratory chain, was discovered in Sl.
acidocaldarius and later works showed that the component SoxE, a sulfocyanin, could
participate in the electron transport like the rusticyanin [6, 9]. From these electron transport
chains, sulfocyanin and rusticyanin (Rus/SoxE) emerges as a common element. Both are
members of the cupredoxin superfamily and contain a copper binding site type 1 (His-xn-Cysx4-His-x4-Met) with a characteristic -barrel structure (Fig. 1) [10]. In the case of Rus/SoxE,
they have characteristically only one domain and their molecular weight range between 10 to
20 kDa.
In the past few years, it was thought that the community of microorganisms involved in the
bioleaching of copper was, predominantly, constituted by Acidithiobacilli and Leptospirilli.
Now, the overall picture of microbial community show a higher diversity, thanks to the
arduous work of many research groups and the availability of new molecular techniques like
real time PCR, microarrays and, most recently, the arrival of high throughput sequencing
DNA techniques. One of the newcomers are the Sulfobacilli, they are moderate
thermophiles Gram-positive microorganisms able to oxidize Fe2+ and sulfur reduced
compounds [12]. Even though they are able to fix CO2 still require yeast extract as growth
supplement in laboratory cultures [13]. Sulfobacilli are particularly frequent in operations or
bioleaching test with temperatures above 40C [14].
With the aim to add more insights in to the energy metabolisms of the Sulfobacillus genera,
we analysed the expression of genes possibly related to the aerobic ferrous iron oxidation.
For this purpose the microbial community gene expression in a bioleaching column test was
studied by RNAseq. More detailed information about the column test are available in Marin
et al [15].
Figure 1. The Cu-binding site structure of
rusticyanin (pdb code: 1CUR) from At.
ferrooxidans [11]. Note the characteristic barrel conformation of blue copper proteins and,
in the amplified section, the components of type
1 copper binding site are indicated (HCHM).
The graphical representation was made with the
SPDB software [17].

179

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Methods
Bioleaching column and samples. Three samples were collected at different times for
population and transcriptional analyses from BHP-Billiton SIMCOL ore bioleaching tests
[15].
RNA sequencing. The RNA purification was performed as described previously [16].
Molecular Research LP staff (Shallowater, TX 79363) performed the RNA-seq library
preparation and sequencing. The RNA-seq libraries were prepared for samples from three
different times (days 49, 90 and 210), and sequenced on the Illumina MiSeq in two lanes to
give 100 + 100 paired-end reads.
RNAseq analysis. The raw sequences reads were cleaned by discarding the adaptor
sequences and low-quality reads and filtering the reads with an unknown nucleotide
percentage greater than 5%. The mapping of the cleaned reads onto selected microbial
genomes using the RNA seq tools of CLC Genome Workbench (Qiagen) platform was
performed.
Other bioinformatics analyses. Multiple sequence alignment of proteins was carried using
MUSCLE application [18] in CLC Genome Workbench 8.0 (Qiagen). The secondary
structure was predicted from protein alignments with Ali2D [19].
Results and Discussion
The relations between the members of cupredoxin superfamily are difficult to infer by
sequence based analysis as their identity is as low as 10% [20]. However, by using secondary
and, when is possible, three dimensional structure analysis, tenuous evidence of their
relationships emerges [21] (Fig. 2). The recent advances in genome sequences of Sulfobacilli
allow the systematic inquiry of the metabolic possibilities of the newcomer in the bioleaching
acidophilic community of microorganisms. The analysis of Sulfobacilli genomes available at
NCBI database showed the presence of coding sequences for Rus/SoxE like proteins. The
comparative analysis and secondary structure prediction (Fig. 2), reinforce the possibility that
the Sulfobacilli have functional Rus/SoxE among other members of the cupredoxin
superfamily.
.......................................H....................................................C....H....M
Thvolc
(BAB60619)
VSVHFIVINVDT-DSYHNFAIS[-]NRGPPYPYMVGMMG[15]DLYAYSEFN[]YTFSS[1]GDYWYLCTYPGHAENGMYGEIIV
Thacid
(CAC12623)
VTVHFVVVNIDTDSE-HNFVLS[-]TRGPPYPYMSGME-[18]T-NSGHFY[3]FSYAF[3]GTYWYLCTYPGHAENGMYGKIVV
Tprospe
(ACD03845)
KKVTISVINTNGGAE-HSFMIT[3]PPYSAMPNPSSLHA[12]GQFNTDTVE[]WTPPG[1]GTYYYLCKTPGHASTGMHGKIVV
Atf
(BAC22704)
ATVDITFINTNKGFG-HSLDIT[-]KKGPPYAVMPVINP[15]F--GYTDFT[-]WRPAA[]GTYYYVCQIPGHAATGMFGKIVV
Atf
(ACK80662)
ATVDVTFINTNKGFG-HSFDIT[-]KKGPPYAVMPVIDP[17]----YTDFT[-]WHPTA[]GTYYYVCQIPGHAATGMFGKIVV
Afevo
(AEM47988)
ATVDVTFINTNKGFG-HSFDIT[-]QKTPPFAVMPVIDP[18]T-----NFT[-]WHPTA[]GTYYYVCQIPGHAATGMFGKIIV
Sther_AT-1
2311
AQITVDLVNADQGYM-HGFEVT[-]TARPPFREMAMMQG[21]H--RSTQ--[]FTATK[1]GTYSYICPVPGHAAQGMAGRFVV
Sther
AMDSBA5
703
AQITVDLVNADQGYM-HGFEVT[-]TARPPFREMAMMQG[19]Q--FHRSTQ[]FTATK[1]GTYSYICPVPGHAAQGMAGQFVV
Desul
(EGW39055)
AKVTMELINEDTGMP-HGVELT[-]TAPPPYYYMAMMQG[16]NQYPSAQVS[]FTTSD[1]GQFYYICQYPGHAAKGMYGKIII
Dacid
(AFM42769)
AKVTMELINEDTGMP-HGVELT[-]AAPPPYAYMSMMQG[16]NQYPSAQVS[]FTASN[1]GEFYYLCQYPGHAAKGMYGKIII
Cmaqui
(ABW02752)
ATVKITVLDVSV-LP-HSFGLV[-]SKGPPYSASITPDQ[21]A-SSSSIS[3]IEFNA[3]GVYWYICFVPGHAASGMYGKFIV
Slosol
(NP_343834)
WNVMIILTNEQS-IP-HNANIV[3]TQIPNNPNISADGK[21]T--AVGILD[-]-NISA[]GYYWIACGITGHAKNGMWADLIV
Slotok
(NP_375952)
WNLYITFINQQS-LP-HNLNLV[3]TSTPNSANIADDGK[21]S--ASGLYT[-]-DIPA[]GIYWLCCGIAGHAESGMWVVLVA
Msedu
(YP_001190424)
YNVEVEFTNQES-LQ-HNLLLV[3]TATPNAADLASDGK[19]G--QTALGV[]YGPMA[1]GTYWLACGISGHAESGMWVNLVV

180

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Mcupri
(YP_004410335)
]IGFLN[4]GTYWLACGISGHAESGMWVNLIV
Slosol
(NP_344287)
]WGPLS[1]GTYMLVCGILGHAQSGMWAVVIV
Sloacid
(Q53765)
]WGPIS[1]GDYMLVCGILGHAASGMWAVLVA
Achos
(YP_004459045)
]GYYWFACGYEDHAESGMWGVIEC
Slotok
(NP_378394)
]GYYWFCCGIAGHAVAGMWGVIIV
Aliaci
(WP_014465392)
]FTASR[1]GNFALVCAVPGHALAGMWDKLVV
Sbene
AMDSBA4
]FTPTT[1]GPYRIACLFPGHLQIGMYIDLKV
Sther
(WP_020373222)
]FVTPN[2]RHYRLACLRPGHLGYGMYLDLNV

DNIEIKFTNQES-LQ-HNVLLV[3]TPTPNAADLASDGK[16]I--SSGQSA[WSVYVKFVNEQS-LP-HNLILL[3]TATPSNPDVGQFGK[19]G--QSDSGL[STVIVKFINQES-LP-HNLVLL[3]TPTPQSPEISSDGK[19]G--ASAEGV[WKVCVIYTNFEP-ID-HNFIIV[5]VPSCSIIPSSNIIL[16]GASATGSIV[-]LSP--[WTVIVYFTNEESGLP-HNLLIV[3]TATPNSSDVGNDGK[21]--SASGSIT[-]LQP--[WRVQIHFRNASF-TP-HSAMVV[2]GDYDRGSFDSSLLA[15]G--AAENVE[YKVTVNFKNNAS-IP-HSAAII[-]------GPTGTGQT[18]G--GTATFS[TRVTVTFINNAPHQF-HSLALI[-]------GPHGLSAR[18]H--SHAIFT[-

Figure 2. Partial view of blue copper proteins rusticyanin/sulfocyanin present in bacteria and
archaea. On the top, the residues that conform the copper binding site type 1 are indicated.
Gray areas correspond to beta sheet and black areas to alpha helix, residues that conform the
T1 copper binding site (HCHM) are indicated. The brackets show the sites where the
sequence was shortened. Accession numbers are in parentheses. Some Sulfobacilli sequences
were not in the NBCI nr database but are available upon request.

Figure 3. Expression
levels of genes possibly
implicated in ferrous iron
oxidation in Sulfobacilli
identified by RNAseq.
Level expression of
cytochromes
and
sulfocyanin/ rusticyanin
genes
(noted
as
cupredoxins)
was
calculated as the Log2 of
the RPKM. Samples were evaluated at 49, 90 and 210 days of the column operation.

When the temperature inside the bioleaching columns increased over 40 C, on day 79 of
operation, the Sulfobacilli growth (IMCOMPLETE) and it was possible to note the
transcription of genes related to energy metabolism in bacteria and those for Rus/SoxE like
proteins (Fig. 3). Recently, it was found that a gene coding for a sulfocyanin was
overexpressed when Sb. thermosulfidooxidans ST was grown on ferrous sulfate [11].
Although there exist some differences, ours results support the hypothesis of Gou and
coworkers [11].
Conclusion
In this work we showed that Sulfobacilli have the genetic elements for ferrous iron oxidation
metabolism similar to those described for At. ferrooxidans, and those elements are actively
transcribed during growth on copper sulfide ore. The analysis of the proteins sequences
showed that both Rus/SoxE are probably members of the same family. More research is still
181

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
necessary to solve which of the Sulfobacilli proteins participate in the ferrous iron oxidation
and if, similarly to the rusticyanin of At. ferrooxidans, they also control the electron flow.
Acknowledgement
Part of this work was financed by FONDEF project IT13I20042 and INNOVA project 08
CM0 03.
References
[1]

L.J. Bird, V. Bonnefoy, D.K Newman, Bioenergetic challenges of microbial iron


metabolisms. Trends Microbiol. 19 (2011) 330-340.
[2] W.J. Ingledew, Thiobacillus ferrooxidans. The bioenergetics of an acidophilic
chemolithotroph. Biochim. Biophys. Acta. 683 (1982) 89117.
[3] S.J. Ferguson, W.J. Ingledew, Energetic problems faced by micro-organisms growing
or surviving on parsimonious energy sources and at acidic pH: I. Acidithiobacillus
ferrooxidans as a paradigm. Biochim. Biophys. Acta 1777 (2008) 1471-1479.
[4] M.T. Giudici-Orticoni, F. Guerlesquin, M. Bruschi, W. Nitschke, Interaction-induced
redox switch in the electron transfer complex rusticyanin-cytochrome c(4). J Biol
Chem. 274 (1999) 3036530369.
[5] J. Castresana, M. Lbben, M. Saraste, New archaebacterial genes coding for redox
proteins: implications for the evolution of aerobic metabolism. J Mol Biol. 250 (1995)
202-210.
[6] Komorowski, L., Schfer, G. 2001. Sulfocyanin and subunit II, two copper proteins
with novel features, provide new insight into the archaeal SoxM oxidase supercomplex.
FEBS Lett. 487:351-355.
[7] A.P. Yelton, L.R. Comolli, N.B. Justice, C. Castelle, V.J. Denef, B.C. Thomas, J.F.
Banfield, Comparative genomics in acid mine drainage biofilm communities reveals
metabolic and structural differentiation of co-occurring archaea. BMC Genomics.
14(2013) 485.
[8] C. Castelle, M. Guiral, G. Malarte, F. Ledgham, G. Leroy, M. Brugna, M.-T. GiudiciOrticoni, A new iron-oxidizing/O-2-reducing supercomplex spanning both inner and
outer membranes, isolated from the extreme acidophile Acidithiobacillus ferrooxidans.
J Biol Chem. 283 (2008) 2580325811.
[9] M. Dopson, C. Baker-Austin, P.L. Bond, Analysis of differential protein expression
during growth states of Ferroplasma strains and insights into electron transport for iron
oxidation. Microbiology. 151 (2005) 4127-4137.
[10] E.E. Allen, G.W. Tyson, R.J. Whitaker, J.C. Detter, P.M. Richardson, J.F. Banfield,
Genome dynamics in a natural archaeal population. Proc Natl Acad Sci USA. 104
(2007) 1883-1888.
[11] M.V. Botuyan, A. Toy-Palmer, J. Chung, R.C. 2nd Blake, P. Beroza, D.A. Case, H,J.
Dyson,. NMR solution structure of Cu(I) rusticyanin from Thiobacillus ferrooxidans:
structural basis for the extreme acid stability and redox potential. J Mol Biol. 263
(1996) 752-767.
[12] X. Guo, H. Yin, Y. Liang, Q. Hu, X. Zhou, Y. Xiao, L. Ma, X. Zhang, G. Qiu, X. Liu,
Comparative genome analysis reveals metabolic versatility and environmental
182

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

[13]

[14]

[15]

[16]

[17]
[18]
[19]
[20]
[21]

adaptations of Sulfobacillus thermosulfidooxidans strain ST. PLoS One. 9 (2014)


e99417.
T.I. Bogdanova, I.A. Tsaplina, T.F. Kondrat'eva, V.I. Duda, N.E. Suzina, V.S.
Melamud, T.P. Tourova, G.I. Karavaiko, Sulfobacillus thermotolerans sp. nov., a
thermotolerant, chemolithotrophic bacterium. Int J Syst Evol Microbiol. 56 (2006)
1039-1042.
N. Okibe, M. Gericke, K.B. Hallberg, D.B. Johnson, Enumeration and characterization
of acidophilic microorganisms isolated from a pilot plant stirred-tank bioleaching
operation. Appl Environ Microbiol. 69 (2003) 1936-1943.
S. Marn, M. Acosta, P. Galleguillos, C. Chibwana, H. Strauss, C. Demergasso, Insights
into the active carbon fixation pathways of a microbial community in a chalcopyrite
bioleaching column. 2015 This issue.
C. Salazar, M. Acosta, P. Galleguillos, A. Shmaryahu, R. Quatrini, D.S. Holmes, C.
Demergasso, Analysis of gene expression in response to copper stress in
Acidithiobacillus ferrooxidans strain D2, isolated from a copper bioleaching operation.
Advanced Materials Research, 825 (2013) 157 - 161.
N. Guex, M.C. Peitsch, SWISS-MODEL and the Swiss-PdbViewer: An environment
for comparative protein modeling. Electrophoresis 18 (1997) 2714-2723.
R.C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res. 32 (2004) 1792-1797.
Information on: http://toolkit.tuebingen.mpg.de/ali2d
L.G. Ryden, L.T. Hunt, Evolution of protein complexity: The blue-copper containing
oxidases and related proteins. J Mol Evol. 36 (1993) 41-66.
M.G. Savelieff, T.D. Wilson, Y. Elias, M.J. Nilges, D.K. Garner, Y. Lu, Experimental
evidence for a link among cupredoxins: red, blue, and purple copper transformations in
nitrous oxide reductase. Proc Natl Acad Sci U S A. 105 (2008)7919-7924.

183

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Bioleaching of Chalcopyrite by Thermophilic Archaea


Jin-Long Songa, Shuang-Jiang Liub and Cheng-Ying Jiang c*
State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese
Academy of Sciences, Beijing 100101, PR China
a

will@163.com, b, liusj@im.ac.cn, c,* correspondence: jiangcy@im.ac.cn +86(10)6480-7581

Keywords: thermoacidophilic archaea;


bioleaching, chalcopyrite; biomining.

Metallosphaera

cuprina;

Acidianus;

Abstract. Bioleaching and biooxidation of sulfidic ores and concentrates generate very high
acidities and a great of heat, which rise the temperature in the reactors or heaps, and
accumulate the sulfur on the surface of the ores. Extremely thermoacidophilic archaea,
mainly from the genus of Acidianus, Sulfolobus, Metallosphaera and sulfurisphaera, have
great potential to contribute to biomining processes for their inherent tolerance for low pH,
high temperature, and high-soluble metal concentrations. Species of the genus
Metallosphaera typically grow by aerobic respiration on CO2 with S0, tetrathionate (S4O62+),
and Fe2+ as electron donors, particularly suitble for metal extraction under high temperature
by their iron- and sulfur-oxidation ability. Several species from Metallosphaera and
Acidianus genera were investigated for their ability and conditions to dissolve various ores
under a range of conditions. All of them showed good performance in copper extraction from
chalcopyrite, with strain M.cuprina Ar-4 displaying higher activity than others. Surface
analysis of chalcopyrite leached with the strain showed the leaching products accumulated on
the ores. Our study will cover new understandings on the application of these
thermoacidophilic archaea in biomining.
Introduction
Chalcopyrite, the most abundant sulfide presenting in the world copper reserves, is the
primary mineral source for copper extraction [1]. However, it is particularly recalcitrant to
extract by hydrometallurgical processes for its complex crystal lattice. Copper extraction
from low-grade chalcopyrite-bearing ores with acidophilic microbes offers an alternative
method to conventional leaching and has developed rapidly in many countries [2].
Nevertheless, bioleaching chalcopyrite by mesophilic microorganism is not economically
feasible due to slow leaching rate and low copper recovery. Extreme thermophilic
microorganisms allow the bioleaching process to be operated at a higher temperature,
therefore improving the leaching kinetics and copper extraction, and reducing passivation
caused by sulfur [3]. Most of extreme thermophilic microorganisms employed in the
bioleaching belong to Sulfolobaceae, including genera of Sulfolobus, Metallospharea and
Acidianus. Though the benefits of them were well-known, the resources of extreme
thermophilic microorganisms were very limited, due to the difficulties for isolating the
extremophiles and obtaining sample from extreme environments.
In our previous works, an extreme thermophilic archaea Metallosphaera cuprina Ar-4 was
isolated from a sulfuric hot spring in Tengchong country, Yunnan Province, China. It grows
aerobically at an optimal temperature of 65 C and pH 3.0, with elemental sulfur, ferrous iron,
184

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
tetrathionate or pyrite as electron donor [4]. In order to explore the potential of M. cuprina
Ar-4 in bioleaching and further understand the bioleaching activities and mechanism of
extreme thermophilic archaea, bioleaching conditions and extracellular polymeric substances
produced by the strains were investigated in this study.
Experimental setup
Preparation of mineral samples. The main metals of mineral sample were detected by
atomic absorption spectrometry (Analytikjena contrAA 700, German) as follows (mass %):
Cu 24.64, Fe 28.21, Mn 0.015, Mg 0.39, Pb 0.08, with chalcopyrite (approximately 92%) as
the main component. The mineral sample was crushed and sieved to size of 75m. Before the
experiments, the mineral powder was orderly washed with 2 M H2SO4 and deionized water.
Microorganisms and culture media. Thermophilic archaea used in this study were M.
cuprina Ar-4, M. prunae DSM10039 and A. brierleyi DSM1561, among which M. cuprina
Ar-4 was isolated by our lab, M. prunae DSM10039 and A. brierleyi DSM1561 were
purchased from German Collection of Microorganisms and cultures (DSMZ). Basal salt
medium (BSM) was modified by the addition of 1 ml trace element solution (1.1 g
FeCl36H2O, 0.05 g CuSO45H2O, 0.2 g H3BO3, 0.2 g MnSO4H2O, 0.08 g, NaMoO42H2O
0.06 g, CoCl26H2O and 0.09 g ZnSO47H2O were dissolved in one liter of distilled water)
[5].
Bioleaching experiments. For the leaching experiments, the strains of thermophilic
archaea were inoculated in 500 mL Erlenmeyer flasks containing 200 mL BSM medium and
4 g chalcopyrite at 65 C and pH 2.0 with shaking at 150 rpm, respectively. The loss of
evaporation was supplemented by basal medium each 24 h. All experiments were performed
in triplicate at the same conditions.
Analytical methods. The pH and redox potential of leaching solution were determined by
a pH meter (PHB-10, Sartorius, Germany) and a Pt electrode (E-431Q, ASI, USA) using a
calomel electrode (Hg/Hg2Cl2) as reference. Cell density was determined by direct counting
with a Neubauer chamber of 0.1 mm depth and 0.0025mm2 area with an optical microscope
(BME, Leica, Germany). The concentrations of copper and total iron during bioleaching
process were monitored by atomic absorption spectrometry (Analytikjena contrAA 700,
German). The extracellular polymeric substances from the mineral surface were extracted and
analysed as described by Zeng et al. [6].
Optimization of the bioleaching condition. The following important parameters that
significantly influenced bioleaching rate and their optimized ranges were chosen as
independent variables in this experiment: temperature, 5080 C; pH 1.52.5; and inoculum
biomass amount 0.12.0107 cells/ml. Response surface methodology based on the Box
Behnken design was used to optimize these parameters and their interactions [7], which
significantly affected bioleaching rate of M. cuprina Ar-4. M. cuprina Ar-4 was inoculated
into BSM containing 2 % (m/v) chalcopyrite as the sole energy source, which was used to
detect bioleaching rate in the samples on the 14th day. Cultures without inoculation were
used as abiotic controls. The experimental design is shown in Table 1. The second-order
polynomial equation is expressed as follows:

Yi bo bi X i bij X i X j bii X i2

(1)

where Yi is the predicted response, Xi and Xj are variables, bo is the constant, bi is the linear
coefficient, bii is the quadratic coefficient, and bij is the interaction coefficient.
185

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Results and discussion
Bioleaching of chalcopyrite with M. cuprina Ar-4 and other thermophiles. As shown
in Fig. 1, comparing with the M. prunae DSM10039 and A. brierleyiDSM1561, M.cuprina
Ar-4 grew better with longer log and stationary phases, peaking at 1.803108 cells mL-1 at
12th day, in accordance with the result of Zhu et al. [5]. In Fig. 1, it can be seen that the pH
fluctuated through the whole process. Initially, the pH values increased for the first four days.
After that, the pH values dropped notably. These data show that all leaching processes
apparently began with the acid consumption reflected by an initial increasing of the pH,
followed by the acid production reflected by a decrease of the pH, which was corresponding
with the results of previous studies [8]. The acid consumption may be related to the proton
attack to the mineral, and the acid production may mainly result from the bacterial sulfur
oxidation [9].

Figure 1. The growth (A) and pH change (B) during bioleaching process with thermophiles.
The concentrations of the copper and total iron ions leached by M. prunae DSM10039, A.
brierleyi DSM1561and M. cuprina Ar-4 are shown in Fig. 2. The copper concentration after
14 days reached 3.93 g/L in M. cuprina Ar-4 culture, higher than 3.76 g/L in A. brierleyi and
2.55 g/L in M. prunae DSM10039. The iron dissolution curves had a similar trend, and the
maximum concentration of iron in solution was 2.75 g/L in the M. cuprina Ar-4 culture. The
abiotic control experiment kept at a low level of copper and iron ions during leaching of
chalcopyrite.

Figure 2. The concentrations of the copper (A) and total iron ions (B) during bioleaching
process.
186

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Optimization of the bioleaching condition. The BoxBehnken design was used to
analyze the variables that significantly affected the bioleaching rate of chalcopyrite by M.
cuprina Ar-4, including temperature, medium pH, and initial inoculum biomass. The design
matrix and response of the dependent variable are shown in Table 1. The results of regression
analysis showed that at the theoretical maximum point, the optimum conditions for
bioleaching rate by M. cuprina Ar-4 were determined to be 66.1 C and pH 2.0. With the
fixed value of inoculum biomass (non-significant factor variable) at 1.22107 cells mL-1, the
three-dimensional response surface was plotted to directly display the effects of medium
temperature and pH on bioleaching rate (Fig. 3).
Table 1. Box-Behnken experimental design with three independent variables.

Note: X1: temperature, 1 (60 C), 0 (65 C), 1 (70 C);


X2: three-dimensional response surface: pH, 1 (1.5), 0
(2.0), 1 (2.5); X3: inoculum, 1 (0.1107 cells/mL), 0
(1.1 107 cells /mL), 1 (2.0107 cells/mL)

Figure 3. The three-dimensional response


surface

Conclusions
An extreme thermophilic archaea M. cuprina Ar-4 compared with reference strains
showed that M. cuprina Ar-4 have a great prospects in bioleaching of chalcopyrite. The
optimum conditions for bioleaching rate by M. cuprina Ar-4 were determined to be 66.1 C
and pH 2.0 with inoculum biomass of 1.22107 cells mL-1. Analysis of EPS indicated that
large amount of EPS would remain on the mineral surface and possibly enhance the
passivation layer at the end of bioleaching. In this case, the copper extraction rate decreased
largely and the attached microorganisms would be difficult to obtain nutrients and oxygen
from the bioleaching solution. The results suggest that M. cuprina Ar-4 is efficient for the
bioleaching of chalcopyrite ores.
References
[1]

Marhual N, Pradhan N, Kar R, Sukla L, Mishra B: Bioresour. Technol. (2008) Vol. 99,
P. 8331.

[2]

Rohwerder T, Gehrke T, Kinzler K, Sand W: Appl. Microbiol. Biotech. (2003) Vol. 63,
P. 239.
187

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[3]

Brierley JA: Hydrometallurgy (2003) Vol. 71, P. 13.

[4]

Liu LJ, You XY, Guo X, Liu SJ, Jiang CY: Int. J. Syst. Evol. Microbiol. (2011) Vol. 61,
P. 2395.

[5]

Zhu W, Xia JL, Yang Y, Nie ZY, Zheng L, et. al.: Bioresour. Technol. (2011) Vol. 102, P.
3877.

[6]

Zheng W, Qiu G, Zhou H, Liu X, Chen M: Hydrometallurgy. (2010) Vol. 100, P.


177.

[7]

Vani S, Binod P, Kuttiraja M, Sindhu R, et. al.: Bioresour. Technol. (2012) Vol. 112, P.
300.

[8]

Zhou HB, Zeng WM, Yang ZF, Xie YJ, Qiu GZ: Bioresour.Technol. (2009) Vol. 100, P.
515.

[9]

J. Vilcez K. Suto C. Inoue: Minerals Engineering (2008) Vol. 21, P. 1063.

188

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Comparative Study of Iron and Sulfur Speciation Transformation of


Pyrite and Marcasite by Extreme thermophilic Archaea Acidianus
manzaensis
Hong-chang Liu1a, Jin-lan Xia1b*, Zhen-yuan Nie1c, Hong-rui Zhu1d,
Yi-dong Zhao2e, Chen-yan Ma2f, Lei Zheng2g, Cai-hao Hong2h
1 School of Minerals Processing and Bioengineering, Central South University,
Changsha 410083, China; Key Lab of Biometallurgy of Ministry of Education of
China, Central South University, Changsha 410083, China
2 Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese
Academy of Sciences, Beijing 100049, China
ahongch_liu@csu.edu.cn, b

jlxia@csu.edu.cn, czynie@csu.edu.cn,
d437416667@qq.com, e zhaoyd@ihep.ac.cn, fmacny@ihep.ac.cn,
gzhenglei@mail.ihep.ac.cn, hhongch@ihep.ac.cn, *Correspondence to be addressed
Keywords: biooxidation, pyrite, marcasite, xanes, acidianus manzaensis.
Abstract. The iron and sulfur speciation transformation of pyrite and marcasite during
bioleaching by Acidianus manzaensis was comparatively studied based on synchrotron
radiation X-ray absorption near edge structure (XANES) spectroscopy, accompanying with
the determination of leaching parameters and the observation of pyrite surface modification
by scanning electron microscopy. The results showed that pyrite was oxidized faster than
marcasite by A. manzaensis. The surfaces of both pyrite and marcasite are serious corroded
after bioleaching. The iron and sulfur speciation analysis showed Fe(III)-containing species
as well as jarosite were gradually produced for both pyrite and marcasite, however, more
elemental sulfur species were formed on the marcasite surface than that of pyrite. It
demonstrates the mineral structure does affect the biooxidation of pyrite and marcasite, and
the more elemental sulfur precipitated on the mineral surface might be one of the reasons
leading to lower oxidation rate of marcasite by A. manzaensis.
Introduction
Biohydrometallurgy takes important role in metal recovery from low grade mineral sulfide
with attractively economical, environmental and social benefits. Within these ores, pyrite and
marcasite are abundant in coals, hydrothermal veins, contact metamorphic deposits and
sedimentary rocks [1]. Pyrite and marcasite are isomers (FeS2) but they differ in structure and
morphology. The former is orthorhombic and the latter is cubic. These differences may result
in differential utilization of pyrite and marcasite by microbes.
It has been confirmed that the dissolution of surface sulfur-containing compounds may
occur in different ways under different conditions during biooxidation of pyrite [2], such as
thiosulfate (Eq. 1), which is known as the thiosulfate pathway to the biooxidation mechanism
of pyrite [1].
FeS2+6 Fe3+ + 3 H2O S2O32- + 7 Fe2+ + 6 H+
189

(1)

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
However, for marcasite, the relevant researches are few, and the differential biooxidation
of pyrite and marcasite are always contradictory. Wang et al. [3] showed marcasite was
biooxidized faster than pyrite. However, in the present study, we found pyrite was faster
utilized by A. manzaensis than marcasite. Such differences in the results between Wang et al
[3] and the present study may be caused by many factors, including the variability in sample
characteristics, leaching conditions (such as Temp. and initial pH value) and the properties of
the test cultures.
In addition, the product evolutions on the mineral surface of pyrite and marcasite have not
been studied, which may also affect the differential utilization between these two isomers. In
order to learn the concrete details about the differential utilization of pyrite and marcasite, the
sulfur and iron speciation transformation was analyzed by synchrotron radiation X-ray
absorption near edge structure (XANES) spectroscopy, as well as scanning electronic
microscopy (SEM), X-ray diffraction (XRD) and Fourier Transform Infrared (FT-IR)
spectroscopy.
Experimental
The strain A. manzaensis YN-25 (accession number of 16S rDNA in GeneBank:
EF522787) used in the present study was stored at the Key Laboratory of Biometallurgy of
Ministry of Education of China, Changsha, China. The basal medium for cell growth
contained 3.0 g/L (NH4)2SO4, 0.5 g/L MgSO47H2O, 0.5 g/L K2HPO4, 0.1 g/L KCl, 0.01 g/L
Ca(NO3)2, and 0.2 g/L yeast extracts with initial pH 2.0.
The mineral samples were provided by the School of Minerals Processing and
Bioengineering, Central South University, Changsha, China. X-ray diffraction (not shown)
showed that the original pyrite and marcasite are well consistent with PDF 42-1340 and PDF
37-0475, respectively. Before the experiment, both of the original pyrite and marcasite were
passed through a sieve of 200 - 400 mesh (i.e. 74 - 37 m).
The bioleaching experiments of pyrite or marcasite were carried out in the 500 mL flasks
containing 200 mL sterilized basal medium and 2 g pyrite or marcasite in a high temperature
rotary shaker at 65 C and 170 r/min. The abiotic control was performed without A.
manzaensis. All the experiments were carried out in triplicate. During the experiment, the cell
density, pH, Eh, total [Fe], [Fe3+] of the leaching solution were determined. Meanwhile, the
solid samples were collected, washed and dried in a vacuum oven at 40 C, and then stored at
-20 C until analysis. The surface morphologies and XRD patterns of leaching residues and
the S K-edge and Fe L-edge XANES spectroscopy of the solid sample were analyzed as in
previous descriptions [4, 5].
Results and discussion
Leaching experiments. The leaching parameters were characterized by cell density, pH,
Eh, and total [Fe] (Fig. 1a-d). Results in Fig. 1a showed that A. manzaensis grown faster,
reached earlier to the stationary stage, and had higher cell density during bioleaching of
pyrite than that of marcasite. The pH values in bioleaching solution of pyrite were lower than
marcasite (Fig. 1b), while the Eh values (Fig. 1c) and total [Fe] (Fig. 1d) were higher. By
contrast, the sterile control experiment showed pH values and total [Fe] were little different
between pyrite and marcasite, while the Eh values in the leaching solution of pyrite were
higher than that of marcasite.
190

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

50

(a)

2.0

(b)

650

1.8

550
30

1.6

500
450

1.4

20

Pyrite
Marcasite
Pyrite sterile
Marcasite sterile

Eh

pH

Cell density (10 cells/mL)

(c)

600

40

400

Pyrite
Marcasite

Pyrite
Marcasite
Pyrite sterile
Marcasite sterile

1.2

10

1.0

350
300

0
0
4.0

Time (d)

Time (d)

Time (d)

(d)

3.6

Figure 1. Cell growth curves (a), pH value curves (b),


Eh value curves (c) and total ion concentration curves
(d) of pyrite and marcasite leached by A. manzaensis
and in the sterile experiment.

3.2

Pyrite
Marcasite
Pyrite sterile
Marcasite sterile

2.8

Total [Fe] (g/L)

2.4
2.0
1.6
1.2
0.8
0.4
0.0
0

Time (d)

Surface morphologies and composition analysis. The surfaces of leaching residues (not
shown) showed that both pyrite and marcasite were corroded gradually by A. manzaensis, and
the surface morphologies of the leaching residue at day 6 became more complicated. By
contrast, little products formed in sterile control experiment and the surface morphologies
were basically unchanged. The FT-IR spectra and XRD patterns (not shown) showed that the
compositions of bioleaching residues were mainly jarosite with a little pyrite or marcasite.
Fe L-edge XANES analysis The Fe L-edge XANES spectra (Fig. 2) showed a significant
difference in the energy peaks (a, b) of the L3-edge. For ferrous sulfate (Fe(II)), the intensity
of peak a is significantly higher than peak b, while for ferric sulfate and jarosite (Fe(III)) it is
opposite. The Fe L-edge XANES spectra of original pyrite and marcasite showed similar
features with Fe(II). However, after growth of A. manzaensis, the peak a of the spectra of
pyrite and marcasite residues gradually became lower than peak b, indicating surface Fe(II)
gradually changed to Fe(III). This is the result of jarosite-like and other ferric iron- containing
compounds formation. It should be noted that after 2 days bioleaching the surface iron
speciation of pyrite residues had been changed to Fe(III), while for marcasite it was about 1 d
longer than pyrite. By contrast, for the sterile experiment, surface iron speciation contained
Fe(II) and Fe(III).
(a)

(b)

a
Marcasite

(c)

a b

b
a

b
a

Normalized absorption

Py-6 d

Mar-6 d

Pyrite

b
b
b

FeSO4

Py-4 d

Fe2(SO4)3

Mar-4 d a
b
a

Mar-2d

Py-1 d

Jarosite

704

a
b

Py-2 d
a

Fe3O4

700

Figure 2. Fe L-edge XANES spectra of (a)


standard iron-containing compounds, (b) pyrite
residues and (c) marcasite residues leached by A.
manzaensis for 1, 2, 4 and 6 days and leached
chemically for 6 days. In the internal of these
figures, the letters a and b represents the low
energy shoulder and the high energy shoulder of
iron L3 edge.

Mar-1 d
Mar-sterile

Py-sterile
708

Energy (eV)

712

716 700

704

708

712

Energy (eV)

716 700

704

708

712

Energy (eV)

716

191

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

S K-edge XANES analysis Fig. 3(a) showed that the S K-edge XANES spectra of
standard samples were significantly different in the position intensity and width of the
absorption peaks, which were in accordance with previous descriptions [2].
Compared with the spectra of original pyrite and marcasite, the XANES spectra of pyrite
and marcasite residues (Fig. 3b, c) leached by A. manzaensis changed over time, in which the
peak at 2472 eV became weaker over time and finally basically disappeared, and the peak at
2483 eV gradually appeared and finally became the main peak. By contrast, little change was
found from the spectra of pyrite residues in the sterile control experiment.
The fitted results of the spectra of these unknown pyrite and marcasite samples are shown
in Table 1. The fitted results showed sodium thiosulfate was detected, indicating -S2O3 like
species were formed as important intermediate compounds during bioleaching of both pyrite
and marcasite.
Table 1. Fitted results of S K-edge XANES spectra of Py-FeS2 and Mar-FeS2 during
bioleaching.
Percentage of contribution of standard spectra (%)
Pyrite residues
Marcasite residues
Sample
Jarosit
Pyrite -S8 Jarosite Na2S2O3 Pyrite
Na2S2O3
-S8
e
Sterile
96.0
0
4.0
0.0
98.7
0.0
1.3
0.0
1 day
75.3
1.2
23.5
0.0
87.9
5.0
6.2
3.0
2 day
15.0
1.7
79.3
3.5
80.7
6.5
10.8
2.2
4 day
8.0
2.5
88.3
3.2
13.9
5.9
83.6
4.6
6 day
2.0
1.9
94.2
0.9
3.1
5.5
92.7
1.2
Results also showed the biooxidation rate of pyrite was faster than that of marcasite (Fig. 3
and Table 1). It should be noted that orthorhombic -S8 during bioleaching of marcasite was
found more than that of pyrite, which could be one of the reasons for the differential
oxidation rates of marcasite and pyrite by A. manzaensis.
Conclusions
In this study, the differential utilization and the iron and sulfur speciation transformation
of pyrite and marcasite by extreme thermophilic Archaea Acidianus manzaensis were
investigated. Results showed pyrite was oxidized faster than marcasite by A. manzaensis. The
surface of both bioleached pyrite and marcasite residues was seriously corroded. The Fe(III)containing species and jarosite were gradually produced. Results also showed more elemental
sulfur species were formed on the marcasite surface than that of pyrite, which indicated the
precipitated elemental sulfur might be one of the reasons to lead to lower oxidation rate of
marcasite by A. manzaensis.
Acknowledgement
This work is supported by NSFC ( No.U1232103, 51274257), Open Funds of BSRF (No.
VR-12419) and Hunan Provincial Innovation Foundation For Postgraduate (CX2014B092).
192

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
References
[1]

M. Vera, A. Schippers, and W. Sand: Appl. Microbiol. Biotechnol. (2013) Vol. 97, p.
7529

[2]

J.L. Xia, Y. Yang, H. He, et al.: Hydrometallurgy (2010) Vol. 100, p. 129

[3]

H. Wang, J.M. Bigham, and O.H. Tuovinen: Hydrometallurgy (2007) Vol. 88, p. 127

[4]

J.L. Xia, Y. Yang, H. He, et al.: Int. J. Miner. Process. (2010) Vol. 94, p. 52

[5]

H.C. Liu, J.L. Xia, Z.Y. Nie, et al.: Process Biochem. (2013) Vol. 48, p. 1855

193

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Natural Organic Matter Affects the Treatment of Mine Tailings


through Bioleaching Processes
Ren A. Silva1,a, Jeonghyun Park1,b, Jeongsik Hong1,c, Heejae Kim1,d,
Jayhyun Park2,e, Hyunjung Kim1,f *
1Department

of Mineral Resources and Energy Engineering, Chonbuk National


University, Jeonju, Jeonbuk 556-756, Republic of Korea

2R&D

Team, Institute of Mine Reclamation Coporation, Coal Center, Jongro-gu


Seoul, 110-727, Repubilic of Korea

arene.alberto.silva@gmail.com, bpjh88@jbnu.ac.kr, cblack2kr@jbnu.ac.kr,


dheejea7@jbnu.ac.kr, ejayhp@mireco.or.kr, f *kshjkim@jbnu.ac.kr

Keywords: mine tailings, metal bioleaching, natural organic matter, zinc


extraction.
Abstract. In the present study, the effects of natural organic matter (NOM) on metal
bioleaching from mine tailings were investigated. NOM can enter into the bioleaching
process either through mine tailings being exposed in the natural ground surface conditions or
through the water quality in the bioleaching process. An analysis of the conditions resembling
the interaction between NOM and mine tailings was conducted through the variation of the
concentration of suspended NOM (0, 20, 50 ppm) and the amount of NOM (0, 20, 50 ppm)
attached to the mine tailings surface. Different concentrations of Suwannee River Humic
Acid (SRHA) were considered as the main source of NOM for the bioleaching experiments.
The flask experiments were conducted using bacterial cultures of Acidithiobacillus
ferrooxidans (1x107 cells/mL) grown in DSMZ medium 882 at a constant temperature of 30
C, shaking speed of 150 rpm, and 1.8 as initial pH. The solid concentration was fixed at 0.5
% w/v of mine tailings (particle size of 100-150 m), which were obtained from Janggun
Mine, Gyeongsang, South Korea. No differences in extraction efficiency were observed in
relation to variation of NOM concentration (050 ppm SRHA) attached to the surface of
mine tailings. On the other hand, a reduction of approximately 10% to 15% of metal
bioleaching efficiency (Zn) was observed due to the increment of suspended NOM
concentrations, 20 and 50 ppm of SRHA, respectively.
Introduction
Bioleaching is part of the biohydrometallurgical methodologies and it is considered as an
effective method for the extraction of precious metals from mineral ores. In addition,
bioleaching is currently used for other applications including soil remediation [1]. This
technology has several advantages over traditional metal extraction processes (e.g.
pyrometallurgy, hydrometallurgy, etc.), due to its cost effectiveness and environmental
friendliness. One of the advantages of bioleaching is that it does not require strict
specifications of the raw material composition. Hence, this method was proved to be suitable
for the extraction of precious metals from a variety of raw materials, such as complex and
194

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
refractory ores, sewage and wastewater residual sludge, soil remediation, and others [2,3].
Nevertheless, several parameters must be taken into account due to their high influence over
the efficiency of the process. These parameters have been identified as the initial pH, solid
concentration, temperature, and others [1].
Recent studies identified the impact of Natural Organic Matter (NOM) concentration on
metal extraction efficiency during bioleaching of metals from sewage and residual sludge
[2,3]. It was also demonstrated that NOM inhibits the bacterial metabolism and hence,
decreases the metal extraction efficiency of the process [3]. NOM however, is present in
almost every bioleaching application. Such is the case of the bioleaching of mine tailings, in
which the introduction of NOM to the process occurs when mine tailings are exposed to
atmospheric conditions and anthropogenic activities (e.g. surface waters, winds, flora and
fauna, and reforestation activities), and by the concentrations of NOM contained in water
used in the process [4]. Thus, important reductions of the process efficiencies could be
generated. To the best of our knowledge, the effects of NOM on the metal bioleaching from
mine tailings have not been previously analyzed. In addition, no analysis of the influence of
NOM attached to the mine tailings surface nor the NOM suspended in the processes waters
have not been conducted so far. Consequently, the objective of this study is to investigate the
effects on the metal extraction efficiency from different concentrations of NOM attached to
mine tailings surfaces, as well as the influence of different concentrations of NOM suspended
in the bioleaching solution. The behavior obtained for the metal solubilization of Zinc (Zn)
during the bioleaching experiments was used as metal of reference to analyze the changes in
the process efficiency.
Materials and methods
Removal of initial NOM from mine tailings. Mine tailings were initially washed in
Deionized Water (DI) in order to remove any NOM remains. Mine tailings were washed in
periods of 1 h in a rotary agitator at 70 rpm. An interval of 10 min was taken before the
separation of the supernatant. The supernatant was then discharged and fresh DI was used for
a next washing period until the absorbance of the supernatant was lower than 0.010 in a 540
nm wavelength. Then, the mine tailings were dried at 80 C and ready for bioleaching
experiments as zero NOM concentration (0 ppm of SRHA). The solid concentration of mine
tailings during the washing of mine tailings was settled at 0.5% w/v.
Variations of attached and suspended NOM. Different concentrations of Suwannee
River Humic Acid (SRHA) were used as the source of NOM for the bioleaching experiments.
To modify the amounts of SRHA attached to the surface of the mine tailings (attached NOM),
washed mine tailings at zero NOM concentration were agitated in solutions containing
different concentrations of SRHA (0, 20, 50 ppm). The agitation was conducted using a
rotary agitator at 45 rpm until the attachment equilibrium was confirmed (12 h). The solid
concentration of washed mine tailings during the SRHA attachment was settled at 0.5% w/v.
Later, the mine tailings were dried at 80 C and were used for the experiments. To modify the
concentration of NOM suspended in the bioleaching solution (suspended NOM), different
concentration of SRHA (0, 20, 50 ppm) were adjusted in the bioleaching solution medium
previous the bacterial inoculation.
Bioleaching experiments The experiments were conducted with various concentrations of
attached and suspended NOM. Flask type experiments were conducted using mine tailings of
100-150 m particle size, obtained from Janggun Mine in Gyeongsang, South Korea. The
195

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
solid concentration used was fixed at 0.5 % w/v. The microorganism selected for the
experiments was Acidithiobacillus ferrooxidans with a bacterial concentration of 1x107
cells/mL grown in DSMZ medium 882, at constant temperature and shaking speed of 30 C
and 150 rpm, respectively. The initial pH was corrected to 1.8. The experiments were carried
out during 720 h. The oxidationreduction potential (ORP) and pH were measured every 24
hours.
Metal concentration analysis. An aliquot of 2 mL was filtered through a 0.45 m nylon
syringe filter previous of the ICP analysis to determine the concentration of Zn, Cu and Fe.
Additionally, the Fe2+ ion concentration was analyzed through o-phenanthroline method. The
Fe3+ ion concentration was calculated by mass balance between the total Fe and Fe2+ ion. The
water losses were corrected in a daily basis by adding DI water.
Results and Discussion
Mine tailings characterization. Table 1 details the chemical composition of the mine
tailings from Janggun Mine. As it can be observed the mine tailings contain a high
concentration of Zinc (Zn), which is higher than that of the other metals present in the mine
tailings, such as Copper (Cu) and Arsenic (As). Therefore, as a preliminary step to analyze
the effects of NOM in the metal extraction through bioleaching processes, Zn was chose as
the reference metal to compare the variations of metal extraction efficiency related to the
modification of NOM concentration in bioleaching processes.
Table 1. Metal characterization of Janggun Mines mine tailings with a 100-150 m
particle size.
Metal
Content [ppm]

Zn
50,600

As
34,600

Cu
2,600

Fe
172,700

Effects of the variation of attached NOM. As seen in Fig. 1, there was a similar Zn
extraction rate while comparing the effects of the attached NOM. The Zn extraction rate was
not affected even after the exposure of the mine tailings to higher concentrations of SRHA.
The results obtained were similar for all the parameters analyzed (i.e. pH, ORP, total
concentration of Fe, Fe2+, and Fe3+) and no difference was observed while increasing the
NOM concentration (Data not shown). These results led us to conclude that the variation of
attached NOM to the surface of the mine tailings does not provoke a reduction of the
bioleaching extraction efficiency.

196

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Figure 1. Zn behavior extracted from mine tailings with time varying attached NOM
amount.
Effects of variation of suspended NOM. After comparing the effects of the variations of
suspended NOM concentrations in the bioleaching solution, a decrease of approximately 10%
and 15% of Zn extraction efficiency was observed at 20 ppm and 50 ppm of suspended
SRHA, respectively (Fig. 2a). In addition, a faster decrease in the concentrations of total Fe
and Fe3+ ions was observed as the concentration of NOM increases (Fig. 2b). In contrast, no
differences were obtained in the concentration of Fe2+ ion, pH and ORP trends while varying
the suspended NOM concentrations, which were in accordance to the trends observed in the
attached NOM experiments (Data not shown).
The decrease of total Fe occurs due to the formation of insoluble Fe3+ complex compounds
[1]. Nevertheless, in previous experimentation the oxidation of Fe2+ to Fe3+ ions remained
unaffected due to bacteria in the system [1,5]. In the present experiment, it was observed that
even if the concentration of total Fe and Fe3+ ion decreased, similar trends of ORP were
observed regardless of higher concentrations of NOM, reflecting the continuous oxidation of
Fe2+ to Fe3+ ions. The ORP trend increased to 610 mV in the first 60 h of experiment, which
remained almost constant until the end of the experiment (Data not shown). However, as
shown in Fig. 2b, the concentration of Fe3+ did not increase even when the oxidation of Fe2+
ion by bacteria remained unaffected. This phenomenon might be related to two possible
reasons, the first, a possible secondary reaction between the Fe3+ ions and the SRHA in the
solution. Therefore, further analyses of the precipitates of the bioleaching experiments are
required. In addition, based on the DerjaguinLandauVerweyOverbeek (DLVO)
interaction, which normally governs the attachment interaction between two substrates, it is
believed that the presence of NOM in the form of SRHA inhibits bacterial attachment on
mine tailings surface. NOM attaches to the surface of both, mine tailings and bacteria, and
disfavors the interaction between both of them [3,4,6]. It was stated that a reduction of
bacterial attachment also reduces the availability of Fe2+ ions, hence the oxidation of Fe2+ to
Fe3+ ions in the system [1]. Furthermore, the reduction of bacterial attachment also impacts
directly the Zn extraction efficiency, which is additionally affected by a possible coprecipitation of Zn with any of the insoluble Fe3+ complex compounds [5]. Likewise, the Zn
extraction efficiency is affected by the reduction of Fe3+ ion [1] produced by the
aforementioned reasons. The reduction of Zn extraction efficiency led to the conclusion that
suspended NOM does promote an inhibition of metal extraction, and the inhibition is directly
related to the NOM concentration in the bioleaching medium.

197

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 2, (a) Zn extraction behavior from mine tailings with time varying suspended NOM
concentration. (b) Total Fe y Fe3+ ions concentration behavior in time varying suspended
NOM concentration.
Conclusions
No differences in extraction efficiency were observed while varying the concentration of
NOM attached to of mine tailings surface. On the other hand, a substantial reduction of
bioleaching efficiency (i.e. 10-15%) was observed while varying the concentration of
suspended NOM in the solution. It was proved that the suspended NOM directly affects the
Zn extraction efficiency, and therefore, the treatment of mine tailings through bioleaching
processes.
Acknowledgements
This work was supported by the Basic Science Research Programs through the National
Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and
Technology (NRF-2011-001467).
References
[1] Silva, R. A., Park, J., Lee, E., Park, J., Choi, S. Q., & Kim, H., Influence of bacterial
adhesion on copper extraction from printed circuit boards. Separation and Purification
Technology 143 (2015) 169-176.
[2] Mazuelos, A., N. Iglesias, and F. Carranza, Inhibition of bioleaching processes by
organics from solvent extraction. Process Biochemistry 35(5) (1999) 425-431.
[3] Fang, D. and L. Zhou, Effect of sludge dissolved organic matter on oxidation of
ferrous iron and sulfur by Acidithiobacillus ferrooxidans and Acidithiobacillus
thiooxidans. Water, Air, & Soil Pollution 171(1-4) (2006) 81-94.
[4] Schwab, P., D. Zhu, and M. Banks, Heavy metal leaching from mine tailings as
affected by organic amendments. Bioresource Technology 98(15) (2007) 2935-2941.
[5] Park, J., Han, Y., Lee, E., Choi, U., Yoo, K., Song, Y., & Kim, H., Bioleaching of
highly concentrated arsenic mine tailings by Acidithiobacillus ferrooxidans.
Separation and Purification Technology 133 (2014) 291-296.

198

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[6] Fein, J. B., Boily, J. F., Gl, K., &Kaulbach, E., Experimental study of humic acid
adsorption onto bacteria and Al-oxide mineral surfaces. Chemical Geology 162(1)
(1999) 33-45.

199

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Acid Leaching of Cu and Zn from a Smelter Slag


with a Bacterial Consortium
Olli H. Tuovinen1,2,a, Silja Srkijrvi1,b, Esa Peuraniemi3,c,
Saku Junnikkala3,d, Jaakko A. Puhakka1,e, Anna H. Kaksonen1,4,f*
1Department

of Chemistry and Bioengineering, Tampere University of Technology,


FI-33101 Tampere, Finland

2Department

of Microbiology, Ohio State University, Columbus, OH 43210, USA

3Boliden
4CSIRO

Harjavalta, Teollisuuskatu 1, FI-29200 Harjavalta, Finland

Land and Water Flagship, 147 Underwood Avenue, Floreat, WA 6014,


Australia

atuovinen.1@osu.edu, bsiljasarkijarvi@gmail.com, cesa.peuraniemi@boliden.com,


dsaku.junnikkala@boliden.com, ejaakko.puhakka@tut.fi, f*anna.kaksonen@csiro.au

Keywords: copper solubilization, slag bioleaching, smelter slag, zinc solubilization


Abstract. This study was undertaken to determine the leaching of Cu and Zn from a smelter
slag in acidic, sulfate-rich solutions with, and without, mesophilic Fe- and S-oxidizing
bacteria. Cu in the slag was mostly distributed in fayalite, Fe-deficient Cu-sulfides and
metallic Cu, and Zn was associated with fayalite, magnetite and glassy silicates. The test
culture was enriched from acid mine water using mineral salt growth media supplemented
with 4.5 g Fe2+ L-1 and 10 g S0 L-1. The bioleaching experiments were carried out in shake
flasks at 27 C and chemical controls were included. The slag sample was pre-leached for 24
h to partially satisfy the acid demand before the leaching experiments at 10% pulp density. In
the bioleaching experiments, 69-83% Cu and 4.1-14% Zn were dissolved in 25 days at pH
2.0-2.2. The highest extent of bioleaching was with S0 as the substrate. The efficiency of the
bioleaching depended on H2SO4 generation from the added S0. The activities of the bacteria
were not adversely affected by the dissolved metals. The maximum yields of chemical
leaching were 68% Cu and 3.7% Zn.
Introduction
Slags formed in pyrometallurgical processes represent a potential resource of metals but
also constitute a potential environmental concern because of their long-term storage [1].
Slags from smelting processes contain fayalite (Fe2SiO4) and other silicate phases as well as
Fe-oxides. Fayalite is relatively acid soluble and does not require a chemical oxidant such as
ferric iron [2]. Cu and Zn are usually distributed in various oxide phases but a fraction also
occurs as the respective sulfides. Several solid phases in slags can be increasingly soluble in
acid solutions, enhanced by increasing temperature and decreasing particle size [1,3-5].
Therefore, acid leaching mediates slag solubilization at ambient temperatures but additional
substrates are usually required for the bioleaching approach [6,7].
The purpose of the present study was to examine the efficiency of leaching of Cu and Zn
from a smelter slag sample under chemical and bacterial process conditions. Chemical
leaching of the slag was based on contact with sulfuric acid solutions. A mesophilic
200

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
consortium of iron- and sulfur-oxidizing acidophiles was used in the bacterial leaching
experiments.
Materials and Methods
The sample of the smelter slag was collected from the flash smelting process at Boliden
Harjavalta, Finland. The sample was air dried and the particle size of the sample was 73% -45
m, with 45% within the 20 to 45 m size fraction. Partial elemental composition was
dominated by Fe (41.1%) and SiO2 (29.6%) (Table 1). Almost half of the matrix (48.8%) was
fayalite (Table 2), where Fe is in the reduced form. Some Cu- and Fe-arsenide grains and
occlusions were also present. Fayalite and magnetite accounted almost 95% of the total Fe,
the remainder being associated with glassy silicate phases (90% SiO2 and the rest comprising
Na-, K-, and Al-silicates). Zinc was distributed in fayalite (58%), magnetite (20%), glassy
silicates (16%) and sphalerite (6%). Copper was mostly in Fe-deficient Cu-sulfides (57%),
and the rest in fayalite (18%) and metallic Cu (16%) and with minor amounts in glassy
silicates and magnetite. The dominant Cu-sulfides were bornite and chalcocite. Metallic Cu
was mostly in +45 m size fraction as free and occluded grains.
Table 1. Partial elemental composition
of the smelter slag sample
Element
Fe
Zn
Cu
Ni
Co
As
Pb
Sb
S
SiO2

Table 2. Mineralogical composition of


the smelter slag sample
Mineral
Fayalite
Glassy silicates
Magnetite
Cu-sulfides:
mostly bornite
and chalcocite
Sphalerite
Galena
Metallic Cu

% Composition
40.9
2.79
0.38
0.05
0.04
0.16
0.60
0.04
0.14
29.6

% Composition
48.8
23.7
22.4
0.35

0.23
0.16
0.07

Test Culture. A mesophilic bacterial consortium designated PS was used in the study.
The consortium was originally enriched from samples collected at the Pyhsalmi mine, south
of Oulu Province, Finland. The consortium contained Acidithiobacillus thiooxidans, A.
ferrooxidans, and Leptospirillum ferriphilum as the dominant bacteria (unpublished data).
The culture was maintained in media containing (per liter) 0.5 g each of (NH4)2SO4, K2HPO4
and MgSO47H2O, acidified to pH 2.5 with sulfuric acid. The media were supplemented with
trace metals [7] and 4.5 g Fe2+ L-1 (added as FeSO47H2O) and 10 g S0 L-1. The consortium
was incubated in shake flasks at 150 rpm and 27 C.
Acid consumption. Immediate and 24 h acid consumption of the slag was measured at 5%
pulp density at pH 2.0, 1.5, and 1.0. The slag sample was suspended in ultrapure H2O and 1
M H2SO4 was added with a 719 S Titrino titrator that was controlled with TiNet 2.5 software
(Metrohm, Herisay, Switzerland).
201

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Toxicity experiments. Initially, the potential toxicity of metals dissolved from the slag
was tested by leaching the slag chemically for 3 days at initial pH 1.0 in the mineral salt
solution, followed by filtration to remove the suspended solids. The filtrate was supplemented
with Fe2+ and S0 and spent growth medium (initial pH 3.0) for the PS culture. Iron oxidation
and acid production were monitored as indication of potential toxicity.
Leaching Experiments. The bioleaching experiments were carried out with duplicate
shake flask cultures at 10% pulp density of the slag sample and initial pH 2.1-2.2. The 24 h
acid consumption was satisfied before the slag was added to the shake flasks. Three substrate
additions were used: 4.5 g Fe2+ L-1, 10 g S0 L-1, and the combination of Fe2+ and S0 additions.
The chemical control involved both substrates without PS inoculum. All cultures in the
leaching experiments were incubated on a shaker at 150 rpm and 27 C. The cultures were
sampled at 3-4 day intervals for immediate measurement of pH and redox potential (Pt with
Ag/AgCl), followed by filtration (0.45 m) for analysis of dissolved metals by atomic
absorption spectroscopy and inductively coupled plasma emission spectroscopy.
Results and Discussion
Acid consumption. Acid consumption, expressed as kg H2SO4 t-1, was 886 at pH 1.0, 412
at pH 1.5, and 196 at pH 2.0 in 24 h. Subsequently the slag samples were preconditioned to
pH 2.0 with H2SO4 for the 24 h acid consumption before the beginning of the bioleaching
experiments.
Toxicity experiments. In the initial toxicity experiments, Fe2+ was oxidized completely
and the pH decreased from pH 3.0 to 2.0 within four days. There was no evidence for toxicity
of the leachate to the PS culture.
Leaching experiments. The time course of bioleaching in shake flaks with Fe2+, S0 and
2+
Fe plus S0 as substrates and chemical control with 10% slag pulp density and initial pH 2.12.2 is shown in Figure 1. Acid formation was evident in S0-supplemented cultures as the pH
decreased to 1.9. Chemical controls continued to have acid consumption, increasing the pH to
approximately 2.8. Ferrous iron was oxidized in biotic flasks but had little impact on pH.
Redox potential increased to >600 mV in biotic flasks as a result of Fe2+ oxidation but not in
the chemical controls.

202

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

2.8

Redox (mV)

600

pH

2.6
2.4
2.2

1.8
12000 0

10

15

20

25

D
Total Fe (mg L-1 )

Fe2+ (mg L-1 )

10000
8000
6000
4000
2000

0
300 0

10

15

20

25

F
Zn (mg L-1 )

250

Cu (mg L -1 )

500

400
300

700

200

150
100

Chemical control
Fe2+ addition
Sulfur addition
Fe2+ and sulfur addition

50
0
0

10
15
Time (d)

20

200
7000 0

10

15

20

25

10

15

20

25

10
15
Time (d)

20

25

6000
5000
4000
3000
2000
1000
0
350 0

300
250
200
150
100
50
0

25

Figure 1. Changes in A) pH, B) redox potential, C) Fe2+, D) total dissolved Fe, E) Cu and F)
Zn during chemical and bacterial leaching of 10% slag. Additions were 4.5 g Fe2+ L-1 and 10
g S0 L-1. The chemical control received both substrates without inoculum. Error bars are
shown for all data points except for a single set of total Fe data in the Fe2+ and sulfur
combination.
The dissolution of Cu and Zn was highest in flasks supplemented with S 0 and lowest in
chemical controls (Figure 1). This was attributed to bacterial generation of H2SO4 that
decreased the pH, thus enhancing acid dissolution of Cu and Zn. The dissolution of Cu and
Zn in 25 days is summarized in Table 3. Subsequent bioleaching experiments with S0supplemented leach solutions confirmed the enhancing role of bacterially produced sulfuric
acid (data not shown). Examination of leach residues by scanning electron microscopy
equipped with wavelength-dispersive X-ray spectroscopy and energy-dispersive X-ray
spectroscopy indicated that the fayalite phase had clearly decreased and the relative
proportion of the glassy silicate phase had increased during the leaching (data not shown).
Dissolved silicate concentration in the leach solution exceeded 1 g L-1 in some of the
experiments.

203

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Table 3. Leaching of Cu and Zn from the slag in 25 days of contact time
Condition
Chemical control
Fe2+ + S0
Fe2+
S0

% Leaching (mean range)


Cu
Zn
68 0.0
3.7 0.2
69 9.7
7.3 1.8
74 0.9
4.1 0
83 0.6
14 0.9

Conclusions
The mixed culture oxidized both Fe2+ and S0, and the initial toxicity experiments showed
no inhibitory effects of the slag leachate on the bacterial oxidation of Fe2+. Bioleaching of the
slag sample responded to supplemental S0 as a result of biogenic sulfuric acid generation. The
slag contained about 7 times more Zn as compared to Cu on a mass and mole basis. Zn was
mainly (94%) present in silicate and oxide minerals with only 6% in sulfides and the leaching
of Zn appeared to proceed primarily through acid dissolution rather than Fe3+ attack. About
57% Cu was distributed as sulfides with bornite and chalcocite as the primary phases. Both
biogenic sulfuric acid and Fe3+ generation appeared to facilitate dissolution of Cu although
the effect was not as clear as for Zn. Examination of leach residues indicated that the loss of
fayalite during the leaching was a major change in the solid phase composition. Silicate
solubilization from fayalite is a concern because in some experiments it reached levels that
increased solution viscosity, making the processing of leach solution more convoluted.
References
[1] N.M. Piatak, M.B. Parsons, R.R. Seal II: Appl. Geochem. (2015), in press
[2] C.M. Santelli, S.A. Welch, H.R. Westrich and J.F. Banfield: Chem. Geol. Vol. 180
(2001), p. 99
[3] F. Carranza, N. Iglesias, A. Mazuelos, R. Romero, O. Forcat: Miner. Eng. Vol. 22
(2009), p. 107
[4] F. Carranza, R. Romero, A. Mazuelos, N. Iglesias, O. Forcat: Hydrometallurgy Vol. 97
(2009), p. 39
[5] D.M. Urosevic, M.D. Dimitrijevic, Z.D. Jankovic, D.N. Antic: Physicochem. Probl.
Miner. Process. Vol. 51 (2015), p. 73
[6] E.A. Vestola, M.K. Kuusenaho, H.M. Nrhi, O.H. Tuovinen, J.A. Puhakka, J.J. Plumb,
A.H. Kaksonen: Hydrometallurgy Vol. 103 (2010), p. 74
[7] A.H. Kaksonen, L. Lavonen, M. Kuusenaho, A. Kolli, H. Nrhi, E. Vestola, J.A.
Puhakka, O.H. Tuovinen: Miner. Eng. Vol. 24 (2011), p. 1113

204

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Reductive Dissolution of Iron Oxides and Manganese Bioleaching


by Acidiphilium Cryptum JF-5
Gonzlez E.1,a, Gonzlez F.2,b, Muoz J.A.2,c,
Blzquez M.L.2,d and Ballester A.2,e
1Biochemical

Engineering School, Pontificia Universidad Catlica de Valparaso, Av.


Brasil 2085, Valparaso, Chile

2Departamento

de Ciencia de Materiales e Ingeniera Metalrgica, Facultad de


Qumicas, Universidad Complutense, Ciudad Universitaria, 28040 Madrid, Spain.
aernesto.gonzalez@ucv.cl, bfgonzalezg@quim.ucm.es, cjamunoz@quim.ucm.es,
dmlblazquez@quim.ucm.es, eambape@quim.ucm.es

Keywords: Acidiphilium cryptum, hematite, goethite, oxalate, thionine.


Abstract. In the development of new processes to use the potential of iron reducing bacteria,
Acidiphilium cryptum, the main bacterium involved in the reduction of Fe(III) compounds in
acidic environments, could play an important biohydrometallurgical role. Thus, the
bioleaching of hematite, goethite and a low-grade manganese ore was assayed, in vials and
columns, using three different media; two of which included a ligand, oxalate, or a redox
mediator, thionine.
Although the presence of A. cryptum was essential for promoting the dissolution of both iron
oxides and the bioleaching of manganese ore, the addition of oxalate to the media enhanced
the microbial dissolution of hematite and goethite, threefold and fourfold, respectively.
Introduction
Biohydrometallurgy has successfully applied the ability of iron-oxidizing microorganisms
to leach copper and gold low-grade ores. However, over the last 20 years, there has been an
increasing interest in the scientific community on the use of microorganisms to reduce metal
oxides. The reductive dissolution of iron oxides has applications in areas such as: (1) removal
of iron impurities from kaolin clay, silica or bauxite; (2) recovery of iron from their minerals
and residues; and (3) leaching enhancement of other elements [1]; an example about the
recovery of nonferrous metals is the Ferredox process [2].
Although iron oxide reduction can be performed by neutrophiles (e.g. S. putrefaciens) and
acidophiles (e.g. A. cryptum), only the last ones are useful in a reductive leaching process,
since under circumneutral condition Fe(II) solids, as siderite and vivianite, are usually formed
[3]. Among strategies used by microorganisms to transfer electrons to insoluble electron
acceptors [4], ligands and redox mediators allow electron transfer to solids without having
direct contact with bacteria.
Accordingly, in this research the dissolution of three solids (hematite, goethite and a lowgrade manganese ore) was assayed in sealed vials and columns using three media: one
formulated with basic nutrients, and other two supplied with a ligand (oxalate) and a redox
mediator (thionine).

205

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Experimental setup
Bacteria. Acidiphilium cryptum JF-5 was cultured in modified Acidiphilium medium [5],
hereafter referred as E medium, with the following composition per liter: 2.0 g (NH4)2SO4,
0.10 g KCl, 0.50 g K2HPO4, 0.50 g MgSO47H2O, 0.30 g yeast extract and 3.0 g glucose,
adjusted to pH 2.4 with H2SO4. Most of the microbiological work was done in a horizontal
laminar flow cabinet.
Ferric solids. Low-grade manganese (7.3 % Mn, 25.1 % Fe, 24.0 % Si, 5.6 % Al and
37.0 % O), hematite (55.6 % Fe, 10.5 % Si, 2.2 % Al, 0.3 % P and 36.1 % O) and goethite
(67.7 % Fe, 1.21 % Si, 0.15 % Al and 30.7 % O) ores came from Brazil, the latter two
specifically from Jangada mine and Itinga (Minas Gerais), respectively. Solids were ground,
sieved (particle size < 0.090 mm) and stored under environmental conditions; additionally,
hematite ore with particle size between 1 and 2 mm was used for column tests. Previous to
each assay, solids were disinfected with ethanol. X-ray diffraction analysis showed that:
magnetite ore contained little amounts of hematite and wstite, hematite had some iron
phosphates and goethite did not show any other crystalline phase.
Reductive dissolution and bioleaching assays in sealed vials. Assays were performed in
duplicate using sealed vials filled with E medium (1% pulp density) and an initial bacterial
population of 1108 cells/mL (with their respective abiotic controls), in an orbital shaker at
35 C and 150 rpm. For sampling, vials were homogenized and 2 mL of supernatant sample
was removed using a previously deoxygenated sterile syringe, ensuring to replace the volume
of sample with N2:CO2 (80:20 v/v) gas mixture. An aliquot of 0.5 mL was diluted (1:10) in
1 mol/L HCl dissolution and stored to measure Fe(II) and total iron (Fe Total), using ferrozine
[6] and atomic absorption spectrometry, respectively. The redox potential and pH were
measured in the remaining sample. The pH reading and a titration curve previously made for
the media were used to control the pH off-line below 2.8, by adding aliquots of H2SO4
(0.5 mol/L). A second assay was performed for hematite and goethite ores following the same
methodology, but using the E/Ox medium; whose composition and pH were identical to E
medium except for the addition of 2 mmol/L of oxalic acid.
Reductive dissolution in columns. The dissolution of the hematite ore was studied in
columns filled with 20 g of mineral and 120 mL of leaching liquor circulating at
35 mL/min. In this experiment three media were used: E, E/Ox and E/Thio media; being
the composition of the latter similar to E medium but with 100 mol/L of thionine. The initial
bacterial population was 1108 cells/mL. Unlike the previous experiment, temperature was
not controlled and sampling was not carried out in a laminar flow cabinet.
Results and discussion

206

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Reductive dissolution and bioleaching assays in sealed vials. Figure 1 shows total iron
profiles in the experiment with E medium. Comparing the evolution of total dissolved iron
for inoculated vials and abiotic controls containing hematite and goethite, it is evident that A.
cryptum promoted their dissolution due to the reductive environment generated inside the
vials (data not shown). Bridge and Johnson [7] have shown that Acidiphilium SJH is also able
to reduce a series of ferric compounds, among them goethite, however, in their experiments
hematite was not significantly dissolved; probably due to the experiment design and its short
assay period. Experiments performed in abiotic conditions [8] and in presence of Shewanella
putrefaciens [9] have shown that the dissolution rate can be correlated to the oxide solubility,
i.e. goethite is more easily dissolved than hematite. Among the reasons that could explain
why hematite was dissolved more easily than goethite in Figure 1 (also in Figure 2) are: the
particle sizes, the exposed surface and the presence of impurities.

2.0

2.0

1.5

1.5

1.0

1.0

0.5

0.5

0.0

15

30

45
60
Time (d)

75

0
90

0.0
0

10

15

30

45
60
Time (d)

75

MnTotal (mmol/L)

2.5

FeTotal (mmol/L)

10

MnTotal (mmol/L)

FeTotal (mmol/L)

2.5

0
90

Figure 1. Total iron and manganese profiles obtained from inoculated vials (A) and abiotic
controls (B) filled with E medium for: hematite (), goethite () and a low-grade manganese
ore (Fe and Mn). Error bar shows mean plus or minus standard deviation between
duplicate experiments.
Secondly, although based on thermodynamics any iron-reducing microorganism can also
reduce Mn(IV) [10], directly or indirectly, via Fe(III) reduction (i.e. using dissolved iron as a
redox mediator) [11], to our knowledge, this is the first time that manganese reduction (and
bioleaching) by Acidiphilium cryptum is reported. Since fermentation products have not been
detected for A. cryptum JF-5 [12], the mechanism involved must be different to the
generation of organic acids used by other microorganisms to bioleach this metal [13].
Considering that the inclusion of ligands in the media usually yield positive results for the
iron mobilization from their oxides, the dissolution of hematite and goethite was also tested
in presence of oxalate (E/Ox medium). Although Figure 2 shows that oxalate caused the
chemical dissolution of both solids due to its chelating and reducing nature (data not shown)
[1], it had a marked stimulating effect on the microbial reductive dissolution, triplicating the
concentration of dissolved iron obtained in its absence (Figure 1). Despite its mechanism of
action is not completely known, three situations may be occurring: (1) oxalate could dissolve
chemically the iron oxide, facilitating the microbial access to Fe(III) [4, 7]; (2) iron-oxalate
complex may behave as a redox mediator in the electrons transfer from bacteria to solids
207

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

FeTotal (mmol/L)

[14]; and finally, the formation of ternary surface complexes could facilitate the electron
transfer from dissolved Fe(II) to the iron oxide [15].
Reductive dissolution in columns. Total iron and pE+pH profiles [16] obtained from the
dissolution of hematite in columns are shown in Figure 3. As can be seen, the concentration
of dissolved iron was higher than that obtained in batch experiments for both E and E/Ox
media over a similar period of time (Figures 1 and 2); even though, much higher
concentrations of dissolved iron were achieved when thionine was supplied (E/Thio
medium). This high dissolution rate obtained
in E/Thio medium was directly related to the
20
low values of pE+pH, which represent
A
stronger reducing conditions than those
15
observed in E and E/Ox media (Figure 3B).
10
Phenosafranin, the only redox mediator
previously tested with A. cryptum [17],
5
4
increased the power output in a microbial fuel
5

0
12

3
11

2
pE+pH

FeTotal (mmol/L)

1
0
0

15

30

45
60
Time (d)

75

90

10

Figure 2. Total iron profiles for dissolution of


hematite (,) and goethite (,) in E/Ox
medium. Solid and hollow symbols represent
inoculated vials and abiotic controls,
respectively. Error bar show mean plus or
minus standard deviation between duplicate
experiments.

20

40

60

80

100

Time (d)

Figure 3. Total iron profiles for dissolution of


hematite in columns with E (), E/OX () and
E/Thio () media. Arrows show successive
glucose additions.

cell. Finally, this dissolution degree was


achieved after periodical addition of glucose when raises in pE+pH were recorded (at those
values, glucose concentrations were found negligible). Since A. cryptum can also grow
aerobically, air infiltrations into the experimental system explain this behavior.
Conclusions
The reductive dissolution of hematite, goethite and a manganese ore by Acidiphilium
cryptum was successfully achieved. To our knowledge, this is the first time that the skill of
this strain to reduce Mn(IV) is reported. Although the addition of oxalate to the medium
caused a slight chemical dissolution of both iron oxides, in the presence of bacteria oxalate
enhanced the dissolution of hematite and goethite, threefold and fourfold, respectively. The
208

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
positive effect of oxalate was also observed in column tests; however, under this
configuration thionine enhanced significantly the dissolution of hematite. This behavior
seems to be related to the low pE+pH that can be achieved in the presence of thionine.
Acknowledgements
The authors wish to express their gratitude to the Spanish Ministry of Economy and
Competitiveness for funding this work (project MAT2011-24186).
References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]

[11]
[12]
[13]
[14]
[15]
[16]

[17]

T.C. Eisele and K.L. Gabby: Mineral Processing and Extractive Metallurgy Review
Vol. 35 (2014), p. 75-105.
C.A. du Plessis, W. Slabbert, K.B. Hallberg, and D.B. Johnson: Hydrometallurgy Vol.
109 (2011), p. 221-229.
H. Dong, J.K. Fredrickson, D.W. Kennedy, J.M. Zachara, R.K. Kukkadapu, and T.C.
Onstott: Chemical Geology Vol. 169 (2000), p. 299-318.
J.A. Gralnick and D.K. Newman: Molecular Microbiology Vol. 65 (2007), p. 1-11.
DSMZ. 269. Acidiphilium medium.
2007
[cited 2015; Available from:
http://www.dsmz.de/microorganisms/medium/pdf/DSMZ_Medium269.pdf.
L.L. Stookey: Analytical Chemistry Vol. 42 (1970), p. 779-781.
T.A.M. Bridge and D.B. Johnson: Geomicrobiology Journal Vol. 17 (2000), p. 193206.
O. Larsen and D. Postma: Geochimica et Cosmochimica Acta Vol. 65 (2001), p. 13671379.
S. Bonneville, T. Behrends, and P. Van Cappellen: Geochimica et Cosmochimica Acta
Vol. 73 (2009), p. 5273-5282.
T. Fenchel, G.M. King, and T.H. Blackburn, in: Bacterial Biogeochemistry: The
Ecophysiology of Mineral Cycling, edited by T. Fenchel, G.M. King, and T.H.
Blackburn/Academic Press, Boston (2012), p. 1-34.
D.R. Lovley, D.E. Holmes, and K.P. Nevin, in: Advances in Microbial
Physiology/Academic Press (2004), p. 219-286.
K. Ksel, T. Dorsch, G. Acker, and E. Stackebrandt: Applied and Environmental
Microbiology Vol. 65 (1999), p. 3633-3640.
W. Zhang and C.Y. Cheng: Hydrometallurgy Vol. 89 (2007), p. 137-159.
U. Schrder: Physical Chemistry Chemical Physics Vol. 9 (2007), p. 2619-2629.
D. Panias, M. Taxiarchou, I. Paspaliaris, and A. Kontopoulos: Hydrometallurgy Vol.
42 (1996), p. 257-265.
R.M. Cornell and U. Schwertmann, in: The Iron Oxides. Structure, Properties,
Reactions, Occurences and Uses, edited by R.M. Cornell and U. Schwertmann/WileyVCH (2003), p. 201-220.
A. Borole, H. ONeill, C. Tsouris, and S. Cesar: Biotechnology Letters Vol. 30 (2008),
p. 1367-1372.

209

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Reductive Dissolution of Ferric Iron in Laterite Overburden using


Acidithiobacillus Spp. and Neutrophilic Iron-Reducing Consortia
Jeannette Marrero1,a, Orquidea Coto2,b, and Axel Schippers1,c
1Federal

Institute for Geosciences and Natural Resources (BGR), Stilleweg 2, 30655


Hannover, Germany

2Laboratory

of Metal Biotechnology, Department of Microbiology, Faculty of Biology,


University of Havana, Calle 25 No. 462, CP 10400, Habana, Cuba

amacoto10400@yahoo.com, b*ocoto@fbio.uh.cu, caxel.schippers@bgr.de

Keywords: Acidithiobacillus, ferric iron reduction, laterite overburden, neutrophilic


iron-reducing bacteria, consortia, bioleaching
Abstract. Cuba is considered as one of the top world producer of nickel and cobalt. The
laterite ore containing nickel and cobalt is mined after first removing an overburden of a long
strip of soil and rock. The laterite has a high content of iron oxide (63%), which has to be
removed in order to recover the nickel and cobalt. This study reports on the kinetics of
reductive dissolution of the Fe(III) from the overburden by two native neutrophilic ironreducing consortia as well as Acidithiobacillus ferrooxidans and Acidithiobacillus
thiooxidans. All of the organisms mobilized the ferric iron in the laterite by reducing it to
Fe(II). The AeRD process using At. thiooxidans was far more efficient in extracting total iron
than the AnRD process using At. ferrooxidans.
Introduction
Different approaches have been considered for the bioleaching of iron-rich nickel and
cobalt oxide ores such as laterites. These approaches include the use of (i) fungi, (ii)
chemolithotrophic bacteria grown under aerobic conditions (iii) dissimilatory iron-reducing
acidophilic bacteria (DIRAB) and (iv) dissimilatory iron-reducing neutrophilic bacteria
(DIRNB) [1-6].
Although DIRNB have been considered for bioleaching and potentially for biobeneficiation [3, 6], most metals mobilized by them from ores precipitate subsequently
because of the circumneutral pH.
Because of high iron solubility at low pH, iron mobilization due to ferric iron reduction is
more significant at low pH than at neutral pH. Furthermore, chemolithotrophic bacteria such
as Acidithiobacillus spp. are efficient in nickel and cobalt leaching from laterite and tailings
[1, 2, 4, 5]. Initial attempts to treat lateritic overburden using At. thiooxidans showed an
improved metal recovery by bioleaching, but it was unclear whether this was merely due to
acidolysis [2]. Here we compare ferric iron reduction and bioleaching of laterite overburden
by DIRNB (Shewanella putrefaciens and native enrichments), and DIRAB (At. thiooxidans,
and At. ferrooxidans as previously described [4, 5]).
Materials and Methods

210

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Overburden sample. A sample of lateritic overburden from Punta Gorda deposit, Moa,
Cuba, was used in this study. The elemental chemical composition was determined by X-ray
fluorescence analysis (XRF) and it is shown in the Table 1.
Bacteria. The DIRAB used in this study were At. thiooxidans DSM 14887 and At.
ferrooxidans DSM 14882. The DIRNB were Shewanella putrefaciens and two consortia, C5123 and C-5124, previously enriched from samples of the subsurface of the lateritic deposit
at Moa mine, Cuba [7].
Table 1. Elemental chemical composition of laterite overburden
Element
(ppm)

Ni
9059

Co
1072

Fe
Mn
445123 1812

Mg
3075

Al
50784

Cr
Cu
18430 140

Iron reduction activity of neutrophilic iron reducing microbial consortia and


Shewanella putrefaciens under anaerobic conditions. The neutrophilic consortia and
Shewanella putrefaciens were inoculated into 150 mL serum bottles with 100 mL of LB
medium containing 20 mM lactate and 2% (w/v) of laterite overburden. Each culture medium
was dispensed into glass flasks in which the air in the headspace was replaced with nitrogen
gas. The flasks were capped with butyl rubber stoppers and sealed with an aluminium crimp.
Sterilization was accomplished in an autoclave (121C, 30 min). Cultures were incubated at
30C. At distinct time intervals, samples (0.5 mL) were removed using sterile syringes, and
Fe(II) and Fe(III) concentrations in the supernatant were determined. Abiotic controls were
also carried out at the same conditions.
Reductive dissolution of lateritic overburden using Acidithiobacillus species. Two
bioreactors were run containing 1.5 L of BS-TE solution at pH 2.5, supplemented with 1%
elemental sulfur. The reactors were maintained at 30C, supplied with sterile air at 1 L/min
and stirred at 120 rpm. They were inoculated to give a cell density of 1 x 10 7 cells/ml. One
bioreactor was inoculated with At. thiooxidans (aerobic (Ae-) bioreactor) and the other one
with At. ferrooxidans (anaerobic (An-) bioreactor). The bioleaching experiments were started
by adding laterite overburden (75 g) when the pH reached 0.8 and the pH controller was then
adjusted between 0.75 and 0.85 and controlled automatically using sterile solutions of 2.5 M
H2SO4 and 1 M NaOH in reservoir flasks. The volumes of acid/base added to maintain the
pH were recorded. At this point, the air in the An-bioreactor was replaced by flowing
nitrogen (2 L/min) for 60 min. Subsequently, nitrogen gas was provided intermittently by
sparging daily at 1 L/min for 30 min. Carbon dioxide was provided by injecting daily 10%
CO2 into the headspace after each sparging with nitrogen gas. The Ae-bioreactor was aerated
at 1 L/min during all experiments. After seven days of operation, the pH controller was then
adjusted to 1.8. Samples were removed from the reactors at regular intervals for
determination of metal concentration, pH, redox potential and the number of living,
cultivable cells of sulfur-oxidizing bacteria. As controls for the bioleaching experiments, not
inoculated reactors were also run to account for chemical leaching, one operated under
aerobic conditions at pH 0.8 and the second one under anaerobic conditions at pH 0.8 during
seven days and at pH 1.8 until the end of the experiment.
Microbial diversity of the iron reducing consortia. To analyze the composition of the
neutrophilic consortia, amplification of bacterial 16S rRNA genes was performed by PCR
with the universal bacterial primers GM3F and GM4R. Products of PCR reactions were
211

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
cloned and sequenced by the company Microsynth (Switzerland). Detection and
identification of operational taxonomic units (OTUs, potentially representing bacterial
species) were accomplished as described [8].
Analytical techniques. Concentrations of metals in samples that had been filtered through
0.2 m pore-sized polycarbonate filters were determined by ICP-OES. Ferrous iron and ferric
iron concentrations in all experiments were measured by colorimetric ferrozine assay. The
number of living, cultivable cells of acidophilic sulfur-oxidizing bacteria was determined by
the most probable number (MPN) technique.
Results and discussion
All cultures that were used reduced Fe(III) to Fe(II) (Fig. 1). The Fe(II) concentration
increased over time for all experiments with neutrophiles as well as acidophiles at anaerobic
and aerobic conditions. The ferrous iron concentration increased rapidly during the growth of
the neutrophilic iron-reducing microbial consortia and Shewanella putrefaciens while neither
ferrous iron nor ferric iron formation was detected in the abiotic control (Fig. 1A). Similar
results in Fe(III) reduction activity for Sh. putrefaciens and the enriched consortium C-5124
were observed. Enzymatic Fe(III) reduction is known for e.g. Geobacter metallireducens,
Desulfuromonas acetoxidans and Shewanella putrefaciens.
Clone libraries of the 16S rRNA gene sequences from the iron-reducing consortia showed
that most of the sequences were closely related (99%) to strains of either C. argentinense
(previously Clostridium botulinum type G), C. sporogenes, C. thiosulfatireducens or C.
sulfidigenes. Although chemical Fe(III) reduction could occur due to fermentation products,
an enzymatic Fe(III) reduction by the Clostridium consortia cannot be ruled out since the
presence of a single NAD(P)H-Fe(III) oxidoreductase complex in the cell membrane has
been suggested in Clostridium beijerinckii [9].

212

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 1. Fe(II) and Fe(III) concentrations due to reductive iron dissolution from laterite
overburden using neutrophilic iron-reducing consortia and Sh. putrefaciens (A), At.
ferrooxidans under anaerobic conditions (An) (B) and At. thiooxidans under aerobic
conditions (Ae) (C); Fe(II): solid lines, Fe(III): dashed lines. Total iron solubilised by At.
thiooxidans compared to At. ferrooxidans and abiotic controls (D).
Concerning the experiments with acidophiles, the ferrous iron concentration increased
over time in the An-bioreactor as well as in the Ae-bioreactor but not in the Ae-control or
An-control, indicating that At. thiooxidans as well as At. ferrooxidans are able to accelerate
the reductive dissolution of laterite overburden (Fig. 1B and 1C). It is worth to mention that
in the control bioreactors ferric iron accumulated in solution. This finding indicated that in a
first step the iron oxide in overburden is dissolved by proton attack and that in a second step
soluble Fe(III) is reduced by microbial activity. Although the iron reduction mediated by the
acidophiles either under aerobic or anaerobic conditions increased the dissolution of iron
from the overburden (Fig. 1D), the amount of ferric iron was similar or even far higher than
that of ferrous iron. This indicates that the kinetics of the chemical ferric iron release from the
solid phase to the liquid phase was higher than the microbial iron reduction kinetics.
For the abiotic control experiments acid consumption was recorded, but no consumption
was noted for the inoculated bioreactors. The dissolution of iron from overburden was far
higher in the not inoculated Ae-control than in the An-control bioreactor during the first
seven days of operation at pH 0.8. Ferric iron reduction by At. ferrooxidans was only
stimulated once the pH was increased to a value of 1.8. It was previously shown that there is
a difference in AnRD rates at pH 1.5 and pH 1.8, possibly reflecting the sensitivity of A.
ferrooxidans to extreme acidity [5].
Interestingly, the amount of total iron released from overburden in 27 days was almost 9
fold higher using At. thiooxidans than At. ferrooxidans (Fig. 1D). Two factors could explain
the overall higher amount of dissolved iron by At. thiooxidans under aerobic conditions, (i) in
the aerobic bioreactor more acid was likely generated via bacterial sulfur oxidation than in
the anaerobic bioreactor and (ii) the iron reduction rate was far higher which caused a
disequilibrium and accelerated dissolution. At. thiooxidans achieved the highest values of
cobalt (78%) and manganese (70%) in solution in only seven days, while At. ferrooxidans
required 27 days of treatment to reach a similar amount of dissolved cobalt (75%) and
manganese (65%) (data not shown). Hence, the ability of At. thiooxidans to tolerate
extremely low pH at which to produce large amounts of sulfuric acid and to reduce ferric iron
aerobically under those conditions suggests At. thiooxidans as the preferred candidate over At.
213

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
ferrooxidans for reductive dissolution of laterite overburden in agreement with previous data
on reductive dissolution of laterite tailings [10].
Conclusions
Neutrophilic iron-reducing bacterial consortia comprising of clostridia and Sh.
putrefaciens showed a fast Fe(III) reduction from laterite overburden. At. thiooxidans
accelerated iron dissolution and nickel and cobalt bioleaching from overburden based on its
ability to generate high amounts of sulfuric acid and to reduce Fe(III) under aerobic
conditions. Aerobic reductive dissolution using At. thiooxidans was far more efficient than
anaerobic reductive dissolution using At. ferrooxidans. Aerobic reductive dissolution has
several potential advantages for extracting metals from laterite overburden: high extraction
kinetics, no ferric iron precipitation due to low pH, no requirement for nitrogen gas, cheap
growth substrate sulfur in comparison to organic carbon sources.
References
[1] O. Coto, F. Galizia, I. Gonzlez, J. Marrero, E. Donati: Hydrometallurgy (2008) Vol. 94,
p.18
[2] I. Hernndez, F. Galizia, O. Coto, E.R. Donati: Adv. Mat. Res. (2009) Vol. 71-73, p. 653
[3] C. Garca-Balboa, I. Chion, F. Gonzlez, M.L. Blzquez, J.A. Muoz, A Ballester:
Biores. Technol (2010) Vol. 101, p.7864
[4] C. du Plessis, W. Slabbert, K. Hallberg, D.B. Johnson: Hydrometallurgy (2011)Vol. 109,
p. 221
[5] I. ancucheo, B.M. Grail, F. Hilario, C. du Plessis, D.B. Johnson: Appl. Microbiol.
Biotechnol. (2014) Vol 98, p. 6297
[6] N. Papassiopi, K. Vaxevanidou, A. Kontogianni: Adv. Mat. Res. (2009) Vol. 71-73, p.
505
[7] O. Coto, J. Marrero, A. Schippers: Adv. Mat. Res. (2013) Vol. 825, p. 33
[8] H. Korehi, M. Blothe, M.A. Sitnikova, B. Dold, A. Schippers: Environ. Sci. Technol.
(2013) Vol. 47, p. 2189
[9] P.S. Dobbin, J.P Carter, C. Garcia-Salamanca, M. von Hoke, A.K. Powell, D.J.
Richardson: FEMS Microbiology Letters (1999) Vol. 176, p. 131
[10] J. Marrero, O. Coto, S. Goldmann, T. Graupner, A. Schippers: Environ. Sci. Technol.
(2015) Vol. 49, p. 6674.

214

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Primary Copper Ore Leaching by Leaching Solution Adjusted


Oxidation-Reduction Potential in Column
Tatsuya Shinkawa1, a, Taro Kamiya1, b, Kazuhiro Kojima1, c,
and Tadashi Chida1,d
1

Japan Oil, Gas and Metals National Corporation, 10-1, Toranomon 2-chome,
Minato-ku, Tokyo, Japan
a

shinkawa-tatsuya@jogmec.go.jp, b kamiya-taro@jogmec.go.jp, c kojimakazuhiro@jogmec.go.jp,


d

chida-tadashi@jogmec.go.jp

Keywords: column, ferric ion, iocg deposit, jarosite, leaching, orp, raw ore, smectite,
swelling.
Abstract. Copper ore is classified into three groups; primary copper sulfide, copper oxide
and secondary copper sulfide. Leaching copper from primary copper sulfide, such as
chalcopyrite, with sulfuric acid takes longer time than from copper oxide and secondary
copper sulfide. As such, an oxidant is required to extract copper from chalcopyrite. In this
study, column leaching tests were carried out using primary copper sulfide ores produced in
an iron oxide copper gold (IOCG) deposit and rich in iron in coparison to porphyry copper
ores. The columns of 10 cm diameter and 100 cm long had a double tube structure so that the
column temperature can be kept at desired temperature by circulating warm water in the outer
tube. The oxidation-reduction potential (ORP) of the leaching solutions were adjustedto 400,
450 and 500 mV vs Ag/AgCl. The column leaching test using just pH 2.0 sulfuric acid
without adjustment of ORP at 45 C got a copper recovery rate of 37 % in 400 days. On the
other hand, with ORP adjusted leaching solutions of pH 2.0 sulfuric acid containing 500
mg/L Fe, the copper recovery rate reached up to 87 % in 400 days.In addition, it was
necessary to keep the temperature above 45 C to enhance copper leaching by ORP adjusted
leaching solution. The result of the column leaching test at room temperature (around 30 C)
using ORP adjusted leaching solution shows that the recovery rate of copper is lower than the
result at 45 C. The ORP adjustment of leaching solution is effective for leaching copper
from primary copper sulfide ore, however, the leaching temperature needs to be kept above
45 C. As a result, it makes clear that copper leaching is enhanced by utilization of ORP
adjusted leaching solutions and suggests that the solution ORP control is important to the
application of bioleaching.
Introduction
Copper ore is generally classified into three groups; primary copper sulfide, copper oxide
and secondary copper sulfide. Leaching copper from primary copper sulfide, such as
chalcopyrite, with sulfuric acid takes longer time than from copper oxides and secondary
copper sulfides. Therefore, primary copper sulfide is separated from ore by flotation, then the
concentrate is treated in pyrometallurgical process. Meanwhile, in case of primary copper
sulfide ore of which copper grade is too low to be treated by flotation , the raw copper sulfide
215

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
ore has to be treated with hydrometallurgical process (Leaching, SX/EW). However, an
oxidant is required to extract copper from chalcopyrite. Copper as well as ferrous iron may be
leached out with use of ferric iron as an oxidant (Eq. 1) [1]. And ferrous iron is oxidized to
ferric iron chemically or microbiologically (Eq.2). However, ferric iron in the leaching
solutions reacts with potassium ion (or other monovalent cation) and precipitate as potassium
jarosite (K+Fe3+3(SO4)2(OH)6) which passivates chalcopyrite (Eq. 3) [1].
CuFeS2 + 4 Fe3+ Cu2+ + 5 Fe2+ + 2 S

(Eq. 1)

4Fe2+ 4H+ + O2 4Fe3+ + 2H2O

(Eq. 2)

K+ 3 Fe3+ 2 SO42- 6 H2O K+Fe3+3(SO4)2(OH)6 6 H+

(Eq. 3)

It has been known that the control of oxidation-reduction potential (ORP) of the leaching
solutions is effective to avoid passivation of chalcopyrite and improve copper leaching
extraction from the concentrate [3]. The solution ORP is mainly dependent on the ratio of
ferrous to ferric iron in the leaching solutions. However, little is known about the influence of
solution ORP on copper leaching from the raw copper sulfide ore in which contains
chalcopyrite. Therefore, in this study, column leaching tests for the raw copper sulfide ore
were carried out using leaching solution with various ORP values.
Experimental setup
Heap leaching is a process to extract copper from copper ore, in which copper ore is
crushed and stacked to be exposed to sulfuric acid. In this study, 216olumn is used as a smallscale heap leaching test. The columns have a double tube structure and warm water is
circulated in the outer tube to keep the column temperature at 45C when necessary.
(a)

(b)

Figure 1. (a) Photograph and (b) image of a 216olumn leaching test.


Sample. The ore samples (named "A-ores" in this study) were produced in an iron oxide
copper gold (IOCG) deposit and rich in iron in comparison to porphyry copper ores. A-ores
were classified into A-ore-2010 and A-ore-2012 by the production year. Table 1 shows the
chemical composition of the ore samplesThe ores were decomposed with lithium
216

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
metaborate/lithium tetraborate fusion, then the solutions were analyzed with ICP-AEC and/or
ICP-MS. A-ores contains a little less than 1% of copper, and the principal copper-bearing
mineral was chalcopyrite. In addition, as the result of X-ray diffraction (XRD) analysis, Aores contained quartz, plagioclase, k-feldspar, biotite, amphibole, magnetite, pyrite, chlorite
and so on as the gangue minerals. Biotite and chlorite were main minerals to consume acid in
leaching A-ores by sulfuric acid solutions.
Table 1. Chemical composition of the ore samples.

IOCG-1
(A-ore-2010)
IOCG-2
(A-ore-2012)

Cu
(%)

Fe2O3(T)
(%)

SiO2
(%)

Al2O3
(%)

MgO
(%)

CaO
(%)

K2O
(%)

0.65

29.03

47.19

9.78

2.09

2.08

4.32

0.99

31.34

43.95

9.75

1.91

2.90

4.41

Before putting the ore samples in the columns, A-ores were crushed into <10 mm size,
then, the crushed ores were agglomerated with water in a cement mixer.
Leaching solution. The pH of the leaching solutions was adjusted to 2.0 with sulfuric acid
and then iron (III) sulfate n-hydrate was added so that the leaching solutions contained
around 500 mg/L Fe. The ORP of the leaching solution which is dependent on the Fe3+/Fe2+
is adjusted to 400, 450 and 500 (mV vs Ag/AgCl) by addition of sodium sulfate. Blank test
was also carried out in which the ORP of the leaching solution was uncontrolled.
The test condition of each column was shown in Table 2.
Table 2. Test condition of each column.
Leaching solution
Fe
Flow rate
concentration
(mL/min)
( mg/L)

Test ID

Ore sample

Water content
in
agglomeration
(%)

ORP ctrl

A-ore-2010

45

2.0

not controlled

ORP 400

A-ore-2010

45

2.0

500

400

ORP 450

A-ore-2010

45

2.0

500

450

ORP 500

A-ore-2010

45

2.0

500

500

ORPN ctrl

A-ore-2012

2.0

not controlled

ORPN 450-30

A-ore-2012

2.0

500

450

ORPN 450-45

A-ore-2012

45
room
temperature
45

2.0

500

450

Temperature
(C)

pH

ORP
(mV vs
Ag/AgCl)

Results and discussion


As a result, copper leaching was enhanced by utilization of ORP adjusted leaching
solutions. The left side of Figure 2 shows comparison of copper recovery rates from A-ore2010. The column leaching test using just pH 2.0 sulfuric acid got a copper recovery rate of
around 37 % in 400 days. Alternatively, ORP adjusted leaching solutions of pH 2.0 sulfuric
acid containing 500 mg/L Fe, has a copper recovery rate of up to around 87 % in 400 days.
In the right side of Figure 2, the result of column leaching test using A-ore-2012 shows
that it is necessary to keep the temperature above 45 C to enhance copper leaching by ORP
adjusted leaching solution. The result of the column leaching test at room temperature
217

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
(around 30 C) using ORP adjusted leaching solution shows that the recovery rate of copper
is lower than the result at 45 C. The ORP adjustment of leaching solution is effective for
leaching copper from primary copper sulfide ore, however, the leaching temperature needs to
be kept above 45 C.

Figure 2. Comparison of copper recovery rates from A-ores.


(left: colmun leaching test using A-ore-2010, right: colmun leaching test using A-ore-2012)
After a leaching test, the ore was removed from colmun. Figure 3 shows the photographes
of the residual ores taken out from ORP 450 and ORPN 450-45 columns. The ores were
covered with precipitation which was generated secondary. The precipitation was taken off
from the ores and identified by XRD analysis. As a result, amorphous iron hydroxide and
jarosite were identified, which were not detected from the original ore by XRD analysis.
Besides, it was observed a peak which was considered to be of ferric hydoxysulfate. It
suggests that iron which was added for ORP controll of the leaching solutions and dissolved
from the ores were precipitated in colmuns. Additionally, in the residual ores taken out from
ORPN ctrl colmun, smectite and vermiculite were detected. It is known that smectite is
swelling clay mineral, and it might cause the blockage of flow channel in the colomn [2].
Therefore, it is considered that copper recovery rate of A-ore-2012 was lower than that of Aore-2010 due to swelling of clay minerals such as smectite.

218

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 3. Photographes of residual ores taken out from colmun (left: ORP 450, right: ORPN
450-45).
Conclusion
Column leaching tests for primary copper sulfide ore were carried out using leaching
solutions with an ORP of 400, 450 and 500 mV vs Ag/AgCl. As a result, copper leaching is
enhanced by utilization of ORP adjusted leaching solutions, especially ORP 400 and ORP
500. The copper recovery rate is 37 % in 400 days under the condition of just pH 2.0 sulfuric
acid without ajustment of ORP. Alternatively, ORP adjusted leaching solutions of pH 2.0
sulfuric acid containing 500 mg/L Fe, had a copper recovery rate of up to 87 % in 400 days.
In addition, it is necessary to keep the temperature above 45 C to enhance copper leaching
by ORP adjusted leaching solution. The result of the column leaching test at room
temperature (around 30 C) using ORP adjusted leaching solution shows that the recovery
rate of copper is lower than the result at 45 C. The ORP adjustment of leaching solution is
effective for leaching copper from primary copper sulfide ore, however, the leaching
temperature needs to be kept above 45 C.
The residual ores which was removed from colmun after a leaching test, were covered
with the secondary precipitation such as amorphous iron hydroxide and jarosite. It suggests
that iron which was added for ORP controll of the leaching solutions and dissolved from the
ores were precipitated in the colmuns. Additionally, in residual ores taken out from the
colmuns using A-ore-2012, smectite and vermiculite were detected. Therefore, it is
considered that copper recovery rate of A-ore-2012 was lower than that of A-ore-2010 due to
swelling of clay minerals such as smectite. As for leaching A-ores, the gangue minerals had
an impact on the copper extraction rather than the precipitation which was generated
secondary.
As a result, it makes clear that copper leaching is enhanced by utilization of ORP adjusted
leaching solutions and suggests that the solution ORP control is important to the application
of bioleaching.
References
[1] E.M. Cordoba, J.A. Munoz, M.L. Blazquez, F. Gonzalez and A. Ballester: The John E.
Dutrizac symposium on copper hydrometallurgy (2007) Book. 1, p. 297-307.
[2] G.Velarde: Mineral Processing & Extractive metall. Rev. (2005) Vol. 26, p. 219-231.
[3] H. Okamoto, R. Nakayama, S. Kuroiwa, N. Hiroyoshi and M. Tsunekawa: Shigen-toSozai.
(2005) Vol. 121, p. 246-254.
219

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Bioprocess for Leaching of Copper Concentrate


Maxim I. Muravyov1,a, Natalya V. Fomchenko1,b, and Tamara F.
Kondrateva1,c
1Winogradsky

Institute of Microbiology, Russian Academy of Sciences, 60-let


Oktyabrya Ave., 7/2, Moscow, Russia

amaxmuravyov@gmail.com, bnatalya.fomchenko@gmail.com, ckondr@inmi.ru

Keywords: ferric leaching, copper concentrate, bioregeneration, two-step process.


Abstract. A bioprocess for oxide-sulfide copper flotation concentrates has been proposed. It
includes: i) chemical step leaching with sulfuric acid solution and subsequent high
temperature ferric leaching with microbially produced Fe3+-containing solution, and ii)
biological step bioregeneration of ferric iron along with additional biooxidation of the
sulfide minerals using moderately thermophilic acidophilic microorganisms. The flotation
copper concentrates contained 27.037.4% copper as sulfide (digenite, bornite, etc.) and
oxide (malachite, azurite, tenorite, etc.) minerals. The acid leaching under batch conditions at
50C and pH 1.2 during 22 hours led to 40.6% of copper recovery from the concentrate.
Subsequent ferric leaching of the acid leach residue at 80C, pulp density 9%, initial
concentration of Fe3+ 30.7 g/L, and pH 1.21.3 during 7 hours increased the total copper
recovery to 94.5%. Bioregeneration of the Fe3+ was conducted using moderately thermophilic
microorganisms including bacteria of the genus Sulfobacillus at 40C in the presence of 3%
leach residue. The average ferrous iron biooxidation rate and total copper recovery within 2
days were 1.0 g/Lh and 97%, respectively. Leaching of copper under semi-continuous
conditions with bioregeneration of Fe3+ at 40C was studied. It was found that copper
recovery achieved 90% within 22 hours and the average oxidation rate of ferrous iron was up
to 0.95 g/Lh.
Introduction
Biohydrometallurgical processes based on leaching of nonferrous metals from ores and
concentrates in stirred tank reactors systems are environmentally safe, easy to operate, and
characterized by relatively low capital and operating costs. However, their commercial
application is constrained by insufficient speed, and, therefore, long duration [1]. Chemical
reactions occurring during bioleaching of copper from the secondary sulfides can be
expressed as following equations:
MenSm + anFe3+ = nMea+ + anFe2+ + mS0,
4Fe2+ + 4H+ + O2 = 4Fe3+ + 2H2O,
2S0 + 3O2 + 2H2O = 2H2SO4.

(1)
(2)
(3)

Reaction in (Eq. 1) is purely chemical, and reactions in (Eq. 2) and (Eq. 3) are mainly
catalyzed by microorganisms. It is known that temperature has the most effect on heterophase
reactions. The BioCOP process is based on this principle in which biooxidation of the sulfide
220

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
concentrate is carried out at 78C by the consortium of thermophilic acidophilic archaea [2].
Oxygen and carbon dioxide are needed for respiration and constructive metabolism of
microorganisms but their partial pressures in aerating air are sharply reduced at high
temperature. In addition, the consortium of thermophilic archaea means that the pulp density
should not exceed 12.5%. Bioleaching of high-grade copper concentrates in one-step
technology may result in exceeding of nonferrous ions of a toxic value for the microbial
culture. The two-step process in which chemical and biological steps are carried out
consistently in different reactors seems to be more promising. In this case, the conditions
intensifying the course of chemical oxidation processes in the first step and those favorable
for microbiological oxidation in the second step are created [3].
The purposes of the work were to study the process of bacterial-chemical leaching of
complex copper concentrates under batch and semi-continuous conditions.
Experimental setup
Characteristics of copper concentrates. Two samples of flotation oxide-sulfide copper
concentrate from Russian copper deposit were used. The first sample was used for the
experiments under batch conditions. The basic chemical composition of the first sample is
37.4% copper, 4.34% iron, 10.4% total sulfur, 9.92% sulfide sulfur, 0.75% calcium, 0.53%
magnesium, and 0.76% carbon. The mineralogical composition is 24% digenite, 14% bornite,
3% delafossite, 2.5% chalcopyrite, 12% chalcocite, ~5% malachite, ~5% azurite, <1%
tenorite, 42% silicate minerals, 1% calcite, 12% magnetite. Thus, approximately 80% of
copper in the concentrate was in the sulfide minerals and approximately 20% was in the
oxide minerals. The second sample of the concentrate was used for the experiments under
semi-continuous conditions and had similar mineralogical composition. Content of copper
was 27.0%.
Microorganisms and cultivation conditions. The moderately thermophilic consortium of
microorganisms including museum strains of bacteria Sulfobacillus thermotolerans Kr1T and
S. sibiricus N1T, and strains of bacteria of the genus Sulfobacillus Sh1 and Sh8, were used for
the step of biooxidation. Cultivation of the mixed culture of microorganisms was performed
on a modified 9K medium at 40 [4]. An additional 0.02% of yeast extract was added into
the medium. This culture was adapted to the concentration of copper ions in the medium of 4
g/L.
Experiments under batch conditions. Acid treatment, ferric leaching and biooxidation were
carried out in a 2.5 L reactor at stirring speed of 430 rpm. The pH was adjusted to the desired
value by adding 98.5% sulfuric acid. A solution containing ferric iron for ferric leaching was
obtained by biooxidation of salt FeSO47H2O in 9K medium by the mixed culture. The acid
pretreated concentrate was deposited in the reactor, then the solution with ferric iron
preheated to the required temperature was added. After the cessation of the cycle of leaching,
the pulp was centrifuged at 7000 g for 1 min. The precipitate was returned to the reactor for
the next cycle. Ferric leaching of the concentrate was carried out at 80, pulp density of
9%, concentration of Fe3+ in the leaching solution of 30.7 g/L, and at pH 1.21.3. In the study
of biooxidation processes of the concentrate the amount of salt FeSO47H2O was equivalent
to 17.1 g/L Fe2+ ions. Pulp density for biooxidation tests was 3%.

221

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 1. Laboratory unit for the semi-continuous treatment of the copper concentrate (1
reactor for ferric leaching, 2 thickener, 3 bioreactor, 4 heat exchanger, 5 thickener, 6
air compressor, 7, 8, 9 peristaltic pumps, 10, 11 heater).
Experiments under semi-continuous conditions. A study of copper extraction from the
concentrate was made on the laboratory unit (Fig. 1). It consisted of a reactor 1 for ferric leaching
(volume 0.68 L), a bioreactor 3 for ferric iron bioregeneration (volume 22 L), thickeners 2 and 5,
and a few peristaltic pumps. The duration of the experiments was 20 h at flow rate through the
system 1.22.1 L/h. Initial concentration of ferric ions in the leaching solution was about 10 g/L
at pH 1.5.
Results and discussion
Experiments under batch conditions. Acid treatment was conducted at pulp density of
17% for 22 hours at 50. pH 0.6, 1.2, and 1.6 were selected for the experiments. The main
results of the acid treatment process are shown in Table 1. Comparison of the results indicates
that the most promising pH value for acid treatment is 1.2, because too much acid
consumption (405 g/kg) is required without a significant improvement in process
performance while maintaining a pH of 0.6. The extraction of copper into the solution at pH
1.2 was 40.6% after 22 hours of acid treatment, and that indicates the dissolution not only of
oxide copper minerals, which contain approximately 20% of copper, but of some of the
sulfides.

pH

0.6
1.2
1.6

Table 1. Main results of acid treatment of copper concentrate.


Yield of residue Cu content in Cu extraction Consumption
Average Cu
[%]
the residue [%]
[%]
of H2SO4
extraction rate
[g/kg]
[g/(Lh)]
68.3
73.4
80.0

28.4
30.2
35.9

48.1
40.6
23.3

405
313
202

1.64
1.38
0.79

Samples of the concentrate after its acid treatment at pH 1.2 and 1.6 were selected to
determine the effect of acid treatment on subsequent ferric leaching of the copper
222

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
concentrate. Two cycles of ferric leaching were conducted to investigate recovery of copper
from the acid pretreated concentrate. The main results of ferric leaching of the copper
concentrate depending on the pH of the acid pretreatment are shown in Table 2. Comparison
of ferric leaching of the concentrate pretreated with sulfuric acid at pH 1.6 and 1.2 shows that
in the latter case the process was much more effective. The total extraction of copper into the
solution in the first case was only 81.2%, while that in the second one was 94.5%.
Table 2. Main results of ferric leaching of copper concentrate after its acid treatment.
pH at the acid Number of Duration
Cu
Total Cu Average Cu Consumption
treatment
leaching
[h]
content in extraction extraction rate
of H2SO4
step
cycle
the
[%]
[g/(Lh)]
[g/kg]
residue
[%]
1.6
1
2.5
22.3
56.8
6.3
103
2
5
8.4
81.2
2.5
0
1.2
1
2
ND
70.6
7.7
54
2
5
3.0
94.5
1.4
38
Note: * NDNo data.
Biooxidation experiments were carried out at 40 in the presence of a solid phase,
obtained after two cycles of ferric leaching of copper concentrate, which was pretreated with
solution of sulfuric acid at pH 1.2. Complete oxidation of Fe2+ proceeded for 2 days at an
average rate of 1.0 g/(Lh), the rate of copper leaching in this case was 0.0083 g/(Lh), and
the specific leaching rate was 0.15 g/(kgh). There was a loss of Fe3+ into the precipitation
during the next five days. The biooxidation caused an increase in the total copper recovery to
97%, i.e. 2.5% increase compared to ferric leaching and reduction of its content in the residue
by two times (to 1.49%).
Experiments under semi-continuous conditions. The following results were obtained
during the testing. Analysis of the leach residues demonstrated that content of copper at the
ferric leaching step decreased from 27.0% to 7.7% for 20 h at the residue yield of 29.4% of
initial concentrate. At the bioregeneration step copper content made up 2.1% at residue yield
of about 20%. Thus, approximately 50% of the initial concentrate was dissolved as a result of
leaching. Total copper recovery from the concentrate into the liquid phase for 20 h was 90%.
The main results of semi-continuous tests are presented in Table 3. The maximal rates of
ferric iron reduction and copper leaching were observed during the first hour of the process,
and then they were sharply decreased to remain constant the rest of time. High rate of copper
leaching during the first hours was a result of the dissolution of copper oxides and carbonates
in the concentrate.

223

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Table 3. Main results of semi-continuous leaching of the copper concentrate.
Time [h]
Flow rate,
Rate of Fe3+
Rate of Cu2+
[L/h]
reduction [g/(Lh)]
leaching, [g/(Lh)]
1
2.1
32.1
25.0
2
2.1
14.7
9.9
4
1.4
11.8
6.4
8
1.4
11.5
6.2
12
1.35
11.1
5.9
16
1.3
10.5
5.5
20
1.2
9.7
5.1
Oxidation of ferrous ions by a mixed culture of microorganisms at the bioregeneration step
was close to 100%, i.e. Fe2+ concentration at the output of the bioreactor was practically zero.
Rate of ferric iron regeneration during the testing was over 0.95 g/(Lh), which is rather close
to the value obtained under batch conditions.
Conclusions
It was shown that the copper from complex concentrates could be leached using the twostep process. It includes: i) chemical step leaching with sulfuric acid solution and
subsequent ferric leaching, and ii) biological step bioregeneration of ferric iron along with
additional biooxidation of the sulfide minerals. The most intensive step was ferric leaching
for 7 hours. Total copper extraction from the concentrates was 9097%.
Acknowledgements
The reported study was partially supported by RFBR, research project No. 15-08-03763 a.
References
[1] H.R. Watling: Hydrometallurgy (2006) Vol. 84, p. 81
[2] J.D. Batty and G.V. Rorke: Hydrometallurgy (2006) Vol. 83, p. 83
[3] N.V.Fomchenko and M.I. Muravyov: Int. J. Miner. Proc. (2014) Vol. 133, p. 112
[4] V.S. Melamud and T.A. Pivovarova: Microbiology (1998) Vol. 34, p. 309

224

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Bioleaching of Orpiment (As2S3) in Absence of Fe3+


Guangji Zhang1,a*, Qiao Yang1, Chao Yang1,b
1National

Engineering Laboratory for Hydrometallurgical Cleaner Production


Technology,
Insititute of Process Engineering, Chinese Academy of Sciences, Beijing 100190,
China
E-mail: a,*gjzhang@ipe.ac.cn; bchaoyang@ipe.ac.cn
Keywords: orpiment,
Acidthiobacillus caldus.

bioleaching,

arsenic,

Acidithiobacillus

thiooxidans,

Abstract. Orpiment (As2S3) is one of the major arsenic sulfide minerals, which can be
dissolved by ferric ion and proton produced by the bacteria, and the main intermediates were
polysuldes and elemental sulfur. In this study, two strains (Acidithiobacillus thiooxidans and
Acidthiobacillus caldus) were used to bioleach the orpiment without iron ions addition. The
experimental results show that both the two strains can grow in the pulp and dissolve the
orpiment. In the bioleaching, it was found that pH decreased, the concentration of arsenic
increased significantly and no elemental sulfur is detected on the surface of the residuals. At
the same time the density of the planktonic bacteria increased obviously. These results
indicate that the orpiment can be dissolved by the bacteria easily in absence of Fe 3+. This
study suggests that the release of arsenic which is from orpiment in the mining tailings can be
faster than expected in open air.
Introduction
Orpiment (As2S3) is one of the major arsenic sulfide minerals, which is associated with
some gold bearing minerals and can be found as solid waste in many gold mine sites
worldwide[1]. This mineral can release dangerous arsenical chemicals due to the bioleaching
in open air. Orpiment can be dissolved by ferric ion and proton produced by the bacteria, and
the main intermediates were polysuldes and elemental sulfur[2]. But few studies are
involved with the bioleaching of this mineral. In our previous work, it was indicated that this
mineral can be bioleached with the additional Fe3+[3]. However, in that study we found that
as a metalloid sulfide mineral, orpiment can be bioleached in absence of iron more easily
compared with the metal sulfide.
In this study, the mesophilic bacterium Acidithiobacillus thiooxidans (At.t) and moderately
thermophilic Acidithiobacillus caldus (At.c) were used to bioleach the orpiment without Fe2+
or Fe3+ addition. The results are expected to be helpful in understanding the mechanism of
orpiment bioleaching, which in turn provide a sound basis for further development of
technology for suppressing the release of arsenic from the arsenic-containing solid waste.
Experimental setup
Materials. The mineral used in this study is natural orpiment, which is from Hunan
province, China and provided by the National Museum of Geology, Beijing, China. Chemical
analysis of the sample reveals that this mineral contains 58.24% As. X-ray diffraction
225

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
analysis shows that the most important mineral phase is orpiment and no iron bearing mineral
is detected. The original samples are yellow blocks and were finely ground. The ground
mineral was sieved to obtain the size fraction of 49-74 m.
Bacteria. All strains were cultured on the Leathen medium containing 0.15 g/L
(NH4)2SO4, 0.05 g/L KCl, 0.05 g/L K2HPO4, 0.5 g/L MgSO47H2O and 0.01 g/L Ca(NO3)2
[4].The strains were grown on a elemental sulfur containing medium for 7 days. Before the
experiments, the bacteria were separated by centrifugation and filtered. The cells were
resuspended in 20 mL fresh Leathen medium as the inoculum. 5mL of this inoculum was
added into the 250 mL flask containing 95 mL medium.
Bioleaching experiments. The experiments were carried out in shake flasks, at 160 rpm,
35oC for the Acidithiobacillus thiooxidans and 45 oC for the Acidithiobacillus caldus. 0.5 g
orpiment was added into each flask and the initial pH was adjusted again to 2.3 for At.
thiooxidans, 2.0 for At. caldus and 1.90 for the sterile control. All the experiments are iron
free.1.0 mL supernatant was taken from each flask as sample every two days for analyzing
the concentration of As. pH and the was periodically measured. The water loss by
evaporation was compensated by adding deionized water.
Analysis methods. The pH value was measured with a pH meter being calibrated using
standard pH 4.01 and 6.86 buffers. The concentration of dissolved arsenic was analyzed by
inductively coupled plasma atomic emission spectroscope (ICP-OES, Optima 5300DV). At
the end of the experiment, the solution was filtered and the solids were rinsed several times
and dried at ambient conditions. The solid samples were analyzed by scanning electron
microscopy (SEM,JSM-7001F) and energy dispersive X-ray spectroscopy (EDS, XMAX150).
12

As leached%

10

Figure 1. Evolutions of
orpiment bioleaching fraction at 35
o
C.

8
6
4

bioleaching with At.t;


sterile control

2
0
1

Time(d)

14
12

Figure 2. Evolutions of
orpiment bioleaching fraction at
45oC.

10
8
6

As
leach

bioleaching with
At.c
sterile control

2
0
0

10

12

Time(d)

226

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 3. SEM images of mineral residues after bioleaching


(a) sterile control; (b) bioleaching with At.t ; (c) bioleaching with At.c.
Results and discussion
The experimental results show that in the case of At.t, more than 10% arsenic was leached
in two weeks. This rate is very close to the rate of bioleaching with At.f(Acidithiobacillus
ferrooxidans) and 10g/L additional Fe2+[3]. At the same time the density of the planktonic
bacteria increased obviously. In the experiment with At.t, the cell density improved from
2.5105 to 3107 . The pH decreased from 2.3 to about 1.90 in the bioleaching and in the
sterile control the pH increased slightly from 1.90 to 2.05. The situation was similar in the
experiment under 45 oC. Orpiment is not a conductor and no galvanic interaction is involved
in the bioleaching process. Meanwhile, both these strains are incapable of oxidizing Fe2+, so
only the proton attack is likely to be responsible for the leaching of the arsenic in our
experiment. On the other hand, unlike the bioleaching with additional Fe3+, the SEM and
EDS results show that there was no detectable elemental sulfur formed on the surface of the
mineral.
Previous researchers thought that the sulfide mineral can be bioleached by an enzymatic
action between the bacterial cell and the sulfide mineral surface, namely bioleached by the
so-called direct mechanism[5]. Some studies showed that the sulfide mineral can be dissolved
in the bioleaching experiments with At.t.[6] But Sand et al pointed out that the "direct"
mechanism does not exist, the role of the bacteria without the Fe2+ oxidizing capacity in the
bioleaching is just to oxidize the chemically formed elemental sulfur to sulfuric acid, and the
dissolution of sulfide minerals in the absence of Fe3+ is just originated from the acid
attack[2]. In our experiments the pH is lower in the sterile control than that in the
bioleaching, however, the leaching rate in sterile control is much lower than that in
bioleaching. This results implied that the significantly higher leaching rate of orpiment in the
bioleaching cannot just be a result of the sulfuric acid attack, maybe there is a more
complicated biochemical mechanism involved.
According Sand and his colleagues, the extracellular polymeric substances (EPS)of this
leaching bacterium can concentrateFe3+ at the mineral surface. and then enhance the
dissolution of the metal sulfide significantly[7,8].So we speculate that EPS can concentrate
H+ by as Fe3+ and accelerate the proton attack on the sulfide.
Conclusion
The experimental results show that the orpiment can be dissolved by the bacteria cells
easily in the absence of Fe3+ and in this process all the sulfur in this mineral was oxidized to
sulfuric acid and released into the solution together with bioleached arsenic. These results
227

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
suggest that it is very possible that the extracellular polymeric substances (EPS) of the
bacteria can concentrate H+ at the mineral surface and, thus accelerate the proton attack on the
sulfide, and thus the release of arsenic which is from orpiment in the mining tailings can be
faster than expected in open air. But further research is needed to prove the speculation.
Acknowledgements
The authors acknowledge the financial support from the National Basic Research Program
of China (2013CB632601), the National Natural Science Foundation of China (51174185)
and the Major National Scientific Instrument Development Project (21427814).
References
H. Long, D. G. Dixon, Pressure oxidation kinetics of orpiment (As2S3) in sulfuric acid,
Hydrometallurgy Vol 85 (2007) 95102
W. Sand, T. Gehrke, P Jozsa, A. Schippers, (Bio) chemistry of bacterial leachingdirect vs.
indirect bioleaching, Hydrometallurgy Vol 59 (2001) 159175.
G. Zhang, X. Chao, P. Guo, J. Cao, C. Yang. Catalytic effect of Ag+ on arsenic bioleaching
from orpiment (As2S3) in batch tests with Acidithiobacillus ferrooxidans and
Sulfobacillus sibiricus. Journal of Hazardous Materials, Vol 283(2015) 117-122.
W. W. Leathen, L. D. Mcintyre, S. A. Braley, A medium for the study of the bacterial
oxidation of ferrous iron, Science Vol 114 (1951) 280-281.
Klaus Bosecker. Bioleaching: metal solubilization by microorganisms. FEMS Microbiology
Reviews 20 (1997) 591-604
S. Porro, S. Ramirez, C. Reche, G. Curutchet, S. Alonso-Romanowski, E. Donati. Bacterial
attachment: its role in bioleaching processes. Process Biochemistry Vol. 32, No. 7, pp.
573-578, 1997
Wolfgang Sand, Tilman Gehrke. Extracellular polymeric substances mediate
bioleaching/biocorrosion via interfacial processes involving iron(III) ions and
acidophilic bacteria. Research in Microbiology. Vol 157 (2006) 4956
K. Kinzler, T. Gehrke, J. Telegdi, W. Sand. Bioleachinga result of interfacial processes
caused by extracellular polymeric substances (EPS). Hydrometallurgy 71 (2003) 8388

228

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Insights into the Active Carbon Fixation Pathways of a Microbial


Community in a Chalcopyrite Bioleaching Column
Sabrina Marn1, Mauricio Acosta1, Pedro Galleguillos2, 1, Clement
Chibwana3, Hannes Strauss3, Cecilia Demergasso1, 2
1Centro

de Biotecnologa, Universidad Catlica del Norte, Antofagasta, Chile.


de Investigacin Cientfico y Tecnolgico para la Minera, Antofagasta,
Chile. 3BHP Billiton, Antofagasta, Chile. Correspondence: cdemerga@ucn.cl

2Centro

Keywords: Bioleaching community, CO2 fixation, microbial succession, microarrays.


Abstract. Recently, a preliminary model has been proposed for relating the microbial
succession of bioleaching heaps with the activity of different CO2 fixation pathways. In order
to confirm this hypothesis and to understand the impact of the carbon metabolism in the
metallurgical performance, the expression levels of carbon fixation pathways were
investigated in a chalcopyrite bioleaching column test by transcriptomic analysis. The
community structure, the physicochemical conditions and the metallurgical parameters were
also analyzed. Gene expression profiles obtained by microarrays confirmed the temporal
distribution of microorganisms as a function of the temperature and the different pathways
for CO2 fixation. These results revealed the impact of the different CO2 fixation pathways in
the composition of the microbial assemblage as the bioleaching proceeds.
Introduction
It is widely known that the community inhabiting bioleaching heaps is dynamic in terms
of structure and function [1]. A preliminary model has been proposed that relates this
microbial succession with three different pathways of CO2 fixation utilized by obligate
autotrophic microorganisms: i) the Calvin-Bassham-Benson cycle (CBB), used for most
aerobic autotrophic bacteria; ii) the reductive citric acid cycle (rTCA) found in anaerobic or
microaerophilic bacteria; and iii) the 3-hydroxypropionate cycle used mostly by archaea. In
addition, this preliminary model incorporates acidophilic heterotrophs as a key component of
the microbial succession and bioleaching success [2]. At present, there is not proteomic or
transcriptomic evidence supporting this postulate generated only by bioinformatics analyses
of available genomes, whereby more deeply analyses are required for a further
comprehensive understanding of the biology of bioleaching. The aim of the present work was
to study the microarray expression profile of different genes associated to the three carbon
metabolic pathways in a chalcopyrite bioleaching test along 301 days of operation and to
relate these results with those of temperature, CO2 availability, community structure and
microbial succession.
Material and methods
Bioleaching column and samples. Six samples were collected at different operation times
for population and transcriptomic analyses between October 2012 and December 2013, from
the BHP-Billiton SIMCOL-1 bioleaching column test (10 m high and 1 m of diameter). The
chalcopyrite column was operated in an open circuit system fed with raffinate and
229

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
continuously forced inoculated. The physicochemical conditions (T, CO2, O2, pH, Eh) and
metallurgical parameters were daily monitored along the whole experiment (Table 1).
Microbial community analysis. DNA was obtained from six samples (Table 1) of
SIMCOL-1 column PLS (pregnant leach solution) and the structure of bioleaching
community was determined by quantification of the 16S rRNA copy number using Real-time
PCR with primers previously developed [1].
RNA purification and genomic microarrays. RNA was obtained and analyzed as
described before [3]. Normalization was performed using alaS as reference gene.
Results and Discussion
Bioleaching operational conditions and microbial community structure. The physical
and chemical characteristics of SIMCOL-1 PLS samples are summarized in table 1.
Table 1. Physicochemical and metallurgical description of PLS samples.
Physicochemical parameters
Operation day

Average T [ C]

CO2 out (ppm)

PLS Eh

Cu recovery (%)

49

30.7

276

721

4.1

90

43.8

240

714

13.4

141

45

236

706

26

210

51.1

493

687

37.2

260

55.1

474

667

43.8

301

57.1

543

668

48.6

At the first 90 days of the bioleaching process (30 45 C) the predominant species in the
SIMCOL-1 community were Acidithiobacillus thiooxidans and Acidithiobacillus
ferrooxidans. When the average temperature reached 50 C (operational day 141)
mesophylic species begun to be replaced by moderate thermophile Sulfobacillus sp. and
Ferroplasma sp. However, Leptospirillum sp. failed to prevail in this bioleaching
community, probably due to the elevated temperatures reached (Fig. 1).

230

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 1. Quantitative characterization of SIMCOL-1 community determined by real time PCR.


The CO2 profile during the operation time showed two accented peaks, one at the
beginning of the process - induced for an initial reaction between acid and carbonate content
of the ore - and another peak approximately at the operation day 90 (Fig. 2 to 5). The obligate
autotrophs At. ferrooxidans and At. thiooxidans (Fig. 1) predominated between days 0 - 50
which could consume the initial available CO2 leading to a drop of the gas concentration
between days 30 - 80 approximately. Later the heterotrophs/mixotrophs Ferroplasma and
Sulfobacillus became predominant (Fig. 1), and could use organic matter as energy source to
produce CO2 (after day 90) when the second CO2 peak was observed.
Transcriptomic analysis by microarrays. The CBB cycle was mostly active in At.
thiooxidans (Fig. 2), the predominant member of the assemblage during the initial stage of
the operation (Fig. 1). The overexpression of the genes coding for the proteins involved in
the carboxysome system for concentrating CO2 (csoS1, csoS2, csoS3) in all Acidithiobacillus
spp. suggests that the CO2 available (200 to 400 ppm of CO2 out) was lower than the
optimum for full cell growth (Fig. 2, Fig. 3). In mesophyles the transcriptional level of the
genes involved in the CBB cycle (cbbL, cbbS, cbbR, cbbQ) varied following the increase of
temperature and the CO2 profiles (Fig. 2). The CBB cycle activity was increased in
Acidithiobacillus caldus and Sulfobacillus populations when the average temperature was
increased (Figs. 1, 3, 4). The rTCA cycle was active in Leptospirillum ferriphilum population
(Fig. 4), in spite of its permanent low abundance (Fig. 1). The activity of the 3hydroxypropionate cycle was increased in the Ferroplasma population when the operation
proceeded, however transcriptional level of the genes involved in that cycle was lower than
the ones potentially involved in rTCA cycle (Fig. 5), as has been observed in other archaea
[2].

231

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 2. Expression dynamics of rubisco genes from CBB cycle (cbbL, cbbS, cbbR, cbbQ)
(left) and carboxysome structural genes (csoS1, csoS2, csoS3) of Acidithiobacillus
thiooxidans (right) inhabiting the SIMCOL-1 column along 301 days of chalcopyrite
bioleaching.

Figure 3. Expression dynamics of rubisco genes from CBB cycle (cbbL, cbbS, cbbR, cbbQ)
(left) and carboxysome structural genes (csoS1, csoS2, csoS3) (right) of Acidithiobacillus
caldus inhabiting the SIMCOL-1 column along 301 days of chalcopyrite bioleaching.
Conclusions
These results obtained from a transcriptomic setting - revealed by microarrays analysis
confirm the impact of temperature changes and the strategies exploited by the
microorganisms to derive carbon for metabolic processes on the succession of species and
the composition of the microbial assemblage when the bioleaching proceeds. From a
metallurgical point of view, this adaptive microbial community performance helps to
maintain a permanent bioleaching metabolism in spite of the different physicochemical and
biological conditions of the heap along the operational time.

232

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 4. Expression dynamics of pyruvate-oxidoreductase subunits (por) and succinate


dehydrogenase A-subunit (sdhA) from rTCA cycle of Leptospirillum ferriphilum (left).
Expression dynamics of rubisco genes from CBB cycle of Sulfobacillus acidophilus (SBA)
and S. thermosulfidooxidans (SBT) (right) inhabiting the SIMCOL-1 column along 301
days of chalcopyrite bioleaching.

Figure 5. Expressions dynamics of three genes from the 3-hydroxypropionate cycle


(accA/Acetyl-CoA carboxylase A subunit, sbm Ct/Methylmalonil-CoA mutase-C-terminal
and sbm Nt/ Methylmalonil-CoA mutase-N-terminal) (left) and two genes from rTCA cycle
(por subunits and ppsA/phosphoenolpyruvate synthase A) of Ferroplasma sp. inhabiting the
SIMCOL-1 column along 301 days of chalcopyrite bioleaching.
Acknowledgements
Part of this work was financed by INNOVA project 08CM0 03.
References
[1] F. Remonsellez, F. Galleguillos, M. Moreno-Paz, V. Parro, M. Acosta and C.
Demergasso, Dynamic of active microorganisms inhabiting a bioleaching industrial heap
of low-grade copper sulfide ore monitored by real-time PCR and oligonucleotide
prokaryotic acidophile microarray, Microbial Biotechnology 2 (2009) 613-624.
233

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[2] J. Valds, J. P. Crdenas, R. Quatrini, M. Esparza, H. Osorio, F. Duarte, C. Lefimil, R.
Seplveda, E. Jedlicki and D. S. Holmes, Comparative genomics begins to unravel the
ecophysiology of bioleaching, Hydrometallurgy 104 (2010) 471-476.
[3] C. Salazar, M. Acosta, P. Galleguillos, A. Shmaryahu, R. Quatrini, D. S. Holmes and C.
Demergasso, Analysis of gene expression in response to copper stress in
Acidithiobacillus ferrooxidans strain D2, isolated from a copper bioleaching operation,
Advanced Materials Research 825 (2013) 157 - 161.

234

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Study on Bioleaching of Sulfur in Iron Ore by Mixed Culture


He Shanga*, Jiankang Wenb, Biao Wuc, and Xiaolan Mod
National Engineering Laboratory of Biohydrometallurgy, General Research Institute
for Nonferrous Metals, No.2 Xinjiekouwai Street, Beijing, 100088, P.R.China
a*shanghe123321@163.com, bkang3412@126.com, cangelwbiao@sina.com,
dmxl0545@163.com

Keywords: mixed culture, bioleaching, iron ore, sulfur.


Abstract. Iron ore is the raw material for steel production, in addition to iron and slag major
component, still contains sulfur and phosphorus compounds and other harmful elements, is
the potential adverse effects of factors constitute the steel product quality and environment.
Sulfur in iron ores into the steel products will not only produce "heat brittle" phenomenon,
but also in the sintering process by roasting produce sulfur dioxide into the air, causing
damage to the atmosphere and ecological environment. A typical of the high sulfur iron ore
from Inner Mongolia, China, iron grade of 53.06% and sulfur content is 2.76%, the main
metal mineral in the ore is magnetite, followed by magnetic pyrite, pyrite and siderite,
otherwise a small amount of copper mineral chalcopyrite, bornite. In this work, a mixed
culture composed by Sulfobacillus thermotolerans, Leptospirillum ferriphilum and
Ferroplasma acidiphilum was used to leach the sulfur in iron ore samples, we investigated
the leaching rate of sulfur under different initial pH, temperature and pulp density conditions.
The results showed that under the condition of the initial pH of 1.8, the temperature was
33oC, and pulp density 15%, after 7 days of oxidation, we got a yield of 80.16% product in
which iron grade of 62.31% and sulfur content is 0.17%. Compared with original sample,
sulfur content decreased 95.06%, iron grade increased by 9.25%, and iron recovery was
94.13%. From the results it can be concluded that this microbial process for high sulfur iron
ore lead to a significant effect of sulfur reduction and substantial increase in iron grade.
Introduction
Iron ore is the raw material for steel production, in addition to iron and slag major
component, still contains sulfur and phosphorus compounds and other harmful elements, is
the potential adverse effects of factors constitute the steel product quality and environment.
China's imports of iron ore by the domestic iron ore and mineral composition, and there is
obvious difference in the sulfur components, imported iron ore the average sulfur content
significantly lower than the domestic product iron ore. Domestic parts of the south,
southwest, northwest local mining a rich iron ore, without separation directly send steel ore
matching use, most of the sulfur of component is on the high side [1]. Sulfur in iron ore can
be solved through traditional methods such as mineral processing [2], sintering flue gas
desulfurization removal [3]. However, ore processing exist the problem of low recovery rate
of iron resources and flue gas desulfurization methods need a large investment in equipment.
Bio-hydrometallurgy has been commercially successful application in copper, uranium, gold
extraction[4-6], and in iron ore dephosphorization has carried out some research work [7]. In
this study, mixed culture was used to leach the sulfur in iron ore. The main principle is the
use of microbial oxidation of sulfur in the minerals such as pyrite, pyrrhotite, etc. to achieve
235

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
the purpose of removing sulfur, and then avoid or significantly reduce sulfur dioxide
emissions from the sintering process.
Materials and methods
Iron Ore. Iron ore employed in this study was obtained from Inner Mongolia, China. The
particle size was 100% passing 0.074mm The main metal mineral in the ore is magnetite,
followed by pyrrhotite, pyrite and siderite, otherwise a small amount of copper mineral
chalcopyrite, bornite. The grade of some important constituents of the iron ore used is shown
in Table 1.
Table 1. Results of partial chemical analysis of iron ore.
Element
Content
Element
Content

Fe(%)
53.06
S(%)
2.76

Cu(%)
0.036
Ca(%)
3.06

Pb(%)
0.0093
Mg(%)
2.24

Zn(%)
0.0065
SiO2(%)
4.63

Mn(%)
0.058
Al2O3(%)
0.87

Microorganisms and culture medium. Mixed culture used were composed by


Sulfobacillus thermotolerans, Leptospirillum ferriphilum and Ferroplasma acidiphilum,
saved in National Engineering Laboratory of Biohydrometallurgy, General Research Institute
for Non-Ferrous Metals.
The mixed culture was maintained in a medium containing 3 g/l (NH4)2SO4, 0.5 g/l K2HPO4,
0.5 g/l MgSO47H2O, 0.1 g/l KCl, 0.01 g/l CaNO3 and 1.0 g/l sulfur. Transfer into fresh
medium was done every 1 month. Cultures for biooxidation experiments were prepared by
transferring 10% (v/v) of maintenance culture into fresh growth medium containing 3 g/l
(NH4)2SO4, 0.5 g/l K2HPO4, 0.5 g/l MgSO47H2O, 0.1 g/l KCl, 0.01 g/l CaNO3 and 50 g/l
iron ore.
Microbial-mineral interactions. The iron ore was bioleaching in a shakeflask which in
the constant temperature oscillator over a period of 7 days at a pulp density between 5% and
20% solids using a culture of already grown mixed culture. The initial pH was adjusted to
between 1.2 and 2.0 with sulfuric acid. The thermostat oscillator set temperature between 25
and 35oC, set speed for 150 revolutions per minute
Analysis. Sulfur in the samples was determined using the volumetric method [8]and the
iron was determined by potassium dichromate titration method[9].
Results and discussion
Bioleaching of sulde. Biooxidation of sulde using the chemolithotrophic microorganisms is currently a standard practice and has been applied in industry for some years
[10]. Micro-organisms oxidize ferrous suldes to ferric sulfate and sulfuric acid [11]. The
oxidation of sulde in the sample using Sulfobacillus thermotolerans, Leptospirillum
ferriphilum and Ferroplasma acidiphilum for 7 days at 33oC and we got a yield of 80.16%
product in which iron grade of 62.31% and sulfur content is 0.17%. Compared with original
sample, sulfur content decreased 95.06%, iron grade increased by 9.25%, and iron recovery
was 94.13%.
Effect of temperature. The initial pH was adjusted to1.8 with sulfuric acid and over a
period of 7 days at a pulp density of 15% solids. Temperature is set between 25oC and 35oC.
Fig.1 shows that increasing the temperature was found to be effective in increasing the
236

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
desulfurization rate, above 33oC microbial activity is restrained and the desulfurization rate
did not continue to improve. On the other hand, there was no significant effect of temperature
on the iron grade because of the improvement of iron grade is largely due to acid soluble
gangue mineral dissolution. So 33oC is the most suitable temperature for desulphurization.
62.5
95

Iron grade/%

Sulfur removal rate/%

62.4
90

85

80

62.3

62.2

62.1
75

24

26

28

30

32

34

62.0
24

36

Temperature/

26

28

30

32

34

36

Temperature/

(a)

(b)

Figure 1. Effect of temperature on desulfurization rate (a) and iron grade (b).

96

65

95

64

Iron grade/%

Sulfur removal rate/%

Effect of pulp density. The initial pH was adjusted to1.8 with sulfuric acid and over a
period of 7 days at 33oC. The pulp density is set between 5% and 20% solids. Fig.2 shows
that when the pulp density is less than 15%, the higher pulp density had no significant effect
on desulfurization efficiency, when the pulp density is higher than 15%, continue to increase
pulp density desulfurization rate dropped significantly. Maybe it was because the rate of
ferrous and sulfur oxidation biological is insufficient to maintain the rate of leaching per unit
mineral. At the same time, we get similar results with previous test that there was no
significant effect of pulp density on the iron grade. So we concluded that 15% is the best pulp
density.

94

93

63

62

92

61
91

60
5

10

15

20

Pulp density/%

10

15

20

Pulp density/%

(a)

(b)

Figure 2. Effect of pulp density on desulfurization rate (a) and iron grade (b).
Effect of initial pH. The iron ore was bioleaching in a shakeflask at 33oC over a period of
7 days at a pulp density of 15% solids using a culture of already grown mixed culture. The
initial pH was adjusted to between 1.2 and 2.0 with sulfuric acid. Fig.3 shows that when the
initial pH less than 1.8, continue to reduce the initial pH, the desulfurization rate was
significantly decreased and the iron grade was improved significantly. But on the other hand,
under the condition of low pH the iron loss will be rised. Therefore, an initial pH of 1.8 is the
most appropriate.
237

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

65

94

Iron grade/%

Sulfur removal rate/%

95

93

92

64

63
91

90
62
1.2

1.4

1.6

1.8

2.0

1.2

pH

1.4

1.6

1.8

2.0

pH

(b)

(a)

Figure 3. Effect of initial pH on desulfurization rate (a) and iron grade (b).
Conclusions
From the results and discussions above, it can be concluded that microbial process for iron
ore is an effective method for desulfurization, at the same time is also an effective way to
improve the iron grade. Sulfobacillus thermotolerans and Ferroplasma acidiphilum could
degrad the sulde in iron ore into solutionLeptospirillum ferriphilum may contribute to the
decrease in sulfur grade through ferrous oxidation to support ferric leaching of pyrite and
chalcopyrite. The results showed that under the condition of the initial pH of 1.8, the
temperature was 33oC, and pulp density 15%, after 7 days of oxidation, we got a yield of
80.16% product in which iron grade of 62.31% and sulfur content is 0.17%. Compared with
original sample, sulfur content decreased 95.06%, iron grade increased by 9.25%, and iron
recovery was 94.13%.
Acknowledgments
This project was financially supported by the National Natural Science Foundation of Chi
na (No.51404031). Our sincere appreciation goes to them for their financial support.
References
[1] Bai Linlin: Metallurgical economics and management (2010) Vol. 1, p. 24
[2] Ran Yinhua: China Mining Magazine. (2007) Vol. 16, p. 124
[3] Cen Wanglai, Hu Yong, Li Jin, Ye Hai and Yin Huaqiang: Industrial Safety and
Environmental Protection. (2007) Vol. 33, p. 27
[4] M.S. Prasad, R. Mensah-biney and R.S. Pizrro: Minerals Engineering(1991) Vol.4,
p12571277
[5] T. Rohwerder, T. Gehrke, K. Kinzler and W. Sand: Appl Microbiol Biotechnol(2003)
Vol.63, p239248
[6] G. J. Olson, J. A. Brierley and L. Brierley: Appl Microbiol Biotechnol(2003) Vol.63,
p249257
[7] Li Yubiao, Gong Wenqi, Pi Kewu, Hu Chun and Xin Zhenkai: Journal of Anhui Agri.
Sci. (2010) Vol. 38, p. 6825
[8] Sun Lijun, Chen Ping, Lv Xianjun and Du Feifei: Metal Mine(2009) Vol.14, p7074
238

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[9] Lu Jianjie:Journal of South-central University for Nationalities(2000)Vol.19, p8183
[10] R.K. Amankwah, W.T. Yen and J.A. Ramsay: Minerals Engineering (2005) Vol.18,
p.103-108
[11] Rawlings, D.E: Journal of Industrial Microbiology and Biotechnology (1998) Vol.20,
p268274.

239

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Effect of Particle Size on the Column Bioleaching of Tibet Yulong


Copper Ore
Li kai 1, a, b, Yuguang Wang a, b, Lijuan Zhang a, b, Chen Zhu a, b, Mao Feng
a, b
and Hongbo Zhou 2, a, b
a

Key Laboratory of Biometallurgy, Ministry of Education, China


School of Minerals Processing and Bioengineering, Central South University, Chan
gsha, China
1lee2101115@163.com; 2zhbzyz@163.com

Keyword: bioleaching, particle size, column reactor, moderately thermophilic


microorganisms
Abstract: This study aimed to investigate the effect of ore particle size on the bioleaching of
Yulong copper ore in the bench-scale columns using the mixed culture of moderately
thermophilic microorganisms. Bioleaching experiments were carried out on particle sizes of
5-10, 10-15 and 15-25mm in the same kind of column reactors. In the control test of acid
leaching, the column reactor was charged with the middle particle size (10-15mm). The
results indicated that copper extraction in the column reactor with particle size of 5-10 mm
was highest among the three particle sizes. After 110-days leaching, 89% of copper was
leached at 5-10 mm particle size while 57% was extracted at 15-25 mm particle size and 80%
at 10-15 mm. Under the same particle size (10-15 mm), copper recovery in the column
reactor with inoculation of microorganisms was 25% higher in comparison to the control test
of acid leaching, while sulfuric acid consumption was 33% less than that.
Introduction
Tibet Yulong copper deposit is located in the Changdu area of Tibet autonomous region,
which is the second largest copper mineral resource in China. The high altitude leads Yulong
copper deposit to be alpine extremely cold and water shortage. Therefore, conventional
mining-mineral processing and smelting face numerous serious challenges, such as high
production cost, environment pollution, low resource utilization [1]. Heap bioleaching, as a
low-cost and eco-friendly process which has been successfully applied in some countries
such as Chile and Australia, is a good alternative[2].
Although heap leaching has been applied in some mining industry, the process remains
limited by the low recoveries and the long extraction times, Especially applied to process
these complexities and low solubility sulphide ores[3]. Amongst others, an approach to
increase the recoveries and to cut down the extraction times is to decrease the particle size.
Small particle size ores can increase both the contact area within ores and microbial and the
bioleaching capacity of microbial.
The purpose of this work was to study the effect of particle size on small scale column
bioleaching of Yulong copper ore with the mixed culture of moderately thermophilic
240

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
microorganisms, and thus offered references for the next stage industrial trials and
production.
Materials and methods
Characterization of sample. The copper sulfide ore used in the column bioleaching test
was obtained from Yulong copper mine. The sample mainly contains 2.95% Cu, 21.58% Fe
and 24.78% S. Copper mineralogical analysis of the ore sample showed that 21.36%, 65.08%
and 13.56% was present in primary copper sulfide, second copper sulfide and copper oxide.
Microorganisms and culture medium. The mixed culture of moderately thermophilic
microorganisms used in this study was enriched from acid mine drainage samples collected
from several chalcopyrite mines in China. Two moderately thermophilic bacteria species
were identified as Leptospirillum ferriphilum and Acidithiobacillus caldus [4].
Ore bioleaching columns. Three different particle sizes and representative artificial
mixture copper ore was separately loaded into the same kind of jacketed column (0.5m tall,
8cm diameter). Each column contained 1.2Kg of ore and equipped with a 3L solution
reservoir. Heated water was circulated through column jackets to maintain the inside
condition in column at about 45. Irrigation solution dripped centrally at a flow rate of
33mL /h .Before inoculation, the ore sample was pre-leached by diluted sulfuric to control the
discharged solution pH at a level for good bacterial activity. Clear air was supplied via a
rotameter and the air flow rate was 1L/min.
Result and discussion
Changes in pH with time in the bioleaching experiments were presented in Fig.1. In order
to assure that the sterile controlled trial worked effectively, different pH levels were
maintained during different period. It can be seen from Fig.1 that the pH of off-solution was
always higher than that of on-solution indicating that acid was continuously consumed. But
the acid consumption of the four column leaching was different (Table.1). This could be
explained by synthesizing the acid consumption and production. Smaller particle size ores
have on bacterial attachment to mineral which could have increased the amount of acid
generated by the organisms [5]. Compared the middle size with sterile control columns on the
acid consumption, the microbial inoculated in the column can save about 33% sulfuric acid
consumption.
Table 1. Acid consumption during preleaching and bioleaching.
Acid consumption [kg/t]

Particle size [mm]


5-10

10-15

15-25

control

Pre-leaching

9.507

9.353

9.337

9.353

Bioleaching

37.858

56.764

29.946

89.884

All

47.365

66.117

39.283

99.237

241

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 1. Changes of pH in leachate of three particle size ores (a) and the controlled
experiment(b).

Figure 2. Numbers of bacterial (a) and copper leaching rate (b)during bioleaching.
The bacterial growth in the leachate of three different particle sizes was shown in Fig.2a.
Three stages can be identified. In the first stage, due to the bacterial adsorbed on the surface
of ores and kept at adjustment period, the number of microbial during the first 25 days after
inoculation decreased. But since then with the absorbed microbial growing, more and more
microbial went into leachate; the numbers of microbial in off-solution began to increase [6].
In the last stage, the numbers of microbial in off-solution sharply decreased, it may be
attributed to decrease of ferrous iron in the medium which was an essential nutrient.
Fig.2b showed the copper leaching rate at three different particle sizes ores columns and
one sterile control column. As the particle size decreased, the copper extraction percentage
significantly increased, from 57.08% at 15-25mm particle size to 89.27% at 5-10mm particle
size. The increase of copper extraction percentage may be due to the increased surface area
and the short infiltration paths of the finer particles that can increase the reaction between the
copper ore and leachate [7]. The dissolution of copper at the sterile control test was 25%
lower than that at the same particle size with inoculation.
The solid residues were examined by the XRD and the results were given in Fig.3.
Compared with the sterile controlled test, pyrite and copper sulphide peak were weaker in the
inoculation test. It illustrated that the existence of microbial accelerated the oxidation of
sulphide ore. With the particle size decreased, jarosite and sulfur were obviously detected on
242

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
the surface of 5-10mm particle size ore [8]. This can be proved by the sharply decreased of
ferric concentration and the suppression of the copper leaching rate during the later stage of
bioleaching.

Figure 3. The XRD of spectra of


solid residues of bioleaching at 510mm and 15-25mm particle size

Conclusions
Particle size have significant influence on the bioleaching of Tibet of Yulong copper ore.
In 110 days, 89.27% of copper was leached at 510 mm particle size, while only 57.28% of
copper was leached at 1525 mm particle size. Compared with the non-sterile at the same
particle size(10-15mm), the inoculated column can improve 25% on the copper leaching rate
and cut down 33% on the acid consumption simultaneously.
References
[1]
M. Vera, A. Schippers, W. Sand: Appl Microbiol Biotechnol. (2013) Vol. 97, P. 752941.
[2]
K. Wakeman, H. Auvinen, and D. B. Johnson: Biotechnol Bioeng. (2008) Vol. 101, P.
739-750.
[3]
Y. Ghorbani, M. Becker, J. Petersen, A. N. Mainza and J. P. Franzidis: Minerals
Engineering (2013) Vol. 52, P. 38-51.
[4]
H. B. Zhou, W. M. Zeng, Z. F. Yang, Y. J. Xie and G. Z. Qiu: Bioresour Technol.
(2009) Vol. 100, P. 515-520.
[5]
P. A. Olubambi, S. Ndlovu, J. H. Potgieter and J. O. Borode: Hydrometallurgy. (2007)
Vol. 86, P. 96-104.
[6]
M. Nemati, J. Lowenadler and S. T. L. Harrison: Applied microbiology and
biotechnology (2000) Vol. 53, P. 173-179.
[7]
E. Darezereshki, M. Schaffie, M. Lotfalian, S. A. Seiedbaghery and M. Ranjbar:
International Journal of Minerals, Metallurgy, and Materials. (2011) Vol. 18, P. 138143.
[8]
A. H. Kaksonen, C. Morris, S. Rea, J. Li, K. M. Usher, R. G. McDonald, F. Hilario, T.
Hosken, M. Jackson and C. A. du Plessis: Hydrometallurgy. (2014) Vol. 147-148, P.
264-272.
243

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Study on the Gold Recovery of Double Refractory Gold Ore


Concentrate by Biological Oxidation Pretreatment
Wenjie Luoa, Hongying Yangb*, Zhenan Jinc
School of Materials &Metallurgy, Northeasten University, Shenyang 110819,
China
a66463863@qq.com, b,*correspondence:

yanghy@smm.neu.edu.cn,

cjinzn@smm.neu.edu.cn

Keywords: double refractory gold ore, bioleaching, CIL, carbonaceous substances.


Abstract. In this paper, Bacterial oxidation-cyanide leaching experiments were carried out
and the carbonaceous substances composition of carbonaceous gold concentrate was been
studied. The elemental composition was 9.73 % iron, 9.66 % sulfur, 4.84 % arsenic and
13.23 % carbon which element carbon and organic carbon was 12.11wt.% and 0.06 wt.%
respectively. The main carbonaceous substances were elemental carbon which the
morphology was dense and similar to graphite. The removal rates of iron, arsenic and sulfur
were achieved to 93.78%, 97.02% and 95.54% respectively by bioleaching, and the gold
recovery of oxidation residue reached 92.34% by carbon inhibited cyanide leaching process.
The sulfide minerals packing problem could be effectively solved by bacterial oxidation
process and greatly increased the gold recovery. So the bacteria oxidation and carbon
inhibited leaching process is applicable to the carbonaceous gold ore.
Introduction
The Bakyrchik gold ore localized in the east of the gold-bearing belt in the Kyzyl zone,
eastern Kazakhstan. The ore localized within black shales[1], it had carbonaceous matters
what had pre-robbing action for gold, and the main gold-bearing mineral is pyrite and
arsenopyrite, so the gold ore was double refractory gold ore.
The double refractory gold ore was pretreatment by the process of roasting, pressure
oxidation, chemical oxidation or bio-oxidation. Through pretreatment test of gold
concentrate, K.E. Sobel found that the high temperature Redox process could reduce the gold
adsorption capacity of carbon and gold recovery in excess of 95% was achieved by cyanide
leaching of the Redox product [2]. On the contrary, the results of researches demonstrated that
that most carbon could be oxidized by oxidation treatment but some carbon substances would
be active by heat in acid conditions and enhance the gold adsorption capacity [3,4]. Meanwhile
there were many toxic NO/NO2 gas produced in Redox process and it was very difficult to
recover and generated nitric acid. So the large-scale use of Redox process was limited.
Bioleaching is applied on an industrial scale to extractive metallurgy as it offers low cost
and environmentally friendly solutions, without strict requirements of operating conditions,
and is suitable for the treatment of complex and low-grade gold ores [5,6]. The studies
indicated that active carbon could reduce the ratio of ferric and ferrous (Fe 3+/Fe2+)[7,8], which
could maintain redox potential(Eh) in low valueThe results of previous studies considered
244

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
that the oxidation rate of pyrite and arsenopyrite had close relation with redox potential in the
liquid phase, the oxidation rate increase with the high of redox potential [9,10]. So the
carbonaceous substance had effect on the oxidation of the refractory gold ore. In this paper,
the feasibility of bio-oxidation on the carbonaceous refractory gold ore was studied using the
Bakyrchik gold concentrate in which the content of carbonaceous achieved 13.23%.
Experimental setup
Materials. The gold concentrate sample was taken from Bakyrchik gold ore in eastern
Kazakhstan. The grade of main chemical elements of sample was showed in table 1 and the
composition of carbonaceous substances was showed in table 2 which was determined by the
Leco CS230 carbon sulfur analyzer. It was shown there are lower iron, sulfur and high
carbonaceous substance. It was shown that the carbonaceous substance was mainly element
carbon in the gold concentrate from table 2. The Scanning electron microscopy (SEM)
images (fig 3) were obtained using a ZEISS Ultra Plus Field emission scanning electron
microscope. The morphology of the element carbon was dense and similar to graphite (Fig 1).
Table 1. Main chemical elements of gold conc.
Description

Au *

Ag*

Fe

Content
52.44
2.1
9.73
(wt.%)
*note: the Units of measurement of Au and Ag were g.t-1

Description
Concent
(wt.%)

As

9.66

4.84

13.23

Table 2. Main composition of carbonaceous substances.


Inorganic
Organic
Total carbon
carbon
carbon
13.23

1.06

0.06

Graphitic
carbon
12.11

Figure 1. SEM photo of element carbon.


Bacteria. Bacteria used in the study was named HQ0211, which was cultured and
domesticated by Northeast University Bio-metallurgy laboratory. It is a mixed oxidation
245

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
bacteria which constituted of Acidithiobacillusb ferrooxidans, Acidithiobacillus thiooxidans
and Leptospirillum ferrooxidans. The bacteria were cultured in 9K medium which contain
ammonium sulfate (3gL-1), potassium chloride (0.1 gL-1), dipotassium hydrogen phosphate
(0.5 gL-1), magnesium sulfate 7-hydrate (0.5 gL-1), calcium nitrate (0.01 gL-1) and ferrous
(9gL-1).
Bacterial oxidation experiment. The experiment was performed in 5 liters bacterial
oxidation stirred tank what contained 1000 mL of inoculum, 2000mL of 9K medium without
iron, and 300g gold concentrate which particle size was -0.036mm over 88%. The initial pH
was adjusted to 1.80 with 9N sulfuric acid.
Cyanide leaching experiment. Cyanide leaching tests were performed by a 500mL tank
with pulp density of 30%. The pH of leaching solution was adjusted by lime and the final pH
value was kept in 10.5-11. Analytical-grade sodium cyanide (NaCN) was used for cyanide
leaching experiments, which was kept 0.02% (w/v). Dosage of activated carbon was 5g.L-1.
The cyanide leaching experiments were conducted for 48 hours.
Results and discussion
Bacterial oxidation experiment. The change of Eh was shown in fig 2. The Eh sharply
reduced in the first day and began to climb form second day, it reached a maximum by 8 days
and the maximal value of Eh achieved 662 mV. It indicated that bacteria quickly adapted to
the environment and started the work of oxidizing sulfide mineral. After leaching for 11days,
the result of bacterial oxidation was shown in table 3. The content of iron, arsenic and sulfur
was lower in bacterial oxidation residue and the 93.78%, 97.02% and 95.54% removal rates
were achieved respectively. The results evidenced that carbonaceous carbon was little effect
on the bioleaching in this sample.
Table 3. The results of major elements for bacterial oxidation residue.
Description

Au*

Fe

As

Concent (wt.%)

64.75

0.84

0.55

0.20

oxidation
rate(%)

93.78

95.54

97.02

246

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Figure 2. Eh over time during bio-oxidation.
Two different separation methods were studied for washing and separated the liquid and
solid of the pulp after bioleaching. The first method was to simulate the counter current
decantation circuits (CCD) and the second method was to simulate the filter press and the
weight of oxidation residue was 229.8g and 234.9g respectively. The weightlessness achieved
23.4% and 21.7% and the loss of gold achieved 35.7% and 3.3% respectively. After bacterial
oxidation, the grain size of mineral become smaller, the ultrafine particle was difficult to
settlement and would take away of gold. The ultrafine particle could be kept in residue by
filter press. So there were more gold lost in the first washing method compared with the
second washing method.
Cyanide leaching experiment. In this sample, the main carbonaceous substances were
element carbon which form was almost similar graphite. The element carbon could adsorb
gold cyanide compounds and reduce the gold cyanide leaching recovery. Comparison of
adsorption capacity for gold cyanide compounds of activate carbon and element carbon in
sample(SC), the results shown the SC(adsorption capacity 5g.Kg-1) significantly weaker than
the activated carbon(adsorption capacity 18g.Kg-1 ), so carbon inhibited cyanide leaching
process (CIL) was been used for improving gold recovery in this sample.
The results of CIL experiment were shown in table 4. The gold recovery rate of bacterial
oxidation residue increased to 86.87% in 24 hours and it was 57.81% higher than direct
cyanide leaching. For 48 hours cyanide leaching results, the gold recovery of bacterial
oxidation residue increased to 92.34% and it was 57.56% higher than direct cyanide leaching.
As for the consumption of sodium cyanide (NaCN), it was nearly same for direct cyanide
leaching and bacterial oxidation residue cyanide leaching.
Table 4. Cyanide leaching results for the gold concentrate and bacterial oxidation
residue.
Description
Leaching
The grade of Au in Gold recovery
Consumption of
time (h)
cyanide residue (g.t
rate (%)
NaCN (kg.t-1)
1
)
gold
24
37.2
29.06
11.5
concentrate
48
34.2
34.78
13.25
bacterial
oxidation
residue

24

8.5

86.87

10.80

48

4.96

92.34

13.04

Conclusion
It was high content of carbon in Bakyrchik gold concentrate, the high Eh and removal rates
of iron, arsenic and sulfur indicated that the carbonaceous substance had little effect on the
bacterial oxidation process. As the oxidation of sulfide mineral, the problem of sulfide
inclusions was effectively solved. Due to the fine granularity is not easy to settlement, the
loss of gold was resulted in CCD, it could be solved by filter press process. The gold
recovery of oxidation residue was 92.34% with CIL, it had an increase of 57.56% over the
concentrate direct leaching, which showed Bacterial oxidation CIL was feasible for the
carbonaceous gold concentrate.
247

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Acknowledgements
The authors acknowledge the National Natural Science Foundation of China (51174062
and 51374066 ); Industrial research projects in Liaoning Province (2012223002).
References
[1] M.M. Starova, V.E.Bocharov: KazIMS, Alma-Ata (1977) Issue 7, p. 97.
[2] K.E Sobel,L. Bolinski, and K.A. Foo: Miner. Eng. 1995, vol. 8(4-5), p. 431440.
[3] E.A. Razvozzhaeva, V.K. Nemerov, A.M. Spiridonov, S.I. Prokopchuk: Russian Geology
and Geophysics (2008) Vol.49, p.371.
[4] Y WEI, K. Ahong, E. V. Adamov and R. W. Smith: Miner. Eng.1997, Vol.10(6), p.577.
[5] R. K. AmankwahW T YenJ. Ramsay: Miner. Eng. 2005, Vol 18(1), p.103.
[6] M. I. Muravvyov, A. G.Bulaev: Miner. Eng. 2013, Vol 45, p.108.
[7] H. Nakazawa, H. Fujisawa and H.Sato: Int. J. Miner. Process. 1998, Vol 55(2), p.87.
[8] W M Zhang, SH F Gu: Trans, Nonferrous Met. SOC. (2007), Vol 17(5): 11231127.
[9] A.W.Breed, S T L Harrison and G. S.Hansford: Miner. Eng. (1997), Vol 10 (9), p.1023.
[10] R. Ruitenberg, G.S.Hansford, M.A.Reuter and A.W.Breed: Hydrometallurgy (1999),
Vol 52 (1), p.3753.

248

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Spectroscopic and Microscopic Investigation for


Biohydrometallurgy
Keiko Sasaki*
Department of Earth Resources Engineering, Kyushu University
Fukuoka, 819-0395, Japan
*corresponding author, keikos@mine.kyushu -u.ac.jp
Keyw ords: bioleaching, pyr ite, chalcopyr ite, enargite, X -ray photoelectron
spectroscopy, FTIR, Raman spectroscopy, SEM - EDX, XAFS.

Abstract. In a process of bioleaching of sulfides, the surface of target


mineral is sometimes covered with intermediates and final prod ucts to
interfere the extraction of metal. Understanding characterization and
formation order of secondary minerals, which are responsible for passivation,
is a key to resolve the passivation. In the present article, identification of
secondary minerals an d intermediates in a process of bioleaching of several
sulfides by X-ray photoelectron spectroscopy, Raman spectroscopy,
identification of jarosite group minerals using Raman spectroscopy, and
expectation of formation order of secondary minerals by SEM -EDX and TEM
observation are overviewed. Direct observation of a nano -domain by TEM
provided a useful information on amorphous secondary minerals. In
bioleaching of arsenic-bearing copper sulfides, which are expected to be a
new target in the near future, a pa ssivation model was proposed to keep
maximizing Cu recovery and minimizing As solubilization, based on
combination of solid characterization with aqueous observation.
Introduction
Microbial oxidation of Fe 2 + and reduced sulfur species is a basic reaction
to dissolve sulfide in biohydrometallurgy. Depending on sulfides the detailed
reaction mechanisms are different, because the properties of chemical
bonding in sulfides, the releasing rate of ions, the interm ediate species and
the secondaril y formed minerals are different. For better understanding the
mechanism, not only bulk reaction but also interface reaction involving
biological tissues must be considered, where different techniques for direct
observation of minerals including spectroscopic anal ysis and microscopic
observation have contributed largel y in biohydrometallurgy. In the present
paper, the unique application of X -ray photoelectron spectroscopy, FT -IR,
Raman spectroscopy, SEM -EDX, XAFS SEM-EDX, and TEM to bioleaching
samples and their combination will be introduced. These techniques have
been well developed in material sciences, however, the same techniques
249

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
sometimes cannot be applied directl y or unsuitable to biohydrometallurgical
samples. The pres ent symposium can be a platform to share some modified
techniques for observation of biohydrometallurgical samples among
biohydrometallurgists.
Surface chemical speciation in bioleaching of
pyrite by X-ray photoelectron spectroscopy
Pyrite is a very common mineral and used be
an important resource of H 2SO4 in the past. In
these days the minerals in itself is not valuable,
but bio-oxidation of pyrite is economicall y very
important for pretreatment of gold ores, because
tiny gold grains are often present in p yrite as
well as arsenopyrite.
Konno et al. [1] have published the first paper
on XPS anal ysis of solid residues after bio oxidation
of
pyrite
by
Acidithiobacillus
ferrooxidans. It is d ifficult to separate inorganic
minerals from bacterial tissues, so organic
matters always accompany with the samples to
disturb the spectroscopic anal ysis under high
vacuum. Due to their less electron -conductivit y,
such samples induce differential charging effects.
Figure 1 shows changes in XP -spectra of S 2p for
solid residues after bacterial leaching of pyrite
with At. ferrooxidans. Five sulfur species can be
observed at the maximum. The lowest binding
energy of E B[2p 3/2] at 162.0 eV (A) is assigned
to pyritic sulfur. The 2nd lowest binding energy Binding energy, Eu/eV
of E B[2p3/2] at 163.8 eV (B), which has larger E Figure 1. XP-spectra of S 2p
B with 2.1-2.4 eV than the former, is predominant for
solid
residues
after
and assigned to pyritic sulfur which is bacterial leaching of pyrite
differentiall y charged. Other 3 sets o f peaks C, D, with At. ferrooxidans for (a)
and E are also differentiall y charged with the 1 day, (b) 4 days (c) 6 days ,
same E B , and assigned to elemental sulfur, (d) 8 days, (e) 11 days.
sulfite and sulfate, respectivel y. In a spectrum Vertical bars indicate 500
(a), differential charge is not observed probabl y cps [1].
because bacterial growth is not so much after one da y culture. The
differential charging shift should be observed in the same manner also in
other orbitals. In this samples, K 2p and Fe 2p spectra showed the similar
charging shift to S 2p because of the formation of potassium jarosite
(KFe3(SO4)2(OH)6). Also the intensit y ratio provides the information of
components, because the surface molar ratio is related with the intensit y ratio
between two components. Recentl y synchrotron radiation -based X-ray
diffraction is used effectivel y also for less crystalline a nd minor phases [2].
250

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Speciation of intermediate and secondary
minerals in bioleaching of chalcopyrite by
Raman and FTIR spectroscopy
Chalcopyrite is the most important Cu
resources as the primary Cu sulfides.
Electrochemical investigation has predicted
some copper sulfides as secondary minerals
formed in leaching, but not supported by
direct evidences. Laser Raman spectroscopy is
much useful for mineralogical identification
compared than FTIR because the information
in low wave number region is available [3 ].
Figure 2 shows that the band position of Cu -S
bonding in covellite (CuS) is a little higher
than those of S -S bonding in sulfur around
470-476 cm - 1 , sulfur has other larger band at
219 cm - 1 and that covellite is distinguishable
from chalcocite. From these standard spectra,
the intermediate is assigned to covellite not
chalcocite in earl y stage. Covellite is more
easil y oxidized than chalcopyrite, so it
graduall y disappeared with time. Small Figure 2. Raman spectra for
amounts of covellite is difficult to detect by solid residues after bacterial
XRD and no IR active, in addition, XPS does leaching of chalcopyrite with
ferrooxidans .
Vertical
not give distinguishable information of At.
bars
indicate
0.1
cps,
except
covellite from chalcopyrite.
for sulfur which is 20 cps[3].
Jarosite
(MFe3(SO4)2(OH)6)
group
minerals are well known to form as passivated
layers in bioleaching of sulfides, involving monovalent cations in leaching
solutions. Potassium, sodium, ammonium ions often assist the precipitation
of jarosite group minerals.
Reflection peaks in X -ray diffraction are close each other jarosite, so it is
not enough to distinguish. However, jarosite group minerals characteristic IR
bands in stretching vibration mode of SO 4 2 - , which is influenced by
monovalent cation involved. Depending on involved cations the stretching
vibration modes of v:(SO4 2 ") and v3(SO4 2 - ) are shifted, while the bending
vibration modes of v 2(SO4 2 - ) and v4(SO4 2 - ) are not so much shifted [4].
This propert y is caused by lattice parameter c in jarosite, depending on
monovalent cations. In bioleaching of sulfides in the bacterial medium, the
mixture of potassium jarosite and ammoniojarosite can be observed in FTIR
for the solid residues without decomposition of the solid.
Formation ordering of secondary minerals in bioleaching by SEM -EDX
Arsenic bearing copper sulfides, like enargite (Cu 5AsS4) and tennantite
(Cu12As4Sn) have not yet been considered as one of Cu resource targets to
251

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
exploit. These sulfides are d istributed in deep ore body and also difficult to
recover copper with suppressing arsenic, however, they are sometimes
accompanied together with chalcopyrite in heap leaching. Enargite is more
refractory than tennantite under strongly acidic conditions [5] . Inside the
heap, the temperature increases, sometimes at higher than 70 C even in
winter season in North Europe.
Extremophiles are majorit y in
.4.
brierleri
such
an
extremel y
unusual
condition. A thermophilic and
acidiphilic
iron -oxidizing
archearon of Acidianus brieleyi
is the representative one of them, and has been acclimatized under 100 mg/L
As(V) in advance.
XAFS anal ysis proved As speciation of As(III) in energite [6].
Biooxidation of dissolved
Fe 2 + by A. brieleyi supplies
Fe 3 + which oxidizes energite
to release arsenite (As(III))
as well as Cu 2 + ideall y.
Bioleached
minerals
for
different days are suspended
in resin, cut to provide the
cross-section for scanning
electron microscopy-energy
dispersive X-ray anal ysis
(SEM-EDX). The stratifying
distribution of the unreacted
enargite, amorphous sulfur,
and then scorodite and/or
jarosite i s clearl y observed
[7]. Sulfur zone is very
porous, probabl y amorphous.
LC-ICP-MS anal ytical results
proved the major species of
Figure 3. Schematic model of the bioleaching
dissolved As is arsenate
of enargite followed by the sequential
(As(V)), and also XRD
formation of secondary compounds in the
indicated the formation of
vicinit y of the enargite surface [7].
scorodite, which is believed
the stable storage for a rsenic.
Both of scorodite and jarosite are undistinguishabl y overlapped. They are the
fate of Fe(III), depending on provided Fe 2 + and As 3 + concentrations [8].
These results remind us one question is arising: how arsenite was oxidized
into arsenate. Enargit e does not provide energy source to A. brieleyi, but it is
electron conductive to transfer electron from a redox couple of Fe 3 + /Fe 2 + to
arsenate/arsenite. Enargite oxidation is mediated by Fe 3 +, which is reduced
to Fe 2 + and reoxidized by A. brierleyi. The mineral surface oxidation releases
Cu 2 + and H3AsO3 into the solution phase, while the S -entity is oxidized to
elemental sulfur that accumulates on the surface. H 3AsO3 is oxidized to
H2AsO4 - , with enargite surface acting as a thus catal yst. Arsenate formed
precipitates as scorodite and, in the absence of Fe 3 +, as cupric arsenate. In
252

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
the bulk medium, Fe 3 + precipitates as jarosite. The EPS layer may function to
sequester cations and form complexes with metal cations. Based on TEM
observation of the cross secti on of solid residual particles sliced b y
microtome, the schematic model of the interface between enargite and the
secondary minerals can be illustrated in Fig. 3. Later it was found that A.
brierleyi is able to oxidize arsenite into arsenate in the presenc e of peptone
[9]. This also facilitates to suppress arsenic release to keep Cu recovery from
arsenic bearing copper sulfides. Scorodite precursor, before crystallization,
was confirmed by the stretching vibration mode of v 3(AsO4 2 - ) using FTIR
spectroscopy [10].
Conclusions
Spectroscopic and microscopic observation provides interface and solid
information after bioleaching and biomineralization. Combination of plural
techniques is powerful for better understanding of the passivation mechanism
in bio-oxidation of sulfides.
References
[1]

H. Konno, K. Sasaki, M. Tsunekawa, T. Takamori, R. Furuichi, Bunseki


Kagaku, 40, 609 (1991).

[2]

H. Liu, J. Xia, Z. Nie, Hydrometal., in press.

[3]

K. Sasaki, Y. Nakamuta, T. Hirajima, O. H. Tuovinen: Hydrometal., 95,


153 (2009).

[4]

K. Sasaki, O. Tanaike, H. Konno: Can. Mineral., 36, 1225 (1998).

[5]

K. Sasaki, K. Takatsugi, K. Ishikura, T. Hirajima: Hydrometal., 100, 144


(2010).

[6]

K. Sasaki, K. Takatsugi, K. Kaneko, N. Kozai, T. Ohnuki, O. H.


Tuovinen, T. Hirajima: Hydrometal., 104, 424 (2010).

[7]

K. Takatsugi, K. Sasaki, T. Hirajima: Hydrometal., 109, 90 (2011).

[8]

K. Sasaki, K. Takatsugi, T. Hirajima: Hydrometal., 109, 153 (2011).

[9]

N. Okibe, M. Koga, S. Morishita, M. Tanaka, S. Heguri, S. Asano, K.,


Sasaki, T. Hirajima, Hydrometal., 143, 34 (2014).

[10] N. Okibe, M. Koga, K. Sasaki, T. Hirajima, S. Heguri, S. Asano, Miner.

Engng., 48, 126 (2013).

253

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Influence of Biological and Environmental Factors on Leaching


Efficiency during Chalcopyrite Bioleaching Process
Liyuan Ma1,2,a, Xingjie Wang1, Xue Feng1,2, Xue Guo1,2, Qi Hu1,2, Yunhua
Xiao1,2, Xiaodong Hao1,2, Yili Liang1,2, Huaqun Yin1,2, Xueduan Liu1,2,b,*
1. School of Minerals Processing and Bioengineering, Central South University,
China;
2. Key Laboratory of Biometallurgy of Ministry of Education, China
E-mail: amaliyuan@csu.edu.cn; bxueduanliu@csu.edu.cn
Keywords: bioleaching; biological factors; environmental factors; leaching efficiency.
Abstract. In the bioleaching process, many factors in ore, water and sediments are important
contributors as driving forces to improve leaching efficiency. In this study, FeSO47H2O and
S0 as energy substrates were added to an oxide-rich, low-grade copper ore to explore the
influence of biological and environmental factors on leaching efficiency. Mantel test results
showed that the leaching rate was significantly correlated with biological and environmental
factors with r values of 0.78 and 0.63 respectively, indicating that influence of biological
factors were more significant. It cannot be ignored that environmental factors were important
to construct the microbial community. Real-time quantification polymerase chain reaction
(RT-qPCR) showed that the dominant and minor species were A. caldus and A. ferrooxidans.
Canonical correspondence analysis (CCA) made it clear that pH and ferrous concentration
were crucial for shaping microbial community. All results are of great significant to gain the
optimal leaching condition on Zambia oxide-rich, low-grade copper ore.
Introduction
Bioleaching has already been successfully applied in biometallurgy for extracting metals
from low-grade ores [1]. It is an economical and environmental friendly method that iron- and
sulfur-oxidizing microorganisms can be adequate to build a loop of redox reactions [2, 3].
Solution conditions, including pH, Eh, temperature, aeration, additives, and concentration of
metal ions Fe2+, Fe3+ etc. have been widely investigated to develop an optimum leaching
system [4, 5].
Bioleaching is a complex reaction system that involved a combination of all kinds of
attributes. As it was described, latitudinal patterns of magnitude and interannual variability in
net ecosystem exchange were regulated by biological and environmental variables [6].
Likewise, these contributors in bioleaching system could be divided into two main parts:
biological and environmental factors which influenced with each other [7]. The relationships
among single environment factors, microbial population and the bioleaching performance
have been elucidate in many researches. While no researchers have analysed the relationships
between environment factors, microbial population and the bioleaching rate as a whole.
The purpose of this study is to investigate the impact of biological and environmental
factors on leaching efficiency conducted on an oxide-rich and low-grade copper ore from
Mulyashi, Zambias Luanshya Copper Mines (LCM). In the bioleaching process of low-grade
ore, microbial growth and metabolism could be obviously improved by the presence of
254

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
energy substance [8]. Moreover, previous studies have also suggested that ferrous iron and
sulfur can effectively improve mineral dissolution [9]. Energy substrate was introduced to
highlight the differences of biological and environmental factors. The hypothesis that
biological factors is more important for leaching efficiency was established on the basis of
the quantification of statistic analysis and was verified by chemical-phase analysis. And the
effect of environmental factors on microbial community was further discussed.
Materials and Methods
The typical bioleaching strains in the consortium were isolated from Acid Mine Drainages
(AMD) environment of Dexing copper mine (Jiangxi province, China) and purified by BOXPCR meanwhile identified by 16S rDNA. The strains including Acidithiobacillus
ferrooxidans DX2012, Sulfobacillus thermosulfidooxidans DX2012, Leptospirillum
ferriphilum DX12, Ferroplasma thermophilum DX2012, Acidithiobacills caldus DX2012
were mixed in a ratio of 1:1:1:1:1.
To investigate the influence of different factors on copper leaching process, an abiotic
control and two experimental groups were set up, namely ore only (named Z below), ore with
microbes (ZM) and ore with energy substrate and microbes (ZEM). Energy substrate contains
4.47 g/L FeSO4 and 1g/L S0. The ore was sterilized by autoclave and ultraviolet. The
bioleaching experiment was carried out in 500 ml shaking flasks containing 250 ml 9K
medium with an initial pH of 2.0 and 5% w/v pulp density. It was inoculated with 5106
cells/mL mixed microbes. Reactions were carried out at 40 C, 175 rpm. Microbes from
leachate and mineral particle surface were collected regularly in group ZM and ZEM.
Additionally, microbial community in pure culture with energy substrate only was detected at
the same time named EM as biotic control. All tests were conducted in triplicate. Mantel test
was used to evaluate the linkages between copper leaching rates and different attributes.
Canonical correspondence analysis (CCA) was used to identify the major factors controlling
microbial community assembly.
Results
Substrate of FeSO4 and S0 played a key role in the fluctuation of biological and
environmental factors (Fig. 1). Cell concentration and pH of group ZM remained stable in all
cycle. In group ZEM, energy substrate was functioned as a promoter to drive cell
concentration up to 1.5108 and pH down to 1.25. ORP of group ZEM reached to 650 mV in
one day. Particularly, the ORP of group ZM rose to about 580 mV rapidly and lasted for 14
days. At the early stage, ferrous concentration of energy-added groups decreased steeply,
accordingly pH rose in a short term.

255

2.4

(Z)
(ZE)
(ZSE)

18

(Z)
(ZE)
(ZSE)

2.2

15

2.0

12
9

1.8
1.6

1.4

3
0

1.2
0

10

12

14

Time (day)

10

12

14

Ferrous concentration (mg/L)

21

pH

Cell concentration (x10 cells/ml)

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
(Z)
(ZE)
(ZSE)

2800

C
2600
2400
400
200
0
-200

Time (day)
800

Time (day)

10

12

14

(Z)
(ZE)
(ZSE)

Eh (mV)

700

600

500

400

10

12

14

Time (day)

Figure 1. Variation of cell concentration (A), pH (B), ferrous concentration (C) and Eh (D) in
leachate.

(Z)
(ZE)
(ZSE)

1.6
1.4
1.2

750

1.0
0.8
0.6
0.4
0.2
0.0

700

650

600
0

Time(day)

10

12

14

al
tot
in
ore
er
pp
ery
Co
ore
Prim
ry
e
da
n
xid
co
do
Se
e
ine
xid
mb
eo
Co
Fre

ained in differ
ent
parts of res
idues(%)

800

copper rem

Copper concentration (mg/L)

Compared with the abiotic control, the dissolved copper concentration obviously increased
in the two experimental groups (Fig. 2A). In the microbial adjustment period for 2 days, there
werent any apparent differences. After the early stage, the copper concentration of group ZM
and ZEM, continuously increased to 728 and 775 mg/L, respectively. Residues analysis
showed that 85.08% and 86.81% copper was recovered in experimental groups while 72.00%
in the abiotic control. To assess the specific alteration, copper phases of free oxide, combined
oxide, secondary ore and primary ore in residues were detected by chemical analysis (Fig.
2B). Leaching rate for different copper phases was improved in experimental groups,
especially for the secondary ore which was increased from 9.04% in abiotic control to
73.87% and 71.32% in group ZM and ZEM.

Untreated
Abiotic control
ZM
ZEM

Figure 2. Copper concentration in leachate (A) and different copper phases in residues (B).
Visible differences in community dynamics of Group EM, ZM and ZEM were shown by
pie and line chart (Fig. 3). The community structure of EM (Fig. 3A) showed that all the
other four strains could grow well to 107-108 except A. ferrooxidans due to the constant
incubating temperature. When the same inoculation implanted on low-grade copper ore, the
community of group ZM changed gradually at a lower cell density (Fig. 3B). The dominant
and minor species were A. caldus and A. ferrooxidans. The most obviously inhibited strains
were F. thermophilum. While in ZEM (Fig. 3C), two heterotrophs of S. thermosulfidooxidans
and F. thermophilum fluctuated obviously.

256

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
0.05%
20%
20%
20%
20%
20%

73.83%

3.45%
3.87%

7.1% 15.57%

0.02%

0.01%
72.72%

9.3%
14.09%

39.89%
36.68%

0.01%

Cell concentration (log10cells/ml)

Cell concentration (log10cells/ml)

10.0
9.5
9.0
8.5
8.0
7.5
7.0
6.5
6.0
5.5
5.0
4.5
4.0
3.5

50.33%
21.18%

16.91%
10.35%
11.56%
13.06%

Time (day)
A

Cell concentration (log10cells/ml)

10.0
9.5
9.0
8.5
8.0
7.5
7.0
6.5
6.0
5.5
5.0
4.5
4.0
3.5

12

9.0
8.5

17%

75.06%

15.97%
14.01%
0.19%

0.86%
1.24%

87.35%
7.38%
4.2%

10.52%
12.33%

2.83%

82%
8.04%
6.02%

1.11%

0.78%

7.5
7.0
6.5
6.0
5.5
5.0
4.5
4.0
3.5

95.41%

6.44%

67.99%

8.0

0.01%
0.07%

0.05%

75.72%

0.69%

20%
20%
20%
20%
20% 1.84%

9.5

0.15%

20%
20%
20%
20%
20%

0.29%

10.0

0.66%

3.35%

73.39%
24.99%

0.52%

1.54%

Time(day)
B

12

0.01%

89.65%
5.79%
3.41%

1.14%

Time(day)
C

12

Figure 3. Microbial community dynamics of EM (A), ZM (B) and ZEM (C).


A. ferrooxidans;

S. thermosulfidooxidans;

L. ferriphilum;

F. thermophilum;

A. caldus

Discussion
Mantel test [10] of copper leaching rate with different attributes was conducted (Table 1).
The results showed that leaching rate was significantly (P<0.01) correlated with biological
and environmental factors with r values of 0.78 and 0.63, respectively. It was acknowledged
that microbial contribution was primarily on sulfide and environmental factors mainly
functioned on oxide [11]. A tentative inference on this result is that the difference of leaching
rate should be on sulfide rather than on oxide. And the hypothesis was supported by the result
of chemical-phase analysis. The leaching rate of oxide was 10% enhancement meanwhile the
more impressive enhancement was obtained on sulfide (Table 2). Sulfide leaching rate of
group ZM was still 4.8% higher than that of group ZEM even with lower cell concentration.
So it elucidated there was not an absolutely proportional correlation between the level of
leaching rate and the number of microbes.
Table 1. Mantel test of leaching rate with different contributors.
Attribute (unit)
Environmental factors

r value
0.63

P value
0.001

pH
Eh
ferrous
ferric

0.33
0.73
0.44
0.18

0.023
0.001
0.044
0.036

Attribute (unit)
Biological factors
A. ferrooxidans
S. thermosulfidooxidans
L. ferriphilum
F. thermophilum
A.caldus

r value
0.78
0.83
0.73
0.63
0.79
0.04

P value
0.001
0.001
0.001
0.002
0.001
0.328

Table 2. Oxide and sulfide leaching rate.


Rate of oxide
Rate of sulfide

Z (%)
78.55
13.74

ZM (%)
88.45
55.05

ZEM (%)
90.92
50.25

Although the above research work showed that the influence of biological factors were
more significant than environmental factors, its worth mentioning that environmental factors
257

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
were important to construct the microbial community. As a significant model at the
confidence level of P<0.01, the results of CCA demonstrated that pH, Eh, copper and ferrous
concentration were important environmental attributes controlling the microbial community
(Fig. 4).
It obviously can be seen that pH and ferrous concentration were crucial for shaping
microbial community structure. It revealed that A. ferrooxidans and S. thermosulfidooxidans
were suppressed by lack of ferrous. On the other hand, the dominant strain A. caldus, which
was correlated with the pH straight line, activated by acid. In the later stage, S.
thermosulfidooxidans and F. thermophilum fluctuated greatly due to the increased organic
carbon generated as primary production.
Figure 4. CCA tri-plot reflecting the correlations
between microbial community and environmental
attributes. Arrows on the graph represent
environmental attributes. Triangles represent the
five typical species. Circles represent groups of
ZM (I) and ZEM (IIA: early stage and IIB: late
stage).

Conclusions
The additives of FeSO4 and S0 were used to explore the influence of biological and
environmental factors on copper leaching efficiency of an oxide-rich, low-grade copper ore.
The results indicated influence of biological factors was more significant to copper leaching
rate than environmental factors. And environmental factors were important to construct the
microbial community.
Acknowledgments
This work was supported by National Basic Research Program of China (973 Program)
(No. 2010CB630901), Natural Science Foundation of China (NSFC 31170111) and the
Fundamental Research Funds for the Central Universities of Central South University.
References
[1] Rohwerder T, Gehrke T, et al. Applied microbiology and biotechnology, 2003, 63(3):
239-248.
[2] Watling H. Hydrometallurgy, 2006, 84(1): 81-108.
[3] Shahrabi-Farahani M, Yaghmai S, et al. Separation and Purification Technology, 2014.
[4] Dorado A D, Sol M, et al. Minerals Engineering, 2012, 39(0): 36-38.
[5] Mousavi S M, Yaghmaei S, et al. Bioresource Technology, 2008, 99(8): 2840-2845.
[6] Yuan W, Luo Y, et al. Global change biology, 2009, 15(12): 2905-2920.
[7] Zhu W, Xia J-L, et al. Bioresource Technology, 2013, 133(0): 405-413.
258

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[8] Chen P, Yan L, et al. Bioresource technology, 2011, 102(3):3260-7.
[9] Sand W, Gehrke T, et al. Hydrometallurgy, 2001, 59(2):159-75.
[10] Zhili H, Yvette p, et al. The ISME journal, 2012, 6(2): 259-272.
[11] Islam A B M R, Maity J P, et al. Journal of Hazardous Materials, 2013, 262(0): 989-996.

259

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Indium Extraction from Reiche Zeche Sphalerite and Community


Analysis of Acidic Mine Water
Nadja Gelhaar1, a *, Simone Schopf b and Michael Schlmannc
1Leipziger

Strae 29, 09599 Freiberg, Germany

anadja.gelhaar@ioez.tu-freiberg.de, bsimone.schopf@ioez.tu-freiberg.de,
cmichael.schloemann@ioez.tu-freiberg.de

* Corresponding author
Keywords: bioleaching, sphalerite, ore material, bacterial community analysis.
Abstract. During the process of industrialization, the world-wide demand for resources
steadily increases. Significant amounts of crucial metals and metalloids remain in low grade
mineral deposits, however using conventional metal extraction methods on these minerals is
not environmentally feasible. To overcome these problems, biohydrometallurgy has become
the focus of recent research. Biohydrometallurgy utilizes the activity of iron-oxidizing
bacteria to catalyze the dissolution of sulfide minerals, in our case local sphalerite (ZnS), with
the aim of winning zinc and indium. To achieve this enrichment cultures originating from
waters of the Reiche Zeche mine in Freiberg, Germany, were used as inoculum for two acidic
growth media. To explore the efficiency of the bioleaching process leaching tests have been
performed in shaking-flasks under laboratory conditions. Ground ore from Reiche Zeche is
mainly comprised of the sulfide minerals sphalerite, galena and pyrite. After the leaching
process both the solution and the residue were analyzed either by ICP-MS or XRD.
The results clearly show that it is possible to leach indium and zinc from natural sphalerite,
but that leaching efficiency is hindered, and dissolved indium removed, by the formation of
iron-hydroxy precipitates. Hence, optimal conditions for maximum indium recovery with
minimal precipitation have to be determined by variation of physico-chemical parameters.
Furthermore, the microbial diversity of Reiche Zeche mine waters were studied with
cultivation dependent and independent methods.
Introduction
Minimization of the pollution of water, soil and air, that is the result of conventional
mining methods, can be achieved by alternative techniques such as biohydrometallurgy,
namely bioleaching. Microbial metal extraction, especially from low-grade ores, is
considered to be more eco-friendly and feasible compared to conventional methods like
smelting.
Commonly acidophilic mesophilic bacteria like Acidithiobacillus ferrooxidans,
Acidithiobacillus thiooxidans [1] and Leptospirillum ferrooxidans are applied for bioleaching.
These iron- and/or sulfur-oxidizing bacteria grow optimally at low pH-values and
temperatures around 30C [2]. A. ferrooxidans and L. ferrooxidans derive their energy from
oxidation of ferrous iron, A. thiooxidans and A. ferrooxidans are also able to oxidize reduced
sulfur compounds like sulfides and elemental sulfur [3]. For the bioleaching of minerals with
high concentrations of heavy metals such as copper, zinc, uranium, lead, silver, and gold, A.
ferrooxidans was successfully used [46]. Sulfide ores often contain sphalerite, pyrite or
260

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
other compounds with complex matrices and mineralogical properties. Due to this
complexity, and the low solubility of some metals in general, limitation may occur during
biohydrometallugical processes [7]. There are studies reporting successful bioleaching of zinc
sulfide in columns or in shake flasks [810]. Since different experimental conditions and
specimens of ore material have been used in our experiments, the results vary to
aforementioned studies. The objective of the work presented here was to establish the
bioleaching of indium from sphalerite ore with bacteria enriched from mining effected sites,
and to identify the naturally occurring bacterial community in acidic Reiche Zeche mine
water.
Methods
Enrichment and cultivation. Environmental cultures were enriched from different
mining affected sites. LT1.5 was enriched directly from Reiche Zeche mine waters, TNS2
from the small canal Roter Graben which collects mine waters from several drainages
running out of Reiche Zeche. Each sample was used as inoculum for different media.
For leaching tests two widely used growth media for the cultivation of acidophilic ironoxidizing bacteria were used. Medium 9K [5] contains the following components (g/L):
(NH4)2SO4, 3.0; KCl, 0.1; K2HPO4, 0.5; MgSO4x 7H2O, 0.5, and Ca(NO3)2, 0.01. The
DSMZ medium no. 882 is comprised of (mg/L): (NH4)2SO4, 128.9; MgCl2x 6H2O, 51.9;
KH2PO4, 26.0; MgCl2x 6H2O, 213.2; MnCl2x 2H2O, 0.062; ZnCl2, 0.068; CoCl26H2O,
0.064; H3BO3, 0.031; Na2MoO4, 0.01 and CuCl2x 2H2O, 0.067. The pH value of each
medium was adjusted to 2.7 by adding H2SO4. After autoclaving, the appropriate amount of a
sterile-filtered FeSO4-solution was added to adjust the ferrous iron concentration to 72
mmol/L. The cultivation was in glass tubes at room temperature without shaking. After
growth occurred, cultures were regularly transferred into respective fresh medium.
To obtain conditions similar to the mine, besides aforementioned DSMZ media no. 882
(pH 2.7) without trace-element solution, two sterile filtered mine water samples from Reiche
Zeche, referred to as RZ2_4 and RZ2_7 were used. RZ2_4 contained the following
components (mg/L): SO4, 20900; Fe, 3500; Zn, 2460; Cl, 50; NO3, 27; Cd, 21.8; As, 18.9; In,
0.42; Pb, 0.29, and Ge, 0.01. RZ2_7 comprises (mg/L): SO4, 42100; Fe, 7300; Zn, 7160; As,
944; Pb, 0.29; Cd, 41.4; In, 0.22, and NO3, 0.13. A ferrous iron concentration of 25 mmol/L
was adjusted by adding sterile-filtered FeSO4-solution. The pH of RZ2_4 was 2.0, and of
RZ2_7 2.6. In each application a small amount of ground ore was added for adaption.
Cultivation temperature was at 12C, to reflect mine conditions, with a regular transfer of
cultures into fresh medium.
Mineral characteristics. Sphalerite was won from the mine Reiche Zeche (Freiberg,
Germany). The analysis of this material by X-ray diffraction (XRD) showed 25-30 %
sphalerite (ZnS), 15-25 % galena (PbS) and 25-35 % pyrite (FeS2) as the major components.
The minor minerals found in these samples were 10-15 % quartz (SiO2), 1-2 % siderite
(Fe(CO3)), and 1-3 % ankerite (CaFe(CO3)2). The elemental composition was analyzed by Xray fluorescence and was 33.0 % S, 19.6 % Fe, 18.0 % Zn, 13.5 % Pb and 5-6 % Si. Some
elements appeared in trace amounts only, for example 0.64 % Al, 0.2 % Mg, 0.54 % Ca, 0.42
% Mn, 0.18% Cu, 0.11 % Cd, and 0.0095 % In. Prior to bioleaching, the ore material was
sterilized by tyndalization.
Community analysis. For identification of the natural habitat of sphalerite leaching
bacteria, acidic mine waters that ran next to a sphalerite vein in Reiche Zeche were collected
261

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
and filtered. The bacterial DNA from this filtrate was extracted using the PowerSoil DNAIsolation kit (Mo Bio) and amplified with the primers 27f and 1387r. Purified 16 S rRNA
gene products were cloned using a Strataclone PCR cloning kit (Stratagene, La Jolla, CA)
following the manufacturers instructions. For the clone library construction 150 clones were
chosen. Digestion patterns from amplified ribosomal DNA restriction analysis (ARDRA)
were grouped and plasmid DNA of one or two representative clones per group were
sequenced. The NCBI database was used for alignment and taxonomical classification. The
phylogenetic tree was calculated with MEGA 6.0.
Bioleaching application. For leaching experiments 150 ml baffled, sterile Erlenmeyer
flasks were filled with 30 mL medium in triplicates. The pulp density of ground ore was 2 %.
The bioleaching experiments were conducted in a shaking incubator at 80 rpm and 30C for
30 days. Sampling for analysis was done periodically. The pH and redox potential were
monitored and the content of dissolved zinc, iron and indium were determined by a
combination of ion chromatography (IC), photometry and inductively coupled plasma mass
spectrometry (ICP-MS). Before and after the leaching process, the composition of
environmental cultures were checked by Terminal Restriction Fragment Length
Polymorphism analysis (T-RFLP) as described elsewhere [11].
Results and discussion

80

80

60

60

40
20

262
9K

882

Recovery rate [%]

Recovery rate [%]

Bioleaching of sphalerite-containing ore. As a result of iron oxidation during the


leaching process, the redox potential increased to 850 and 800 mV when using 9K and 882
media respectively. Due to formation of sulfuric acid, the pH decreased to a final value of 1.8
in 9K and 2.1 in 882 media. Analyses of the zinc concentration clearly showed that each of
the environmental mixed species cultures preferred one medium for zinc recovery (Fig. 1).
TNS2 performed better in 9K, reaching a maximum zinc recovery of 70 % after 20 days,
whereas LT1.5 was more successful in 882 where 75 % of the zinc was dissolved. These
results are comparable to the literature, where leaching rates of zinc at around 80 % could be
achieved from sphalerite [6,7]. Interestingly, bioleaching of indium from sphalerite was
successful as well. At the end of the leaching process a maximum indium recovery rate of 50
% in 882 and 32 % in 9K was obtained (data not shown). As the leaching tests in this work
were performed at an initial pH of 2.7, the formation of secondary minerals (schwertmannite,
jarosite) can limit the surface area contact between the leaching agent and mineral and thus
lower the metal extraction rate [8,9] Additionally, the high concentration of galena in the
mineral results in formation of insoluble lead sulfate [10]. The frequent formation of jarosite
in leaching experiments at pH values around 2 involves several cations like potassium,
ammonium and sodium [12]. The leaching residue analyzed yielded high concentrations of
lead-containing phases, elemental sulfur and jarosite. 9K contains higher ammonium- and
potassium concentrations than 882 media, which enhance jarosite formation. Indium
dissolved from sphalerite ore could be removed by incorporation in jarosite, resulting in the

40
20
9K

882

Figure 1. Comparison of zinc recovery rates for two different enrichment cultures (TNS2 (a.) and
0
10
20
30
0
10
20
30
9K and 882.
a.
Leaching time [d] LT1.5 (b.)) in media b.
Leaching time [d]

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
aforementioned poor indium recovery rates of only 30-50 %. The lower amounts of indium in
9K for both applications indicates a correlation between indium extraction and jarosite
formation and implies the formation of indium bearing jarosite. The reason for differences in
the extraction rates of the different media, depending on TNS2 and LT1.5, was found in the
composition of the environmental cultures analyzed via T-RFLP. In the presented
applications the key players are Acidithiobacillus as well as Leptospirillum or Acidiphilium.
In contrast to medium 882 the bacterial community of both cultures changed in medium 9K
during the leaching process.
Analysis of the leaching-site community. The characterization of the bacterial
community at a potential in-situ leaching site in the mine Reiche Zeche was meant to provide
information about the bacteria present. The comparison of the 16S rRNA-genes from the site
to entries in the database revealed Acidithiobacillus ferrivorans as a major component, as
well as other -proteobacteria like Acidiferrobacter sp. and members of the - and proteobacteria respectively. Another large group, with an amount of 32 %, belongs to
uncultured and unclassified species of proteobacteria. Representatives of Nitrospira like
Leptospirillum sp. could also be identified as well as members belonging to phyla
Actinobacteria and Acidobacteria like Acidobacteriaceae sp. with a relative amount of 3 %.
Cultivation at 12C. The temperature inside Reiche Zeche is at a constant 12C. Hence,
there is a crucial importance to cultivate iron-oxidizers with a high activity at those
temperatures. It was possible to enrich environmental iron-oxidizing cultures in medium 882
and sterilized mine-waters RZ2_4 and RZ2_7. Biological iron oxidation could be
demonstrated as well, but community analysis and investigation of the sphalerite leaching
efficiency is still in progress.
Conclusions
Bioleaching tests with sphalerite ore from Reiche Zeche were performed with focus on
zinc and indium extraction rate. It was possible to dissolve these metals with enrichment
cultures enriched from the mine. With regard to the indium bioleaching process some
problems could be detected, for example, low indium extraction rate and leaching
suppression due to formation of elemental sulfur, jarosite and other iron-hydroxides.
Furthermore, a community analysis of waters from a sphalerite rich site were performed,
showing that Acidithiobacillus is the main component. Cultivation dependent approaches at
12C were successful and a phylogenetic analysis is under construction.
Acknowledgements
The work was supported by the
Biohydrometallurgical Center Freiberg.

Dr.-Erich-Krger-Stiftung as

part

of

the

References
[1]

R. N. Kumar and R. Nagendran: J. of Hazardous Materials (2009) Vol. 169 p. 1119


1126.

[2]

S. Mousavi, S. Yaghmaei, M. Vossoughi, R. Roostaazad, A. Jafari, M. Ebrahimi, O.C.


Habibollahnia and I. Turunen: Bioresource Technology (2008) Vol. 99 p. 28402845.
263

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
[3]

W. Vishniac and M. Santer: Bacteriol Rev (1957) Vol. 21 p. 195213.

[4]

P. Olubambi, S. Ndlovu, J. Potgieter and J. Borode: Hydrometallurgy (2007) Vol. 86


p. 96104.

[5]

M.P. Silverman and D.G. Lundgren: J. Bacteriol. (1959) Vol. 77 p. 642647.

[6]

Y. Rodrguez: Hydrometallurgy (2003) Vol. 71 p. 5766.

[7]

S.M. Mousavi, S. Yaghmaei, M. Vossoughi, A. Jafari, R. Roostaazad and I. Turunen:


Hydrometallurgy (2007) Vol. 85 p. 5965.

[8]

L. Ahonen and O.H. Tuovinen: Hydrometallurgy (1995) Vol. 37 p. 121.

[9]

C. Gmez, M.L. Blzquez and A. Ballester: Miner. Eng. (1999) Vol. 12 p. 93106.

[10]

S.M. Mousavi, A. Jafari, S. Yaghmaei, M. Vossoughi amd R. Roostaazad:


Hydrometallurgy (2006) Vol. 82 p. 7582.

[11]

J.S. Tischler, R.J. Jwair, N. Gelhaar, A. Drechsel, A.M. Skirl, C. Wiacek, E. Janneck
and M. Schlmann: J. of Microbial Methods (2013) Vol. 95 p. 138144.

[12]

B. Nazari, E. Jorjani, H. Hani, Z. Manafi and A. Riahi: Transactions of Nonferrous


Metals Society of China (2014) Vol. 24 p. 11521160.

264

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Chalcopyrite Bioleaching at High Sulfate Concentrations


Suzanne M. Rea1b*, Naomi J. Boxall1,a*, Jian Li2,c, Christina Morris1,d and
Anna H. Kaksonen1,e
1CSIRO

2CSIRO

Land and Water Flagship, Private Bag No. 5, Wembley 6913, Western
Australia, Australia

Mineral Resources Flagship, 7 Conlon Street, Waterford 6152, Western


Australia, Australia

*correspondence: anaomi.boxall@csiro.au, bsuzyrea@westnet.com.au,


cjian.li@csiro.au, dchristina.morris@csiro.au, eanna.kaksonen@csiro.au

Keywords: bioleaching, copper, sulfate, bacteria, sulfide ores.


Abstract. The efficiency of chalcopyrite bioleaching in a high sulfate background was
evaluated using acidophilic microorganisms adapted to sulfate. The concentration of
magnesium sulfate added to mesophilic, moderately thermophilic and thermophilic
bioleaching tests was equivalent to 100, 40 and 80 g L-1 SO42-, respectively. Biological copper
extraction was highest at 45 C (67 %), followed by 60 C (54 %) and 30 C (16 %).
Quantitative x-ray diffraction (QXRD) analysis of the ROM ore and bioleached residues
revealed the complete disappearance of pyrrhotite and a significant reduction of pyrite at all
temperatures. Significant chalcopyrite was leached at 45 and 60 C; however, no
chalcopyrite was leached at 30 C. As the bioleach did not plateau after 31 days, it is possible
that higher copper yields may have been achieved with prolonged leaching.
Introduction
The efficiency of bioleaching sulfide (or oxide) ores in the presence of saline or brackish
waters is compromised, as acidophilic microorganisms are generally intolerant of high salt
levels. Chloride (Cl-) and sulfate (SO42-) anions are introduced to processes via water sources
(i.e. groundwater, sea water) and contaminants from low-grade ores. Research has shown that
as little as 1.5 g L-1 Cl- can affect the efficiency of a heap bioleach, although pure microbial
strains grown in the laboratory are able to tolerate much higher concentrations [1, 2, 3, 4]. In
contrast, acidophilic bioleaching microorganisms have been reported to tolerate much higher
SO42- concentrations [3, 4, 5] The literature suggests that bioleaching activity is lost at sulfate
concentrations exceeding 110 g L-1 [6]; however, some mining operations report
concentrations in excess of 180 g L-1 SO42- [7]. This study aimed to investigate the effect of
adaptation to increasing SO42- concentrations on the efficiency of bioleaching chalcopyrite by
mesophilic, moderately thermophilic and thermophilic bioleaching cultures. Adaptation and
identification of salt tolerant bioleaching microorganisms has the potential to reduce the
requirement for fresh, potable water, whilst also improving efficiency of bioleaching in
processes with a high saline background.

265

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Materials and Methods
Adaptation of cultures. Previously, cultures were enriched from environmental samples
obtained from the South-West of Western Australia (WA) [1] and revived from the CSIRO
Biotechnology culture collection and adapted to successive increases in SO42-. When growth
failed, 1 % (w/v) pyrite concentrate (Kalgoorlie Consolidated Gold Mines, WA, Australia)
was added to support growth of iron (Fe) oxidising cultures at high SO42- concentrations. All
concentrates were washed in ethanol and rinsed in deionised water three times to remove
organic solvents. The washed concentrate was filtered (Whatman paper no. 4), dried at 50 C
and sterilised by tyndallisation (100 C, 1 h, 3 successive days).
Bioleaching. Mesophilic, moderately thermophilic and thermophilic SO42--adapted Fe and
sulfur (S0) oxidising cultures were combined and inoculated into basal medium (pH 1.8)
containing 3 % (w/v) chalcopyrite concentrate (Mount Isa Mines [MIM], Queensland,
Australia) with yeast extract (0.1 g L-1). SO42- concentrations for bioleaching were
determined based on the highest concentration at which cell numbers were greater than 5
106 cells mL-1. Bioleaching tests were conducted in duplicate at 30, 45 and 60 C in shake
flasks (150 rpm) and with abiotic controls. Samples were obtained at day 0, 3, 7, 10, 14, 19,
26 and 31 of the experiment. Cells were enumerated in triplicate using a Thoma ruled
haemocytometer by phase contrast microscopy (100 objective). Solution pH was measured
using a TPS smart-CHEM meter with pHTPS double junction sensor and redox potential
using TPS MC-80 meter with IONODE ORP comb electrode model PRFO (Ag/AgCl
reference). Fe2+ was analysed in filtered (0.2 m) samples by the phenanthroline assay [8].
Soluble metals (Cu and Fe) and S concentrations were analysed by inductively coupled
plasma atom emission spectrometry (ICP-AES). The mineralogy of the chalcopyrite
concentrate and the bioleached residues were examined by quantitative x-ray diffraction
(QXRD) analysis using corundum (Al2O3; 25 w/w %) as an internal standard.
Results and Discussion
Adaptation of cultures. Mesophilic Fe and S oxidising cultures tolerated higher SO42concentrations than the higher temperature cultures, irrespective of growth substrate. At all
temperatures, S oxidising cultures were able to tolerate greater SO42- concentrations than Fe
oxidising cultures which was consistent with previous studies [1, 9]. Mesophilic cultures
grown on soluble Fe with or without the addition of pyrite tolerated 225 g L-1 MgSO47H2O
(87.7 g L-1 SO42- and 22.2 g L-1 Mg2+), in comparison to the S oxidising cultures which
tolerated up to 350 g L-1 MgSO47H2O (136 g L-1 SO42- and 34.51 g L-1 Mg2+). Similar results
were observed with the moderately thermophilic and thermophilic cultures; however, the
overall SO42- tolerance of both Fe and S oxidisers decreased with increasing temperature. The
maximum SO42- tolerance observed for mesophilic S oxidising cultures was 350 g L-1
MgSO47H2O (136 g L-1 SO42- and 34.51 g L-1 Mg2+), which was higher than previously
recorded (100 g L-1 SO42- ) [4]. Fe oxidation by Acidithiobacillus ferroxidans was shown to
be completely inhibited at approximately 20 g L-1 Mg2+, with concentrations below this not
affecting the rate of Fe oxidation [10]. However, for Leptospirillum ferriphilum, Fe oxidation
was affected at only 10 g L-1 Mg2+ [11]. Similar to SO42- tolerance, S oxidisers are generally
more tolerant of increasing Mg concentrations [12]. In this study, the maximum Mg
concentration for mesophilic Fe and S oxidising cultures was 22.2 and 34.51 g L-1,
respectively, which was in agreement with the literature. The high concentrations of SO42266

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
and Mg and the resulting ionic strength are likely contributors to the inability to adapt
cultures further.
Bioleaching. Bioleaching tests were undertaken at the maximum tolerable SO42concentration of 100, 40 and 80 g L-1, for the 30, 45 and 60 C cultures, respectively. Cell
numbers in all cultures were 108-109 cells mL-1 for the duration of the experiment. The Fe2+
concentrations remained < 200 mg L-1 and redox potential increased to > 500 mV within 5
days in all bioleach tests indicating biological Fe2+ oxidation. The pH of the bioleaching tests
gradually decreased as the experiment progressed, with the greatest pH change observed in
the 60 C culture (from pH 1.80 to 1.45), followed by the 45 C (pH 1.8 to 1.6) and the 30 C
(pH 1.7). Soluble Fe, Cu and S concentrations (Fig. 1A, 1B and 1C, respectively) were higher
in all bioleaching flasks when compared to abiotic tests. Fe extraction was highest with the 45
C culture with 40 g L-1 SO42- (26 %), followed by 30 C with 100 g L-1 SO42- (23 %) and 60
C with 80 g L-1 SO42- (18 %) (Fig. 1A). Biotic flasks showed an increasing trend in soluble S
which was consistent with the decrease in pH, whilst no significant change in soluble S was
observed in the abiotic tests (Fig. 1B). Highest Cu extraction was observed at 60 C (54 %),
followed by 45 C (37 %) and 30 C (16 %) (Fig. 1C), which is consistent with previously
reported bioleaching kinetics of chalcopyrite with unadapted cultures [13, 14, 15]. It is likely
that greater Cu extraction could occur with longer leaching periods as bioleaching curves did
not plateau after 31 days.

Figure 1. Fe (A), Cu (B) and S (C) concentrations during biological and abiotic leaching of
MIM chalcopyrite concentrate with a high SO42- background at 30, 45 and 60 C. Initial SO42concentrations (g L-1) in the growth media are indicated in parentheses.
Mineralogy of leach residues. The MIM chalcopyrite concentrate contained pyrite,
pyrrhotite, quartz and clay minerals (Table 1). In addition, trace amounts of gypsum, jarosite
267

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
and melanterite were also detected; however, these were determined to be secondary minerals
that may have been formed by the oxidation of the mineral during storage. Pyrrhotite and the
majority of pyrite were bioleached at all temperatures and some chalcopyrite was leached at
45 C and 60 C, but none was leached at 30 C. This is consistent with bioleaching of
chalcopyrite at low temperatures [16]. Jarosites were detected in the leach residues of the 45
C and 60 C cultures. The 45 C residues contained more potassium, sodium and/or
hydronium jarosites, and the 60 C culture residues contained more ammonium jarosite
(Table 1).
Conclusions
Bioleaching microorganisms adapted to increasing concentrations of SO42- were able to
bioleach Cu from a MIM chalcopyrite concentrate in a high SO42- background. Mesophilic
bioleaching was slower and had lower extraction efficiency than moderately thermophilic and
thermophilic bioleaching; however, extraction efficiencies were similar to those of
bioleaching tests with low SO42- concentrations, which indicated that adaptation to increasing
SO42- concentrations may improve bioleaching in high SO42- backgrounds. The bioleaching
cultures used in this study were tolerant of higher concentrations of SO42- than previously
reported. Further research will be targeted at continuing microbial adaptation to higher SO 42concentrations and optimising chalcopyrite bioleaching in a high SO 42- background to
improve leaching efficiency.
Table 1. Mineralogical composition (w/w %) of the MIM concentrate and leach residues
following high SO42- biological (B) and abiotic (C) leaching at 30, 45 and 60 C.
Minerals

Quartz
Pyrite
Pyrrhotite
Chalcopyrite
Sulfur
Melanterite
Jarosite
Ammonium
jarosite
Gypsum
Clinochlore
Talc
Unaccounted

Ideal formula

SiO2
FeS2
Fe1-xS, x = 0-0.17
CuFeS2
S8
FeSO47H2O
(H3O, K,
Na)Fe
3(SO4)2(OH)6
(NH )Fe
(SO ) (OH)
4

4 2

9
5
0.6
64

5 2

Leach residues
30 C 30 C 45 C 45 C 60 C 60 C
A
B
A
B
A
B
10
5
0.8
71
0.3

3
3

11
0.4
71

10
7
0.4
67
0.9

13

10
6

15
1

56

62
3

45
2

13
4

5
1

21

3
6
5

2
6
6

3
6
7

CaSO42H2 O
(Mg,Fe++)5Al(Si3Al)O10(OH
)Mg
8
(Si O ) (OH)
3

MIM

2
2
5
6

2
5
5

2
6
5

2
6
5

Acknowledgements
The authors would like to acknowledge the CSIRO Minerals Flagship for funding this
research.

268

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
References
[1]

S.M. Rea, N.J. McSweeney, B.P. Degens, C. Morris, H.M. Siebert, A.H. Kaksonen:
Min Eng 75 (2105), p. 126.

[2]

C.S. Gahan, J.E. Sundkvist, M. Dopson, . Sandstrm: Biotechnol. Biooeng. 106


(2010), p. 422.

[3]

C.A. du Plessis, J.D. Batty, D.W. Dew, in Biomining, edited by D.E. Rawlings and
B.D. Johnson. Springer-Verlag, Berlin, Heidelberg (2007) p. 57.

[4]

D.W. Shiers, K.R. Blight, D.E. Ralph, D.E: Hydrometallurgy 80 (2005), p. 75.

[5]

K.R. Blight, D.E Ralph: Hydrometallurgy 73 (2004), p. 325.

[6]

H.R. Watling, E.J. Watkin, D.E. Ralph: Environ. Technol. 31 (8-9), (2010), p. 915.

[7]

F.M. Adaos: oral presentation at the IBS (2013), Antofagasta, Chile.

[8]

3500-Fe: APHA, Washington, DC (1992), p. 1100.

[9]

L. Harahuc, H. M. Lizama, I. Suzuki: Appl. Environ. Microbiol. 66(3) (2000), p. 1031.

[10] H-m Li, J-j Ke. Hydromet. 61 (2001), p. 151-156.


[11] T.V. Ojumu, J. Petersen, G. S. Hansford: Hydromet. 97 (2008), p. 69.
[12] I. Suzuki, D. Lee, B. MacKay, L. Harahuc, J. K. Oh: Appl. Environ. Microbiol. 65
(1999), p. 5163.
[13] Y. Rodrguez, A. Ballester, M. L. Blquez, F. Gonzlez, J. A. Muoz: Hydromet. 71
(2003), p. 47.
[14] H R. Watling: Hydromet. 84 (2006), p. 81.
[15] J. Vilcez, K. Suto, C. Inoue: Int. J. Min. Proc. 88(1-2) (2008), p. 37.
[16] N. Pradhan, K.C. Nathsarma, K. Srinivasa Rao, L.B. Sukla, B.K. Mishra. Min. Eng. 21
(2008), p. 355.

269

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

The Relationship between Metabolic Pathways of Bacteria and


Pyrrhotite Bioleaching Behavior
Guo-hua GU1,a, Hui-sha YANG2,b, Chong-qing WANG3,c, Xiong-yi XU1
1

School of Mineral Processing and Bioengineering, Central South University, Changsha


410083, China
2 China

Nerin Engineering Co. Ltd., Nanchang 330031, China

School of Chemistry and Chemical Engineering, Central South University, Changsha


410083, China
aguguohua@126.com, b

774247566@qq.com, c18229472114@126.com

Keywords: pyrrhotite, bioleaching, Sulfobacillus thermosulfidooxidans, energy


sources
Abstract: The effect of Sulfobacillus thermosulfidooxidans, cultured respectively in the
mediums containing ferrous ion or solid sulfur in a long term, on the leaching behavior of
pyrrhotite was revealed through leaching tests and surface analysis of pyrrhotite leaching
residues using XRD and SEM. It was demonstrated that there was significant difference in
growth characteristic of S. thermosulfidooxidans, the leaching behavior and surface products
of pyrrhotite, when pyrrhotite bioleaching was conducted using S. thermosulfidooxidans
cultured in different mediums. It was suggested that the difference was chiefly due to
different metabolic pathways. The leaching behavior of pyrrhotite using S.
thermosulfidooxidans grown on ferrous ion was similar to that in the sterile acidic system,
and only leaching yield was slightly improved. This was attributed to that the ability to
oxidize sulfur of S. thermosulfidooxidans was weakened and thus the effect of the generated
sulfur could not be eliminated, leading to low iron extraction and low S.
thermosulfidooxidans reproduced ability for lack of growth energy. In the case of S.
thermosulfidooxidans cultured in medium containing sulfur, the ability to oxidize sulfur was
enhanced, the bacterium grew rapidly in the mid-term of leaching, which weakened the
suppressing effect of sulfur film and improved significantly pyrrhotite leaching. However, a
large number of jarosite was generated owing to the accumulation of ferric ions, and the
formed wrapping layer by jarosite and minor sulfur on mineral surface suppressed further
leaching of pyrrhotite.
Introduction
In bioleaching system, numerous factors affect the leaching efficiency and leaching
behavior of minerals, one of which is the characteristics of bacteria. A large number of
studies have shown that the same strain of the same bacteria cultured in different conditions
demonstrated different microbial behavior and activity, and various leaching effects to the
same mineral [1-5].
Bacteria utilize mainly iron-oxidizing and/or sulfur-oxidizing metabolic pathways to
accelerate the leaching of sulfide minerals. Then, is the metabolic pathway of bacteria related
to bioleaching efficiency and behavior, and what the effect is on leaching process? Related
studies published on this object are scarce. In our study, pyrrhotite was bioleached
270

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
respectively by the bacterium only possessing the ability to oxide iron and the mixed bacteria
mixed it with bacterium only possessing the ability to oxide sulfur. There was significant
difference in the bioleaching behavior of mineral and this was illustrated due to the different
metabolic pathways of bacteria[6]. In this paper, the effect of S. thermosulfidooxidans
possessing oxide ability for iron and sulfur on pyrrhotite bioleaching behavior was
investigated through culturing it in medium containing ferrous ion or solid sulfur in a long
term, respectively. The reason causing the difference in bioleaching behavior of pyrrhotite
was revealed by surface analysis of leaching residues using X-ray diffraction (XRD) and
scanning electron microscope (SEM), and the relationship between metabolic pathways of
bacteria and pyrrhotite bioleaching behavior was further examined.
Materials and methods
Pyrrhotite preparation. The samples of pyrrhotite used in this study were obtained from
Da Baoshan Mining in Guangdong Province, China. Samples were crushed, dry ground and
sieved to obtain suitable size less than 0.074 mm for bioleaching experiments. Chemical
analysis showed pyrrhotite contained 58.28 % Fe, 37.7 % S. The X-ray diffraction (XRD)
analysis indicated that composition of the ore was mainly pyrrhotite with a small amount of
quartz.
Microorganisms and culture media. Sulfobacillus thermosulfidooxidans (Shorthand for
S.t) used in the experiments was provided by the Key Laboratory of Biometallurgy in Central
South University, China, which was cultured in medium 9K using rotary shakers at 160 rpm
with initial pH of 1.6 and temperature of 52. The 9K medium: (NH4)2SO4 (3g/L), KCl
(0.1g/L), K2HPO4 (0.5g/L), MgSO47H2O (0.5g/L), and Ca(NO3)2 (0.01g/L). The energy
source was either FeSO47H2O (20g/L) or S (10g/L). Yeast extract (0.02% wt/vol) was also
added to support the growth of S.t.
Bioleaching experiments. Bioleaching tests were carried out in 250 ml Erlenmeyer flasks
containing 100 mL medium. The 9K basal salts medium without sulfur or iron was used in
the pyrrhotite bioleaching experiments. The mineral concentration was 1% (wt/vol), and the
inoculation of S.t cultured in different energy source was 5107 cells/mL. The abiotic control
was also conducted as parallel experiment. All leaching tests were operated for 10 days. The
progress of bioleaching was monitored through measurement of the concentration of total
iron and cell concentration. H2SO4 (4.0 M) was employed to adjust the pH value. The
bioleaching pyrrhotite residues were filtered, dried in air, and analyzed by XRD and SEM.
Results and discussion
Pyrrhotite bioleaching. The variation of total iron extraction and cell concentration
during bioleaching by S.t grown on different energy sources and abiotic control were shown
in Fig.1. It could be seen from Fig.1a that the leaching efficiency was completely distinct
using the same strain cultured in different energy source mediums. As to bioleaching by S.t
grown on sulfur, the total iron extraction reached 70.38% just at 6th day, and thereafter the
leaching rate began to decline and the total iron extraction was descended to 65.28% at 10th
day. In comparison, the leaching rate increased slowly with respect to S.t grown on ferrous
iron, only 28.05% iron was achieved, which was 9% higher than that in abiotic control.
Fig.1b showed that long-term culturing of S.t in different energy source presented different
growth characteristics in bioleaching system of pyrrhotite. The cell concentration in the
271

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
presence of S.t grown on ferrous ion reduced with increasing of time, this could be due to the
fact that there were no enough energy sources available because small amounts of iron and
sulfur were released from bioleaching. And this leaded to low extraction of pyrrhotite. In the
case of S.t cultured in sulfur medium, in the early stage of bioleaching, bacteria grew slowly
owing to adapting to leaching environment and low energy sources available. Bacteria
entered the logarithmic phase and increased sharply in the middle stage. The growth curve
was consistent to extraction of pyrrhotite.
12

80

-1
7

60

(b)

2+
Fe adapted S.t
S adapted S.t

10
Cell concentration/10 mL

Total-iron extraction/%

(a)

abiotic control
2+
Fe adapted S.t
S adapted S.t

70

50
40
30
20

8
6
4

10

0
1

10

Time/d

10

Time/d

Figure 1. Total iron extraction (a) and cell concentration (b) changes during bioleaching of
pyrrhotite at pH 1.6 and 52C. (S.t grown on S0; S.t grown on Fe2+; abiotic control)
Microstructure characterization of pyrrhotite residues. The pyrrhotite was leached for
different time in the presence of S.t using ferrous ion or sulfur as energy source, and XRD
patterns and SEM of the residues are shown in Fig.2 and Fig.3, respectively.

300

(e)

(c)

20

30

40

50

60

70

10

80

20

60

Pyrrhotite
Sulfur

1000

(f)
(d)

50

(b)

70

80

Sulfur
Jarosite

200

400

200

600

300

Internsity(Counts)

800

Internsity(Counts)

(c)

40

Two-Theta(deg)

400

0
10

30

Two-Theta(deg)

100

0
10

500

100
50

100

200

150

300

200

Internsity(Counts)

400

Internsity(Counts)

250

500

Pyrrhotite
Sulfur
Jarosite

Sulfur

Pyrrhotite

(a)

(b)
600

700

20

30

40

50

60

70

80

10

20

30

40

50

60

70

80

Two-Theta(deg)

Two-Theta(deg)

Figure 2. XRD patterns of pyrrhotite residues leached by S.t at different leaching time : (a)
Fe2+ adapted S.t for 6 d; (b) Fe2+ adapted S.t for 10 d; (c) S adapted S.t for 6 d; (d) S adapted
S.t for 10 d
272

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
The XRD patterns of the pyrrhotite residues for different leaching time by S.t grown on
ferrous ion showed peaks corresponding to sulfur and pyrrhotite. From SEM analysis shown
in Fig. 3a and Fig. 3b, it could be seen that there were few deposits on the surface of
pyrrhotite residues after bioleaching for 6 days. But more products (sulfur identified by XRD
analysis) had coated on the mineral surface after bioleaching for 10 days. Combining with the
results of the iron extraction mentioned above, it was suggested that the ability to oxide sulfur
of S.t was weakened when S.t grown on ferrous ion for long time. And the elemental sulfur
produced at the later stage of bioleaching formed the passivation film to block continuous
iron extraction.
Fig. 2c presented that the main composition of the residues were pyrrhotite, sulfur and
jarosite after leaching for 6 days by S.t grown on sulfur. This indicated that, in this stage, the
leaching speed of pyrrhotite was quick and the ferric ions in leaching solution were
accumulated to a certain extent, which resulted in the formation of jarosite. And jarosite made
the surface of residues be coated by the dense reaction products as shown in corresponding
SEM micrographs. Furthermore, pyrrhotite was not detected in the residues after bioleaching
for 10 days, and this was attributed to that a mass of jarosite and sulfur formed and covered
compactly on pyrrhotite surface as shown in Fig. 3d.
(a)

(b)

(c)

(d)

Figure 3. SEM images of pyrrhotite residues leached by S.t: (a) Fe2+ adapted S.t for 6 d; (b)
Fe2+ adapted S.t for 10 d; (c) S adapted S.t for 6 d; (d) S adapted S.t for 10 d
Conclusions
When pyrrhotite was leached respectively by S.t cultured in mediums with different
energy sources in a long term, there was significant difference in growth characteristic of
bacteria, the mineral leaching efficiency and products of minerals surface. It was suggested
that the difference was related to the effect of growth conditions on energy metabolism ability
of bacteria. S.t cultured in sulfur medium had the stronger ability to oxide sulfur than that of
S.t cultured in ferrous ion medium.
Acknowledgments
273

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
This work was supported by the China National Basic Research Program No.
2010CB630903 and the National Natural Science Foundation of China Program No.
51374249.
References
[1] A. Das, Rao K. Hanumanth, P. Sharma, K.A. Natarajan and K.S.E. Forssberg. In:
Biohydrometallurgy and the Environment Toward the Mining of the 21st century, Part A.
edited by R. Amils and A. Ballester. (1999), p. 697
[2] Chen P, Yan L, Leng F, Nan W, Yue X, Zhang Y, Feng N and Li H. Bioresource
Technology, (2011) Vol. 102, p.3260
[3] K.A. Third, R. Cord-Ruwisch, H.R. Watling. Hydrometallurgy, (2000) Vol. 57, p.225
[4] D. W. Shiers, D. E. Ralph and H. R. Watling. Hydrometallurgy, (2010) Vol. 104(3-4),
p.363
[5] Gu G, Zhao K, Qiu G, Hu Y and Sun X. Hydrometallurgy, (2009) Vol. 100(1), p.72
[6] Gu G, Yang H, Hu K, Wang C, Xiong X and Li S. J. Cent. South Univ, (2015)
Vol.22,p.880.

274

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Enhanced Column Bioleaching of Copper Sulfides by Forced


Aeration
Mingqing Huanga, Yiming Wangb*, Shenghua Yinc, Aixiang Wud
School of Civil and Environment Engineering, University of Science and Technology
Beijing, Beijing 100083, P. R. China
aseango@126.com, bustbwym@126.com, ccsuysh@126.com, dwuaixiang@126.com

Keywords: copper sulfides, column bioleaching, forced aeration, leaching rates.


Abstract. To assess the effects of forced aeration on leaching dynamics of sulfides, five sets
of column bioleaching of copper sulfides using Acidithiobacillus ferrooxidans were
conducted when the aeration rates ranged from 0 to 150 L/h. The experimental results show
that forced aeration can ameliorate the porosity and flow rates throughout the heap, and
improve the bacterial concentration and oxidative ability. Forced aeration at the column
bottom can enhance the interactions of air, flow and particles, and then facilitate the heap
porosity and connectivity. The oxidant Fe3+ concentrations are proportional to the aeration
rates, and lead to an accelerating dissolution rate of sulfides. In addition, the bacterial
concentration, oxidative ability and Fe3+ concentration are susceptible to aeration rates, and
the forced aeration remarkably enhances the bioleaching when aeration rates are higher than
60 L/h compare to those with none or slight aeration.
Introduction
Bacterial heap leaching is an increasingly important alternative to extract metals from
sulfide ores with low grades[1,2]. The acidic solutions in the presence of microorganisms flow
through the heap by gravity, and consistently transform the solid sulfidic minerals to the
soluble sulfates. Oxygen is a fundamental element and efficient oxidant for bacterial leaching
of sulfides, and it usually penetrate into the heap by natural convection. However, the oxygen
concentration at the heap bottom may be far below the required values due to poor heap
permeability, and thus oxygen becomes a rate limiting factor for bioleaching[3]. Salomon-DeFriedberg and coworkers[4] found the oxygen concentration decreases dramatically from 10%
at the heap surface to 2~3% at 2 m deep, and barely no bioleaching proceeds downwards.
Therefore, forced aeration at the heap bottom indicates a possibility to increase leaching
rates by overcoming the oxygen shortness. Forced aeration has been applied as early as 1922
at Bingham Canyon copper mine, when the operators used large fans in the galleries below
the heap to provide extra air, and they found the aeration boosted the copper leaching rates[5].
In 1993, Girilambone copper mine firstly introduced the forced aeration in heap bioleaching
of copper sulfides and rewarded with greater copper recovery[6]. From then on, forced
aerations have been applied in series of bioleaching practices worldwide and regarded as a
key technology to enhance the bacterial leaching of sulfides[7-9].
However, the enhanced leaching mechanism by forced aeration in heap bioleaching stays
equivocal due to its complexity in measuring and detecting. In this study, some parameters,
such as flow rate, Fe concentration and Cu concentration are taken as indicators to assess the
effects of forced aeration on leaching dynamics. Firstly, the native microorganisms are
275

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
isolated and enriched from Zijinshan copper mine. Secondly, five sets of column bioleaching
of copper sulfides on the conditions of variable aeration rates are conducted. Thirdly,
leaching dynamics of flow rates, Fe concentration evolutions and Cu leaching rates are
discussed and analyzed. The experimental results may add some informative conclusions to
the heap bioleaching of copper sulfides.
Materials and methods
Mineralogy. The run out mine (ROM) were supplied by Zijinshan copper mine, China. The
total copper grade is 0.62% (Table 1), in which the secondary sulphidic copper and
protogenetic copper account for 89.13% and 3.42%, respectively. The main copper sulfides in
the samples are digenite, covellite and enargite, along with rare chalcocite, bornite and
chalcopyrite. The gangue minerals consist of dickite, quartz, alaunite and rare feldspar (Table
2).
Table 1. Elements composition of the copper sulfides.
No.
1
2
3
4
5
6
7
8
9

Elements
Cu
As
S
Fe
K2O
Na2O
MgO
CaO
Al2O3

composition[wt%]
0.62
0.038
2.6
3.86
0.067
0.074
0.055
0.46
10.84

No.
10
11
12
13
14
15
16
17
18

Elements
SiO2
SO3
Au
Ag
Pb
Zn
TiO2
Mo
Co

composition[wt%]
73.62
3.74
0.18 g/t
6.5 g/t
0.01
0.02
0.18
0.002
0.0024

Table 2. Minerals composition of the copper sulfides.


Minerals

pyrite

chalcocite

covellite

Energite

quartz

alunite

dickite

sericite

Composition[wt%]

5.8

0.64

0.38

0.16

65.62

12.12

15.2

0.08

Microorganisms. The microorganisms were collected from the surface of Zijinshan


bioleaching heap, China, where the water temperature was 26 C and pH was 2.6. Before
bioleaching, the strain was cultured in an orbital shaker with a rotary speed of 160 r/min at
30C, and the initial acidity was adjusted to pH 2.0 with 1 M sulfuric acid. Several
generations of bacterial successive cultivation and enrichment were sequentially carried out,
and the identifications of the bacteria showed that Acidithiobacillus ferrooxidans dominated
the bacterial communities. Thus, the 9K culture were used, which contains 0.1 g/L KCl, 0.5
g/L K2HPO4, 0.5 g/L MgSO47H2O and 0.01 g/L Ca(NO3)2.
Column bioleaching experiments. The column bioleaching experiments were conducted
in five plexiglass columns, 50 mm in inner diameter and 600 mm high. The top 30 mm of
columns were charged with 5 mm cobblestones as filtering layers, the medium 470 mm
were placed with ore particles finer than -8 mm, and the basin 100 mm was gas-stable
chambers. The columns were sealed except for the inlet and outlet solution pipes, so as to
prevent the disturbance from the atmosphere. Experimental parameters were set as Table 3.
The leisurely spraying systems were conducted, i.e. 3-day spraying and 1-day suspending in
the initial stage, and 2-day spraying and 2-day suspending in the later stage. Column 1
proceeded with natural convection, and the other four columns were supplied with forced
276

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
aeration from the bottoms every two days. The aeration lasted 2 h every time, and the
aeration rates were in the range of 20~150 L/h.
Table 3. Initial experimental parameters of column bioleaching by forced aeration.

C1

height of ore
layers[mm]
470

weight of
ores[g]
1852.1

inoculation of
bacteria[%]
15

spray intensity
[L/(m2h)]
240

aeration
rate[L/h]
0

C2

470

1799.4

15

240

20

C3

470

1889.3

15

240

60

C4

470

1847.2

15

240

100

C5

470

1909.3

15

240

150

No.

Statistical Analysis. During the course of the bioleaching experiment, 5 mL pregnant


leaching solutions (PLS) from each column was collected for determination of solution pH,
redox potential and ion concentrations (Fe2+, total Fe and Cu2+). The sampling and the
evaporation were compensated with sterile distilled water. The pH and redox potentials were
monitored by SX-620 pH monitor with Ag/AgCl as reference electrode at room temperatures.
Concentrations of total Fe (TFe) and Fe2+ were determined by titration with sodium
diphenylamine sulfonate as an indicator. The Fe3+ concentration was calculated by
subtracting the Fe2+ concentration from the TFe concentration. Additionally, Cu2+
concentrations were determined by EDTA spectrophotometer and WFX-110 type atomic
absorption spectrum.
Results and discussion
Evolutions of solution pH and redox potential. In the time frame of experiments, pH in
the pregnant leaching solutions decreases fast on the first 8~12 days, and continue to decrease
at a slower rate afterwards (Fig. 1). Though initial pH values in five columns are set as the
same, they decrease faster in the preliminary stages and behave lower final values when
aeration rates increase. In fact, pH is controlled by gangue contents and acid productions in
the leaching process. None of the gangues in the ROM is acid-consuming mineral, therefore
barely none sulfuric acid is consumed, and pH values in PLS tend to decrease consistently
during leaching. Moreover, dissolution of sulfides takes O2 as its main oxidant and produce
acid in biochemical reactions, which results in pH decrease.

Figure 1. Evolutions of solution pH


in PLS.

Figure 2. Evolutions of redox potentials


in PLS.
277

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Redox potentials throughout the experiments slowly increase in the initial stages,
dramatically increase in the medium stages and keep relatively stable in the later stages (Fig.
2). Redox potentials are mainly decided by Fe3+/Fe2+ values, which strongly affected by
bacterial concentration and oxidative ability. In the initial stages, the transition of Fe2+ to Fe3+
was limited due to low bacterial concentration. Sequentially, bacterial growth reaches a
logarithmic phase, when dissolution rates of sulfides and Fe3+ concentration increase sharply.
However, acid-accessible sulfides are leached when bacteria reach their stable phase or
decline phase, thus Fe3+/Fe2+ values keeps relatively stable.
Evolutions of solution flow rates. Solution flow rates in the five columns increase before
day 8 and decrease afterwards, and evolutions of flow rates in C2~C5 show nearly a same
pattern (Fig. 3). The final rate accounts for 74.3% of the initial rate on the condition of
natural aeration, while this proportion exceeds 92.6% in the presence of forced aerations.

Figure 3. Evolutions of flow rates in five columns with or without forced aeration.
Before day 8~12, irregular and unstable unsaturated flows preferentially flow to the areas
with greater porosity due to the uneven distribution of intra- and inter-particle porosity. These
preferential flows travel faster as fractures develop, thus show an increase of flow rates in the
initial stages. However, fine particles gradually aggregate at pore throats and start to form a
physical blocking or clogging. Likewise, chemical precipitation and hydrolyzate are produced
in the biochemical reaction among bacteria, acid, ions and gangues, and then narrow the flow
galleries. Generally, deterioration of heap porosity is irreversible, but forced aeration at the
column bottom can promote the interactions of air, flow and particles, disturb the structure
and stress equilibrium, and then ameliorate the heap permeability.
The solution flow rate is an important indicator for heap porosity and connectivity.
Though the final flow rates in the presence of forced aeration are higher to that without
aeration, their differences are not remarkable. The results indicate that porosity extension is
not the principal way to enhance bioleaching of sulfides.
TFe and Fe2+ concentrations. The evolution rules of TFe and Fe2+ concentrations are
identical with or without forced aeration (Fig. 4). Fig. 4 shows that Fe2+ concentrations
sequentially experience a consistent increase, sharp decrease and stable stage, while the ratio
of Fe3+/Fe2+ increase throughout the experiments.

278

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

(a) Natural convection (C1)

(b) Forced aeration rate of 20 L/h (C2)

(c) Forced aeration rate of 60 L/h (C3)

(d) Forced aeration rate of 100 L/h (C4)

(e) Forced aeration rate of 150 L/h(C5)

Figure 4. TFe and Fe2+ concentration variations in five columns with or without forced
aeration.
Pyrite (FeS2) is the main resource for Fe2+ and Fe3+ in PLS, and it tends to accelerate the
leaching of copper sulfides[10]. FeS2 can only be corroded by Fe3+ through the thiosulfate
mechanism; therefore, Acidithiobacillus ferrooxidans oxidize Fe2+ to Fe3+, so as to provide
sufficient oxidant for FeS2 dissolution. The variation trends of TFe concentrations vary
accordingly to the bacterial growth phases, and the final TFe concentrations are proportional
to the aeration rates.
Copper leaching rates. Copper leaching rates sequentially behave a lag phase, a rapid
growth phase and a relative stable phase throughout the experiments, as can be seen in Fig. 5.
When the aeration rates exceed 60 L/h (C3, C4 and C5), copper recoveries are higher than the
rest columns. Note that Cu recovery reaches 81.2% when aeration rate is 100 L/h compares to
70.4% in the absence of aeration. Also, forced aeration promote copper leaching rates at the
279

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
same period compare to those with none or low aeration rate. The Cu extraction rate is 34.1%
on day 16, while Cu recoveries are higher than 53.2% when aeration rates exceed 60 L/h at
the same period.

Figure 5. Copper recovery variations in five columns with or without forced aeration.
Due to relatively weak bacterial oxidative ability at the beginning, Fe3+ concentration
become the rate limiting factor for the leaching, thus copper leaching is retarded on the first
four days. Afterwards, Cu recoveries in C1 and C2 are continuing increase until reach a
stable state on day 40. However, Cu leaching rate behaves a different way in C3, C4 and C5.
When the aeration rates are higher than 60 L/h, Cu leaching rates increase dramatically on
day 4~20.These phenomenon attributes to mineralogy of the raw materials. The secondary
copper sulfides are acid-accessible, and dissolute through the polysulfide mechanism in the
presence of Fe3+. When these acid-accessible minerals and Fe3+ are consumed, a stationary
phase appears and lasts for 8~12 days. The variation of Cu leaching rates behaves an another
peak after day 24 until day 44, which means parts of covellite and/or primary copper sulfides
are gradually leached.
The Cu leaching rates in C3 (60 L/h), C4 (100 L/h) and C5 (150 L/h) are close, indicating
that, in this study, aeration rate is not the rate limiting factor for copper sulfides leaching. For
industrial heap leaching of copper sulfides, the standard aeration rates are usually 0.08~2
Nm3/(m2/h), which are much lower than the experimental parameters in this paper. Hence,
only a small proportion of forced aeration has been converted to efficient aeration. Further
studies should be carried out to understand the relationships of copper leaching rate, aeration
rate and efficient aeration.
Conclusions
(1)

(2)

(3)

Forced aeration at the column bottom can enhance the interactions of air, flow and
particles, and then ameliorate the heap porosity and connectivity, but porosity
extension is not the principal way to enhance bioleaching. Final flow rates in the
presence of forced aeration are higher to that without aeration at the same period.
The ratio of Fe3+/Fe2+ increase throughout the experiments with or without forced
aeration, and the final TFe concentrations are proportional to the aeration rates. The
isolated native microorganisms play an important role in transforming the Fe2+ to Fe3+,
and accelerating the FeS2 dissolution.
The forced aeration remarkably enhances the copper sulfides leaching when aeration
rates are higher than 60 L/h compare to those with none or slight aeration. The
bacterial concentration, bacterial oxidative ability and Fe3+ concentration are
280

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
susceptible to aeration rates, and the interactions of these factors directly lead to the
difference of Cu recoveries.
Acknowledgements
The authors would like to acknowledge the financial support for this work provided by the
National Natural Science Foundation of China (51374035).
References
[1]

J.A. Brierley, C.L. Brierley, Present and future commercial applications of


biohydrometallurgy, Hydrometallurgy. 59 (2001) 233-239.

[2]

J.A. Brierley, A perspective on developments in biohydrometallurgy, Hydrometallurgy.


94 (2008) 2-7.

[3]

M. Maley, W. Van Bronswijk, H.R. Watling, Leaching of a low-grade, coppernickel


sulfide ore: 2. Impact of aeration and pH on Cu recovery during abiotic leaching,
Hydrometallurgy. 98 (2009) 66-72.

[4]

H. Salomon-De-Friedberg, Quebrada Blanca: lessons learned in high-altitude leaching,


Meeting Preprint of Expomin 2000. Santiago, Chile, 2000.

[5]

W.J. Schlitt, History of forced aeration in copper sulfide leaching, Minerals &
Metallurgical Processing. 23 (2006) 57-66.

[6]

D.J. Readett, Straits resources limited and the industrial practice of copper bioleaching
in heaps, Australasian Biotechnology. 11 (2001) 30-31.

[7]

J.D. Batty, G.V. Rorke, Development and commercial demonstration of the BioCOP
thermophile process, Hydrometallurgy. 83 (2006) 83-89.

[8]

H.R. Watling, The bioleaching of sulphide minerals with emphasis on copper sulphides-a review, Hydrometallurgy. 84 (2006) 81-108.

[9]

C.S. Gahan, H. Srichandan, D.J. Kim, et al, Biohydrometallurgy and biomineral


processing technology: a review on its past, present and future, Research Journal of
Recent Sciences. 1 (2012) 85-99.

[10] S.M.J. Koleini, V. Aghazadeh, A. Sandstrm, Acidic sulphate leaching of chalcopyrite


concentrates in presence of pyrite, Minerals Engineering. 24 (2011) 381-386.

281

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Fluoride Toxicity in Bioleaching of Fluorapatite


Jarno Mkinen1,a, Pivi Kinnunen1,b, Mona Arnold1,c, Outi Priha1,d and
Tuija Sarlin1,e
1VTT

Technical Research Centre of Finland Ltd, Vuorimiehentie 3, PL 1000, 02044


VTT, Finland

ajarno.makinen@vtt.fi, bpaivi.kinnunen@vtt.fi, cmona.arnold@vtt.fi, douti.priha@vtt.fi,


etuija.sarlin@vtt.fi

Keywords: bioleaching, phosphorus, fluoride, toxicity, fluorapatite.


Abstract. The use of biohydrometallurgical processes may be restricted by microbial
inhibition due to inhibiting fluoride originating from the feed material. In this work,
phosphorus bioleaching experiments on fluorapatite ore were conducted in a reactor using Feand S-oxidizing bacteria, resulting in 56 % leaching yield for P, despite abundant (800 mg l-1)
F in the pregnant leach solution. In further F toxicity experiments it was observed that
aluminum had a significant role in decreasing the inhibition caused by F, by producing stable
complexes with Al. The bioleached ore contained plenty of Al, explaining why bioleaching
was not strongly inhibited.
Introduction
Food production is dependent of phosphate fertilizers, produced mainly from nonrenewable phosphate rocks. Since high grade phosphate rock reserves are depleting in the
future, more complex and lower grade deposits have to be utilized. However, these deposits
may be uneconomic for the common P recovery processes [1]. Thus novel phosphorus
recovery methods, viable also with lesser quality resources, should be introduced.
Bioleaching is a commercially applied method for solubilizing valuable base metals from
sulfide ores, and it may provide solutions also for P recovery. However, research has been
limited related to bioleaching of phosphate rocks, e.g. different apatite minerals [2, 3]. P
bioleaching yields of 70-79 % have been reported from fluorapatite with 100 g l-1 pulp
density, and the P solubilization is shown to be caused by sulphuric acid (Eq. 1), produced by
sulphur oxidizing microbes (e.g. Acidithiobacillus thiooxidans, At. ferrooxidans) (Eq. 2).
Ca5(PO4)3F + 5H2SO4 + 10H2O 3H3PO4 + 5CaSO42H2O + HF

chemical

(1)

S0 + 1O2 + H2O H2SO4

biological

(2)

Fluorapatite contains fluoride (Eq. 1), which is liberated into the pregnant leach solution
(PLS). The pH has a strong effect on the form of F and its toxicity [4,5]. In strongly acidic
conditions, in bioleaching, F is present as free undissociated HF, capable of penetrating
through cell membrane and dissociating into H+ and F-. Under the neutral pH of the cell H+
and F- destroy the difference in pH and cell activity. [6,7] Fluoride can cause inhibition of
bacteria already in 1.9 47.5 mg l-1 concentrations, and at least one industrial scale
bioheapleaching operation failed due to elevated F concentrations [8]. Therefore, if ore
282

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
contains F, it is essential to study its effects on the bioleaching process already in early
demonstration stages. The decrease of the concentration of free F ions by stable complexes
typically with aluminum [5,6], altering process parameters such as pH and redox potential,
and precipitation of F ions in situ [9] have been proposed as ways to reduce the toxicity of F.
Fluoride inclusion into jarosite is likely not a viable option to reduce F toxicity in bioleaching
[9].
The aim of this study was to demonstrate bioleaching of fluorapatite in scaled-up reactor,
as a continuum of earlier shake flask bioleaching experiments [4], in order to obtain more
accurate data about PLS and residual solids. Previous experiments showed that different
fluorapatite containing materials behave differently in bioleaching systems, and one reason
anticipated was F inhibition and its removal by Al, occurring in different concentrations in
ore samples. The Al was estimated to remove the F toxicity due to formation of stable
complexes. Therefore, in this paper, also F toxicity and Al effects were studied for used
bioleaching culture.
Materials and methods
Microorganisms. The mixed acidophilic bacterial culture previously enriched from a
sulfide ore mine site [10,11], contained A. ferrooxidans, A. thiooxidans, A. caldus, L.
ferrooxidans and Sulfobacillus thermotolerans, and was adapted earlier [3] to 10 % w/v low
grade fluorapatite ore.
Bioleaching of fluorapatite ore. The low grade fluorapatite ore contained 3.6 % P and 0.7
% F, and had an Al:F ratio of 6.2. The bioleaching experiment was performed in a continuous
stirred-tank reactor (CSTR), equipped with a top-entered agitator (propeller diameter 10 cm,
180 rpm), aeration (2.0 l min-1) and was maintained at 29 C. The reactor was filled with
modified 9 K medium without added phosphate or iron (3 g (NH4)2SO4, 0.5 MgSO47H2O,
0.1 g KCl, 0.01 g Ca(NO3)2 and 10 g S0 l-1; [12,13]), followed by inoculation (10 % v/v) of
the adapted acidophilic bacterial culture. The total solution volume was 2500 ml. After 8-d
pre-cultivation of microbes in the reactor, low grade fluorapatite ore was added (100 g l -1).
The leach solution was monitored by taking 60 ml samples for the pH, redox-potential and
PO4-P (Hach-Lange LCK 349) measurements. At the end of the experiment PLS was filtered
(0.45 m) and analyzed with ICP-MS. Solid leaching residue was analyzed with XRF.
Fluoride toxicity experiments. The experiments were conducted in duplicate, in 100 ml
shake flasks with 50 ml solution volume. The flasks were filled with modified 9 K medium
without added iron (as above but with 0.5 g l-1 K2HPO4), followed by inoculation (10 % v/v)
of the adapted acidophilic bacterial culture. The pH was adjusted to 1.6 with strong H2SO4.
Different NaF and/or Al(OH)3 concentrations were added to the flasks (Table 1), in order to
reach similar Al:F ratios as in the fluorapatite ore samples. F concentrations of 40 and 800
mg l-1 were determined at the end of the bioleaching experiments in shake flasks for
fluorapatite concentrate and in reactors for low grade ore, respectively ([3] and unpublished
results). Flasks were incubated in a rotary shaker (150 rpm, 30 C) for 27 days and the pH
and redox-potential was followed. At the end of the experiment, the suspensions were stained
with LIVE/DEAD stain (Invitrogen), and visualized with epifluorescence microscopy
(Olympus BX60) to observe live (green) bacterial cells and dead (red) bacterial cells.

283

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Table 1. Fluoride and aluminum concentrations in the F toxicity experiments. The Al:F ratios
were selected according to two ore samples, and F according to concentrations found from
PLS. FTOX5 represents the ore used in the reactor bioleaching experiment.
Name
Fluoride (mg/l)
Aluminum (mg/l)
Al:F ratio
FTOX1

FTOX2

40

FTOX3

40

0.08

FTOX4

800

FTOX5

800

5000

6.25

Results and discussion


Bioleaching of fluorapatite ore. The pH of the adapted bacterial culture was 1.2 after the
8-d pre-incubation. When low grade fluorapatite ore was added to the reactor, pH rose
immediately to 2.1 (Fig. 1) and kept increasing for seven days, but decreased then to a final
value of pH 1.6. As no acid was added, acidification was due to biological sulfuric acid
production from elemental sulfur. The P leaching was dependent on the pH (Fig. 1). In the
first day, > 1000 mg l-1 PO4-P was solubilized to leach solution, but when the pH rose, P
started to precipitate. When the pH decreased to pH 1.6, >2000 mg l-1 PO4-P was solubilized
to the leach solution.

Figure 1. The pH and phosphate concentrations measured in the reactor.


The PLS contained 2635 g l-1 total-P (ICP-MS) and leaching residue 1.6 % P (XRF) at the
end of the experiment, indicating a leaching yield of 56 % for P. The fluoride concentration
in PLS was 810 mg l-1, being magnitudes higher than inhibitory levels, 1.9 47.5 mg l-1,
presented in the literature [8]. Even though the bioleaching culture was adapted to
fluorapatite, a specific fluoride resistance was not likely to occur. Most likely the high
aluminum concentration in PLS (2000 mg l-1) reacted with fluoride, simultaneously removing
the toxic effects.
Fluoride toxicity experiments. The pH was followed as indication of biological sulphur
oxidation in fluoride toxicity experiments (Fig. 2). In F and Al -free conditions a final pH of
0.8 was reached (FTOX1). In the presence of 40 mg l-1 F the pH decrease was minor with a
final value of pH 1.3 (FTOX2). However, when 3 mg l-1 Al was added together with 40 mg l284

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
1

F, the pH decrease was again stronger (FTOX3). When F concentration was increased (800
mg l-1), the pH remained steady (FTOX4). When 5000 mg l-1 Al was introduced together with
800 mg l-1 F concentration (FTOX5), the pH rose rapidly to pH 3.5 and started to decrease
after 40 days. As Al was added as hydroxide, it first increased the pH, but the results clearly
show the decrease of pH as indication of sulfur oxidation later on.

Figure 2. The pH (average from duplicates) measured from the shake flasks with different Al
and F concentrations.
Abundant numbers of live bacteria were observed in suspensions containing both F and Al
(Fig. 3, FTOX3 and FTOX5). Suspensions with only F addition contained some live
microbes, but they were small in size, indicating inhibition (FTOX2 and FTOX4). Only a few
live bacteria were observed in suspension without F or Al (FTOX1).

Figure 3. Microscopy images of LIVE/DEADstaining from the fluoride toxicity experiment


solutions. Green = live cells , red = dead cells.
LIVE/DEADstaining showed more viable bacteria when aluminum was added together
with fluoride, indicating that the complexing reactions reduced the fluoride toxicity. Fluoride
remarkably reduced and weakened the bacterial population. A controversial observation was
done with reference experiment without fluoride and aluminum only some viable bacteria
were observed. The reason for this can be the low pH of 0.8 at the end of the experiment,
because it is outside the favorable conditions for bioleaching bacteria used in this experiment.
Conclusions
Our experiments showed how phosphorus bioleaching can successfully be implemented in
spite of the presence of fluoride, which is known to inhibit sulfur oxidizing bacteria. Results
285

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
showed that aluminum ions originating from the fluorapatite strongly complexed fluoride
ions in solution. The presence of leachable Al containing minerals may significantly reduce
the F toxicity during bioleaching.
References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]

M. Gharabaghi, M. Irannajad and M. Noaparast. Hydromet. 103 (2010), p. 96.


T.M. Bhatti and W. Yawar. Hydromet. 103 (2010), p. 54.
O. Priha, T. Sarlin, P. Blomberg, L. Wendling, J. Mkinen, M. Arnold and P. Kinnunen.
Hydromet. 150 (2014), p. 269.
Z. Peng, R. Yu, G. Qiu, W. Qin, G. Gu, Q. Wang, Q. Li and X. Liu. Trans. Nonferrous
Met. Soc. China 23 (2013), p. 812.
L. Sicupira, T. Veloso, F. Reis and V. Leo. Hydromet. 109 (2011), p. 202.
T.C. Veloso, L.C. Sicupira, I.C.B. Rodrigues, L.A.M. Silva and V.A. Leo. Biochem.
Eng. J. 62 (2012), p. 48.
D. Parsonage, P. Singh and A.N. Nikoloski. Mineral Processing & Extractive Metall.
Rev. 35 (2014), p. 44.
J.A. Brierley and M.C Kuhn. Hydromet. 104 (2010), p. 410.
L. Gunneriusson, . Sandstrm, A. Holmgren, E. Kuzmann, Kovacs K. and Vrtes A.
Hydromet. 96 (2009), p. 108.
M. Dopson, A.-K. Halinen, N. Rahunen, B. zkaya, E. Sahinkaya, A.H. Kaksonen,
E.B. Lindstrm and J.A. Puhakka. Biotechnol. Bioeng. 97 (2007), p. 1205.
A.-K. Halinen, N. Rahunen, A.H. Kaksonen and J.A. Puhakka. Hydromet. 103 (2009),
p. 92.
M.P. Silverman and D.G. Lundgren. J. Bacteriol. 77 (1959), p. 642.
C.Q. Xiao, R.A. Chi, W.S. Li and Y. Zheng. Miner. Eng. 24 (2011), p. 956.

286

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Roles of Oligotrophic Acidophiles (Alicyclobacillus) in Chalcopyrite


Bioleaching System: Shake Flask Evaluation
Liu Xingyua*, Zhang Mingjiangb, Liu Wenyanc, Chen Boweid, Meng
Chunyue and Wen Jiankangf
National Engineering Laboratory of Biohydrometallurgy, General Research Institute
for Nonferrous Metals, No.2 Xinjiekouwai Street, Beijing, China 100088.
a,*correspondence:

wellwoodliu@163.com, +86-(10) 82241312

Keywords: oligotrophic acidophiles, chalcopyrite bioleaching, microbial community.


Abstract. An oligotrophic culture of acidophiles (Alicyclobacillus) isolated from Dexin acid
mine drainage was evaluated for its synergistic effect in chalcopyrite bioleaching.
Bioleaching of chalcopyrite with and without the Alicyclobacillus culture was investigated at
different temperatures (33 oC, 45 oC and 65 oC) and a culture-independent approach based on
16S rRNA gene clone library was used to analyze changes in the microbial community
change during the bioleaching process. For 33 oC leaching tests, only the bacterial community
was analyzed, but for the other two temperatures, both the bacterial community and archaea
communities were analyzed. Results showed that at high leaching temperature (65oC),
Alicyclobacillus culture could increase copper leaching recovery from 57.83% to 60.7%.
While at relative low temperature (45oC and 33oC), adding Alicyclobacillus culture inhibited
copper bioleaching, copper leaching recovery decreased from 36.10% to 31.52% and from
34.02% to 21.97% respectively at 45oC and 33oC. Clone libraries analysis showed that
Alicyclobacillus helps the growth of genus Sulfobacillus at 45 oC while inhibiting the growth
of genus Leptospillum at both 33oC and 45 oC. Furthermore, when adding Alicyclobacillus
growth of Ferroplasma was limited and Acidoplasma was facilitated at 45oC. At 60oC,
adding Alicyclobacillus culture facilitated the growth of genus Metallosphaera while limiting
the growth of Leptospillum and Ferroplasma. The results showed potential application of
Alicyclobacillus in high temperature chalcopyrite bioleaching and bioremediation of acid
mine drainage.
Introduction
Biologically mediated iron (Fe) cycling is a crucial process in bioleaching system. The
potential for Fe(III) reduction seems to be widespread among acidophilic heterotrophs. Since
many acidophilic heterotrophs have been detected in commercial bioleaching heaps [1], their
roles in bioleaching systems need to be evaluated. In this research, oligotrophic acidophiles
(Alicyclobacillus) were isolated from Dexin acid mine drainage. Physiology study revealed
isolated Alicyclobacillus could reduce Fe(III) to Fe(II) under anaerobic environment. This
culture was evaluated for the synergistic effect in chalcopyrite bioleaching. With the 16S
rRNA-based clone library assay, the community dynamics, and the effects of chalcopyrite
bioleaching under different temperature are, respectively explored.

287

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Experimental setup
Bacteria and culture media. The autotrophic culture MBZ06 was a mixed culture from
Zijinshan bioleaching system and Dexin bioleaching system containing Leptospirillum
ferriphilum, Thermoplasma sp., Acidithiobacillus, Thiomonas arsenivorans, Ferrimicrobium
acidiphilum, Acidiphilium organovorum, Sulfobacillus, Acidithiomicrobium ferrooxidans,
Ferroplasma sp. The culture of oligotrophic acidophiles isolated from Dexin acid mine
drainage and consisted of three strains: Alicyclobacillus sp. A, Alicyclobacillus sp. B,
Alicyclobacillus sp. AP-AC.
The culture medium for Alicyclobacillus contained 3 g/L (NH4)2SO4, 0.1 g/L KCl, 0.5
g/L K2HPO4, 0.5 g/L MgSO47H2O, 0.01 g/L Ca ( NO3 )2, 0.5 g/L Tryptone, 0.25 g/L
Yeast extract, 0.25 g/L NaCl, then 5% chalcopyrite was added, and adjusted pH to 3.0. The
culture medium for autotrophic microorganism and synergistic bioleaching experiment
contained 3 g/L (NH4)2SO4, 0.1 g/L KCl, 0.5 g/L K2HPO4, 0.5 g/L MgSO47H2O, 0.01 g/L
Ca ( NO3)2, then 5% chalcopyrite was added, and adjusted pH to 2.0.
Mineral ore. The chalcopyrite ores used in the experiments were obtained from Dexing
copper mine located in China. The size fraction of the concentrate used was 53150 m.
The elemental composition of the ore was as follows (wt%): Cu, 0.12; Fe, 7.59; S, 4.71; Na,
0.63; K, 2.12; Mg, 1.10; Ca, 3.10; Al, 6.35; Si, 24.03; and As, 0.011. Copper was mainly
present in the form of chalcopyrite, which accounted for 73.17% of the copper minerals, and
others were in the form of secondary copper ore (4.43%), oxide copper ore (1.57%), silicate
copper ore (20.67%), etc.
Bioleaching experiments. The mineral sample was washed with 2 M H2SO4, distilled
water, and pure ethanol, in that order. Then the particles were dried in a vacuum desiccator at
room temperature. Two different leaching experiments were designed as follows: autotrophic
culture MBZ06 with and without Alicyclobacillus culture. The autotrophic culture MBZ06
(MJ-cl, BS, ZJ, 0Y, 6Y), oligotrophic culture were centrifuged to obtain cell pellet, which
was suspended and inoculated into shake flask with bioleaching medium and chalcopyrite
powder. Tests were conducted in triplicate. The bioleaching systems were cultured at 33 , 45
for 30 d and 65 for 10 d respectively, then samples were collected to analyse the
community structure and succession, and to determine the bioleaching efficiency of copper
and iron.
Sample preparation, DNA extraction, Community succession and function analysis.
For DNA extraction and clone library construction, the methods described previously[2] were
used. For the bacteria clone library, 16S rRNA genes were amplified by PCR with general
primers (27f and 1492r)[3]. For the Archaea, archaeal primers Arch21f and 1492r [4] were
used.
The 16S rRNA gene were curated and processed using the open-source program, Mothur
v.1.33.3 [5, 6], Sequences were aligned using the SILVA database, and chimeras removed
using the Uchime code [7]. The taxonomy of sequences was determined using the
classify.seqs command with trainset9_032012 and a cut-off of 80%. Distance matrices were
generated using a cutoff of 0.30.
Chemical analysis of the leached ore residue samples. Copper and iron in the samples
were analyzed using ICPAES.
Results and dcussion
288

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
Copper leaching rate and iron leaching rate at different test. Leaching efficiency of
chalcopyrite at different temperatures were analysed and the results were shown in Fig. 1.
Results showed that at high leaching temperature (65oC), adding Alicyclobacillus culture
could increase copper leaching recovery from 57.83% to 60.7%. While at relative low
temperature (45oC and 33oC), adding Alicyclobacillus culture inhibited copper bioleaching,
copper leaching recovery decreased from 36.10% to 33.34% and from 34.02% to 21.97%
respectively at 45oC and 33oC. For iron leaching rate, at relative high temperature (45oC and
65oC), adding Alicyclobacillus culture accelerated iron leaching, iron leaching increased from
8.63% to 14.41% and 31.52% to 31.85% at 65oC and 45oC respectively. While at low
temperature (33oC), adding Alicyclobacillus culture could decrease iron leaching recovery
from 24.48% to 22.66%.

Figure 1. Leaching efficiency of chalcopyrite at different temperature(CK33: Leaching test


without Alicyclobacillus culture at 33oC; 33: Leaching test with Alicyclobacillus culture at
33oC; CK45: Leaching test without Alicyclobacillus culture at 45oC; 45: Leaching test with
Alicyclobacillus culture at 45oC; CK65: Leaching test with Alicyclobacillus culture at 65oC;
65: Leaching test with Alicyclobacillus culture at 65oC)
Community structure comparison between samples. The composition ratio of microbes
in each sample was analysed and the results displayed in the bacteria community composition
bar graph (Fig. 2) and archaea community composition bar graph (Fig. 3). Clone libraries
analysis showed that Alicyclobacillus helps the growth of genus Sulfobacillus at 45 oC while
inhibiting the growth of genus Leptospillum at both 33oC and 45 oC. Furthermore, when
adding Alicyclobacillus, growth of Ferroplasma was limited and Acidiplasma was facilitated
at 45oC. At 60oC, adding Alicyclobacillus culture facilitated the growth of genus
Metallosphaera while limiting growth of Acidiplasma and Ferroplasma.
289

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Figure 2. Bacteria community composition bar graph

Figure 3. Archaea community composition bar graph


Roles of Alicyclobacillus culture. The utilization of Fe(III) and reduction of
schwertmannite Fe(III) and reduce schwertmannite by genus Alicyclobacillus was reported
previously[8]. Our research also finds that when Alicyclobacillus was present, the formation
of jarosite was diminished in chalcopyrite bioleaching at high temperature (unpublished data).
Considering the Fe(III) reduction ability, it seems under high temperature, that the presence
of Alicyclobacillus may: a. help to reduce jarosite; b. help to reduce Fe(III) coupled with
sulphur oxidation. By such means, the chalcopyrite bioleaching was facilitated. At relatively
low temperature, since genus Alicyclobacillus could reduce Fe(III), and maintain the Eh at
relative low level, the growth of iron oxidizers (Leptospirillum and Ferroplasma) would be
inhibited. In such an environment, the leaching of pyrite and other metal sulphides would be
restricted. This provides a possible application of Alicyclobacillus in bioremediation of acid
mine drainage.
Conclusions
Roles of oligotrophic acidophiles (Alicyclobacillus) in chalcopyrite bioleaching system
were studied in shake flask tests. Alicyclobacillus culture could increase copper leaching
recovery at high temperate, while at low temperature, it inhibited copper bioleaching. Clone
libraries analysis showed that Alicyclobacillus helps the growth of genus Sulfobacillus but
290

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
inhibited the growth of genus Leptospillum at low temperature. At high temperature, adding
Alicyclobacillus culture facilitated the growth of genus Metallosphaera but limited the
growth of Leptospillum and Ferroplasma. The results indicate Alicyclobacillus have
synergistic effect in high temperature chalcopyrite bioleaching and have untapped potential in
the bioremediation of acid mine drainage.
Acknowledgments
This work was funded partially by National Natural Science Foundation of China
(50904011, U1402234), The Ministry of environmental protection (201409042), Guangxi
scientific research and technology development plan (Guikegong14124004-3-1).
References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]

Xingyu, L., Bowei, C.,Jiankang, W: Advanced Materials Research.(2013)Vol. 825, p.


50-53
Xingyu, L., Bowei, C.,Jiankang, W.,Renman, R: Hydrometallurgy.( 2010) Vol.
104(34): p. 399
Lane, D.J.: In bacterial systematics edited by E. Stackebrandt and M.
Goodfellow(1991), p. 115-175.
DeLong, E.F.:Proc Natl Acad Sci USA. (1992) Vol. 89, p. 5685
Schloss, P.D., et al.,:Appl Environ Microbiol. (2009) Vol. 75(23),p. 7537
O'Brien, C.L., et al.,: PLoS One. (2013) Vol. 8(5), p. e62815
Edgar, R.C., et al.,:Bioinformatics. (2011) Vol. 27(16), p. 2194.
Silveira, C.B., et al.,: PLoS One. (2011) Vol. 6(3), p. e17789.

291

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia

Bioleaching of Aluminum Slags with Thermophilic Bacteria


R. E. Rivera-Santillan1,*, F. Patricio Ramirez1, V. D. Aguilar Perez 1.
1

Facultad de Qumica. Universidad Nacional Autnoma de Mxico, Ciudad


Universitaria 04510, Mxico, D. F. Mxico.

* E-Mail: relva@unam.mx; Tel.: +52-55-56-225-241; Fax: +52-55-56-225-228.


Keywords: bioleaching, aluminum salt slag, melting salts, foundry, sodium chloride,
potassium chloride.
Abstract. The recovery of metallic aluminum from the waste generated in the production of
secondary aluminum by bioleaching process using the nutrient medium MKM was
investigated. The development of this project was carried out due to the need to treat waste
foundry which have a major impact on the environment, using environmentally friendly
techniques, such as bioleaching. At work, bioleaching of smelting slag of aluminum
generated in the laboratories of the Department of Metallurgy, Faculty of Chemistry, UNAM,
was reported. Tests were conducted using thermophilic microorganisms at 70C in an orbital
incubator at natural pH, obtaining metallic clean aluminum, aluminum in solution and salts
solution. The pH, bacterial growth and redox potential were monitored daily. We conclude
that bioleaching of aluminum slags is feasible. The lack of information about the treatment of
this type of industrial waste, makes this research is pioneer in this field.
Introduction
In Mexico, all aluminum processed by the aluminum industry for making a wide range of
aluminum products is imported from countries where primary aluminum is extracted from
bauxite. In addition, foundry operations for recycling aluminum are made, resulting in
secondary aluminum. Recycling is an essential part of the aluminum industry, is currently
one third of the total aluminum consumed in the world, making this process to take economic
sense, technically and environmentally. The Aluminum used for recycling consists of
products of the processing of aluminum scrap and used old parts. Aluminum salt slags are
wastes generated in the secondary aluminum processing basically these solids contain
crystallized salt, particles of non-metallic components and metal drops. Depending on the raw
material mixture produced salt slag from secondary aluminum per ton ranges from 200 to
500 kg and typically contains metallic aluminum (10-20%), a mixture of molten salts (4055%), and aluminum oxide (20-50%). The conventional salt slag treatment consists slag
milling and sieving to recover the metal value (metallic aluminum), followed by leaching
with water at ambient or higher temperature and pressure to dissolve the salt in water and
separating the insoluble oxides. The salt is recovered by filtration and evaporation. The
residue, containing mainly aluminum oxide and other alloying elements, can be used after
washing or calcining, in various industries as cement, ceramics, construction, etc. Exist other
slag treatment technologies by aluminum smelting recovery, however are expensive and also
generate salt slag.
Salt slags have been classified as toxic wastes and hazardous disposal in landfills should
be managed in accordance with the law. Environmental regulations have forced the
secondary aluminum industry in Europe and the United States to consider recycling
292

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
technologies to reduce waste. Although they constitute a hazardous waste because they can
interact with water or moisture generating toxic gases or leaching of elements to the soil or
groundwater, it is important to become conscious that they are a residue with potential
economic value, especially in countries like Mexico where there is no production of
secondary aluminum, because recovery of byproducts as metallic aluminum, metal oxides,
reaction products of fluxes and residues unreacted salts is possible. In this context, this
research work present the bioleaching aluminum salt slag as a viable alternative technical and
economically, for the recovery of aluminum from salt slag generated in the smelting process.
The research is based on the possibility that acidophilic biooxidant microorganisms take
nutrients of fluxes or molten salts and oxidation of some metal species contained in the slag.
Materials and methods
A mixed strain of extreme thermophilic microorganisms and salt slag of aluminum was
used, available and obtained in the laboratories of the Department of Engineering Metallurgy,
Faculty of Chemistry, UNAM, respectly. Preparation by grinding aluminum slag for
characterization by SEM, X-ray diffraction and chemical analysis by acid digestion and ICP,
was done according to standard ASTM C-117-95. The adaptation of the bacteria was
performed in flasks in orbital incubator, preparing two cultures with MKM nutrient media
and thermophilic microorganisms (coming from a RBAL1 RELVA previous bioreactor)
and slag 40% solids. The cultures were maintained in orbital incubator at 70 C and 150 rpm.
The pH and bacterial growth were monitored periodically. The solid residues were weighed
and fused. The aluminum obtained was characterized by optical emission spectrometry and
metallographically to determine the metallurgical quality of the aluminum obtained by
melting the slag treated by bioleaching.
Results and Discussion
In the Fig. 1 and 2, it presents the results of the characterization of the used slag. In figure
1 it is observed that the main elements slag containing are Al, Mg, Cl, Na, K, O, Si, with
traces of F and S.

Figure 1. Characterization of the elements present in the slag by SEM-EDX.


In figure 2 the XRD analysis shows a rich aluminum and magnesium slag, with metallic
aluminun as well as Al, Mg and Cu oxides, in addition containing KCl (Silvita), NaCl
293

21st International Biohydrometallurgy Symposium (IBS) 2015


October, 5-9, 2015
Inna Grand Bali Beach Hotel
Bali, Indonesia
(halite), SiO2 (quartz), principally. The high aluminum and magnesium content indicates that
these slags are alloys of based elements and the flux used were NaCl-KCl, with a minimum
amount of fluoride.

Figure 2. Characterization of the used slag by XRD and ICP after acid digestion.
Figure 3 shows the results of monitoring of bacterial growth and pH during bioleaching
test for cultures A and B. In the growth graphics, in both curves typical behavior of bacterial
life cycle (conditioning, growth, stationary and finally death phase) is observed. In the flask
A a steady growth is observed around the day10, reaching a maximum on day 45, where it
remained stable until day 57, and then the microorganisms began to die. The decline in the
population of microorganisms starting approximately in the day 58 for both flasks, probably
attributed to its growth is limited by nutrient depletion in the salts of the slag.
In the pH graph the curves show a initial pH, close to 5, imposed by the natural pH of
MKM average and the inoculum, w