Você está na página 1de 22

Escola EB 2,3 Professor Gonçalo Sampaio

Curso EFA -Secundário

Epidermodisplasia Verruciforme ou doença do


`` Homem Arvore ´´
Introdução

A Epidermodisplasia Verruciforme ou doença do 'Homem Árvore', como é


popularmente conhecida, é uma doença hereditária extremamente rara e cruel,
que leva a formação de verrugas na pele que nunca param de crescer. O
indivíduo portador desta doença rara, infelizmente não passa despercebido pois
a formação de verrugas dá-se (principalmente nos pés, nas mãos e na cara)
sendo por isso marginalizado pelos outros humanos. A Epidermodisplasia
Verruciforme (EV) é uma doença de carácter genético, autossômica recessiva e
de ocorrência rara Sendo uma doença genética os cromossomas são os únicos
transportadores da hereditariedade. Características específicas transmitidas de
pais para filhos desenvolvem-se nas células geminais de cada indivíduo. É
multifactorial e ocorre em indivíduos apresentando consanguinidade entre os
pais, desordens hereditárias ligadas ao cromossoma X e a mutações nos genes
ligados ao cromossoma 17q25. Essas alterações podem resultar especialmente
na diminuição da resposta imune celular, sendo caracterizada pela
susceptibilidade à infecção por tipos distintos de papilomavírus humanos (HPV)
1,2,3.

Em várias patologias, a associação entre os genes HLA e a resposta imune está


bem estabelecido, produzindo exacerbação como nas doenças auto imunes ou
supressão, como em alguns tumores ou infecções virais 3,4,5. Em ambos os
casos, dependendo da natureza do antígeno ou das características genéticas do
indivíduo esse padrão da resposta imune não é obedecido. A Epidermodisplasia
Verruciforme (EV) é uma genodermatose rara, caracterizada pela
susceptibilidade à infecção por tipos distintos de papilomavírus humanos
(HPV). Os vírus encontrados na EV são em sua maioria específicos da doença,
sendo denominados HPVs associados à EV (HPVEV). Imagem do vírus da EV.

2
O processo de desenvolvimento que ocorre nas células germinais é descrito por
duas teorias (i) a teoria que defende que o óvulo/esperma contêm partículas
para todos as características, (ii) a teoria que sugere que o óvulo e o esperma
sofrem desenvolvimento em várias etapas. A teoria (i) aparenta ser mais
relevante no contexto do desenvolvimento da hereditariedade. Todas as células
germinais possuem uma propriedade fundamental: a de passar por várias
alterações químicas que levam por fim à formação de um adulto. O “ovo” é a
entidade principal onde as alterações do desenvolvimento têm lugar. Em termos
da transmissão de caracteres, as células germinais masculinas, i. e o esperma,
contribuem tanto como o óvulo. Os “cromossomas” sobreviveram como
transportadores cruciais de traços hereditários e da sua transmissão através das
gerações sucessivas.

3
O ADN

O ADN é o Ácido Desoxirribonucleico. Este ácido é considerado a


UNIDADE DA VIDA. O Ácido Desoxirribonucleico, é uma molécula biológica
universal presente em todas as células vivas. É no ADN que está contida
toda a nossa informação genética, sob a forma de genes. O ADN é constituído
por quatro tipos de nucleótidos, unidade básica do ADN (que por sua vez é
constituído por uma pentose, um grupo fosfato e uma base azotada), que se
associam de uma forma específica, formando uma cadeia dupla: adenina (A)
com timina (T) e guanina (G) com citosina (C). Os nucleótidos são
designados deste modo devido às bases azotadas que entram nas suas
constituições. É possível ler a cadeia de ADN, obtendo-se uma sequência de
letras, como por exemplo, ATGATTCTGTAGCCTGATCCC, a uma sequência
completa de ADN dá-se o nome de genoma.

4
O ADN tem a forma de uma escada de corda enrolada helicoidalmente,
ou seja, de uma hélice dupla em que os degraus são formados por pares de
bases azotadas ligadas entre si, através de ligações de hidrogénio, com
fundamento na complementaridade de bases. A estrutura, do ADN, foi
proposta há 53 anos por James Watson e Francis Crick. A descoberta da
estrutura do ADN abriu o caminho para se compreender como é que a
informação genética é transmitida de progenitores para descendentes, ou de
uma célula para outra, isto é, como funciona a hereditariedade.

Hoje em dia, esta descoberta tem um impacto em muitas áreas da vida


moderna, tais como a medicina, a reprodução, a alimentação, a longevidade e
o ambiente. No caso da medicina, e da saúde, há milhares de doenças
hereditárias diferentes: cada uma resulta de um defeito num gene, muitos
dos quais agora conhecemos. Assim, sabe-se detectar esses defeitos antes da
nascença e tem-se esperança de os poder corrigir dentro de algum tempo,
utilizando a terapia genética. Os testes genéticos permitem prever as doenças
genéticas a que um indivíduo está mais sujeito e preveni-las a tempo. A
amniocentese é um exemplo de um teste genético pré-natal que é muito
usado para detectar se um bebé irá sofrer da síndroma de Down, mais
conhecido como mongolismo, e que resulta da duplicação do cromossoma

5
21. Outro exemplo de influência genética é na reprodução, são as técnicas de
fertilização in vitro (FIV) que permitem que hoje muitos casais inférteis
possam ter filhos. Aliado à FIV está o diagnóstico genético preimplantatório,
que permite detectar, nos embriões, erros no ADN que causam doenças,
reduzindo-se assim a probabilidade de a criança nascer com uma doença
genética. Este diagnóstico não pode, contudo, ser usado para excluir embriões
com características estéticas e sociais não desejadas, como por exemplo, cor
dos olhos, sexo ou inteligência.

6
Outro assunto em que a genética tem influência é na alimentação pois através
da engenharia genética é agora possível produzir alimentos mais baratos, mais
energéticos e mais resistentes as pragas e à seca, sem poluir o ambiente nem
gastar tanta água. Igual interferência genética dá-se na longevidade celular,
resta agora continuar estes estudos de forma a descobrir como se impede o
envelhecimento das células e como se reparam os estragos naturais das células
velhas, estudos elaborados na mosca da fruta e numa espécie de lombrigas já
identificaram certos genes responsáveis pelo prolongamento da longevidade.
No ambiente o ADN é uma importante ferramenta para se salvarem espécies
de animais e de plantas em perigo de extinção e mesmo para se trazerem de
volta algumas que tenham desaparecido recentemente. O ADN traz a
possibilidade de se criarem novas bactérias geneticamente modificadas que
sejam capazes de limpar o ambiente de toxinas nocivas, pois decompõem
resíduos orgânicos (nocivos para o ambiente) e transformam-nos em água e
dióxido de carbono.

É, também, através do ADN, que se podem criar os «bilhetes de


Identidade genéticos» isto é, a partir dos genes de ADN que se encontram no
núcleo das nossas células é possível reconhecer a nossa identidade de uma
maneira que ninguém o possa negar, pois o nosso ADN é único. Ou então
pode-se verificar a veracidade dos progenitores, com o teste de paternidade.

Estrutura química do ADN.

O ADN é um longo polímero formado por unidades repetidas chamadas


nucleotídeos. A cadeia de ADN tem 2,2 a 2,4 manómetros de largura, e um
nucleotídeo possui aproximadamente 0,33 manómetros de comprimento.
Embora os monómeros (nucleotídeos) que constituem o ADN sejam muito
pequenos, polímeros de ADN podem ser moléculas enormes, com milhões de
nucleotídeos. Por exemplo, o maior cromossoma humano (cromossoma 1),
possui 220 milhões de pares de bases de comprimento.

7
Em organismos vivos, o ADN não existe como uma molécula única (cadeia
simples), mas sim como um par de moléculas firmemente associadas. As duas
longas cadeias de ADN enrolam-se como uma trepadeira formando uma dupla
hélice. Os nucleotídeos estão presentes em ambas as cadeias da dupla hélice,
unidos com nucleótidos da mesma cadeia por ligações fosfodiéster e à cadeia
complementar através de pontes de hidrogénio formadas pelas suas bases. Em
geral, uma base ligada a um açúcar é chamada nucleosídeo e uma base ligada a
um açúcar e um ou mais fosfatos é chamada nucleotídeo. Portanto, o ADN pode
ser referido como um polinucleotídeo.

Diferentes níveis de condensação do ADN. (1) Cadeia simples de ADN. (2)


Filamento de cromatina (ADN com histonas). (3) Cromatina condensada em
interfase com centrómeros. (4) Cromatina condensada em profase. (Existem
agora duas cópias da molécula de DNA) (5) Cromossoma em metáfase

O cerne (backbone) da cadeia de ADN é formado por fosfato e resíduos de


açúcar, dispostos alternadamente. O açúcar no ADN é 2-desoxirribose, e é uma
pentose (açúcar com cinco carbonos). Os açúcares são unidos por grupos de
fosfato que formam ligações fosfodiéster entre o terceiro e quinto átomos de
carbono dos anéis de açúcar adjacentes. Estas ligações assimétricas significam
que uma cadeia de ADN tem uma direcção. Numa dupla hélice, a direcção dos
nucleotídeos de uma cadeia é oposta à direcção dos nucleotídeos da outra

8
cadeia. O formato das cadeias do ADN é designado anti paralelo. As terminações
assimétricas das cadeias de ADN são designadas terminais 5’ (cinco linha) e 3’
(três linha). Uma das diferenças principais entre o ADN e o ARN encontra-se no
açúcar, com a substituição da 2-desoxirribose no ADN pela ribose no RNA:

Diagrama da molécula do ADN vista ao microscópio:

Se prestarmos atenção com mais pormenor notamos que a molécula do ADN é


formada como se fosse uma escada com duas colunas e muitos degraus, mas que
foi depois retorcida em forma de uma hélice.

Outra coisa que observamos é que os degraus da escada são feitos de “madeiras
diferentes ou tacos” ou sejam de substâncias diferentes chamadas BASES com
os seguintes nomes:

A = Adenina
G = Guanina
T = Timina
C = Citosina

9
As moléculas das 4 BASES

O alfabeto anglo-saxónico tem 25 letras. O alfabeto português tem 22 porque


não usa as letras K, W e Y. Mas a Mãe Natureza só com estas 4 letras AGTC é
capaz de criar e manter vivos todos os seres, que existem na terra!

A Mãe Natureza apenas com estas 4 letras é capaz de criar milhões de


sequências diferentes, originando assim tremendas variedades existentes neste
planeta: animais, vegetais e vírus!

10
O que são mitocôndrias

As mitocôndrias estão na clara ou branco do ovo da galinha. O branco do ovo


contem a energia certa para o pintainho crescer durante 21 dias e depois sair da
casca cá para fora. Pois é na parte branca ou citoplasma de todas as nossas
células, que também está concentrada a energia para a célula poder viver.

Quem é que fornece essa energia às células? São as mitocôndrias que são
pedaços de filamentos de ADN ou pedaços das “escadas ou tacos ” do ADN que
se organizam de tal maneira na parte branca da célula, tornando-se em fábricas
energéticas, ou motores de energia fosfórica das células.

Célula completa com núcleo e citoplasma

(branco do ovo) mostrando as

Mitocôndrias

Os 99% das mitocôndrias encontram-se


no citoplasma, ou parte branca do ovo, e
são derivadas da mãe. O núcleo ou a
parte amarela ou gema do ovo não tem
nenhumas mitocôndrias, porque as
poucas mitocôndrias que o esperma leva
consigo ao fecundar o óvulo, (ovo da
mulher), são as mitocôndrias masculinas
que desaparecem.

Portanto as mitocôndrias só dão informação genética a


respeito da família da mãe. As mitocôndrias só revelam

11
o padrão da herança materna. Duma maneira geral cada célula contem entre
500 a 1000 mitocôndrias. À primeira vista era de esperar que a análise genética
das mitocôndrias fosse muito fácil, mas assim não acontece, porque as
mitocôndrias formam uma variedade enorme de combinações entre si tornando
a sua identificação muito difícil. É por isso que a identificação paterna por meio
do cromossoma Y é muitíssimo mais fácil. O cromossoma Y é constante e nunca
muda mesmo em milhares de gerações. As mulheres mudam muito mais
facilmente…. Incluindo nas suas mitocôndrias! Assim é composto o organismo
do ser humano.

O que é um cromossoma

Cromossoma é um vocábulo composto por duas palavras gregas: cromo = cor,


mais soma = corpo. Para melhor compreensão temos que analisar a composição
de uma célula. O melhor exemplo é o ovo da galinha que tem três partes
importantes: (1) a casca ou membrana, (2) a parte branca do ovo ou
protoplasma e (3) o amarelo, a gema ou o núcleo da célula do ovo. Vistos ao
microscópio os cromossomas parecem filamentos compostos por moléculas de
ácido desoxirribonucleico, simbolizado pela sigla ADN, também chamada
unidade da vida.

Na raça humana o cromossoma Y é o mais pequeno e o mais


poderoso. Ele é que determina o sexo masculino. Mas ainda tem
outra característica muitíssimo importante: o cromossoma Y
NUNCA se modifica de geração em geração. Quer dizer que o
cromossoma Y do meu filho tem exactamente as mesmas
características, os mesmos genes, que o seu antecessor macho de
há milhares de anos! É por isso que as análises do cromossoma
Y se podem fazer nas ossadas que sejam guardadas em
mausoléus até cinquenta ou cem mil anos!

Vejamos agora um diagrama dum cromossoma Y. Notar que os


traços horizontais dentro do cromossoma representam os genes

12
ou “agulhas do ramo do pinheiro”. Uns são mais grossos que os
outros e têm até cor diferente, daí o nome de cromossoma…
cromo de cor… omas humanos são numerados conforme o seu
tamanho e formato. Assim os cromossomas maiores são aqueles
que têm um número mais baixo.

Os cromossomas estão organizados em pares. Por isso o par de


cromossomas maiores chama-se número 1, e assim
sucessivamente. O par de cromossomas mais pequenos, são o
número 23, e são chamados cromossomas sexuais. No homem
este par é representado pelas letras XY. Na mulher por dois XX.
Aqui está uma imagem com o panorama geral dos 23 pares ou
46 cromossomas na raça humana.

13
Números de cromossomas existentes em

diferentes espécies

Cada espécie tem diferentes números de cromossomas, como


podemos constatar através desta tabela, sendo que as espécies
que mais se aproximam dos seres humanos são: o porco, o
coelho, o macaco e o rato.

14
Espécie 2n de cromossomas Espécie 2n de cromossomas
Drosófila 8 Humano 46
Centeio 14 Macaco 48
Coelho 44 Rato 44
Cobaia 16 Carneiro 54
A voante 16 Cavalo 64
Caracol 24 Galo 78
Minhoca 32 Carpa 104
Porco 40 Borboleta 380
Trigo 42 Samambaia 1200

O que o são genes

Por sua vez cada cromossoma possui cerca de 500 a 1000 genes. Os genes são
factores específicos que determinam por exemplo a cor da pele, a cor dos olhos,
etc. Cada gene tem uma função hereditária própria em cada indivíduo humano.
Há genes que são dominantes e outros que são recessivos. Os dominantes
transmitem as mesmas qualidades às gerações seguintes. Os recessivos
continuam como que “adormecidos” e só se revelam se receberem de ambos os
pais, um par de genes recessivos. Então juntos constituem uma força genética
dominante. Dentro da genética moderna, o gene é uma sequência de
nucleotídeos do ADN que pode ser transcrita em uma versão de RNA. O termo
gene foi criado por Wilhem Ludvig Johannsen. Desde então, muitas
definições de gene foram propostas.

15
O gene é um segmento de um cromossoma a que corresponde um código
distinto, uma informação para produzir uma determinada proteína ou
controlar uma característica, por exemplo, a cor dos olhos.

Este esquema ilustra o gene com relação à estrutura do ADN e um cromossoma


(direita). Árvore genealógica da vida humana Para simplificar esta explicação
genética podem-se comparar os cromossomas e os genes a um pinheiro com 23
pares de ramos.
Os ramos representarão os 46 cromossomas, formando 23 pares, e as folhas ou
agulhas do pinheiro serão os genes. Cada ramo terá 500 ou mil agulhas ou
folhas do pinheiro…. Um pinheiro com 23 pares de ramos num total de 46,
contendo entre 500 a 1000 agulhas ou folhas. Cada ramo é um cromossoma. As
agulhas (ou folhas) do pinheiro representam os genes. Os cromossomas da
raça humana: com 23 pares de cromossomas (ramos) num total de 46, contendo
um total de genes (agulhas) entre 500 a 1000. Notar no vértice do Pinheiro o
cromossoma 23 - sexual macho com X e Y. Os ramos da parte inferior do
pinheiro representam os cromossomas maiores portanto estes têm os números
mais baixos. Os dois cromossomas sexuais, ou os dois mais pequenos, estão
localizados na extremidade ou no vértice do pinheiro. Dede como é conhecido

16
na Indonésia recebeu dos pais, genes recessivos e por isso sofre desta doença
terrível sem cura que é o EV.

A epidermodisplasia verruciforme (EV) é uma genodermatose rara,


caracterizada pela susceptibilidade à infecção por tipos distintos de
papilomavírus humanos (HPV). Os vírus encontrados na EV são na sua maioria
específicos da doença, sendo denominados HPVs associados à EV (HPVEV). A
enfermidade inicia-se usualmente na infância, entre os cinco e os 11 anos de
idade, manifestando-se por múltiplas lesões de verrugas planas-símile e/ou
máculas semelhantes à pitiríase versicolor (PV). Após a terceira década de vida,
cerca de 30 a 50% dos doentes podem desenvolver câncer da pele,
frequentemente múltiplos e preferencialmente nas áreas que tem maior
exposição solar. A doença apresenta alterações imunológicas sobretudo da
imunidade mediada por células.

17
Essa deficiência imunológica parece ser local e específica, e a presença de
polimorfismos genéticos no complexo maior de histocompatibilidade (MHC)
determina apresentação inadequada de antígenos específicos do HP nas células
de defesa. Os doentes desenvolvem infecção disseminada e de longa duração
pelo HPV, a qual tardiamente pode desencadear distúrbios inespecíficos na
imunidade celular do doente.

Dede actualmente tem 37 anos, já foi casado e tem dois filhos. A primeira
verruga apareceu-lhe no joelho quando ele era adolescente. A medida que o
tempo foi passando o corpo foi-se-lhe enchendo de verrugas, com elas também
os problemas na vida de Dede foram aparecendo: Perdeu o emprego, a mulher
abandonou -o, passou a ser evitado pelos vizinhos, pelos amigos. Assim sendo a
maioria das actividades normais do dia-a-dia de um homem, como atender o
telefone, pescar, trabalhar, fazer a sua higiene etc., ficaram limitadas ou
impossíveis de fazer. Para provir a sua subsistência num dado momento da sua
vida, Dede trabalhou num circo e desse modo conseguiu mobilizar a atenção
pública, recebendo doações e ajuda do governo para realizar um tratamento.

18
Com as doações que recebeu, Dede comprou um terreno onde planta arroz, e
comprou um carro usado para que os parentes o possam transportar ao
hospital. E desta forma a sua vida tornou-se um pouco melhor e a sua vergonha
e sofrimento foram se atenuando. Recentemente a Discovery Channel fez um
documentário mostrando as aflições que essa doença causa ao «Homem
árvore.» E foi graças a esse documentário que o governo Indonésio resolveu
agir.

Em Agosto de 2008, Dede foi submetido a uma intervenção cirúrgica para


remover 6kg de verrugas de seu corpo. Essa intervenção foi-lhe proporcionada
pelo estado Indonésio.

19
Mas essas verrugas estão novamente a crescer, e Dede precisa de ajuda para
fazer novas cirurgias. Esta doença não tem cura, e para que Dede tenha uma
melhor qualidade de vida, precisa de ser submetido a cirurgias anuais (o ideal
seriam duas por ano).
Dede é um ser humano vítima de uma doença sem cura, mas que pode ter o seu
sofrimento amenizado, caso o governo da Indonésia assuma a responsabilidade
e lhe forneça a assistência médica necessária. O único tratamento conhecido é a
remoção cirúrgica das verrugas que voltam a crescer em seguida, o que exige
cirurgias frequentes. Mas necessárias para que Dede possa viverem com o
mínimo de dignidade, que esta doença monstruosa lhe permite.

20
Uma vez que lhe roubou a dignidade e o respeito das outras pessoas, pois
infelizmente devido a doença de que padece, Dede foi abandonado por todos
desde: a esposa os filhos e os vizinhos ficando apenas alguns familiares para
cuidarem dele, e ajuda-lo em coisas tão banais como a higiene diária, a
confecção dos alimentos. Uma simples ida ao médico para Dede tornou-se um
calvário devido a repulsa que as pessoas sentem dele.

21
CONCLUSÃO

Através da informação que obtive na pesquisa efectuada, Dede não é o único


homem a padecer desta doença desumana que é a Epidermodisplasia
Verruciforme, mas é o único sobre o qual existe informação disponível. Esta
doença faz o indivíduo descer ao mais baixo do seu ser, pois passa a ser visto
como um pária é não como um ser humano com sentimentos e necessidades,
como qualquer outro que sofra de uma doença degenerativa. É aqui que os
governos, sejam de que países forem, devem criar leis de apoio, ás pessoas que
sofrem deste e de outros tipos de doenças ou enfermidades. Todo o ser humano
tem direito a sua dignidade enquanto pessoa, não apenas quando é saudável
mas sobretudo quando sofre de algum tipo de enfermidade ou doença. No caso
de Dede o governo Indonésio, deveria criar uma instituição para que lhe possam
ser prestados todos os cuidados e ajuda necessária, para que o seu dia-a-dia se
desenrole dentro da maior normalidade possível. Todos os governos deveriam
criar os meios adequados e necessários, para o estudo e desenvolvimento de
pesquisas na área desta e de outras doenças deste tipo, pois o que tem sido feito
até hoje não é o suficiente. Sendo a Epidermodisplasia Verruciforme uma
doença congénita, desta forma é transmitida de pais para filhos o mais provável
é que os filhos de Dede ou algum dos seus descendentes quando os tiver venham
a sofrer desta horrível doença. Seria bom que o governo e os especialistas na
matéria, começassem a pensar seriamente em novas medidas para poderem
ajudar estas e outras pessoas que possam aparecer tanto na Indonésia como
noutra parte qualquer do planeta, pois como apareceu a Dede pode surgir em
qualquer outro país. Por isso seria conveniente que todos os países quando
surge uma doença deste tipo se unissem para procurar a cura ou pelo menos
algum meio para minimizar os efeitos destas doenças.

Trabalho elaborado por: Amélia Carneiro

22