Food Microbiology 33 (2013) 252e261

Contents lists available at SciVerse ScienceDirect

Food Microbiology
journal homepage: www.elsevier.com/locate/fm

Analysis of bacterial diversity during the fermentation of inyu, a high-temperature

fermented soy sauce, using nested PCR-denaturing gradient gel electrophoresis
and the plate count method
Chia-Li Wei a, Shiou-Huei Chao b, Wen-Bin Tsai a, Pei-Shan Lee a, Nai-Hung Tsau a, Jhih-Shan Chen a,
Wen-Lin Lai c, James Ching-Yueh Tu d, Ying-Chieh Tsai b, *
a

Department of Biochemical Science and Technology, National Chiayi University, Chiayi City 60004, Taiwan
Institute of Biochemistry and Molecular Biology, National Yang-Ming University, Taipei City 11221, Taiwan
School of Medical Laboratory and Biotechnology, Chung Shan Medical University, Taichung City 40201, Taiwan
d
San Ying Foods Co., Ltd., Chiayi County 62151, Taiwan
b
c

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 20 September 2011
Received in revised form
14 July 2012
Accepted 2 October 2012
Available online 9 October 2012

The diversity of bacteria associated with the fermentation of inyu, also known as black soy sauce, was
studied through the nested PCR-denaturing gradient gel electrophoresis (DGGE) of samples collected
from the fermentation stages of the inyu production process. The DGGE proles targeted the bacterial 16S
rDNA and revealed the presence of Citrobacter farmeri, Enterobacter cloacae, Enterobacter hormaechei,
Enterococcus faecium, Klebsiella pneumoniae, Pantoea agglomerans, Salmonella enterica, Serratia marcescens, Staphylococcus sciuri and Weissella confusa. The bacterial compositions of 4 fermented samples were
further elucidated using the plate count method. The bacteria isolated from the koji-making stage
exhibited the highest diversity; Brachybacterium rhamnosum, E. hormaechei, K. pneumoniae, Kurthia
gibsonii, Pantoea dispersa, Staphylococcus gallinarum, Staphylococcus kloosii and S. sciuri were identied.
Koji collected during the preincubation stage presented the largest cell counts, and E. hormaechei,
K. pneumoniae, E. cloacae and Enterobacter pulveris were identied. In brine samples aged for 7 and 31
days, the majority of the bacteria isolated belonged to 4 Bacillus species, but 4 Staphylococcus species and
Delftia tsuruhatensis were also detected. This study demonstrates the benets of using a combined
approach to obtain a more complete picture of microbial populations and provides useful information for
the control or development of bacterial ora during inyu fermentation.
2012 Elsevier Ltd. All rights reserved.

Keywords:
inyu
Soy sauce
Bacterial diversity
Nested PCR-DGGE
16S rDNA

1. Introduction
Soy sauce is a traditional fermented seasoning in Asia. The
common method used to produce soy sauce is soaking soybeans in
water, steaming them, and then mixing them with baked wheat
our. The mixture is then inoculated with Aspergillus oryzae or
Aspergillus sojae and incubated at 25e30
C for 2e3 days, in
a process known as koji making. Subsequently, the koji is mixed
with a high concentration of salty water to obtain brine with a nal
concentration of 22e23% salt. The mixture is then aged at room
temperature for 6e12 months (Huang and Teng, 2004; Su et al.,
2005; Ko et al., 2009). Generally, soy sauces are divided into

* Corresponding author. Tel.: 886 2 2826 7125; fax: 886 2 2826 4843.
E-mail address: tsaiyc@ym.edu.tw (Y.-C. Tsai).
0740-0020/$ e see front matter 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.fm.2012.10.001

Chinese and Japanese types. The main difference between these

two types is that the former uses soybeans as the only ingredient,
whereas the latter uses soybeans and wheat (Lioe et al., 2010). Inyu,
black soy sauce, is another traditional type of soy sauce from
Taiwan that has special properties due to enhanced avors during
cooking (Chen, 1975). The traditional means of producing inyu also
consists of koji and brine fermentation steps, as used for soy sauce,
but the production process has several differences and additional
steps compared with soy sauce (Chen, 1975). Inyu uses black
soybeans as the only ingredient or as the main ingredient accompanied by 1e4% of baked our. The koji for making inyu is incubated
at 32e33
C for 5e7 days. The koji is then washed to remove spores
from the surfaces of the soybeans in a process known as koji
washing, which is carried out to avoid avor impairment. Subsequently, the koji is incubated at 43
C for 3e8 h to promote the
enzymatic digestion of the ingredients. The resultant koji is then

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

mixed with salt, loaded in a vat with salty water and covered with
a layer of salt. Finally, the resultant mixture is aged outdoors
without stirring for 2e4 months with exposure to sunlight.
Because of the nonsterile nature of koji making, there are
various types of microorganisms living in the fermentation
medium that are responsible for the unique avors and tastes of the
soy sauce. A. oryzae or A. sojae, the molds that the koji is inoculated
with during koji fermentation, produces extracellular enzymes that
hydrolyze the proteins and carbohydrates of the ingredients that
are involved in the brine fermentation (Lioe et al., 2010). Halophilic
lactic acid bacteria (LAB), such as Tetragenococcus halophilus, grow
during the early stage of brine fermentation and produce lactic acid
that acidify the brine (Huang and Teng, 2004). Salt-tolerant yeasts,
such as Zygosaccharomyces rouxii, grow rapidly, are associated with
decreases in the brine pH, and are capable of alcoholic fermentation
and the hydrolysis of various amino acids into their respective
alcohols during the middle stage of brine fermentation (Huang and
Teng, 2004). Salt-resistant yeasts, such as Torulopsis versatilis,
produce odor compounds during the maturation stage of brine
fermentation (Huang and Teng, 2004). Bacillus subtilis and Bacillus
mesentericus also contribute to the production of odor compounds
and create a more complex avor during brine aging (Huang and
Teng, 2004). However, the competition of the Bacillus species
with the molds decreases the production of amylases and proteases, rendering the bacteria as undesirable contaminants of koji
(Takazane et al., 1998). Because there are increasing demands from
the consumers and producers of fermented foods for high-quality
products that are free from bacterial contaminants, it is necessary
to understand and control the changes in bacterial ora that occur
during the fermentation process.
The traditional approach for studying the diversity of a microbial community consists of isolating and enumerating microbial
groups by growing them on various selective culture media and
identifying the predominant populations using phenotypic and
molecular techniques. However, in addition to being laborious and
time intensive, these culture-dependent approaches will not
identify strains or species that cannot grow on regular nutrient
media. As a result, culture-independent approaches that apply
molecular techniques based on the direct detection of DNA or RNA
in microbial ecosystems are particularly attractive for studying
microbial population dynamics both reliably and rapidly. Among
these methods, denaturing gradient gel electrophoresis (DGGE)
analysis is one of the most widely applied molecular techniques
(Muyzer et al., 1993). However, the GC-clamped primers used in
such analyses present sensitivity limitations when targeting lowabundance samples in natural environments (Vanbroekhoven
et al., 2004). Recently, this drawback has been addressed to
assess the microbial diversity of fermented soybean foods by using
nested PCR combined with DGGE (Kim et al., 2009; Lee et al.,
2010).
The aim of this study was to investigate bacterial communities
that were either contributively or undesirably associated with the
process of inyu fermentation by using a combination of culturedependent and culture-independent methods. Nested PCR-DGGE
of the V6eV8 regions of the bacterial 16S rDNA was used to
monitor the diversity of the bacterial populations that are associated with the 9 stages of inyu fermentation. Both koji samples and 2
brine samples, which appeared to contain all bands of all brine
samples in DGGE proles, were subjected to further evaluation of
their bacterial diversities using the plate count method. The isolates
were grouped and identied on the basis of their genotypic characteristics, as determined by randomly amplied polymorphic DNA
(RAPD) and 16S rDNA sequencing. To the best of our knowledge,
this is the rst report to reveal the bacterial diversity associated
with inyu production.

253

2. Materials and methods

2.1. Sampling procedures
Fermented samples were collected from the San Ying Foods Co.,
Ltd., Chiayi County, Taiwan. The manufacturing process is shown in
Fig. 1. The samples were fermented from July to November 2009,
during which the average monthly temperatures were 29.3
C,
28.7
C, 28.9
C, 25.0
C and 21.6
C in July, August, September,
October and November, respectively. The temperature of the fermented brine just under the top layer of NaCl, which was measured
at 16:00 on a sunny day in July 2009, was approximately 41
C.
Solid koji samples from the koji making (KM) and preincubation
(PI) stages and brine samples from the outdoor aging stages at 1 day
(1D), 1 week (1W), 2 week (2W), 1 month (1M), 2 month (2M), 3
month (3M) and 4 month (4M) were collected (Fig. 1) in sterile
bottles and transported to the laboratory at room temperature
within 1 h. On the same day, 40 g of the koji samples were
homogenized in 40 mL of sterile saline (0.85% NaCl) using a mortar
and pestle. The samples were then passed through 4 layers of
sterilized cheesecloth. Forty-milliliter aliquots of either the resulting ltrates or the outdoor-aged brines were centrifuged individually at 10,000  g for 10 min. The cell pellets were suspended in
2 mL of sterile saline, resulting in a 20-fold concentration of the
cells. One milliliter of the concentrated cells was aliquoted for DNA

Black soybean
Soaking
4 hours
Steaming

Aspergillus oryzae (108-9 spore/1 kg soybean)

Mixing
Room temperature
6 days
7 days

Baked rice bran (10 g/1 kg soybean)

Sample KM

Koji
Washing
Incubating
4550 C
95% humidity
8 hours

6 hours

Sample PI

Koji (750 kg)

Water (380 kg)

Mixing

NaCl (180 kg)

Covering
Covering
Aging
1 day
1 week
Outdoor
Sunlight
4 months

2 weeks

Sample 1D
Sample 1W
Sample 2W

1 month

Sample 1M

2 months

Sample 2M

3 months

Sample 3M

Inyu brine

Sample 4M

Fig. 1. The production diagram of inyu used in this study with the sampling points
indicated.

254

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

extraction. The other 1 mL of concentrated cells was mixed with

1 mL of sterile saline and centrifuged again. The pellets were
resuspended in 2 mL of Nutrient Broth (NB; BD Difco, MD, USA)
containing 10% dimethyl sulfoxide (DMSO), resulting in a 10-fold
concentration of the cells; these stocks were then stored at 80
C.
2.2. Analyses of pH and salt concentration
The pH values of the brine samples were measured with a DO
Microelectronic pH-Vision pH meter (model PHB-9901, Ai-On
Industrial Corp., Taipei, Taiwan). The salt concentrations (g/100 g)
of the brine samples were measured with a digital salinity refractometer (model PAL-03S, Atago Co., Ltd., Japan) after a 5-fold
dilution. The refractometer measures the concentration of salts
such as sodium chloride, magnesium and calcium sulfates in
liquids.
2.3. Microbial enumeration and isolation
The 10-fold-concentrated cells were serially diluted (100 to
10 ) in saline, and 100 mL of the appropriate dilution was plated on
NB agar supplemented with cycloheximide (100 mg/mL) alone or
with cycloheximide plus NaCl (5%, 10% or 15%, w/v). The plates were
incubated at 30
C for 2e3 days. The isolates were cultured in NB at
30
C for 1e2 days and were then washed with saline. After
centrifugation, the pellets were suspended in NB containing 10%
DMSO and stored at 80
C.
6

2.4. DNA extraction

Genomic DNA was extracted as previously described (Chao et al.,
2008), with some modications. Briey, cells from 200 mL of
overnight cultures of pure isolates (for RAPD ngerprinting), from
a piece of agar containing a pure isolate (for RAPD ngerprinting) or
from 200 mL of the 20-fold-concentrated cells from the collected
samples (for PCR-DGGE analysis) were added to 250 mL of lysis
buffer (200 mM TriseHCl, 80 mM EDTA, pH 9.0) and 50 mL of 10%
sodium dodecyl sulfate. The samples were incubated at 65
C for
20 min with occasional inversions, followed by cooling at room
temperature for 10 min. An equal amount of phenol was added and
inverted before centrifugation for 5 min at 12,000  g. The supernatant was collected and mixed with 1 volume of phenole
chloroformeisoamyl alcohol (25:24:1, v/v). After centrifugation,
the supernatant was mixed with 0.1 volume of sodium acetate (3 M,
pH 5.4) and 1 volume of isopropanol. Following another centrifugation step, the DNA was washed with 70% ethanol, air-dried and

nally dissolved in 30 mL of sterile TE buffer (TriseEDTA, pH 8.0)

and stored at 20
C.
2.5. PCR-DGGE analysis
Fragments of the bacterial 16S rDNA (547 bp, positions 968 to
1514 in the Escherichia coli numbering system) were generated by
PCR amplication of genomic DNA extracted from fermented
samples using the primers F-968 and Bac-1492R-II (Table 1 and
Fig. 2) under the PCR conditions described previously (Chao et al.,
2008). Subsequently, for each reaction, the PCR product was used
as a template for a nested PCR amplication that targeted the
segment of the bacterial 16S rDNA from nucleotide positions 968 to
1401 using the DGGE primers F-968-GC and R-1401 (Table 1 and
Fig. 2) to create a DNA fragment suitable for DGGE analysis. Nested
PCR was performed as previously described (Manninen et al.,
2006), except that 20 ng of DNA template and 2 U of Taq polymerase (Takara Bio Inc., Shiga, Japan) were used.
The products of the nested PCR amplication were analyzed by
DGGE using a Dcode apparatus (Bio-Rad Laboratories s.r.l., Milan,
Italy). The samples were applied to 10% (w/v) polyacrylamide gels
in TAE buffer (20 mM Tris, 10 mM acetate and 0.5 mM EDTA, pH
8.0). Parallel electrophoresis experiments were performed at 60
C
using gels containing a 30e65% urea-formamide denaturing
gradient (100% corresponded to 7 M urea and 40% [w/v] formamide). DNA was visualized by UV illumination after the gels were
stained in TAE buffer containing ethidium bromide and destained
in TAE buffer. Selected bands from the PCR-DGGE gel were excised
using a clean scalpel blade. Each slice was sectioned and placed in
an Eppendorf tube, and DNA was eluted in 30 mL of sterile TE buffer
by incubation at 4
C overnight.
The DNA was re-amplied using the GC-clamp primers as
described above and run on another DGGE gel for further separation with a narrower gradient range. The bands were excised, and
the DNA was re-amplied using the same primer set without the
GC-clamp under the same PCR conditions. The PCR products were
then sequenced by using the primer F-968 (Table 1 and Fig. 2).
2.6. RAPD ngerprints
RAPD-PCR analysis was performed as previously described
(Chao et al., 2008), with the following modications. The random
primers used in this analysis were primers A, 8, and OPL-05
(Table 1). The cycling program consisted of 1 cycle of 94
C for
2 min; 5 cycles of 94
C for 30 s, 36
C for 1 min and 72
C for 90 s;
29 cycles of 94
C for 20 s, 36
C for 30 s and 72
C for 90 s; and

Table 1
Primers used in this study.
Positiona

Reference

Genomic DNA
Genomic DNA
Genomic DNA
Bacterial 16S rDNA
Bacterial 16S rDNA
Bacterial 16S rDNA
Bacterial 16S rDNA
Bacterial 16S rDNA
Bacterial 16S rDNA
Bacterial 16S rDNA
Bacterial 16S rDNA

8e27
515e530
933e954
1541e1522
531e517
804e787
968e985
1514e1492

Chao et al., 2008

Johansson et al., 1995
Holzapfel et al., 1997
Chao et al., 2009
Chao et al., 2008
Chao et al., 2008
Chao et al., 2008
Chao et al., 2008
Chao et al., 2008
Nubel et al., 1996
Weisburg et al., 1991

Bacterial 16S rDNA

968e985

Nubel et al., 1996

Bacterial 16S rDNA

1401e1385

Nubel et al., 1996

Primer name

Primer sequence

Target

A
8
OPL-05
8F
520F
930F
15R
520R
800R
F-968
Bac-1492R-II

CCGCAGCCAA
ACGCGCCCT
ACGCAGGCAC
AGAGTTTGATCMTGGCTCAG
CAGGAGTGCCAGCAGCCGCGG
GCACAAGCGGTGGAGCATGTGG
AAGGAGGTGATCCAACCGCA
ACCGCGGCTGCTGGC
CAGGACTACCAGGGTATCTAAT
AACGCGAAGAACCTTAC
ACGGYTACCTTGTTACGCGACTT
CGCCCGGGGCGCGCCCCGGGCG
GGGCGGGGGCACGGGGGGAACG
CGAAGAACCTTAC
CGGTGTGTACAAGACCC

F-968-GC
R-1401
a

Escherichia coli numbering system.

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

8F

3.2. Determination of bacterial diversity using PCR-DGGE analysis

F-968

520F

930F

16S rDNA
520R

255

800R

R-1401

100 bp

Bac-1492R-II
15R

Fig. 2. The position of primers used in this study with regard to the bacterial 16S rDNA.

a nal cycle of 72
C for 3 min. The RAPD proles obtained were

used to discriminate the chromosomal compositions among
isolates. Isolates with identical RAPD patterns were placed in
a group and considered to represent the same strain. Only one
representative strain from each group was chosen for subsequent
rRNA gene analysis.

2.7. 16S rDNA amplication, sequencing and phylogenetic analysis

This analysis was performed as previously described (Chao et al.,
2008). The 8F and 15R primers were used to amplify full-length 16S
rDNA (positions 8 to 1541 in the E. coli numbering system, Table 1
and Fig. 2) (Brosius et al., 1978).
DNA sequencing and phylogenetic analysis were performed as
previously described (Chao et al., 2008), except that the primers
used for full-length sequencing of the 16S rDNA were 8F, 520F,
930F, 520R, 800R and 15R (Table 1 and Fig. 2).

3. Results
3.1. Bacterial enumeration, pH and salt concentration
measurements
The counts for viable bacterial colonies observed on NB medium
during the fermentation of inyu are shown in Table 2. Bacteria were
quantied at a concentration of 6.2  107 cfu/g in the KM stage.
After washing and preincubation, the koji exhibited the largest
bacterial population (2.2  108 cfu/g) of all of the collected samples.
After placing the koji in a vat with salty water and salt, the
concentrations of the bacteria were slightly reduced to 3.7  107
and 1.8  107 cfu/mL in brines that had been exposed to sunlight for
1 day and 1 week, respectively. The bacterial concentrations of the
brines continued to decrease, reaching a range of 1.1  106 to
1.2  105 cfu/mL after aging from 2 weeks to 4 months.
The pH of brine was determined to be 5.7 after aging in sunlight
for 1 day, and then, the pH gradually decreased to 5.4 after aging for
1 month (Table 2). The pH subsequently decreased further to 4.9
after aging for 2 months and then remained stable.
The salt concentration of brine aged for 1 day was 30%; the salt
concentration then increased from 35% to 39% after aging for 1
week to 3 months (Table 2). At the end of the aging period, the salt
concentration had reached 42%.

Total DNA was directly extracted from the koji and brine
samples, and the V6eV8 regions of the bacterial 16S rDNA were
amplied to yield nested PCR products for the characterization of
bacterial diversity using DGGE on a 30e65% denaturing gradient
gel (Fig. 3a). Based on the premise that bands that migrated to the
same position were identical, bands AeX (highlighted in Fig. 3a)
were selected, excised, re-amplied and subjected to sequencing.
The sequencing results suggested that all of the bands were
mixtures of amplicons. In fact, the 16S rDNA fragments might have
identical melting properties even though they had different
sequences (Ercolini, 2004), and therefore, they cannot be separated
by this DGGE condition. Re-amplied products of these bands were
thus applied to further separation by a second round of DGGE
analysis with 3 narrow ranges of denaturing gradient gels,
including 30e50% (bands AeG; Fig. 3b), 40e60% (bands HeO;
Fig. 3d) and 50e70% (bands PeX; Fig. 3c). The initial brine
samples of 1W and 2M were included on the 30e50% and 50e70%
gels (Fig. 3b and c), respectively, to conrm the origin of these reamplied products. In addition to analysis on the 50e70% gel, the
re-amplied products of bands P1 and Q1 were also included in the
40e60% gel (Fig. 3d) to exclude the possibility that the re-amplied
products were artifacts. The bands highlighted in Fig. 3bed were
excised and re-amplied prior to sequencing. The identication
results are presented in Table 3.
Bands E, G, H, I and O shown in Fig. 3a had corresponding bands
(with similar migration positions) in all samples. In the subsequent
DGGE analysis (Fig. 3b and d), the bands developed from E1eE3,
G1e2, H1e2, I1e3 and O1e3 yielded sequences with close
homologies to Staphylococcus sciuri (band 1), Klebsiella pneumoniae
(bands 2, 4e10, 12e13, 19e21 and 23e26), Enterobacter cloacae
(bands 11, 15, 22 and 31), Salmonella enterica (band 14), Enterobacter
hormaechei (bands 17e18 and 32e33), Citrobacter farmeri (band
16), Enterococcus faecium (band 35) and Weissella confusa (band 34).
With the exception of bands 34 and 35 that were only present in
brine aged for 1 week (Fig. 3D), the other bands were present in
both the koji and brine samples (Fig. 3b and d). K. pneumoniae was
also identied from band 36 but was present only in brine aged for
2 months and not in brine aged for 1 week or 1 month (Fig. 3c).
Band C in Fig. 3a only exhibited corresponding bands in koji
samples from the KM and PI stages. The secondary DGGE ngerprint, as shown in Fig. 3b, also revealed that band 3 only had clear
corresponding bands in these koji samples. However, its sequence
corresponded to Pantoea agglomerans and was the same as that of
band 37 developed from Q2, for which corresponding bands were
found in all of the brine samples shown in Fig. 3c. These results
suggested that P. agglomerans was present in both the koji and
brine samples.
Bands with positions similar to bands JeN shown in Fig. 3a were
present in all of the brine samples but were not found in the koji
samples. In the subsequent DGGE analysis (Fig. 3d), bands 27 and
28e30, with sequences homologous to sequences of Serratia

Table 2
The bacterial counts, pH values and salt concentrations in the fermented samples of inyu.
Sample

Koji preparationa

Maturation under sunlightb

KM

PI

1D

1W

2W

1M

2M

3M

4M

Cell counts
pH value
Salt concentration (%)

7.79
e
e

8.34
e
e

7.57
5.7
30

7.25
5.6
35

6.06
5.4
38

5.98
5.4
37

5.6
4.9
39

5.56
5.1
39

5.06
5.1
42

e: Not determined.
a
Bacteria counts are represented as log10 cfu/g.
b
Bacteria counts are represented as log10 cfu/ml.

256

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

KM PI

1D 1W

2W 1M 2M

3M

4M

1W

1M

P1 Q1 X

KM
PI
C1 E1 C2 E2 G1 A

KM
PI
I1 O1 H1 I2 O2 H2 I3 J

1W
D E3 F

G2

1W

1W
K L M N O3 P1 Q1

2M
P2 Q2 R

2M

Fig. 3. DGGE proles of the V6eV8 regions of bacterial 16S rDNA. (a) A 30e65% denaturing gradient gel was used to analyze nested PCR products amplied from DNA directly
extracted from inyu fermentation samples. Lanes KM and PI: koji samples from the koji-making and preincubation stages; lanes 1D, 1W, 1M, 2M, 3M and 4M: brine samples from
outdoor aging for 1 day, 1 week, 2 weeks, 1 month, 2 months, 3 months and 4 months. Bands with different migration distances (AeX) were selected from different samples. The
different numbers behind the same letter indicate bands obtained from different samples that migrated the same distance. The bands AeG, PeX and HeO were further excised, reamplied and subjected to a second round of DGGE analysis using (b) 30e50%, (c) 50e70% or (d) 40e60% denaturing gradient gels. Bands indicated by numbers alone were excised,
re-amplied and subjected to sequencing.

marcescens and C. farmeri, respectively, only had corresponding

bands in brine aged for 1 week. However, these results cannot rule
out the possible presence of trace amounts of corresponding
sequences in the koji samples. Moreover, C. farmeri was also found
in band 16, which had corresponding bands were also present in
koji samples (Fig. 3b).
3.3. Bacterial diversity determined using the plate count method
According to DGGE analysis, similar migration patterns for
bands A, B and DeQ were observed for almost all brine samples,
and bands ReX were present in the brine samples that had been
aged for 1 and 2 months (Fig. 3a). Therefore, the brine samples that

had been aged for 1 week and 1 month and appeared to contain all
of the bands in all of the brine samples, together with both koji
samples, were further subjected to an evaluation of their bacterial
diversities using the plate count method. A total of 212 isolates
were analyzed by RAPD-PCR using 3 sets of random primers (data
not shown).
RAPD analysis has been widely used for studying the genetic
diversity of bacteria (Atienzar and Jha, 2006). Isolates that showed
identical RAPD patterns were regarded as identical strains and,
thus, as members of the same group. To verify the RAPD proles,
a total of 120 groups were obtained from koji samples in the KM (21
groups) and PI (5 groups) stages and from brine samples that had
been aged for 1 week (46, 21 and 7 groups selected from 5%, 10%

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

Table 3
Sequencing results of selected DGGE bands in Fig. 3
Closest relative (accession no.)
Staphylococcus
Staphylococcus sciuri (JF935130)
Enterobacteria
Citrobacter farmeri (FN433046)
Citrobacter farmeri (FN433046)
Enterobacter cloacaec (CP003678)
Enterobacter cloacaec (JQ766938)
Enterobacter cloacaec (CP003678)
Enterobacter cloacaec (JQ904624)
Enterobacter hormaecheic (JF772054)
Klebsiella pneumoniaec (JF772079)
Klebsiella pneumoniaec (JQ701742)
Klebsiella pneumoniaec (JQ917917)
Pantoea agglomerans (GU991862)
Pantoea agglomerans (GU991862)
Salmonella enterica (CP003416)
Serratia marcescens (DQ182326)
Lactic acid bacteria
Weissella confusac (JQ754469)
Enterococcus faecium (JQ778275)

Banda

Identityb

364/364 (100%)

16
28e30
11
15
22
31
17e18, 32e33
2, 4e10, 12e13,
23e26, 36
19
20e21
3
37
14
27

363/364
364/364
363/364
361/364
362/364
330/330
364/364
364/364

(99%)
(100%)
(99%)
(99%)
(99%)
(100%)
(100%)
(100%)

364/364
364/364
364/364
363/364
363/364
363/364

(100%)
(100%)
(100%)
(99%)
(99%)
(99%)

34
35

364/364 (100%)
364/364 (100%)

Only highest homology matches were presented.

a
Bands are numbered according to Fig. 3.
b
Sequence identity with a sequence in the GenBank database is represented by
(the number of the identical base)/(total length of the DNA fragment). The DNA
fragment of band 31 targeted nucleotide positions 1055e1384 of the E. coli 16S
rDNA; the other bands targeted nucleotide positions 1021e1384.
c
Other possible species with same identity were as follows: band 2, 4e10, 12e13,
23e26 and 36: Stenotrophomonas acidaminiphila (JN941322), Klebsiella oxytoca
(JN644535), Enterobacter aerogenes (HQ398232), Providencia rettgeri (GU049676) or
Raoultella planticola (EF551363); band 11 and 22: Erwinia chrysanthemi (JF816284),
Cronobacter sakazakii (HM748461), Klebsiella pneumoniae (EU924134) or Klebsiella
variicola (AM937459); band 15: Enterobacter hormaechei (JQ831744); band 17e18
and 32e33: Enterobacter cloacae (JQ904624), Enterobacter asburiae (JQ829479) or
Enterobacter cancerogenus (JN644583); band 19: Klebsiella variicola (FR828822) or
Klebsiella oxytoca (JN848786); band 20e21: Klebsiella variicola (JQ659780) or
Enterobacter cancerogenus (JN969367); band 31: Enterobacter hormaechei
(JF772054), Enterobacter asburiae (JQ829479) or Enterobacter cancerogenus
(JN644583); band 34: Weissella cibaria (HM369807).

and 15% NaCl plates, respectively) and 1 month (12 and 8 groups
selected from 5% to 10% NaCl plates, respectively). One representative isolate from each group was chosen for full-length
sequencing of its 16S rDNA. A total of 8 genera and 17 species of
bacteria, including the Bacillus (4 species), Brachybacterium (1
species), Delftia (1 species), Enterobacter (3 species), Klebsiella (1
species), Kurthia (1 species), Pantoea (1 species) and Staphylococcus
(5 species) genera, were identied (Table 4). All of the isolates
yielded similarity scores of over 99% to their corresponding species,
with the exception of the isolate obtained from the koji during the
PI stage that had a 98.6% similarity score for Enterobacter pulveris. A
total of 32 isolates that were identied as different species that had
been selected from the various samples and plates with differing
NaCl concentrations were further subjected to molecular phylogenetic analysis on the basis of their 16S rDNA (Fig. 4).
The koji from the KM stage exhibited the highest diversity of
bacteria, with a total of 6 genera and 8 species. Among these,
Brachybacterium rhamnosum made up the bulk of the community
(34%) with a concentration of 2.0  107 cfu/g; E. hormaechei (28%)
was found at a concentration of 1.7  107 cfu/g; Staphylococcus spp.
(24%) presented concentrations of 7.0  106, 4.5  106 and
2.5  106 cfu/g for Staphylococcus gallinarum, Staphylococcus kloosii
and S. sciuri, respectively; and K. pneumoniae, Pantoea dispersa and
Kurthia gibsonii made up 14% of the community, with concentrations of 5.0  106, 2.5  106 and 5.0  105 cfu/g, respectively.
However, most of these species were absent from the subsequently
collected samples; only the levels of E. hormaechei (2.5  107 cfu/g)

257

and K. pneumoniae (1.6  108 cfu/g) increased in the koji from the PI
stage by 1.5 and 32.0 fold, respectively. Although the koji from the
PI stage yielded the largest population among all of the collected
samples, with the exception of E. hormaechei and K. pneumoniae,
only two additional species, E. cloacae (3.0  107 cfu/g) and E.
pulveris (5.0  106 cfu/g), were identied.
In brine samples that had been aged for either 1 week or 1
month, 4 species of Bacillus were identied as being dominant in
the isolates selected from the agar plates containing 5% NaCl.
Bacillus pumilus (2.5  102 and 3.0  104 cfu/mL in brines aged for 1
week and 1 month, respectively) was only isolated from 5% NaCl
agars, whereas B. subtilis and Bacillus licheniformis were detected in
isolates selected from both 5% NaCl agar (5  104 and 8.6  104 cfu/
mL of B. subtilis in brines aged for 1 week and 1 month, respectively; 5  102 and 6.9  103 cfu/mL of B. licheniformis in brines aged
for 1 week and 1 month, respectively) and 10% NaCl agar (2.1  103
and 1.1  103 cfu/mL of B. subtilis in brines aged for 1 week and 1
month, respectively; 1.6  103 and 3.9  103 cfu/mL of
B. licheniformis in brines aged for 1 week and 1 month, respectively). Bacillus amyloliquefaciens increased from 2.7  104 to
1.5  105 cfu/mL while aging from 1 week to 1 month in isolates
selected from 5% NaCl agar; this species was also detected in
isolates selected from 10% NaCl agar (5.7  102 cfu/mL) in brine
aged for 1 month. In brine aged for 1 week, Delftia tsuruhatensis and
4 species of Staphylococcus (including Staphylococcus cohnii,
Staphylococcus condimenti, S. gallinarum and S. kloosii), with
concentrations ranging from 1.1  102 to 1.2  103 cfu/mL, were also
identied in isolates selected from 5 to 15% NaCl agar plates
(Table 4).
4. Discussion
Recently, the microbial communities involved in the soy sauce
manufacturing process were analyzed using the PCR-DGGE method
(Tanaka et al., 2012). However, no such evaluations that focused on
inyu fermentation have been reported. The production of inyu,
a type of fermented soy sauce made in Taiwan, employs a longer
fermentation period for koji making and a higher temperature
for brine aging than traditional soy sauces; these characteristics led
to the hypothesis that a much higher level of bacterial diversity
would be associated with inyu production. In addition, an articial
method and nonsterile operations are used for koji making,
washing, preincubation, loading in vats and sunlight exposure
aging during inyu production. These manufacturing processes that
are characteristic of inyu production led us to elucidate the associated bacterial communities, providing valuable information
regarding the functions of the bacteria during fermentation. Here,
we revealed the bacterial compositions during the different
stages of the inyu fermentation using both culture-independent
and culture-dependent techniques. Four species (E. cloacae,
E. hormaechei, K. pneumoniae and S. sciuri, belonging to 3 genera)
were identied using both techniques, 6 additional species
(C. farmeri, P. agglomerans, S. enterica, S. marcescens, E. faecium and
W. confusa, belonging to 6 genera) were identied using nested PCRDGGE (Table 3), and 13 additional species (B. amyloliquefaciens,
B. licheniformis, B. pumilus, B. subtilis, B. rhamnosum, D. tsuruhatensis,
E. pulveris, K. gibsonii, P. dispersa, S. cohnii, S. condimenti, S. gallinarum
and S. kloosii, belonging to 7 genera) were identied using a traditional plating technique (Table 4).
Although DGGE provided a broad and rapid overview of the
microbial population dynamics, the DGGE proles of the bacterial
V6eV8 16S rDNA amplied directly from fermented samples were
a mixture of amplicons (Fig. 3aed). The excised bands were reamplied and separated by DGGE using 3 different ranges of
denaturing gradients (Fig. 3bed). These results suggested that

258

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

Table 4
Quantication of bacterial species in the fermented samples of inyu.
Species

Samples
KMa

PIa

1Wb

0%

5%

10%

15%

5%

10%

15%

e
7.22
e
6.70
6.40

7.48
7.40
6.70
8.20
e

e
e
e
e
e

e
e
e
e
e

e
e
e
e
e

e
e
e
e
e

e
e
e
e
e

e
e
e
e
e

7.29

5.70

e
e
6.85
6.65
6.40

e
e
e
e
e

e
3.07

2.33
e
1.70
2.32
e

2.06
e
e
e
e

e
e
e
e
e

e
e
e
e
e

e
e
e
e
e

2.70

e
e
e
e

e
e
e
e

4.43
2.70
2.40
4.70

e
3.19
e
3.33

e
e
e
e

5.17
3.84
4.48
4.93

2.75
3.59
e
3.05

e
e
e
e

0%
Enterobacteria
Enterobacter cloacae
Enterobacter hormaechei
Enterobacter pulveris
Klebsiella pneumoniae
Pantoea dispersa
Brachybacterium
Brachybacterium rhamnosum
Kurthia
Kurthia gibsonii
Staphylococcus
Staphylococcus cohnii
Staphylococcus condimenti
Staphylococcus gallinarum
Staphylococcus kloosii
Staphylococcus sciuri
Delftia
Delftia tsuruhatensis
Bacillus
Bacillus amyloliquefaciens
Bacillus licheniformis
Bacillus pumilus
Bacillus subtilis

1Mb

e: Not found.
a
Bacteria counts are represented as log10 cfu/g.
b
Bacteria counts are represented as log10 cfu/mL.
c
Salt concentration in the agar plates.

a complicated bacterial composition might exist in the inyu

samples. Only 10 species were identied after DNA sequencing of
37 bands (Table 3). This result is not surprising, because the ranges
of the second round of DGGE gels (30e50%, 40e60% and 50e70%)
overlapped. Another reason that the 37 bands yielded only 10
species may be that the bacterial genomes contained multiple
copies of the rDNA operon, leading to sequence variations in each
strain. Thus, the DGGE analysis would show multiple bands for each
strain (Fig. 3bed) (Ercolini, 2004). In addition, nucleotides just
downstream of the primer F-968 cannot be veried by direct
sequencing of the re-amplied products of these DGGE bands. This
inability caused the differing mobilities of bands such as 2, 4e10,
12e13, 23e26 and 36 (Fig. 3bed) that had identical sequencing
results (Table 3). The DGGE prole shown in Fig. 3a also suggested
that the bacterial communities might be similar among the
samples. For instance, bands E, G, H, I and O had corresponding
bands almost in all of the collected samples. Nevertheless, the
results obtained using the plate count method revealed that no
common species could be found in all samples (Table 4). These
persistent bands in the DGGE ngerprints might have originated
from dead cells that were present in the primary fermentation
samples during the KM stage (Thanh et al., 2008).
LAB are the main bacteria that are useful in soy sauce brine
fermentation. The brine is acidied by halophilic LAB, such as T.
halophilus, which will then limit the growth of undesirable
microorganisms during the fermentation process (Huang and Teng,
2004; Tanaka et al., 2012). Surprisingly, the only LAB detected in our
inyu brine samples using DGGE analysis were E. faecium (band 35 in
Fig. 3d and Table 3) and W. confusa (band 34 in Fig. 3d and Table 3).
In fact, no LAB were found by plating the brines that had been aged
for 1 week and 1 month on MRS (de Man, Rogosa and Sharpe) agars
containing 15% and 10% NaCl, respectively (data not shown). The
limited populations of halophilic LAB identied during the inyu
brine fermentation might be due to the much higher concentration
of salt present (30e42% during aging from 1 day to 4 months;

Table 2) than in traditional soy sauce (25% or 19% after 1 year of

aging) (Huang and Teng, 2004; Ko et al., 2009). However, the pH
values associated with inyu production decreased from 5.4 to 4.9
during aging from 1 to 2 months, suggesting that some halophilic
microbes, though not LAB, were involved in the acidication of the
inyu brine.
Four Bacillus species, B. amyloliquefaciens, B. licheniformis,
B. pumilus and B. subtilis, were identied in the brine samples using
the plate count method; however, none of these species were found
in our DGGE proles. This result might be due to the similar GC
contents of the nested PCR products among Bacillus species, which
we were unable to separate by DGGE. In this study, the brine aged
for 1 month contained just Bacillus and no other genera of bacteria
(Table 4). Moreover, no fungi were detected in the brine plated on
Yeast Malt agar (data not shown). Bacillus species are renowned for
their strong amylase and protease activities. The halophilic Bacillus
found in the brine might exhibit such activities. For example,
a halotolerant serine protease has been characterized in B. licheniformis isolated from sh sauce, a food prepared by fermenting sh
with salt in a ratio of 2e6:1 (17%e50% salt) (Toyokawa et al., 2010).
Furthermore, 2 brinolytic enzymes have been characterized from
B. amyloliquefaciens and B. subtilis isolated from Chinese traditional
douchi. Like inyu, douchi is made primarily from black soybeans,
and its production employs a manufacturing procedure similar to
that of inyu (Teng et al., 2004).
In addition to their proteolytic activity, a series of reports have
identied other possible roles for Bacillus in fermented food.
B. amyloliquefaciens, isolated from sh sauce, was found to produce
histamine oxidase. The application of this species as a starter
culture in sh sauce fermentation has been found to be effective in
reducing the accumulation of biogenetic amines that cause adverse
health effects in consumers when ingested in considerable
amounts (Zaman et al., 2011). B. subtilis has been used as a starter
culture to control the fermentation of natto and kinema (Steinkraus,
1991). B. subtilis and B. pumilus have been shown to have the

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

259

Pseudomonas aeruginosa DSM 50071T (NR_026078)

1000

1W10C9
Delftia tsuruhatensis IFO 16741T (NR_024786)

PI2

1000

Enterobacter pulveris E444 (EF059835)

Pantoea ananatis ATCC 33244T (NR 026045)

1000

Pantoea agglomerans DSM3493T (NR_041978)

1000

KM9B

1000

Pantoea dispersa GTC1472T (AB273743)

Citrobacter farmeri CDC 2991-81T (NR_024861)
Enterobacter asburiae E53 (HQ407230)
999

Enterobacter hormaechei EN 562T (AJ853890)

KM8A
PI3B
Enterobacter aerogenes JCM 1235T (NR 024643)
Klebsiella pneumoniae ATCC13884T (Y17657)
973

KM6
PI1

960

Klebsiella variicola ATCC BAA-830T (NR 025635)

Enterobacter cloacae ATCC13047T (NR 028912)

991

Enterobacter dissolvens LMG2683T (Z96079)

Enterobacter ludwigii DSMZ 16688T (AJ853891)
PI4

5%

1000
999
977
1000

1000

1000

1000

1000

1000

5%

Escherichia coli ATCC11775T (X80725)

Dermabacter hominis DSM7083T (NR 026271)
Brachybacterium nesterenkovii DSM9573T (NR_026270)
Brachybacterium tyrofermentans CNRZ 926T (NR_026272)
KM2C
Brachybacterium rhamnosum LMG19848T (AJ415376)

KM1
Kurthia gibsonii NBRC15534T (AB271738)
1000 KM4A
Staphylococcus sciuri DSM20345T (NR_025520)
Staphylococcus condimenti DSM11674T (NR_029345)
1000
1W5D2
Staphylococcus carnosus GTC1232T (AB233329)
1W10A13
1000
KM5A
Staphylococcus kloosii ATCC43959T (AB009940)
1W10A11
991
1W15A2
Staphylococcus cohnii ATCC49330T (AB009936)
1W10A3
Staphylococcus arlettae ATCC43957T (NR_024664)
1W10A10
Staphylococcus
gallinarum ATCC35539T (D83366)
966
KM7
Staphylococcus succinus ATCC700337T (AF004220)
Bacillus aerophilus 28K (AJ831844)
1M5C7
1W5D1
Bacillus pumilus DSMZ27T (AY456263)
1W5B14
1M5B31
1W10C10
1000
1M10A10
Bacillus licheniformis BCRC11702T (EF433410)
1000
Bacillus aerius 24K (AJ831843)
Bacillus vallismortis DSM11031T (AB021198)
1M5B1
1W5B26
Bacillus nematotocita B-16T (AY820954)
Bacillus amyloliquefaciens NBRC15535T (AB325583)
965
1M10A32
Bacillus mojavensis NBRC15718T (AB021191)
1W5B29
1W10C4
1M5A1
1M10A33
Bacillus subtilis IAM12118T (AB042061)

Fig. 4. Phylogenetic tree based on the 16S rDNA sequence analysis showing the phylogenetic placement of species isolated from kojis at the koji-making (KM) and preincubation
(PI) stages and from brines aged for 1 week (1W) and 1 month (1M) during the fermentation of inyu. Panels a and b illustrate the results for species of gram-negative and grampositive bacteria, respectively. The tree was constructed by the neighbor-joining method (Escherichia coli was used as the outgroup). Bootstrap values (expressed as the percentages
of 1000 replications) greater than 90% are shown at branch points. The scale bar represents 5% sequence divergence.

260

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

capacity to produce both a pleasant aroma and antimicrobial

substances against pathogens during the manufacture of soumbala
(Ouoba et al, 2005, 2007). B. licheniformis and B. subtilis have
previously been reported as the dominant organisms in doenjang
and are thought to play important roles during fermentation (Yoo
et al., 1999). B. subtilis also contributed to the production of the
organic acids, amines and esters that are important for creating
a more complex avor during soy sauce aging (Huang and Teng,
2004).
Nine species belonging to the family Enterobacteriaceae were
identied using both screening methods (Tables 3 and 4 and Figs. 3
and 4). Members of the Enterobacteriaceae have the capacity to
adapt to a wide variety of environments and can be isolated from
a range of host species. K. pneumoniae has been isolated from
tempeh, a traditional fermented soybean food in Indonesia, and it
has been suggested that this bacteria was involved in the production of vitamin B12 during fermentation (Mulyowidarso et al., 1990;
Keuth and Bisping, 1994). E. hormaechei, K. pneumoniae and
P. agglomerans have been detected in fermented drinks, such as
pulque (Mexico) and taberna (Mexico) (Escalante et al., 2008;
Alcantara-Hernandez et al., 2010). P. dispersa and S. marcescens have
been detected in healthy or Botrytis-infected grapes (Nisiotou et al.,
2011). It is well known that Enterobacteriaceae contains many
potential animal and plant pathogens, including E. cloacae,
K. pneumoniae, P. agglomerans and S. enterica (Kanemitsu et al.,
2007; Holden et al., 2009). However, K. pneumoniae strains have
been identied that do not possess 3 of the known enterotoxin
genes (Keuth and Bisping, 1994). It has been reported that 2 strains
of E. cloacae isolated from Italian table olives were inhibited by salt
concentrations of 70e80 g/L (Bevilacqua et al., 2010). These
enterobacteria, which were also found in our samples, may have
been present due to contamination during koji fermentation but
were then inhibited by the 30e42% (300e420 g/L) salt concentrations present during brine fermentation. Thus, none of these
species were found in the brine samples (Table 4).
Five Staphylococcus species were identied in koji from the KM
stage and from brines aged for 1 week using the plate count
method (Table 4). S. sciuri was also identied by DGGE analysis
(Table 3). S. gallinarum, S. kloosii, S. condimenti and S. sciuri, which
belong to the coagulase-negative group of staphylococci (CNS),
have been isolated from miso, meat starter culture, doenjang and
marri (Onda et al., 2003; Zell et al., 2008). The former 2 strains were
also identied in the koji and brine of soy sauce using DGGE
analysis (Tanaka et al., 2012). The rst 3 strains have been subjected
to tests for potential pathogenic risks, and no hemolytic activity
was identied (Onda et al., 2003; Zell et al., 2008). S. cohnii is also
a member of the CNS group and can be found in the human environment. Staphylococcus is a common component of the microbial
ora of human and animal skin (Wesley et al., 1976, 1998). The
presence of the Staphylococcus species identied in this study was
not surprising and can be explained as contamination that occurred
during the nonsterile fermentation process. However, some reports
have shown that Staphylococcus might have a functional signicance in fermented products. For example, the nitrate reductase
and antioxidant activities of CNS Staphylococci have been reported
to be important for color formation and for preventing the formation of off-avors and rancidity (Montel et al., 1996, 1998; Casaburi
et al., 2005). In addition, their proteolytic and lipolytic activities
also contributed to the generation of avor-active compounds
during sausage fermentation (Montel et al., 1996; Leroy et al.,
2006). Moreover, S. sciuri has been successfully used as part of
a consortium starter culture in cheese production (Bockelmann and
Hoppe-Seyler, 2001).
B. rhamnosum, K. gibsonii and D. tsuruhatensis were 3 other
species that were isolated from koji at the KM stage or brine aged

for 1 week using the plate count method (Table 4). To our knowledge, this is the rst report describing the presence of these species
in fermented food. B. rhamnosum, belonging to the family Dermabacteraceae, class Actinobacteria, and the closely related species
(based on 16S rDNA) Brachybacterium squillarum have been isolated
from salt-fermented seafood in Korea (Park et al., 2011).
D. tsuruhatensis has been isolated from activated sludge collected
from a domestic wastewater treatment plant in Japan and was able
to degrade various aromatic hydrocarbon compounds (Shigematsu
et al., 2003). This species has been described as a plant growthpromoting bacterium and has been proposed as a potential
biocontrol agent against plant pathogens (Han et al., 2005; Validov
et al., 2007). Recently, this species has also been described as the
causative agent of a human catheter-related infection (Preiswerk
et al., 2011).
In conclusion, nested PCR-DGGE analysis combined with a plate
count method was used for the rst time to assess the bacterial
communities involved in inyu production. The combination of the 2
techniques overcame the limitations of each individual method and
provided a more global insight into the bacterial diversity that is
associated with inyu fermentation. This study might be a great
benet for the further modication of the fermentation process to
produce inyu with more attractive avors without safety concerns.
In brief, most of the bacterial species found in the KM koji,
including Brachybacterium, Kurthia and Staphylococcus species,
were absent after koji washing. The family Enterobacteriaceae, the
sole survivors in the PI koji, also disappeared in the subsequent
brine sample. In addition to the unusual high-salt and hightemperature environment used for the fermentation of inyu
brine, Staphylococcus and Bacillus species might also contribute to
the inhibition of pathogenic bacteria as well as the possible role of
S. gallinarum and S. kloosii in soy sauce fermentation (Tanaka et al.,
2012) and thus provide a natural safety control. Furthermore,
bacteria from both genera, especially the latter, which was also
found in 1M brine, might produce useful catalysts that give inyu
special avors during brine fermentation. Their possible thermotolerant and halotolerant properties might be valuable for both
other food fermentations and industrial applications. On the other
hand, the safety issues related to the Staphylococcus species could
be determined by analyzing the hemolytic activity of the bacteria as
well as inyu brine. Certainly, the desirable or undesirable effects of
bacteria during brine fermentation should be claried in further
studies. Once these bacteria are classied to be undesirable, they
might be prevented by introducing bacteriocin-producing LAB to
lower the pH and produce antimicrobial proteins (Chang and
Chang, 2011; Sarika et al., 2012) in the early brine fermentation
steps.

Acknowledgments
We thank Prof. H.-M. Ho and Prof. H.-C. Mei (National Taipei
University of Education, Taipei) for their technical assistance with
the nested PCR-DGGE analysis.

References
Alcantara-Hernandez, R.J., Rodriguez-Alvarez, J.A., Valenzuela-Encinas, C., Gutierrez-Miceli, F.A., Castanon-Gonzalez, H., Marsch, R., Ayora-Talavera, T.,
Dendooven, L., 2010. The bacterial community in taberna a traditional
beverage of southern Mexico. Letters in Applied Microbiology 51, 558e563.
Atienzar, F.A., Jha, A.N., 2006. The random amplied polymorphic DNA (RAPD) assay
and related techniques applied to genotoxicity and carcinogenesis studies:
a critical review. Mutation Research 613, 76e102.
Bevilacqua, A., Cannarsi, M., Gallo, M., Sinigaglia, M., Corbo, M.R., 2010. Characterization and implications of Enterobacter cloacae strains, isolated from Italian
table olives Bella di Cerignola. Journal of Food Science 75, M53eM60.

C.-L. Wei et al. / Food Microbiology 33 (2013) 252e261

Bockelmann, W., Hoppe-Seyler, T., 2001. The surface ora of bacterial smearripened cheeses from cows and goats milk. International Dairy Journal 11,
307e314.
Brosius, J., Palmer, M.L., Kennedy, P.J., Noller, H.F., 1978. Complete nucleotide
sequence of a 16S ribosomal RNA gene from Escherichia coli. Proceedings of the
National Academy of Sciences of the United States of America 75, 4801e4805.
Casaburi, A., Blaiotta, G., Mauriello, G., Pepe, O., Villani, F., 2005. Technological
activities of Staphylococcus carnosus and Staphylococcus simulans strains isolated from fermented sausages. Meat Science 71, 643e650.
Chang, J.Y., Chang, H.C., 2011. Growth inhibition of foodborne pathogens by kimchi
prepared with bacteriocin-producing starter culture. Journal of Food Science 76,
M72eM78.
Chao, S.H., Tomii, Y., Watanabe, K., Tsai, Y.C., 2008. Diversity of lactic acid bacteria in
fermented brines used to make stinky tofu. International Journal of Food
Microbiology 123, 134e141.
Chao, S.H., Wu, R.J., Watanabe, K., Tsai, Y.C., 2009. Diversity of lactic acid bacteria in
suan-tsai and fu-tsai, traditional fermented mustard products of Taiwan.
International Journal of Food Microbiology 135, 203e210.
Chen, S.H., 1975. Inyu. In: Chen, S.H. (Ed.), Soy Sauce. Natural Publishing, Taipei,
pp. 255e273.
Ercolini, D., 2004. PCR-DGGE ngerprinting: novel strategies for detection of
microbes in food. Journal of Microbiological Methods 56, 297e314.
Escalante, A., Giles-Gomez, M., Hernandez, G., Cordova-Aguilar, M.S., LopezMunguia, A., Gosset, G., Bolivar, F., 2008. Analysis of bacterial community during
the fermentation of pulque, a traditional Mexican alcoholic beverage, using
a polyphasic approach. International Journal of Food Microbiology 124, 126e134.
Han, J., Sun, L., Dong, X., Cai, Z., Sun, X., Yang, H., Wang, Y., Song, W., 2005. Characterization of a novel plant growth-promoting bacteria strain Delftia tsuruhatensis HR4 both as a diazotroph and a potential biocontrol agent against
various plant pathogens. Systematic and Applied Microbiology 28, 66e76.
Holden, N., Pritchard, L., Toth, I., 2009. Colonization outwith the colon: plants as an
alternative environmental reservoir for human pathogenic enterobacteria.
FEMS Microbiology Reviews 33, 689e703.
Holzapfel, W.H., Schillinger, U., Du Toit, M., Dicks, L., 1997. Systematics of probiotic
lactic acid bacteria with reference to modern phenotypic and genotypic
methods. In: Reuter, G., Klein, G., Heidt, P.J., Rusch, V. (Eds.), Microecology and
Therapie, vol. 26. CRC Press, Herborn, pp. 1e10.
Huang, T.C., Teng, D.F., 2004. Soy Sauce, Handbook of Food and Beverage Fermentation Technology. CRC Press.
Johansson, M.L., Quednau, M., Molin, G., Ahrne, S., 1995. Randomly amplied
polymorphic DNA (RAPD) for rapid typing of Lactobacillus plantarum strains.
Letters in Applied Microbiology 21, 155e159.
Kanemitsu, K., Endo, S., Oda, K., Saito, K., Kunishima, H., Hatta, M., Inden, K.,
Kaku, M., 2007. An increased incidence of Enterobacter cloacae in a cardiovascular ward. Journal of Hospital Infection 66, 130e134.
Keuth, S., Bisping, B., 1994. Vitamin B12 production by Citrobacter freundii or Klebsiella pneumoniae during tempeh fermentation and proof of enterotoxin
absence by PCR. Applied and Environmental Microbiology 60, 1495e1499.
Kim, T.W., Lee, J.H., Kim, S.E., Park, M.H., Chang, H.C., Kim, H.Y., 2009. Analysis of
microbial communities in doenjang, a Korean fermented soybean paste, using
nested PCR-denaturing gradient gel electrophoresis. International Journal of
Food Microbiology 131, 265e271.
Ko, B.K., Ahn, H.J., van den Berg, F., Lee, C.H., Hong, Y.S., 2009. Metabolomic insight
into soy sauce through (1)H NMR spectroscopy. Journal of Agricultural and Food
Chemistry 57, 6862e6870.
Lee, J.H., Kim, T.W., Lee, H., Chang, H.C., Kim, H.Y., 2010. Determination of microbial
diversity in meju, fermented cooked soya beans, using nested PCR-denaturing
gradient gel electrophoresis. Letters in Applied Microbiology 51, 388e394.
Leroy, F., Verluyten, J., De Vuyst, L., 2006. Functional meat starter cultures for
improved sausage fermentation. International Journal of Food Microbiology
106, 270e285.
Lioe, H.N., Selamat, J., Yasuda, M., 2010. Soy sauce and its umami taste: a link from
the past to current situation. Journal of Food Science 75, R71eR76.
Manninen, T.J., Rinkinen, M.L., Beasley, S.S., Saris, P.E., 2006. Alteration of the canine
small-intestinal lactic acid bacterium microbiota by feeding of potential probiotics. Applied and Environmental Microbiology 72, 6539e6543.
Montel, M.C., Masson, F., Talon, R., 1998. Bacterial role in avour development. Meat
Science 49, S111eS123.
Montel, M.C., Reitz, J., Talon, R., Berdagu, J.L., Rousset-Akrim, S., 1996. Biochemical
activities of Micrococcaceae and their effects on the aromatic proles and
odours of a dry sausage model. Food Microbiology 13, 489e499.
Mulyowidarso, R.K., Fleet, G.H., Buckle, K.A., 1990. Association of bacteria with the
fungal fermentation of soybean tempe. Journal of Applied Bacteriology 68, 43e47.
Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Proling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase
chain reaction-amplied genes coding for 16S rRNA. Applied and Environmental Microbiology 59, 695e700.
Nisiotou, A.A., Rantsiou, K., Iliopoulos, V., Cocolin, L., Nychas, G.J., 2011. Bacterial
species associated with sound and Botrytis-infected grapes from a Greek
vineyard. International Journal of Food Microbiology 145, 432e436.

261

Nubel, U., Engelen, B., Felske, A., Snaidr, J., Wieshuber, A., Amann, R.I., Ludwig, W.,
Backhaus, H., 1996. Sequence heterogeneities of genes encoding 16S rRNAs in
Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.
Journal of Bacteriology 178, 5636e5643.
Onda, T., Yanagida, F., Tsuji, M., Shinohara, T., Yokotsuka, K., 2003. Time series
analysis of aerobic bacterial ora during Miso fermentation. Letters in Applied
Microbiology 37, 162e168.
Ouoba, L.I.I., Diawara, B., Annan, N.T., Poll, L., Jakobsen, M., 2005. Volatile
compounds of Soumbala, a fermented African locust bean (Parkia biglobosa)
food condiment. Journal of Applied Microbiology 99, 1413e1421.
Ouoba, L.I.I., Diawara, B., Jespersen, L., Jakobsen, M., 2007. Antimicrobial activity of
Bacillus subtilis and Bacillus pumilus during the fermentation of African locust
bean (Parkia biglobosa) for Soumbala production. Journal of Applied Microbiology 102, 963e970.
Park, S.K., Kim, M.S., Jung, M.J., Nam, Y.D., Park, E.J., Roh, S.W., Bae, J.W., 2011. Brachybacterium squillarum sp. nov., isolated from salt-fermented seafood. International Journal of Systematic and Evolutionary Microbiology 61, 1118e1122.
Preiswerk, B., Ullrich, S., Speich, R., Bloemberg, G.V., Hombach, M., 2011. Human
infection with Delftia tsuruhatensis isolated from a central venous catheter.
Journal of Medical Microbiology 60, 246e248.
Sarika, A.R., Lipton, A.P., Aishwarya, M.S., Dhivya, R.S., 2012. Isolation of a bacteriocin-producing Lactococcus lactis and application of its bacteriocin to
manage spoilage bacteria in high-value marine sh under different storage
temperatures. Applied Biochemistry and Biotechnology 167, 1280e1289.
Shigematsu, T., Yumihara, K., Ueda, Y., Numaguchi, M., Morimura, S., Kida, K., 2003.
Delftia tsuruhatensis sp. nov., a terephthalate-assimilating bacterium isolated
from activated sludge. International Journal of Systematic and Evolutionary
Microbiology 53, 1479e1483.
Steinkraus, K.H., 1991. African alkaline fermented foods and their relation to similar
foods in other parts of the world. In: Westby, A., Reilly, P. (Eds.), Proceedings of
a Regional Workshop on Traditional African FoodsdQuality and Nutrition.
International Foundation for Science, pp. 87e92.
Su, N.W., Wang, M.L., Kwok, K.F., Lee, M.H., 2005. Effects of temperature and sodium
chloride concentration on the activities of proteases and amylases in soy sauce
koji. Journal of Agricultural and Food Chemistry 53, 1521e1525.
Takazane, S., Endo, T., Shida, O., Tagami, H., Takagi, H., Kadowaki, K., 1998. Inuences
of Bacillus species in shoyu koji on shoyu brewing (part 1) isolation and identication of antifungal antibiotics producing bacteria. Shoyu Kenkyujyo Kenkyu
Houkoku 24, 77e82.
Tanaka, Y., Watanabe, J., Mogi, Y., 2012. Monitoring of the microbial communities
involved in the soy sauce manufacturing process by PCR-denaturing gradient
gel electrophoresis. Food Microbiology 31, 100e106.
Teng, D.F., Lin, C.S., Hsieh, P.C., 2004. Fermented whole soybeans and soybean paste.
In: Hui, Y.H. (Ed.), Handbook of Food and Beverage Fermentation Technology.
CRC Press.
Thanh, V.N., Mai le, T., Tuan, D.A., 2008. Microbial diversity of traditional Vietnamese alcohol fermentation starters (banh men) as determined by PCRmediated DGGE. International Journal of Food Microbiology 128, 268e273.
Toyokawa, Y., Takahara, H., Reungsang, A., Fukuta, M., Hachimine, Y., Tachibana, S.,
Yasuda, M., 2010. Purication and characterization of a halotolerant serine
proteinase from thermotolerant Bacillus licheniformis RKK-04 isolated from Thai
sh sauce. Applied Microbiology and Biotechnology 86, 1867e1875.
Validov, S., Kamilova, F., Qi, S., Stephan, D., Wang, J.J., Makarova, N.,
Lugtenberg, B., 2007. Selection of bacteria able to control Fusarium oxysporum
f. sp. radicis-lycopersici in stonewool substrate. Journal of Applied Microbiology 102, 461e471.
Vanbroekhoven, K., Ryngaert, A., Wattiau, P., Mot, R., Springael, D., 2004. Acinetobacter diversity in environmental samples assessed by 16S rRNA gene PCRDGGE ngerprinting. FEMS Microbiology Ecology 50, 37e50.
Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA
amplication for phylogenetic study. Journal of Bacteriology 173, 697e703.
Wesley, E.K., Carol, G.G., Jennifer, S.O., Linda, V.P., Mary, L.M., Barbara, L.Z.,
Eugene, M., Melvin, P.W., Stanley, M., 1998. Staphylococcus hominis subsp.
Novobiosepticus subsp. nov., a novel trehalose- and N-acetyl-D-glucosaminenegative, novobiocin and multiple-antibiotic-resistant subspecies isolated from
human blood cultures. International Journal of Systematic Bacteriology 48,
799e812.
Wesley, E.K., Schleifer, K.H., Smith, R.F., 1976. Characterization of Staphylococcus
sciuri sp. nov. and its subspecies. International Journal of Systematic Bacteriology 26, 22e37.
Yoo, S.K., Cho, W.H., Kang, S.M., Lee, S.H., 1999. Isolation and identication of
microorganisms in Korean traditional soybean paste and soybean sauce. Korean
Journal of Applied Microbiology and Biotechnology 27, 113e117.
Zaman, M.Z., Abu Bakar, F., Jinap, S., Bakar, J., 2011. Novel starter cultures to inhibit
biogenic amines accumulation during sh sauce fermentation. International
Journal of Food Microbiology 145, 84e91.
Zell, C., Resch, M., Rosenstein, R., Albrecht, T., Hertel, C., Gotz, F., 2008. Characterization of toxin production of coagulase-negative staphylococci isolated
from food and starter cultures. International Journal of Food Microbiology
127, 246e251.