Acta Tropica 153 (2016) 101110

Contents lists available at ScienceDirect

Acta Tropica
journal homepage: www.elsevier.com/locate/actatropica

Regulation of intrinsic apoptosis in cycloheximide-treated

macrophages by the Sichuan human strain of Chinese Leishmania
isolates
Jin Zeng a,1 , Qi-Wei Chen a,1 , Ze-Ying Yu a,2 , Jun-Rong Zhang a,2 , Da-Li Chen a , Chen Song b ,
Jie Luo b , Chen Zhang b , Shun-Li Wang b , Jian-Ping Chen a,c,
a

Department of Parasitology, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, Sichuan, PR China
West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, Sichuan, PR China
c
Animal Disease Prevention and Food Safety Key Laboratory of Sichuan Province, Sichuan University, Chengdu, Sichuan, PR China
b

a r t i c l e

i n f o

Article history:
Received 29 March 2015
Received in revised form 27 August 2015
Accepted 12 October 2015
Available online 23 October 2015
Keywords:
Leishmania
Apoptosis
THP-1
RAW264.7
Cycloheximide

a b s t r a c t
Leishmania spp. are able to survive and proliferate inside mammals mononuclear phagocytes, causing
Leishmaniasis. Previous studies have noted that the regulation of apoptosis in host cells by these parasites
may contribute to their ability to evade the immune system. However, current results remain unclear
about whether the parasites can promote or delay the apoptotic process in host cells, because the regulatory effect of Leishmania was assumed to be strain-, species- and even infection time-dependent. The aim
of this study was to investigate whether the Sichuan isolates of Chinese Leishmania (SC10H2) can alter the
process of intrinsic apoptosis induced by cycloheximide in different types of macrophage cell lines and to
determine in which steps of the signaling pathway the parasites were involved. Human THP-1 and mouse
RAW264.7 macrophages were infected by SC10H2 promastigotes followed by cycloheximide stimulation
to assess the alteration of intrinsic apoptosis in these cells. The results indicated that SC10H2 infection
of human THP-1 macrophages could promote the initiation of intrinsic apoptosis, but completely opposite results were found in mouse RAW264.7 macrophages. Nevertheless, the expression of Bcl-2 and the
DNA fragmentation rates were not altered by SC10H2 infection in the cell lines used in the experiments.
This study suggests that SC10H2 promastigote infection is able to promote and delay the transduction
of early apoptotic signals induced by cycloheximide in THP-1 and RAW264.7 macrophages, revealing
that the regulation of intrinsic apoptosis in host cells by SC10H2 in vitro occurs in a host cell-dependent
manner. The data from this study might play a signicant role in further understanding the relationship
between Leishmania and different host cells.
2015 Elsevier B.V. All rights reserved.

1. Introduction
Protozoan parasites of the genus Leishmania, obligate intracellular pathogens, primarily invade macrophages as well as monocytes
in mammals and cause zoonotic leishmaniasis. Depending on the
different organs where the pathogen is found, human leishmaniasis
can be categorized into three main forms: visceral, cutaneous and
mucocutaneous leishmaniasis. Substantial human infection can be
caused by at least 21 of 30 species of the genus Leishmania in dif-

Corresponding author at: Department of Parasitology, West China School of

Preclinical and Forensic Medicine, Sichuan University, No. 24, 1st Section of First
Ring Road South, Chengdu, Sichuan 610041, PR China.
E-mail address: jpchen007@163.com (J.-P. Chen).
1
These authors contributed equally to this work.
2
These authors also contributed equally to this work.
http://dx.doi.org/10.1016/j.actatropica.2015.10.010
0001-706X/ 2015 Elsevier B.V. All rights reserved.

ferent regions (Chandra and Naik, 2008; Olivier et al., 2005). In the
relationship between Leishmania and humans, the sand y plays
an important role as a vector that carries and transmits the parasite to human beings. The two forms of Leishmania, promastigotes
and amastigotes, represent the different stages in sand ies and
humans, respectively. When transmitted by sand ies, promastigotes develop into amastigotes in macrophages and continue to
proliferate inside of the ies. An intriguing component of Leishmania pathogenesis is the ability to evade the immune system,
which promotes successful survival and further proliferation by
protecting the parasites from the killing effect of macrophages.
To avoid immune elimination and guarantee their survival
within hosts, Leishmania can evade and suppress the immune
defense system of hosts by developing multiple tactics, such
as modifying the complement system and phagocytosis process,
interfering with signaling pathways in macrophages, modulating

102

J. Zeng et al. / Acta Tropica 153 (2016) 101110

cytokine and chemokine production, and altering Toll-like receptor

and T cell response pathways, etc. (Gupta et al., 2013; Mougneau
et al., 2011; Bogdan and Rollinghoff, 1998). A prominent mechanism of the immune evasion of Leishmania is apoptosis, a process
of programmed cell death. Traditionally, the activation of apoptosis
in response to various stimuli has been known to terminate the life
of cells in a silent way without initiating inammatory processes
or causing further injury to the adjacent tissue or cells. However,
Leishmania parasites have been found to regulate the process of
apoptosis by interfering with the transduction of apoptotic signals
in infected host cells (Getti et al., 2008; Wanderley et al., 2005).
Therefore, the parasites may benet from this regulation to avoid
the killing by internal inammatory factors produced by host cells
in the early stage and thus may continue proliferating inside host
cells.
Several previous studies have demonstrated that Leishmania undermine the apoptotic process in infected host cells. The
amastigotes of Leishmania mexicana have been found to inhibit
apoptosis of infected monocyte-derived dendritic cells in vitro
(Gutierrez-Kobeh et al., 2013). Early stage infection with both Leishmania donovani and Leishmania infantum has also been shown to
involve a delay in the induced apoptosis process of primary mouse
macrophages (PMM) and RAW264.7 macrophages (Deschacht
et al., 2012). Moreover, infection with Leishmania major has been
shown to delay spontaneous apoptosis and prolong the life span
of infected neutrophil granulocytes (Sarkar et al., 2013; Aga et al.,
2002). On the other hand, there are also opposite ndings arguing
that Leishmania is able to promote apoptosis in host cells. When
incubated with L. major and two additional Old World Leishmania
species for long time periods of time, THP-1 cells showed increased
numbers of apoptotic bodies with amastigotes inside (Getti et al.,
2008). Although the results regarding the regulation of apoptosis
by Leishmania remain controversial, most of the investigators are
more or less in agreement that the regulatory effects of the parasites
on host cell apoptosis are dependent on different strains, different species and different experimental time points (Getti et al.,
2008; Deschacht et al., 2012; Donovan et al., 2009). Notably, most
of the studies have employed either mouse cells or human cells for
their investigation and have obtained consistent results from them.
Whether the utilization of cells from both humans and mice as the
host cells for one Leishmania species can lead to different outcomes
regarding the regulation of apoptosis has not yet been investigated.
In this study, MHOM/CN/90/SC10H2 Leishmania isolates were
isolated from symptomatic patients in Sichuan Province, China.
Great efforts have been made to investigate this isolated strain in
different aspects in previous studies, including in vitro cultivation
and critical gene expression (Cao et al., 2012; Guan et al., 2012; Li
et al., 2007; Hu et al., 2002; Tian et al., 2004). The aim of this study is
to gain insight into whether and how Leishmania SC10H2 regulates
cycloheximide (CHX)-induced intrinsic apoptosis of macrophages
by measuring of several hallmarks of the signaling pathway. Considering the possibility of different outcomes due to the different
mammalian cells used, we extended this study by using two cell
lines, human THP-1 and mouse RAW264.7. Notably, Leishmania
SC10H2 was found to regulate cycloheximide-induced apoptosis
in human and mouse macrophages, but the two cell types had
totally contrasting results. In the case of RAW264.7 cells, the parasites successfully prevented early apoptotic signal transduction
by delaying the loss of mitochondrial transmembrane permeabilization, decreasing the activities of caspase-9 and caspase-3 and
inducing the expression and synthesis of XIAP. However, surprisingly, the induced apoptosis in THP-1 cells was promoted by
Leishmania infection under the same experimental conditions. At
the same time, the expression of Bcl-2, an important death inhibitor
located on mitochondria, was not affected by parasite infection.
Finally, the parasites-mediated regulation was found to persist

throughout the early stage of apoptosis, with an absence of changes

of DNA fragmentation rates. Altogether, our ndings may help to
clarify the immune evasion of Leishmania regarding its role in apoptosis, and this study is the rst to compare the regulation of the
signaling pathway of intrinsic apoptosis in different mammalian
cells by the SC10H2 strain.
2. Materials and methods
2.1. Cultivation of parasites and macrophage cells
Leishmania MHOM/CN/90/SC10H2 was maintained as promastigotes in vitro in liquid nitrogen. The promastigotes were
cultured at 27 C in M199 medium (Hyclone), enriched with 10%
new-born calf serum (NBCS) (Sijiqing), 50 g/ml streptomycin and
50 U/ml penicillin. The promastigotes were used at the late logarithmical growth phase.
A murine macrophage-like stable cell line RAW 264.7 was a kind
gift from Dr. Xue F., Friendship Hospital of Capital Medical University, China and cultured at 37 C in a 5% CO2 95% air mixture in
RPMI-1640 media (Thermo) containing 2.05 mM l-glutamine, supplemented with 10% heat-inactivated fetal bovine serum (HiFBS)
(Bioind), 100 g/ml penicillin, 100 g/ml streptomycin, with passage every two days. A human monocytic cell line THP-1 was
purchased from Shanghai Institutes for Biological Sciences and routinely maintained in the same conditions as RAW264.7 cells, with
medium changed three times a week.
2.2. Preparation and treatment of macrophages
Those cells were maintained in cell culture asks of multiwell plates. To induce differentiation into macrophage-like cells,
THP-1 cells were treated with phorbol 12-myristate 13-acetate
(PMA) stimulation (0.6 g/ml) (Sigma) for 1 day. Cells were washed
twice with sterile phosphate-buffered saline (PBS) to remove PMA
and were incubated for an additional 3 days in fresh RPMI-1640
medium prior to infection.
Both terminally differentiated THP-1 and RAW264.7 cells were
subjected to infection with SC10H2 promastigotes (10:1 parasite:
cell ratio) for 4 h only or followed by treatment of pro-apoptotic
agent cycloheximide (CHX) (5 g/ml for THP-1, 2.5 g/ml for
RAW264.7 cells) for 16 h. All incubations were performed at 37 C
in a 5% CO2 95% air mixture for variable periods of time. After
a 4-h post-infection, all medium with non-infecting promastigotes was washed away and replaced by fresh RPMI-1640 medium,
then followed by CHX treatment. After 16 h of treatment with CHX,
all medium was discarded and cells were harvested for following
experiments. Uninfected and untreated macrophages were used as
control.
2.3. Optical microscopy and transmission electron microscopy
Terminally differentiated THP-1 cells were infected by Leishmania SC10H2 promastigotes at a desired parasite to cell ratio. After
the desired time of infection, cells were harvested for preparation of samples. The infected macrophages were methanol xed,
Wright-stained and observed by optical microscopy. Spare sample of the macrophages was collected by centrifugation, xed in
glutaraldehyde, processed and observed by transmission electron
microscopy.
2.4. Mitochondrial transmembrane potential
To detect the impact of the parasites infection on the
mitochondrial transmembrane potential of the macrophages, a
mitocaptureTM mitochondrial apoptosis detection uorometric kit

J. Zeng et al. / Acta Tropica 153 (2016) 101110

103

Table 1
Primers used for reverse transcription PCR.
Primer sequence (5 3 )

cDNA

Transcript

Sense

Antisense

Human

Bcl-2
cIAP1
XIAP
GAPDH

TTTGAGTTCGGTGGGGTCAT
CTCCAGCCTTTCTCCAAACCC
AGACACCATATACCCGAGGAACC
GAAGGTGAAGGTCGGAGTCA

TGACTTCACTTGTGGCCCAG
CCAGTTACTGAGCTTCCCACCAC
GTTTTCCACCACAACAAAAGCAC
TTCACACCCATGACGAACAT

Mouse

Bcl-2
c1AP-1
XIAP
-actin

GCACCCACTCCCTTCATACAAT
GTGGTTAAAGCAGCCTTGGA
TTGGAACATGGACATCCTCA
ATATCGCTGCGCTGGTCGTC

ACGCAGGTTACATTCGTCTTCC
CATTGGTGTCACACACGTCA
CGCCTTAGCTGCTCTTCAGT
AGGATGGCGTGAGGGAGAGC

(Biovision) was used. Enough incubation buffer was pre-warmed

to 37 C and MitoCaptureTM reagent was diluted, just prior to use,
in the buffer (1 l MitoCapture to 1 ml buffer) with vortex of the
solution immediately. The cells prepared on coverslips in plates
were stained with MitoCapture. Observation and images acquisition were performed immediately by a uorescence microscopy
using a band-pass lter. Cells in resting stage, because of MitoCapture accumulation and aggregation in the mitochondria, show a
bright orange to red uorescence, whereas apoptotic cells show
green due to the altered mitochondrial transmembrane potential making MitoCapture diffused in the cytoplasm remaining its
monomer form.
2.5. Extraction of protein
The treated macrophages were washed three times with cold
PBS, scraped from the 25 cm2 asks, collected by centrifugation at
600 g, 4 C for 5 min. The pellets were re-suspended in two different
lysis buffer solution to prepare lysates for western blot analysis
(RIPA lyses buffer: 50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA,
0.2% Nonidet P-40, 0.5 mM PMSF) (all from Sigma) and for protease
activity assay (Caspase lysis buffer, Beyotime), respectively. Lysates
were kept on ice for 30 min with occasional vortex followed by
centrifugation at 18,000 g, 4 C for 10 min to obtain supernatants
for further experiments. Protein samples were subjected to BCA and
Bradford methods for determination of total protein concentration,
and frozen immediately at 80 C until utilization.
2.6. Caspase-3 and caspase-9 activation assay
The detection of caspase-3 and caspase-9 protease activities
was carried out according to the manufacturers instructions by
the caspase-3 and caspase-9 activity assay kit (Beyotime). The
prepared protein lysates were transferred to a 96-well plate and
incubated with the reaction buffer individually containing the
caspase-3 substrate Ac-DEVD-pNA (2 mM), the caspase-9 subustrate Ac-LEHD-pNA (2 mM) at 37 C for 2 h. The pNA was released
by the caspase-3 and caspase-9 activity and measured by Tecan
micro plate reader at 405 nm wavelengths.
2.7. Western blot
A western blot analysis of prepared protein samples was
performed following standard protocols. A 10 L of each sam-

ple containing 30 g proteins were used for SDS-PAGE analysis

in 12% acrylamide gels. Proteins were separated at 120 V, until
the dye front had reached the bottom of the gel, and then
transferred at 150 mA for 150 min from gels to polyvinylidene
uoride(PVDF) membranes (Whatman) in transfer buffer (25 mM
TrisHCl, 192 mM glycine, 20% methanol, 0.02% SDS, pH 8.3). Afterward, the membranes were incubated for 2 h in blocking solution
consisting of PBS-T buffer (1 PBS, 0.1% Tween) supplemented with
1% bovine serum albumin (BSA) (Sigma). Then they were incubated
in antibody dilutions, for 16 h at 4 C with shaking, individually with
XIAP, Bcl-2 (both from Cell Signaling Technology), GAPDH and actin (both from ImmunoWay), respectively. All primary antibodies
were used at a 1:1000 dilution and HRP conjugated anti-rabbit
secondary antibodies (ZSGB-BIO) were used at a 1:5000 dilution.
Membranes were then visualized by ECL Western blot detection
system (Beyotime).
2.8. Reverse transcription PCR and related procedures
The treated macrophages as well as control macrophages were
harvested and total RNA was isolated following the guideline of the
Simply P Total RNA Extraction Kit (BioFlux). Genomic DNA removal
and the rst strand cDNA synthesis were conducted following the
procedure by using One-Step gDNA removal and cDNA Synthesis
SuperMix (TransGen Biotech).
The relative expression of Bcl-2, c-IAP1, XIAP, GAPDH and actin mRNA were determined by using 1 l of cDNA of the different
samples, 2 l of forward and reverse primer (TSINGE), respectively,
for the genes listed in Table 1, 25 l of 2 Taq Plus MasterMix. The
PCR conditions, including cycles and temperatures for amplication
of macrophage cDNAs were indicated as follows (Tables 2 and 3).
The PCR products were analyzed by the 1.2% agarose gel electrophoresis.
2.9. TUNEL assay for chromatin fragmentation
TdT-mediated dUTP Nick-End Labeling (TUNEL) assays were
performed using the in situ cell death detection kit (Keygen
Biotech), according to manufacturers instructions. It was used
to detect apopototic cell death by enzymatic labeling of DNA
strand breaks with uorescein-dUTP and TdT. THP-1 and RAW264.7
cells were plated onto coverslips in 24-well plates with infec-

Table 2
PCR cycles and temperatures for amplication of the different human cDNA.
Thermo-cycling conditions

Melting
Annealing
Extension
Final extension
Cycles

Bcl-2

cIAP1

XIAP

GAPDH

Temperature

Duration

Temperature

Duration

Temperature

Duration

Temperature

Duration

95 C
63 C
72 C
72 C
35

30 s
30 s
1 min
5 min

95 C
59 C
72 C
72 C
28

30 s
30 s
1 min
5 min

95 C
61 C
72 C
72 C
29

30 s
30 s
1 min
5 min

94 C
55 C
72 C
72 C
30

2 min
1 min
1 min
5 min

104

J. Zeng et al. / Acta Tropica 153 (2016) 101110

Table 3
PCR cycles, and temperatures for amplication of the different mouse cDNA.
Thermo-cycling conditions

Melting
Annealing
Extension
Final extension
Cycles

Bcl-2

cIAP1

-actin

XIAP

Temperature

Duration

Temperature

Duration

Temperature

Duration

Temperature

Duration

94 C
56 C
72 C
72 C
30

30 s
30 s
30 s
5 min

94 C
55 C
72 C
72 C
30

2 min
1 min
1 min
5 min

94 C
55 C
72 C
72 C
30

30 s
30 s
1 min
5 min

95 C
59 C
72 C
72 C
30

30 s
30 s
1 min
5 min

tion and treatments described previously. The prepared coverslips

were xed with paraformaldehyde and subjected to TUNEL system. Macrophages with DNA double-strand ruptures appeared dark
brown. Finally, images were acquired by phase contrast microscopy
at 1,000 magnication.

observed (Fig. 1A), while the internal amastigotes were typically

round or round-like in shape (Fig. 1B). After lysis with trypsin, the
infected cells contained typical amastigotes within the cytoplasm,
as observed under a transmission electron microscope, indicating
the alteration of the morphology of the parasite after internalization by host cells (Fig. 1C).

2.10. Statistical analysis

Statistical analysis was performed by GraphPad Prism 6
Software using one-way analysis of variance followed by the
Bonferronis multiple comparisons test (nonparametric ANOVA).
Signicance was set at P < 0.05. Each experiment was carried out
two or three times independently according to the condition of
individual experiment.
3. Results
3.1. Culture and establishment of an internal parasitic model of
the Chinese Leishmania strain SC10H2
An internal parasitic model needed to be established to guarantee the internalization of parasites by macrophages prior to
performing any other experiment. There are usually two forms of
the parasites: promastigotes, the form that is found in the sand
y, and amastigotes, the form that is found inside host cells. The
in vitro cultured promastigotes of the Chinese Leishmania strain
SC10H2 were used to infect macrophages derived from human
THP-1 cells at an optimized ratio and time before harvesting and
morphological conformation with Wrights Dye. Under an optical
microscope, the nuclei and kinetoplasts of the promastigotes were

3.2. Leishmania infection promotes the alteration of the

cycloheximide-induced loss of mitochondrial transmembrane
potential in macrophages
Because Leishmania are internal parasitic protozoa, the intrinsic apoptotic signal pathway of host cells might be an appropriate
target for the parasites. Mitochondria are critical to maintain cell
homeostasis because of their role in energy metabolism. In addition, they also play major roles in intrinsic apoptosis. Dysfunction
of mitochondria is recognized as an important hallmark of the
initiation of the intrinsic apoptotic process because the permeabilization of the mitochondrial outer membrane leads to the release
of a great amount of pro-apoptotic factors from the mitochondria
into the cytoplasm, which transducer apoptotic signals (Cosentino
and Garcia-Saez, 2014), such as nuclear condensation and caspase activation. Normally, the integrity of the mitochondrial outer
membrane is essential for maintaining the potential of the mitochondrial membrane. With the existence of signals such as heat,
UV or reactive oxygen species, the potential is gradually reduced
and the apoptotic process is initiated (Rodust et al., 2009; Liu et al.,
2009). Thus, the loss of mitochondrial transmembrane potential
represents an abnormal condition of the mitochondria as well as
an initiation signal of apoptosis.

Fig. 1. The morphology and infectivity of Leishmania SC10H2. (A) Leishmania SC10H2 promastigotes visualized by Wrights Dye. With an infection ratio of 10:1
(parasitesmacrophages) and an infection time of 4 h, the culture medium with uninfected promastigotes was harvested and stained for agella, nuclei and kinetoplasts in
each individual under an optical microscope. The results are from one representative experiment out of three. (B) Leishmania SC10H2 amastigotes visualized by Wrights
Dye. With the same infection ratio and time as above, the infected cells on slides with transformed amastigotes in their cytoplasm could be observed by Wrights Dye. The
results are from one representative experiment out of three. (C) The transformed SC10H2 amastigotes within THP-1 macrophages visualized with a transmission electron
microscope. A single amastigote with the structure of both the cell nucleus and the kinetoplast could be found close to the nuclear membrane of the macrophage under the
transmission electron microscope. The results are from one representative experiment out of two.

J. Zeng et al. / Acta Tropica 153 (2016) 101110

105

Fig. 2. Loss of the mitochondrial transmembrane potential of macrophages shown by uorescence. With cycloheximide stimulation (5 g/ml for THP-1 cells and 2.5 g/ml
for RAW264.7 cells) for 16 h after a 4 h infection time (infection ratio 10:1), the infected THP-1 cells (A1) had a greater ratio of early apoptotic cells to normal cells than that of
control cells (A2), representing an increased loss of mitochondrial transmembrane potential in these cells. In contrast to the results found in THP-1 cells, infected RAW264.7
cells treated with cycloheximide demonstrated a decreased loss of mitochondrial transmembrane potential (A3) by having a greater ratio of normal cells to early apoptotic
cells compared with that of control cells (A4). (B1) and (B2) represent the infected and uninfected THP-1 cells without stimulation, respectively. (B3) and (B4) demonstrate
infected and uninfected RAW264.7 cells without stimulation, respectively. The orangered color indicates normal cells, while the green color indicates early apoptotic cells.
The results are from one representative experiment out of two. (For interpretation of the references to color in this gure legend, the reader is referred to the web version of
this article.)

To examine the alteration of the mitochondrial transmembrane

potential, cells infected with Leishmania on coverslips were treated
with MitoCapture, a dye that distinguishes cells with lost mitochondrial transmembrane potential from normal cells according to the
ratio of the green and red uorescence. In this study, the baseline
level of the loss of transmembrane potential in THP-1 macrophages
was measured with or without incubation of Leishmania, showing
no difference between the two groups (Fig. 2B1 and B2). Therefore,
a proapoptotic treatment was included following the incubation of
parasites with macrophages. Cycloheximide is a chemical that is
conventionally used as an inducer of the intrinsic apoptotic pathway because of its role in interfering with the synthesis of essential
proteins for cell survival (Donovan et al., 2009; Martin et al., 1995).
An optimal concentration (5 g/ml) and stimulation time of cycloheximide was chosen to stimulate infected THP-1 macrophages
and controls. Under cycloheximide challenge, Leishmania were able
to drive THP-1 macrophages into an accelerated apoptotic status
by increasing the ratio between the apoptotic and normal cells
(Fig. 2A1 and A2).
To compare cells from different species of mammals, mouse
RAW264.7 macrophages were treated and harvested using the
same experimental conditions before staining with MitoCapture.
At baseline, the infected RAW264.7 also showed a similar ratio
between the two colors compared with control cells (Fig. 2B3 and
B4). Notably, treatment with cycloheximide (2.5 g/ml) as an apoptotic inducer, resulted in the opposite effect in infected mouse
macrophages compared to human THP-1 cells. The infected mouse
cells had a decreased ratio between early apoptotic and normal cells
compared to controls (Fig. 2A3 and A4). Therefore, the regulation
of the early apoptotic process by Leishmania SC10H2 might occur
in a host cell genetic background-dependent manner.
3.3. Leishmania infection regulates the cycloheximide-induced
activities of important caspases in THP-1 and RAW264.7
macrophages
Caspase family members play an essential role in the apoptotic
process by orchestrating signal transduction (McIlwain et al., 2013).
Members of this family can be classied into apoptosis initiators
and apoptosis effectors according to their roles in different steps of

apoptosis. Caspase-9 has been recognized as an important initiator

caspase that is responsible for initiating the upstream processes
in the intrinsic pathway (McIlwain et al., 2013). Caspase-3, one of
the effector caspases, is a critical executioner that can be cleaved
and activated from its zymogen form by caspase-9 (Tait and Green,
2013). When intrinsic apoptosis is triggered, permeabilization of
the mitochondrial membrane leads to the release of cytochrome
c to form a complex with Apaf-1, called the apoptosome, recruiting pro-caspase-9 and activating caspase-3 (Parrish et al., 2013;
Banerjee et al., 2011). Caspase-3 executes the process of chromatin
degradation via caspase-activated DNase (Cohen, 1997). Therefore,
the activities of these two caspases may indicate the transduction
of apoptotic signals from the mitochondria to the cytoplasm. In this
study, the activities of the caspases were measured by evaluating
their ability to cleave their corresponding substrates.
After cleavage, the tetrapeptide substrates used in the experiment release a chromogenic radical that can be recognized under
a certain wavelength. The absorbance units within a period of
time, representing the caspase activity, were calculated. To obtain
the data, the absorbance values at 10 min, 30 min, 1 h and 2 h
were collected and bar charts were constructed with triplicate
samples. The results of the experiment revealed up-regulated
caspase-3 and caspase-9 activity in Leishmania-infected human
THP-1 macrophages induced by cycloheximide, revealing the promotion of apoptosis in these cells (Fig. 3A and C). Notably, the
activities of caspase-3 and caspase-9 in THP-1 also had an increasing trend during baseline infection, but to a lesser extent compared
with the groups stimulated by cycloheximide (Fig. 3A and C).
In contrast to human THP-1 macrophages, the activities of both
caspase-3 and caspase-9 were decreased in mouse RAW264.7 cells
when the cells were incubated with cycloheximide after parasite
infection (Fig. 3B and D), indicating the delayed or weakened apoptotic process in these cells. Data from both of the two cell lines
demonstrated regulatory effect of initiator caspase-9 and effector
caspase-3 towards on infection-mediated apoptotic stimulation,
indicating that the apoptotic pathway was altered from upstream
to downstream. However, infected RAW264.7 macrophages did not
display a signicant decrease of caspase activities during baseline
infection compared with control cells (Fig. 3B and D), implying that

106

J. Zeng et al. / Acta Tropica 153 (2016) 101110

Fig. 3. Caspase-3 and caspase-9 activities of human THP-1 macrophages and mouse RAW264.7 macrophages. In (A), CHX+ and CHX represent the caspase-3 activities
of infected and un-infected THP-1 cells for 4 h (10:1 ratio) followed by stimulation with cycloheximide (5 g/ml) for 16 h. + and Represent the caspase-3 activities of
infected and uninfected THP-1 cells for 4 h without stimulation of the inducer for 16 h. The indices of (C) represent the same experimental conditions as (A), with caspase-9
activity measured in place of caspase-3. In (B), CHX+ and CHX represent the caspase-3 activities of infected and uninfected RAW264.7 cells for 4 h followed by stimulation
of cycloheximide (2.5 g/ml) for 16 h. + and Represent the caspase-3 activities of infected and uninfected RAW264.7 cells for 4 h without cycloheximide stimulation for
16 h. The indices of (D) represent the same experimental conditions as (B), with the caspase-9 activity measured in place of caspase-3. The unit of caspase activity was 
absorbance/(time in h concentration of protein). The results represent the mean SD of three independent experiments. * P 0.05, ** P 0.01 and *** P 0.001.

the caspase activities in mouse macrophages were not affected by

parasite infection alone. Intriguingly, parasitic infection regulated
caspase activities independent of apoptosis induction in THP-1
cells, but not in RAW264.7 cells, revealing the different sensitivities
of the two cell lines towards infection.

3.4. Leishmania infection regulates the expression of XIAP in

macrophages stimulated by cycloheximide but has no impact on
Bcl-2 expression in these cells
Because Leishmania SC10H2 was found to regulate the mitochondrial transmembrane potential as well as caspase activities
following cycloheximide stimulation, the investigation of downstream apoptotic factors is essential for understanding the whole
pathway.
The inhibitors of apoptosis protein (IAP family), sharing the socalled baculovirus-IAP-repeat (BIR) domain, are death regulators
interfering in the apoptotic process (Yang, 2000; Dubrez-Daloz
et al., 2008). The X-linked inhibitor of apoptosis protein (XIAP)
is the only family member that inhibits caspases by direct physical interaction (Obexer and Ausserlechner, 2014). Other members,
such as c-IAP1 and c-IAP2, can mark caspase-3 and caspase-7 for
proteasomal degradation, but without direct physical interaction
(Blankenship et al., 2009). As XIAP is able to regulate the nal steps

in death execution, it has been studied most frequently in cancer

research.
We chose XIAP as the main target of IAPs and assessed the protein expression level by western blotting. The results showed that
following cycloheximide treatment, infected THP-1 macrophages
had less XIAP synthesis than control cells (Fig. 4), indicating that
SC10H2 was able to promote cycloheximide-induced apoptosis
through the regulation of IAPs. At the same time, the XIAP protein
level was found to be elevated in cycloheximide-treated, infected
RAW264.7 cells compared to control cells (Fig. 4). These regulatory
effects of XIAP may help explain the diverse effects on caspase-3
activity found in infected cells treated with cycloheximide in our
previous results.
The B-cell lymphoma-2 (Bcl-2) family of proteins plays a signicant role in regulating the mitochondrial apoptosis pathway
(Garcia-Saez, 2012). According to their roles in apoptosis, the proteins are divided into two groups, pro-apoptotic and anti-apoptotic
proteins. Among them, Bcl-2 acts as a major anti-apoptotic
(pro-survival) factor to inhibit other pro-apoptotic Bcl-2 family
members, such as Bax, as well as some important pro-apoptotic
factors released from mitochondria, such as cytochrome c (Adams
and Cory, 2007; Chipuk and Green, 2008). In several cases of intrinsic apoptosis, Bcl-2 has been shown to be down-regulated to release
the pro-apoptotic members it binds to. Therefore, examination of

J. Zeng et al. / Acta Tropica 153 (2016) 101110

107

Fig. 4. Different expression levels in THP-1 macrophages and mouse RAW264.7 macrophages by Western blot and PCR. (+) indicates the XIAP, Bcl-2 and c-IAP1 expression
levels of macrophages stimulated with cycloheximide (5 g/ml for THP-1 cells and 2.5 g/ml for RAW264.7 cells) for 16 h after infection with Leishmania (10:1) for 4 h. ()
Indicates cells stimulated with cycloheximide for 16 h without parasites infection. GAPDH was the housekeeping control for THP-1 cells, and -actin was the housekeeping
control for RAW264.7 cells. The molecular weight of each antigen tested in the Western blot is: 53 kDa for XIAP, 28 kDa for Bcl-2, 37 kDa for GAPDH and 43 kDa for -actin.
The results are from one representative experiment out of three.

Bcl-2 will help to determine whether this critical anti-apoptotic

factor is involved in the regulatory effect on host cells by SC10H2.
Our experiments showed that Bcl-2 protein synthesis was not
markedly different between infected THP-1 macrophages and control cells treated with cycloheximide (Fig. 4). Furthermore, there
was also no alteration of Bcl-2 in RAW264.7 when infected with
Leishmania followed by cycloheximide stimulation (Fig. 4). These
results revealed that SC10H2 might bypass Bcl-2 to regulate the
intrinsic apoptosis pathway.
In addition to protein synthesis, the genetic expression of
IAPs and Bcl-2 was measured to determine whether the alteration of protein expression resulted from alteration at the genetic
level. c-IAP1, another apoptotic inhibitor of IAPs that drives the
ubiquitin-mediated degradation of executioner caspases (Silke and
Vucic, 2014), was also inspected in the experiment. The results
showed that the expression of XIAP and c-IAP1 in cycloheximidetreated, infected THP-1 macrophages was decreased compared to
un-infected cells (Fig. 4), indicating that the regulation of these proteins by SC10H2 was initiated at the genetic level. As expected,
the expression of Bcl-2 was not changed by parasitic infection
(Fig. 4), revealing that neither the genetic expression nor protein
processing was affected by parasite infection. The apoptotic factors measured in human THP-1 cells were also investigated in
mouse RAW264.7 macrophages. The results revealed that under the
same experimental conditions, RAW264.7 cells showed an opposite
pattern to that of THP-1 macrophages. The c-IAP1 and XIAP expression levels were up-regulated with parasitic infection, while Bcl-2
expression was not altered (Fig. 4). These results were in accordance
with the protein expression results by western blot, implying that
the alteration at the protein level was a result of regulation at the
genetic level, but not at the protein processing stage.
3.5. The DNA fragmentation level of macrophages is not changed
by Leishmania infection
In previous experiments, the early signals of intrinsic apoptosis, including the alteration of the mitochondrial transmembrane

potential, caspase activities and expression of apoptosis inhibitors,

was assessed in Leishmania-infected macrophages. Therefore,
assessing the later stage of intrinsic apoptosis was crucial to investigate the whole signaling pathway. To determine whether infection
with and proliferation of Leishmania SC10H2 amastigotes inside
macrophages could have an impact on DNA fragmentation, the
execution step of apoptosis, infected or uninfected host cells on
coverslips were challenged with or without cycloheximide stimulation followed by a TUNEL assay. TUNEL is the most frequently
used method for the detection of DNA fragments produced during
apoptosis. These small fragments have a 3 -OH end that can bind
to dUTP marked with DAB dye catalyzed by the TdT enzyme. The
results of the TUNEL assay can either be shown in photos with a
visible dye under a microscope or charts representing the uorescence density of the ow cytometry. Here, the former method was
chosen to obtain a more direct impression of the apoptotic level.
Surprisingly, there was no difference in the DNA fragmentation
rates between infected cells with cycloheximide stimulation and
cells receiving stimulation only, neither in THP-1 nor RAW264.7
cells (Fig. 5A1A4). Moreover, the DNA fragmentation rates in all of
the cycloheximide-treated cells were very low compared with the
positive controls, indicating the absence of visible DNA fragmentation in this study. At the same time, the baseline DNA fragmentation
rates of infected and uninfected cells were also low and similar to
each other (Fig. 5B1B4), implying that parasitic infection failed to
induce visible alterations in the DNA fragmentation rates in these
two cell lines.
4. Discussion
The regulation of host cell signaling pathways by intracellular parasites is of great importance for their survival and
proliferation. As one of the fetal protozoa that can cause severe
diseases in the clinic, Leishmania spp. are believed to regulate the
immune system of host cells to avoid killing by the destructive factors produced in the process of phagocytosis. Conventional studies
of this regulatory mechanism have mostly focused on the inam-

108

J. Zeng et al. / Acta Tropica 153 (2016) 101110

Fig. 5. A TUNEL assay shows the DNA fragmentation level of THP-1 and RAW264.7 macrophages following apoptosis induction and at the baseline level. (A1) revealed that
the DNA fragmentation level of THP-1 cells infected with SC10H2 (infection ratio of 10 parasites:1 macrophage) for 4 h followed by stimulation with cycloheximide for 16 h
were similar to that of uninfected cells under the same conditions (A2). When treated with only parasites for 4 h without an apoptotic inducer, the uninfected THP-1 cells
(B2) and SC10H2-infected cells (B1) also had the same DNA fragmentation level. (C1) and (C2) demonstrate the positive and negative control, respectively.
(A3) shows that the DNA fragmentation level of RAW264.7 cells infected by SC10H2 (infection ratio of 10 parasites:1 macrophage) for 4 h followed by stimulation with
cycloheximide for 16 h were similar to that of uninfected cells under the same conditions (A4). When treated with parasites only for 4 h, the uninfected RAW264.7 cells (B4)
and SC10H2-infected cells (B3) also had the same DNA fragmentation level. (C3) and (C4) demonstrate the positive and negative control, respectively. The results are from
one representative experiment out of three.

matory system, the main component involved in Leishmania killing

effects by host immunity (Filardy et al., 2014, 2010; Wenzel et al.,
2012; Adalid-Peralta et al., 2011). Recently, investigators discovered another important process that was altered by Leishmania
spp.apoptosis (Wanderley et al., 2005; Deschacht et al., 2012; ElHani et al., 2012; Gannavaram and Debrabant, 2012; Wanderley
and Barcinski, 2010). In this study, we compared the regulatory
effects of cycloheximide-induced intrinsic apoptosis by infection
with Sichuan isolates of Chinese Leishmania (SC10H2) in human
and mouse macrophage cell lines. Under the same experimental conditions, the early signals of intrinsic apoptosis, including
loss of the mitochondrial transmembrane potential and caspase-9
and caspase-3 activities, were increased in THP-1 cells by parasitic infection, while all of these hallmarks were decreased in
RAW264.7 cells. Moreover, the genetic expression and protein synthesis of XIAP were reduced in THP-1, but elevated in RAW264.7
cells by parasitic infection. These results clearly indicate that infection with Leishmania SC10H2 successfully regulates the early signal
transduction of apoptosis induction in THP-1 and RAW264.7 cells,
but with opposite outcomes. However, SC10H2 did not interfere
with the classical apoptosis inhibitor Bcl-2 in both of the cell lines.
Under the same experimental conditions, the early signals of intrinsic apoptosis, including loss of the mitochondrial transmembrane
potential and caspase-9 and caspase-3 activities, were increased in
THP-1 cells by infection with the parasites, while all of these hallmarks were decreased in RAW264.7 cells. Surprisingly, the induced
DNA fragmentation rates in the two cell lines were not changed by
parasitic infection, indicating the possibility of an early stage regulatory process, as suggested by the results of this study.
In previous studies, most of the investigators only used mouse
macrophages, either primary cells derived from the bone marrow or cell lines, as host cells for the assessment of alteration

of apoptosis by Leishmania infection. By using different species

of Leishmania, including L. major, L. donovani and L. infantum,
the investigators evaluated their ability to interfere with apoptosis in murine macrophages by measuring the activity of effector
caspase-3, cytochorme c release, Bcl-2 family member expression
and associated pathways, such as NF-B and PI3K/Akt, demonstrating that Leishmania infection prevents the induction of apoptosis in
these cells (Donovan et al., 2009; Akarid et al., 2004; Moore et al.,
1994; Ruhland et al., 2007; Srivastav et al., 2014). In these reports,
Leishmania were able to delay the apoptosis caused by either chemical apoptosis inducers, such as staurosporine and cycloheximide,
or the deprivation of essential stimulating factors (Donovan et al.,
2009; Akarid et al., 2004; Moore et al., 1994; Ruhland et al., 2007;
Srivastav et al., 2014), which is in agreement with our results. However, our studies demonstrated for the rst time that Leishmania
were also able to promote the induction of intrinsic apoptosis in
host cells. Because Leishmania SC10H2 were obtained from patients
with visceral leishmaniasis, human macrophages might be a better target for the infection. Therefore, we chose one of the most
frequently used cell lines, the THP-1 human monocytic leukemia
cell line, and stimulated it with PMA for differentiation. In addition
to THP-1 cells, human U-937 monocytes could also be differentiated into macrophages. Lisi and colleagues, who investigated
the relationship between Leishmania infection and induced apoptosis in U-937 monocytes, found that infection with L. infantum
promastigotes or treatment with soluble factors from the culture
media of parasites prevented apoptosis induced by actinomycin
D. Notably, the strain of parasites and host cells that they chose
were different from those used in our experiments. Conventionally, the only prevalent species of Leishmania in China was thought
to be L. donovani, which causes visceral leishmaniasis (Cao et al.,
2011; Yang et al., 2013). Previous studies using SC10H2 suggested

J. Zeng et al. / Acta Tropica 153 (2016) 101110

that these isolates were more like Leishmania tarentolae than L.

donovani in origin (data not shown), indicating the diversity of
the isolates. Therefore, they might use different membrane-bound
or secreted components to regulate host cells. Indeed, different
species of Leishmania might have different impacts upon apoptosis in infected host cells, as suggested by Donovan et al. (2009).
Moreover, although U-937 and THP-1 cells are both monocytes,
the former are human myeloid monocytes, while the latter are
leukemic monocytes. Compared with the U-937 cell line, differentiated THP-1 cells were reported to behave more like native
monocyte-derived macrophages (Auwerx, 1991). Actually, in the
absence of an apoptotic inducer, apoptosis was also found to be
induced in THP-1 macrophages by infection with three species of
Leishmania (Getti et al., 2008).
With regards to the two macrophages in this study,
RAW264.7 cells originated from primary mouse monocyte-derived
macrophages, while human THP-1 cells required further differentiation into macrophages by stimuli, such as PMA. As suggested
by Daigneault et al. (2010) the expression of CD206, a marker
the alternatively activates macrophages, in PMA-induced THP-1
macrophages was nearly null, while it was detected in nearly half
of primary monocyte-derived macrophages. Furthermore, murine
macrophages are assumed to express receptors that could be recognized by the virulence factors of Legionella pneumophila, leading
to the activation of caspases (Tao et al., 2013). However, human U937 cells failed to respond to these factors because of the absence
of such receptors or mutations in the alleles (Tao et al., 2013), indicating that the regulatory effects might vary according to the host
cells genetic background. Thus, it is likely that Leishmania adapts to
the different expression proles of receptors and other important
markers on the membranes of THP-1 and RAW264.7 macrophages
by promoting or preventing apoptosis in these cells, respectively.
Moreover, Getti et al. (2008) suggested the existence of different regulatory effects at different stages of infection, because they
detected an induction of apoptosis after 48 and 72 h of Leishmania infection, which is much longer than the most frequently used
time point of 24 h. Based on their ndings, the promastigotes might
promote the apoptosis of host cells to avoid the initiation of inammation and prevent apoptosis to allow for proliferation at different
stages. In this case, the time point that we chose to measure the
apoptotic pathway (4 h of infection followed by 16 h of stimulation) might represent different stages of regulation in THP-1 and
RAW264.7 cells, resulting in opposite outcomes.
In this study, neither the protein synthesis nor genetic expression of Bcl-2, which functions similarly to Bcl-xL (Kang and
Reynolds, 2009) were altered by Leishmania infection. Previously,
the expression of Bcl-2 was found to be increased in neutrophils
co-incubated with L. major (Sarkar et al., 2013). However, the elevated Bcl-2 was a result of L. major only, but not the combination of
infection and stimulation with the apoptotic inducer. In addition,
the different host cells and different species of Leishmania used in
experiments might lead to different outcomes. Moreover, Donovan
et al. (2009) noted that Bcl-xL, one of the pro-survival members in
the Bcl-2 family, was up-regulated in murine macrophages infected
by several strains of Leishmania are treated with cycloheximide.
Therefore, the regulation of apoptosis was likely to skip Bcl-2 and
rely on Bcl-xL, which functions similarly to Bcl-2.
Although early signs of apoptosis were discovered to be regulated by Leishmania infection and treat with cycloheximide, an
alteration of the DNA fragmentation rates was not observed. Most
studies focusing on the relationship between host cell apoptosis and Leishmania infection have investigated DNA fragmentation
after an examination of early apoptotic signal transduction. Many
have noted that the prevention of apoptosis in host cells by Leishmania was accompanied by decreased DNA fragmentation rates
(Akarid et al., 2004; Moore et al., 1994; Ruhland et al., 2007; Lisi

109

et al., 2005). All of these results are based on different concentrations of the different chemical inducers or different time points
to measure DNA fragments. The inducers used for these experiments included actinomycin D, staurosporine, cycloheximide and
campothecin (Donovan et al., 2009; Akarid et al., 2004; Ruhland
et al., 2007; Lisi et al., 2005) in different concentrations. A dose gradient study of cycloheximide in rats suggests that below a certain
concentration, cycloheximide has no effect on the inhibition of protein synthesis (Alessenko et al., 1997). Nevertheless, it is unlikely
that the doses (5 g/ml for THP-1 cells, 2.5 g/ml for RAW264.7
cells) were below this threshold, because these concentrations
were appropriate according to other experiments for the induction of DNA fragmentation (Kim et al., 2000; Wang et al., 2005;
Cipriani et al., 2001). Another condition that should be considered
is the time points used for the measurements. Studies using chemical inducers primarily chose a time point of approximately 28 h in
total (with infection for 4 h and stimulation for 24 h) while our time
point was 20 h (with infection for 4 h and stimulation for 16 h). In
particular, Donovan et al. (2009) used the same inducer with the
same infection and stimulation time points as we did, but the concentration of cycloheximide was not stated. An interesting result
obtained from nding of induced apoptosis in THP-1 macrophages
infected by Leishmania was the absence of DNA fragmentation
(Nagata and Apoptotic, 2000), indicating that apoptosis could occur
independently of DNA fragmentation or nuclear degeneration. The
incomplete activation of macrophage apoptosis was also demonstrated in the investigation of L. pneumophila and host cell apoptosis
(Abu-Zant et al., 2005). However, the results of our study indicate
that even the control cells, which were treated with cycloheximide
alone, did not show increased DNA fragmentation rates, indicating
that the particular type of apoptosis induction mentioned above
was not the cause of the absence of DNA fragmentation. Therefore,
we attributed the absence of DNA fragmentation to the time points
that we chose for the experiments. Because the exposure time of
macrophages to cycloheximide was relatively short, the nal step
of apoptosis may not have occurred. Indeed, when we conducted
the experiment in THP-1 macrophages with prolonged time points
(24 h of infection followed by 24 h of stimulation with cycloheximide), we observed a difference in the DNA fragmentation rates
between infected and un-infected cells (data not shown), demonstrating that the absence of DNA fragmentation was due to the short
challenge time. Surprisingly, after 48 h, infected THP-1 cells displayed a decreased induction of apoptosis, which is the opposite of
the result that we found at the 20 h time point. Therefore, our data
suggest that Leishmania both induce and prevent apoptotic signal
transduction. In the early stage, they promote apoptosis to avoid
killing by inammatory factors, while in the late stage, they prevent the apoptosis to proliferate as much as possible inside host
cells.

5. Conclusions
In conclusion, the SC10H2 isolates of Chinese Leishmania are
able to infect macrophages in vitro. Cycloheximide-induced intrinsic apoptosis is regulated by these parasites, but has contrasting
outcomes in THP-1 and RAW264.7 cells. Therefore, it is likely that
Leishmania adapt to the particular environment of the individual host cells from different mammals and thus have different
regulatory effects. However, there was no difference in the DNA
fragmentation rates between the infected and un-infected cells
during apoptosis induction, despite the signicant differences in
the early signs of apoptosis, indicating that the time point chosen
is too early for the execution step. Future studies should focus on
the possibility of reversing of apoptosis at prolonged time points in

110

J. Zeng et al. / Acta Tropica 153 (2016) 101110

different host cells and the relationship between SC10H2 survival

and host immunity in vivo.

Acknowledgments
This work was supported by the National Natural Science
Foundation of China (81171607, J1103604), the National Project
of Important Infectious Diseases of China (2008-ZX10004-011),
and the Foundation for Young Teachers in Sichuan University
(2012SCU11093).

References
Abu-Zant, A., et al., 2005. Incomplete activation of macrophage apoptosis during
intracellular replication of Legionella pneumophila. Infect. Immun. 73 (9),
53395349.
Adalid-Peralta, L., et al., 2011. Mechanisms underlying the induction of regulatory
T cells and its relevance in the adaptive immune response in parasitic
infections. Int. J. Biol. Sci. 7 (9), 14121426.
Adams, J.M., Cory, S., 2007. Bcl-2-regulated apoptosis: mechanism and therapeutic
potential. Curr. Opin. Immunol. 19 (5), 488496.
Aga, E., et al., 2002. Inhibition of the spontaneous apoptosis of neutrophil
granulocytes by the intracellular parasite Leishmania major. J. Immunol. 169
(2), 898905.
Akarid, K., et al., 2004. Leishmania major-mediated prevention of programmed cell
death induction in infected macrophages is associated with the repression of
mitochondrial release of cytochrome c. J. Leukoc. Biol. 76 (1), 95103.
Alessenko, A.V., et al., 1997. Mechanisms of cycloheximide-induced apoptosis in
liver cells. FEBS Lett. 416 (1), 113116.
Auwerx, J., 1991. The human leukemia cell line, THP-1: a multifacetted model for
the study of monocyte-macrophage differentiation. Experientia 47 (1), 2231.
Banerjee, R., et al., 2011. TGF-beta-regulated tyrosine phosphatases induce
lymphocyte apoptosis in Leishmania donovani-infected hamsters. Immunol.
Cell. Biol. 89 (3), 466474.
Blankenship, J.W., et al., 2009. Ubiquitin binding modulates IAP
antagonist-stimulated proteasomal degradation of c-IAP1 and c-IAP2(1).
Biochem. J. 417 (1), 149160.
Bogdan, C., Rollinghoff, M., 1998. The immune response to Leishmania:
mechanisms of parasite control and evasion. Int. J. Parasitol. 28 (1), 121134.
Cao, D.P., et al., 2011. Species delimitation and phylogenetic relationships of
Chinese Leishmania isolates reexamined using kinetoplast cytochrome oxidase
II gene sequences. Parasitol. Res. 109 (1), 163173.
Cao, D.P., et al., 2012. Axenic culture and identication of amastigotes from Sichuan
human strain of Chinese Leishmania isolates. Vet. Parasitol. 183 (34), 353355.
Chandra, D., Naik, S., 2008. Leishmania donovani infection down-regulates
TLR2-stimulated IL-12p40 and activates IL-10 in cells of
macrophage/monocytic lineage by modulating MAPK pathways through a
contact-dependent mechanism. Clin. Exp. Immunol. 154 (2), 224234.
Chipuk, J.E., Green, D.R., 2008. How do BCL-2 proteins induce mitochondrial outer
membrane permeabilization? Trends Cell Biol. 18 (4), 157164.
Cipriani, B., et al., 2001. Curcumin inhibits activation of V gamma9Vdelta2 T cells
by phosphoantigens and induces apoptosis involving apoptosis-inducing
factor and large scale DNA fragmentation. J. Immunol. 167 (6), 34543462.
Cohen, G.M., 1997. Caspases: the executioners of apoptosis. Biochem. J. 326 (pt. 1),
116.
Cosentino, K., Garcia-Saez, A.J., 2014. Mitochondrial alterations in apoptosis. Chem.
Phys. Lipids 181, 6275.
Daigneault, M., et al., 2010. The identication of markers of macrophage
differentiation in PMA-stimulated THP-1 cells and monocyte-derived
macrophages. PLoS One 5 (1), e8668.
Deschacht, M., et al., 2012. Role of oxidative stress and apoptosis in the cellular
response of murine macrophages upon Leishmania infection. Parasitology 139
(11), 14291437.
Donovan, M.J., et al., 2009. Leishmania infection inhibits cycloheximide-induced
macrophage apoptosis in a strain-dependent manner. Exp. Parasitol. 123 (1),
5864.
Dubrez-Daloz, L., Dupoux, A., Cartier, J., 2008. IAPs: more than just inhibitors of
apoptosis proteins. Cell Cycle 7 (8), 10361046.
El-Hani, C.N., et al., 2012. Apoptosis and apoptotic mimicry in Leishmania: an
evolutionary perspective. Front. Cell. Infect. Microbiol. 2, 96.
Filardy, A.A., et al., 2010. Proinammatory clearance of apoptotic neutrophils
induces an IL-12(low) IL-10(high) regulatory phenotype in macrophages. J.
Immunol. 185 (4), 20442050.
Filardy, A.A., et al., 2014. Infection with Leishmania major induces a cellular stress
response in macrophages. PLoS One 9 (1), e85715.
Gannavaram, S., Debrabant, A., 2012. Programmed cell death in Leishmania:
biochemical evidence and role in parasite infectivity. Front. Cell. Infect.
Microbiol. 2, 95.
Garcia-Saez, A.J., 2012. The secrets of the Bcl-2 family. Cell Death Differ. 19 (11),
17331740.

Getti, G.T., Cheke, R.A., Humber, D.P., 2008. Induction of apoptosis in host cells: a
survival mechanism for Leishmania parasites? Parasitology 135 (12),
13911399.
Guan, W., et al., 2012. Phylogenic analysis of Chinese Leishmania isolates based on
small subunit ribosomal RNA (SSU rRNA) and 7 spliced leader RNA (7SL RNA).
Acta Parasitol. 57 (2), 101113.
Gupta, G., Oghumu, S., Satoskar, A.R., 2013. Mechanisms of immune evasion in
leishmaniasis. Adv. Appl. Microbiol. 82, 155184.
Gutierrez-Kobeh, L., et al., 2013. Inhibition of dendritic cell apoptosis by
Leishmania mexicana amastigotes. Parasitol. Res. 112 (4), 17551762.
Hu, X., et al., 2002. Difference in DNA sequences in SSU rDNA variable regions
among pathogens isolated from different epidemic foci of visceral
leishmaniasis in China. Chin. Med. J. (Engl.) 115 (10), 14571459.
Kang, M.H., Reynolds, C.P., 2009. Bcl-2 inhibitors: targeting mitochondrial
apoptotic pathways in cancer therapy. Clin. Cancer. Res. 15 (4), 11261132.
Kim, H.S., et al., 2000. Induction of apoptosis in human leukemia cells by
3-deazaadenosine is mediated by caspase-3-like activity. Exp. Mol. Med. 32
(4), 197203.
Li, J.F., et al., 2007. Cloning of avastin gene of Leishmania donovani isolates from
Sichuan Province and its expression in eucaryotic system. Zhongguo Ji Sheng
Chong Xue Yu Ji Sheng Chong Bing Za Zhi 25 (2), 124128.
Lisi, S., et al., 2005. Infection with Leishmania infantum inhibits actinomycin
-induced apoptosis of human monocytic cell line U-937. J. Eukaryot. Microbiol.
52 (3), 211217.
Liu, C.Y., Lee, C.F., Wei, Y.H., 2009. Role of reactive oxygen species-elicited
apoptosis in the pathophysiology of mitochondrial and neurodegenerative
diseases associated with mitochondrial DNA mutations. J. Formos. Med. Assoc.
108 (8), 599611.
Martin, S.J., et al., 1995. Early redistribution of plasma membrane
phosphatidylserine is a general feature of apoptosis regardless of the initiating
stimulus: inhibition by overexpression of Bcl-2 and Abl. J. Exp. Med. 182 (5),
15451556.
McIlwain, D.R., Berger, T., Mak, T.W., 2013. Caspase functions in cell death and
disease. Cold Spring Harb. Perspect. Biol. 5 (4), a008656.
Moore, K.J., Turco, S.J., Matlashewski, G., 1994. Leishmania donovani infection
enhances macrophage viability in the absence of exogenous growth factor. J.
Leukoc. Biol. 55 (1), 9198.
Mougneau, E., Bihl, F., Glaichenhaus, N., 2011. Cell biology and immunology of
Leishmania. Immunol. Rev. 240 (1), 286296.
Nagata, S., Apoptotic, D.N.A., 2000. Fragmentation. Exp. Cell Res. 256 (1), 1218.
Obexer, P., Ausserlechner, M.J., 2014. X-linked inhibitor of apoptosis proteina
critical death resistance regulator and therapeutic target for personalized
cancer therapy. Front. Oncol. 4, 197.
Olivier, M., Gregory, D.J., Forget, G., 2005. Subversion mechanisms by which
Leishmania parasites can escape the host immune response: a signaling point
of view. Clin. Microbiol. Rev. 18 (2), 293305.
Parrish, A.B., Freel, C.D., Kornbluth, S., 2013. Cellular mechanisms controlling
caspase activation and function. Cold Spring Harb. Perspect. Biol. 5 (6).
Rodust, P.M., et al., 2009. UV-induced squamous cell carcinomaa role for
antiapoptotic signalling pathways. Br. J. Dermatol. 3 (161 Suppl), 107115.
Ruhland, A., Leal, N., Kima, P.E., 2007. Leishmania promastigotes activate PI3K/Akt
signalling to confer host cell resistance to apoptosis. Cell Microbiol. 9 (1),
8496.
Sarkar, A., et al., 2013. Infection of neutrophil granulocytes with Leishmania major
activates ERK 1/2 and modulates multiple apoptotic pathways to inhibit
apoptosis. Med. Microbiol. Immunol. 202 (1), 2535.
Silke, J., Vucic, D., 2014. IAP family of cell death and signaling regulators. Methods
Enzymol. 545, 3565.
Srivastav, S., et al., 2014. Leishmania donovani prevents oxidative burst-mediated
apoptosis of host macrophages through selective induction of suppressors of
cytokine signaling (SOCS) proteins. J. Biol. Chem. 289 (2), 10921105.
Tait, S.W., Green, D.R., 2013. Mitochondrial regulation of cell death. Cold Spring
Harb. Perspect. Biol. 5 (9).
Tao, L., et al., 2013. Induction of rapid cell death by an environmental isolate of
Legionella pneumophila in mouse macrophages. Infect. Immun. 81 (9),
30773088.
Tian, Y., Chen, J.P., Hu, X.S., 2004. Cloning and sequence analysis of the ribosomal
DNA ITS gene of Leishmania donovani isolates from hill foci of China. Zhongguo
Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 22 (5), 294296.
Wanderley, J.L., Barcinski, M.A., 2010. Apoptosis and apoptotic mimicry: the
Leishmania connection. Cell. Mol. Life Sci. 67 (10), 16531659.
Wanderley, J.L., et al., 2005. Apoptotic mimicry: an altruistic behavior in
host/Leishmania interplay. Braz. J. Med. Biol. Res. 38 (6), 807812.
Wang, Z., et al., 2005. TNF-alpha induces proliferation or apoptosis in human
saphenous vein smooth muscle cells depending on phenotype. Am. J. Physiol.
Heart Circ. Physiol. 288 (1), H293301.
Wenzel, U.A., et al., 2012. Leishmania major parasite stage-dependent host cell
invasion and immune evasion. FASEB J. 26 (1), 2939.
Yang, B.B., et al., 2013. Analysis of kinetoplast cytochrome b gene of 16 Leishmania
isolates from different foci of China: different species of Leishmania in China
and their phylogenetic inference. Parasite Vectors 6, 32.
Yang, Y.L., 2000. The IAP family: endogenous caspase inhibitors with multiple
biological activities. Cell Res. 10 (3), 169177.