Você está na página 1de 155

Volume 38 Number 4

http://www.rdi.ku.ac.th

Kasetsart Journal : Natural Science October - December 2004 Volume 38 Number 4

October - December 2004

The Kasetsart Journal


Advisor :

Napavarn Noparatnaraporn
Rangsit Suwanketnikom

Editor-in-Chief :

Ed Sarobol

Associate Editors :

Wanchai Chanprasert, Natural Science


Suparp Chatraphorn, Social Science

Editorial Board :

Natural Sciences

Social Sciences

Amara Thongpan

Suwanna Thuvachote

Pornsri Chairatanayuth

Pongpan Trimongkholkul

Onanong Naivikul

Matrini Ruktanonchai

Praparat Hormchan

Nongnuch Sriussadaporn

Korchoke Chantawarangul

Patana Sukprasert

Aree Thunyakijjanukij
Overseas Members
G. Baker (Mississippi State University, USA.)
A. Bruce Bishop (Utah State University, USA.)
John Hampton (Lincoln University, New Zealand)
Helen H. Keenan (University of Stathclyde, Scotland)
Chitochi Miki (Tokyo Institute of Technology, Japan)
Eiji Nawata (Kyoto University, Japan)
Manager :

Orawan Wongwanich

Assistant Managers : Surai Suwannarat


Business Office :

Kasetsart University Research and Development Institute (KURDI)


Kasetsart University, Chatuchak, Bangkok 10900.

The Kasetsart Journal is a publication of Kasetsart University intended to make available the results
of technical work in the natural and the social sciences. Articles are contributed by Kasetsart University faculty
members as well as by those from other institutions. The Kasetsart Journal : Natural Sciences edition is issued
four times per year in March, June, September and December while The Kasetsart Journal : Social Sciences
edition is issued twice a year in June and December.
Exchange publications should be addressed to
The Librarian,
Main Library,
Kasetsart University,
Bangkok 10900, Thailand.

KASETSART JOURNAL
NATURAL SCIENCE
The publication of Kasetsart University
VOLUME 38

October - December 2004

NUMBER 4

Hard Seededness and Germination of Small White Flower Morningglory


.......................................... Rungsit Suwanketnikom and Anucha Julakasewee
Screening of Tomato (Lycopersicon esculentum Mill.) Varieties for Resistance to Branched
Broomrape (Orobanche ramosa L.)
...................................... Etagegnehu G. Mariam and Rungsit Suwanketnikom
Study of Maize Populations Contained Different Proportions of U.S. Corn Belt Germplasm
......................................................... Krisda Samphantharak and Putu Darsana
Root Responses to Water Deficit under Rain-fed Lowland Rice
....................... Soraya Uyprasert, Theerayut Toojinda, Nawarat Udomprasert,
.............................................. Somvong Tragoonrung and Apichart Vanavichit
Effect of Dry Season Cutting Management on Subsequent Forage Yield and Quality of Ruzi
(Brachiaria ruziziensis) and Dwarf Napier (Pennisetum purpureum L.) in Thailand
.................................... Tadesse Tekletsadik, Sayan Tudsri, Sunanta Juntakool
............................................................................... and Somkiert Prasanpanich
Rescue of Peach Embryo in Culture Media with Additional of 6-benzylademine
and Gibberellic Acid
...................................................... Nonglak Jeengool and Unaroj Boonprakob
Morphology and Biology of Phyllocoptes azadirachtae Chandrapatya (Acari : Eriophyidae)
...................................... Pavinee Noochanapai and Angsumarn Chandrapatya
Evaluation of Different Larval Feeds for Survival and Development of Early Stage Mud Crab
(Scylla olivacea)
......... Pattanee Jantrarotai, Praphaphan Temphakdee and Suparp Pripanapong
A Proteomic Approach to Analyze Rice Bran and Shoots of Kao Dawk Mali 105
and its Mutants
.......................... Arunee Trisiriroj, Shui-Tein Chen and Narumon Jeyashoke1
Partial Purification of Mulberry (Morus rotunbiloba) Peroxidase Using Aqueous
Two-Phase Extraction Coupling with Ion-exchange and Gel-filtration Chromatography
................. Supannapa Luanghiran, Poontariga Harinnasut, Amara Thongpan,
.................................................... Amonrat Proomboon and Sunanta Ratanapo
Assay of Acetaminophen in Paracetamol Tablets by Differential Pulse Voltammetry
... Duncan Thorburn Burns, Nipon Tungkananuruk, Sumaporn Kasemsumran
.............................................................................. and Kanita Tungkananuruk

425

434
440

448

457

468
475

484

493

501

510

Application of the Dual Sorption Model for Water Adsorption of Maltodextrin Various DE
............................... Suched Samuhasaneetoo, Siree Chaiseri, Imad A. Farhat,
........................... Tanaboon Sajjaanantakul and Rungnaphar Pongsawatmanit
Prevalence of Flavobacterium psychrophilum Infection in Ayu (Plecoglossus altivelis)
in Gunma Prefecture, Japan and Comparison of the gyr B Sequences of Isolates
.................... Hajime Arai, Yukio Morita, Kunihiro Nobusawa, Masanao Arai,
......................................................... Sumalee Boonmar and Hirokazu Kimura
Evaluation of Thai Foods Prepared with Soluble Fiber Composite from Rice Bran
and Barley Flour
................. Patcharee Tungtrakul, Payom Auttaviboonkul, Boonma Niyomvit
........................................................................................ and Saipin Maneepun
Strength Development of Soft Marine Clay Stabilized with Cement and Fly Ash
................... Supakij Nontananandh, Sanupong Boonyong, Thakol Yoobanpot
......................................................................... and Korchoke Chantawarangul

515

523

531

539

Kasetsart J. (Nat. Sci.) 38 : 425 - 433 (2004)

Hard Seededness and Germination of Small


White Flower Morningglory
Rungsit Suwanketnikom1 and Anucha Julakasewee2

ABSTRACT
Small white flower morningglory (Ipomoea obscura (L.) Ker-Gawl) has hard seeds. Scarification
in 97.7% sulphuric acid for 40 to 120 minutes allowed germination, and the 80 minute treatment produced
the fastest germination rate (recorded as coefficient of velocity). For acid scarified seeds germination did
not differ at pHs ranging from 2.2 to 8.5, but the coefficient of velocity was greatest at a pH of 7.0, while
germination decreased as osmotic potential increased from -0.19 to -0.76 MPa, and no germination
occurred at -0.79 MPa. Cold scarification at 4C did not allow germination of non-scarified seeds and had
no effect on the germination of scarified seeds, which germinated equally well (>90%) at constant
temperatures between 15 and 35C. Germination at alternating temperatures did not differ from that at
constant temperatures. Seeds on the soil surface did not germinate, but >85% emergence was recorded
at sowing depths of 1 and 2 cm. Seeds sown at 8 and 12 cm did not emerge. Reducing light intensity (from
100 to 25% of full sunlight) did not affect seedling emergence or plant dry weight 12 weeks after sowing,
but did delay the time to flowering. As this climbing weed can smother pineapple fields, it is important
that effective control is achieved at the seedling stage.
Key words: small white flower morningglory, Ipomoea obscura (L.) Ker-Gawl, seed germination,
seedling development, light intensity

INTRODUCTION
Small white flower morningglory (Ipomoea
obscura (L.) Ker-Gawl) is a vine belonging to the
subfamily Ipomoea and family Convolvulaceae
(Elmore et al., 1990). This weed is found in warm,
humid tropical regions such as eastern Africa,
Asia, northern Australia and Fiji. It grows in
pasture, forest, on roadsides and abandoned lands
and in sandy soil near the seashore, and from sea
level to 1,300 m above sea level (Elmore et al.,
1990). It has been reported that small white flower

1
2

morningglory infests pineapple fields in Rayong


Province, eastern Thailand (Laosinwattana, 1994).
This is one of the major pineapple production
areas, supplying fruit to canning factories.
Normally, farmers control weeds in
pineapple with two herbicide applications. The
first application of bromacil alone or in combination
with diuron controls weeds for 3 to 4 months. The
same herbicides may also be applied at early or late
post-emergence. As pineapple grows and leaf
density increases, the crop usually inhibits the
growth or development of many weeds, but small

Department of Agronomy, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand.


Department of Plant Science, Faculty of Agriculture, Rachmongkala Institute of Technology, Bangpra Campus, Cholburi,
Thailand.

Received date : 27/05/04

Accepted date : 27/07/04

426

Kasetsart J. (Nat. Sci.) 38 (4)

white flower morningglory can grow in pineapple


crops and cause serious problems during fruit
harvest. As there is no selective post-emergence
herbicide available, farmers have to control this
weed by hand which increases the cost of
production. In order to develop effective control
measures, a more thorough understanding of the
factors governing seed germination and
development of this species is needed.
Factors affecting the germination of small
white flower morningglory or other Ipomoea spp.
have been studied in other countries where the
environmental conditions differ from that in
Thailand. Horak and Wax (1991) found that when
seeds of bigroot morningglory (I. pandurata) were
scarified by H2SO4 for 80 minutes, the percent and
rate of germination increased. Furthermore, they
found that seeds could germinate in soil at a pH of
5.5 to 7.5. The seeds of various species in the genus
Ipomoea can germinate at a similar ranges of
temperature; I. coccinia and I. obscura germinate
between 10 to 40C (Hardcastle, 1978), bigroot
morningglory between 15 to 30C and ivyleaf
morningglory between 20 to 35C (Gomes et al.,
1978).
The effects of osmotic potential on seed
germination of bigroot morningglory have been
previously studied; the seeds could not germinate
at an osmotic potential of 0.8 MPa (Horak and
Wax, 1991). The greatest emergence of purple
moonflower morningglory seed was observed
when planted 2.5 to 7.5 cm deep (Chandler et al.,
1977), while seeds of tall morningglory and ivyleaf
morningglory had more than 50% emergence from
7.5 cm in a sandy loam soil and from 5.0 cm in a
silt loam soil, respectively (Wilson and Cole,
1966). However, information on seed germination
of Ipomoea in Thailand is limited.
The objectives of the study were to
determine various factors governing seed
germination of small white flower morningglory
found in Thailand in order to assist in designing
effective management methods in pineapple fields.

MATERIALS AND METHODS


Seeds of small white flower morningglory
were collected from a commercial pineapple field
at Rayong province, approximately 120 km east of
Bangkok during early April 1997. A few days after
collection, the capsules were sun-dried and seeds
were separated from the dried capsules. A few
seeds were planted at a depth of 2 to 3 cm in pots
containing clay loam soil (23% sand, 35% silt,
42% clay and 1.7% organic matter) from a
commercial pineapple field. Each pot was 15 cm
in diameter and 15 cm tall. The pots were placed
outdoor in full sunlight (30 to 38C), and watered
as needed. Twenty days after planting, the seedlings
of small white flower morningglory were thinned
to one plant/pot. At first bloom, each flower was
tagged and labeled with the date of blooming. It
had previously been determined that seeds reached
their physiological maturity at 21 to 22 days after
blooming and became hardseeds after that period
(Julakasewee et al., 1999). Therefore, seeds used
in the experiments were collected 28 days after
blooming when the moisture content was
approximately 14% (Julakasewee et al., 1999).
The dormant hardseeds were separated from the
capsules, put in plastic bags, and refrigerated at 5
to 8C. These hardseeds were used to study various
factors affecting their germination, using methods
of adapted from those reported by Horak and Wax
(1991) and Hardcastle (1978).
Except for the acid scarification and
stratification experiments, hardseeds were acidscarified with 97.7% H2SO4 for 80 minutes and
rinsed with tap water for 5 minutes in order to
break the hardseed prior to the experiments.
Acid scarification
The hardseeds from refrigerator storage
were scarified in 97.7% H2SO4 from 0 to 120
minutes (Table 1). Another group of hardseeds
were pricked with a needle. The acid treated or
needle-pricked hardseeds were put on two layers

427

Kasetsart J. (Nat. Sci.) 38 (4)

Table 1 Effect of seed scarification with 97.7% H2SO4 and needle-pricking on the germination of
morningglory hardseeds.

1/

Methods of seed
scarification

Germination
(%)

Coefficient
of velocity

Non-viable seed
(%)

0 min. in acid
10 min. in acid
20 min. in acid
30 min. in acid
40 min. in acid
50 min. in acid
60 min. in acid
70 min. in acid
80 min. in acid
90 min. in acid
120 min. in acid
Needle-pricking

7 e1/
9e
54 d
66 c
89 ab
90 ab
93 ab
94 a
96 a
94 a
94 a
85 b

11.4 g
15.4 fg
16.4 fg
17.4 fg
25.6 f
27.9 e
32.6 de
40.9 bc
53.2 a
35.2 c
34.5 c
33.5 c

0e
0e
0e
0e
0e
1 de
3 cd
3 cd
3 cd
5 bc
6b
13 a

CV (%)

8.60

13.09

64.44

Means within the same column followed by the same letters are not significantly different at P<0.05

of 9 cm germination paper in a 10 cm petri dish


wetted with 8 ml of distilled water. All petri dishes
were placed in an unlit germination chamber
maintained at 27C. Distilled water was added as
needed.
The germinated seeds were counted and
recorded every day for 14 consecutive days. If the
radicle length was longer than 3 mm, those seeds
were considered as germinated seeds. The viability
of ungerminated seeds was tested by sodium
tetrazolium. The seed germination counts were
used to calculate the percent germination and
coefficient of velocity. The coefficient of velocity
was calculated by the following formula (Horak
and Wax, 1991):
Coefficient of velocity (CV) = 100[Ni /
NiTi]
When, Ni = The accumulated numbers of
germinated seed until day i
Ti = The numbers of day [i] after
sowing

In the planting depth and light intensity


experiments, emergence data were used in the
equation instead of germination data.
pH
Buffer solutions with different pH values
of 2.2 to 8.5 (Table 2) were prepared by mixing 0.1
M HCl or NaOH with distilled water. Other
experimental procedures were the same as
described for the acid scarification experiment.
Osmotic potential
Eight different osmotic potential solutions
(Table 3) were prepared by mixing distilled water
with polyethylene glycol 6000 as reported by
Michel (1983). After mixing, the osmotic potential
of each solution was measured with a vapor pressure
osmometer. The control (without polyethylene
glycol 6000) was distilled water with an osmotic
potential of 0.08 MPa (Mega Pascal). Other
experimental procedures were the same as those

428

Kasetsart J. (Nat. Sci.) 38 (4)

described for the acid scarification experiment.


Cold stratification
The hardseeds of small white flower
morningglory were taken from the refrigerator
and uniformly mixed with 160 g of fine sand and

Table 2 Effect of pH of germinating solution on


the germination of small white flower
morningglory.
pH

Germination (%)

Coefficient
of velocity

8.5
8.0
7.0
6.0
5.0
4.0
3.0
2.2

96 a1/
97 a
98 a
96 a
96 a
96 a
97 a
92 a

40.7 a
46.1 a
54.7 a
41.6 a
41.5 a
46.2 a
40.6 a
40.7 a

CV (%)

4.53

9.01

1/

Means within the same column followed by the same


letters are not significantly different at P<0.05

placed in a 10 cm petri dish, 25 seeds per petri dish.


Before mixing, the sand was cleaned with distilled
water and dried. Two milliliters of distilled water
was added to the sand in order to keep the petri dish
under low moisture conditions. All petri dishes
were placed in a refrigerator at a constant
temperature of 4C. Every two week for up to 12
weeks, 8 petri dishes were brought out from the
refrigerator and the sand was removed from the
seeds by washing with tap water. The seeds from
four petri dishes (4 replications) were subjected to
acid scarification with H2SO4 for 80 minutes
while seeds from the other four petri dishes (4
replications) were not treated. The scarified and
unscarified seeds were placed on two layers of 9
cm germinating paper in 10 cm petri dishes. Eight
ml of distilled water was added to each petri dish
and the petri dishes were kept in the germinating
chamber in the dark at 27C for 14 days. The
germination data were recorded as described in the
acid scarification experiment.
Temperature
Acid-scarified seeds were placed on 2 layers
of 9 cm germination paper in a 10 cm petri dish
wetted with 8 ml of distilled water. The petri

Table 3 Effect of osmotic potential solution on the germination of small white flower morningglory.
Osmotic potential (MPa)

1/

Germination (%)

Coefficient of velocity

-0.08
-0.19
-0.22
-0.34
-0.39
-0.58
-0.61
-0.76
-0.79

97 a1/
89 b
82 c
75 c
71 d
38 e
27 f
4b
0g

48.1 a
28.9 b
23.6 c
18.8 d
13.2 e
11.7 e
9.9 e
4.5 f
0.0 g

CV (%)

5.48

12.98

Means within the same column followed by the same letters are not significantly different at P<0.05

429

Kasetsart J. (Nat. Sci.) 38 (4)

dishes were then placed in the germination chamber


at either a constant temperature of between 5 and
40C (Table 4) or a fluctuating temperature (Table
5) for 14 days. The germination data were collected
as described in the acid scarification experiment.
Seeding depth
Acid-scarified seeds were planted in 40 cm
wide, 50 cm long and 40 cm tall pots containing
clay loam soil to 5 cm below the top edge of the
pot. One hundred seeds were placed in each pot at
a specific depth ranging from 0 to 12 cm (Table 6).
All pots were placed outdoor (30 to 38C) and
watered as needed. The data were collected in the

same manner as in the acid scarification experiment.


Light intensity
Acid-scarified seeds were planted in 30 cm
and 40 cm tall pots containing clay loam soil as in
the soil depth experiment. Twenty-five seeds were
planted in each pot at a depth of 1 to 2 cm. Four
small shade houses, 3 m wide, 4 m long and 2 m
tall, were built without walls, to enable airflow and
avoid heat buildup. The temperature of each house
was approximately equal to that of the open air (28
to 36C). The roof of the house for the 100% of
sunlight plot was covered with transparent saran
while in the other houses additional sarans reduced

Table 4 Effect of constant temperature for 2 weeks on the germination of small white flower
morningglory.
Temperature (C)
5
10
15
20
25
30
35
40
CV (%)
1/

Germination (%)
1 d1/
68 b
93 a
96 a
97 a
97 a
94 a
38 c
6.02

Coefficient of velocity (%)


8.3 e
20.4 d
28.2 cd
32.6 bc
39.1 ab
42.1 a
38.5 ab
34.8 abc
20.96

Means within the same column followed by the same letters are not significantly different at P<0.05

Table 5 Effect of fluctuating temperature for 2 weeks on the germination of small white flower
morningglory.

1/

Temperature (C)

Germination (%)

Coefficient of velocity (%)

20 (16 hrs)/ 10(8 hrs)


30 (16 hrs)/ 20(8 hrs)
40 (16 hrs)/ 30(8 hrs)

92 a1/
96 a
90 a

18.8 b
38.6 a
35.7 a

CV (%)

4.32

7.51

Means within the same column followed by the same letters are not significantly different at P<0.05

430

Kasetsart J. (Nat. Sci.) 38 (4)

Table 6 Influence of seedling depth on the emergence of small white flower morningglory seedlings.
Seeding depth (cm)

Emergence (%)

0
1
2
4
6
8
12

Coefficient of velocity

Dry weight (mg/plant)

9.04 e
21.32 a
18.80 b
16.25 c
15.02 d
9.25 e
0.00 f

0.277 d
0.465 a
0.402 b
0.390 b
0.352 c
0.275 d
0.000 e

5f
87 a
85 b
74 c
71 d
7e
0g

CV (%)

2.46

4.83

sunlight to 75, 50, or 25%. Four pots (replications)


were placed in each house. The pots were watered
every day or as needed. The emergence data were
recorded at 14 days after planting. The plants were
allowed to grow for 84 days, and plant height, dry
weight and the day of first bloom were recorded,
calculated, and tabulated (Table 7).
All experiments used a completely
randomized design. The experiments were
conducted from April 1998 until April 2000 at the
Seed Laboratory, Department of Agronomy,
Faculty of Agriculture, Kasetsart University,
Chatuchak, Bangkok and the Central Laboratory,
Faculty of Agriculture Rachmongkala Institute of

7.62

Technology, Bangpra, Sriracha, Chonburi,


Thailand.
RESULTS AND DISCUSSION
Acid scarification
Julakasewee et al. (1999) showed that
seeds of small white flower morningglory reached
physiological maturity at 21 to 22 days after
blooming. The seeds used in the experiments were
collected at 28 days after blooming and only 7%
germinated when they were soaked in distilled
water (Table 1). Soaking the hardseeds in 97.7%
H2SO4 for 40 minutes or longer allowed maximum

Table 7 Effect of light intensity on emergence and plant development of small white flower morningglory.
Light intensity
(%)

25
50
75
100
CV (%)
1/

Emergence
(%)

Plant height
(cm)

First flower
blooming
(day after planting)

Plant dry weight


at 12 weeks
(g/plant)

4 weeks

8 weeks

81 a 1/
83 a
80 a
84 a

17.3 a
16.8 a
12.5 b
11.7 b

43.8 a
39.8 a
29.6 b
27.4 b

77.6 a
71.1 ab
63.5 bc
57.3 c

12.8 a
13.7 a
18.6 a
20.4 a

8.15

18.79

16.17

11.99

37.92

Means within the same column followed by the same letters are not significantly different at P<0.05

Kasetsart J. (Nat. Sci.) 38 (4)

germination. The coefficient of velocity of the


seeds also increased when seeds were soaked for
50 minutes or longer (Table 1). The highest percent
germination occurred with a 40 to 120 minutes
soaking, and soaking for 80 minutes resulted in the
greatest coefficient of velocity (Table 1). Needlepricking the seeds before germination also
increased percent germination but also the percent
of non-viable seeds. These results indicated that
after reaching the physiological maturity period,
the seeds of small white flower morningglory can
not germinate because of impermeability of the
seed coat to water, similar to other reports. Seeds
of most weeds in the genus Ipomoea become
dormant because of impermeability of the seed
coat to water and dormancy occurs immediately at
physiological maturity or a few days after this
period (Elmore et al., 1990). This dormancy is
called coat-imposed dormancy in which the seed
coat is a mechanical barrier and is different from
embryo dormancy (Bradbeer, 1998).
pH
After breaking the dormancy of seeds by
acid scarification, the pH of the germinating
solution ranging from pH 2.2 to 8.5 did not affect
the germination of small white flower morningglory
hardseeds (Table 2). The greatest coefficient of
velocity occurred at pH 7.0 while a pH below 7.0
reduced the germination rate (Table 2). Bigroot
morningglory also germinated very well in soil at
a pH of 5.5 to 7.5 which is the normal pH of soil in
agricultural land (Horak and Wax, 1991).
Osmotic potential
Small white flower morningglory seed
germinated best in distilled water which had an
osmotic potential of 0.08 MPa (Table 3). As the
osmotic potential increased the percentage
germination and coefficient of velocity decreased.
Seeds did not germinate when the osmotic potential
was 0.79 MPa. These results were similar to that
reported for bigroot morningglory seeds that did

431

not germinate at an osmotic potential value of 0.8


MPa (Horak and Wax, 1991). Bigroot
morningglory is found only in the eastern and
southern parts of the United State, not in the west
which is drier (Horak and Wax, 1991). Different
species of Ipomoea have a different tolerance to
osmotic stress. Pitted morningglory is more tolerant
to osmotic stress than small flower morningglory
(Hoveland and Buchanan, 1973). This study
confirms observations in the field that the
emergence of small white flower morningglory in
eastern Thailand occurs only in the rainy season.
Therefore, it is essential that farmers should be
aware of the emergence of small white flower
morningglory during this season and institute
control measures while the seedlings are small.
Cold stratification
Storage of small white flower morningglory
hardseeds at 4C for 0 to 12 weeks did not affect
the percent germination and coefficient of velocity
of dormant hardseeds or acid-scarified seeds (data
not presented). These results indicated that
exposure to low temperatures alone cannot break
hardseededness of small white flower
morningglory. This agreed with the evidence that
this weed was a tropical plant.
Temperature
Germination was 93% to 97% across a
constant temperature range of 15 to 35C, while a
temperature above or below this range caused a
reduction in germination (Table 4). The coefficient
of velocity values were similar at a temperature
range of 25-40C, but decreased as temperature
decreased (Table 4). Similarly, the appropriate
temperature for I. coccinia to germinate was
reported to be 10 to 40C (Hardcastle, 1978),
bigroot morningglory could germinate at 15-30C
(Horak and Wax, 1991), and tall morningglory (I.
purpurea) and ivyleaf morningglory could
germinate at 15-30C and 20-35C, respectively
(Cole and Coats, 1973 ; Gomes et al., 1978).

432

Kasetsart J. (Nat. Sci.) 38 (4)

Fluctuating temperatures of 20/10C, 30/


20C, and 40/30C resulted in 90 to 96%
germination but the coefficient of velocity was
reduced at 20/10C (Table 5). Temperatures of 30/
20C and 40/30C are similar to the average
temperature of pineapple fields. Therefore the
fluctuating temperature does not appear to be a
limiting factor for small white flower
morninggglory germination in the field.
Seeding depth
Only five percent of small white flower
morningglory hardseeds could germinate at the
soil surface. The coefficient of velocity and seedling
dry weight were also low when the seeds were
placed on the soil surface (Table 6). The highest
percent emergence was 87% observed in the seeds
planted 1 cm deep. The greatest coefficient of
velocity and seedling dry weight were also observed
when seeds were planted 1 cm deep in the soil
(Table 6). Emergence percentage decreased as
planting depth increased beyond 1 cm. Emergence
was only 7% when seeds were planted 8 cm deep
and none emerged from 12 cm. (Table 6).
Normally, land is ploughed at a 15 cm
depth, which is likely to bring many seeds into the
optimum zone for germination and emergence.
Therefore, the results from the study indicated that
even no-tillage of the land before crop planting
could not prevent small white flower morningglory
establishment.
These results were similar to that reported
for bigroot morningglory seeds which became
established when their seeds were placed at a 2 cm
depth. They could germinate at a 16 cm depth but
the percent emergence decreased (Horak and Wax,
1991). Purple moonflower morningglory had the
highest percent emergence at a 2.5 to 7.5 cm depth
(Chandler et al., 1977) and tall morningglory and
ivyleaf morningglory could emerge from a 7.5 cm
depth in sandy loam soil and at a 5.0 cm depth in
silt loam soil, respectively (Wilson and Cole,
1966). Therefore, the establishment of seedlings

from different soil depths depends on emergence


force of the seeds and soil type.
Light intensity
Light intensity did not affect the emergence
of small white flower morningglory when seeds
were planted at 1 to 2 cm depth (Table 7). However,
under lower light intensity (25 and 50% of sunlight)
conditions, the height of small white flower
morningglory plants were greater than those grown
under high light intensity (75 and 100% of sunlight)
(Table 7). Plant dry weight at 12 weeks after
planting was not affected by light intensity (Table
7). Planting to first blooming took 57 days under
full sunlight and increased to 78 days with 25% of
full sunlight (Table 7). These results indicated that
small white flower morningglory plants could
grow under the lower light conditions of a pineapple
canopy.
CONCLUSION
Normally, small white flower morningglory
is a climber and often observed in pineapple fields
after it has climbed up and covered the crop, about
6 months after planting. It is very difficult to
control this weed when it grows up onto the
pineapple plants since it is a dense crop with spiny
leaves. The results from the study emphasize the
importance for farmers of watching for weed
seedlings growing under the pineapple canopy
and controling them before they climb up and
cover the crop.
ACKNOWLEDGEMENTS
This research was financially supported by
the Kasetsart University Research and
Development Institute. The authors gratefully
acknowledge Professor Yasutomo Takeuchi and
Professor Koichi Yoneyama, Center for Research
on Wild Plants, Utsunomiya University and Dr.
Michael Braverman, IR-4 Project, Rutgers

Kasetsart J. (Nat. Sci.) 38 (4)

University for their comments and suggestions for


preparing this manuscript. We also thank Mr.
Sarawut Rungmekarat and Ms. Narisara
Tummanee for their assistance with this project.
LITERATURE CITED
Bradbeer, J.W. 1988. Seed Dormancy and
Germination. Blackie, Glasgow and London,
146 p.
Chandler, J.M.,R.L. Munson and C.E. Vaughan.
1977. Purple moonflower: emergence, growth,
and reproduction. Weed Sci. 25: 163-167.
Cole, A.W. and G.E. Coats. 1973. Tall
morningglory germination response to
herbicides and temperature. Weed Sci. 21:
443-446.
Elmore, C.D., H.R. Hurst and D.F. Austin. 1990.
Biology and control of morningglories
(Ipomoea spp.). Rev. Weed Sci. 5: 83-114.
Gomes, L.F., J.M. Chandler and C.E. Vaughan.
1978. Aspects of germination, emergence and
seed production of three Ipomoea taxa. Weed
Sci. 26: 245-248.
Hardcastle, W.S. 1978. Influence of temperature
and acid scarification duration on Ipomoea

433

obscura Hassk. seed germination. Weed Res.


18: 89-91.
Horak, H.J. and L.M. Wax. 1991. Germination
and seedling development of bigroot
morningglory (Ipomoea pandurata). Weed
Sci. 39: 390-396.
Hoveland, C.S. and G.A. Buchanan. 1973. Weed
seed germination under simulated drought.
Weed Sci. 21: 322-324.
Julakasewee,A., R. Suwanketnikom and S.
Chandakul. 1999. Development, germination,
and dormancy of small-white flower
morningglory [Ipomoea obscura (L.)KerGawl] seeds, pp 583 587. In Proceedings
I(B) the 17 th Asian Pacific Weed Science
Society Conference.
Loasinwattana, C. 1994. Study on No-tillage in
Pineapple and Its Effect on Weed Status
and Strategy of Management. M.Sc. Thesis,
Kasetsart University. Bangkok.
Michel, B.E. 1983. Evaluation of water potentials
of solutions of polyethylene glycol 8000 both
in the absence and presence of other solutes.
Plant Physiol. 72: 66-70.
Wilson, H.P. and R.H. Cole. 1966. Morningglory
competition in soybeans. Weeds 14: 49-51.

Kasetsart J. (Nat. Sci.) 38 : 434 - 439 (2004)

Screening of Tomato (Lycopersicon esculentum Mill.) Varieties for


Resistance to Branched Broomrape (Orobanche ramosa L.)
Etagegnehu G. Mariam1 and Rungsit Suwanketnikom2

ABSTRACT
Thirty tomato varieties were evaluated for branched broomrape resistance in pot experiments
under natural conditions in Central Rift Valley of Ethiopia. The susceptible variety of tomato Roma VFN
was used as a control. Percent yield loss of tomato due to branched broomrape was used as a main
parameter and number and dry weight of branched broomrape shoot per tomato plant, were used as
support parameters. Results revealed that the highest levels of resistance were found in varieties, LE 244,
LE 180 A, South Africa, CLN 2123 A, Florida MHI UCG, Riogrande, Melekashola and Seedathip, with
yield losses of 32% to 43% and numbers of parasite per plant were 7.0 to 13.0. Caribe and Floradade
varieties were found to be highly susceptible to branched broomrape with yield losses 74% and 75%
respectively. Thirty one and thirty three branched broomrape shoots developed on their roots. The percent
yield loss (37%) of South Africa variety seemed minimal compared to the varieties parasitized by lower
and equal number of branched broomrape. This indicated that South Africa variety was less affected by
the parasite.
Key words: branched broomrape, tomato varieties, resistance, tolerance, parasitic weeds

INTRODUCTION
Parasitic plants of the genus Orobanche
(broomrapes) connect to dicotyledonous host plants
using a special intrusive multicellular organ, the
haustorium, and deprive water and nutrients from
them. Broomrapes are holoparasitic, devoid of
leaves and totally dependent on their hosts. Survival
of the parasite depends on its ability to establish
contact with a host and to develop an haustorium.
Each broomrape plant produces thousands of tiny
seeds that remain viable in the soil for many years,
allowing a rapid increase of the parasite seed bank
in agricultural soil. Normal development of the
parasite starts with seed germination that comes in

1
2

response to the reception of a chemical stimulus


from host roots (Zhou et al., 2004).
The branched broomrape (Orobanche
ramosa L.) is a wide-spread destructive root parasite
of many crop plants. Tomato (Lycopersicon
esculentum Mill.) is important vegetable crop
highly susceptible to and damaged by O. ramosa.
Severe infestation of tomato field by this parasite
seriously reduces yield and can lead to total crop
failure (Kasrawi and Abu-Irmaileh, 1989).
Several strategies to control branched
broomrape have been developed from cultural
practices to chemical control but none has
succeeded, being either not feasible, uneconomic,
hard to achieve or resulting in incomplete

Melkasa Agricultural Research Center, Nazareth, 436, Ethiopia.


Department of Agronomy, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand.

Received date : 16/05/04

Accepted date : 19/10/04

Kasetsart J. (Nat. Sci.) 38 (4)

protection. The search for resistant tomato cultivars


to this parasite becomes of great economic
importance. The use of resistant cultivars are the
most economical, feasible and environmentalfriendly method of control. Host genetic resistance
is also generally considered critical to successful
integrated pest management programs (Goldwasser
et al., 2001; Joel, 2000; Morozov et al., 2000;
Rubiales et al., 2003; Westwood and Foy, 1999).
Useful levels of resistance have been found
in several hosts against parasitic plants, like in
sorghum against Striga hermonthica and cowpea
against S. gesnerioides (Rubiales et al., 2003),
sunflower against O. cumana (Kasrawi and AbuIrmaileh, 1989), fababean (Alders and Pieterese,
1986), chickpea (Cubero, 1991) and vetch (Gil et
al., 1984) against O. crenata, egg plant against O.
cernua (Dalela and Mathur, 1971). Most attempts
to select Orobanche-resistant tomato varieties have
yielded only a range of varying susceptibility.
Dalela and Mathur (1971) found only one line
moderately resistant to O. cernua out of 41
studied. Abu-Gharbieh et al. (1978) found only
slightly resistance to O. ramosa in 8 out of 100
lines studied. Saghir et al. (1980) found slightly
tolerant to O. ramosa in 8 out of 108 cultivars.
Abedeev and Scherbinin (1982) developed PZU11, a tomato line uniformly resistant to O.
aegyptiaca. However, the resistance of PZU- 11
was lost when retested in other location (Foy et al.,
1987). Hence, this experiment was initiated to find
out tomato varieties resistance to branched
broomrape in Ethiopia.
MATERIALS AND METHODS
A pot experiment was carried out under
natural conditions (open field) at Melkasa
Agricultural Research Center, Ethiopia.
Randomized complete block design with three
replications were used as an experimental design.
Thirty varieties of tomato with and without parasites
were used as treatments. Roma VFN was used as

435

susceptible control. Twenty varieties were provided


by Melkasa Agricultural Research Center,
Horticulture Division, Ethiopia and other ten
varieties were provided by Asian Vegetable
Research and Development Center (AVRDC),
Thailand.
Seeds of branched broomrape were
collected from plants parasitizing tomato in Nura
Era state farm. Soil and sand were sterilized in
oven at 105C for 24 hours before planting. Plastic
pots (22 cm diameter) of 18 cm height with holes
in the bottoms were filled with soil mixed (3 soil:
1 sand) 4 kg per pot. The soil was sandy loam with
pH of 7.8 and electrical conductivity 0.449. A 100
mg of branched broomrape seeds were mixed with
200 g sand and thoroughly mixed with 600 g soil
by passing through a plastic funnel five times in
each case and added to the upper 2 cm of the pots.
Ten seeds of tomato were sown directly to each
pot. The pots were irrigated with 200 ml of tap
water every day and seedling production and
preconditioning of branched broomrape were done
together. After one month the tomato seedlings
were thinned to one plant per pot. The newly
emerged branched broomrape shoots were counted
every week and the older pulled out. Once emerged
they dried within two weeks and were difficult to
take their fresh weights. The plants grown in the
open with the average air temperature and rainfall
over the growing period were 22.36C and 118.32
mm respectively.
Ripen tomato fruits were harvested starting
from the fourth month after sowing date every
week for four times. At the end of the experiment
the soil was washed carefully from the roots, and
the number of un-emerged branched broomrape
shoots were taken, mixed with emerged branched
broomrape shoots and dried in the oven at 70C for
48 hours (Kasrawi and Abu- Irmaileh, 1989; Saghir
et al., 1980). The data collected were numbers and
dry weights of branched broomrape shoot and fruit
yield of tomato. Numbers and dry weights of
branched broomrape shoot and percent yield losses

436

Kasetsart J. (Nat. Sci.) 38 (4)

subject to analysis of variance and the means were


separated by Duncans multiple range test at 1%
level of significance. The percent yield loss values
of a-d, e-i, j-l, m-o and p were used as criteria to
classify varieties as highly resistant, moderately
resistant, slightly resistant, susceptible and highly
susceptible respectively.
RESULTS AND DISCUSSION
Thirty tomato varieties were evaluated for
branched broomrape resistance in pot experiments
under natural conditions. Tomato variety Roma
VFN was used as a susceptible control. Percent
yield loss of tomato due to branched broomrape
was used as main parameter and number and dry
weight of branched broomrape shoot per tomato
plant were used as support parameters. Highly
significant differences were obtained between the
control and other varieties (Table 1). Findings
indicated that out of the 30 varieties, 8 were highly
resistant to branched broomrape parasitism. These
included LE 244, LE 180 A, South Africa, CLN
2123 A, Florida MHI UCG, Riogrande,
Melkashola, and Seedathip. Low percents of yield
loss, 32% to 43%, low numbers of branched
broomrape shoot per tomato plant, 7.0 to 13.0 and
low dry weights of branched broomrape shoot per
tomato plant, 1.6 to 2.9 g were obtained from these
varieties. Eleven varieties, Cherry, Floralou, CLN
1621 L, CL-5916-206-04-2-2-0, CL-5915-206D4-2-5-0, H 24, H 1350, Cerise, Cardinal, Calipso
and Marglobe improved were found to be
moderately resistant. Medium percents of yield
loss 45% to 55%, medium numbers of branched
broomrape shoot per tomato plant 11.0 to 17.0 and
medium dry weight of branched broomrape shoots
per tomato plant 2.7 to 3.5 g were obtained from
these varieties. Four varieties, VFN-138, CLN
1621 J, CLN 2026 D and Melkasalsa were found
to be slightly resistant. High percents of yield loss,
57% to 61%, high numbers of branched broomrape
shoot, 18.0 to 19.0 and medium dry weights of

branched broomrape shoot, 4.1 to 4.6 g per tomato


plant were obtained from these varieties. Other
four varieties, CLN 2116 B, CLN 1314 G, CLN
1621 P and Missuri were found to be susceptible.
High percents of yield loss, 63% to 68%, high
numbers of branched broomrape shoot, 20.0 to
23.0 and high dry weights of branched broomrape
shoot per tomato plant were obtained. The
remaining two varieties Caribe and Floradade
were found to be highly susceptible. Higher
percents of yield loss, higher numbers and dry
weights of branched broomrape shoot per tomato
plant than the control were obtained.
There were similar trends between number
and dry weight of branched broomrape shoot. As
the number of branched broomrape shoots
increased, dry weight of branched broomrape
shoots also increased.
In variety such as South Africa, the number
of parasite medium except the percent yield loss
was lower compared to the varieties parasitized by
lower and equal number of branched broomrape.
This might indicate that variety South Africa was
less affected by this parasite.
According to Parker and Riches (1993), the
term tolerance was used for the reaction of varieties
parasitized to the same extent but suffered less
damage than standard varieties. The converse of
tolerance is sensitivity. The term resistance applies
to varieties showing less attack, usually in terms of
numbers of parasite attached or emerged.
Resistance is rarely complete and, where necessary,
the term partial resistance implies significantly
less attack compared with standard varieties
(tolerance is sometimes used wrongly for this
reaction), while total resistance is usually referred
to as immunity. The converse of resistance is
susceptibility.
The results of this experiment indicated
there were variations among varieties for branched
broomrape resistance. These could be due to
different reasons. As reviewed by Kasrawi and
Abu-Irmaileh (1989), the host might resist the

437

Kasetsart J. (Nat. Sci.) 38 (4)

development of the parasite at three stages of its


life cycle: seed germination, haustoria formation,
and development of flowering shoots. In resistant
variety, the resistance is due to low stimulant
exudation (Parker and Riches, 1993). The findings

by Goldwasser et al. (1999) suggested that


secondary metabolieties might involve in the
defense mechanism(s) of the resistant vetch host,
forming mechanical and chemical barriers against
the invading parasite. Mechanisms by which

Table 1 Responses of different tomato variety to branched broomrape.


Tomato varieties

Roma VFN
Calipso
Cardinal
Caribe
Cerise
Cherry
CL-5915-206-D4-2-5-0
CL-5916-206-04-2-2-0
CLN 1314 G
CLN 1621 J
CLN 1621 L
CLN 1621 P
CLN 2026 D
CLN 2116 B
CLN 2123 A
Floradade
Floralou
Florida MHI UCG
H 24
H 1350
LE 180 A
LE 244
Marglobe improved
Melkasalsa
Melkashola
Missuri
Riogrande
Seedathip
South Africa
VFN-138
1/

2/

No. of parasite/ Shoot dry wt. of


tomato pt.
parasite
(g/tomato pt.)

26.0 r 1/
15.7 j
14.7 i
30.7 s
14.0 i
10.7de
13.7 h
11.7 f
21.7 o
18.7 m
12.7 g
22.0 p
18.7 m
19.7 n
8.7 b
32.7 t
10.7 de
9.0 c
10.0 d
10.7 de
11.0 ef
7.0 a
16.7 k
18.7 m
11.7 f
23.7 q
9.7 c
10.7 de
13.0 h
17.7 l

6.5 q
3.6 j
3.6 j
6.9 r
3.2 i
2.4 cd
3.0 gh
2.7 ef
5.0 n
4.1 kl
2.9 fh
5.3 o
4.6 m
4.8 n
2.3 bc
7.2 s
2.6 de
2.1 b
2.2 b
3.1 hi
2.7 ef
1.6 a
3.5 j
4.3 l
2.8 eg
5.9 p
2.3 bc
2.4 cd
2.9 fh
4.3 l

Tomato fruit
yield with
parasite
(g/pt.)

Tomato fruit
yield without
parasite
(g/pt.)

113 b
203 gh
231 hi
111 b
224 i
176 de
184 ef
181 ef
114 b
144 c
218 i
141 c
123 b
114 b
186 ef
94 a
184 ef
164 d
162 d
162 d
173 de
268 l
188 ef
174 de
255 k
125 b
191 fg
240 j
274 l
170 c

417 n
435 qr
495 u
433 q
448 t
321 f
344 k
334 I
320 f
336 i
404 l
416 n
313 d
309 c
300 a
410 m
341 j
315 e
312 d
323 g
305 b
426 p
418 n
434 q
440 s
324 g
330 h
423 o
436 r
334 i

Tomato fruit
yield loss
(%)

73 p 2/
53 h
53 h
74 p
50 g
45 ef
47 f
46 f
64 mn
57 jk
46 f
66 no
61 l
63 m
38 b
75 p
46 f
40 c
50 g
50 g
43 de
32 a
55 ij
60 l
42 cd
68 o
42 cd
43 de
37 b
58 k

Means followed by the same letters within the same columns are not significantly different according to Duncans multiple
range test at 5% level
Percentage yield loss was calculated from yield without parasite deducted by yield with parasite, divided by yield without
parasite and multiplied by 100

438

Kasetsart J. (Nat. Sci.) 38 (4)

varieties show greater tolerance than others have


been little studied but are likely to receive greater
attention in the future.
CONCLUSION
The use of resistant crop varieties is viewed
as the most reliable and economically feasible
means of Orobanche control. Selection should be
performed on varieties which showed promising
resistance such as, LE 244, CLN 2123 A, Florida,
MHI UCG, Riogrande, H 24, Cherry, Floralou, H
1350, Seedathip, LE 180 A, CL-5916-206-04-22-0, Melkashola, CLN 1621 L, South Africa, CL5915-206-D4-2-5-0, Cerise, Cardinal, Calipso and
Marglobe and should be improved in naturally
infested fields at different locations. Therefore, it
seems to obtain promising resistant varieties as
potentially good sources for developing new
resistant varieties or obtaining varieties directly
put on production.
ACKNOWLEDGEMENTS
The financial support from the Ethiopian
Agricultural Research and Training Project (ARTP)
of the Ethiopian Agricultural Research
Organization (EARO) is gratefully acknowledged.
The authors are grateful to the management and
staffs of Melkasa Agricultural Research Center
(MARC), Ethiopia for logistical and technical
support. The authors also would like to
acknowledge Dr. Sutevee Sukprakarn and Dr.
Lemma Desalegne for providing seeds of tomato
varieties and for their technical advices. Special
thanks are due to Dr. Aberra Deressa, Dr. Fasil
Reda, Dr. Habtu Assefa and Dr. Girefe Sahle for
their technical advices and encouragements.
LITERATURE CITED
Abdeev, Y. and B.M. Scherbinin. 1982. Linkage
Relation of Ora Gene for Resistance to

Orobanche aegyptiaca. Tomato Genet. Coop.,


Dep. Vegetable Crops, Univ. Of California,
Davis. Rpt. 32 p.
Abu-Gharbieh,W.I., K.M. Makkouk and A.R.
Saghir. 1978. Response of different tomato
cultivars to the root-knot nematode, tomato
yellow leaf curl virus, and Orobanche in
Jordan. Plant Dis. Reptr. 62 (3): 263- 266.
Alders, A.J. and R. Pieterese. 1986. Plant vigor as
a misleading factor in the search for resistance
in broad bean to Orobanche crenata, pp 140149. In S.J. Borg (ed.). Proceedings of a
Workshop on Biology and Control of
Orobanche. LH/ VPO, Wageningen, The
Netherlands.
Cubero, J.I. 1991. Breeding for resistance to
Orobanche species: A review, pp 257-277. In
K. Wegmann and L. J. Musselman (eds.)
Proceedings of International Workshop on
Orobanche Research. Eberhard-KarlsUniversitat, Tubingen
Dalela, G.G. and R.L. Marthur. 1971. Resistance
of varieties of eggplant, tomato and tobacco
to broomrape (Orobanche cernua Loefl.).
Pest Articles and News Summaries 17:
482-483.
Foy, C.L., R. Jacobsohn and R. Jain. 1987.
Evaluation of tomato lines for resistance to
glyphosate and/or Orobanche aegyptiaca Pers,
pp 221-230. In H. C. Weber and W. Forstreuter
(eds.). Proceedings 4th ISPFP on Parasitic
Flowering Plants. Marburg, F.R.G.
Garcia-Torres, L. and F. Lopez-Granados. 1991.
Control of broomrape (Orobanche crenata
Forsk.) in broad bean (Vicia faba L.) with
imidazolinones and other herbicides. Weed
Res. 31: 227- 235.
Gil, J., L.M. Martin and J.I. Cubero. 1984.
Resistance to Orobanche crenata Forsk. in
Vicia sativa L: II.Characterization and
Genetics, pp 221-229 In C. Parker, L.J.
Musselman and A.K. Wilson (eds.).
Proceedings of Third International

Kasetsart J. (Nat. Sci.) 38 (4)

Symposium on Parasitic Weeds.


Goldwasser, Y., J. Hershenhorn, D. Plakhine, Y.
Kleifeld and B. Rubin. 1999. Biochemical
factors involved in vetch resistance to
Orobanche aegyptiaca. Physiological and
Molecular Plant Pathology 54: 87-96.
Goldwasser, Y., H. Eizenberg, J. Hershenhorn, D.
Plakhine, T. Blumenfeld, H. Buxbaum, S.
Golan and Y. Kleifeld. 2001. Control of
Orobanche aegyptiaca and O. ramosa in
potato. Crop Prot. 20: 403-410.
Joel, D.M. 2000. The long-term approach to
parasitic weeds control: Manipulation of
specific developmental mechanisms of the
parasite. Crop Prot. 19: 753- 758.
Kasrawi, M.A. and B.E. Abu-Irmaileh. 1989.
Resistance to branched broomrape
(Orobanche ramosa) in tomato germplasm.
Hort. Sci. 24(5): 822- 824.
Morozov, I.V., C.L. Foy and J.H. Westwood.
2000. Small broomrape (Orobanche minor)
and Egyptian broomrape (Orobanche
aegyptiaca) parasitization of red clover

439

(Trifolium pratense). Weed Techno. 14: 312320.


Parker, C. and C.R. Riches. 1993. Parasitic Weeds
of the World. CAB International,
Wallingford, UK. 322 p.
Rubiales, D., A. Perez-de-Luque, J.I. Cubero and
J.C. Sillero. 2003. Crenate broomrape
(Orobanche crenata) infection in field pea
cultivars. Crop Prot. 22: 865-872.
Saghir, A.R., M. Kurban and B. Bundayr. 1980.
Studies on the control of Orobanche in
Lebanon. Tropical Pest Management. 26
(1): 51- 55.
Westwood, J.H. and C.L. Foy. 1999. Influence of
nitrogen on germination and early
development of broomrape (Orobanche spp.).
Weed Sci. 47: 2- 7.
Zhou, W.J., K. Yoneyama, Y. Takeuchi, S. Iso, S.
Rungmekarat, S.H. Chae, D. Sato and D.M.
Joel. 2004. In vitro infection of host roots by
differentiated calli of the parasitic plant
Orobanche. Journal of Experimental
Botany 55(398): 899-907.

Kasetsart J. (Nat. Sci.) 38 : 440 - 447 (2004)

Study of Maize Populations Contained Different


Proportions of U.S. Corn Belt Germplasm
Krisda Samphantharak and Putu Darsana

ABSTRACT
The incorporation of exotic germplasm into tropical breeding materials can broaden and diversify
the genetic base of the tropical maize, and also adding more desirable alleles. For effective utilization of
the exotic germplasm, choice of exotic source and efficient method of incorporation of exotic germplasm
into tropical material is needed. This study was conducted to asses a genetic potential and the
effectiveness of different types of exotic germplasm introduced from U.S. Corn Belt in combination with
tropical breeding materials. The results of the study implied: commercial hybrid was the most promising
source to improve performance of the tropical inbred lines followed by Non-BSSS inbred lines and BSSS
Iowa Stiff Stalk Synthetic inbred lines. Semi-exotic population with 50% exotic showed significantly
lower grain yield, earlier days to silking and anthesis, lower grain moisture content and higher leaf disease
infection than 25 and 12.5 % exotic. On the other hand, no significant difference was observed between
25 and 12.5 % exotic. Semi-exotic pipulations with 25 and 12.5 % commercial exotic hybrid also showed
grain yield higher than the corresponding tropical population but were not statistically different to the best
check variety Suwan 1.
Key words: maize, exotic, germplasm, genetic diversity, population

INTRODUCTION
Commercial variety of major crops
normally derived from intensive selection within
only a small part of the total genetic resources
available (Rasmusson and Phillips, 1997; Troyer,
1999). Normally, the most improved inbreds have
been intermated and subsequently extract for new
improved inbred lines. By this breeding strategy,
for short term, gain of selection appears to by high,
and encourage continued breeding within narrow
gene pool. For long term, on the other hand, this
breeding strategy has led to a genetic gap where
there is a large difference in the favorable gene
frequency between the improved and unimproved

lines and narrowing of genetic diversity within


elite gene pools which presumably reducing the
potential of future progress of breeding program
(Rasmusson and Phillips, 1997), and the associated
problems of genetic vulnerability (Bridges and
Gardner, 1987; Gouesnard et al., 1996; Kraja et
al., 2000),
To increase the effectiveness of long term
breeding program, maintaining and increasing an
effective genetic diversity and adding more
favorable alleles from other sources of germplasm
are required. Exotic germplasm has been suggested
as a source to increase genetic diversity and
favorable alleles. In tropical area, potential
resources of exotic germplasm can be temperate,

Department of Agronomy, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand.

Received date : 08/04/04

Accepted date : 27/09/04

Kasetsart J. (Nat. Sci.) 38 (4)

subtropical, or foreign tropical germplasm. There


is a wide array of exotic germplasm available for
breeding program. This exotic germplasm ranges
from open-pollinated varieties, synthetics, inbred
lines and hybrids.
Despite the usefulness of exotic germplasm
to broaden the genetic diversity of adapted
germplasm, many practical disadvantages also
exist. In the tropical region, the difficulty in using
exotic germplasm introduced from temperate and
sub-tropical regions frequently caused by non
adaptability of exotic germplasm per se and of it
crosses with adapted sources was characterized
by susceptibility to disease, insect, and heat, early
flowering and senescence (Kim, 1990; Khehra et
al., 1986). The non adaptability of the material
creates a problem in identifying superior genotypes.
Successful exploitation of exotic
germplasm for improving the local germplasm
required a systematic approach. Effective choosing
source of germplasm, both adapted and exotic, and
methods applied are very important (Hainzelin,
1998). The use of exotic germplasm in selection
also requires an adaptation phase (Gouesnard et
al., 1996). The most common procedure has been
to cross exotic with adapted germplasm (Holley
and Goodman, 1988). Several generations of
random mating, with or without mild selection,
were recommended before the application of more
stringent selection (Lonnquist, 1974; Hallauer,
1978; Hoffbeck et al., 1995). Optimum proportion
of exotic and adapted germplasm in the foundation
population is another question needed to be
considered (Dudley, 1982; Bridges and Gardner,
1987; Crossa and Gardner, 1987; Darsana and
Samphantharak, 2004).
The objectives of the study were: 1) to
evaluate the potential use of different types of
exotic germplasm introduced from temperate
region (U.S. Corn Belt) as sources of favorable
alleles for improving the existing adapted maize
inbred lines, 2) to determine the optimum
proportion of exotic germplasm of certain region

441

for improving the local adapted population.


MATERIALS AND METHODS
Six tropical maize inbred lines namely
Nei9008, Nei9202, AMATLCOHS 63-2-5-E-31-2, AMATLCOHS 170-2-3-2-1-1-1-B-3, Ag18,
and Ki42 were chosen and intercrossed to four
types of maize germplasm introduced from U.S.
Corn Belt (36 45 North). The four types of
U.S. Corn Belt maize sources were defined as:
1. Commercial hybrids (H) consisted of 8
hybrids, namely D17117A, DK602, DK611,
ISU#1, ISU#2, ISU#3, MITOS, SANTOS.
2. Open pollinated varieties (O) consisted
of 5 varieties, namely BSSS(R)C6, Reid Yellow
Dent, Krug, Lancaster, and Midland.
3. BSSS inbred lines (B), inbred lines
generated from Stiff Stalk Synthetic developed by
Iowa Experiment Station, consisted of 5 inbred
lines, namely B73, B76, B79, B84 and B104.
4. Non-BSSS inbred lines (N), inbred lines
which their background un-related to Stiff Stalk
Synthetic, consisted of 4 inbred lines, namely B90,
B91, B98, and B106.
To generate BC0F1, crosses between the
tropical inbred lines and the exotic groups were
made in the following procedures: 1) Each of the
six tropical inbred lines was crossed by bulked
pollens of 5 to 7 plants from each exotic hybrid, 20
plants per tropical inbred lines. 2) Crosses between
the tropical inbred lines and the open pollinated
varieties (OPV) were made by collecting pollen
samples from 25 plants of each variety and they
were uniformly mixed before pollinated to each of
topical inbred lines, 20 plants per inbred line. The
same procedures were applied with the BSSS and
non-BSSS inbred lines.
In the following season, in order to generate
BC0S1 and BC1F1 seeds, the BC0F1 plants were
self pollinated and backcrossed to the
corresponding tropical inbred lines. The BC0S2
was derived from selfing of the BC0S1. The

442

Kasetsart J. (Nat. Sci.) 38 (4)

BC1F1 was self pollinated to generate BC1S1.


Simultaneously, the BC1F1 was backcrossed to
corresponding tropical inbred lines to generate
BC2F1.
For each exotic group, three semi-exotic
populations containing 50, 25 and 12.5 % were
generated. Details of procedure for the formation
of the 50 % semi- exotic populations of each exotic
group were as followed: (1) Twenty ears of each of
the BC0S1 of the six combinations of each exotic
group x 6 adapted inbred lines were selected to the
total of 120 ears. (2) Equal number (10 seeds) of
seeds were sampled from each of the 120 ears and
uniformly bulked as foundation material. Since
there were 4 exotic groups, the total of 4 semiexotic (50 %) populations were obtained. (3) The
bulked seeds were grown in 25 rows, conventional
plant spacing (0.75 0.25 m) of 5-m long and
approximately, total of 500 plants were obtained.
(4) At the flowering stage, the 500 plants were
recombined by half-sib mating procedure; half of
the plant numbers were arranged as pollen sources
and their bulked pollens were pollinated to the
other half and vice versa. (5) At harvest, 50
desirable ears were selected. The same procedures
were employed to generate 25 % and 12.5 % semiexotic populations using BC1S1 and BC2S1 seeds
as foundation materials, four types and three
proportions of exotic sources. One additional
population was generated by recombining the six
corresponding tropical inbred lines, representing
the tropical population (0 % exotic).
Four additional populations were included
in order to facilitate experimental arrangement.
Two of the four additional populations were Suwan
1 and Bisma. Suwan 1 is a widely adapted tropical
population developed by Kasetsart University and
Bisma is a tropical population widely adapted in
Indonesia developed by Food Crops Research
Center, Department of Agriculture Indonesia. The
other two populations were newly formed
populations. The 16 populations were evaluated
in 4 4 lattice design with three replications.

Yield trials were conducted in the year


2003 at three locations: National Corn and Sorghum
Research Center (Suwan Farm, Nakhon
Ratchasima, Thailand) locating at 1430 North,
101 30 East, 356 meter above sea level ; Bangkok
Seed Industry Research Farm (Salengparn,
Saraburi, Thailaand) locating at 1430 North,
101 30 East, 40 meter above sea level; and PT.
BISI Research Farm (Kediri, Indonesis) locating
at 7 55 South, 112 01 East, 110 meter above
sea level. Each plot consisted of six 5-m rows at
Salengparn and Kediri, and 4.5-m rows at Suwan
Farm. Plant spacing was 0.75 m between rows and
0.20 m within row. Plots were over-planted with
44 seeds per row and after two weeks, plants were
thinned to 1 plant per hill or population size of
66,667 plant/ha. Standard cultural practices were
followed at all locations. Data were recorded on,
days to 50 % anthesis and silking, ear and plant
height expressed in cm, leaf disease infection
Southern rust and leaf blight (1 = highly
resistance, 9 = highly susceptible), root lodged and
stalk lodged expressed in percent plant lodged per
plot, grain moisture content at harvest expressed in
percent, and grain yield at 15 % moisture expressed
in ton ha-1.
The analysis of variance was done in two
phases. First, population means over locations
were computed by running individual location
analyses, obtaining lattice adjusted and/or
unadjusted means, and then by averaging those
means over locations. For all traits, the following
single degree of freedom comparisons (group
comparisons) between means of population type
were performed:
1) A vs H, O, B, N
2) H vs O, B, N
3) O vs B, N
4) B vs N
Where, A = adapted population; H, O, B and N
were semi-exotic populations derived from U.S.
Corn Belt hybrids, OPVs, BSSS, and Non-BSSS
inbred lines, respectively.

Kasetsart J. (Nat. Sci.) 38 (4)

Each population type consisted of three


semi-exotic populations representing three
proportions of exotic gemplasm. In the second
phase, effect of treatment (proportion of exotic
germplasm) was analyzed. The later analyses
were done based on simple randomized complete
block design using unadjusted data and separated
for each group of exotic sources. The populations
and the location x treatment interaction sum of
squares were partitioned into linear and non-linear
orthogonal polynomials. All statistical
computations used the MSTAT-C computer
program (MSTAT-C, 1988).
RESULTS AND DISCUSSION
Diversity among the 16 populations clearly
displayed as the treatment mean squares for all
traits showed highly significant differences, except
plant and ear height (Table 1). Highly significant
location x treatment interaction implied the
instability of all traits over locations, except plant
and ear height. The variance of overall semiexotic populations showed significant difference
to the 0 % exotic population (A) for grain yield and
moisture content and highly significant difference
for days to anthesis and silking. Among type of
exotic sources, for grain yield, comparison between
variance of A vs H, O, B and N showed significant
difference, and between variance of H vs O, B and
N and between variance of O vs B and N showed
highly significant difference. On the other hand,
no significant difference was noted between
variance of B vs N. In addition, significant
difference was also found for leaf disease infection
between variance of O vs B and N.
Among types of exotic source (Table 2),
population contained exotic germplasm of type-H
(commercial hybrids) showed the highest mean
grain yield, followed by population containing
exotic germplasm of type-N (Non-BSSS inbred
lines), and type-B (BSSS inbred lines). The lowest
mean grain yield was found in semi-exotic

443

population containing exotic germplasm of typeO (open-pollinated variety). Type-H also showed
mean grain yield similar to the population with 0
% exotic germplasm (tape-A). These phenomena
indicated that the hybrids were the most promising
sources to improve performance of the tropical
inbred lines followed by Non-BSSS and BSSS
inbred lines. The type-H exotic source is
commercial hybrid which, theoretically,
accumulates more desirable alleles than other
sources, since this type of germplasm has already
experienced of inbreeding and intense selection
during inbred line development and hybrid
evaluation. The type-N and type-B were also
promising sources, respectively. This result was
in agreement with the result reported by Goodman
(1999) which suggested that using exotic
germplasm with history of inbreeding gave about
100-fold advantage over elite synthetic with no
history of inbreeding. Types of germplasm showed
no significant effects to the semi-exotic population
performance for days to anthesis and silking, grain
moisture content and leaf disease infection which
indicated that, with the same region of adaptation
of exotic sources, the different performances of
semi-exotic populations were mostly caused by
difference in accumulation of desirable alleles for
grain yield.
Comparison among semi-exotic
populations with different proportions of exotic
germplasm of each type of exotic source showed
that, in general, semi-exotic population with 50 %
exotic showed significantly lower grain yield,
earlier days to silking and anthesis, lower grain
moisture content and higher leaf disease infection
than those of 25 and 12.5 % exotic. On the other
hand, between 25 and 12.5 % exotic, no significant
difference was observed. However, semi-exotic
populations with 25 and 12.5 % exotic type-H
showed grain yield higher than the corresponding
proportions of exotic of other types. The lowest
grain yield of the 50 % exotic population than the
25 and 12.5 % revealed that with 50 % exotic, high

143

Total
CV (%)
8.31

0.214
0.378
2.080**
1.397*
2.542**
2.250**
0.085
0.484**
1.168**
0.209
0.231
0.390
0.213

2.61

27.174
5.417
16.363**
7.704**
0.001
0.222
7.407
4.603**
0.821
1.953
10.019**
6.130*
1.787

2.41

5.021
3.847
15.929**
2.001**
0.694
6.722
15.574
4.132**
0.257
3.361
4.500
6.241*
1.632

5.1

45.440**
3.941
34.591**
15.099*
0.713
1.912
0.392
2.364*
6.564
0.356
4.331
0.892
1.297

13.77

110.271**
1.368
5.833**
1.641
1.778
2.722**
0.167
1.908**
2.028
1.232
0.686
0.722
0.650

1/

Ear height

4.91

7.73

3136.302** 2463.611**
73.840
43.292
133.266
73.444
0.055
36.347
15.384
0.174
10.478
7.094
193.423
3.787
113.522
89.874
110.116
32.135
202.791
143.918
165.234
39.324
2.456
141.745
94.000
64.210

Mean squares
Grain yield Days to anthesis Days to silking Grain moisture Leaf disease Plant height

*, ** Significant at 0.05 and 0.01 probability levels, respectively.


A= local adapted (0%exotic) ; H, O, B and N are U.S. Corn Belt germplasm; hybrids, OPVs, BSSS and Non-BSSS inbred, respectively.

2
6
15
1
1
1
1
30
2
2
2
2
90

d.f.

Locations
Replication within locations
Treatments
A vs H, O, B, N
H, vs O, B, N
O, vs B, N
B vs N
Location x Treatment
Loc. X A vs H, O, B, N
Loc. X H vs O, B, N
Loc. X O vs B, N
Loc. X B vs N
Pooled error

Source of variation 1/

Table 1 Mean squares of yield and other desirable traits; a comparison between check and type of exotic sources, among type of exotic sources,
combined across three locations.

444
Kasetsart J. (Nat. Sci.) 38 (4)

445

Kasetsart J. (Nat. Sci.) 38 (4)

Table 2 Means of grain yield and other desirable traits, and responses due to proportion of exotic
gerplasm, averaged across three locations.
Type of exotic
germplasm1)

H
(F1 Hybrid)

Proportion of
exotic germ.

50%
25%
12.5%
0%
Average3)
Response: Linear
Quadratic
Qubic
O
50%
(Open pollinated var.)
25%
12.5%
0%
Average3)
Response: Linear
Quadratic
Qubic
B
50%
(BSSS Inbred line)
25%
12.5%
0%
Average3)
Linear
Quadratic
Qubic
N
50%
(Non-BSSS Inbred line)
25%
12.5%
0%
Average3)
Linear
Quadratic
Qubic
SUWAN 1
SUWAN 2
BISMA
LSD (0.05)
CV (%)

Grain yield

--kg/ha-5.17b
5.97a
6.14a
5.91a
5.76
**
**

Days to
anthesis

Days to silking

---------day--------50.3c
51.9c
50.9b
52.7b
52.2a
53.9a
52.1a
53.4a
51.1
52.8
**
**

Grain
moisture

Leaf
disease2)

----%---19.7c
22.0b
24.1a
23.4a
21.9
**

---1-9--6.7a
5.4b
5.5b
5.7b
5.9
**
*

**
50.3b
50.4b
52.4a
52.1ab
51.0
*

*
52.4c
53.4b
54.3a
53.4b
53.4
**
*

*
19.5c
22.0b
24.2a
23.4ab
21.9
**

50.4c
51.6b
52.7a
52.1ab
51.6
**
*
*
49.0c
50.9b
52.6a
52.1a
50.8
**

52.1c
53.3b
54.6a
53.4b
53.3
**
**
**
50.8c
51.7bc
54.3a
53.4ab
52.3
**

6.24
4.93
5.98

52.2
48.1
52.2

*
54.3
50.4
54.1

19.9c
22.4b
24.6a
23.4b
22.3
**
**
**
19.8d
22.2c
24.4a
23.4b
22.1
**
**
**
24.6
20.4
23.9

0.43
8.31

1.3
2.6

2.0
2.4

5.1
1.1

4.51c
5.55ab
5.45b
5.91a
5.17
**

5.02b
5.68a
5.75a
5.91a
5.49
**

5.22b
5.69a
5.78a
5.91a
5.56
**

7.3a
6.6a
5.7b
5.7b
6.4
**

6.9a
5.9b
5.2c
5.7bc
6.0
**
**
*
6.8a
5.9ab
5.7b
5.7b
6.1
*

5.0
5.3
4.3
0.8
13.8

*, ** ; signfinicant at 0.05 and 0.01 proability levels, respectively.


1) A = 0% exotic germplasm; H,O, B and N are exotic germplasm from US corn Belt; Hybrids, OPVs BSSS and Non BSSS
inbred lines, respectively.
2) Leaf disease: 1 = highy resistance ; 9 = highly susceptible.
3) Average based upon 50, 25, and 12.5 % exotic only, 0% excluded.

446

Kasetsart J. (Nat. Sci.) 38 (4)

amount of un-adapted alleles especially susceptible


to disease and heat were presented and suppressed
the effective function of desirable alleles as
indicated by high leaf disease infection and
premature death of the plant.
Significant nonlinear (quadratic) response
among semi-exotic population means due to
proportion of exotic germplasm was noted for
grain yield in the populations containing exotic
source of type-H, which indicated the curvilinear
nature of the response (Table 2 and Figure 1). The
curvilinear response also indicated that additional
backcrosses to adapted germplasm would not
achieve further significant increases in grain yield.
The same result was also reported by Crossa and
Gardner (1987). On the other hand, semi-exotic
populations containing some other types of exotic,
type-O, type-B and type-N, showed significant
linear response due to proportion of exotic sources
for grain yield, which indicated that additional
backcrosses to tropical sources were required to
lift the mean of this semi-exotic populations to the
same level or exceed the adapted population.
Albrech and Dudley (1987) also reported
significant linear response when introgressing an
exotic germplasm South Africa Photoperiod

Insensitive Composite II to U.S. Corn Belt maize


population, RSSSC. The responses of mean
population due to proportion of exotic germplasm
for other traits mostly tended to show linear
response (Table 2).
Commercial hybrids, inbred lines and openpollinated varieties of the U.S. Corn Belt sources
interact differently in response to the numbers of
backcross. With improved sources (exotic hybrid),
smaller numbers of backcross to the tropical
recurrent parent were required to improve the
performance of the tropical sources and open the
chance to incorporate higher proportion of desirable
alleles of exotic sources into the semi-exotic
population. On the other hand, if less advanced
exotic sources were used, more backcrosses to the
tropical recurrent parent were required in order to
eliminate the negative epistatic effect of un-adapted
alleles and therefore, to decrease chance to add
genetic diversity to the semi-exotic population.
CONCLUSSION
Exotic germplasm with history of
inbreeding and intensive selection for combining
ability was the most promising source to improve

Figure 1 Changes in means of grain yield of semi-exotic population from different sources (types) and
proportions of exotic germplasm, averaged across three locations.

Kasetsart J. (Nat. Sci.) 38 (4)

the performance of the semi-exotic population. At


least one backcross to the tropical recurrent parent
was required to effectively incorporate the desirable
and to eliminate the un-adapted alleles of exotic in
semi-exotic population
LITERATURE CITED
Albrecht, B. and J.W. Dudley. 1987. Evaluation
of four maize populations containing different
proportions of exotic germplasm. Crop Sci.
27: 480-486.
Bridges, W.C. Jr. and C.O. Gardner. 1987.
Foundation population for adapted by exotic
crosses. Crop Sci. 27: 501-506.
Crossa, J. and C.O. Gardner. 1987. Introgression
of an exotic germplasm for improving an
adapted maize population. Crop Sci. 27:
187-190.
Darsana, P. , K. Samphantharak. and A. Silapapun.
2004. Genetic potential of exotic germplasm
introduced from different latitudes for the
improvement of tropical maize (Zea mays L).
Kasetsart J. (Nat. Sci.) 38: 1-10.
Dudley, J.W. 1982. Theory of transfer of alleles.
Crop Sci. 22: 631-637.
Goodman, M.M. 1999. Broadening the genetic
diversity in breeding by use of exotic
germplasm, pp. 139 148. In J.G. Coors and
S. Pandey (eds.). The Genetics and
Exploitation of Heterosis in Crops.
American Society of Agronomy, Inc.
Gouesnard, B.,J.Sanou, A. Panouille and V.
Bourion. 1996. Evaluation of agronomic traits
and analysis of exotic germplasm
polymorphism in adapted x exotic maize
crosses. Theor. Appl. Genet. 92: 368-374.
Hainzelen, E. 1998. Exotic introgression incidence
on two elite tropical maize populations.
Maydica 43: 19-26.
Hallauer, A.R. 1978. Potential of exotic germplasm
for maize improvement, pp. 229-247. In D.B.
Walden (ed.). Maize Breeding and Genetics.
Wiley. New York.

447

Hoffbeck, M.D., S.J. Openshaw, J.L. Geadelmann,


R.H. Peterson and D.D. Stuthman. 1995.
Backcrossing and intermating in an exotic x
adapted cross of maize. Crop Sci. 35: 13591364.
Holley, R. N. and M. M. Goodman. 1988. Yield
potential of tropical hybrid maize derivatives.
Crop Sci. 28: 213-218.
Lonnquist, J.H. 1974. Consideration and
experiences with recombination of exotic and
Corn Belt maize germplasm, pp. 102-117. In
Proc. 29th Annu. Corn and Sorghum
industry Res. Conf. Chicago, IL. 12-14 Dec.
American Seed Trade Association,
Washington, DC.
Khehra, A.S., B.S. Dhillon, N.S. Malhi, V.K.
Saxena, V.V. Malhotra, S.K. Dey, S.S. Pal,
and W.R. Kapoor. 1986. Systematic
introgression of the Corn Belt germplasm
maize, pp. 291-301. In B. Napompeth and
Suranant Subhadrabandhu (eds.). Proc. Fifth
International Congress Society for The
Advancement of Breeding Researches in
Asia and Oceania(SABRAO). Thailand,
Nov. 25-29, 1985.
Kim, S.K. 1990. Breeding of temperate maize
germplasm for tropical adaptation, pp. 208229. In C. De Leon, G. Granados and M.D.
Read. (eds.). Proc. Fourth Asian Regional
Maize Workshop. Pakistan, Sep. 21-28,1990.
Kraja, A., J.W. Dudley and D.G. White. 2000.
Identification of tropical and temperate maize
population having favorable alleles for disease
resistance. Crop Sci. 40: 948-954.
MSTAT-C. 1988. MSTAT-C a Microcomputer
Program for the Design, Management,
Analysis of Agronomic Research
Experiments. Michigan State University. 402
p.
Rasmusson, D.C. and R.L. Phillips. 1997. Plant
breeding progress and genetic diversity from
de novo variation and elevated epistasis. Crop
Sci. 37: 303-310.
Troyer, A.F. 1999. Background of U.S. hybrids
corn. Crop Sci. 39: 601-626.

Kasetsart J. (Nat. Sci.) 38 : 448 - 456 (2004)

Root Responses to Water Deficit under Rain-fed Lowland Rice


Soraya Uyprasert1, Theerayut Toojinda2, Nawarat Udomprasert1,
Somvong Tragoonrung2 and Apichart Vanavichit1

ABSTRACT
Drought is a major problem for rice grown under rainfed lowland conditions. The ability of rice
plants to tolerate drought stress is associated with root system characters. However, genetic of root traits
under lowland condition was uncertain. To determine the performance of root characteristic response
to drought tolerance, a total of 220 double haploid lines, their parents (CT9993 and IR62266), and three
standard checks (IR20, NSG19 and KDML105) were used in the experiments. The extent of genetic
variation in root characters, relative water content, visual leaf rolling and drought injury under different
intensities of water deficit were determined. Genotypes with short root were more dehydration tolerant
than the longer root genotype, consequently more relatively high water content and delayed leaf rolling
and senescence under severe water deficit.
Key words: rice, rainfed lowland, double haploid lines, relative water content, drought

INTRODUCTION
Rain-fed lowland rice is mostly grown in
South and Southeast Asia, and more than 50% is
under drought-prone conditions (Garrity and O
Toole, 1994). Drought is a major factor determining
productivity in rain-fed lowland rice. The incidence
of drought was measured by timing, duration and
severity at specific locations over several years. In
relation to the timing of plant growth and
development, drought can be classified as
vegetative, reproductive, and terminal. Drought
may delay the phenological development of the
rice plants and may also affect the physiological
processes of transpiration, photosynthesis,
respiration, and translocation of assimilates to the

1
2

grain (Fukai and Cooper, 1995). Drought also


strongly affects the morphology of the rice plant.
Leaf area development may be hampered due to
reduced leaf expansion, leaf rolling, early
senescence, suppressed tillering (OToole and
Namuco, 1983).
Increased soil strength under reduced soil
moisture and the presence of hardpans in the
subsoil of rain-fed lowlands make it difficult for
roots to gain access to deep soil moisture. Under
such conditions, roots with higher penetration
ability have an advantage for absorbing water
from deeper soil layers. Genotypic variation in
root penetration and other root traits have been
reported in rice (Yu et al., 1995; Nguyen et al.,
1997). Increased rooting depth, root density, root

Department of Agronomy, Kasetsart University, Kamphangsaen Campus, Nakhon Pathom 73140, Thailand.
Rice Gene Discovery Unit, BIOTEC, National Center for Genetic Engineering and Biotechnology, Kasetsart University,
Kamphangsaen Campus, Nakhon Pathom 73140, Thailand.

Received date : 13/08/04

Accepted date : 19/11/04

Kasetsart J. (Nat. Sci.) 38 (4)

shoot ratio, root pulling force and penetration


ability through hardpans are reported to be major
drought resistance traits associated with the root
systems in rice.
Visual leaf rolling score is an efficient
method for detecting drought avoidance and this
can be used as an indirect estimate of drought
resistance. Visual drought scoring by an
experienced researcher based solely on leaf
desiccation is apparently quite effective in
discriminating drought avoidance in rice (OToole
and Moya, 1978). This field study was conducted
to determine the performance of root characteristic
response to drought stress conditions in rainfed
lowland rice.
MATERIALS AND METHODS
Genetic materials
The rice breeding lines, CT9993-10-1-M
and IR62266-42-6-2, differ consistently for a range
of traits as expressed under drought stress and nonstress conditions (Babu et al., 2001). These traits
include gross root morphology, root penetration
index (RPI) and osmotic adjustment (OA). A
double haploid line (DHL) population was
developed through anther culture from a cross
between CT9993-10-1-M (abbreviation as
CT9993, an upland japonica ecotype possessing a
deep and thick root system and low OA) and
IR62266-42-6-2 (abbreviated as IR62266, an indica
ecotype with a shallow root system and high OA),
at Centro International de Agricultura Tropical
(CIAT), Columbia, and International Rice Research
Institute (IRRI), Philippines. The 220 DHLs,
parental lines and standard checks; IR 20, NSG19,
KDML105 were used in this study.
Experimental design and cultural practice
The experiment was conducted under
lowland rice conditions at Ubon Ratchthani Rice
Research Center (latitude 15 19 52.35 N,
Longitude 104 40 55.15 E, altitude 110m),

449

located in Northeast Thailand during the 20002001 dry season. The soil texture was sandy loam,
acidic, infertile and low in organic matter. The
plants were seeded on 22 December 2000. The
populations were randomly allocated in 3
replications in a randomized complete block design,
and every 7 lines, KDML105 and NSG19 were
grown as running checks. Individual plot size was
0.84 m2, which consisted of 4 rows, 15 cm apart,
1.4 m in length, 14 hills per row. Hills were 0.1m
apart within each row.
Surface irrigation was applied until
vegetative stage (54 days after sowing, DAS) and
the first group of data which represent well water
condition was collected before drought stress was
applied. To induce drought stress, flooded water
was drained out of the field. Then the data were
collected again as mild stress and severe stress
condition 14 days and 24 days after drought was
induced, respectively (68 DAS and 78 DAS). To
induce recovery condition, water was pumped into
the field as surface flood for 7 days and the data
were collected as recovery condition (85 DAS).
Measurements
Relative water content (RWC): At
specific time intervals (predawn 01.00 05.00 am
and midday 10.30 am 3.00 pm) mature leaf tissue
was excised from tillers in each experimental plot
for all lines and all water conditions. Three mature,
fully expanded leaves were used. The leaves were
excised at the base, while the top of each leaf was
trimmed to make them equal in length. To
determine RWC, the 3 leaf samples were excised
about 1 cm2 in size, and immediately weighed
them in a hermetically sealed container, floated in
distilled water until fully re-hydrated, weighed,
and then dried them until a constant oven-dry
weight was obtained. The data obtained was
computed for RWC according to Turner (1982) as
follows:
RWC =

(Fresh Weight - Dry Weight)


100
(Turgid Weight - Dry Weight)

450

Kasetsart J. (Nat. Sci.) 38 (4)

Leaf rolling and drought score: Plants


were evaluated for leaf rolling and drought score,
to assess the effects of drought. Evaluation began
when the most susceptible entries had tightly rolled
leaves at midday (10.00 am - 3.30 pm). A rating
of leaf rolling score was visually estimated in each
plot using a 1 - 5 scale, where a score of 1 was no
rolling and 5 was completely rolled (OToole and
Moya, 1978). Rating of drought scores (0 - 9) was
estimated for each plot based on symptom of leaf
drying on the plants. A score of 0 indicated no
symptoms of stress, with an increasing score where
more leaves die due to water deficit (IRRI, 1975).
A score of 5 indicated that 50% of the entire leaves
was fully dried. The maximum score of 9 indicated
that all plants were apparently dead.
Root mass : Root mass density (RMD) and
total root mass were determined after recovery
period (90 DAS). The method and technique for
the determination of root system was developed
by Pantuwan et al. (1997). Two adjacent hills were
randomly selected before taking measurements. A
38 mm (inner diameter) steel tube was placed next
to a hill with less than 1 cm between the closest
tiller and the tube. The soil column was sampled at
45 cm deep, collected and cut the soil into three
sections at the depth of 0-15, 15-30 and 30-45 cm,
respectively. The second soil column was taken
from another hill using the same procedures. Soil
samples were placed on 1 mm mesh screen and
roots were washed to remove soil using tap water.
Roots were dried in a hot-air oven at 70C for 48
h and weighed to determine root dry mass.
Plant height : After recovery period , plant
height and tiller number were randomly measured
on 10 hills in each plot. The height was measured
from the soil surface to the tip of tallest panicle
within each hill and tiller numbers were counted
on 10 hills sampled independently.
RESULTS
Genotypic variation in root characteristics and

plant height
Root mass densities (RMD) of rice genotype
were significantly different at depths of 15-45 cm
in the soil (Table 1). The highest RMD of rice was
located at 0-15 cm soil depth. The parent, CT9993
had higher RMD (0.214 mg cm-3) at this depth
than that of IR62266 (0.098 mg cm-3). Mean
RMD of the DHLs was 0.150 mg cm-3 (0.041 0.352 mg cm-3). Three standard checks (IR20,
NSG19 and KDML105) revealed that RMD was
not significantly different for all depths in the soil.
Total root mass (TRM) and root mass distribution
(%RMD) was significantly different among DHLs
at all depths in the soil. Mean TRM of the DHLs
was 131.7 gm-2 (68.0-228.0 gm-2). %RMD was
80.95 % (62.33-94.57 %) at the depth of 0-15 cm;
17.18% (5.28-33.56 %) at the depth of 15-30 cm,
and 1.84 % (0.08-9.62 %) at the depth of 30-45 cm.
These three standard checks did not produce
significantly different result.
Mean plant height was 37 cm for IR62266
and 45 cm for CT9993, while mean plant height of
the population was 42 cm (SEM = 4 cm). There
was a positive relationship between plant height
and RMD (r = 0.212**, 0.226** and 0.158* for
RMD at 0-15, 15-30 and 30-45 cm of soil depth,
respectively) and TRM (r = 0.251**) (Figure 1).
These relationships suggested that taller plants
tended to have larger root systems.
Genotypic variation and consistency in relative
water content (RWC)
Significant genotypic variation in RWC
was observed for both predawn and midday across
water stress condition (Table 2). During mild
stress, mean RWC of the DHLs was 89.3% at
predawn and 77.0% at midday and decreased
when stress was more severe (77.6 and 66.9 % at
predawn and midday). They increased again when
the DHLs were in the recovery period (77.8%).
Mean RWC of their parents, CT9993 and IR62266,
as well as the three standard checks were similar
under all water conditions, except at the midday

a=

b=

0.037
0.041
0.001
68.02
62.33
5.280
0.080

Min

1.443
0.352
0.093
228.0
94.57
33.56
9.620

DHL
Max

standard error of the mean of parents and checks,


least significant difference

0-15
15-30
30-45

0-15
15-30
30-45

RMD (mg cm-3)

TRM (g m-2)
RMD (%)

Depth
(cm)

Root traits

0.852
0.214
0.020
162.9
78.79
19.34
1.865

0.057
0.026
0.011
10.071
0.284
1.853
1.086

CT9993
Mean SEMa

-2
TRM (g m ) in 0-45 cm

0.071
0.150
0.017
131.7
80.95
17.18
1.842

Mean
0.069
0.016
0.007
12.471
1.867
1.870
0.709
0.621
0.094
0.019
110.1
84.42
12.91
2.664

0.077
0.020
0.005
13.832
2.064
1.602
0.578
0.667
0.120
0.009
119.6
83.61
15.26
1.128

0.101
0.021
0.007
17.692
1.651
1.501
0.822

0.377
0.108
0.032
65.36
10.41
9.54
3.22

KDML 105
LSD (b)
Mean SEMa (5 %)

RMD (mg cm-3) in 0-15 cm

0.700
0.131
0.025
128.5
81.80
15.24
2.952

NSG 19
Mean SEMa

20

1.6

RMD (mg cm-3) in 15-30 cm

0.032
0.013
0.005
3.844
2.327
1.765
0.709

IR 20
Mean SEMa

RMD (mg cm-3) in 30-45 cm

0.625
0.098
0.016
111.0
84.51
13.73
1.755

IR62266
Mean SEMa

Table 1 Minimum, maximum and mean root mass densities (RMD) (mg cm-3), total root mass (TRM) (g m-2) and RMD (%) determined after drought
stress period of double haploid lines (DHL), parents (CT9993 and IR62266) and three standard checks (IR20, NSG19 and KDML105) at Ubon
Ratchathani Rice Research Center in 2002 dry season.

Kasetsart J. (Nat. Sci.) 38 (4)

451

1.6

r = 0.212 **

1.2

.8

.4

0.0

20

20

20

30

30

30

30

40

1.2
r = 0.226 **

.8

.4

0.0

1.6
40

r = 0.158 *

1.2

.8

.4

0.0
40

300

250
r = 0.251 **

200

150

100

50
40

50
60
70

50
60
70

50
60
70

50
60
70

Plant height (cm)

Figure 1 Relationship between root mass density (RMD, mg cm-3) in 0-15, 15-30
and 30-45 cm; and total root mass (TRM,
g m-2) and plant height (cm) of double
haploid population at Ubon Ratchathani
Rice Research Center in 2002 dry season. Horizontal and vertical bars are
5% LSD applicable to differences for
root characteristics and plant height
among lines.

1.49

12.95

measurement under severe stress treatment, where


IR62266 had significantly lower RWC than
KDML105.
Genotypic consistency in RWC across
water conditions was observed. The correlation
genotype means was highly significant across all
water condition (Table 3). The correlation
coefficient (r) between RWC measured during the
water stress (mild and severe stress) and the
recovery, was 0.208 ** and 0.199 ** at predawn
and midday during mild stress, and 0.411 ** and
0.359 ** at predawn and midday during severe
stress.

standard error of the mean of parents and checks,


least significant difference
a

Midday
Recovery

58.5

90.6

77.8

80.1

2.53
84.1
2.39

73.4

2.65
79.1
1.56

78.8

10.43
11.71
1.81
0.46
Predawn
Midday
Severe stress

63.4
47.0

92.2
83.3

77.6
66.9

74.7
65.6

0.92
5.57
80.2
59.7
1.10
2.28

76.9
70.0

1.20
1.11
79.0
71.5
0.70
1.57

82.7
75.8

10.23
14.17
1.86
1.14
91.0
84.0
0.75
1.45
91.7
81.8
3.39
3.48
0.68
1.88
89.4
79.6
Predawn
Midday
Mild stress

76.2
56.3

99.2
90.0

89.3
77.0

90.7
74.7

2.15
1.62

87.2
77.3

NSG19
Mean SEMa
IR62266
Mean SEMa
DHL
Max

Mean

CT9993
Mean SEMa

Mean

IR20
SEMa

KDML 105
Mean SEMa

LSDb
(5 %)

Kasetsart J. (Nat. Sci.) 38 (4)

Min

Table 2 Minimum, maximum and mean relative water contents (%) determined during drought stress period at mild and severe plant water deficit and
recovery after drought stress was relieved for five days of double haploid lines (DHL), parents (CT9993 and IR62266), and three standard
checks (IR20, NSG19 and KDML105) at Ubon Ratchathani Rice Research Center in 2002 dry season.

452

Genotypic variation and consistency in leaf


rolling and death
Mean leaf rolling of the DHLs was 2.9
under mild stress condition, and increased to 3.9
when stress was severe and then decreased to 1.5
thereafter when rice was in recovery period. Mean
drought score of the DHLs also increased under
mild and severe stress condition and then decreased
when rice was in recovery period (3.0, 4.8, 1.7).
Highly significant genotypic variation in leaf rolling
and death (visual drought score) was observed
(Table 4). Although there were significant
differences among DHLs, this was not so in their
parents. KDML105 had the lowest of both visual
scores when compared to the parents and the other
standard checks (IR20 and NSG19). As for the leaf
rolling score, KDML105 was significantly different
from IR62266 only at the mild stress period, and
was significantly different from some other
cultivars for drought score at all water condition.
The genotypic consistency in visual
estimation of leaf rolling and death across water
conditions was observed. The relationship for
genotype means was significant across all water
conditions, except that the relationship between
the leaf rolling score under the severe stress and
recovery periods (Table 5), indicating that genotype
ranking between the two visual symptoms under
different intensities of drought was highly

453

Kasetsart J. (Nat. Sci.) 38 (4)

consistent.
DISCUSSION
This study has shown the high degree of
sensitivity to water deficit in rice and different
physio-morphological responses to water deficit
among rice genotype examined. After water
stress was imposed, although the rice genotypes
were somewhat different in root development (root
mass density, total root mass and, root mass
distribution), most of the root mass distribution
was only in the top 0-15 cm layer of the soil (Table
1). This limited root development in shallow topsoil zones in rain-fed lowlands is partly a result of
the hardpan that develops through pudding
(Pantuwan et al.,1997) and, may also due to the
limitation of oxygen supply in lower soil depths in
anaerobic lowland conditions (Wade et al., 1998).
Because of the shallow nature of the root system,
genotypic variation in root mass or length is rather
limited. Nevertheless, in the parents of DHLs,
CT9993 had significantly higher root mass density
at 15-30 cm soil depth and, also taller than IR62266.
The genotypic differences in root mass density or
root length density at 5-30 cm depth were related
with differences in both visual estimation of
retention of green leaves during a dry period and

water extraction (Pantuwan et al.,1997). It was


anticipated that larger effects of drought resistance
could be obtained if genotypes develop deep root
systems rather than more shallow roots at the 30
cm deep. A large root system may be able to
extract more water from the soil, but this does not
necessarily result in higher yield under limited
water condition (Fukai et al., 1999). The larger
root system may result in more rapid extraction of
available water and hence, faster development of
water deficit that may have an adverse effect on
grain yield.
The results suggested that the DHLs with
better root traits had less drought resistance in
terms of osmotic adjustment in rainfed lowland
conditions. This negative association indicated
that there were different strategies (avoidance and
tolerance) employed by the rice plant to cope with
periods of water deficit. For example, CT9993 has
higher root mass density and low osmotic
adjustment (Samson et al., 1995), while IR62266
has higher osmotic adjustment and a low root mass
density. The differences of the two parental lines
was characterized under both stress and non-stress
conditions in the greenhouse and in the field (Azhiri
et al., 2000; Nguyen et al.,1997). Under rain-fed
lowland conditions where often both flooding and
drought alternately occur during crop growth,

Table 3 Phenotypic correlation among predawn and midday relative water content (%) determined
during drought stress period at mild and severe water stress and recovery after drought stress
was relieved for five days in a double haploid population at Ubon Ratchathani Rice Research
Center in 2002 dry season.
environment

Mild stress
Severe stress
Recovery

Mild stress
Predawn
Midday
Predawn
Midday
Predawn
Midday
Midday

**, Significant levels at 1 %

0.378**
1

Severe stress
Predawn
Midday

Recovery
Midday

0.239**
0.322**
1

0.208 **
0.199 **
0.411 **
0.359 **
1

0.272**
0.293 **
0.585 **
1

454

1.02
1.19
1.54
0.13
0.39
0.00
1.6
3.5
1.0
0.43
0.39
0.23
2.6
4.8
1.2
0.17
0.30
0.00
2.0
4.6
1.0
0.21
0.22
0.33
2.9
4.5
1.3
0.09
0.12
0.15
2.8
5.0
1.8
a

= standard error of the mean of parents and checks,


= least significant difference

3.0
4.8
1.7
1.3
3.0
1.0
Drought score
Mild stress
Severe stress
Recovery

4.7
7.3
5.0

1.03
0.87
0.71
0.19
0.11
1.7
3.2
0.11
0.11
2.6
3.8
0.22
0.19
2.6
4.0
0.22
0.22
2.8
3.8
0.22
0.08
2.5
3.8
2.9
3.9
1.5
4.3
5.3
5
1.7
3.0
1
Leaf rolling score
Mild stress
Severe stress
Recovery

LSDb
(5 %)
KDML105
Mean SEMa
NSG19
Mean SEMa
IR20
Mean SEMa
Mean

We wish to thank Dr. Shu Fukai


and Dr. Grienggrai Pantuwan for valuable
discussion and the staff of Ubon
Ratchatani Rice Research Center for
agronomic management of the
experiment.The financial support by the
National Science and Technology
Development Agency (NSTDA) is
gratefully acknowledged.

Min

ACKNOWLEDGEMENTS

IR62266
Mean SEMa

These results clearly indicated that


between 62-94% of root were distributed
in the top 0-15 cm soil depth and very few
roots were found below 30-45 cm. The
rice genotypes, which had low root mass
density, were able to maintain water status,
consequently delayed tissue death and
leaf senescence in rice under water stress.
It is suggested that the ultimate goal to
combine high dehydration tolerance with
strong root penetration may not be realized
in the existing germplasm for rainfed
lowland rice.

CT9993
Mean SEMa

CONCLUSION

DHL
Max

different drought resistance strategies


could be combined rather than depending
solely on one mechanism (Ludlow, 1989).
Yield advances in limited water condition
could occur, if high osmotic adjustment
and good depth and thickness of roots for
exploration of soil water are combined
through breeding.

Table 4 Minimum, maximum and mean leaf rolling and drought score determined during drought stress period at mild and severe plant water deficit
and recovery after drought stress was relieved for five days of double haploid lines (DHL) and their parents (CT9993 and IR62266), and three
standard checks (IR20, NSG19 and KDML105) at Ubon Ratchathani Rice Research Center in 2002 dry season.

Kasetsart J. (Nat. Sci.) 38 (4)

455

Kasetsart J. (Nat. Sci.) 38 (4)

Table 5 Phenotypic correlation among drought score, and leaf rolling score determined during drought
stress period at mild and severe water stress and recovery after drought stress was relieved for
five days of double haploid lines (DHL) at Ubon Ratchathani Rice Research Center in 2002 dry
season.
Drought score
Mild stress Severe stress Recovery
Drought score Mild stress
Severe stress
Recovery
Leaf rolling
Mild stress
Severe stress
Recovery
a;

0.716**
1

0.376**
0.598**
1

Leaf rolling
Mild stress Severe stress
0.769**
0.515**
0.180**
1

0.477**
0.365**
0.064 nsa
0.615*
1

Recovery
0.171**
0.259**
0.385**
0.134*
0.155*
1

ns, not significant; * and **, Significant levels at 5 % and 1 %, respectively

LITERATURE CITED
Azhiri-Sigari, T., A.Yamauchi, A. Kamoshita and
L.J.Wade. 2000. Genotypic variation in
response of rainfed lowland rice to drought
and rewatering. II. Root growth. Plant Prod.
Sci . 3: 180-188.
Babu, R.C., H.E. Shashidhar, J.M. Lilley, N.D.
Thanh, J.D. Ray, S. Sadasivam, S. Sarkarung,
J.C. OToole and H.T. Nguyen. 2001.
Variation in root penetration ability, osmotic
adjustment and dehydration tolerance among
rice accessions adapted to rainfed upland and
lowland ecosystems. Plant Breed. 120: 233238.
Fukai, S. and M.Cooper. 1995. Development of
drought-resistant cultivars using physiomorphological traits in rice. Field Crops Res.
40: 67-86.
Fukai, S., G. Pantuwan, B. Jongdee and M. Cooper.
1999. Sceenning for drought resistance in
rainfed lowland rice. Field Crops Res. 64:
61-74.
Garrity, D.P. and J.C. OToole. 1994. Screening
for drought resistant at the reproductive phase.
Field Crops Res. 39: 99-100.
IRRI (International Rice Research Institute).1975.
Standard Evaluation System for Rice. IRRI,

Los Banos, Philippines. 64 p.


Ludlow, M.M.1989. Strategies of response to water
stress, pp. 269-281. In K.H. Kreeb, H. Richter
and T.M. Hinckley (eds.). Structural and
Function Responses to Environmental
Stresses : Water shortage. The Hague,
Netherlands: SPB Academic Publishing.
Nguyen, H.T., R.C. Babu and A. Blum. 1997.
Breeding for drought resistance in rice:
Physiology and molecular genetics
considerations. Crop Sci. 37: 1426-1434.
OToole, J.C. and T.B., Moya. 1978. Genotypic
variation in maintenance of leaf water potential
in rice. Crop Sci. 18: 873-876.
OToole, J.C. and O.S. Namuco. 1983. Role of
panicle exert in water stress induced sterility.
Crop Sci. 23: 1093-1097.
Pantuwan, G., S. Fukai, M. Cooper, J.C. OToole
and S. Sarkarung. 1997. Root traits to increase
drought resistance in rainfed lowland rice, pp.
170-179. In Breeding strategies for rainfed
lowland rice in drought-prone environments.
Proceedings of an International Workshop
held at Ubon Ratchatani, Thailand, 5-8
November, 1996. ACIAR, Canberra.
Samson, B.K., L.J. Wade, S. Sarkarang, M. Hasan
and R.Amin. 1995. Examining genotypic
variation in root traits for drought resistance,

456

Kasetsart J. (Nat. Sci.) 38 (4)

pp. 521-534. In Proceedings of the


International Rice Research Conference.
13-17 February, 1995. IRRI, Los Banos,
Philippines.
Turner, N.C. 1982. The role of shoot characteristics
in drought resistance of crop plants, pp. 115134. In Drought Resistance in Crop with
Emphasis on Rice. IRRI, Los Banos,
Philippines.

Wade, L.J., T.George, J.K. Ladha, U. Singh, S.I.


Bhuiyan and S. Pandey.1998. Opportunities
to manipulate nutrient-by-water interactions
in rainfed lowland rice systems. Field Crops
Res. 56: 93-112.
Yu, L.X., J.D. Ray, J.C. OToole and H.T. Nguyen.
1995. Use of wax-petrolatum layers for
screening rice. Theor. Appl. Genet. 97: 3744.

Kasetsart J. (Nat. Sci.) 38 : 457 - 467 (2004)

Effect of Dry Season Cutting Management on Subsequent Forage


Yield and Quality of Ruzi (Brachiaria ruziziensis) and Dwarf Napier
(Pennisetum purpureum L.) in Thailand
Tadesse Tekletsadik1, Sayan Tudsri2, Sunanta Juntakool2 and Somkiert Prasanpanich3

ABSTRACT
A field study was conducted under rainfed conditions during 2002 2003 to determine the effect
of dry season cutting management on the yield and quality of ruzi (Brachiaria ruziziensis) and dwarf
napier (Pennisetum purpureum) grass during the dry season and the following wet season. The pastures
were cut 1, 3, 6 times during the dry season and 7 times during the following wet season at 5 and 20 cms
above ground level. The study was sited on a reddish brown sandy clay loam soil at Suwanvajokkasikit
Field Crop Research Station in the Pakchong district of northeast Thailand.
During both dry and wet seasons, leaf production and total plant production of dwarf napier were
noticeably higher than ruzi grass but similar in stem production. Lax cutting (20 cm) produced
significantly higher yield than close cutting (5 cm) and cutting every 2 months (3 times) tended to give
higher yields than cutting more and less frequently of dwarf napier grass but not of ruzi. However, in the
following wet season the pastures cut only once during the dry season produced significantly higher yields
of herbage than those defoliation more frequently, particularly in the case of dwarf napier.
The protein percentage in dwarf napier and ruzi grass was not significantly different, although
tended to be higher in dwarf napier particularly during the wet season and in the stem fraction. Protein
yields, however, between the two grasses were highly significant with dwarf napier yield being much
higher than ruzi, which was largely a reflection of the respective dry matter yields. Both pasture species
showed higher protein yields under lax cutting than close cutting in both seasons.
Lax cutting also tended to produce higher neutral detergent fiber (NDF) and acid detergent fiber
(ADF) content in the total herbage than close cutting and in both seasons. NDF and ADF concentration
significantly increased with delayed time of cutting in the dry season.
Key words: dwarf napier, ruzi, cutting height, forage yield, dry season
INTRODUCTION
Most of the ruminant animals in Thailand
raised on natural pastures and local dairy farmers,
in particular, are keen to improve their pasture in
order to achieve better economic milk production.
1
2
3

Tudsri et al. (2002) noted that the grass species


most commonly used on these dairy farms were
para (Brachiaria mutica), ruzi (B. ruziziensis),
guinea (Panicum maximum) and napier grass
(Penisetum purpureum). At present, most of these
grasses are cut and fed fresh to livestock or

Holetta Agricultural Research Center, POB 2003, Addis Ababa, Ethiopia.


Department of Agronomy Faculty of Agriculture Kasetsart University, Bangkok 10900, Thailand.
Department of Animal Science, Faculty of Agriculture Kasetsart University, Bangkok 10900, Thailand.

Received date : 13/08/04

Accepted date : 21/09/04

458

Kasetsart J. (Nat. Sci.) 38 (4)

conserved rather than grazed. The reason given is


that cut pasture gives the higher production
although this has been clearly reflected by research
conducted at D.P.O. (Hongyantarachai et al., 1989).
Another factor is a lack of effective fencing.
Grazing or cutting management plays an
important role in determining yield, quality and
longevity of the pasture, and hence several workers
have experimented in this area. For example,
Tudsri et al. (2002) reported that grassland farmers
tended to cut or graze their pasture to a very low
level (0 10 cm) from the beginning of wet season
and continued throughout the drought period. This
may lead to a reduction in pasture yield during
subsequent regrowth in the following wet season.
These authors further suggested that optimum
cutting height for all napier cultivars should not be
lower than 20 cms in order to achieve good and
quick regrowth. Tudsri and Kongsanor (1992)
also showed that under severe water stress, cutting
of dwarf napier grass resulted in death of all plants
and no regrowth was observed after rewatering.
Hard cutting under mild water stress also led to a
considerable reduction in plant growth and dry
weight relative to the lax cutting. In later work at
Pakchong, Tudsri et al. (2002) showed that delaying
the closing date of the pasture into the dry season
produced a negative effect on regrowth in the
following season, especially when a low cutting
height had been imposed. Thus, a better
understanding of cutting management during the
drought period (November April) is essential to
improve dry season production and also reduce the
effect of drought on subsequent pasture production.
The experiment was designed to compare the two
grass species, ruzi (Brachiaria ruziziensis) and
dwarf napier, (Pennisetum purpureum) under
different cutting management during the dry period
(November- April) and these effects were examined
in the following wet season in terms of herbage
yield and quality for ruminant livestock production.

MATERIALS AND METHODS


The field experiment was conducted at
Pakchong district, Nakhon Ratchasima province,
The Suwanvajokkasikit Field Crop Research
Station, Thailand, approximately 150 km northeast
of Bangkok (14.5 N in latitude and 101 E in
longitude, at an altitude of 360 m asl). Soil type of
the experimental area was classified as a moderate
reddish brown lateritic soil. Chemical content of
the soil in the top 0 15 cm of the trial site was
1.44% organic matter, 52.4 ppm available
phosphorus (P) and 125.8 ppm available potassium
(K) with a mean pH of 6.12.
The experiment was a split-split plot in a
randomized complete block design and replicated
four times. The two grass species were main plots.
Sub plots were two cutting heights: 5 and 20cms.
Sub-sub plots were three dry season cutting
management: - 1) every month started from
November April, 2) in November, January and
April, and 3) only once in April. The size of each
plot was 2m 2.5m. Two tropical perennial grass
dwarf napier (Pennisetum purpureum) and ruzi
grass (Brachiaria ruziziensis cv. Kennedy) were
used for this experiment. Ruzi grass seeds and
stem cuttings of dwarf napier grass bearing two
nodes were planted in small plastic pots in June
2002. The resulting seedlings were watered daily
until they reached the required height for planting
(20 30cm). The seedlings were then transplanted
to the field in August 2002. Seedlings were planted
in rows 50cm apart with 50cm between plants and
within the rows. Individual plots consisted of five
2.5m long rows spacing 0.5m apart. Each row
contained 6 plants for a total of 30 plants per plot.
Fertilizer was applied twice, initially with a basal
compound fertilizer dressing of NPK (15-15-15)
at the rate of 300 kg /ha and at the time of
transplanting on August 8/ 2002, and again
(15:15:15) at the rate of 30 kg/rai (187.5 kg/ha)
and 10kg N/ rai (62.5 kg N/ha) as urea, on 1st May
2003 at the onset of rainy season.

459

Kasetsart J. (Nat. Sci.) 38 (4)

fiber (ADF) concentrations. Total nitrogen was


determined by micro Kjeldahl method (AOAC,
1975). Crude protein (CP) was calculated as % N
x 6.25, and protein yield was estimated by
calculation. NDF and ADF were determined
according to the procedure described by Goering
and Van Soest (1970).
The data were analyzed for significant
differences among various treatments by analysis
of variance using SAS statistical computer package
Ver. 6.12 (SAS 1996). Duncans Multiple Range
Test (DMRT) was employed to compare the
treatment means for different parameters and their
significances at P< 0.05.
RESULTS AND DISCUSSION
Climatic conditions
Monthly rainfalls and monthly mean
maximum and minimum air temperatures at the
experimental site during the experimental period
in 2002 and 2003 are presented in Figure 1.
Temperatures were quite similar over both years.

350

40

300

35
30

250

25

200

20
150
15
100

Temperature (C)

Rainfall (mm)

In the dry season, forage was cut monthly,


bimonthly and left uncut until the first week of
April to the appropriate cutting height (5 and 20
cms).
In the wet season, each plot was cut
manually with a sickle every month (started May
2003) to the treatment stubble heights of 5 and 20
cms above ground. The total biomas was weighed
in the field and a representative fresh sub samples
of 300 400 gm was brougth to the weighing
room, hand sorted into leaf and stem components.
Dry matter of leaf and stem was determined by
drying at 60C for 72 hours (three days) in a drying
oven. The sample weight obtained after drying
leaf and stem was expressed in ton/hectare to
determine dry matter yields. Dried samples were
then ground with a mill to pass a 1mm sieve, and
kept for chemical analysis.
Duplicate forage samples per treatment
harvested in the last month of the dry season
(April) and the wet season cutting (July) were
subsequently analyzed to determine nitrogen (N),
neutral detergent fiber (NDF) and acid detergent

10

50

0
Jan Feb Mar Apr May Jun July Aug Sep Oct Nov Dec
Month
Rain average
Rain (2002)
Rain (2003)
Max temp (2002)
Min temp (2002)
Max temp (2003)
Min temp (2003)

Figure 1 Medium term mean rainfalls (1996-2003) (rain average), monthly rainfalls (rain) and mean
monthly maximum and minimum temperatures (max temp and min temp) in 2002-2003 at the
Pakchong research site.

460

Kasetsart J. (Nat. Sci.) 38 (4)

Rainfall obtained at the experimental site in the


wet season of 2002 (May to October) was equal to
the mid term average. The trend of rainfall pattern
showed a linear increase from June to September
and then declined in October in the same manner
as the mid term mean. The unusual rainfalls
recorded in December 2002 and February and
March 2003 of the dry season were above the
average and exceeded it by approximately 8%.
The actual and average rainfalls received were
higher in the months of March and April than the
other months of the dry season. This had an impact
on and was accounted for the tremendous increase
of forage production harvested in early April. The
amount of rainfall received in the wet season of
2003 was adequate and evenly distributed
particularly in the last wet period of September
and October. The total amounts of rainfall at the
experimental site were 1085mm in 2002 and
1264mm in 2003 compared with the eightyear
average of 1164mm.
Dry matter production
The main effects of grass species, cutting
height and dry season cutting management on dry
matter production during both the dry and wet
seasons are presented in Table 1. As shown, the
dry season production of dwarf napier was
significantly greater than that of ruzi grass in terms
of both leaf and total yield, but not in terms of stem
yield. This agreed with the findings of Tudsri and
Kaewkunya (2002) who showed that dwarf napier
produced consistently greater dry matter yield and
higher leaf percentage than ruzi under both mixed
and pure swards.
Swards cut at 20 cm generally gave higher
leaf, stem and whole plant yields than when cut at
5 cm, but this effect only reached significance in
dwarf napier (Table 2a). It is possible that the
relatively low growing, spreading habit of ruzi
grass with its relatively short rhizomes compared
with the erect habit of dwarf napier (Skerman and
Riverose, 1990) may be accounted for this

difference in response to cutting heights imposed.


The growth habit of ruzi could make it more
tolerant to close cutting whereas the erect habit of
dwarf napier could well suffer from low residual
leaf area after cutting for regrowth (Tudsri, 1986).
There were also significant interactions
recorded between dry season cutting management
and grass species and between dry season cutting
management and cutting height (Table 2b and 2c).
As shown, the approximate bimonthly (3 cuts)
cutting of dwarf napier produced the highest yield
but ruzi showed no significant difference in yield
to the different dry season cutting management.
Also the dry matter yield recorded in the different
dry season cutting treatments showed no significant
difference if cut to 5 cm, but when cut to 20 cm the
single dry season cut in April was less than the two
cutting treatments.
As shown in the higher order interaction in
Table 3, the greater productivity recorded in the
bimonthly dry season cutting treatment was very
different in dwarf napier grass and particularly
when cut lax (20 cm). In contrast, ruzi grass
appeared quite tolerant of frequent cutting
(monthly), but less only if cut laxly (20 cm). As
mentioned above the differing growth habits of the
two grasses possibly accounts for much of the
response obtained particularly under frequent
defoliation, whereas the significant time differences
in the age of the respective swards ranging from 1
month (cut monthly) to almost 6 months (cut once)
would probably produce considerable losses in
dead matter particularly in the more prostrate
swards of ruzi.
In the following wet season, dry matter
yield increased substantially in both grasses due
no doubt to ample rainfall and better weather
conditions for growth. Dwarf napier produced
significantly more leave than ruzi although the
superiority in terms of whole plant yield failed to
reach significance (Table 1). As in the dry season,
there was no significant effect on stem production
of the two grasses.

461

Kasetsart J. (Nat. Sci.) 38 (4)

Table 1 Main effects of grass species, cutting height and dry season cutting management on mean dm
yield (t/ha) of leaf, stem, whole plant and percent leaf, of dwarf napier and ruzi grasses in dry
and wet seasons, of 2002 and 2003.

Dry season
A. Species
Dwarf napier
Ruzi grass
B. Cutting height
5
20
C. Dry season cut1
1 (6 cut)
2 (3 cut)
3 (1 cut)
Wet season
A. Species
Dwarf napier
Ruzi grass
B. Cutting height
5
20
C. Dry season cut1
1
2
3
Interaction:
Dry Season
A
B
AxB
C
AxC
BxC
AxBxC
Wet Season
A
B
AxB
C
AxC
BxC
AxBxC
1
2

Leaf

Stem

Whole plant

Leaf %

12.23a2
9.65b

8.60
8.79

20.84a
18.44b

58.53a
52.25b

10.42b
11.46a

8.05b
9.34a

18.47b
20.80a

56.30
54.79

10.74b
11.83a
10.25b

8.41b
9.14a
8.53b

19.15b
20.97a
18.79b

56.10a
56.13a
54.40b

18.91a
13.71b

11.82
10.78

30.73
24.49

61.43a
56.06b

15.34b
17.27a

10.54b
12.06a

25.88b
29.34a

58.89a
58.60a

15.82b
15.46b
17.65a

10.99b
10.76b
12.15a

26.81b
26.22b
29.80a

58.77
58.73
58.73

Leaf
**
**
ns
**
**
*
**

Stem
ns
**
*
*
*
**
**

Total
**
**
*
**
**
**
**

Leaf(%)
**
ns
ns
*
*
ns
*

*
**
**
*
ns
ns
ns

ns
**
**
ns
ns
ns
ns

ns
**
**
*
ns
ns
ns

**
ns
ns
ns
ns
ns
ns

Dry season cutting, 1 = cut every month from Nov to April, 2 = Cut in Nov, Jan and April, 3 = cut only once in April.
Within columns for each main effect and season, means followed by the different letters are significantly different (p<0.05).

462

Kasetsart J. (Nat. Sci.) 38 (4)

Table 2 Mean whole plant dry matter yields (t/ha) of species x cutting height (a) species x dry season
cut (b), and cutting height x dry season cut (c) interaction effect in the dry season harvest of 2002
and 2003.
(a) Species x Cutting height interaction
Cutting height (cm)
Species
Dwarf napier
Ruzi grass
Mean

20

Mean

19.12b1
17.83b
18.47b

22.55a
19.05b
20.80a

20.84A2
18.44B

(b) Species x Dry season cut


Species
Dwarf napier
Ruzi grass
Mean

Dry season cutting management


2

Mean

19.30b
19.02b
16.15b

23.42a
18.53b
20.97a

19.80b
17.78b
18.79b

20.84A
18.44B

Dry season cutting management


2

Mean

17.23b
21.09a
19.15b

19.21b
22.74a
20.97a

18.99b
18.59b
18.79b

18.47B
20.80A

(c) Cutting height x Dry season cut


Cutting
height (cm)
5
20
Mean
1
2

Within rows means followed by different small letters are significantly different (p<0.05).
Within columns means followed by the different capital letters are significantly different (p<0.05).

Table 3 Effect of grass species, cutting height and dry season cutting management on whole plant dry
matter yield (t/ha) dwarf napier and ruzi grasses in dry season, of 2002 and 2003.
Dry season
Cutting management

1. Cut every month


2. Cut three times
3. Cut only once in April
Mean
1
2

Dwarf napier
Cutting height (cm)
5
20
5
17.98b1
20.41a
18.98b
19.12B2

20.61b
26.43a
20.61b
22.55A

Ruzi

16.47b
18.01a
19.00a
17.83B

Within columns means followed by different small letters are significantly different (p<0.05)
Within rows means followed by different capital letters are significantly different (p<0.05)

Mean
20
21.56a
19.04b
16.56c
19.05B

19.15b
20.97a
18.79b

463

Kasetsart J. (Nat. Sci.) 38 (4)

This leafiness of dwarf napier supported


the earlier work of Tudsri et al. (2002) and
Sukkagate et al. (1997) where dwarf napier
produced a higher leaf: stem ratio than ruzi, purple
guinea and para grass over a wide range of maturity.
According to Beaty and Engel (1980), such
cultivars high in leaf content were much higher in
quality than cultivars that produced more stems.
Swards cut at 20 cm produced more leaves
and stems and achieved higher whole plant yield
than swards cut at 5 cm and as shown in Table 4,
this only reached significance in the dwarf napier
swards. This finding agreed with that of Tudsri et
al. (2002) in his work with cultivars of napier grass
and that of Goonewardena et al. (1984) working
with Panicum maximum. These latters further
stated that lenient cutting favored the persistence
of erect growing grasses such as Panicum
maximum, but if cut or grazed intensively they
were short lived and became invaded by weeds
and required frequent replanting.
Whole plant production increased markedly
when only cut once during the dry season compared
with the lower production from more frequent
cutting in the dry season. This was apparent in
both the leaf and stem fractions and hence in total
production. This yield difference was possibly
due to the accumulation of carbohydrate plant
reserves built up during the previous dry season
when this treatment was left uncut almost for 6
months.

Chemical composition
There were no significant effects of grass
species or cutting height on the crude protein
concentration in the leaf, stem or whole plant in
either the dry or wet seasons (Table 5). However,
there was a general decline in crude protein
concentration, especially in the dry season, with
increasing length of cutting interval. This was
similar to results obtained elsewhere in Thailand
with ruzi (Kasantikul, 1993) and napier grass
(Sukkagate, 1994). It was worth noting, however,
that the crude protein levels recorded in this
experiment were consistently above the level
expected to impair animal production as Milford
and Minson (1966) showed that intake was only
reduced if crude protein of the forage was less than
7%. As reported for most grasses, both tropical
and temperate, leaves contain noticeably higher
concentrations of crude protein than stems.
There were highly significant differences
recorded in crude protein yield between dwarf
napier and ruzi, between 5 cm and 20 cm cutting
heights and between dry season cutting
management treatments (Table 5). However, these
differences were largely a reflection of difference
in dry matter yield already presented. The only
response of significance from the generalization
was in the protein yields recorded during the dry
season from close cutting (5 cm) of dwarf napier
and ruzi. While dwarf napier benefited significantly
from lax cutting, ruzi grass showed no difference

Table 4 Mean whole plant dry matter yields (t/ha) of species x cutting height interaction effect in the
wet season 2003.
Species

Dwarf napier
Ruzi
1
2

Cutting height (cm)

Mean

20

29.87a2
21.90b

31.60a
27.08a

Within columns means followed by different letters are significantly different (p<0.05).
Within rows means followed by different letters are significantly different (p<0.05).

30.73a1
24.96b

464

Kasetsart J. (Nat. Sci.) 38 (4)

Table 5 Mean crude protein concentrations (%) and crude protein yields (kg/ha) of leaf, stem and whole
plant of dwarf napier and ruzi grass as affected by forage species, cutting height and cutting
management in dry and wet seasons, of 2002 and 2003.
Crude protein content (%)
Crude protein yield (kg/ha)
Leaf
Stem
Whole plant
Leaf
Stem
Whole plant
Dry season (April)
A. Species
1025.9a
2415.0a
Dwarf Napier
11.5
11.4
11.6
1411.9a
Ruzi grass
12.6
7.6
10.3
1214.8b
620.3b
1875.3b
B. Cutting height
5
12.4
9.6
11.1
1346.0
714.4b
2020.1
20
11.8
9.5
10.7
1280.8
931.8a
2270.1
C. Dry season cut1
1
13.6a
10.4
12.9a
1458.1a
876.99a
2477.0a
b
b
b
a
2
11.0
9.4
10.2
1308.2
871.3
2184.1b
b
b
c
b
3
11.6
8.8
9.6
1173.8
721.2
1774.2c
Wet Season (July)
A. Species
1232.6a
3990.1a
Dwarf Napier
13.9
11.0
13.1
2639.0a
b
b
Ruzi grass
11.3
7.4
9.8
1556.8
802.4
2403.2b
B. Cutting height
5
12.5
9.0
11.1
1948.1b
916.0b
2911.2b
a
a
20
12.7
9.4
11.7
2247.7
1119.0
3482.1a
C. Dry season cut
1
12.5
9.4
11.6
1996.1b
1003.4b
3098.3
b
b
2
12.9
9.0
11.6
2040.7
920.2
3082.3
3
12.4
9.2
11.2
2257.0a
1128.9a
3409.3
Significance:
Dry Season (April)
Leaf
Stem
Total
Leaf
Stem
Total
A
ns
ns
ns
**
**
**
B
ns
ns
ns
ns
**
**
AxB
ns
ns
ns
ns
**
**
C
**
ns
**
**
**
**
AxC
ns
ns
ns
**
**
**
BxC
*
ns
ns
**
ns
**
AxBxC
ns
ns
ns
**
**
**
Wet Season (July)
A
ns
ns
ns
*
*
*
B
ns
ns
ns
**
**
**
AxB
ns
ns
ns
ns
ns
ns
C
ns
ns
ns
*
**
ns
AxC
ns
ns
ns
*
*
ns
BxC
*
ns
ns
ns
**
**
AxBxC
ns
ns
ns
ns
*
*
1
2

Dry season cutting management 1 = cut every month from Nov to April, 2 = cut in Nov, Jan and April, 3 = cut only once in April.
Within columns for each main effect and season, means followed by different letters are significantly different (p<0.05)

465

Kasetsart J. (Nat. Sci.) 38 (4)

in protein yield when close or lax. This was most


apparent during the dry season but not so conclusive
during the wet season.
As shown in Table 6, the leaf of dwarf
napier grass, grown during the dry season, had
significantly higher percentages of NDF and ADF
than the leaf of ruzi grass. However, this superiority
was not reflected in the whole plant and was not
evident during the wet season.
Plants cut at 20 cm tended to have higher
NDF and ADF than those cut at 5 cm particularly
during the dry season. NDF and ADF contents of

the whole plant also increased significantly with


less frequent cutting, particularly, in the stem
fraction, but was not apparent in the wet season.
CONCLUSIONS
The finding from this study suggested that
dwarf napier produced more yield and greater
percentage of leaf than ruzi grass in both dry and
wet seasons. Both dwarf napier and ruzi produced
better yield at 20 cm than 5 cm cutting height in the
dry season as well as in the wet season.

Table 6 Mean neutral detergent fiber (NDF) and acid detergent fiber (ADF) concentrations in leaves,
stems and whole plants of dwarf napier and ruzi grass in dry and wet seasons, of 2002 and 2003.
NDF %
Stem
Whole plant

Leaf

ADF %
Stem
Whole plant

60.7a2
55.0b

64.5
66.9

61.9
60.7

34.7a
27.0b

38.3
36.4

36.1
31.7

56.3
59.4

64.1
67.3

60.1
62.5

30.1
31.6

36.6
38.1

33.4
34.3

57.2
57.4
58.9

63.3b
62.8b
71.0a

58.4b
59.4b
66.1a

30.1
31.2
31.2

33.9b
34.3b
43.8a

30.8b
32.4b
38.4a

54.6
54.9

61.0
64.5

55.8
58.2

32.1
28.9

37.0
36.6

32.9
31.5

54.8
54.7

62.3
63.2

56.9
57.1

30.2
30.8

35.8
36.8

31.9
32.6

54.4
55.0
54.9

62.2
63.9
62.2

56.6
57.3
57.1

30.2
30.5
30.9

35.9
36.8
36.1

31.9
32.2
32.5

Leaf
Dry season (April)
Species
Dwarf napier
Ruzi grass
Cutting ht
5
20
Dry season cut1
1
2
3
Wet season (July)
Species
Dwarf napier
Ruzi grass
Cutting ht (cm)
5
20
Dry season cut
1
2
3
1
2

Dry season cutting, 1= cut every month from Nov to April, 2 = Cut in Nov, mid Jan and April, 3 = Cut only in April.
Within columns for each main effect and season, means followed by the different letters are significantly different (p<.0.05)

466

Kasetsart J. (Nat. Sci.) 38 (4)

Pasture management in the dry season made


considerable contribution to increased forage and
protein yield in the following wet season. Hence,
the farmers should refrain from frequent cutting of
their pasture in the dry season if they desire to
produce maximum yield and get maximum benefit
from their pasture in the subsequent wet season.
However, if the farmers need to use their pastures
in the dry season then, lax cutting at 20 cms is
recommended.
ACKNOWLEDGMENTS
The authors wish to acknowledge the
Ethiopian Agricultural Research Organization
(EARO/ARTP) for granting MS. scholarship to
the first Author and financing the research. The
authors are thankful to all the management and
staff of the Agronomy Department and
Suwanwajokkasikit Field Crop Research Station,
Kasetsart University, Thailand for assistance in
providing facilities and transport service to carry
out this experiment. The authors thank Professor
B.R. Watkin for suggestions and criticism.
LITERATURE CITED
AOAC. 1975.Official Methods of Analysis (12th
ed.). Association of Official Analytical
Chemists, Washington, DC. 58 (4): 811-817.
Beaty E. R., and J. L. Engel.1980. Forage quality
measurements and forage research A review,
Critique and interpretation. J. Range
Management 33 (1): 49-54.
Goering H. K. and P. J. Van Soest. 1970. Forage
fiber analysis (apparatus, reagents, procedures
and some application), pp. 1-120. In Agric.
Handbook 379, ARS, USDA, Washington,
DC.
Goonewardena L. A., K. Nadarajah, V. Ravindran
and S. Panditharatne. 1984. Effect of nitrogen
application, defoliation intensity and
defoliation frequency on the yield and feeding

value of Panicum maximum Jacq (Guinea A)


fodder. Beitrage Zur Tropischen
Landwirtshaft und Veterinarmedizin. 22:
383-389.
Hongyantarachai, S., G. Nithichai, N. Wongsuwan,
S. Prasanpanich, S. Siwichai, S. Pratumsuwan,
T. Tasapanon and B. R. Watkin.1989. The
effects of grazing versus indoor feeding during
the day on milk production in Thailand. Trop.
Grassl. 23: 8-14.
Kasantikul, V. 1993. Studies on yield and quality
of some tropical pasture grasses and
legumes at different stage of growth. M.S.
thesis. Kasetsart University, Bangkok.
Milford, R. and D. J. Minson, 1966. The feeding
value of tropical pasture,. pp.106-114 In E.
W. Davies and C. L. Skidmore. (eds.).
Tropical Pastures. Faber and Faber, London
Phaikaew C. and P. Pholsen. 1993. Ruzi grass
(Brachiaria ruziziensis) seed production and
research in Thailand. In C. Chen and C.
Statjipanon (eds.). Strategies for suitable
forage based livestock production in Southeast
Asia. Proc. of the 3rd meeting of regional
working group on grazing and feed
resources of Southeast Asia 31 January 6
February 1993, Khon Kaen Thailand.
SAS institute Inc., 1996. SAS/ STAT Users
Guide, Release 6.12 edition. Statistical
analysis systems institute inc., Cary, NC, USA.
Skerman, P. J. and F. Riveros.1990. Tropical
Grasses. FAO. Plant production and
protection series No. 29. Rome. 832 p.
Sukkagate, S. 1994. Effects of defoliation
frequency on yield and quality of four
different growth habit grasses. M. S. Thesis.
Kasetsart University, Bangkok.
Tiley G. E. D. 1989. Factors affecting the
productivity of elephant grass. Proc. of the
XVI international grassland congress, Nice,
France, 599-60.
Tudsri S. and C. Kaewkunya. 2002. Effect of
leucaena row spacing and cutting intensity on

Kasetsart J. (Nat. Sci.) 38 (4)

the growth of leucaena and three associated


grasses in Thailand. Asian Aust. J. Anim.
Sci. 15 (7): 986-991.
Tudsri S., T. Jorgenson, P. Ridach and A.
Pookpakdi. 2002. Effect of cutting height and
dry season closing date on yield and quality of
five napier grass cultivars in Thailand. Trop.
Grassl. 36: 248-252.
Tudsri, S. and Kangsanor, M. 1994. Effect of
water stress and cutting height on dwarf napier

467

Grass (Pennisetum purpureum CV. Mott).


Paper presented at the 32nd Kasetsart
University Conference 3-5 February 1994,
Bangkok, Thailand.
Tudsri, S. 1986. A study of the effects of
defoliation and water stress on growth and
development of Stylosanthes hamata (L.)
Taub. CV. Verano. Ph.D. Thesis, Massey
University.

Kasetsart J. (Nat. Sci.) 38 : 468 - 474 (2004)

Rescue of Peach Embryo in Culture Media with Additional


of 6-benzylademine and Gibberellic Acid
Nonglak Jeengool1 and Unaroj Boonprakob2

ABSTRACT
Culture media and plant growth regulators (PGRs) are important factors for successful embryo
rescue. Four medium formulas: Brooks and Hough (BH), Woody Plant (WP), Gilmore, and Monet, were
compared for their effects on rescuing immature embryo of peach and later development into seedlings.
The results indicated that all media allowed embryos to continue their development and generated high
percent germination ( >80%). Seedlings germinated in WP and BH were significantly larger in size than
those in either Monet or Gilmore. Survival rate of transplanted seedlings was highest in WP (54.4%).
Overall observation pointed to WP as the best culture medium in rescuing immature peach embryos. In
the following experiment, the response of immature embryos to PGRs: BA and GA3, in WP was evaluated
for germination and seedlings formation. Most embryos germinated well (>85%) with or without PGRs;
however, resulting seedlings showed much difference. Numbers of seedling with dead shoot tips were
much lower when either or both PGRs were added in the medium. The results showed that WP with 0.1
mg/l GA3 and either 0.5 or 1.0 mg/l BA yielded 100% germination and no rosetting seedlings. Significant
linear responses (P = 0.04) of seedling height and quadratic responses (P = 0.03) of seedling dry weight
were observed with GA3. Seedlings showed significant linear response (P < 0.01) with BA for their leaf
number, but total leaf area remained comparable. Positive correlations between seedling dry weight with
root length (r = 0.23), root number (r = 0.49), leaf number (r = 0.24) and leaf area (r = 0.3) were significant,
while that between dry weight and seedling height was not significant.
Key words: in vitro, embryo culture, plant growth regulator, breeding, Prunus persica (L.) Batsch

INTRODUCTION
Annual production of dessert and processing
type peach in Thailand was approximately 20-30
and 400-500 metric ton, respectively. Ripening
season of dessert type peach extends from late
March to late April in which most fruits come to
market in mid-April. Peach fruit ripening in late
March gets higher price because there is no

1
2

competition of tropical fruits such as durian and


rambutan during the same period. Therefore, any
early ripening peach variety gets advantages of
marketing window and high profit.
The early ripening trait in peach is
genetically controlled and is an important objective
in many stonefruit breeding programs (Ramming,
1993; Anderson and Byrne, 2001). Crosses
between both early ripening parents could generate

Department of Agriculture, Ministry of Agriculture and Cooperatives, Muang District, Sakon Nakhon 47000, Thailand.
Department of Horticulture, Faculty of Agriculture Kamphaengsaen, Kasetsart University, Kamphaengsaen Campus, Nakhon
Pathom 73140, Thailand. e-mail: unaroj.b@ku.ac.th

Received date : 27/05/04

Accepted date : 08/09/04

Kasetsart J. (Nat. Sci.) 38 (4)

greater proportion of progeny with this trait


resulting in better chance of making new selections.
However, hybrid seeds from these parents
germinated poorly due to their immature embryos
or embryo abortion when fruits are ripe (Turkey,
1933). Embryo rescue is necessary to recover
viable hybrid seeds and allows embryos to continue
growing to seedling stage. Embryo culture was
successfully performed by Turkey (1933) in sweet
cherry and since then much research work has
been conducted to optimize embryo culture
technique in several crops.
Successful embryo rescue depends on a
culture medium, developmental stage of embryo
and culture conditions (Chaparro and Sherman,
1994; Kuden et al., 1999). Embryos were
successfully cultured in several media such as
Gilmore and Monet media (George et al., 1987),
Brooks and Hough medium (Scorza and Sherman,
1996) and Woody Plant medium (Emershad and
Ramming, 1994). In addition, plant growth
regulators enhance embryo growth. Kuden et al.
(1999) reported the beneficial effect of BA and
GA3 on the development of embryo and seedling
germination. Koukhartehik and Semenas (2000)
found that media with BA and GA3 produced good
shoots and those with only GA3 stimulated good
rooting. For a particular variety, developmental
stage of embryos when fruits are ripe depends on
climatic conditions where the trees are grown,
therefore, successful reports of embryo culture in
one place may not confirm similar results in another
place (Scorza and Sherman, 1996). In Thailand,
embryo culture in peach has not been accomplished
and there is a need for this technique in developing
early ripening peach variety. The objectives of
this research were to compare the effects of culture
media on rescuing immature embryos and to
evaluate the response of immature embryos to BA
and GA3 added in culture medium.

469

MATERIALS AND METHODS


Comparison of culture media
Four culture medium formulas, Brooks and
Hough (1958), Woody Plant (Lloyd and McCown,
1981), Gilmore (1950), and Monet (1968), were
used to compare the growth and development of
EarliGrande peach embryos. The media were
prepared with 2% sucrose, 0.65% agar and adjusted
pH to 5.7. Approximately 15-20 ml of media was
added into 100 ml wide-mount food jars and
autoclaved at 121C for 15 min.
Firm ripe fruits were collected in midApril in 2000 from Angkhang Royal Agricultural
Station, Chiang Mai. Fruits were surfaced sterilized
in 1.2% sodium hypochloride for 15-20 min. and
seeds were aseptically removed from endocarp.
Seedcoat was peeled off and an embryo (hylum
side) was placed into culture media. One hundred
and forty-two replications (one embryo per jar)
were set for each medium.
Jars containing embryo cultures were stored
at 2-4C in the dark for 10 weeks for stratification,
then they were transferred to a culture room (16 h
photoperiod with white fluorescent at 23C) for 4
weeks and germination number was recorded.
Ten jars were randomly selected from each medium
to determine their seedling properties, i.e., plant
height, leaf number, lateral root number, lateral
root length, fresh weight and dry weight. All
seedlings were transplanted into a sterile growing
medium (1 sand : 1 peat moss, v:v) and kept in the
culture room for 7 weeks. Survival rate was
determined, then 10 vigorous seedlings were
selected from each medium and recorded for plant
height, leaf number and leaf area. The Statistical
Analysis System (SAS) general linear model
procedure was used to analyze the data and the
Duncans New Multiple Range Test (DMRT) was
performed to compare the effect of each medium.

470

Kasetsart J. (Nat. Sci.) 38 (4)

Response of embryos to 6-benzylademine (BA)


and gibberellic acid (GA3)
After the best medium was selected,
additional of BA at three concentrations: 0, 0.5 and
1.0 mg/l and GA3 at three concentrations: 0, 0.1
and 0.2 mg/l were included in this selected medium.
The medium with BA was sterilized in an autoclave,
then GA3 stock filtered through 0.2 m cellulose
nitrate membrane was later added. The 33
factorial experiment in CRD was arranged in 2001.
Fifty embryos (50 replications) were done for each
treatment combination. Embryos were stratified
and raised in similar conditions as previously
described. Data was collected in the same manner
except no survival rate of seedling after
transplanting into growing medium was recorded.
The SAS general linear procedure was used to
analyze the data. Contrast analysis was used to test
for significant response of embryo development to
plant growth regulators. Seedling parameters were
analyzed using correlation analysis.

than those in BH, Gilmore or Monet media (Table


1). The better performance of WP was similar to
other reports on peaches and nectarines having
approximately 90-100% germination rate
(Emershad and Ramming, 1994; Rizzo et al.,
1998). The resulting seedlings in WP and BH
media were significantly taller and had more fresh
weight than those cultured in Monet or Gilmore
media (Table 1 and Figure 1). No significant
difference was detected in the other growth
parameters such as leaf number and root growth.
Seven weeks after transplanting, seedlings from
WP had the highest survival rate and other growth
parameters were significantly greater (Table 2).
The vitamins and amino acids included in WP
seemed to enhance the seedling growth. The
beneficial effects of vitamins and amino acids on
development of immature embryo were observed
in several plant species (Raghavan, 1994). In
addition, its lower salt concentration than that in
BH permitted greater root development in peaches
and nectarines (Emershad and Ramming, 1994).

RESULTS AND DISCUSSION


Comparison of culture media
In this experiment, the seeds had
approximately 13% dry weight. All four medium
formulas gave more than 80% germination rate
and embryos cultured in WP germinated better

Response of embryos to 6-benzylademine (BA)


and gibberellic acid (GA3)
In this experiment, the seeds had
approximately 15% dry weight. Embryo
germination rate was greater than 85% with or
without both PGRs. One hundred percent

Table 1 Germination rates and seedling growth parameters in culture media after 4 weeks in culture
room.

Medium

Germination
rate (%)

BH
WP
Monet
Gilmore

84.5
88.7
80.3
80.3

P < F-test
1/

Weight1/ (g)
Fresh
Dry

Height1/
(cm)

Leaf
number

Lateral root
Number Length (cm)

0.55 a
0.53 a
0.35 b
0.44 ab

0.073
0.074
0.062
0.064

4.1 a
4.4 a
2.7 b
3.2 ab

9.2
6.3
6.9
6.7

5.4
6.2
4.3
3.4

0.01

0.47

0.02

0.38

0.25

12.6
13.8
9.8
10.5
0.78

Values within a column followed by a different letter are significantly different at the 95% confident level using DMRT

471

Kasetsart J. (Nat. Sci.) 38 (4)

Figure 1 Seedlings of EarliGrande peach resulted from embryo rescue on four media: Woody Plant
(WP), Brooks and Hough (BH), Monet, and Gilmore.
Table 2 Survival rate and growth parameters of seedlings seven weeks after transplanting.
Medium

Survival rate (%)

Height1/ (cm)

Leaf number1/

BH
WP
Monet
Gilmore

33.8
54.4
35.2
33.8

4.3 b
5.8 a
4.0 b
3.9 b

11.6 ab
14.1 a
10.0 b
11.0 ab

1/

Leaf area1/ (cm2)


4.7 a
5.2 a
2.1 b
3.2 b

Values within a column followed by a different letter are significantly different at the 95% confident level using DMRT

germination rate was observed with embryos in


0.1 mg/l GA3 plus either 0.5 or 1.0 mg/l BA (Table
3). Seedlings grown with neither BA nor GA3
developed higher incident of dead shoot indicating
that these seedlings might be weaker and became
more sensitive to desiccation. Increasing BA
concentration was associated with increasing
number of seedlings with small leaf. No obvious
effect of PGRs on the number of normal and
rosetting seedlings was detected during four weeks
in culture.
Interaction effect of the PGRs was
significant on leaf number (Table 4) in which
increasing GA3 concentrations at 0.5 mg/l BA had
positive effect but increasing GA3 concentrations

at 1 mg/l BA had negative effect (Figure 2). Leaf


number was also increased linearly with the amount
of BA used, however, these leaves were smaller in
size and total leaf area per seedling was not
increased. Significant effect of GA3 on seedling
dry weights and heights was observed. Dry weight
had quadratic response to the amount of GA3 and
the highest value was obtained at 0.1 mg/l. Taiji et
al. (2002) suggested that total plant dry weight
was an appropriate measurement for plant growth
in vitro. In this experiment seedling height
responded linearly to the amount of GA3, known
to enhance cell elongation and hence made the
distinctive difference in height of those treated
with high concentrations of GA3. Nonsignificant

472

Kasetsart J. (Nat. Sci.) 38 (4)

Table 3 Effects of BA and GA3 in WP on embryo germination and seedling condition.


Treatment combination
BA (mg/l)
GA3 (mg/l)
0
0
0
0.5
0.5
0.5
1.0
1.0
1.0

Germination
rate (%)

Normal

91
86
97
94
100
91
94
100
97

69
90
73
82
71
87
65
88
70

0
0.1
0.2
0
0.1
0.2
0
0.1
0.2

Seedling condition (%)


Rosetting
Small leaf
3
7
6
0
0
0
0
0
3

9
0
3
6
20
13
27
9
27

Dead shoot
16
3
18
12
9
0
3
3
0

Table 4 Seedling growth parameters on WP with BA and GA3.

Factor

Height
(cm)

Weight (g)
Fresh
Dry

BA (mg/l)
0
0.5
1.0

2.7
3.3
3.3

0.806
0.881
0.892

Linear
Quadratic

0.06
0.27

0.22
0.60

GA3 (mg/l)
0
0.1
0.2

2.7
3.2
3.4

0.766
0.932
0.880

Linear
Quadratic

0.04
0.59

BA and GA3

0.05

Leaf
Number Area (cm2)

Lateral root
Number Length (cm)

0.087
8.4
0.63
0.094
14.2
0.60
0.093
18.1
0.58
Probability of contrast analysis
0.36
<0.01
0.91
0.59
0.80
0.96

10.4
8.7
8.4
0.11
0.54

0.83
0.32

9.0
9.0
9.5

5.9
7.3
6.8

0.11
0.08

0.081
12.7
0.60
0.100
15.1
0.70
0.092
13.1
0.50
Probability of contrast analysis
0.14
0.59
0.31
0.03
0.08
0.11

0.67
0.78

0.38
0.29

0.86

Probability of interaction effect


0.79
<0.01
0.55

0.92

0.58

effect of PGRs was observed on other growth


parameters.
Because dry weight was the best indication
of in vitro growth, statistical correlation was

6.5
7.3
6.2

analyzed between dry weight with other growth


parameters: height, average lateral root length,
lateral root number, leaf number and leaf area.
Significant correlation coefficient (r) was detected

473

Kasetsart J. (Nat. Sci.) 38 (4)

Leaf number
30

20
BA 0 mg/l
BA 0.5 mg/l
BA 1.0 mg/l

10

0
0

0.1

0.2

GA3 (mg/l)

Figure 2 Interaction effect of BA and GA3 on leaf number.


between dry weight with average lateral root length
(r = 0.23; P = 0.02), lateral root number (r = 0.49;
P < 0.01), leaf number (r = 0.24; P = 0.02) and leaf
area (r = 0.3; P < 0.01). This indicated that an
increase in dry weight was a result of an increase
of lateral root number, root length, leaf number
and leaf area but seedlings height. These growth
parameters significantly correlated with dry weight
were vital for seedling survival.

ACKNOWLEDGEMENTS
The authors wish to express their
appreciation to the Royal Project Foundation and
Center for Agricultural Biotechnology under the
Science and Technology Higher Education
Development Project for financial support of this
research work.
LITERATURE CITED

CONCLUSION
Immature embryos of peach from seeds
having about 13-15% dry weight could be
successfully rescued and stimulated to develop in
vitro to seedlings using different culture media.
The most suitable medium for best germination
and survival rate was WP medium. The PGRs had
beneficial effects on embryo growth and
development. Adding BA (1.0 mg/l) and GA3 (0.1
mg/l) resulted in 100% germination, prevented
rosetting and improved seedling growth. Increasing
in seedling dry weight was positively associated
with lateral root number, lateral root length, leaf
number and leaf area.

Anderson, N. and D.H. Byrne. 2001. Cooler


temperate during germination improves
germination and survival of embryo cultured
peach seed. Acta Hort. 592: 25-27.
Brooks, H.J. and L.F. Hough. 1958. Vernalization
studies with peach embryos. Proc. Amer.
Soc. Hort. Sci. 71: 95-102.
Chaparro, J.X. and W.B. Sherman. 1994. Culture
date and germination procedure effects success
of nectarine ovule and embryo culture. Fruit
Var. J. 48: 173-175.
Emershad, R.L. and D.W. Ramming. 1994. Effect
of media on embryo enlargement in earlyripening genotypes of Prunus growth in vitro.

474

Kasetsart J. (Nat. Sci.) 38 (4)

Plant Cell, Tissue and Organ Cult. 37: 5559.


George, E.F., D.J.M. Puttock and H.J. George.
1987. Plant Culture Media Volume 1:
Formulation and Uses. Exegitics Limited,
England. 567p.
Gilmore, A.E. 1950. A technique for embryo
culture of peaches. Hilgardia 20: 147-170.
Koukhartehik, N.V. and S. Semenas. 2000.
Embryo culture in Prunus L. breeding. Acta
Hort. 538: 663-665.
Kuden, A.B., E. Tanriver, H. Gulen and S.
Buyukalaca. 1999. Embryo rescue of peach
hybrids. Acta Hort. 484: 531-533.
Lloyd, G. and B. McCown. 1981. Commerciallyfeasible micropropagation of mountain laurel
Kalmia latifolia, by use of shoot-tip culture.
Comb. Proc. Intl. Plant Prop. Soc. 30: 421427.
Monet, R. 1968. Methode permettant l obtention
de plantes viables a partirdembryos de
varieties tris pricoces chez le peach. Ann.
Amelior. Plantes 18: 85-91.
Raghavan, V. 1994. In vitro methods for the
control of fertilization and embryo

development, pp. 173-194. In I.K. Vasil and


T.A. Thorpe (eds.). Plant Cell and Tissue
Culture. Kluwer Academic Publishers,
Dordrecht.
Ramming, D.W. 1983. Embryo culture, pp. 136144. In J.N. Moore and J. Janick (eds.).
Methods in Fruit Breeding. Purdue Univ.
Press, West Lafayette, Indiana.
Rizzo, M., D. Bassi, D. Byrne and K. Porter. 1998.
Growth of immature peach [Prunus persica
(L.) Batsch] embryos on different media. Acta
Hort. 465: 141-144.
Scorza, R. and W.B. Sherman. 1996. Peach, pp.
325-440. In J. Janick and J.N. Moore (eds.).
Fruit Breeding Volume 1: Tree and
Tropical Fruit. John Wiley & Sons, New
York.
Taiji, A., P.P. Kumar and P. Lakshmanan. 2002.
In vitro Plant Breeding. Food Product Press,
An Imprint of The Haworth Press, New York.
167 p.
Tukey, H.B. 1933. Growth of the peach embryo
in relation to growth of fruit and season of
ripening. Proc. Amer. Soc. Hort. Sci. 30:
209-218.

Kasetsart J. (Nat. Sci.) 38 : 475 - 483 (2004)

Morphology and Biology of Phyllocoptes azadirachtae Chandrapatya


(Acari : Eriophyidae)
Pavinee Noochanapai and Angsumarn Chandrapatya

ABSTRACT
Phyllocoptes azadirachtae Chandrapatya belongs to Family Eriophyidae, Suborder Actinedida.
The scanning electron photographs of dorsal shield, genitalia, microtubercle and featherclaw are
presented. This mite is able to feed and reproduce on 3 neem plants; Azadirachta indica Juss. siamensis
Val. (Sadao-Thai), Azadirachta indica Juss. (Sadao-India) and Azadirachta excelsa (Jack) Jacobs
(Sadao-Chang). Sadao-Thai is proved to be the most suitable host for P. azadirachtae judging from low
mortality rate during development (7%), short life cycle (7.8 days) and high fecundity (21.8 eggs/female).
Key words: Phyllocoptes azadirachtae, neem, eriophyid mite, morphology, biology

INTRODUCTION
Eriophyoids are the smallest phytophagous
mites, ranging in length from 80 to 300 m. Most
eriophyoids are host specific, causing galls, erinea,
russetting and leaf or shoot deformation, and many
species are leaf vagrants (Keifer, 1952; Jepson et
al., 1975; Chandrapatya and Baker, 1986). Three
species of eriophyoid mite were recorded feeding
on Sadao India (Azadirachta indica Juss.) namely
Phyllocoptes azadirachtae Chandrapatya,
Diptilomiopus azadirachtae (Boczek) and
Calepitrimerus azadirachtae Channabasavanna
(Channabasavanna, 1966; Boczek and
Chandrapatya, 1992, 1993).
In 1966
Channabasavanna reported that C. azadirachtae
lived as a vagrant on the tender shoot not on the
leaves. In addition, premature leaf falling was
probably induced by this mite. Ten years later, C.
azadirachtae was one of the most serious pest of
neem in India (Uthamasamy et al., 1973).

In Thailand, D. azadirachtae was reported


as a vagrant mite where P. azadirachtae caused
russetting on the lower leaf surface (Boczek and
Chandrapatya, 1992, 1993). Sombatsiri et al.
(1995) reported that young neem leaves infested
by eriophyoid mites might become malformed and
dried up while old leaflets became yellowish and
dropped. Preliminary surveys of the neem mite in
several parts of Thailand revealed that P.
azadirachtae was commonly found on 3 varieties
of neem, Azadirachta indica Juss. siamensis Val.
(Sadao-Thai), Azadirachta indica Juss. (SadaoIndia) and Azadirachta excelsa (Jack) Jacobs
(Sadao-Chang). Heavy mite infestation on the old
leaves induced russetting on both leaf surfaces
whereas malformation usually occurred mainly on
the young shoot.
Eriophyoids develop from egg through two
nymphal instars to adult. The immature stages are
sometimes referred to as larval or nymphal, or the
first instar may be called a larva and second instar

Department of Entomology, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand.

Received date : 03/08/04

Accepted date : 20/09/04

476

Kasetsart J. (Nat. Sci.) 38 (4)

a nymph (Lindquist, 1996). However, information


on biology of the neem mite has not been available
in the literature.
Studies on the external structures of
eriophyoid mite began with the remarkable work
of Nalepa (1887) where he produced his
observations on these minute mites with the light
microscope available at that time. With modern
day phase contrast and differential interference
phase contrast microscopes, more detailed
morphological information has been accumulated
on eriophyoids (Keifer, 1952, 1959; Krantz, 1973).
However, some structures still require higher
resolution, so scanning and transmission electron
microscopy are being used to reveal both external
and internal morphology of eriophyoid mites
(Nuzzaci, 1979; Chandrapatya and Baker, 1986;
Petanovic and de Lillo, 1992; Huang, 2001).
Unfortunately morphological characters of P.
azadirachtae have never been investigated under
these types of microscope.
The external morphology of adult P.
azadirachtae emphasising on the dorsal shield,
cuticular sculpturing, genitalia and leg were
investigated along with biology, longevity and
fecundity of this mite under laboratory conditions.
MATERIALS AND METHODS
External morphology study
Adult mites were fixed overnight in calcium
formaldehyde at 4C. After washing in distilled
water, the specimens were post-fixed in 1% osmium
tetroxide for 24 h at 4C. After the specimens were
rinsed 3 times with distilled water, they were
placed in plastic containers made from BEEM
capsules. The BEEM capsules were cut about
halfway to form a 57 mm cylinder. Each open
end was then covered with filter paper held in
place by BEEM capsule lids with the center
removed. This facilitated liquid exchange during
dehydration and critical point drying and also
prevented the loss of specimens during processing.

Specimens in the plastic containers were


dehydrated in a graded series of ethanol (30, 50,
70, 90, 100 and 100%) and then transferred to a
Balzers Union CPD 020 Critical Point Dryer. The
dried specimens were attached to brass stubs with
double-sided sticky tape and coated with goldpalladium in Balzers Union SCD040 Coater. The
specimens were viewed with a Jeol JSM-5410 LV
Scanning Electron Microscope at 15 KV and
images were recorded on Kodak VP 100 film.
Life history study
The life history study of P. azadirachtae
was conducted in the laboratory on leaves of A.
indica siamensis, A. indica and A.excelsa collected
at Kasetsart University. Each leaflet (1 cm in
diameter) was placed upside down on moisten
cotton pads in a 10242 cm plastic box, with 14
equal cells of 5.551 cm, to maintain the vitality
of the leaf. Any leaf that showed signs of
deterioration was replaced with a new one. The
plastic boxes were kept in the incubator set at
282C and 584% R.H. Ten female mites were
introduced on each individual leaf. All mites were
removed after 24 h and only 1 egg was allowed to
stay on each leaflet. The observation was made
every 6 h until all mites reached adulthood. The
number of stages and time required for each
developmental stage was recorded.
Longevity and fecundity of unmated female
A female imagochrysalis was placed on
each neem leaflet resting on moisten cotton pad.
The mites were subjected to temperature 282C
and 584% R.H. Each leaflet was checked every
6 h for adult eclosion and leaf surfaces were
checked daily for egg deposited during the previous
24 h until adult death. Three neem varieties were
also tested in this experiment.
Data from biology, longevity and fecundity
studies were subjected to ANOVA using SAS
program and Lsd was employed to separate the
treatment means.

Kasetsart J. (Nat. Sci.) 38 (4)

RESULTS AND DISCUSSION


External morphology of Phyllocoptes
azadirachtae (Figure 1 and 2)
The body of P. azadirachtae is fusiform
and exhibits the three standard acarine body
regions: the gnathosomal region with the
mouthparts, the podosoma with only 2 pairs of

477

legs and the opisthosoma with the genital region


situating on the anterior part (Figure 2a). A pair of
typical antapical setae is located on gnathosoma.
Dorsal shield of P. azadirachtae is a flattened,
subtriangular with net-like pattern (Figure 1a).
The anterior portion of the dorsal shield forms a
broad-based lope over rostrum. Numerous granules
are located on the underneath of dorsal shield that

Figure 1 External structures of Phyllocoptes azardirachtae Chandrapatya a) dorsum of dorsal shield,


b) lateral of dorsal shield, c) female genitalia and d) male genitalia.

478

Kasetsart J. (Nat. Sci.) 38 (4)

can be seen clearly on lateral view (Figure 1b).


Dorsal tubercles situate slightly ahead of rear
shield margin. Scapular setae are typical in shape,
short and point up.
Both female and male genitalia protrude
from the anterior part of opisthosoma, close but
not appress to the second coxae. Female genital
coverflap covers the genital opening which is a

transverse slit. The coverflap open posteriorly and


approximately 12-14 distinct longitudinal lines
are presented on each flap (Figure 1c). The male
genitalia has a genital shield open anteriorly. A
pair of peg-like structure are situated on the anterior
margin of the genital shield. The proximal part of
this shield, posterior to these structures, is covered
with granules (Figure 1d). Legs of P. azadirachtae

Figure 2 External structures of Phyllocoptes azardirachtae Chandrapatya a) dorsum of female , b)


featherclaw and solenidion, c) dorsal microtubercle and d) ventral microtubercle.

479

Kasetsart J. (Nat. Sci.) 38 (4)

consist of 6 segments. Both coxal fields are


covered with granules. Three pairs of coxal setae
and all leg setae are presented. The featherclaw is
a four-rayed structure and the solenidion ended in
a bulb-like structure (Figure 2b).
The opisthosoma is composed of 28-30
tergites and 62-69 sternites. The dorsal sculptural
elements, microtubercles, are indistinct, oval in
shape and situated on the ring margin (Figure 2c).
The ventral microtubercles are triangular or pointed
and locate on the posterior margin of the sternites
(Figure 2d).
All external features examined under
Scanning Electron Microscope are similar to the
work of Boczek and Chandrapatya (1992) but the
details of dorsal shield, coxal field and
microtubercles can be seen more clearly in the
SEM photographs.
Life history of Phyllocoptes azadirachtae
Phyllocoptes azadirachtae was reared on

leaflets of 3 neem species at 282C, 584%R.H.


Each mite passed through 3 developmental stages
consisting of the egg, larval and nymphal stages
before adult emergence. Two quiescent stages
known as the nymphochrysalis and imagochrysalis
preceeded the nymphal and adult stages.
Developmental periods of P. azadirachtae on each
host plant are presented in Table 1.
Female mites deposited eggs singly on leaf
surface, preferably near the midrib. Newly laid
eggs were light cream in color and gradually
turned to light red or red before hatching. The
incubation period of P. azadirachtae on A. excelsa
(3.69 0.65 days) was significantly shorter than
those on A. siamensis and A. indica (4.00 0.31
and 4.11 0.75 days). A newly-hatched larva was
light red in color with 2 pairs of legs. Feeding
usually occurred immediately after hatching,
consequently, the body color changed into dark
red. The larval periods significantly differed on 3
neem species, with the longest on A indica (1.82

Table 1 Duration of each developmental stage of Phyllocoptes azadirachtae Chandrapatya on 3


different neem species under laboratory conditions (282C and 584%R.H.).
Developmental stages

Egg
n
Larva
n
Nymphochrysalis
n
Nymph
n
Imagochrysalis
n
Life cycle
(egg-adult)
n
*

A. indica siamensis
(Sadao-Thai)

MeanS.D* (days)
A. indica
(sadao-India)

A. excelsa
(Sadao-Chang)

4.000.31 a
104
1.230.18 c
102
0.780.24 a
99
1.050.33 c
98
0.740.22 b
97

4.110.75 a
48
1.820.56 a
31
0.880.56 a
31
2.380.71 a
25
0.930.22 a
23

3.690.65 b
60
1.380.33 b
43
0.790.20 a
39
1.340.37 b
37
0.760.09 b
36

7.800.64 b
97

9.381.12 a
23

7.910.83 b
36

Means in the same row not followed by same letters are significantly different (p<0.05) as determined by Lsd.

480

Kasetsart J. (Nat. Sci.) 38 (4)

0.56 days) followed by 1.38 0.33 days on A.


excelsa and 1.23 0.18 days on A. indica siamensis.
The leaflets of A indica and A. excelsa were not
found to be suitable for P. azadirachtae larval
development since 35.42 and 28.33% larval
mortalities were recorded as compared to only
4.59% observed on A. indica siamensis leaflets.
The full grown larvae then entered the
resting period called the nymphochrysalis in which
larva stopped feeding and the new cuticle was
formed under the old cuticle. The shiny surface on
the old cuticle clearly indicated the time of ecdysis.
This resting stage lasted approximately 0.78-0.88
days on the 3 neem species before molting to
nymph. The second instar or nymph was relatively
large and red in color. This stage was more active
and prefered to move along both sides of midrib.
Approximately 19% and 5% of nymphs died on A.
indica and A. excelsa leaflets. P. azadirachtae
developed significantly faster on A. indica
siamensis (1.05 0.33 days) than those on A.
excelsa (1.34 0.37 days) and A. indica (2.38
0.71 days). The last resting stage, imagochrysalis,
of P. azadirachtae lasted 0.74 - 0.93 days.
Adults emerged from imagochrysalis were
fusiform, active, and red in color. They gradually
increased in size and their color changed to deep
red. P. azadirachtae was able to complete its
development on 3 neem species. The life cycle of
P. azadirachtae reared on A. indica was
significantly longer (9.38 1.12 days) than those
on A. excelsa (7.91 0.83 days) and A. indica
siamensis (7.80 0.64 days). A total of 89% of P.
azadirachtae completed their life cycle on A.
indica siamensis leaflets where only 42 and 58%
of those mites reared on A. indica and A. excelsa
leaflets developed successfully into adult stage.
Percentage of egg hatch was considerably
high (95-96%) when the mites were reared on A.
indica siamensis and A. excelsa leaflets where
only 88.89% of egg was hatched on A. indica
leaflets. The egg of P. azadirachtae gradually
changed to deeper color as recorded on other mite

species, such as Eriophyes laevis Nalepa


(Shevchenko, 1975) and Tegolophus artocarpi K
(Ghosh and Chakrabarti, 1989). P. azadirachtae
eggs on 3 neem species hatched within 3.69- 4.00
days at 28C, which was quite longer than 2.39 and
3.04 days of Coptophylla caroliniani Chandrapatya
& Baker and Aceria mississippiensis Chandrapatya
& Baker at 29C (Chandrapatya and Baker, 1986).
This could be due to the incubation period which
increased as temperature decreased (Dobrivojevic
and Petanovic, 1985; Westphal et al., 1990; Shi,
2000). However, egg period of Aculus fockeui
(Nalepa & Trouessart) and T. artocarpi required
3-5 days at 17-19C and 4.29 days at 24C (Huang
et al., 1994; Ghosh and Chakrabarti, 1989) which
was similar to this finding.
Larvae fed on cell contents immediately
after hatching which was similar to C. caroliniani
and A. mississippiensis (Chandrapatya and Baker,
1986), but differed from T. artocarpi that remained
inactive for about 6 h (Ghosh and Chakrabarti
1989). The study indicated that the larval periods
of P. azadirachtae averaged 1.23 1.82 days
which was longer than 0.78 and 1.08 days of C.
caroliniani and A.mississippiensis at 29C
(Chandrapatya and Baker, 1986) However,
Westphal et al. (1990) reported that larvae of Aeria
cladophthirus (Nalepa) required 2-3 days to
develop at 18-24C and T. artocarpi larvae required
2.95 days at 24C (Ghosh and Chakrabarti, 1989)
which was contrast with this finding due to lower
temperature.
Immature stages are usually similar to adults
in appearance, but are smaller in size and lack
external genitalia (Lindquest, 1996). The nymph
of P. azadirachtae developed successfully within
1.05-2.38 days which was faster than 3.03 days of
T. artocarpi at 24C (Ghosh and Chakrabarti,
1989) and 4-5 days of A. cladophthirus at 18-24
C (Westphal et al., 1990). However, nymphs of C.
caroliniani and A. mississippiensis needed only
0.54-0.80 days at 29C to complete their
development (Chandrapatya and Baker, 1986).

481

Kasetsart J. (Nat. Sci.) 38 (4)

P. azadirachtae completed its development


within 7.8 9.3 days at 28C which was longer
than 4.81 and 6.64 days of C. caroliniani and A.
mississippiensis at 29C (Chandrapatya and Baker,
1986) and shorter than 10-12 days of T. artocarpi
at 24C (Ghosh and Chakrabarti ,1989) and 11-15
days of A. cladophthirus at 18-24C (Westphal et
al., 1990).
Longevity and fecundity
Longevity and fecundity of P. females on 3
neem species are shown in Table 2. P. azadirachtae
reared on A. indica lived significantly longer (15.24
days, ranging 10-21 days) than on A. indica

siamensis (13.06 days) and on A. excelsa (12.06


days). Male mites lived considerably shorter than
females in all treatments (averaged 9.55 10.36
days). Female mites on A. indica siamensis laid
the first egg after being adult for 0.63 0.39 days
while those reared on A. excelsa and A. indica
needed 0.81 0.49 and 1.68 0.95 days,
respectively. The longest oviposition period (11.28
1.55 days) was observed on A. indica siamensis
where the highest egg production of 21.81 4.18
eggs/female and 1.95 0.41 eggs/female/day were
noted. This results clearly indicated that A. indica
siamensis was the most suitable host plant for
rearing P. azadirachtae. Mites cultured on A.

Table 2 Longevity and fecundity of Phyllocoptes azadirachtae Chandrapatya on 3 different neem


species under laboratory conditions (281C and 58 4%R.H.).
Parameters

Pre-oviposition Period
range
n
Oviposition Period
range
n
Post-oviposition Period
range
n
Egg/female
range
n
Egg/female/day
n
Female longevity
range
n
Male longevity
range
n
*

A. indica siamensis
(Sadao-Thai)

MeanS.D* (days)
A. indica
(Sadao-India)

A. excelsa
(Sadao-Chang)

0.630.39 b
(0.5 2.0)
16
11.281.55 a
(8.5 14.0)
16
1.221.00 b
(0.5 3.0)
16
21.814.18 a
(12 25)
16
1.950.41 a
16
13.061.65 b
(10 15)
16
10.362.01 b
(8 15)
6

1.680.95 a
(0.5 4.0)
17
8.532.99 b
(3 13.0)
17
5.032.61 a
(0.5 10.0)
17
7.653.46 c
(3 15)
17
0.920.30 c
17
15.243.13 a
(10 21)
17
11.892.85 a
(8 16)
9

0.810.49 b
(0.5 2.0)
18
8.941.98 b
(5.5 13.0)
18
2.312.11 b
(0.5 7.0)
18
12.442.85 b
(8 17)
18
1.410.26 b
18
12.063.19 b
(7 17)
18
9.552.82 b
(7 15)
20

Means in the same row not followed by same letters are significantly different (p<0.05) as determined by Lsd.

482

Kasetsart J. (Nat. Sci.) 38 (4)

indica lived considerably longer on the host plant,


but the egg production was very low (only 0.92
0.30 eggs/female/day) and the egg-laying period
was also short (8.53 2.99 days). Therefore, total
egg production was lower than those mites on the
other 2 host plants. In addition, mites on A. indica
leaflets also had long post-oviposition period which
in turn affected the number of egg production in
total as well.
Many workers reported that temperature
affected mite longevity. Chandrapatya and Baker
(1986) reported that A. mississippiensis female
had a longevity of 30.4 days as compared to 34.9
days for C. caroliniani at 25C. The pre-oviposition
period was also depended on the temperature. Shi
(2000) indicated that E. gibbosus had a preoviposition period of 2.85 days at 22.6C (2.85
days), Boczek et al. (1984) found that the
oviposition period of A. fockeui was 28 days at 28
C which was considerably higher than all
experiments in this study. Moreover, E. gibbosus
at 22.6C laid only 8.4 egg/female (Shi, 2000)
where Phyllocoptruta oleivora (Ashmead) at 27
C produced 15.4 eggs/female (Allen et al., 1995)
which was in the same range as this study. However,
Wahba et al. (1985) reported that Aceria tulipae K
laid 44 eggs/female at 26C which was much
higher than those of P. azadirachtae in all
treatments.
CONCLUSION
Phyllocoptes azadirachtae is a pest of neem
in Thailand. Field observation revealed that this
mite was frequently encountered on Sadao-Thai
leaf (A. indica siamensis) than the other neem
species. Biological observation also agreed with
this statement since the mite showed the highest
survival percentage, the shortest life cycle and the
highest egg production on A. indica siamensis.
This mite distributes in many parts of the country,
causing leaf deformation and subsequently leaf
defoliation. Hence, more works are needed to be

investigated, especially life table and proper control


measures in order to keep P. azadirachtae under
control.
ACKNOWLEDGEMENTS
This work was supported by the TRF/
BIOTEC Special Program for Biodiversity
Research and Training Grant (BRT 542096).
LITERATURE CITED
Allen, J.C., Y. Yang and J. L. Knapp. 1995.
Temperature effects on development and
fecundity of the citrus rust mite (Acari :
Eriophyidae). Env. Entomol. 24: 996-1004.
Boczek, J. and A. Chandrapatya. 1992. Studies on
eriophyid mites (Acari : Eriophyoidea) X.
Bull. Polish Acad. Sci. (Biological Sciences)
40(4): 261-267.
Boczek, J. and A. Chandrapatya. 1993. Studies on
eriophyid mites (Acari : Eriophyoidea) XI.
Bull. Polish Acad. Sci. (Biological Sciences)
40(4): 269-277.
Boczek, J., W. Adwadzki and R. Davis. 1984.
Some morphological and biological
differences in Aculus fockeui (Nalepa &
Trouessart) (Acari: Eriophyidae) on various
host plants. Intern. J. Acarol. 10: 81-87.
Chandrapatya, A. and G. T. Baker. 1986.
Biological aspects of the geranium mites,
Coptophylla caroliniani and Aceria
mississippiensis (Prostigmata : Eriophyidae).
Exp. Appl. Acarol. 2: 201-216.
Channabasavanna, G.P. 1966. Contribution to
The Knowledge of India Eriophyid Mites.
(Eriophyoidea: Trombidiformes: Acarina).
University of Agricultural Sciences Hebbal,
Bangalor, 153 p.
Dobrivojevic, K. and R. Petanovic. 1985. The
eriophyid rassberry leaf miner Phyllocoptes
gracilis (Nal.) (Eriophyoidea, Acarina), a little
known pest in Yugoslavia Zastuta-Rilja,

Kasetsart J. (Nat. Sci.) 38 (4)

36(3): 245-247.
Ghosh, N.K. and S. Chakrabarti. 1989.
Morphology of developmental stages on
Tegolophus artocarpi (Acari: Eriophyidae)
and some observations on its biology. Indian
J. Acarol. 10(1&2): 41-46.
Huang, Z. Y., X. Liu, L. H. Li, T. X. Qi and A.G.
Liang. 1994. Study on the biology of Aculus
fockeui, Entomological Knowledge 31(1):
15-17.
Huang, K. 2001. The eriophyoid mites of Taiwan:
description of twelve species from Green
Island. Bull. Nat. Museum Natural Science.
13: 95-109.
Jeppson, L.R., H.H. Keifer and E.W. Baker. 1975.
Mites Injurious to Economic Plant.
University of California Press, Berkeley,
California, 613 p.
Krantz, G. W. 1973. Observations on the
morphology and behavior of the filbert rust
mite, Aculus comatus (Prostigmata:
Eriophyoidea) in Oregon, Ann. Ent. Soc.
Amer. 66: 709-717.
Keifer, H. H. 1952. The eriophyid mites of
California. Bull. Calif. 2(1): 1-123.
Keifer, H. H. 1959. Eriophyid studies XXXVI.
Bull. Calif. Dept. Agr. 47: 271-281.
Lindquist, E. E. 1966. Phylogenetic relationships,
pp. 301327. In E. E Lindquist, M. W. Sabelis
and J. Bruin (eds.). Eriophyoids Mites
Their Biology, Natural Enemies and
Control. Elsevier Science Publication,
Amsterdam, The Netherlands.
Nalepa, A. 1887. Die Anatomie der Pohytopten.
Sitzenberichten Akademi Wissenschaften,
Wien 96: 115-165.
Nuzzaci, G. 1979. Contribution alla conoscenza
dello gnatosoma degli Wriofidi (Acarina :
Eriophyoidea). Entomologica (Bari). 15:
73-101.
Petanovic, R. and E. de Lillo. 1992. Two new

483

Vasates species (Acari : Eriophyoidea) of


Euphorbia L. from Yugoslavia with
morphological notes on Vasates euphorbiae
Petanovic. Entomologica (Bari) 27: 5-17.
Shevtchenko, V. G. 1975. The life history of the
alder gall mite, Eriophyes laevis (Nalepa)
(Acariformes, Tetrapodili). Entomologicheskoe Obzrenie 36: 598-618.
Shi, A. 2000. Eriophyoid mites (Acari
Eriophyoidea) associated with blackberries
and raspberries (Rubus spp.): species,
bionomy and the impact on host plant.
Summary of Ph.D. thesis, Department of
Applied Entomology, Warsaw Agricultural
University.
Sombatsiri, K., K. Ermel and H. Schmutterer.
1995. Other meliaceous plants containing
ingredients for integrated pest management
and further purposes, pp. 585-597. In H.
Schmutterer (ed.). The Neem Tree Source
of Unique Natural Products for Integrated
Pest Management, Medicine, Industry and
Other Purposis. VCH. Publish Inc., New
York, USA.
Uthamasamy, S., P. V. S. Rao, M. Mohanasundaram and T. R. Subramaniam. 1973. A note
on some new pests attacking the neem tree
(Azadirachta indica) in Tamil Nadu, Science
and Culture 39: 399-400.
Wahba, M. L., S. A. Doss and A. M. I. Farrag.
1985. Source of reinfestation by Eriophyes
K. for garlic plant with some biological aspects.
Bulletin de l Soc. Entomologie d Egypte.
65: 179-182.
Westphal, E., F. Dreger and R. Bronner. 1990.
The gall mite Aceria cladophthirus.l. Life
cycle, survival outside the gall and symptoms
expression on susceptible or resistant Solanum
dulcamara plants. Exp. Appl. Acarol. 9:
183-200.

Kasetsart J. (Nat. Sci.) 38 : 484 - 492 (2004)

Evaluation of Different Larval Feeds for Survival and Development


of Early Stage Mud Crab (Scylla olivacea)
Pattanee Jantrarotai1, Praphaphan Temphakdee1 and Suparp Pripanapong2

ABSTRACT
The effects of early feeds and feeding regimes on survival and development of mud crab (Scylla
olivacea) larvae were studied in two experimental phases ; phase 1 from zoea 1 to zoea 5 and phase 2 from
megalopa to the first crab stage. In the first phase trial, the treatments were characterized by feeding
regimes of two types of feeds of which the first feed was applied from outset zoea 1 and later when entering
zoea 2, the first feed was partially substituted by the second feed. The treatments of aboved regimes were
as followed: 1. rotifer and artemia 2. rotifer and frozen copepod 3. artemia and rotifer 4. artemia and frozen
copepod 5. microencapsulated feed and artemia and 6. microencapsulated feed and frozen copepod. It
was shown that the survival rate of zoea when developed till zoea 5 were 13.89, 4.00, 2.50, 10.33, 0.11
and 0.00% for treatments 1 to 6, respectively. The survival rates for treatments 1 and 4 were higher
(P<0.05) than those of the other treatments. The average time for the development of zoea into zoea 5
were less (P<0.05) in treatments 1 and 4 which were 20.67 and 21.67 days, respectively.
The second phase aimed to study the effects of feed on the development of megalopa to the first
crab stage. The experiment was randomized into five treatments for the following feeds: 1. artemia 2.
chopped mussel 3. artemia and larval shrimp feed 4. artemia and chopped mussel 5. larval shrimp feed
and chopped mussel. Survival rates of megalopa developed to the first crab stage were 75.00, 16.44,
63.89, 58.33 and 47.22% for treatments 1 to 5, respectively. There were no significant differences
(P>0.05) in survival rates for treatments 1, 3 and 4 and these were higher (P<0.05) than that of treatment
2. The average development time of megalopa to the first crab stage in treatments 1 to 5 were 12.05, 15.22,
10.77, 12.15 and 10.99 days, respectively, which were not significantly different (P>0.05) among
treatments.
Key words: Scylla olivacea, larval feed, zoea, megalopa, crab
INTRODUCTION
Mud crabs (Scylla olivacea) commonly
found along the coast of Gulf and Andaman sea of
Thailand, contribute to well-being and socioeconomics of coastal fisherfolks. In 2002, Thailand
exported over 3,900 metricton of mud crab,
generated significant income to the fishers and

1
2

culturists . However, the population of mud crab is


under threatened and has continuously declined
over years due to many reasons such as the
destruction and polluting of mud crab habitats, the
over-exploitation and undersized catching of mud
crab (Ronquillo et al., 1998). The concerns on the
decline of crabs have brought about the attempts
in conservation of wild crab stocks and increase

Department of Zoology, Faculty of Science, Kasetsart University, Bangkok 10900, Thailand.


Ranong Coastal Aquaculture Station, Ranong 85000, Thailand.

Received date : 16/05/04

Accepted date : 30/09/04

Kasetsart J. (Nat. Sci.) 38 (4)

population through aquaculture. For the latter,


although the success in mass propagation of mud
crab seeds is achieved, high mortality usually
occurs at the stage of zoea and megalopa. Many
causes of mortality are speculated and one of the
most concern is focused on the proper use of larval
feed and feeding management in the early stage of
mud crab. In normal practice,rotifer and artemia
are usually used as early feed for mud crab (Treece
and Davis, 2000). These zooplankton are well
nutritional defined for fish and crab larvae.
However, the preparation process and cost are
usually not attractive so the proper choices and
feeding management may be the key success for
larvae nursing.
The purpose of this study was to evaluate
the effects of various early feed for mud crabs
either feeding solely or in combination of two
types on the survival and development of mud crab
in zoea and megalopa stage. The result from this
study would provide the information for the
improvement of early feeds and feeding
management for larval crab which may contribute
to the reduction of mortality of mud crab larvae.
MATERIALS AND METHODS
The studies were conducted into two
experiments. Experiment 1 was to evaluate the
effects of different early feed on survival and
development of zoea 1 to zoea 5. Experiment 2
was carried out for the same objective from
megalopa stage to the first crab stage.
Experiment 1
Preparation of experimental larval crab
An ovigerous female crab obtained from a
private farm was brought to the hatchery of the
Ranong Coastal Aquaculture Station and
acclimatized in a 50-l plastic tank containing 30
ppt sea water with aeration. The crab was daily fed
with chopped trash fishes and squids at 0700 and
1800 hours and raised until maturation and

485

spawned. Hatched zoea 1 (Z1) were collected and


randomly used for further experiments.
Experimental feed and sea water
Larval feeds used in the experiment were
rotifer (R), artemia (A), copepod (C), and
microencapsulate feed (M). Rotifer was prepared
by cultivation with chorella in a 200-l fiberglass
tank at 30 ppt salinity . Artemia obtained from
hatching of commercial artemia cyst, copepod
used was the thawed copepod. Microencapsulated
feed was from commercially available.
Natural raw sea water of 26-28 ppt salinity
was obtained from a private hatchery. It was
stocked in a 20-ton concrete tank and treated with
30 ppm calcium hyperchlorite and allowed three
days for the chloride evaporation before utilization.
Salinity of treated sea water was adjusted to 30 ppt
by using NaCl .
Experimental management
The experiments were carried out in 18
stylofoam boxes of 31.0 43.5 29.5 cm3,each
containing 15-l of prepared sea-water. The boxes
were randomly assigned to six treatments with
three replications each. The treatments were
different in either larval food type, their
combination and/or sequence of feeding as shown
in Table I.
Three allotments of 100 zoea 1 mud crab
were randomly stocked in each stylofoam box to
contain 300 zoeae. Throughout the experiment 1,
zoea 1 were fed once a day in the morning according
to the designed schemes. At stage of zoea 1, all
treatments were fed with the different single early
feeds till the development to stage of zoea 2. Then
the combination of the feeds used in zoea 1 and
another type of early feeds were applied for
respective treatments till the larval crabs developed
into zoea 5.
Rotifer, artemia and microencapsulate feed
were fed to zoea 1 at the rate of 30 individual/ml,
10 individual/ml and 4 mg/l, respectively. During

486

Kasetsart J. (Nat. Sci.) 38 (4)

Table 1 Treatments assigned for the treatment 1.


Treatment

Crab stage
Z1

1
2
3
4
5
6

Z2

Rotifer
Rotifer
Artemia
Artemia
Microencapsulate
Microencapsulate

zoea 2 - zoea 5, where the combination of feeds


were used, the amount of early feeds were 15
individual/ml, 5 individual/ml, 5 individual/ml
and 2 mg/l for rotifer, artemia, copepod and
microencapsulate, respectively. Therefore, the
amounts of previous feed used in zoea 1 were
reduced to half when used in combination.
During daily water exchange, live zoea
were siphoned from the stylofoam boxes to the
containers. The boxes were cleaned and refilled
with sea water. Zoea were then picked up from the
containers by a wide-bore pipette, the number
were recorded and returned to their respective
boxes.
Survival rate of zoea (%) and the
developmental period (days) from zoea 1 to zoea
5 were determined and subjected to statistical
analysis.
Experiment 2
The experiment 2 was to study the
influences of feed on the development of megalopa
to the first crab stage . Five treatments set up with
different types of feed were used for the experiment
as follows
Treatment 1: newly hatched artemia (A)
Treatment 2: finely ground mollusc meat
(GM)
Treatment 3: newly hatched artemia + black
tiger larval shrimp feed (A+F)

Z3

Z4

Z5

Rotifer + Artemia
Rotifer + Copepod
Artemia + Rotifer
Artemia + Copepod
Microencapsulate + Artemia
Microencapsulate + Copepod

Treatment 4: newly hatched artemia +


finely ground mollusc meat (A+GM)
Treatment 5: black tiger larval shrimp feed
+ finely ground mollusc meat (F+GM)
Experiment 2 was carried out in 15
stylofoam boxes as in the experiment 1. A piece of
foam with twelve cut holes of 8 cm in diameter was
floated within each box. This foam was for holding
twelve punched-plastic cups, each containing only
a megalopa to prevent cannibalism. Each box
contained 20 liter of 30 ppt salinity sea water. The
boxes were randomly allocated to each of five
treatments with three replications.
Megalopa were daily fed with their
respective treatments right after daily water change.
Artemia, finely ground mollusc meat, black tiger
larval shrimp feed were fed to megalopa at the rate
of 10 individuals/ml, 0.1g/megalopa and 0.1 g/
megalopa, respectively. For those treatments with
the combination schemes, the quantities of food
were reduced to half for each item. Survival rate
(%) and developmental period (days) of first crab
of all treatments were analyzed for statistical
difference.
Data analysis
Survival rate (%) and developmental period
(days) influenced by different food types in both
experiments were analyzed with one-way analysis

487

Kasetsart J. (Nat. Sci.) 38 (4)

of variance. Mean differences were determined by


Duncans new multiple range test at 95% confident
level. Statistical analysis was performed using
SPSS software.
RESULTS
Table 1 and Figure 1 showed the influences
of different larval foods on survival rate of zoea in
each stage. Survival rates of zoea 1 which developed
to zoea 2 were not signficantly different (P>0.05)
among treatments 1, 2, 3, 4 and 5. For treatment 6,
zoea 1 survived to zoea 2 at lower percentage than
those in other treatments. Accumulated high
mortality in almost all treatments were observed
during the development of zoea 1 to zoea 3. Zoea
3 where treatments 1, 2 and 4 survived only 46, 40
and 43%, respectively, but still were higher
(P>0.05) than those of other treatments. It was
obvious that zoea1 raised on treatment 6 was
hardly survived to zoea 3 as its survival rate was
only 0.45%. The survival rate of zoea1 developed
to zoea 4 were 16, 11, 4, 12, 0.11 and 0% for
treatments 1, 2, 3, 4, 5 and 6, respectively. The
survival of zoea 5 developed from zoea 1 were
only 14% and 10% for those fed with treatments 1
and 4, while the survival to zoea 5 in the other
treatments were almost none.
The developmental period from zoea 1 to
zoea 5 in treatments 1, 2, 3, 4 and 5 were 20.67,
28.00, 25.50, 21.67 and 29.00 days, respectively
(Table 2). For treatment 6, zoea 1 failed to develop
to zoea 5 since 100% mortality was observed in
zoea 4.
Table 3 and Figure 2 showed the result of
the second experiment. The survival rate of the
first crab stage developed from megalopa was the
highest (75%) for those fed on artemia. This
survival rate was not significantly different
(P>0.05) from those given artemia in combination
with black tiger larval shrimp feed (treatment 3) or
finely ground mollusc meat (treatment 4). The
lowest survival rate (19%) was found in megalopa

fed solely on finely ground mollusc meat (treatment


2).
Development periods for megalopa
developed to the first crab stage were observed at
the range of 11 to 15 days. These periods were not
significantly different ( P>0.05) among treatments.
DISCUSSION
It was clearly indicated in the experiment 1
that live feeds ( rotifer and artemia ) were superior
to microencapsulate feed ( processed feed ) for the
development of zoea. The survival rate of these
zoea raised on live feeds were higher probably
because the opportunity of zoea to come across
live feed was higher than that to processed feed.
Zoea at its early life stage has not yet fully
developed swimming appendices so that it is unable
to approach microencapsulated feed. The
advantage of live feed is that they are freely
dispersed in water made them readily available for
zoea which taking feed randomly at this stage
(Warner, 1977; Hill, 1979). Although
microencapsulate feed is efficient for supporting
survival of mysis shrimp up to 70% (Teshima et
al., 1982), but in this study microencapsulated
feed is not suitable for larval crab. This result
agreed with the study by Quinitio et al. (1999) who
reported high mortality of crab zoea nursed on
microencapsulated feed, due to the zoea was unable
to take on bottom spreading feed.
Regardless of feed types given to zoea, the
overall survival from zoea 1 to zoea 2 was higher
than 65%. This could attribute to the fact that at the
early stage of zoea, yolk sac might play an
important role on providing nutrient to zoea and
contribute to the survival rate (Tseng, 1987).
During the developement of zoea 2 to zoea
3, the survival rate of zoea among treatments were
quite low for some treatments. This was probably
because yolk sac in zoea 2 was completly absorbed
and no longer available for zoea. Therefore, zoea
were fed on proper larval foods could survive at

488

Kasetsart J. (Nat. Sci.) 38 (4)

Table 1 Mean percent survival of zoea 1 to zoea 5 (Z1 - Z5 ) as influenced by feeding of different larval
feeds.
Larval feed
1. R-(R+A)

Z1

Z2

Z3

Z4

Z5

81.450.69a
45.5613.83a
15.568.33a
13.897.03a

2. R-(R+C)

85.223.35a
39.898.44a
11.006.33ab
4.002.18bc

3. A-(A+R)

86.174.95a
20.5010.61b
4.004.24bc
2.502.59c

4. A-(A+C)

86.566.20a
43.3313.05a
11.896.26ab
10.335.51ab

5. M-(M+A)

72.788.06ab
12.226.85bc
0.110.19c
0.110.19c

6. M-(M+C)

65.8912.04b
0.450.39c
0.00c
0.00c

Means within the same column followed by the same letter are not significantly different (P>0.05)
note: Data are expressed as meanSD
1. R-(R+A) = Rotifer - ( Rotifer+Artemia)
2. R-(R+C) = Rotifer - ( Rotifer+Copepod)
3. A-(A+R) = Artemia - ( Artemia+Rotifer)
4. A-(A+C) = Artemia (Artemia+Copepod)
5. M-(M+A) = Microencapsulate (Microencapsulate+ Artemia)
6. M-(M+C) = Microencapsulate (Microencapsulate+ Copepod)

489

Kasetsart J. (Nat. Sci.) 38 (4)

Figure 1 Percentage of zoea surviving reared by various feeds.


Note:
R-(R+A) = Rotifer - ( Rotifer+Artemia)
R-(R+C) = Rotifer - ( Rotifer+Copepod)
A-(A+R) = Artemia - ( Artemia+Rotifer)
A-(A+C) = Artemia (Artemia+Copepod)
M-(M+A) = Microencapsulate (Microencapsulate+ Artemia)
M-(M+C) = Microencapsulate (Microencapsulate+ Copepod)

higher rate. The finding showed better results in


treatments 1, 2 and 4 which were the combination
of rotifer and artemia, rotifer and copepod ,
artemia and copepod, respectively. Live feeds in
general is superior to processed feed due to its
proper size, movability and completed nutrient
compositions including free amino acid (Warner,
1977; Lebour, 1928; Tungkerkoran, 1999).
However, the reason for low survival of zoea 2
developed to zoea 3 under feeding on artemia and
rotifer (treatment 3) was that zoea was first fed on
artemia (500 ) which was much larger in size than
rotifer (200 ) . Therefore, zoea were accustomed
to large food size and when fed rotifer at later
stage, it was perhaps, difficult for zoea 2 to take
rotifer of smaller size or otherwise zoea had to

Table 2 Developmental periods (days) of zoea 1


to zoea 5 as influenced by feeding of
different larval feeds.
Larval feed

Developmental period (days)

1. R-(R+A)
2. R-(R+C)
3. A-(A+R)
4. A-(A+C)
5. M-(M+A)
6. M-(M+C)

20.670.58a
28.001.41c
25.502.12bc
21.673.79ab
29.000.00c
-

Means within the same column followed by the same letters are
not significantly different (P>0.05)
Note: Data are expressed as meanSD

490

Kasetsart J. (Nat. Sci.) 38 (4)

Table 3 Survival rates (%) and the developmental periods (days) of megalopa to the first crab stage
influenced by feeding of different larval feeds.
Larval feed

Survival rate

Developmental period

1. A
2. GM
3. A+F
4. A+GM
5. F+GM

75.008.33a
19.449.62c
63.8912.73ab
58.330.00ab
47.2220.97b

12.050.65a
15.223.27a
10.771.45a
12.151.87a
10.990.35a

Means within the same column followed by the same letter are not significantly different (P>0.05)
note: Data are expressed as meanSD
A = Artemia
GM = Finely ground mollusc meat
A+F = Artemia+ Black tiger larval shrimp feed
A+GM = Artemia+ Finely ground mollusc meat
F+ GM = Black tiger larval shrimp feed +Finely ground mollusc meat

Figure 2 Percentage of megalopa reared by various feed.


spend more energy to fill up the stomach and hence
resulted in poor performance (New, 1987 ; Herper,
1988 ; Lovell, 1989).
Zoea 3 was kept dying when developed to
zoea 4. Only zoea which nursed on lived feeds in
treatments 1, 2 and 4 survived 11-16% while those
fed on microencapsulated feed died almost
completely (0-4% survive). It was quite clear in
this study that highly mortality of zoea occurred

during zoea 2 developed to zoea 4 although it had


higher survival rate in treatments 1, 2 and 4. The
reasons were that during this peroid, gland filter
and hepatopancreas were well developed
meanwhile swimming and walking legs were still
developing (Li et al., 1995) and therefore nutrients
and energy were required. From zoea 4 to zoea 5,
the rates of mortality declined in all treatments due
to their digestive system and morphology being

491

Kasetsart J. (Nat. Sci.) 38 (4)

much more stable.


The developmental period from zoea 1 to
zoea 5 were the shortest ( 21-22 days) in treatments
1 and 4 for those fed on the combination of rotifer
and artemia, artemia and copepod. This was
consistent with the other studies that zoea 1 of
Scylla olivacea and Scylla serrata nursed on rotifer
and artemia took 18-25 days for development to
zoea 5 (Pripanapong,1999; Heasman and
Fielder,1983).
Results from the experiment 2 showed that
newly hatched artemia was more suitable food for
megalopa than mollusc meat and shrimp feed.
This was indicated by high survival rate of
megalopa feeding on artemia. Baylon and Failaman
(1999) reported that megalopa of scylla serrata
had high survival rate (72.22%) when fed on
artemia, but survival rates decreased to 50.00,
38.89 and 33.33% when artemia mixed with worm,
shrimp meat and squid meat were used,
respectively. It was suggested that artemia was the
suitable feeds for megalopa as artemia contained
high protein (65.6%) and its movement facilitated
the aggressive predation of megalopa (Warner,
1977; Williams et al.,1999).
The developmental period from megalopa
to the first crab stage was not influenced by types
of feed in this study. However, the shorter
developement period was resulted from treatments
contained shrimp feed. It might be postulated that
well-balanced nutrients in black tiger larval shrimp
feeds might affect period for the development of
megalopa to a certain extent.
CONCLUSION
The influences of six various feed on
survival rate of zoea, indicated that live feeds,
rotifer and artemia were superior to
microencapsulate feed for the development of
zoea 1 to zoea 2. For the combinations of feed used
for zoea 2 to zoea 5, the combination of either
rotifer and artemia or artemia and copepod revealed

high survival rate of zoea 5. Duration for


development of zoea 1 to zoea 5 were 18-25 days.
Zoea fed on rotifer and artemia satisfied the shortest
time for development. For the experiment 2, the
megalopa fed on artemia solely had higher survival
rate than those fed on mollusc meat solely or
combination with ground mollusc meat or larval
shrimp feed. The developmental period of the first
crab from megalopa was not influenced by types
of feed and ranged from 11 to 15 days.
LITERATURE CITED
Baylon, J.C. and A.N. Failaman. 1999. Larval
rearing of the mud crab Scylla serrata in the
Philippines, pp. 141-146. In C.P. Keenan and
A. Blackshaw (eds.). Mud Crab Aquaculture
and Biology. ACIAR Proceedings, Australia.
Heasman, M.P. and D.R. Fielder. 1983.
Laboratory spawning and mass rearing of the
mangrove crab Scylla serrata (Forskal) from
first zoea to first crab stage. Aquaculture
34: 303-316.
Hepher, B. 1988. Nutrition of Pond Fishes.
Cambridge University Press, Cambridge. 383
p.
Hill, B.J. 1979. Aspects of the feeding strategy of
the predatory crab Scylla serrata. Mar. Biol.
55: 209-214.
Lebour, M.V. 1928. The larval stages of the
plymouth Brachyura. Proc. Zool. Soc. Lond.
473-560. cited by G.F. Warner. 1977. The
Biology of Crabs. Princeton, Van NostradReinhold. 202 p.
Li, S., G. Wang, H. Tang, and Q. Lin, 1995.
Comparative studies on the hydrolytic enzyme
activities for the mud crab, Scylla serrata
during embryonic development. Journal of
Xiamen University ( Natural Science) 34:
970-974.
Lovell, R.T. 1989. Nutrition and Feeding of
Fish. Van Nostrand Reinhold, New York.
260 p.

492

Kasetsart J. (Nat. Sci.) 38 (4)

New, M. 1987. Feed and Feeding of Fish and


Shrimp. ADCP/REP/87/26. United Nations
Development Program. Food and Agriculture
Organism of the United Nations, Rome. 275
p.
Ong, S.K. 1960. The early developmental stage of
Scylla serrata (Forskal) (Crustacea:
Portunidae) reared in the laboratory. Proc.
Indo. Pacific 11: 135-186.
Overton, J.L., Macintosh, D.J. and R.S. Thorpe.
1997. Multivariate analysis of the mud crab
Scylla serrata (Brachyura: Portunidae) from
four locations in Southeast Asia. Mar. Biol.
128: 55-62.
Pripanapong, S. 1999. Nursing zoea of mud crab
(Scylla olivacea) in styrofoam box with
densities. TCE-Project Newsletter July 3:
(7). http://www.biology.aau.dk/cenTER/
NL.pdf, October 12, 2001.
Quinitio, E.T., Parado-Estepa, F. and V. Alava.
1999. Development of hatchery techniques
for the mud crab Scylla serrata (Forskal)
comparison of feeding schemes, pp. 125130. In C.P. Keenan and A. Blackshaw
(eds.). Mud Crab Aquaculture and Biology.
ACIAR Proceedings, Australia.
Ronquillo, J.D., Pura, Z. and R. Traifalgar. 1998.
Development Biology and Culture of Portunid

Mud Crab Scylla oceanica (DANA 1852).


International Forum on the Culture of
Portunid Crab. Philippines. 20 p.
Teshima, S.I., Kamazawa, A. and M. Sakamoto.
1982. Microparticulalate diets for the larvae
of aquatic animals. Min. Rev. Data Fiels.
Res. 2: 67-86.
Treece, G.D. and D.A. Davis. 2000. Culture of
Small Zooplanktons for the Feeding of
Larval Fish. Southern regional, Aquaculture
Center. 8 p.
Tseng, W. Y. 1987. Shrimp Marineculture-A
Practical Manual. The University of Papua
New Guinea Port Moresby, Papua New
Guinea. 196 p.
Tungkerkoran, N. 1999. Carcinology.
Development of Aquatic Science. Faculty of
Science, Burapha University, Chonburi. 187p.
Warner, G.F. 1977. The Biology of Crabs.
Princeton. Van Nostrad-Reinhold. 202 p.
Williams, G.R., Wood J., Dalliston B., Shelley
C.C. and C.M. Shelley. 1999. Mud crab
(Scylla serrata) megalopa larvae exhibit high
survival rates on artemia-based diets, pp. 131140. In C.P. Keenan and A. Blackshaw,
(eds.). Mud Crab Aquaculture and Biology.
ACIAR Proceedings, Australia.

Kasetsart J. (Nat. Sci.) 38 : 493 - 500 (2004)

A Proteomic Approach to Analyze Rice Bran and


Shoots of Kao Dawk Mali 105 and its Mutants
Arunee Trisiriroj1, Shui-Tein Chen2 and Narumon Jeyashoke1

ABSTRACT
Proteomic analysis was used to investigate bran proteins from wild-type Oryza sativa L. variety
KDML105 and its mutant RD15. Fractionation of bran proteins by sequential solubilization showed about
1,000 total spots in 2-D gel. The 2-D gels revealed the similarity in protein patterns between KDML105
and RD15 because most expressed proteins in bran were house-keeping proteins. Consequently, rice
shoots were investigated using etiolated shoots and green shoots of KDML105 and its two mutants,
namely RD15 and RD6. Rice shoot proteins were extracted by 10% TCA in acetone. 2-D gels presented
a greater number of etiolated proteins than green shoot proteins in all 3 varieties. Due to low expression
of RuBisCO enzyme in etiolate, some proteins appeared in higher intensities in etiolated samples than in
green shoot samples. As a consequence the proteins were excised for MS analysis. However, most of the
different proteins among these three varieties appeared in low intensities. The result of this study revealed
that KDML105, RD15 and RD6 expressed different types of salt-stress induced proteins.
Key words: proteomic, Orysa sativa L. ssp. indica, Kao Dawk Mali 105

INTRODUCTION
The phenotypic appearance is controlled
by many proteins and genes. One way of getting
insight into this complex biological system is to
focus on the network of gene products, which can
be accomplished by proteome analyses [Roberts,
2002]. Proteomic analysis is a powerful tool that
can be used both to visualize and compare complex
mixtures of protein and to gain a large amount of
information about the individual proteins involved
in specific biological responses. Proteome analysis,
in general, is performed by (i) separation of proteins
by 2D-PAGE, (ii) determination of peptide mass
fingerprints/amino acid sequences by mass
spectrometry, (iii) identification of protein/protein

1
2

homologs using databases, and (iv) characterization


of proteins of unknown function by amount,
localization, structure, post-translational
modification and enzyme activity (Komatsu et al.,
2003; Rakwal and Agrawal, 2003). Plant proteins
extracted from embryos (Woo et al., 2002), leaves
(Wilson et al., 2002), bran (Trisiriroj et al., 2004),
roots (Mang et al., 2004) and etiolated and green
shoots (Komatsu et al., 1999) were previously
separated and analyzed by 2D-PAGE.
Kao Dawk Mali 105 (KDML105) is the
famous aromatic rice of Thailand and RD15 and
RD6 are mutant rice derived from KDML105 by
gamma-ray mutation. The relation of their
physiological and protein profiles will provide
valuable information for further functional genomic

King Mongkuts University of Technology Thonburi, Bangmod, Toongkru, Bangkok 10140, Thailand.
Institute of Biological Chemistry, Academia Sinica, Taipei, Taiwan R.O.C

Received date : 12/07/04

Accepted date : 27/09/04

494

Kasetsart J. (Nat. Sci.) 38 (4)

studying. In this study, the protein patterns of rice


bran and shoots from KDML105 RD15 and RD6
were compared and the different proteins encoded
by expressional genes in each tissue were identified.
In addition, the global protein complements
expressed under the consequence of the mutation
could be investigated.
MATERIAL AND METHODS
1. Plant materials
1.1 Rice bran
Rice seeds of KDML105, RD15 and RD6
were obtained from Prachinburi Rice Research
Center. Seeds were milled by laboratory-scale
milling machine and seed bran was stored
immediately at -80C before use.
1.2 Rice shoot
Three cultivars of Thai rice (Oryza sativa
L. ssp. indica) were used in this research: Kao
Dawk Mali 105 (KDML105), RD15 and RD6. All
of them were harvested from Sakolnakorn province
(northeastern of Thailand) and were broken of
their dormancy by incubation at 50C for 3 days.
Seeds of KDML 105, RD 15 and RD 6 were
soaked in sterile tap water overnight and kept in
damp cotton wool for 10 days. For etiolate, the
rice seeds were planted in a dark room. After 10
days, both green shoots and etiolates were harvested
and kept at 80C before use.
2. Two dimensional electrophoresis (2-DE)
2.1 Preparation of bran proteins
Seed bran from each variety was ground in
liquid nitrogen and proteins were precipitated by
10% trichloroacetic acid (TCA) in acetone
(Damerval et al., 1986) and lyophilized.
Lyophilized proteins were fractionate solubilized
in 2 lysis buffers (Jacobs et al., 2001). One mg of
lyophilized powder proteins was first solubilized
in lysis buffer A, consisting of 8 M urea, 4% (w/v)
3-[(3-cholamidopropyl)dimethylammonio]-1propanesulfonate (CHAPS) and 65 mM

dithioerythritol (DTE). The supernatant A was


kept for running 2D-PAGE by centrifugation at
10,000 g for 10 min. The residue was re-solubilized
in lysis buffer B, consisting of 7 M urea, 2 M
thiourea, 4% (w/v) CHAPS and 65 mM DTE. The
supernatant B was kept by centrifugation at 10,000
g for 10 min for running 2D-PAGE.
2.2 Preparation of shoot proteins
Three mg of rice shoot from each variety
were ground in liquid nitrogen, and proteins were
precipitated by 10% TCA in acetone and
lyophilized. Lyophilized proteins were solubilized
in a lysis buffer consisting of 5 M urea, 2 M
thiourea, 2% CHAPS, sulfobetaine 3-10, 20 mM
DTE and 5 mM Tris (2-carboxyethyl) phosphine
(TCEP) (Mechin et al., 2003). The protein
concentration in the supernatant was determined
by a PlusOne protein assay kit (Amersham
Biosciences).
2.3 Protein separation by 2D-PAGE
2-DE was performed three times for each
sample. Approximately 500 g of extracted rice
shoot proteins in 350 L lysis buffer was loaded
into 18 cm IPG strips (Amersham Biosciences) for
pH range 4-7. Strips were re-hydrated in the
presence of sample solution plus 0.5% (v/v)
ampholyte buffer pH 4-7 and 0.25% (v/v)
ampholyte buffer pH 3-10 under constant low
voltage (50 V) for 12 h. The first dimensional
isoelectric focusing (IEF) was conducted at 20C
using an IPG-phore (Amersham Biosciences). It
was programmed with a voltage of 100 V for 1 h,
250 V for 1 h, 1000 V for 0.5 h, 2000 V for 0.5 h,
4000 V for 1 h and 6000 V, for a total of 90 KVh.
After first dimension, the strips were incubated in
an equilibration buffer which contained 50 mM
Tris-HCl pH 8.8, 6 M urea, 30% (v/v) glycerol, 2%
(w/v) sodium dodecyl sulfate (SDS) plus 65 mM
DTE for 20 min, followed by incubation in the
equilibration buffer plus 65 mM iodoacetamide
for 20 min. The second dimension electrophoresis
using PROTEAN II xi Multi-Cells (Bio-Rad
Laboratories) was performed on 12.5% (w/v) linear

Kasetsart J. (Nat. Sci.) 38 (4)

polyacrylamide gel at 40 mA until the buffer front


line was 5 to 10 mm from the bottom of the gel.
Proteins were stained with Sypro Ruby. The
electrophoretic patterns of 2-D gels were compared
and analyzed using PDQUEST software, version
7.0 (Bio-Rad Laboratories).
3. In-gel digestion and peptides extraction for
MS analysis
Spots of interest were excised and de-stained
by washing twice with 250 L of acetonitrile/50
mM ammonium bicarbonate at the ratio of 1:1 (v/
v) for 15 min. The gels were dried using a centrifugal
vacuum concentrator. A reduction and alkylation
process for cysteine residues was performed on
samples using DTE and iodoacetamide,
respectively, before adding trypsin solution. For
tryptic digestion, the dried gel was rehydrated in
12.5 ng/L modified trypsin and incubated at 37
C for at least 16 h.
Peptide mass spectra were acquired using a
MALDI-Q-TOF mass spectrometer (Micromass,
UK) operating in a delayed extraction reflector
mode. Mass spectrometry was performed using an
accelerating voltage of 20 kV. Selected peptides in
the mass range of 1000-3500 Da were used for
database matches.
Peptide mass fingerprint data from MALDIQ-TOF were used to match against protein
candidates in NCBI and SWISS-PROT protein
databases
using
MASCOT
(http://
www.matrixscience.com). Search parameters were
allowed for oxidation of methionine,
carbamidomethylation of cysteine, one
misscleaved site and peptide mass tolerance of
0.15 Da and MS/MS tolerance of 0.25 Da.
RESULTS AND DISCUSSION
The purpose of this work was not to identify
the proteins derived from the mutated genes, but to
distinguish between protein patterns of wild-type
KDML105 and mutant varieties RD15 and RD6.

495

This study provided information for further analysis


of the functional genomics of rice. Different
proteins expressed in bran, and in etiolated and
green shoots were investigated.
Analysis of 2-D protein patterns of bran proteins
of wild-type KDML 105 and mutant RD15
Bran proteins of KDML105 and RD15
were sequentially solubilized in both lysis buffers
A and B. Both proteins in lysis A and B were
separated by 2D-PAGE at pH range 4-7 and stained
by Sypro Ruby (Figure 1). 2-D gels were analyzed
by PDQUEST, which revealed similar protein
patterns of KDML105 and RD15 in both lysis A
and B.
Most of the different spots detected by
PDQUEST were irreproducible spots. By this
extraction method, it could be determined about
600 spots in lysis buffer A and 500 spots in lysis
buffer B. There were about 137 spots which were
common in both lysis buffers A and B. Therefore,
about 1,000 spots could be detectd in rice bran by
the sequential solubilization method. From the
similarity of protein patterns in both KDML105
and RD15, it was likely that most of these proteins
were house-keeping proteins. However, some spots
to identify by MALDI-Q-TOF were chosen.
Protein identification by MALDI-Q-TOF
More than twenty spots were digested with
trypsin and the resultant peptides were analyzed
by peptide mass fingerprinting (Figure 2). The
acquired mass spectra were searched against NCBI
databases of Oryza sativa for protein identification
(Table 2).
Table 2 shows protein identification by
both MALDI-TOF and MALDI-Q-TOF. For
MALDI-TOF, the proteins reported were those
which matched the NCBI database with a score
higher than 50, or those for which the molecular
weight and pI observed of each spot was close to
the calculated one. The result revealed that most of
them were proteins with no known function. Some

496

Kasetsart J. (Nat. Sci.) 38 (4)

Figure 1 2-D gels of bran proteins of KDML105 and RD15 in lysis buffer A and B.
1(a) KDML105, lysis buffer A, 1(b) RD15, lysis buffer A
1(c) KDML105, lysis buffer B, 1(d) RD15, lysis buffer B
spots had no peptide peaks that matched the
database, and some spots provided very low score
match. These were excised and analyzed again by
MALDI-Q-TOF. From MALDI-Q-TOF, three
spots, 16, 19 and 20 showed low score match, and
spots no. 16, 17, 19 and 20 showed low matched
peaks compared with the rice protein databases.
This outcome can be attributed to two
reasons: First, the protein databases do not have
enough information for identification of known
rice proteins. Second, it is possible that the TCA/
acetone precipitate protein method may lead to
poor protein identification. A similar result by
Fukuda et al., (2003) reported that embryo proteins
precipitated by TCA/acetone were difficult to
identify because of low recovery of proteolytic
peptide peaks and mis-matches against the NCBI
database.

Figure 2 2-D gel of bran proteins of KDML105.


The arrows indicate excised protein
spots.

Kasetsart J. (Nat. Sci.) 38 (4)

497

Table 2 Identification of rice bran proteins by MALDI-TOF and MALDI-Q-TOF.


Spot
No.

Score

%cov

Mw/pI
observe

Mw/pI
calculate

Protein identification

NCBI
accession

1
2
3
4
5
6
7
8
9

82
69
38
50
58
132
37
51
41

28
30
39
59
54
35
59
80
57

43000/5.6
41000/5.7
32000/6.0
42000/6.2
90000/5.4
90000/5.6
46000/5.1
54000/5.2
58000/5.0

42929/9.7
43246/7.7
31967/11.5
55184/5.9
174630/8.8
37438/5.9
43002/4.8
6985/4.9
70205/6.0

AC018727
AC091724
AC091247
AC79936
AC084831
AC084406
D13224
BAB17111
AC084406

10
11
12

253
48
54

59
45
66

48000/4.8
47000/5.6
42000/5.5

35517/5.0
29178/4.8
40008/8.7

13
14
15
16
17
18
19
20

115
32
14
11
83
344
32
9

42
63
2
2
42
68
12
2

56252/9.2
19184/6.1
55000/6.2
15000/5.5
17000/6.5
15000/6.8
18000/6.8
21000/5.5

48000/8.0
11200/6.02
61450/5.3
19863/9.5
18064/8.4
16900/8.8
58277/8.5
36529/11.3

Hypothetical protein
Unknown protein
Hypothetical protein
Hypothetical protein
Putative gag-pol polyprotein
Putative protein phosphatase
Tubulin beta chain
P0410E01.32
Putative thiamin biosynthesis
protein
Putative fructokinase II
Putative 14-3-3 protein
Ferredoxin-NADP reductase,
leaf isozyme
Glutelin
Hypothetical protein
Hypothetical protein
P0413G02.20
Prolamin
Prolamin
Hypothetical protein
P0407B12.21

AAL26573
AC087181
P41344
1312296A
BAD11618
NP_921892
BAC07363
AB016505
D73383
AAO17348
BAB17184

Note : Spots no. 1-14 were analyzed by MALDI-TOF and no. 15-20 by MALDI-Q-TOF.
%cov = % coverage

Detecting different proteins in etiolate and green


shoots
Most proteins in the embryo and aleuronic
layer were house-keeping proteins and thus had no
differential expression. Therefore, the coleoptiles
were selected to study the difference in expressed
proteins corresponding to their different genomes.
And in this study, KDML105 and its mutants,
RD15 and RD6 were used as models. The purpose
of using etiolate was, first, to seek the different
proteins which were not parts of the photosynthetic
system and second, to decrease abundant proteins
such as ribulose-1,5-bisphosphate carboxylase/

oxygenase enzyme (RuBisCO) involved in the


photosynthetic pathway. Rice shoots from 10-day
planted rice were used for protein extraction. The
proteins were extracted by 10% TCA/acetone and
separated by 2-DE (Figure 3). The gels of each
variety were replicated before matching by
PDQUEST to avoid the erroneous interpretation
by irreproducible spots.
RuBisCO contributes about 50% of total
proteins in leaves (Schneider et al., 1992), so it can
interfere with detection of low abundant proteins.
From Figure 3a, there were no RuBisCO in etiolate,
which allowed some proteins (arrows) to be

498

Kasetsart J. (Nat. Sci.) 38 (4)

Figure 3 2-D gels of hypocotyl proteins of KDML105 a) etiolate b) green shoot.


LSU = large subunit, SSU = small subunit, LSUF = large subunit fragment
detected and some proteins to increase their
intensities in 2-D gel. Figure 3b shows the large
subunit of RuBisCO and fragments derived from
it in vivo (LSUF) and small subunit of RuBisCO,
which is similar to the result reported by Salekdeh
et al. (2002).
By this extraction method, more than 1500
spots in KDML105 etiolated shoot and 1100 spots
in KDML105 green shoot could be detected (Table
3). Approximately the same number of spots were
obtained from etiolated and green shoots, for both
RD15 and RD6. Otherwise, it was found that about
35% of spots from both etiolated and green shoots,
RD15 and RD6, were different from the KDML105
variety. However, all of the different spots were
low abundant proteins. Some spots were excised
to analyze further by MALDI-Q-TOF (Figure 4).

Figure 4 2-D gels showing the excised spots to


analyze by MALDI-Q-TOF.

Table 3 Comparison of protein spots in etiolated and green shoots from three rice varieties by
PDQUEST image analysis.
Rice variety

KDML105
RD15
RD6

Etiolate (et)
Total spots
Match spots
1573
1033
1255

100%
64%
67%

Green Shoot (gs)


Total spots
Match spots
1106
1015
1193

100%
65%
65%

Match spots
between et/gs
74%
64%
66%

499

Kasetsart J. (Nat. Sci.) 38 (4)

Some different spots were picked to analyze


further by MALDI-Q-TOF as shown in Table 4.
Spot no.21, which was absent in RD6 in both
etiolated and green shoots, was identified as saltstress induced protein, SaLT gene product and
mannose binding rice lectin. Spot no. 22 could not
be detected in KDML105 green shoot, but it could
be detected in the etiolate. It suggested that this
protein was low abundant protein in KDML105,
and it could be detected when RuBisCO was not
expressed. Spot no. 23 was identified as
P044D10.21. Its amino acid sequences were similar
to putative mannose binding rice lectin, (a blast
search NCBI at score 105 bits in first hit) and SaLT
gene product (with a score of 102 bits for second
hit). Interestingly, RD6 did not show spots no. 21
or 23, but KDML105 and RD15 had all three spots.
Also, KDML105 had spot no. 22 in lower
concentration than RD15 and RD6, as it could be
detected only in etiolated shoot but not in green
shoot.
CONCLUSION

characterization. This study was the first step to


discovering the functional genomics of the rice
plant. In this study, more than one thousand spots
in rice bran proteins by sequential fractionation
could be detected and almost two thousand spots
of etiolate proteins. Although there were few
different proteins in rice bran among the wild type
and mutant varieties, the result showed many bran
proteins that have not been investigated. Therefore,
there were many proteins of unknown function
found in this study. Between etiolated and green
shoot, different proteins which occurred as the
consequence of its mutation could be found. The
result revealed that RD6, the mutant derived from
KDML105, had different types of salt-stress
induced proteins from those of KDML105. The
expression of salt-stress induced proteins was
associated with water deficit or defense responses.
Their regulation in leaves is still unclear. Therefore,
further study in SaLT gene product of these rice
varieties will provide more understanding about
their regulation and different actions in specific
tissues.

Proteomics is a powerful technique to


determine the global proteins for each physiological
Table 4 Protein identification of variable proteins among etiolated and green shoots using MALDI-QTOF.
Spot Etiolate
Green shoot
Mr(kDa)/pI
No. KDML RD15 RD6 KDML RD15 RD6
observe
105
105
21

Yes

Yes

No

Yes

Yes

No

14/5.5

Mr(kDa)/pI
calculate

Score

15/5.19

235

15/5.0

22

Yes

Yes

Yes

No

Yes

Yes

13.5/4.5

15/5.0
15/5.19

278

15/5.0

23

Yes

Yes

No

No

Yes

No

14/4.2

15/5.0
13/5.0

62

Protein Identification

Salt-stress induced
protein
SaLT gene product
Mannose binding
rice lectin
Salt-stress induced
protein
SaLT gene product
Mannose binding
rice lectin
P044D10.21

500

Kasetsart J. (Nat. Sci.) 38 (4)

LITERATURE CITED
Claes, B., R. Dekeyser, R. Villarroel, M. Van den
Bulcke, G. Bauw, M.V. Montagu and A.
Caplan. 1990. Characterization of rice gene
showing organ-specific expression in response
to salt stress and drought. Plant Cell 2: 19-27.
Damerval, C., D. de Vienne, M. Zivy and H.
Thiellement. 1986. Technical improvements
in two-dimensional electrophoresis increase
the level of genetic variation detected in wheatseedling proteins. Electrophoresis 7: 52-54.
Fukuda, M., N. Islam, S-H. Woo, A. Yamagishi,
M. Takaoka and H. Hirano. 2003. Assessing
matrix assisted laser desorption/ionizationtime of flight-mass spectrometry as a means
of rapid embryo protein identification in rice.
Electrophoresis 24: 1319-1329.
Jacobs, D., S.M. Rijssen, R. Heijden and R.
Verpoorte. 2001. Sequential solubilization of
proteins precipitated with trichloroacetic acid
in acetone from culture Catharanthus roseus
cells yields 52% more spots after twodimensional electrophoresis. Proteomics 1:
345-1350.
Komatsu, S., H. Konishi, S. Shen, G. Yang. 2003.
Rice proteomics; A step toward functional
analysis of the rice genome. Mol. & Cell.
Proteomics 2: 1-10.
Komatsu, S., A. Muhammad and R. Rakwal.
1999. Separation and characterization of
proteins from green and etiolated shoots of
rice (Oryza sativa L.) toward a rice proteome.
Proteomics 20: 630-636.
Mang, H.G., E.O. Kang, J.H. Shim, S-Y. Kim,
K.Y. Park, Y.S. Kim, Y.Y. Bahk and W.T.
Kim. 2004. A proteomic analysis identifies
glutathione S-transferase isoforms whose
abundance is differentially regulated by
ethylene during the formation of early root

epidermis in Arabidopsis seedlings. Biochim.


Biophys. Acta Gene Struct. Expr.. 1676:
231-239.
Mechin, V., L. Consoli, M.L. Guilloux and C.
Damerval. 2003. An efficient solubilization
buffer for plant proteins focused in
immobilized pH gradients. Proteomics 3:
1299-1302.
Rakwal, R. and G.K. Agrawal. 2003. Rice
proteomics: Current status and future
perspectives. Electrophoresis 24: 3378-3389.
Roberts, J.K.M. 2002. Proteomics and a future
generation of plant molecular biologists. Plant
Mol. Biol. 48: 143-154.
Schneider, G., Y. Kindqvist and C-I. Branden.
1992. RUBISCO: structure and mechanism.
Annu. Rev. Biophys. Biomol. Struct. 21:
119-143.
Salekdeh, Gh.H., J. Siopongco, L.J. Wade, G.
Ghareyazie and J. Bennett. 2002. A proteomic
approach to analyzing drought- and saltresponsiveness in rice. Field Crops Research
76: 199-219.
Trisiriroj, A., N. Jeyachok and S.T. Chen. 2004.
Proteomic characterization of different bran
proteins between aromatic and non-aromatic
rice (Oryza sativa L. subspecies indica).
Proteomics 4: 2047-2057.
Wilson, K.A., M.T. McManus, M.E. Gordon and
T.W. Jordan. 2002. The proteomics of
senescence in leaves of white clover, Trifolium
repens (L.). Proteomics 2: 1114-1122.
Woo, S.H., M. Fukuda, N. Islam, M. Takaoka, H.
Kawasaki, H. Hirano. 2002. Efficient peptide
mapping and its application to identify embryo
proteins in the rice proteome analysis.
Electrophoresis. 23: 647-654.
Zhu, J.K. 2002. Salt and drought stress signal
transduction in plants. Annu. Rev. Plant Biol.
53: 247-273.

Kasetsart J. (Nat. Sci.) 38 : 501 - 509 (2004)

Partial Purification of Mulberry (Morus rotunbiloba)


Peroxidase Using Aqueous Two-Phase Extraction Coupling
with Ion-exchange and Gel-filtration Chromatography
Supannapa Luanghiran1, Poontariga Harinnasut2, Amara Thongpan1,
Amonrat Proomboon2 and Sunanta Ratanapo2

ABSTRACT
The third to fifth leaves of mulberry plant were selected for peroxidase extraction due to its high
specific activity comparing to other sets of leaf. The initial enzyme isolation included homogenization
and extraction of phenolic compound using aqueous two-phase extraction system consisting of 20/8.9
%(w/v) PEG/(NH)2SO4. This system gave a satisfactorily less partition coefficient (0.018) and also less
peroxidase volume (34% of total volume). The purification was performed on a DEAE-Cellulose column
and double chromatography of Sephadex G-75. The overall result of mulberry peroxidase purification
gave 157.4-folds with 43.4% recovery. The native molecular weight of mulberry calculated from the
relative fraction of the standard curve from gel filtration was found to be 29 kDa as which agreed with
one band of the molecular weight identified by SDS-PAGE.
Key words: aqueous two-phase, mulberry leaf peroxidase, purification

INTRODUCTION
Peroxidase (E.C.1.11.1.7) is a group of
haemoprotein whose main function is to oxidize
various electron donor substrates at the expense of
H2O2. Peroxidase has often served as a parameter
to indicate the metabolic activity during growth
alteration. It is also one of the key enzymes
controlling plant differentiation and development.
This enzyme plays a role in the construction and
rigidification of cell wall by contributing to the
formation of lignin and cross-links between cell
wall protein, as well as protecting it from damage
and infection by pathogen. It is also an indicator of
plant stress (Seigel, 1993).

1
2

Peroxidase has been isolated and purified


from a number of organisms including fungi,
bacteria and higher plants. Horseradish (Amaracia
rusticana) root tubers are commonly employed for
commercial peroxidase production (Wilinder,
1992). However, peroxidase from different origins
especially of locally grown plants is being sought
after. Although palm and some tropical plants
seem to be a good primary source of peroxidase
(Sakharov et al., 2001), the leaves of mulberry,
Morus sp., is another potential source which has
not been purified for peroxidase before. Mulberry
plants are commonly found all over the country
and readily available to use.
As for enzyme purification, aqueous two-

Department of General Science, Faculty of Science, Kasetsart University, Bangkok 10900, Thailand.
Department of Biochemistry, Faculty of Science, Kasetsart University, Bangkok 10900, Thailand.

Received date : 16/06/04

Accepted date : 06/10/04

502

Kasetsart J. (Nat. Sci.) 38 (4)

phase extraction (ATPE) is an interesting method


to be used. This system provides a gentle
environment for biomolecule and offers the
advantages of high activity yield, high capacity
and easy to scale up. The conventional initial
purification step using ammonium precipitation is
laborious and time-consuming. ATPE uses less
time and low energy and is known to give
biocompatible environment to enzyme because a
lot of water in extraction system is involved.
Besides, the chemical materials used in this ATPE
system are inexpensive while the use of an aqueous
polymer and a lyotropic salt as ammonium sulfate
is preferred on an industrial scale. This was the
first attempt to use an aqueous two-phase extraction
for partial purification of peroxidase from mulberry
leaves and subjected the enzyme to DEAECellulose and double gel filtration chromatography.
MATERIALS AND METHODS
Mulberry leaves selection
The shoots, third to fifth, sixth to tenth and
eleventh to fifteenth leaves of mulberry plant
(Morus rotunbiloba Koidz.) from Udon Thani
province grown at the Department of Genetics,
Faculty of Science, Kasetsart University, Thailand,
were collected. They were separately subjected to
enzyme extraction. The specific activity of each
group of leaf was determined to select the highest
enzyme concentration to be used for enzyme
purification.
Preparation of enzyme extract
Crude enzyme extract was prepared by
grinding fresh mulberry leaves in 150mM sodium
phosphate buffer (pH 6.0) using a mortar and
pestle. The homogenate was filtered through a
linin cloth to remove suspended solid particle and
then centrifuged at 10,000 g for 10 min at 4C. The
supernatant was collected and kept at 4C for
further analysis.

Aqueous two-phase (ATP) system preparation


for the enzyme extraction
Aqueous two-phase (ATP) system was
prepared by mixing polyethylene glycol (PEG
M.W. 8,000) and ammonium sulfate with the
enzyme extract. The amount of PEG/(NH4)2SO4
was set at 15/10.1 (%w/v) and 20/8.9 (%w/v). The
entire mixture was stirred on ice and then poured
into a separatory funnel. The phases were allowed
to come to equilibrium as indicated by the yellow
color of the top phase and the green color of the
bottom phase. The top and bottom phases were
collected separately. Aliquots of each phase were
analyzed for enzyme activity and protein
concentration. The partition coefficient (m) of the
enzyme was calculated as the ratio of enzyme
concentration in the top phase to that of the bottom
phase by the equation: m = Ct/Cb where Ct and Cb
were the enzyme concentrations in the top phase
and bottom phase, respectively (Srinivas et al.,
1999).
Ion-exchange chromatography on DEAECellulose
The lower part of aqueous two-phase extract
was collected and dialyzed against 50mM
phosphate buffer (pH 6.0). The dialyzed sample
(25.26mg of total protein) was loaded onto a
DEAE-Cellulose column (0.510 cm) which has
been equilibrated with the same buffer. Bound
proteins were sequentially eluted with 50mM
phosphate buffer (pH 6.0) containing different
concentrations of NaCl, i.e., 0.5M NaCl, 1.0M
NaCl and 1.5M NaCl. Each fraction of 2.0 ml was
collected at a flow rate of 30 ml/hr. Protein
concentration
was
detected
using
spectrophotometer at the absorbency of 280 nm.
Peroxidase activity was further determined and
the fractions containing peroxidase activity were
pooled and concentrated using aquasorb before
subjecting to the following purification steps.

Kasetsart J. (Nat. Sci.) 38 (4)

Gel filtration chromatography on Sephadex G75


The pooled enzyme (12.88 mg of total
protein) from the previous step was dialyzed against
50mM phosphate buffer (pH 6.0) containing 20mM
NaCl. The enzyme was loaded onto a Sephadex G75 column (0.2530 cm) and eluted with the same
buffer at a flow rate of 30 ml/hr. The fractions
recovered were of 1.5 ml each. The enzyme and its
activity were determined as previously described.
Rechromatography of gel filtration on Sephadex
G-75
The pooled peroxidase (1.965 mg of total
protein) from Sephadex G-75 chromatography
was loaded onto the same size of column
(0.2530cm). The purification procedure was
repeated as described above. In addition, molecular
weight of mulberry leaf peroxidase could be
estimated from the standard curve having molecular
weight markers: alcohol dehydrogenase from yeast
(150 kDa), BSA (66 kDa), carbonic anhydrase
from bovine erythrocytes (29 kDa ) and cytochrome
C from horse heart (12.4 kDa) eluted from the
same column.
Electrophoresis
SDS electrophoresis (SDS-PAGE) was
carried out on a 5% acrylamide gel (stacking gel)
and a 12.5% acrylamide gel (separating gel) in the
presence of 0.1% SDS according to Laemmli
(1970). The gel was stained with silver stain
(Amersham Pharmacia Biotech). The molecular
weight marker used was a standard kit (Sigma)
containing BSA (66 kDa), egg albumin (45 kDa),
glyceraldehyde-3-phosphate dehydrogenase from
rabbit (36 kDa), carbonic anhydrase (29 kDa),
trypsinogen from bovine pancreas (24 kDa), trypsin
inhibitor (20.1 kDa) and - lactoalbumin from
bovine milk (14.2 kDa). Commercial horseradish
peroxidase was used as a standard peroxidase.
The samples from the fraction of each purification
step were loaded on the gel at 20 g protein/well.

503

Peroxidase assay and protein concentration


determination
Peroxidase activity was determined
spectrophotometrically at 25C by following the
formation of tetraguaiacol (Amax = 470 nm and
= 26.6 mM-1 cm-1) (Srinivas et al., 1999). The
assay mixture contained 330 l of 150 mM sodium
phosphate buffer (pH 6.0), 330 l of 150 mM
guaiacol and 30 l of enzyme sample. The reaction
was initiated by the addition of 330 l of 17 mM
H2O2, and the absorbance at 470 nm was recorded
within 0-5 min using Jenway 6400
spectrophotometer. One unit of peroxidase activity
(U) represents the amount of enzyme catalyzing
the oxidation of 1 mol guaiacol in one minute.
Protein concentration was determined by Lowrys
method (Lowry et al., 1951).
RESULTS AND DISCUSSION
To determine the suitable materials to be
used for peroxidase assay, the shoots, third to fifth
leaves, sixth to tenth leaves and eleventh to fifteenth
leaves the youngest to the oldest leaves were
tested. It was found that the third to fifth leaves
gave the best specific activity as seen in Figure 1.
They were, then, selected for peroxidase extraction.
Interestingly, these third to fifth leaves are also the
leaves generally collected to use as feed for
silkworm (Aruga, 1994).
The first step of the mulberry leaf peroxidase
purification, using aqueous two-phase extraction,
was performed to eliminate the phenolics that
were present in mulberry leaves. The results of the
peroxidase extraction at various phase
compositions are shown in Table 1. When
peroxidase extraction was partitioned in aqueous
two-phase system having PEG/(NH)2SO4 at 15/
10.1% and 20/8.9 %(w/v), the high activity of
peroxidase was found in the salt rich phase (bottom
phase). At the partition equilibrium, the color of
the top phase was yellowish brown while the color
of the bottom phase was green. It was anticipated

504
Specific Activity (unit/mg protein)

Kasetsart J. (Nat. Sci.) 38 (4)

4500
4000
3500
3000
2500
2000
1500
1000
500
0
shoots

third to fifth

sixth to tenth

eleven to fifteenth

Group of Mulberry Leaves


Figure 1 Specific activity of crude extract peroxidase from different sets of mulberry leaves.

Table 1 Aqueous two-phase extraction of mulberry leaf peroxidase with PEG/(NH4)2SO4 system.
Phase a
composition
(%w/v)

Volume of
top/bottom
Phase
(ml)

Partition
coefficient
(m)

Enzyme
recovery
(%)

Total
enzyme
activity
(U)

Specific b
activity
(U/mg)

Purification
(fold)

15/10.1
20/8.9

2.8/2.2
3.3/1.7

0.02
0.018

99.11
99.22

47,819.50
47,869.70

5,560.40
6,759.60

2.06
2.48

Note : a Total volume of phase composition was 5 ml.


b Initial specific activity of crude enzyme was 2,699 U/mg protein.

that the yellowish brown color seen in the top


phase could be the phenolic compound contained
in the mulberry leaves as also reported by Nomura
(1999). It is, therefore, beneficial to have this
contaminant separated from the remaining of the
peroxidase solution (Figure 2) in the early step of
extraction.
The partition coefficient (m) of the enzyme
was calculated as the ratio of enzyme concentration
in the top phase to that of the bottom phase by the
equation: m = Ct/Cb where Ct and Cb were the
enzyme concentrations in the top phase and bottom
phase, respectively. The less partition coefficient
value indicated the preferred condition of having
higher concentration of enzyme in the bottom
phase than in the top phase. Not only the peroxidase
from 20/8.9%(w/v) (PEG/(NH)2SO4) phase gave
a less partition coefficient value than that of the 15/

Figure 2 Separation of mulberry leaf peroxidase


using aqueous two-phase system
(ATPs) with the ratio of 20/8.9 PEG/
(NH4)2SO4 %(w/v).
10.1 %(w/v) (PEG/(NH)2SO4) phase but it also
gave less bottom phase volume. Therefore, the 20/
8.9 %(w/v) (PEG/(NH)2SO4) was proven to be

505

Kasetsart J. (Nat. Sci.) 38 (4)

better combination of aqueous two-phase extraction


system and was chosen for further purification
processing. The settlement of mulberry leaf
peroxidase found at the bottom phase was similar
to that of Impomea peroxidase as reported by
Srinivas et al. (2002). However, the partition
coefficient of Impomea peroxidase was as high as
0.175 while enzyme recovery was only 76.9% and
the total volume was 38%.
As for the second purification step, both
DEAE-Cellulose (anion exchange chromatography) and CM-Cellulose (cation exchange
chromatography) were used at the optimum pH of
mulberry leaf peroxidase(pH 6.0). It was interesting
to find that DEAE-Cellulose gave a better elution
of mulberry leaf peroxidase than using CMCellulose (result not shown) while most of the
contaminants were also adsorbed to the beads
(Figure 3). The common practice of using DEAECellulose was in the pH range of 5-9 and it was
found that the optimum pH of 6.0 not only gave a
considerably high peroxidase recovery (Table 2)

50 mM Pi

1.6

50 mM Pi
+ 0.5 M NaCl

but also kept the enzyme in the best condition. The


DEAE-Cellulose, therefore, was selected against
CM-Cellulose as a second purification column.
A major activity peak (fractions 10 to 12)
was obtained after peroxidase was passed through
a Sephadex G-75 column in the third step of
purification. The main peroxidase was eluted in a
narrow peak while most of the protein was eluted
as a broad peak (fractions 6 to 21) showing a better
elimination of the contaminated protein from
peroxidase in this step (Figure 4). However,
passing the elute through a Sephadex G-75 for the
second time resulted in having peroxidase activity
in fractions 10 and 11 (Figure 5). The results of
different steps of peroxidase purification are
summarized in Table 2.
The purification of peroxidase (7.3-folds)
obtained by using aqueous two-phase extraction
on mulberry leaves was proven to be better than
the one did by using acetone precipitation on
barley leaves (5.8-folds) (Saeki et al., 1986) or by
using ammonium precipitation on Opuntia ficus

50 mM Pi
+ 1.0 M NaCl

50 mM Pi
+ 1.5 M NaCl

3000

1.4

2000

A280

1
0.8

1500

0.6

1000

Activity (U/ml)

2500

1.2

0.4
500

0.2
78

71

64

57

50

43

36

29

22

15

0
1

Fraction number
Figure 3 Elution profile of mulberry leaf peroxidase obtained from DEAE-Cellulose column. The total
protein of 25.26 mg from aqueous two-phase extraction fraction was loaded onto DEAECellulose column. The column (size: 0.5 10 cm) was eluted with phosphate buffer (pH 6.0)
at 30 min/hr. Fractions No. 6 - 10 were pooled to determine the peroxidase activity. ( )
protein profile, (--------- ) peroxidase activity.

506

Kasetsart J. (Nat. Sci.) 38 (4)

indica (1.2-folds) (Padiglia et al., 1995). However,


it was similar to ammonium precipitation on royal
palm leaves (7.7-folds) (Sakharov et al., 2001).
Yet, enzyme recovery from using aqueous two-

phase extraction of mulberry leaf peroxidase was


better (144%) than that of royal palm leaves (82%).
Considering the second purification step, a
better mulberry peroxidase purification (34.9-

0.25

8000
7000

0.2

5000

A280

0.15

4000
0.1

3000

Activity (U/ml)

6000

2000
0.05

25

23

21

19

17

15

13

11

1000
0

Fraction number

300

200
150
100

Activity (U/ml)

250

50
19

17

15

13

11

0
3

0.04
0.035
0.03
0.025
0.02
0.015
0.01
0.005
0

A280

Figure 4 Elution profile of mulberry leaf peroxidase from Sephadex G-75. Protein of pooled active
fractions No.6 10 from DEAE-Cellulose column (12.88 mg of total protein) was loaded onto
the Sephadex G-75. The column (size: 0.25 30 cm) was eluted with phosphate buffer
(pH 6.0) at 30 min/hr. Fractions No. 10-12 were pooled to determine the peroxidase activity.
( ) protein profile, (--------- ) peroxidase activity.

Fraction number
Figure 5 The repeated elution profile of mulberry leaf peroxidase on Sephadex G-75. The total protein
of 1.965 mg was loaded onto the column (size: 0.5 10 cm) and was eluted with phosphate
buffer (pH 6.0) at 30 min/hr. Fractions No. 10 - 11 were pooled to determine the peroxidase
activity. (
) protein profile, (--------- ) peroxidase activity.

507

Kasetsart J. (Nat. Sci.) 38 (4)

Table 2 Overall results of different steps of mulberry leaf peroxidase purification.


Fraction

Total protein
(mg)

Crude extract
ATPE
(PEG/(NH4)2SO4)
DEAE-Cellulose
Sephadex G-75
Rechromatography
on Sephadex G-75

100
60.3
22.9
9.48
2.75

Total activity
(U)

Specific activity
(U/mg)

5,740,500.0
2,525,820.0

5,740.5
41,905.6

1
7.3

100.0
144.0

4,580,919.0
3,058,686.5
2,491,377.0

200,343.5
322,616.1
903,554.7

34.9
56.2
157.4

79.8
53.3
43.4

folds) was achieved using DEAE-Cellulose column


than from using CM-Cellulose column on barley
leaves (17-folds) (Saeki et al., 1986) and also from
using DEAE-Cellulose column on Opuntia ficus
indica (3.8-folds) (Padiglia et al., 1995). However,
purification folds of mulberry leaf peroxidase at
this step was similar to that of royal palm leaves
using DEAE-Tyropearl column (30-folds)
(Sakharov et al., 2001).
Finally, our overall purification of mulberry
leaf peroxidase using four steps obtained 157.4-

Purification
(fold)

Recovery
(%)

folds with 43.4% recovery. It was reported in


Opuntia ficus indica (82-folds with 47% recovery)
(Padiglia et al., 1995) and in royal palm leaves
using six steps (73-folds with 12.5% recovery)
(Sakharov et al., 2001).
The native molecular weight of mulberry
leaf peroxidase was found to be 29 kDa as calculated
from the relative fraction of the standard curve
from gel filtration (Figure 6). It was found that
molecular weights of peroxidase in other organisms
vary greatly from 220 kDa of bacterium,

200

log MW (KDa)

10 2

Alcohol
Dehydrogenase
(150 KDa)

90
80
70
60
50

Mulberry Peroxidase
BSA
(66 KDa)

40
30

Carbonic
Anhydrase
(29 KDa)

20

Cytochrom C
(12.4 KDa)

1
10
9

8
7
6
5

-.05

0.00

.05

.10

.15

.20

.25

.30

Kav
Figure 6 Gel filtration showing standard curve of molecular weight markers. The native molecular
weight of mulberry leaf peroxidase is 29 kDa as indicated by the arrow.

508

Kasetsart J. (Nat. Sci.) 38 (4)

45 kDa
36 kDa
29 kDa

Figure 7 SDS-PAGE of partial purified mulberry leaf peroxidase. Lane a, molecular marker consisting
of BSA (66 kDa), ovalbumin (45 kDa), glyceraldehyde-3-phsphate dehydrogenase from rabbit
(36 kDa), carbonic anhydrase (29 kDa), trypsinogen from bovine pancreas (24 kDa), lactoalbulin from bovine milk (14.2 kDa); lane b, Commercial HRP standard peroxidase; lane
c, crude peroxidase extract; lane d, aqueous two-phase extraced peroxidase; lane e, DEAECellulose fraction; lane f, Sephadex G-75 fraction; lane g, rechromatograph on Sephadex G75 fraction. 20 g protein was loaded on each well, except 30mg protein of lane g. Proteins
were separated on 12.5 % of SDS-PAGE and silver- stained.

Flavobacterium meningosepticum (Koga et al.,


1999) to 28 kDa of tobacco, Nicotiana tabacum
(Kim et al., 1980).

peroxidase was 29 kDa as calculated from gel


filtration while the result from SDS-PAGE was
not conclusive due to some contamination.

CONCLUSION

ACKNOWLEDGEMENTS

The third to fifth leaves of mulberry (Morus


rotunbiloba) was the most suitable source of
peroxidase with highest specific activity of 4,000
U/mg protein comparing to the other groups of
mulberry leaves. A 20/8.9% (w/v) of PEG/
(NH)2SO4 was the best phase composition for
mulberry leaf peroxidase extraction giving 2.48purification folds and 99.22% recovery. After
having passed through aqueous two-phase
extraction, DEAE-Cellulose and double
chromatography on Sephadex G-75, the overall
purification of mulberry leaf peroxidase gave
157.4- purification folds and 43.3% recovery. The
native molecular weight of mulberry leaf

This work was financially supported by the


grants from the Graduate School, Kasetsart
University, and Kasetsart University Research
and Development Institute (KURDI).
LITERATURE CITED
Aruga, H. 1994. Principle of Sericulture. A.A.
Balkema, Rotterdam.
Kim, S.S., S.H. Wender and E.C. Smith. 1980.
Isolation and characterization of two
isoperoxidases from tobacco tissue cultures.
Phytochemistry 19: 165-168.
Laemmli, U.K. 1970. Cleavage of structural

Kasetsart J. (Nat. Sci.) 38 (4)

proteins during the assembly of the head of


bacteriophage T4. Nature 227: 680-685.
Lowry, O.H., N.J. Rosebrough, A. Lewis Farr, and
R.J. Randall. 1951. Protein measurement
with the folin phenol reagent. J. Biol. Chem.
193: 265 - 275.
Nomura, T. 1999. The chemistry and biosynthesis
of isoprenylated flavonoids from moraceous
plant. Pure. Appl. Chem. 71: 1115 1118.
Padiglia, A., E. Cruciani, G. Pazaglia, R. Medda
and G. Floris. 1995. Purification and
characterization of Opuntia peroxidase.
Phytochemistry 38: 295 - 297.
Sakharov, I., M.K. Vesga, I. Galeav, I.V. Sakharova
and O. Pletjushkina. 2001. Peroxidase from
leaves of royal palm tree Roystonea regia:
purification and some properties. Plant Sci.
161: 835 - 860.
Seiki, K., O. Ishikawa, T. Fukuoka, H. Nakagawa,
Y. Kai, T. Kanuno, J. Yamashita, N. Kasai

509

and T. Horio. 1986. Barley leaf peroxidase:


purification and characterization. J. Biochem.
99: 485 - 494.
Siegel, B.Z. 1993. Plant peroxidase: an organismic
perspective. Plant Growth Reg. 12: 303 312.
Srinivas, N.D., K.R. Rashmi and K.S. Raghavarao.
1999. Extraction and purification of a plant
peroxidase by aqueous two-phase extraction
coupled with gel filtration. Process Biochem.
35: 43 - 48.
, R.S. Barhate and K.S. Raghavarao. 2002.
Aqueous two-phase extraction in combination
with ultrafiltration for downstream processing
of Ipomoea peroxidase. J. Food Eng. 54: 1 6.
Wilinder, K.G. 1992. Superfamily of plant,fungal
and bacterial peroxidase. Cur.Op. Structural
Bio. 2: 388-393.

Kasetsart J. (Nat. Sci.) 38 : 510 - 514 (2004)

Assay of Acetaminophen in Paracetamol Tablets


by Differential Pulse Voltammetry
Duncan Thorburn Burns1,2, Nipon Tungkananuruk2, Sumaporn Kasemsumran2
and Kanita Tungkananuruk3

ABSTRACT
A simple and precise procedure using differential pulse voltammetry was developed for the assay
of acetaminophen in paracetamol tablets. The peak current from acetaminophen in 0.1 mol L-1 phosphate
buffer pH 7.0 was measured using a glassy carbon electrode and a Ag/AgCl reference electrode. The
optimum step potential and modulation amplitude were 0.0020 and 0.0500 V, respectively. The linear
calibration range was 0-300 g ml-1, the detection limit and recovery were 0.15 g ml-1 and 99.4%,
respectively. The results were compared with those obtained by the U.S.P XXII official method.
Key words: acetaminophen; paracetamol, differential pulse voltammetry, glassy carbon electrode

INTRODUCTION
Paracetamol (acetaminophen) is widely
used as an analgesic and antipyretic drug. Many
assays have been described for acetaminophen
including titrimetry (Blake and Shumaker, 1973),
chromatography (McSharry and Savage, 1980;
Carroll et al., 1981 and Wang and Dewald, 1984),
fluorometry (Oztunc, 1982), colorimetry (Murfin
and Wragg, 1972; Belal et al., 1979; Elsayed et
al.,1979; Sane and Kamat, 1980; Afshari and Liu,
2001), UV spectrophotometry (Das et al., 1989),
and various modes of electrochemistry (Miner et
al., 1981; Navarro et al., 1988; Bramwell et al.,
1990; Bramwell et al., 1994; Gilmartin and Hart,
1994; Erdogdu and Karagozler, 1997; Lau et al.,
1989; Zen and Ting, 1997; Wang et al., 2001 and
Ozkan et al., 2003). Although the electrochemical
1
2
3

oxidation of paracetamol at a glassy carbon


electrode has been in the literature for some times,
(Miner et al., 1981) only a few applications of its
use in differential pulse voltammetry have been
reported for determination of the drug in blood
plasma and in a single type of tablet (Navarro et al.,
1988) and in a variety of drug formulations
containing paracetamol (Lau et al., 1989). Recently,
the differential pulse voltammetric behaviour of
some drugs including paracetamol at various
conducting polymers (Erdogdu and Karagozler,
1997) and at pumice mixed carbon electrodes
(Ozkan et al., 2003) have been examined and
reviewed (Wang et al., 2001).
A simple differential pulse voltammetric
method utilizing a glassy carbon electrode vs. Ag/
AgCl for the assay of acetaminophen was reported.
The method was applied successfully to assay of

Department of Analytical Chemistry, The Queens University of Belfast BT9 5AG UK.
Department of Chemistry, Faculty of Science, Kasetsart University, Bangkok 10900, Thailand.
Department of Chemistry, Faculty of Science, King Mongkuts Institute of Technology, Lardkrabang, Bangkok 10520,
Thailand.

Received date : 06/09/04

Accepted date : 27/12/04

Kasetsart J. (Nat. Sci.) 38 (4)

acetaminophen in paracetamol tablets. The


procedure did not show bias, unlike the earlier
method which showed 2.8-7.4 % positive bias, for
simple paracetamol tablets (Lau et al., 1989).
The work was carried out to provide a low
capital cost, inexpensive to operate alternative to
a UV spectrophotometric assay and also to avoid
the use of organic solvent.
MATERIALS AND METHODS
Apparatus
Voltammograms were recorded with
Potentiostat PGSTAT 20 (Autolab), interfaced to
663 VA stand (Metrohm) and Socos computer. A
three-electrode configuration was used with a
glassy carbon electrode (Metrohm) as the working
electrode, a silver-silver chloride reference
electrode (Metrohm) and a platinum wire auxiliary
electrode (Metrohm). The working electrode was
pretreated by polishing it with an alumina water
slurry, followed by washing in an ultrasonic bath.
Reagents and solutions
All reagents used were of analytical reagent
grade and ultra pure water (Millipore Model
ZFR0058008 coupled with a Millipore Model
ZF050UV ultra pure water system) was used
throughout. Acetaminophen standard solution

511

1000 g ml-1, was prepared freshly by dissolving


0.10 g of acetaminophen (Fluka, 98% by HPLC)
in 100 ml of warm water. More dilute solutions
were prepared by dilution with 0.10 mol L-1
phosphate buffer solution, pH 7.0, as required.
The solutions were stored in a cool, light protected
cool location. Phosphate buffer solution pH 7.0,
was prepared by mixing 41.30 ml of 0.10 mol L-1
potassium dihydrogen phosphate with 58.70 ml of
0.10 mol L-1 disodium hydrogen phosphate.
General procedure
A 20 ml aliquot of 30 g ml -1
acetaminophen standard solution in 0.1 mol L-1
phosphate buffer pH 7.0 was pipetted into the
voltammetric cell. The solution was stirred using
solvent-saturated nitrogen for 180 seconds.
Differential pulse voltammograms were recorded,
scanning the potentials from -1.0 to +1.2 V vs.
Ag/AgCl at a step potential of 0.002 V and
modulation amplitude of 0.05 V. Acetaminophen
is oxidized giving a peak current near +0.38 V
(Fig.1). A direct calibration curve method and the
standard addition method were used to evaluate
the acetaminophen contents of commercial samples
of paracetamol tablets.
For the standard addition method, 20 ml of
an unknown sample solution in 0.1 mol L-1
phosphate buffer pH 7.0 was pipetted into the

Figure 1 Differential pulse voltammogram for 30 g ml-1 acetaminophen in 0.1 mol L-1 phosphate
buffer pH 7.0 at a glassy carbon electrode vs. Ag/AgCl.

512

Kasetsart J. (Nat. Sci.) 38 (4)

voltammetric cell. Five voltammograms were


recorded using the conditions described above,
after adding 0.00, 0.50, 1.00, 1.50 and 2.00 ml of
1000 g ml-1 acetaminophen standard solution.
Procedure for paracetamol tablet samples
Twenty tablets of paracetamol were
weighed and then powdered. A 0.1 g of powdered
tablets was weighed accurately and placed in a 250
ml conical flask. A 70 ml of warm water was
added into the flask. The sample was swirled to
dissolve for 30 minutes and left cool. The sample
solution was filtered through a filter paper
(Whatman No.42) into a 100 ml volumetric flask.
The filtrate was made up to the volume. A 8 ml and
a 3 aliquot of sample solutions was pipetted into a
100 ml volumetric flasks and made up to volume
with 0.1 mol L-1 phosphate buffer pH 7.0 for the
direct calibration method and the standard addition
method, respectively. All the commercial samples
of paracetamol tablets were produced in Thailand.
RESULTS AND DISCUSSION
Effect of parameters
The peak currents were examined as a
function of the step potential and modulation
amplitude. A step potential of 0.002 V and a
modulation amplitude of 0.05 V were selected for
the rest of the experiments because at these values
the voltammograms were smooth and gave
maximum peak currents. The anodic current was
independent of the nitrogen gas purge time in the
range of 0 to 420 seconds. Dissolved oxygen in
solution did not affect the anodic peak current at
potentials in the range of -1.00 V to +1.20 V. A
nitrogen gas purge time of 180 seconds was used
in subsequent work for the purpose of stirring.
The number of electrons involved in the
oxidation of acetaminophen
The anodic peak potential, Ep,a from
voltammograms of acetaminophen was measured

at various pH of the media. A linear relationship


was found between Ep,a and pH over the pH range
of 3-11. It was found that Ep,a (V vs. Ag/AgCl) =
-0.0309pH + 0.7169 (r = 0.991) with a slope of
-0.0309 mV/pH unit. For an exact Nernstian
response, the slope would be expected to be 0.0295
for two-electron and two-proton process. It was
concluded, confirming the earlier fluorimetric work
(Oztunc, 1982), that acetoaminophen was
electrochemically oxidised in a pH-dependent,
two-electron, two-proton process to N-acetyl-pquinoneimine. The maximum of anodic current
was obtained at pH 7.0, using 0.1 mol L-1 phosphate
buffer.
Calibration curve, precision, recovery and
detection limit
The relationship between concentration and
peak height anodic current was linear from 0 to
300 g ml-1 of acetaminophen. A concentration
range of 27 to 135 g ml-1 of acetaminophen was
chosen for calibration curve preparation because
in this range the correlation coefficient was almost
unity (r = 0.9997). For the determination of 30 g
ml-1 of acetaminophen, the coefficient of variation
was 1.44% based on 15 results and the recovery
from the standard addition experiments was 99.43%
based on 5 results. The detection limit was 0.15 g
ml-1.
Sample analysis
The contents of acetaminophen in four
commercial brands of paracetamol tablets were
determined from five replicates of each sample.
The results obtained are summarized in Table 1.
The method was checked against results obtained
by the USP XXII official spectrophotometric
method and showed close agreement between the
differential pulse method and the reference method.
In addition, the results agreed well with the
manufacturers stated values. The close agreement
found between the differential pulse voltammetric
method and the reference method confirmed the

513

Kasetsart J. (Nat. Sci.) 38 (4)

Table 1 Assay of acetaminophen in paracetamol tablet samples.


Sample

Declared
acetaminophen
content per
tablet
(mg)

Acetaminophen
USP XXII
Acetaminophen
USP XXII
found by
official method
found by
official method
calibration
by calibration standard addition,
by standard
curve,
curve*
differential pulse*
addition*
differential pulse*
(mg)
(mg)
(mg)
(mg)

Daga
Hoescht

500.0

497.02.8

499.22.4

498.31.3

499.21.8

Paraceamol
Thai Gov. Pharma.

500.0

496.92.2

499.62.7

498.91.0

499.42.1

Sara
Nakorn Patana

500.0

497.32.5

499.22.2

499.11.6

499.52.5

Tylenol
OLIC(Thai)

500.0

498.22.8

499.12.9

499.12.2

499.51.6

*mean 95% confidence for five replicates

absence of any effects from the small amounts of


excipients present.
CONCLUSION
A differential pulse voltammetric method
was developed for the assay of acetaminophen
involving oxidation at a glassy carbon electrode.
This method was simple, requiring no separation
stage, rapid and sufficiently precise for the routine
assay of acetaminophen in paracetamol tablets.
LITERATURE CITED
Afshari, J. T. and T.-Z. Liu. 2001. Rapid
spectrophotometric method for the
quantitation of acetaminophen in serum :
Analyt. Chim. Acta. 43: 165-169.
Belal, S. F., M. A.H. Elsayed, A. Elwalily and H.
Abdine. 1979. Spectrophotometric determination of acetaminophen and salicylamide
through nitrosation and subsequent chelation.

Analyst. 104: 919-927.


Blake, M. I. and L. B. Shumaker.1973.
Differentiating non-aqueous titration of
mixtures containig acetaminopehen and
salicylamide. J. Ass. Off. Analyt. Chem. 56:
653-655.
Bramwell, H., A.E.G. Cass, P. N. B. Gibbs and M.
J. Green.1990. Method for determining
paracetamol in whole blood by
chronoamperometry following enzymatics
hydrolysis. Analyst. 115: 185-188.
Carroll, M. A., E. F. White and J. E. Zarembo.
1981. Over-the-counter drug analyses with
HPLC. Analyt. Chem. 53: 1111A-1114A.
Das, S., S. C. Sharma, S. K. Talwar and P. D. Sethi.
1989. Simultaneous spectrophotometric
determination of mefenamic acid and
paracetamol in pharmaceutical preparations.
Analyst. 114: 101-103.
Elsayed, M. A-H., S. F. Belal, A. A-F. M. Elwalily
and H. Abdine.1979. Spectrophotometric
determination of acetaminophen, salicylamide

514

Kasetsart J. (Nat. Sci.) 38 (4)

and codeine phosphate in tablets. Analyst.


104: 620-625.
Erdogdu, G. and A. E. Karagozler.1997.
Investigation and comparison of the
electrochemical behavior of some organic
and biological molecules at various conducting
polymer electrodes. Talanta. 44: 2011-2018.
Gilmartin, M. A. T. and J. P. Hart.1994. Rapid
detection of paracetamol using a disposable,
surface-modified screen-printed carbon
electrode. Analyst. 119: 2431-2437.
Lau, O.W. , S.F. Luk and Y.M. Cheung.1989.
Simultaneous determination of ascorbic acid,
caffeine and paracetamol in drug formulations
by differential-pulse voltammetry using a
glassy carbon electrode. Analyst. 114: 10471051.
McSharry, W. O. and I. V. E. Savage.1980.
Simultaneous high-pressure liquidchromatographic determination of
acetaminophen,
guaiphenesin
and
dextromethorphan hydrobromide in cough
syrup. J. Pharm. Sci. 69: 212-214.
Miner, D. J., J. R. Rice, R. M. Riggin and P. T.
Kissinger. 1981. Voltammetry of
acetaminophen and its metabolites. Analyt.
Chem. 53: 2258-2263.
Murfin, J. W. and J. S. Wragg. 1972. A colorimetric
method for the determination of phenacetin

and paracetamol. Analyst. 97: 670-675.


Navarro, I., D. Gonzalez-Arjona, E. Roldan and
M. Rueda.1988. Determination of paracetamol
in tablets and blood plasma by differential
pulse voltammetry. J. Pharm. Biomed. Anal.
6: 969-976.
Ozkan, S. A., B. Uslu and H. Y. Aboul-Enein.
2003. Analysis of pharmaceuticals and
biological
fluids
using
modern
electroanalytical techniques. Crit. Rev.
Analyt. Chem. 33: 155-181.
Oztunc, A.1982. Fluorimetric determination of
acetaminophen as its dansyl derivative.
Analyst. 107: 585-587.
Wang , J. and H. D. Dewald. 1984. Electrochemical
detector for liquid chromatography based on
a reticulated vitreous carbon electrode in a
thin-layer cell. J. Chromat. 285: 281-287.
Wang, C., X. Hu, Z. Leng, G. Yang and G. Jin.
2001. Differential pulse voltammetry for
determination of paracetamol at a pumice
mixed carbon electrode. Analyt. Lett. 34:
2747-2759.
Zen , J.-M. and Y-S Ting.1997. Simultaneous
determination of caffeine and acetaminophen
in drug formulations by square-wave
voltammetry using a chemically modified
electrode. Analyt. Chim. Acta. 342: 175180.

Kasetsart J. (Nat. Sci.) 38 : 515 - 522 (2004)

Application of the Dual Sorption Model for Water Adsorption


of Maltodextrin Various DE
Suched Samuhasaneetoo1, Siree Chaiseri1, Imad A. Farhat3,
Tanaboon Sajjaanantakul1 and Rungnaphar Pongsawatmanit2

ABSTRACT
To characterize water sorption of maltodextrin various DE, several physical properties were
determined, including molecular weight, glass transition temperature, sorption isotherm and 1H pulsed
NMR. The average numbers of molecular weight (Mn) and average weight of molecular weight (Mw)
were 1,800,27,000; 900, 7,700; 700, 4,400 and water at monolayer were 5.5296, 4.6753 and 4.4553 g
water/100 g dry solid for maltodextrin DE 5, 14 and 18.5 respectively. Sorption isotherms indicated DE
5 and DE 14 to exhibit an s shape isotherm while for DE 18.5 a discontinuous isotherm occurred.
Maltodextrin DE 5 adsorbed more water than DE 14 and 18.5. Dual Sorption theory was applied for
sorption data analysis and the parameter (CH) was estimated. The results indicated that maltodextrin DE
5 had higher sorption in microvoid than maltodextrin DE 14 and 18.5. This was strongly supported with
the results obtained by 1H pulsed NMR, that maltodextrin DE 5 had more mobile proton mobility in the
low relative humidity region than maltodextrin DE 18.5.
Key words: maltodextrin, sorption isotherm, dual sorption, 1H NMR, microvoid

INTRODUCTION
The dual sorption theory has been
extensively utilized to explain the equilibrium
sorption of penetrants in polymers and
heterogeneous media (Chandrasekaran et al.,
1980). Sorption of penetrants in glassy polymers is
more complex than in a rubbery state (Koros and
Paul, 1978; Chan and Paul, 1980) and exhibits
nonlinear concentration dependence (Wang and
Kamiya, 1999). The total sorption concentration C
consists of two populations or sorption modes.
One population CD held by ordinary dissolution, is
described by Henrys law while the second

1
2
3

population, CH sorbed by a fixed number of sites


or holes is described by a Langmuir isotherm.
Many investigators have associated the
Langmuir capacity of glassy polymers with frozen
microvoid nature, believed to be characteristic of
these nonequilibrium materials, as a result of smallscale inhomogeneity (Barrer et al., 1958). The
extreme restriction on the backbone motions of
amorphous polymers at temperatures significantly
below glass transition temperature (Tg) causing
chain relaxation to be very slow with the result that
trapped excess free volume which may be
sufficiently immobilized over a very long time is
important in terms of frozen microvoids (Koros

Department of Food Science and Technology, Faculty of Agro-industry, Kasetsart University, Bangkok 10900, Thailand.
Department of Product Development, Faculty of Agro industry, Kasetsart University, Bangkok 10900, Thailand.
Division of Food Science, The University of Nottingham, Sutton Bonington campus, Loughborough, United Kingdom.

Received date : 30/07/04

Accepted date : 30/09/04

516

Kasetsart J. (Nat. Sci.) 38 (4)

and Paul, 1978).


1H pulsed NMR has been used to study the
proton mobility in solid system and the pulse was
applied to characterize water in polymer solids
(Kumagai et al., 2002). The Free induction decay
(FID), the signal decay recorded after radio
frequency applied at 90 with a permanent magnetic
field switched off, contained the important
information such as the intensity of the FID signal
which was directly proportional to the total number
of protons in the sample and the protons in physical
or chemical environments decaying at different
rates. The observation of FID was a superposition
of one (one type of proton) or more individual
FIDs, each from different types of proton. Each
FID had a characteristic time constant called
relaxation time, T2 (sec). Ruan et al. (1999) found
that proton mobility of immobile protons of
maltodextrin increased when temperature was
around glass transition temperature.
The aim of this study was to investigate the
effect of DE of maltodextrin on water sorption and
dual sorption theory was used to characterize the
sorption behavior of maltodextrin at different DEs
which was probably correlated to the retention of
flavour.
MATERIALS AND METHODS
Material
Maltodextrin with DEs of 5, 14 and 18.5
(Cerestar, UK) were used in this study.
Molecular weight
A Gel Permeation Chromatograph System
PL110 (Polymer laboratories, USA) was used
with an Ultralinear hydrogel column set (Waters,
USA) to determine the weight average molecular
weight (Mw), the number average molecular weight
(Mn) and polydispersity of maltodextrin. The
sample was prepared by dissolving maltodextrin
1% (w/w) in deionised water and injected at 20 l
using deionised water as mobile phase. The flow

rate was 0.6 ml/min at 30C. RI was used as a


detector.
Glass transition temperature
A known amount (8-10 mg) of sample was
placed in aluminum sample pan (Perkin Elmer,
UK), and was analyzed by DSC 7 (Perkin Elmer,
UK). The instrument was calibrated with standard
indium and cyclohexane. An empty pan was used
as reference. The samples were heated to 160C at
10C/min. After heating, the sample was cooled
down to -20C and reheated to 160C at 10C/min.
Maltodextrin re-spray drying
Due to the differences in size of maltodextrin
various DE, a difference in sorption might occur.
To get rid off this problem, re-spray drying was
applied. Maltodextrin as received DE 5, 14 and
18.5 20 grams were dissolved in 100 milliliters of
distilled water, then spray dried with a spray dryer
APV Anhydro, the inlet and outlet temperatures
were 200 and 90C respectively. The spray dried
products were kept in a tight plastic box at 5C for
further analysis.
Particle size distribution
Particle size distribution was determined
using a Malvern Mastersizer (Malvern Instrument,
UK). The volume size average d32 was used as
particle size distribution parameters. The
measurements were performed in duplicate.
Sorption isotherm
Maltodextrin with various DE were dried
in a tight container over phosphorous pentaoxide
(P2O5) for a week and then equilibrated with LiCl,
CH3COOK, K2CO3, Na2Cr2O7, NaBr, CuCl2,
NaCl, KCl and K2SO4 saturated salt solution for
equilibrium relative humidity of 11.3, 22.5, 35.2,
54.8, 59.5, 67.7, 75.5, 85.1 and 97.0% respectively,
for 3 weeks and heated by oven at 105C for 6
hours or until constant weights were reached. The
calculated moisture contents as a dry basis were

517

Kasetsart J. (Nat. Sci.) 38 (4)

plotted to show the relationship between moisture


content and %RH as sorption isotherm (Laaksonen
and Roos, 2000). The sorption data was fit with
BET model. The monolayer parameter was
calculated.
Proton relaxation by 1H Pulsed NMR.
Maran 33 spectrophotometer was used and
operated at 23 MHz. Samples were sealed in an 8
mm internal diameter NMR tube. Proton free
induction decays (FID) were measured between 0100C. The signal decay after radio frequency
applied at 90 with a permanent magnetic field
switched off was recorded. Spin-Spin Relaxation
Time (T2m) was calculated. The measurements
were performed in duplicate.
RESULTS AND DISCUSSION
Molecular weight
The average weight of molecular weight
(Mw), the average number of molecular weight
(Mn) and the polydispersity of maltodextrin DE 5,
14 and 18.5 are shown in Table 1. When DE
increased, Mn and Mw decreased. Hydrolysis of
starches cut large molecules down into small
fractions. DE 5 had a higher polydispersity than
the others. It had a wide range of molecular
distribution which could affect the mechanical
properties of final product such as its film forming
properties.
Glass transition temperature (Tg)
The results are shown in Table 2. The %RH
affected glass transition temperature. When %RH
increased, Tg decreased. Water played a role as a
plasticizer (Roos, 1995). As the water content
increased, Tg decreased monotonically, because
the average molecular weight of maltodextrinwater decreased which led to increased
intermolecular space or free volume. Maltodextrin
low DE had higher Tg than high DE. This indicated
that low molecular weight molecules had higher

Table 1 M n , M w and Polydispersity of


maltodextrin DE 5, 14 and 18.5.
DE

Mn

Mw

Polydispersity

5
14
18.5

1,800
900
700

27,000
7,700
4,400

14.84
8.48
6.09

Table 2 Glass transition temperature (C) of


maltodextrin DE 5, 14 and 18.5 at various
relative humidity.

DE

11.3

%RH
54.5

75.5

5
14
18.5

152.38
118.87
98.34

82.41
56.62
45.19

49.01
38.24
6.51

molecular mobility than high molecular weight


molecules. From the results shown in Table 2,
maltodextrin DE 5 and 14 had higher Tg than the
temperature used in the sorption experiment while
DE 18.5 at 75%RH had lower Tg than the
temperature in the sorption experiment. This
indicated that sorption experiments especially at
low relative humidity region were done in the
glassy state.
Sorption isotherm
The adsorption isotherms of commercial
maltodextrins of various DE are shown in Figure
1. The particle sizes of maltodextrin DE 5, 14 and
18.5 were not significantly different (Table 4).
The effect of particle size was minimal.
Maltodextrin DE 5 absorbed more water than
those with DE 14 and 18.5 at the same relative
humidity (RH). Maltodextrin DE 5 and DE 14
exhibited S shape (type II) sorption isotherms
indicating a noncrystallizing system character.
McMinn and Magee (1997) tested the sorption
isotherm of potato starch gel and potato starch

518

Kasetsart J. (Nat. Sci.) 38 (4)


DE 5
DE 14
DE 18.5

g water/100 g dry solid

25

20

15

10

0
0

10

20

30

40

50
RH (%)

60

70

80

90

100

Figure 1 Water sorption isotherm of maltodextrin DE 5, 14 and 18.5 at 25C. The solid line is the BET
fitted curve.
with 25, 50 and 75% glucose. Sorption isotherms
of starch with increasing glucose content had
relatively low moisture contents in the low water
activity region. Moates et al. (1997) tested sorption
isotherm of maltooligomers at 20C. At low aw,
the maltooligomers which had higher molecular
weight adsorbed more water than the low molecular
one. Maltodextrin DE 18.5 exhibited a discontinuity
in the sorption isotherm at RH higher than 67.7%
and absorbed less water than maltodextrin DE 5
and 14 at RH 67.7-97%. The discontinuity in the
sorption isotherm and less water absorption
indicated that crystallisation or molecular
entanglement might occur. Discontinuity in the
sorption isotherm indicated that crystallization
might occur which led to a decrease in the solubility
of maltodextrin due to molecules trying to rearrange
themselves to more tightly packed which could
not hold water as much as before (Saltmarch and
Labuza, 1980). Non-crystallizing system adsorbed
more water due to more space between molecules,
while tightly packed molecules adsorbed only on
the outside of the surface.
Water at monolayer
Water at the monolayer was calculated by

fitting the experiment data with the BET Model


results shown in Figure 1. The BET Model plotted
for maltodextrin exhibited that it fitted with the
experiment data for maltodextrin DE 5 and 14
while DE 18.5 fitted just only up to %RH less than
0.75. Crystallization might play an important role
in the deviation from that model fitting (Saltmarch
and Labuza, 1980). The calculated water at the
monolayer is shown in table 3. Mm refers to the
BET-monolayer limit for water vapor absorption
which represents the maximum number of
hydrophilic binding sites of water on material
(Zhang and Zografi, 2000). When DE increased,
the water at the monolayer decreased. High DE
maltodextrin had low molecular weight and was
Table 3 Water at monolayer (M m )
maltodextrin DE 5, 14 and 18.5.
DE

Mm

5
14
18.5

5.5296a
4.6753b
4.4553bc

of

In a column, means with the same letters are not significantly


different at p<0.05

519

Kasetsart J. (Nat. Sci.) 38 (4)

supposed to have more hydroxyl end groups due to


more hydrolysis during maltodextrin production.
As the molecular weight decreased, the number of
chain ends per unit weight increased. That mean
adsorption sites were newly produced when the
molecular weight decreased. This controversial
results showed that high DE had less water
adsorption than low DE maltodextrin. This might
indicate a different structure of maltodextrin at
low molecular weight (high DE maltodextrin)
which probably had a tights structure than that
with a high molecular weight (low DE
maltodextrin).
Dual-mode sorption
In general, sorption equilibria in glassy
polymers are more complex than in rubbers (Koros
and Paul, 1978). The dual-mode sorption model
has provided a useful explanation of the data for
many gas-glassy polymer systems. The sorption
data of maltodextrin of various DE fits with eq.2.
The parameter CH obtained is shown in Table 5.
CH value decreased when DE increased. When
the molecular weight decreased (more short chain
molecules, high DE), molecules had more mobility
than long chain molecules (low DE) and packed
more tightly which reduced space between
molecules and then reduced water adsorption.
This result conformed to the sorption isotherm
result as mentioned earlier. Barrer et al. (1958)
and many investigators associated the Langmuir
capacity of glassy polymers with frozen
microvoids. Chan and Paul (1980) studied
solubility of CO2 in annealed Polycarbonate at 35
C. The result showed that CH decreased
Table 4 Mean particle size (m) of maltodextrin.
DE

Mean particle size (m)

5
14
18.5

31.922.4
39.585.9
32.491.5

considerably as the duration of annealing increased.


During annealing at sub Tg (temperature below
Tg), molecular mobility and rearrangement to
reach equilibrium was expected. Barrie et al.
(1980) studied sorption of hydrocarbon vapors in
glassy polymer at different temperature and found
that CH decreased as the temperature increased.
Koros and Paul (1978) conducted a sorption
experiment of CO2 in Poly (ethylene Terephthalate)
above and below Tg. The results indicated that C
H decreased as the temperature increased and
disappeared when temperature reached Tg.
Proton relaxation time (Spin-Spin Relaxation)
The results above showed that CH value
obtained from dual sorption at low relative humidity
region, decreased when DE of maltodextrin
increased. The study of proton relaxation behavior
according to water by maltodextrin should support
the dual sorption scenario. Free Induction Decay
from 1 H NMR of maltodextrin DE 5 and
18.5storage at 25C, %RH = 11.3, 54.5 and 75.5
were determined. The experiment data was fitted
with following equation (Van den Dries et al.,
1998):
a 2 t 2 sin bt
t
F(t ) = A exp
+ B exp

2 bt
T2 m
A = contributions of the immobile proton
in the sample.
B = contributions of the mobile proton in
the sample.
Table 5 Langmuir saturation constant (CH)
of maltodextrin DE 5, 14 and 18.5.
DE

CH

5
14
18.5

3.0874a 0.4021
1.5996b 1.0710
1.5636bc 0.2982

In a column, means with the same letters are not significantly


different at p<0.05

520

Kasetsart J. (Nat. Sci.) 38 (4)

a = Gaussian line shape with standard


deviation.
b = total width rectangular line shape of
immobile proton fraction.
T2m = Spin-Spin relaxation time of mobile
proton fraction.
The effect of DE and %RH on T2m of
maltodextrin is shown in Figure 2. At low %RH
(less than monolayer level, Table 4), maltodextrin
all DE had very low T2m, which was 105-106 time
(for DE 5 and 18.5) smaller than the value of free
water (~3s). Hills et al. (1999) mentioned that at
low water contents, where structural water played
an important role, relaxation was very short.
Rugraff et al. (1996) stated that at low water
content (<5 g water/ 100 g dry solid) of wheat
starch, all water proton present had a solid like
behavior. This indicated that the water molecules
were strongly bound by maltodextrin matrix,
probably via hydrogen bond to the hydroxyl groups
of the maltodextrin molecules (Hills et al., 1999).
T2m increased with increasing moisture content.
When water increased, there were more hydrogen
bonds forming between water molecules, which
lead to increased mobility and longer T2m (Van

den Dries et al., 1998). DE 5, at water content


4.01%, there were 4.01 water molecules per
maltodextrin molecule. It was less probable that
the water molecule was next to the other. Increasing
the water content to 10.7%, there were 10.7 water
molecules per maltodextrin molecule. The
probability of hydrogen bonds between the water
molecules increased and led to an increase of
mobility. Hemminga et al.(1999) stated that the
less concentrated the system, the less rigid the
hydrogen bond net work. Maltodextrin DE 18.5
had the same trend but had less T2m than DE 5 due
to less water molecule per maltodextrin molecule.
The intensity of an NMR signal was directly
proportional to the number of protons contributing
to it. It could be concluded that maltodextrin DE
5 absorbed more water than maltodextrin DE 18.5
at a low relative humidity region. It is probable
that the low DE of maltodextrin had more free
water to be adsorbed to free space between
molecules than high DE. High DE also had less
space between molecules which resulted in strong
hydrogen bonds between the hydroxyl group of
maltodextrin and water (Saltmarch and Labuza,
1980 ; Bell and Labuza, 2000). This strongly
supported the existence of microvoids.

Figure 2 Comparison of sorption isotherms and relaxation times (T2m) at 20C of maltodextrin DE 5
and 18.5, storaged at various aw at 25C.

Kasetsart J. (Nat. Sci.) 38 (4)

CONCLUSION
Sorption isotherms clearly showed that
maltodextrin Low DE adsorbed more water at a
low relative humidity region. Dual-mode sorption
theory was applied for the sorption data analysed.
It was found that maltodextrin low DE had high
microvoid compared to high DE ones. This scenario
was strongly supported by T2m relaxation of mobile
proton that maltodextrin DE 5 had more mobile
proton mobility than DE 18.5. This could be
explained by the molecular weight of maltodextrin
that low DE had higher molecular weight and
resulted in higher Tg which lowers molecular
mobility.
From those results it implied that when
rubbery maltodextrin cooled down or water
evaporated during spray drying, it moved from
rubbery to glassy state. Molecules stoped moving,
and unrelaxed molecules created microvoids. Low
DE maltodextrin created more microvoids which
allowed penetrant molecules to diffuse through.
Because of this, low DE maltodextrin as a flavour
encapsulation carrier retained less flavour
components after spray drying compared to high
DE.
LITERATURE CITED
Barrer, R.M., J.A. Barrie and J. Slater. 1958.
Sorption and diffusion in ethyl cellulose. part
III. comparison between ethyl cellulose and
rubber. Journal of Polymer Science 27:
177-197.
Barrie, J.A., M.J.L. Williams and K. Mundy. 1980.
Sorption and diffusion of hydrocarbon vapors
in glassy polymers. Polymer Engineering
and Science 20: 20-29.
Bell, N.L. and T.P. Labuza. 2000. Moisture
Sorption : Practical Aspects of Isotherm
Measurement and Use.
American
Association of Cereal Chemists, Minasota.
Chan, A.H. and D.R. Paul. 1980. Effect of SubTg annealing on CO 2 sorption in
polycarbonate. Polymer Engineering and

521

Science 20: 87-94.


Chandrasekaran, S.K., P.S. Campbell and T.
Watanabe. 1980. Application of the Dual
Sorption model to drug transport through
skin. Polymer Engineering and Science 20:
36-39.
Hemminga, M.A., I.J. Van Den Dries, P.C.M.M.
Magusin, D. Van Dusschoten and C. Van Den
Berg. 1999. Molecular mobility in food
components as studied by magnetic resonance
spectroscopy. In Y.H. Roos, R.B. Leslie and
P.J. Lillford (eds.). Water Management in
The Design and Distribution of Quality
Foods. Technomic Publishing, Langcaster.
Hills, B.P., C.E. Manning and J. Godward. 1999.
A multistate theory of water relations in
biopolymer systems, pp. 45-62. In P.S. Belton,
B.P. Hills and G.A. Webb (eds.). Advances
in Magnetic Resonance in Food Science.
The Royal Society of Chemistry, Cambridge.
Koros, W.J. and D.R. Paul. 1978. CO2 Sorption
in Polyethylene terephthalate above and below
glass Transition. Journal of Polymer
Science: Polymer Physics Edition 16: 19471963.
Kumagai, H., W. MacNaughtan, I.A. Farhat and
J.R. Mitchell, 2002. The influence of
carrageenan on molecular mobility in low
moisture amorphous sugars. Carbohydrate
Polymers 48: 341-349.
Laaksonen, T.J. and Y.H. Roos. 2000. Thermal,
dynamic-mechanical, and dielectric analysis
of phase and state transitions of frozen wheat
doughs. Journal of Cereal Science 32: 281292.
McMinn, W.A.M. and T.R.A. Magee. 1997.
Moisture sorption characteristics of starch
materials. Drying Technology 15: 15271551.
Moates, G.K., T.R. Noel, R. Parker and S.G. Ring.
1997. The effect of chain length and solvent
interactions on the dissolution of the B-type
crystalline polymorph of amylose in water.
Carbohydrate Research 298: 327-333.
Roos, Y.H. 1995. Phase Transition in Foods.

522

Kasetsart J. (Nat. Sci.) 38 (4)

S.L. Tatlor ed. Academic Press, San Diego.


Ruan, R., Z. Long, P. Chen, V. Haung, S. Almaer
and I. Taub. 1999. Pulse NMR Study of Glass
Transition in Maltodextrin. Journal of Food
Science 64: 6-9.
Rugraff, Y.L., P. Desbois and D.J. Le Botlan.
1996. Quantitative analysis of wheat starchwater suspensions by Pulsed NMR
spectroscopy. Carbohydrate Research :
185-194.
Saltmarch, M. and T.P. Labuza. 1980. Influence
of relative humidity on the physicochemical
state of lactose in spray-dried sweet whey
powders. Journal of Food Science 45:
1231-1236.
Schmidt, S.J. 1991. Determination of moisture
content by pulsed nuclear magnetic resonance

spectroscopy, pp. 599-613. In H. Levine and


L. Slade (eds.). Water Relationships in
Food. Plenum Press, New York.
Van den Dries, I., D. Van Dusschoten and M.
Hemminga. 1998. Mobility in maltose-water
glasses stidied with 1H-NMR. Journal of
Physical Chemistry 102: 10483-10489.
Wang, J.-S. and Y. Kamiya. 1999. A Method of
validation and parameter evaluation for dualmode sorption model. Journal of Membrane
Science 154: 25-32.
Zhang, J. and G. Zografi. 2000. The Relationship
between BET- and free volume-derived
parameters for water vapor absorption into
amorphous solids.
Journal of
Pharmaceutical Sciences 89: 1063-1072.

Kasetsart J. (Nat. Sci.) 38 : 523 - 530 (2004)

Prevalence of Flavobacterium psychrophilum Infection in Ayu


(Plecoglossus altivelis) in Gunma Prefecture, Japan and Comparison
of the gyr B Sequences of Isolates
Hajime Arai1, Yukio Morita2, Kunihiro Nobusawa1, Masanao Arai1,
Sumalee Boonmar3 and Hirokazu Kimura4

ABSTRACT
The prevalence of cold-water disease (CWD) in ayu (Plecoglossus altivelis) caused by
Flavobacterium psychrophilum was investigated in 3 different sites along the Tone River in Gunma
Prefecture, Japan. F. psychrophilum was isolated from 7 of 8 fishes from site A (88%), 15 of 101 from
site B (15%), and 3 of 8 from site C (38%). The gene encoding DNA gyrase subunit B (gyrB) of F.
psychrophilum in 16 isolates was partially sequenced. Among the 16 strains, 15 strains had gene
sequences that completely matched those of a species type strain (NCIMB1947T). Another strain
confirmed one nucleotide substitution, however, the codon resulting from this substitution was synonymous
with that in the type strain sequence. The results suggested that CWD was widespread in the Tone River
of Gunma Prefecture, with little genetic divergence from the species type strain.
Key words: ayu, Flavobacterium psychrophilum, gyr B, sequence analysis

INTRODUCTION
Ayu (Plecoglossus altivelis) which belongs
to family Osmeridae and genus Plecoglossus, is a
highly popular food and game fish in Japan.
Flavobacterium psychrophilum causes cold-water
disease (CWD) in various fish including ayu, coho
salmon (Oncorhynchus kisutch), and rainbow trout
(Oncorhynchus mykiss) (Wakabayashi et al., 1991;
Holte et al., 1993; Lorenzen et al., 1997; Kondo et
al., 2001; Mata et al., 2002; Madetoja and Wiklund,
2002). After F. psychrophilum was first isolated
from ayu in Japan with CWD in 1987, the organism
has rapidly spread (Wakabayashi et al., 1991).

1
2
3
4

Outbreaks of CWD caused by F. psychrophilum


killed not only a large number of fries but also adult
fishes, making the disease a serious problem for
the fishing industry in several countries (Lorenzen
et al., 1997; Madetoja et al., 2002; Michel and
Garcia, 2003), including Gunma Prefecture, Japan.
However, much of the epidemiology of CWD and
F. psychrophilum remains poorly understood.
F. psychrophilum can be detected and
analyzed using culture methods, Polymerase Chain
Reaction -Restriction Fragment Length
Polymorphism (PCR-RFLP) analysis, and typespecific PCR methods (Toyama et al., 1994; Izumi
and Wakabayashi, 1997; Nilsson and Strom, 2002;

Gunma Prefectural Institute of Fisheries, 13 Shikishima, Maebashi, Gunma 371-0036, Japan.


Gunma Prefecture Science and Technology Promotion Office, 1-1-1 Ote, Maebashi, Gunma 371-8570, Japan
Department of Microbiology and Immunology, Kasetsart University, Bangkok 10900, Thailand.
Gunma Prefectural Institute of Public Health and Environmental Sciences, 378 Kamioki, Maebashi, Gunma 371-0052, Japan.

Received date : 13/06/04

Accepted date : 19/11/04

524

Kasetsart J. (Nat. Sci.) 38 (4)

Izumi et al., 2003). Previous report showed DNA


gyrase subunit B (gyrB) gene had relatively genetic
diversity using PCR-RFLP, suggesting that this
gene is a useful tool for molecular epidemiologic
analysis of F. psychrophilum (Izumi et al., 2003).
Thus, the sequence analysis of gyrB gene in isolates
and the prevalence of CWD caused by F.
psychrophilum in ayu in Gunma Prefecture, Japan
were investigated.
MATERIALS AND METHODS
A total of 117 ayu samples were collected
from 3 sites along the Tone River in Gunma
Prefecture, Japan, between May and June 2002.
The geographic locations of the 3 sites are shown
in Figure1. Dead or dying ayu fishes having focal
ulceration of muscle, bleeding over areas of the
body surface, and gill pallor were collected. Ayu
suspected to have CWD were stored at 4C and
analyzed within 8 h after obtaining from the river.
Isolation and identification of F.
psychrophilum were carried out. Ulcerated areas

were dissected from muscle, gill, and kidney, and


inoculated in a modified cytophaga agar (MCA;
liter, 13.0 g agar, 10.0 g tryptone, 2.5 g beef
extract, 2.0 g yeast extract, 0.2 g CH3COONa, 0.2
g CaCl2 - 7H2O, and 0.2 g MgSo4-- 7H2O, pH 7.2)
(Wakabayashi and Egusa, 1974). MCA inoculated
with gill specimens was incubated for 7 days at 10
C. The MCA inoculated with other specimens was
incubated for 5 days at 18C. Isolates grown in
MCA were identified using an antiserum slide
agglutination method with a rabbit antiserum and
2 kinds of PCR methods targeting 16S ribosomal
RNA gene and gyrB gene from F. psychrophilum.
The antiserum was obtained from the Japan
Fisheries Resource Conservation Association
(Tokyo, Japan). The primers of PCR method
targeting 16S ribosomal RNA gene were 5CGATCCTACTTGCGTAG-3 and 5GTTGGCATCAACACACT-3, producing a
theoretical amplicon of 1,089 nucleotides (Toyama
et al., 1994), and the primers targeting gyrB gene
were 5-TGCAGGAAATCTTACACTCG-3 and
5-GTTGCAATTACAATGTTGT-3, producing

Gunma Prefecture
A:88% (7/8)
37 N

B:15% (15/101)

Japan

20

Tone river

20 km

C:38% (3/8)

36 N
139 E

Site designation: % (positive/no. examined).


Figure 1 Locations of sampling site within Gunma Prefecture and prevalence of Flavobacterium
psychrophilum among dead or dying ayu having typical signs of cold-water disease.

525

Kasetsart J. (Nat. Sci.) 38 (4)

the amplicon of 1,017 nucleotides(Izumi and


Wakabayashi, 1997). After identification of the
isolates as F. psychrophilum, the gyrB in 16 F.
psychrophilum isolates was partially sequenced
(Table 1. As shown in Table 2, new primers were
designed and used to amplify a portion of the gyrB
gene from F. psychrophilum (theoretical size,
400nt). The PCR reaction was performed using
PCR Master Mix (Promega, Madison, WI)

following the condition: 94C, 5min; 30 cycles of


94C, 30 sec, 51C, 90 sec, and 72C, 2 min; an
additional 5 min at 72C in the last cycle.
Amplicons were electrophoresed on a 1.5% agarose
gel. After purification of DNA fragments with a
QIAquick PCR purification kit (Qiagen, Germany),
the nucleotide sequence was determined using an
automated DNA sequencer (ABI 310 DNA
sequencer, Applied Biosystems, USA) and a Dye

Table 1 F. psychrophilum isolates in Gunma Prefecture and compaired strains in this study.
Isolatea/Strain

Source
Locality

No.of gyrB
sequence

Ayu
Ayu
Ayu

Gunma,Japan(site A)
Gunma,Japan(site B)
Gunma,Japan(site B)

AB111950c
AB111949
AB111950c

Ayu
Coho salmon
Ayu
Coho salmon
Rainbow trout
Oikawa
Ayu
Ayu
Rainbow trout
Rainbow trout

Gunma,Japan(site C)
Washington,U.S.A
Tokushima,Japan
Miyagi, Japan
Tokyo,Japan
Hiroshima,Japan
Shiga,Japan
Okayama,Japan
Okayama,Japan
Brittany,France

AB111950c
AB034732
AB012860
AB034733
AB034740
AB034745
AB034736
AB034737
AB034741
AB034739

Host fishb
G02-02,G02-03,G02-04, G2-05
G02-01
G02-06, G02-07, G02-08, G02-09
G02-10, G02-11, G02-12,
G02-13, G02-14, G02-15,
G02-16
NCIMB 1947T
FPC840
FPC817
FPC814
FPC945
FPC956
OKA9805
OKR9802
TG-P01/88
a
b

c
T

16 strains(G02-01-G02-16) were sequenced.


The scientific names of fishes are Oncorhynchus kisutch for coho salmon, O. mykiss for rainbow trout, Peoglossus altivelis for
ayu and Zacco platipus for oikawa.
The gyrB sequences of G02-02 and the other 15 isolates are sharing the accession number of AB111950
The type strain of the species.

Table 2 Nucleotide sequences of primers used.

1/

Primer

Position1/

Nucleotide sequences (5'-3')

Fpsy-F
Fpsy-R

611-630
1010-991

GAACCCGTTTTCGAAAGTCA
TACCACGCAAGCTAAACACG

Positions indicated represent the gyrB gene sequences of Flavobacterium psychrophilum NCIMB1947T (GenBank accession
number AB034732).

526

Kasetsart J. (Nat. Sci.) 38 (4)

Terminator Cycle Sequencing Ready Reaction Kit


(Applied Biosystems) (Kojima et al., 2002). DNA
sequences of gyrB were analyzed phylogenetically
using CLUSTAL W program on the DNA databese
of Japan(DDBJ) (http://www.ddbj.nig.ac.jp/
search/clustalw-e.html) and TreeView program.
The gyrB sequences of F. psychrophilum species
type strain NCIMB1947T (GenBank accession
no. AB034732) , FPC840 (AB012860), FPC817
(GenBank accession no. AB034733), FPC956
(AB034736), OKA9805 (AB034737), FPC945
(AB034745), FPC814 (AB034740), TG-P01/88
(AB034739), and OKR9802 (AB034741) and other
species of Flavobacterium such as F. aquatile
(AB034225), F. ferrugineum(AB073076), F.
johnsoniae(AB034222), F. salegens(AB034227),
and F. uglinosum(AB034224) previously accessed
on GenBank were determined simultaneously.
Evolutionary distances were estimated using
Kimuras two-parameter method (Kimura, 1980)
and phylogenetic trees were constructed using
neighbor-joining(N-J) method selecting F. aquatile
as the outgroup. Reliability of the tree was estimated
using 1,000 botstrap replications.
RESULTS AND DISCUSSION
As shown in Figure 1, F. psychrophilum
was isolated and identified from 7 of 8 fishes from
site A (88%), 15 of 101 fishes from site B (15%),
and 3 of 8 fishes from site C (38%). Thus, CWD
caused by F. psychrophilum appeared to be
widespread in the Tone River of Gunma Prefecture,
Japan from May to June, 2002. All isolates were
only obtained from kidney specimens.
A portion of gyrB gene was successfully
sequenced in 16 F. psychrophilum isolates and F.
psychrophilum species type strain NCIMB1947T
(GenBank accession no. AB034732) and strain
FPC840 (accession no. AB012860). No insertions
or deletions were observed; indeed, 15 strains had
partial gyrB sequences (400 nt) completely
matching with those of a species type strain

(NCIMB1947 T) and strain FPC840. Only one


nucleotide substitution (position 773; A to C) was
found in strain G02-01. However, the codon
resulting from this substitution was synonymous
with that in the NCIMB1947 T and FPC840 strain
sequences. In contrast, 9 nucleotide substitutions
and 8 amino acids substitutions were detected
among 8 gyrB sequence of F. psychrophilum strains
accessed on GenBank (Table 3). All F.
psychrophilum strains had 99.8 to 100% nucleotide
sequence homology and 99.3 to 100% amino acid
sequence homology (Table 3). Phylogenetic trees
constructed by N-J method in the strains and
Flavobacterium bacteria are shown in Figure 2. In
the rooted tree, about 10% of genetic diversity
could be seen in the rpoB gene among all strains,
and these strains were divided into two clusters, I
and II. F. aquatile, F. johnsoniae, F. uglinosum,
F.ferrugineum, and F. salegens belong to cluster I,
while strains of F. psychrophilum belong to cluster
II. Only 1% genetic diversity was seen within
cluster II. Thus, our strains were genetically
closely related to NCIMB1947 T , although
comparing only partially sequences of gyrB genes
(Table 3, Figure 2).
At three sampling points, F. psychrophilum
was detected in 15% to 88% of dead or dying ayu
having typical signs of CWD. The results suggested
that CWD caused by F. psychrophilum was
widespread in the Tone River of Gunma Prefecture,
Japan. CWD caused by F. psychrophilum in ayu
was recognized in 1987, and the pathogen has
rapidly spread in Japan (Wakabayashi et al., 1991).
In 1994, CWD was found in small populations of
ayu in Gunma prefecture, but F. psychrophilum
was not isolated and identified at that time.
Subsequently, a large number of ayu were killed
by CWD and F. psychrophilum was detected in
that outbreak (Nakano et al., 2001). The results
are consistent with those described in an earlier
report (Wakabayashi et al., 1991). However, the
reason for the recent increasing of CWD remains
unknown, therefore, additional studies are required.

527

Kasetsart J. (Nat. Sci.) 38 (4)

F. psychrophilum was isolated from kidney


tissue only. A recent study using in situ
hybridization demonstrated that F. psychrophilum
can infect and be detected in various tissues from
ayu including gill, heart, and muscle as well as
kidney (Liu et al., 2001). An agar plate cultivation
method was used to isolate F. psychrophilum.
Thus, one possible difference in this detection
failure in exstrarenal organs could be a low
sensitivity of agar cultivation comparing to in situ
hybridization. Further studies should be performed
to detect the gyrB gene of F. psychrophilum in
various tissues from ayu with lesions of CWD.
The gyrB gene encodes the subunit B protein
of DNA gyrase; variation in this subunit has been
used for taxonomic classification of various
bacteria (Fukushima et al., 2002). Sequences of
the gyr B genes imply that the rate of molecular
evolution is greater than that as determined by 16S

rRNA sequences (Fukushima et al., 2002;


Yamamoto and Harayama, 1998). Izumi et al.
(2003) analyzed gyrB genes from various fishes
including ayu, coho salmon, rainbow trout using
PCR-RFLP method. They demonstrated that
restricting fragments gave 4 electrophoresed
patterns on agarose gel and the fragments patterns
from ayu differed from the type strain
(NCIMB1947T) (Izumi et al., 2003). According
to the report by Izumi et al.(2003) the type strain
was type S and type R had one nucleotide mutation
(accession no. AB034732, type strain position
163, C to T ). Another sequence position (position
611-1010) was used. In this study, part of the gyrB
was sequenced and compared to nucleotides and
amino acids sequences of the gene. The gyrB and
amino acids sequences of these isolates were
genetically similar to the gene of F. psychrophilus
NCIMB1947T. The results suggested that in

Table 3 Nucleotide divergences and the supposed amino acid changes found in gyrB of F. psychrophilum
isolates and strains.
Isolate/Strain

Nucleotide(amino acid) divergence


Positiona

G02-02(14)c
G02-01
FPC814
FPC840
FPC817
FPC945
FPC956
OKA9805

OKR9802
TG-P01/88
a

b
c
d

Divergenceb
Noned

C 773
G 797

(Arg)
(Lys)

A
A

(Arg)
(Glu)

G
C
C
A
T
T
C
A

(Leu)
(Val)
(Tyr)
(Ala)
(Pro)
(Ser)
(Leu)
(Asp)

Noned
A 808
T 840
A 933
G 902
C 1046
C 1086
T 831
T 834

(Leu)
(Ala)
(Ser)
(Arg)
(Ser)
(Phe)
(Pro)
(Glu)

Nucleotide and the position in gyrB were according to those of NCIMB 1947T(AB034732). Supposed amino acid was enclosed
in parenthesis.
Nucleotide and supposed amino acid changes in position.
The number in parenthesis is the number of F. psychrophilum isolates which have identical gyrB sequences with G02-02.
No nucleotide change was detected.

528

Kasetsart J. (Nat. Sci.) 38 (4)

F.aquatile
F.johnsoniae
F.uglinosum
F.ferrugineum
F.salegens

F. psychrophilum
FPC945
OKA9805
G02-01
NCIMB1947T,G02-02-G02-16, FPC840
TG-P01/88
FPC817
OKR9802
FPC956
FPC814
Diversity
0.01

Figure 2 Phylogenetic rooted tree of the gyrB gene in Flavobacterium spp. constructed by the neighborjoining method.
Gunma Prefecture, ayu with CWD might be
infected with F. psychrophilum which was
genetically related to NCIMB1947T. The species
type strain, NCIMB1947 T, was isolated from
coho salmon in the state of Washington, USA
(Borg, 1960). Together with the preliminary results,
this close identity suggested common genetic
characteristics between the strains acquired and
this USA type strain, which may represent a major
pathogen of CWD in ayu in Gunma Prefecture.
Better understanding of the epidemiology of CWD
and F. psychrophilum will require further molecular
epidemiologic studies.

including ayu (Plecoglossus altivelis) was isolated


in 3 different sites (site A, B and C) along the Tone
River in Gunma Prefecture, Japan. The prevalence
of F. psychrophilum was 88%(7/8) in site A,
15%(15/101) in site B, and 38%(3/8) in site C.
Sequence analysis of gyr B gene in 16 isolates of
F. psychrophilum was investigated and compared
to the species type strain (NCIMB1947T). It was
found that 15 strains had gene sequences completely
matched the species type strain. The result
suggested that CWD was widespread in the Tone
River of Gunma Prefecture, with little genetic
divergence from the species type strain.

CONCLUSION

ACKNOWLEDGEMENTS

Flavobacterium psychrophilum causing


cold-water disease (CWD) in various fishes

This work was partly supported by research


fund for promoting science and technology by

Kasetsart J. (Nat. Sci.) 38 (4)

Gunma Prefecture, Japan.


LITERATURE CITED
Borg, A.F. 1960. Studies on myxobacteria
associated with disease in salmonid fishes.
Wildl. Dis. 8: 1-85.
Fukushima, M., K. Kakinuma, and R. Kawaguchi.
2002. Phylogenetic analysis of Salmonella,
Shigella, and Escherichia coli strains on the
basis of the gyrB gene sequence. J. Clin.
Microbiol. 40: 2779-2785.
Holt, R.A., J.S. Rohovec and J.L. Fryer. 1993.
Bacterial cold-water disease, pp. 3-22. In V.
Inglis, R.J. Roberts, N.R. Bromage (eds.).
Bacterial Disease of Fish. Blackwell
Scientific Publications, London.
Izumi, S. and H. Wakabayashi. 1997. Use of PCR
to detect Cytophaga psychrophilum from
apparently healthy juvenile ayu and Coho
salmon eggs. Fish Pathol. 32: 169-173.
Izumi, S. and H. Wakabayashi. 2000. Sequencing
of gyrB and their application in the
identification
of
Flavobacterium
psychrophilum by PCR. Fish Pathol. 35: 9394.
Izumi, S., F. Aranishi, and H. Wakabayashi. 2003.
Genotyping
of
Flavobacterium
psychrophilum using PCR-RFLP analysis.
Dis. Aquat. Org. 56: 207-214.
Kimura, M. 1980. A simple method for estimating
evolutionary rates of base substitutions
through comparative studies of nucleotide
sequences. J. Mol. Evol.16: 111-120.
Kojima, S., T. Kageyama, S. Fukushi, F.B.
Hoshino, M. Shinohara, K. Uchida, K. Natori,
N. Takeda, and K. Katayama. 2002.
Genogroup-specific PCR primers for detection
of Norwalk-like viruses. J. Virol. Methods
100: 107-114.
Kondo, M., K. Kawai, K. Yagyu, K. Nakayama,
K. Kurohara, and S. Oshima. 2001. Changes
in the cell structure of Flavobacterium

529

psychrophilum with length of culture.


Microbiol. Immunol. 45: 813-818.
Liu, H., S. Izumi, and H. Wakabayashi. 2001.
Detection of Flavobacterium psychrophilum
in various organs of ayu Plecoglossus altivelis
by in situ hybridization. Fish Pathol. 36: 711.
Lorenzen, E., I. Dalsgaard, and J.F. Bernardet.
1997. Characterization of isolates of
Flavobacterium psychrophilum associated
with coldwater disease or rainbow trout fry
syndrome I: phenotypic and genomic studies.
Dis. Aquat. Org. 31: 197-208
Madetoja, J. and T. Wiklund. 2002. Detection of
the fish pathogen Flavobacterium
psychrophilum in water from fish farms. Syst.
Appl. Microbiol. 25: 259-266.
Madetoja, J., I. Dalsgaard, and T. Wiklund. 2002.
Occurrence of Flavobacterium psychrophilum
in fish-farming environments. Dis. Aquat.
Org. 52: 109-118.
Mata, M., A. Skarmeta, and Y. Santos. 2002. A
proposed serotyping system for
Flavobacterium psychrophilum. Lett. Appl.
Microbiol. 35: 166-170.
Michel, C. and C. Garcia. 2003. Virulence stability
in Flavobacterium psychrophilum after
storage and preservation according to different
procedures. Vet. Res. 34: 127-132.
Nakano, A., T. Kuge, S. Kurosawa, K. Yoshizawa.
and K. Nobusawa. 2001. Epidemiologic
studies on cold-water disease in ayu in Gunma
Prefecture. Annual Report of Gunma
Fisheries Experiment Station 7: 28-30.
Nilsson, W.B., and M.S. Strom. 2002. Detection
and identification of bacterial pathogens of
fish in kidney tissue using terminal restriction
fragment length polymorphism (T-RFLP)
analysis of 16S rRNA genes. Dis. Aquat.
Org. 48: 175-185.
Toyama, T., K. Kita-Tsukamoto, and H.
Wakabayashi. 1994. Identification of
Cytophaga psychrophila by PCR targeted

530

Kasetsart J. (Nat. Sci.) 38 (4)

16S ribosomal RNA. Fish Pathol. 29: 271275.


Wakabayashi, H., M. Horinouchi, T. Bunya, and
G. Hoshiai. 1991. Outbreaks of cold-water
disease in coho salmon in Japan. Fish Pathol.
26: 211-212.
Wakabayashi, H., and S. Egusa. 1974.
Characteristics of Myxobacteria associated

with some freshwater fish diseases in Japan.


Bulletin of the Japanese Scientific Fisheries
40: 751-757
Yamamoto, S., and S. Harayama. 1998.
Phylogenetic relationships of Pseudomonas
putida strains deduced from the nucleotide
sequences of gyrB, rpoD and 16S rRNA genes.
Int. J. Syst. Evol. Microbiol. 3: 813-819.

Kasetsart J. (Nat. Sci.) 38 : 531 - 538 (2004)

Evaluation of Thai Foods Prepared with Soluble Fiber Composite


from Rice Bran and Barley Flour
Patcharee Tungtrakul, Payom Auttaviboonkul, Boonma Niyomvit
and Saipin Maneepun

ABSTRACT
Soluble fiber composite from rice bran and barley, which substituted for coconut cream in Thai
foods, was found to give acceptable Thai foods with lower saturated fat contents. It was possible to reduce
the saturated fats in Kanom Ping Kaset, pumpkin pudding, layer cake, dip sauce for fried pot crust, taro
custard and saute chicken curry by 47.78, 94.28, 59.75, 75.27, 61.3 and 60.61%, respectively. The Kanom
Ping Kaset, at a 40% fiber gel substitution, showed an increased textural firmness and a cholesterol
reduction of 20.49%. Pumpkin pudding, at a 100% substitution level, produced a softer semi-moist
texture with a reduction of 94.28% saturated fat. Layer cake displayed a colorful and elastic product at
lower substitution levels. However, at higher level it became less colorful with a tougher texture. The dip
for fried pot crust increased suspension viscosity with increasing fiber gel substitution levels. Taro
custard, even at 80% substitution, had good acceptability scores. The texture was preferable as it
contained cereal, which gave the product more moisture. The saute chicken curry sauce became thicker
when the fiber gel substitution was increased. The differences in texture and flavor, however, appeared
to make small changes in the overall score of general acceptability or suitability of the fiber gel foods.
Key words: rice bran, barley flour, coconut cream, low-fat, fiber

INTRODUCTION
Dietary fat-reduction and caloric intake are
considered important factors in maintaining good
health. People with high blood cholesterol levels
are considered to be at risk for heart disease.
Cereal grains have been recognized to be effective
in lowering serum cholesterol (Inglett and Newman,
1994). An analysis of several studies has shown
the consistent efficacy of oats as a
hypocholesterolemic agent in humans (Ripsin et
al., 1992). The Food and Drug Administration has
recently allowed rolled oats, oat flour and oat bran
to claim health benefits provided that they are used

to give at least 3 grams of soluble fiber [(1-3) (14) - beta D- glucan] per day and used as a part of
a low-saturated fat, low-cholesterol diet (Food and
Drug Administration, 1997a). Soluble fiber
products, such as oat trim, have been widely used
as fat replacement ingredients (Inglett, 1993). More
recent activities are based on using biologically
active soluble fibers as nutraceuticals and food
supplements (Inglett, 1999). The technology for
making these types of soluble fiber products was
extended to making barley and rice soluble fiber
products (Inglett, 2000). This study was made to
determine the effect of using soluble fibers gel
from rice bran and barley flour on the properties of

Institute of Food Research and Product Development, Kasetsart University, Bangkok 10900, Thailand.

Received date : 08/06/04

Accepted date : 27/10/04

532

Kasetsart J. (Nat. Sci.) 38 (4)

some Thai foods. These Thai foods included those


made with substantial amounts of lard and coconut
fat.
MATERIALS AND METHODS
The composite of soluble fibers from rice
bran and barley flour was obtained by coprocessing rice bran and barley flour (Inglett,
2000). A 10% fiber gel was prepared by blending
weights of 10% fiber with 90% water and heating
to boiling before allowing it to gel in a refrigerator
overnight. The 10% fiber gel was substituted on a
weight for weight basis for 40, 60 and 80% of the
butter / shortening in cookies. Coconut cream,
which is used to prepare layer cake, dip sauce for
fried pot crust, taro custard and saute chicken

curry, was replaced with 10% fiber gel at 40, 60


and 80% of the coconut cream by weight, except
for pumpkin pudding, the 10% fiber gel was
substituted for 50, 75 and 100% of the coconut
cream by weight.
Thai food formulations
Comparative food formulations are listed
in Table 1. The comparison of components on a
100 g basis allows an examination of their butter
and coconut cream contents. The amount of these
fats in the various products are substituted by
various amounts of soluble fiber gel. The exact
preparation and ingredient components are listed
under each product with their formulations. The
Thai foods were prepared as follows:

Table 1 Standard formulae of 100 grams Thai dishes.


Products

Butter

Coconut
cream

Egg

Sugar

Flour

Salt

Specific
ingredients

Water

25.9

10.1

22.2

40.4

Pumpkin
pudding

25.4

18.1

15.4

0.4

36.2
(pumpkin)

Layer cake

42.7

25.6

19.65

Dip for fried


pot crust

43.3

12.4

1.2

18.5
(ground
chicken)

Taro custard

31.9

27.7

23.8

13.8
(taro)

Saute chicken
curry

41.3

3.3

2.75
(fish sauce)

41.3
(sliced
chicken)

Kanom Ping
Kaset

Others

1.4
(baking
Soda and
vanilla
extract)
4.5
(grated
coconut)
10.2
1.85
Jasmine
(pandan
water
leaf extract)
12.4
7.2
(peanut,
shallot,
and spices)
2.8
(pandan
leaf extract)
11.35
(curry paste,
Kaffir Lime
leave and
Basil leave)

Kasetsart J. (Nat. Sci.) 38 (4)

Cookie (Kanom Ping Kaset)


Ingredients : 155 g all purpose flour, 45 g
cake flour, 90 g butter, 38 g shortening, one
teaspoon baking soda, 50 g egg, 110 g sugar and
one teaspoon vanilla extract. Preparation : the
sifted flour was blended with baking soda before
mixing with butter, shortening, and sugar until
creamy. The egg and vanilla extract was added
with continued mixing for 1 min. The flour was
added, with spatula blending, before the mixture
was poured onto a baking tray and baked at 177
C for 30 min. The 10% fiber gel was substituted
for 40, 60 and 80% of the butter / shortening in the
cookie mixture as follows: 90 g butter and 38 g
shortening (control); 51.2 g fiber gel, 54 g butter
and 22.8 g shortening (40% substitution); 76.8 g
fiber gel, 36 g butter and 15.2 g shortening (60%
substitution); 102.4 g fiber gel, 18 g butter and 7.6
g shortening (80% substitution).

533

with rice, tapioca and arrowroot flours. The mixture


was mixed well with coconut cream or the fiber gel
in the following proportions: 1000 g coconut cream
(control); 600 g coconut cream (400 g fiber gel)
(40%); 400 g coconut cream (600 g fiber gel)
(60%); and 200 g coconut cream (800 g fiber gel)
(80%). The mixture was divided into two portions.
For the first portion, pandan leaf extract was
added and mixed thoroughly before pouring the
first layer (white) onto a baking pan and steaming
until cooked. The second portion was blended
with a green coloring and poured on top of the
baked white layer and then steamed until cooked.
Alternate white and green layers were made to the
desired level of the cake, keeping the last layer
green.

Pumpkin Pudding (Khanom Fag Thong)


Ingredients: 400 g pumpkin, 100 g rice
flour, 70 g arrow root flour, 200 g sugar, 280 g
coconut cream, 4 g salt and 50 g grated coconut.
Preparation: pumpkin was sliced into long 2.5cm thick pieces, steamed until soft and mashed
thoroughly. Pumpkin was mixed with rice flour
and arrowroot flour followed by sugar and salt.
The mixture was mixed with coconut cream or
fiber gel in the following proportions: 280 g coconut
cream (control); 140 g coconut cream (140 g fiber
gel) (50%); 77.5 g coconut cream (202.5 g fiber
gel) (75%); and (280 g fiber gel) (100%). The
mixture was poured onto a baking pan and grated
coconut sprinkled on the surface before steaming
for 30 min.

Dip sauce for fried pot crust (Khao Tang Na Tang)


Ingredients for dipping sauce: 300 g ground
chicken, 80 g ground roasted coconut, 700 g
coconut cream, 85 g shallot, 200 g sugar, 20 g salt,
10 g coriander root, 6 g pepper, 8 g dried chili, 8.3
g coriander and 200 g water. Preparation :
coriander root, pepper and chili were ground well
in a mortar. In a separate container, the coconut
cream and fiber gel, in the following proportions,
were boiled: 700 g coconut cream (control); 420 g
coconut cream (280 g fiber gel) (40%); 280 g
coconut cream (420 g fiber gel) (60%); and 140 g
coconut cream (560 g fiber gel) (80%). The spice
blend was added to the boiled material, stirred well
before the ground chicken, sugar, salt were added.
After the mixture was removed from the heat, it
was served with fried pot crust or crisp fried bread
that had been fried over medium heat until golden
brown on both sides.

Layer cake (Khanom Chan)


Ingredients: 75 g tapioca flour, 35 g
arrowroot flour, 5 g rice flour, 250 g coconut
cream, 150 g sugar, 60 g water and 10 g pandan
leaf extract. Preparation: sugar was boiled with
water to make syrup before mixing it in a bowl

Taro custard (Sangkaya Puak)


Ingredients : 500 g egg, 575 g coconut
cream, 115 g sugar, 315 g coconut sugar, 250 g
chopped taro and 50 g pandan leaf extract.
Preparation : egg, sugar, coconut sugar and pandan
leaf extract were blended for 4 min and coconut

534

Kasetsart J. (Nat. Sci.) 38 (4)

cream added in the following proportions: 575 g


coconut cream (control); 345 g coconut cream
(230 g fiber gel) (40%); 230 g coconut cream (345
g fiber gel) (60%); and 115 coconut cream (460 g
fiber gel) (80%). The mixture was poured through
cheesecloth and collected on a tray before
sprinkling with chopped taro and steaming for 25
min.
Saute chicken curry (Pha Naeng Gai)
Ingredients : 750 g sliced chicken, 750 g
coconut cream, 150 g curry paste, 60 g cane sugar,
50 g fish sauce, 50 g basil leaves and 4 g sliced
kaffir lime leaves. Preparation : fried chicken was
cooked and remove from the pan. In the pan, the
spice mixture was heated with the coconut cream
in the following proportions: 750 g coconut cream
(control); 450 g coconut cream (300 g fiber gel)
(40%); 300 g coconut cream (450 g fiber gel)
(60%); and 150 g coconut cream (600 g fiber gel)
(80%). The chicken, kaffir lime leaves, sugar and
fish sauce were added to this mixture, and allowed
to simmer over low heat until the curry was thick
before the basil leaves were added.
Sensory evaluations
A sensory panel, composed of 25 trained
members, was set to evaluate the bakery and Thai
food products for the flavor, texture characteristics,
color, appearance, odor and taste by using a 9
hedonic scale. The scale is verbally anchored with
nine categories, as follows: like extremely, like
very much, like moderately, like slightly, neither
like nor dislike, dislike slightly, dislike moderately,
dislike very much and dislike extremely. Significant
differences (International Rice Research Institute.
Irristat version 90-1, Department of Statistics, Los
Banos, Philippines) were measured by ANOVA
and Duncan Multiple Range Test (DMRT). The
products with the acceptability score higher than 6
were analyzed for proximate composition and
saturated fat (AOAC, 1994).

RESULTS AND DISCUSSION


Sensory evaluation of Thai foods
The acceptability for using fiber gel to
replace the butter and coconut cream in various
kinds of Thai food is shown in Table 2. The cookie
(Kanom Ping Kaset) prepared with 40, 60 and
80% replacement levels indicated noticeable
differences in the major anchored categories at the
40% and higher levels. At the 40% level, the
texture was firm but with some decrease in taste
quality compared to the control.
Pumpkin pudding prepared at 50, 75 and
100% replacement with the fiber gel composite
showed much better performance than the cookie.
The 50% replacement product was not significantly
different from the control. At the higher
replacement of fiber gel of 100% substitution for
coconut cream was still acceptable for all of the
characteristics. It should be noted that the pudding
texture at 100% substitution was softer than the
other levels of substitution.
Layer cake at the 40% substitution was not
statistical changes in taste. Taste was accepted at
the 60% level compared to the control, however,
the score was higher than 6.0. For 40% substitution
level product, it was colorful and elastic. The
products with the higher substitution levels showed
less color and tougher texture.
Dipping sauce for fried pot crust at the 40%
substitution level showed a small statistical
difference in taste compared to the control. The
dipping sauce became thicker when the amount of
fiber gel was increased.
Taro custard with the 40% substitution
level showed a little statistical significant difference
in taste compared to the control. However, at 80%
substitution level the taro custard had characteristics
and acceptability scores higher than 6. There was
little difference even at high substitution levels
from the control.
Saute chicken curry at the 40% substitution
level did not show much statistical difference in

535

Kasetsart J. (Nat. Sci.) 38 (4)

Table 2 Sensory evaluation of Thai food products with soluble fiber substitution for fat.1/
Appearance
Cookie* (Kanom Ping Kaset)
0
7.63a
40 %
6.82b
60 %
6.47bc
80 %
6.28c
Pumpkin pudding
0
7.47a
50 %
7.40a
75 %
7.50a
100 %
7.50a
Layer cake (Khanom chan)
0
7.77a
40 %
6.64b
60 %
5.52c
80 %
5.43c
Dip sauce for fried pot crust
0
7.68a
40 %
7.06b
60 %
6.88bc
80 %
6.65c
Taro custard
Control
6.98a
40 %
6.66a
60 %
6.73a
80 %
6.61a
Main dish (Saute chicken curry)
Control
8.05a
40 %
7.25b
60 %
6.72c
80 %
6.38d

Color

Odor

7.50a
6.95b
7.03b
6.90b

7.78a
6.57b
6.32b
5.95c

7.43a
7.53a
7.25a
7.22a

Taste

Texture

Acceptability

7.75a
6.55b
6.03c
5.60c

7.70a
5.72c
4.75c
3.83d

7.72a
5.88b
4.85c
4.05d

7.65a
7.15b
6.97bc
6.60c

7.65a
7.22b
7.00bc
6.85c

7.53a
7.22ab
6.93bc
6.55c

7.53a
7.20a
6.75b
6.55b

7.75a
6.66b
5.27c
4.80c

7.75a
6.77b
6.05c
5.36d

7.59a
7.18a
6.68b
5.68c

7.57a
7.02b
6.02c
5.18d

7.7a
6.8b
6.0c
4.9d

7.44a
7.03b
7.00b
6.94b

7.5a
7.03b
6.85bc
6.15c

7.65a
7.00b
6.91b
6.62b

7.71a
6.74b
6.24c
5.97c

7.74a
6.76b
6.44b
5.97c

7.18a
7.02a
7.00a
6.93a

7.43a
6.77b
6.57c
5.80d

7.30a
6.77b
6.55c
6.05d

7.30a
6.80b
6.48c
6.09d

7.50a
6.77b
6.43c
5.75d

8.00a
7.43b
6.88c
6.60c

8.00a
7.18b
6.65c
6.18d

7.9a
7.2b
6.88c
6.38d

8.05a
6.97b
6.30c
5.82d

8.20a
7.20b
6.47c
5.95d

In a column, means followed by the same superscript are not significantly different at p < 0.05 by ANOVA and DMRT.
1/ prepared by blending 10 % soluble fiber composite (rice bran and barley flour) in hot water (by weight) and refrigerated
overnight before use.

taste compared to the control. However, at 80%


substitution level, the chicken curry had
characteristics and acceptability scores higher than
6. The curry paste, however, became thicker when
the amount of fiber gel was increased.

The Thai foods containing the highest level


of fiber gels with the acceptability scores higher
than 6 were analyzed for proximate compositions
and saturated fat. The results were expressed as
grams per 100 gram (Table 3). The proximate

536

Kasetsart J. (Nat. Sci.) 38 (4)

Table 3 Proximate composition of reduced fat content of foods ( gram per 100 gram).
Product
Kanom Ping Kaset
0
40 % fiber substitute
Pumpkin pudding
0
100 % fiber substitute
Layer cake
0
60 % fiber substitute
Dip sauce for fried pot crust
0
80 % fiber substitute
Taro custard
0
60 % fiber substitute
Saute chicken curry
0
60 % fiber substitute

Moisture

Fat

Protein

Ash

Fiber

CHO

Calorie

7.42
8.13

25.41
13.27

6.33
5.90

1.18
1.15

0.54
0.92

59.12
70.63

490.49
425.55

46.35
52.22

7.81
1.78

4.90
4.03

1.05
1.07

2.29
2.36

37.60
38.54

240.29
186.30

37.74
44.16

7.41
4.26

2.07
1.73

0.57
0.60

0.60
1.20

51.61
48.05

281.41
237.46

55.15
64.47

17.31
6.76

9.57
8.37

1.22
1.13

3.38
6.35

13.37
12.92

247.55
146.00

52.92
58.31

11.98
8.75

5.31
5.04

1.04
0.95

0.84
1.47

27.91
25.48

240.70
200.83

61.37
68.42

12.6
5.07

16.28
11.48

1.42
1.36

1.22
1.10

7.11
12.57

206.96
141.83

analysis of the food products showed reduction in


their fat contents with most foods showing an
increase in fiber content. Since Kanom Ping Kaset
was similar to cookie in having eggs as an
ingredient, the substitution caused the cholesterol
content of 52.37 mg in the control product to
become 41.64 mg (20.49% reduction) after adding
40% fiber gel as substitution for coconut cream.
The saturated fat contents were summarized
as shown in Table 4. Since pumpkin pudding,
layer cake, dip for fried pot crust, taro custard and
saute chicken curry use coconut as ingredient, the
saturated fat contents were found to reduce after
substitution with fiber gel. Each product had a
different amount of saturated fat depending on the
percentage of fiber substitution used. For example,
the saturated fat in pumpkin pudding was reduced
from 7.69 mg to 0.44 mg after 100% fiber
substitution (94.28% reduction). Layer cake
(prepared with coconut cream, hydrogenated

coconut) had a 59.75% reduction of saturated fat


after using 60% fiber substitution. At 80% fiber
gel usage for the dip of fried pot crust, the saturated
fat content was reduced from 13.02% to 3.22%. As
for taro custard, the saturated fat content was
reduced from 9.07% to 3.51% using a 60% fiber
gel replacement while saute chicken curry showed
a decrease of saturated fat from 12.54% to 4.94%
using a 60% fiber gel substitution.
Coconut cream is the principle source of
saturated fat in the Thai diet and is partially
responsible for increase in hypercholesterolemia
conditions in Southeast Asia. Using soluble fiber
gels on the nutritive value of Thai foods that are
made with substantial amounts of butter and
coconut fat showed similar sensory properties. Six
Thai foods, ordinarily high in saturated fat, were
found to have reduced fat contents after replacement
of with the fiber gel.

537

Kasetsart J. (Nat. Sci.) 38 (4)

Table 4 Cholesterol content and % reduction of Thai foods (per 100 grams).
Thai foods
Kanom Ping Kaset
Control
40 % fiber substitute

Cholesterol (mg)

% reduction of cholesterol

52.37
41.64

20.49

Table 5 Saturated fat content and % reduction of Thai foods (per 100 grams).
Thai foods
Pumpkin pudding
0
100 % fiber substitute
Layer cake
0
60 % fiber substitute
Dip sauce for fried pot crust
0
80% fiber substitute
Taro custard
Control
60 % fiber substitute
Saute chicken curry
0
60 % fiber substitute

Saturated fat (g)

% Reduction of saturated fat

7.69
0.44

94.28

9.79
3.94

59.75

13.02
3.22

75.27

9.07
3.51

61.30

12.54
4.94

60.61

CONCLUSION
Some Thai foods could be prepared with
reduced amounts of saturated fat by using a soluble
fiber gel. The soluble fiber gel is a composite that
is prepared from rice and barley flours. Saturated
fat content reductions were 47.78, 94.28, 59.75,
75.27, 61.30 and 60.61% for Kanom Ping Kaset,
pumpkin pudding, layer cake, dip sauce for pot
crust, taro custard and saute chicken curry,
respectively. The substitution of the fiber gel for
saturated fat in these formulations produced some
differences in texture and flavor of the foods.
However, these differences appeared to make small

changes in the overall acceptability or suitability


of the foods themselves.
ACKNOWLEDGEMENTS
The authors would like to express thanks to
Dr. G.E. Inglett for assistance and the soluble fiber
sample. We also thank to Institute of Food Research
and Product Development, Kasetsart University
for financial support to this research work.
LITERATURE CITED
Association of Official Analytical Chemists. 1990.

538

Kasetsart J. (Nat. Sci.) 38 (4)

Official Methods of Analysis. 15th ed.


AOAC, Arlington, Virginia. 1298 p.
Food and Drug Administration. 1997a. Food
labeling: health claims; soluble fiber from
whole oats and risk of coronary heart disease.
Federal Register 62: 15343-15344.
Inglett, G.E.1993. Amylodextrin containing betaglucan from oat flours and bran. J. of Food
Chem. 47: 133-136.
Inglett, G.E. 1999. Nutraceuticals: the key to
healthier eating. Chem. Tech.: Innovation
in Chemistry and Technology 29: 38-42.
Inglett, G.E. 2000. Soluble Hydrocolloid Food
Additives and Method of Making. U.S. Patent

Number 6,060,519.9 May. Alexandria, VA,


USA: United States Patent & Trademark
Office.
Inglett, G.E. and R.K. Newman, 1994. Oat betaglucan-amylodextrins : Preliminary
preparations and biological properties. Plant
Foods Hum. Nutr. 45: 53-61.
International Rice Research Institute. Irristat
version 90-1. Department of Statistics, Los
Banos, Philippines.
Ripsin, C.M., J.M. Keenan and D.R. Jacobs. 1992.
Oat products and lipid lowering. J. Amer.
Med. Asso. 267: 3317-3325.

Kasetsart J. (Nat. Sci.) 38 : 539 - 552 (2004)

Strength Development of Soft Marine Clay


Stabilized with Cement and Fly Ash
Supakij Nontananandh, Sanupong Boonyong,
Thakol Yoobanpot and Korchoke Chantawarangul

ABSTRACT
This study combined the concepts of chemical ground improvement technique with environmental
geotechnics for improvement of a soft marine clay. The objectives were to study strength development
of the cement stabilized soils and to illustrate potential use of the fly ash obtained from a vegetable oil
factory as a cement replacement material. Attempt was also made in order to elucidate contributions of
fly ash as well as reaction products to the development of strengths. Hardening effects were investigated
through unconfined compressive strength. In order to elucidate strength development and its correlations
to reaction products, X-ray diffraction analysis (XRD) were also performed after strength tests.
Based on the experimental results, strengths were markedly increased when mixed with OPC and
OPC with 10% fly ash replacement. Soil mixtures with fly ash content higher than 20% exhibited
relatively lower strengths at short term, however, steady gains in strength could be observed at long term.
In addition, correlations between reduction on strength and fly ash content were proposed and prediction
on strengths for the predetermined fly ash content could be made. It could be concluded that strength
development was attributed to the hydration and pozzolanic reactions. It was also found that increase in
compressive strength was directly proportional to amounts of the major reaction product such as calcium
silicate hydrate (CSH).
Key words: soil improvement, clay, cement, fly ash, X-ray diffraction analysis (XRD), calcium silicate
hydrate (CSH)

INTRODUCTION
For many decades, engineers and
researchers have attempted to solve problems posed
by various types of soft ground. Constructions on
such grounds may encounter with unstabilities
arisen from low shear strength, substantial total
and differential settlement, excessive seepage and
liquefaction. Therefore, various methods of ground
improvement have been developed in order to
improve such unfavorable properties. The

developed technics are based on the basic concepts


of ground improvement which include the effects
of densification, cementation, reinforcement, and
drainage. Among many successful projects, it has
been reported that ground improvement method
using cement and lime is suitable to improve soft
clayey ground having high water content and high
compressibility. The technics such as deep cement
mixing method and soil cement columns have
become widely used recently (DOH and JICA,
1998).

Department of Civil Engineering, Faculty of Engineering, Kasetsart University, Bangkok 10900, Thailand.

Received date : 30/09/04

Accepted date : 11/11/04

540

Kasetsart J. (Nat. Sci.) 38 (4)

In addition, researchers from various fields


have focused on solving environmental problems
due to the production of wastes. Gidley and Sack
(1984) suggested methods of utilization of wastes
such as fly ash, iron slag, waste rock, mill tailing,
and sludge in construction. Kamon et al. (1991)
also pointed out that utilization of wastes as
construction materials would be more effective
when performed in accordance with the proposed
NICE criteria (Non-hazardous, high Improvability,
Consistency and compatibility, and Economically
feasible). Stabilization of these wastes could
considerably reduce environmental risks due to
emission of wastes such as dusting and leaching.
Material recovery from waste utilization not only
has environmental benefits, but also may conserve
natural resources as well as energy by creation of
new materials. Consequently, it is not surprising
that studies on the potential utilizations of wastes
have been of great interest and have been
progressively carried out in the past several decades
(Kamon, 1996).
As main objective of this study, the concepts
of chemical ground improvement combined with
environmental geotechnics were introduced to
improve strength of a soft marine clay. Ordinary
Portland Cement (OPC) was main stabilizers used
in this study. In addition, the fly ash obtained from
a vegetable oil factory was used as partial
substitutions for cement. In the past, this fly ash
was used as fill embankment and cement concrete
block purposes. Since there were only a few studies
that reported on effective utilizations of such fly
ash, it is therefore beneficial to explore more value
added of this new-type industrial waste. This study
also focused on elucidation on how strengths were
improved. Correlations between reaction products
and the developed strengths were observed.
Experimentally, the approaches used in
this study consisted of unconfined compressive
strength test and subsequent X-ray diffraction
analysis (XRD) to investigate the main chemical
compounds of materials and reaction products in

order to evaluate hardening effects.


MATERIALS AND METHODS
1) Materials
The clayey soil used in this study was
sampled from a construction site at Klong Lat Pho,
Samut Prakarn province. The soil was taken from
a depth of 3.0 m in order to obtain a natural soil
having uniform compositions. At this depth, the
soil was located below the weathered zone and the
ground water level which was about 1 m to 2.5 m.
Upon visual inspection, the soil had greenish
to dark gray color, containing some organic
fractions. Further data on their physical and
engineering properties are given in Table 1. The
soil can be classified as clay with high plasticity
(CH) according to the Unified Soil Classification
System.
Investigations on chemical compositions
of the untreated soils were tested in accordance
with ASTM C 323. The results showed that the
soils consisted of 0.8 % calcium oxide (CaO), 1.7
% magnesium oxide (MgO), 1.0 % sodium oxide
(Na2O) and 0.08 % sulphate ion (SO4 2-). The
remolded strength of untreated soil at its average
natural moisture content (63.53%) was within a
Table 1 Physical and engineering properties of
untreated soil.
Properties

Soft marine clay

Liquid limit (%)


Plastic limit (%)
Plasticity index (%)
Shrinkage limit (%)
Wet unit weight (kg/m3)
Specific gravity
Natural moisture content (%)
Permeability (cm/sec)
Untreated strength (kg/cm2)
pH

85.80
32.70
53.10
32.91
1,650
2.76
63.53
6.706 10-6
0.07-0.10
6.64

541

Kasetsart J. (Nat. Sci.) 38 (4)

range of 0.07-0.10 kg/cm2. Based on the test


results, the soil was conformed to soft marine clay.
On the other hand, the fly ash used in this
study was derived from burning coals mixed with
waste oil bleached clay in the fluidized bed system
of the vegetable oil factory at Pathumthani province,
Thailand. The fly ash is residue generated from
burning such solid fuels at temperature of 600800C. Fly ash of approximately 8-10 tons is
produced daily. The fly ash contained various
compositions, but mainly consisted of oxides such
as silicon (SiO 2), aluminum (Al2O3), ferric
(Fe2O3), calcium (CaO) and magnesium (MgO).
In accordance with chemical compositions and
ASTM C 618-94, the fly ash could be classified as
Class F fly ash (ASTM, 2002). Table 2 shows the
major chemical compositions of cement and fly
ash used in this study in comparison with those of
coal fly ash from Mae Moh (data from
Jirathanathaworn, 2003). The fly ash was composed
of fine-grained particles equivalent to a silt grain
size. The specific gravity of the fly ash was 2.11
which was much lower than that of cement grains
(2.96).
2) Specimen preparation and tests
Selection on appropriate stabilizer and mix
proportion was done as suggested by previous
researches. DOH and JICA (1998) recommended
that cement had beneficial effects to improve
properties of soft Bangkok clay, i.e. ground
improvement by cement column. Suitable cement
content was within a range of 80-200 kg/m3 and
appropriate water to stabilizer ratio should be

within a range of 0.8-1.2, based on required design


strength of each project. Therefore, Ordinary
Portland Cement (OPC) with a stabilizer content
of 200 kg/m3 was used in this study to stabilize the
soft marine clay. OPC partially replaced with 1030% fly ash by dry weight were also used as soil
stabilizers. In addition, water to stabilizer ratio
was set to be 0.80 as suggested by DOH and JICA
(1998) and used in our previous study
(Nontananandh and Amornfa, 2002). Specimens
were prepared by mixing the soft marine clay with
these stabilizers at a mix proportion of 200 kg/m3.
Mixing and preparation of specimens was
performed in accordance with the method of
making and curing noncompacted-stabilized soil
specimens.
From each soil mix, cylindrical specimens
of 5 cm diameter by 10 cm long were prepared for
strength tests. After de-molding, the specimens
were sealed tightly in plastic sheets to prevent loss
of moisture due to surface evaporation and then
cured for periods of 3, 7, 14, 28 and 90 days before
strength tests. Unconfined compressive strength
test was performed in accordance with ASTM D
2166-91.
Investigation on reaction products such as
calcium silicate hydrate (CSH) and ettringite
(3CaO.Al2O3.3CaSO4.32H2O) in the mixtures was
performed on the failures of specimens that were
previously performed with strength test, using a
Philips XPert Diffractometer with an input energy
of 40 kV and 30 mA and a scanning speed of 2
degrees/min. This study identified CSH and
ettringite at d-spacings of 3.02 and 3.88 ,

Table 2 Major chemical compositions of cement and fly ash used in this study and Mae Moh fly ash.
Materials
SiO2
Cement in this study
Fly ash in this study
Mae Moh fly ash

20.0
53.5
26.7-34.4

Chemical compositions (% by dry weight)


Al2O3
Fe2O3
CaO
6.0
20.2
19.4-23.4

3.36
7.5
20.4-24.3

66.0
4.3
10.5-16.0

Ignition loss
1.5
4.8
0.4-1.6

542

Kasetsart J. (Nat. Sci.) 38 (4)

respectively, where strong reflection were


prominent and did not overlap with other phases.
RESULTS AND DISCUSSION

Unconfined compressive strength (kg/cm2)

1) Strength characteristics of the stabilized soils


The characteristic curves showing the
development of strength against curing time is
presented in Figure 1. Mix-1 represents the
stabilized soil that was mixed with cement only
while Mix-2, Mix-3 and Mix-4 represent the
stabilized soils that were mixed with cement and
substitutions of cement with fly ash 10, 20 and
30% by dry weight.
Experimental results showed that strength
for all mixtures were significantly increased when
compared with strength of the untreated soil.
Strengths increased with curing time for all
mixtures. For Mix-1, strength significantly
increased during the first two weeks and markedly
increased during 14 to 28 days, while, at long term,
strength almost remained constant. For Mix-2,
strength markedly increased at short term and
steadily increased with curing time. Strengths of
Mix-2 were relatively lower than Mix-1, however,
gain in strength at long term was prominent. As it
could be clearly observed, strength of Mix-2 for 90
days curing time developed close to that of Mix-1,
i.e. 21.84 kg/cm2 and 22.75 kg/cm2, respectively.

Mix-3 and Mix-4 had relatively lower


strengths at short term than Mix-1 and Mix-2,
however, steady gains in strength over the passage
of curing time could also be observed. At 90 days,
strength of Mix-3 also developed close to that of
Mix-2. As it was evident from results of strength
test, therefore, the fly ash used was comparable
with the Mae Moh fly ash (Jirathanathaworn, et
al., 2003).
Based on the results of strength tests, the
stabilized soils with 10%-20% of fly ash content
could obtain preferable strengths and therefore
showed potential uses for ground improvement
purposes such as soil cement column or subbase
materials for roads. However, subsequent
experimental tests should be considered for each
specified application.
2) Deformations of soil cement with fly ash
Modulus of elasticity (E50) is one of the
important parameters in determining the properties
of soil and its interaction with an applied load. It is
required for such calculations as settlement of
footing, modulus of subgrade reaction, and vertical
displacement of soil. For soil cement, hardening
effects establish cementing characteristics,
resulting in an increase in modulus of elasticity
(E50).
As observed in Figure 2, moduli of elasticity

25.00
20.00
15.00
Mix-1
Mix-2

10.00

Mix-3
Mix-4

5.00
0.00
0

10

20

30

40
50
60
Curing Time (Days)

70

80

90

Figure 1 Unconfined compressive strengths against curing time for all mixtures.

100

543

Kasetsart J. (Nat. Sci.) 38 (4)

(E50) of the stabilized soils for all mixtures were


markedly improved with curing time. An increase
in modulus of deformation with curing time implies
that the soils with high plasticity were changed
into materials with high rigidity. For example,
Mix-1 and Mix-2 could obtain superior E50 values
of approximately 1,600 kg/cm 2, which was
equivalent to dense sand. It could also be observed
that modulus of elasticity was developed similarly
to strength development. As it could be seen in
Figure 3, the plot of strengths and E50 of the
stabilized soils for all mixtures exhibit linear
correlation as fitted using the method of least
squares.

3) Effects of fly ash on strength development


Results from strength tests revealed that
reductions on strength could be observed when
10-30% fly ash replaced cement, particularly at
the early age. However, long term strengths for
Mix-2 and Mix-3 gave favorable results. It is
therefore beneficial for practical uses if prediction
on strength as a function of fly ash content can be
made. On the other words, if the target strength is
assigned, a suitable mix proportion of fly ash can
thus be predetermined. Correlations of reductions
on strength per cement content and percentage of
fly ash replacement for all curing time are illustrated
in Figure 4 to Figure 8.

2,000
1,800
1,600

E50 (kg/cm2)

1,400
1,200
1,000

Mix-1
Mix-2
Mix-3
Mix-4

800
600
400
200
0
0

10

20

30

40
50
60
Curing time (days)

70

80

90

100

Figure 2 Modulus of Elasticity (E50) against curing time for all mixtures.

Unconfined compressive strength (kg/cm2)

25.00

20.00
y = 0.0181x - 5.7038
R2 = 0.9036
15.00

10.00

5.00

0.00
600.00

800.00

1,000.00

1,200.00

1,400.00

1,600.00

1,800.00

E50 (kg/cm2)

Figure 3 Relationship between unconfined compressive strengths and modulus of elasticity (E50) for
all mixtures.

544

Kasetsart J. (Nat. Sci.) 38 (4)

It is apparent that strengths decrease as a


function of fly ash content. Based on the curve
fitting by the method of least squares, the data for
mixtures at specified curing times of 7, 14, and 90
days agree well with the polynomial functions
while the correlations of mixtures cured at 3 and 28
days can be either linear or polynomial function.
The polynomial functions are therefore proposed,
as summarized in Tables 3.

Reduction on strength per cement content


(ksc/kg/m3)

4) Reaction products in relation to strength


development of the stabilized soils
The XRD pattern of the untreated soil, as

illustrated in Figure 9, indicates that the soil is


composed of large amount of silica in the form of
quartz, montmorillonite, illite, and kaolinite as
predominant minerals. Identifications reveal that
the untreated soil contains no cementing materials.
Figure 10 illustrates chemical compositions of the
untreated fly ash based on the XRD analysis. The
diffraction pattern indicates that there are various
chemical compositions, but it mainly consists of
combined oxides such as the oxide of quartz (SiO2),
magnetite (Fe3O4), hematite (Fe2O3) and perliclase
(MgO) as dominant chemical compositions.
Preliminary tests based on the XRD analysis

0.030
Linear (curing time 3 days)
0.025

Poly. (curing time 3 days)

0.020

y = 0.0008x + 0.0001
R2 = 0.9598

0.015
0.010

y = 4E-06 x2 + 0.0007x

0.005

R2 = 0.9626

0.000
0

10
15
20
25
%fly ash as replacement material

30

35

Reduction on strength per cement content


(ksc/kg/m3)

Figure 4 Reduction on strength per percent cement content with fly ash contents for strength prediction
at 3 days curing time.

0.030
Linear (curing time 7 days)
0.025
Poly. (curing time 7 days)
0.020
0.015

y = 0 .0008 x
R2 = 0 .8925

0.010

y = 3 E-05 x2 + 5E -05 x
R2 = 0.9892

0.005
0.000
0

10
15
20
25
%fly ash as replacement material

30

35

Figure 5 Reduction on strength per percent cement content with fly ash contents for strength prediction
at 7 days curing time.

545

Reduction on strength per cement content


(ksc/kg/m3)

Kasetsart J. (Nat. Sci.) 38 (4)


0.040
Linear (curing time 14 days)
0.035
Poly. (curing time 14 days)

0.030
0.025

y = 0.001x
0.020

R2 = 0.8787

y = 3E-05 x2 + 0.0002x

0.015

R2 = 0.9642

0.010
0.005
0.000
0

10

15

20

25

30

35

%fly ash as replacement material

Figure 6 Reduction on strength per percent cement content with fly ash contents for strength prediction
at 14 days curing time me.

Reduction on strength per cement content


(ksc/kg/m3)

0.080
0.070
0.060

y = -4E-05x2 + 0.0032x

0.050

y = 0.0023x

R2 = 0.9368

R2 = 0.9054

0.040
0.030
0.020

Linear (curing time 28 days)

0.010

Poly. (curing time 28 days)

0.000
0

10

15

20

25

30

35

%fly ash as replacement material

Reduction on strength per cement content


(ksc/kg/m3)

Figure 7 Reduction on strength per percent cement content with fly ash contents for strength prediction
at 28 days curing time.
0.030
Linear (curing time 90 days)
0.025
Poly. (curing time 90 days)
0.020

y = 0.0007x
R2 = 0.7575

0.015

y = 4 E-05x2 - 0.0003x

0.010

R2 = 0 .9341

0.005
0.000
0

10

15

20

25

30

35

%fly ash as replacement material

Figure 8 Reduction on strength per percent cement content with fly ash contents for strength prediction
at 90 days curing time.

546

Kasetsart J. (Nat. Sci.) 38 (4)

Table 3 Proposed equations for strength prediction.


Curing time (days)

Proposed equations

R2

3
7
14
28
90

Y = 4E-06 X2 + 0.0007 X
Y = 3E-05 X2 + 0.00005 X
Y = 3E-05 X2 + 0.0002 X
Y = -4E-05 X2 + 0.0032 X
Y = 4E-05 X2 - 0.0003 X

0.9626
0.9892
0.9642
0.9368
0.9341

where: Y = reduction of strength per cement content, ksc/kg/m3 (ksc = kg/cm2)


X = fly ash replacement content, %

of cement pastes illustrated that calcium silicate


hydrate (CSH), calcium hydroxide (Ca(OH)2) and
ettringite were the major reaction products, as
illustrated in Figure 11. Consequently, as shown in
Figures 12 and 13, the diffraction intensities of
CSH and ettringite increased with increase in
cement content and curing time. It could be
observed that their intensities markedly increased
during the first two weeks and then slightly
increased or became almost constant at long term.
Typical XRD patterns of the stabilized
soils for Mix-1 and Mix-2 at 3 and 90 days curing
time Figure 14 to Figure 17, showed growths of
major reaction products which could be identified
as CSH and ettringite. As obviously seen in Figures
18 and 19, X-ray intensities of CSH products and
ettringite for all mixtures illustrated their formations
similar to strength characteristic curves. In addition,
the developed strength exhibited general trend to
increase proportionally with amounts of CSH and
ettringite. This can be observed as shown in Figure
20 and Figure 21. In essence, the higher reflections
were obtained from the mixtures having relatively
higher strength. It could therefore be concluded
that these reaction products mainly contribute to
strength development of the stabilized soils.
Another essential role of ettringite
.
(3CaO Al2O3.3CaSO4.32H2O) was attributed to
the fact that large amount of water was combined
in its crystals, resulting in significant decrease in
moisture content at the early age. Extracting water

that existed in the pore spaces by ettringite provided


a reduced water to cement ratio that aided further
hardening. The previous works done by Ariizumi
et al. (1977) and Kamon et al. (1989) assumed that
the formation of ettringite significantly improved
the leachate characteristics of the stabilized soil by
combining metallic ion such as Fe 3+ or heavy
metal such as Cr 3+, and fixing them in its crystal.
Based on the environmental geotechnical
viewpoint, this confirmed the potential uses of the
fly ash from vegetable oil factory combined with
cement to stabilize soft marine clay.
The XRD patterns as shown in Figure 14 to
Figure 17 revealed that peaks of calcium hydroxide
could not be detected since the early curing time.
It was therefore assumed that calcium hydroxide
dissolved rapidly as Ca 2+ and (OH) - into pore
solutions after cement hydration. Increase in pH
also enhanced dissolution of some silicate and
aluminate from clay minerals. It could be
considered that secondary reaction, generally
regarded as pozzolanic reaction, between Ca 2+
and the fly ash particles and some dissolved silicate
and aluminate slowly occurred and thus
substantially produced additional CSH which
contributed to long term strengths. This evidence
was prominent for the soils that stabilized with
cement containing some appropriate proportions
of fly ash. The proposed mechanisms were
agreeable with the investigations performed by
Ogawa et al. (1980) and He et al. (1984).

547

Kasetsart J. (Nat. Sci.) 38 (4)


5000

Qtz = Quartz
Mont = Montmorilonite
Ilt = Illite
Kao = Kaolinite

Qtz

4500
4000

Counts/s

3500
3000
2500
2000
1500
Qtz

1000

Kao Mont

500

Qtz

Qtz Qt Qtz
ILt Mont
Qtz Kao

Kao

Kao

Qtz
ILt
ILt

Mont

0
10

20

30

40

50

60

70

80

2Theta

Figure 9 X-ray diffraction pattern of untreated soil.

1600
Qtz = Quartz
Mgnt = Magnetite
Hemt = Hematite
Percls = Perliclase

1400
1200

Counts/s

1000

Qtz

800
600
Qtz
Hemt

400

Hem Qtz
Qtz Percl

200

Qtz

Qtz
Hem MgntHemt Hem

50

60

0
10

20

30

40

70

80

2Theta

Figure 10 X-ray diffraction pattern of untreated fly ash.

1600
CSH = Calcium Silicate Hydrate
ET = Ettringite
CH = Calcium Hydroxide

1400
CH

1200

Counts/s

1000

CH

800

CSH

600

CH
CH

400

ET

200
0
10

20

30

40

50

60

70

80

2Theta

Figure 11 X-ray diffraction pattern of cement paste 250 kg/m3 at 3 days curing time.

548

Kasetsart J. (Nat. Sci.) 38 (4)


2500

Intensity (counts/s)

2000

1500

1000
Cement 150 kg/m3
Cement 200 kg/m3
Cement 250 kg/m3

500

0
0

10

15
Curing time (days)

20

25

30

Figure 12 Intensity of calcium silicate hydrate (CSH) of cement paste at various cement contents
against curing time.
280

Intensity (counts/s)

270
260
250
240
cement 150 kg/m3
230
cement 200 kg/m3
220
cement 250 kg/m3
210
200
0

10

15
Curing time (days)

20

25

30

Figure 13 Intensity of ettringite of cement pastes at various cement contents against curing time.
4000
Qt = Quartz
Mont = Montmorilonite
Ilt = Illite
Kao = Kaolinite
CSH = Calcium Sillicate Hydrate
Et = Ettringite

3500
3000
Qt

counts/s

2500
2000
1500
1000
500

Kao

CSH
Qt
MontQt Qt
Mont Et Kao
Qt Kao

Qt
Kao

Qt
Mont

Ilt

0
10

20

30

40

50

60

2Theta

Figure 14 X-ray diffraction pattern of Mix-1 at 3 days curing time.

70

80

549

Kasetsart J. (Nat. Sci.) 38 (4)


4000

Qt = Quartz
Mont = Montmorilonite
Ilt = Illite
Kao = Kaolinite
CSH = Calcium Sillicate Hydrate
Et = Ettringite

3500
3000
Qt

Counts/s

2500
2000
1500
1000
Qt

500 Kao

CSH
Mont Qt Qt Qt Kao

Mont Et Kao

Qt
Kao

Qt
Ilt

Mont

0
10

20

30

40

50

60

70

80

2Theta

Figure 15 X-ray diffraction pattern of Mix-2 at 3 days curing time.


4000
Qt = Quartz
Mont = Montmorilonite
Ilt = Illite
Kao = Kaolinite
CSH = Calcium Sillicate Hydrate
Et = Ettringite

Qt

3500

Counts/s

3000
2500
2000
1500
CSH

1000

Qt

500

Mont Qt Qt Qt Kao

Et Kao

Kao Mont

Qt
Kao

Qt
Ilt

Mont

0
10

20

30

40

50

60

70

80

2Theta

Figure 16 X-ray diffraction pattern of Mix-1 at 90 days curing time.


4000
Qt = Quartz
Mont = Montmorilonite
Ilt = Illite
Kao = Kaolinite
CSH = Calcium Sillicate Hydrate
Et = Ettringite

3500
Qt

3000

Counts/s

2500
2000
1500
CSH

1000
500

Qt
Kao

Mont

Mont Qt Qt

Et Kao

Qt
Kao

Qt Kao

Qt
Ilt

Mont

0
10

20

30

40

50

60

2Theta

Figure 17 X-ray diffraction pattern of Mix-2 at 90 days curing time.

70

80

550

Kasetsart J. (Nat. Sci.) 38 (4)


1100

Intensity of CSH (counts/s)

1000
900
800
700
600
500

Mix-1
Mix-2
Mix-3
Mix-4

400
300
200
0

10

20

30

40
50
60
Curing time (days)

70

80

90

100

Figure 18 Intensity of calcium silicate hydrate (CSH) against curing time.

265
Intensity of ettringite (counts/s)

260
255
250
245
240

Mix-1
Mix-2
Mix-3
Mix-4

235
230
225
220
0

10

20

30

40
50
60
Curing time (days)

70

80

90

800

900

1000

100

Unsoaked Unconfined Compressive Strength


(kg/cm2)

Figure 19 Intensity of ettringite intensity against curing time.

25.00

20.00

15.00

10.00

5.00

0.00
200

300

400

500

600

700

1100

Intensity of CSH (counts/s)

Figure 20 Relationship between calcium silicate hydrate intensity of the stabilized soils for all mixtures
and unconfined compressive strengths.

551

Unsoaked Unconfined Coppressive Strength


(kg/cm2)

Kasetsart J. (Nat. Sci.) 38 (4)


25.00

20.00

15.00

10.00

5.00

0.00
220

230

240

250

260

270

Intensity of ettringite (counts/s)

Figure 21 Relationship between ettringite intensity of the stabilized soils for all mixtures and unconfined
compressive strengths.
CONCLUSIONS
Based on the results of this study, it could
be concluded that strengths of the stabilized soils
significantly increased when mixed with cement
and cement partially replaced with fly ash. It was
also found that the strength hardening effect of the
stabilized marine clay was substantially influenced
by the fly ash content. The fly ash derived from a
vegetable oil factory could be potentially used as
a cement replacement material when the fly ash
content was approximately 20 percent or less.
Stabilized soils appeared satisfactory for extensive
ranges of applications due to the preferable
strengths obtained. Prediction on strength could
be accomplished using the proposed correlations
with the predetermined fly ash content.
Identification of the major reaction products
such as calcium silicate hydrate (CSH) and
ettringite as well as elucidation on contribution of
fly ash on strength development could be
accomplished by XRD analysis. It was found that
growths of CSH and ettringite with curing time
were similar to strength characteristic curves.
Addition of suitable amount of fly ash into cement
considerably improved strength development in
the long term. Increase in strength at long term was
attributed to the pozzolanic reactions. It was also

realized that strength developed was proportional


to amounts of the major hydration products such as
CSH and ettringite formed.
ACKNOWLEDGEMENTS
The authors would like to acknowledge the
International Graduate Program in Civil
Engineering, Kasetsart University for providing
partial fund for this research.
LITERATURE CITED
American Society for Testing and Materials.2001.
Annual Book of ASTM Standards, Vol.
04.08, West Conshohocken, PA, 1660 p.
Ariizumi, A., T.Oosuga and H.Kurihara.1977.
Solidification of harmful wastes and muds by
means of cement bacillus and its application,
pp.253-263. In Proc. of the 9th International
Conference on Soil Mechanics and
Foundation Engineering, Tokyo, Japan.
Department of Highways of Thailand (DOH) and
Japan International Cooperation Agency,
(JICA) 1998. Manual for Design and
Construction of Cement Column Method.
75 p.
Gidley, J.S. and W.S.Sack.1984. Environmental

552

Kasetsart J. (Nat. Sci.) 38 (4)

aspects of wastes utilization in construction.


J. Envi. Engrg. American Society of Civil
Engineers 110(6): 1117-1133.
He, J.Y., E.Barry and D.M.Roy.1984. Hydration
of fly ash-portland cements.Cement and
Concrete Research 14:505-512.
Jirathanathaworn, T.,S.Nontananandh and
K.Chantawarangul. 2003. Stabilization of
clayey sand using fly ash mixed with small
amount of lime, GTE 93-98. In Proc. of the
9 th National Convention on Civil
Engineering, Engineering Institute of
Thailand and Thammasat University,
Petchaburi.
Kamon, M.1996. Environmental Geotechnics.
A.A.Balkema Publishers.Vol.2.1207 p.
Kamon, M.,S.Nontananandh and T.Katsumi.
1989.Effective utilization of stainless-steel
slag for soil stabilization, pp. 1947-1948. In

Proc. of the 24th Japan National Conference


on Soil Mechanics and Foundation
Engineering, Tokyo.
Kamon, M.,S.Nontananandh and S.Tomohisa.
1991. Environmental geotechnology for
potential waste utilization, pp. 397-400. In
Proc. of the 9th Asian Regional Conference,
ISSMFE.
Nontananandh, S. and K.Amornfa. 2002.
Stabilization of soft clayey soil using cement
and lime, GTE 120-125. In Proc. of the 8th
National Convention on Civil Engineering,
Engineering Institute of Thailand and Khon
Kaen University, Khon Kaen.
Ogawa, K., H.Uchikawa and K.Takemoto.1980.
The mechanism of the hydration in the system
C 3S-pozzolana. Cement and Concrete
Research 10:683-696.

Kasetsart J. (Nat. Sci.) 38 (4)

553

Author Index
Arai, H. ; Y. Morita ; K. Nobusawa ; M. Arai ; S. Boonmar and H. Kimura
Prevalence of Flavobacterium psychrophilum Infection in Ayu (Plecoglossus altivelis)
in Gunma Prefecture, Japan and Comparison of the gyr B Sequences of Isolates .................. 523
Arai, M. see Arai, H. et al ................................................................................................................ 523
Artjariyasripong, S. see Athipunyakom, P. et al ............................................................................ 83
Artjariyasripong, S. see Luangsa-ard, J. J. et al ............................................................................. 94
Athipunyakom P. ; L. Manoch and C. Piluek
Isolation and Identification of Mycorrhizal Fungi from Eleven Terrestrial Orchids .............. 216
Athipunyakom, P. ; L. Manoch ; C. Piluek ; S. Artjariyasripong and S. Tragulrung
Mycorrhizal Fungi from Spathoglottis plicata and the Use of these Fungi to Germinate
Seeds of S. plicata in vitro ......................................................................................................... 83
Attathom, S. see Gemechu, A. L. et al ............................................................................................ 369
Auttaviboonkul, P. see Tungtrakul, P. et al .................................................................................. 531
Boonmar, S. see Arai, H. et al ......................................................................................................... 523
Boonprakob, U. see Jeengool, N. and U. Boonprakob ................................................................. 468
Boonthrapong, M. see Jangchud K. et al ....................................................................................... 247
Boonyong, S. see Nontananandh, S. et al ....................................................................................... 539
Burns, D. T. ; N. Tungkananuruk ; S. Kasemsumran and K. Tungkananuruk
Assay of Acetaminophen in Paracetamol Tablets by Differential Pulse Voltammetry .......... 510
Chairoj, P. and N. Roongtanakiat
Decomposition of Vetiver Shoot and Effect of Vetiver Mulching on Super Sweet Corn
Hybrid Yield ............................................................................................................................ 305
Chaiseri, S. see Samuhasaneetoo, S. et al ...................................................................................... 515
Chaiyawat, M. see Raksakulthai, N. et al ...................................................................................... 102
Chalermsan , N. ; P. Vijchulata ; P. Chirattanayuth ; S. Sintuwanit ; S. Surapat and A. Engkagul
Effects of Preservatives on Raw Milk Components Analyzed by Infrared
Spectrophotometry .................................................................................................................... 38
Chandrapatya, A. see Maimala, S. and A. Chandrapatya .......................................................... 331
Chandrapatya, A. see Noochanapai, P. and A. Chandrapatya ................................................... 475
Chandrapatya, A. see Sakunwarin, S. et al ................................................................................... 340
Chanprasert, W. see Phyo, A. K. et al .............................................................................................. 21
Chantawarangul, K. see Nontananandh, S. et al .......................................................................... 539
Chantikul, S. see Raksakulthai, N. et al ......................................................................................... 102
Chen, S.-T. see Trisiriroj, A. et al ................................................................................................... 493
Chiemsombat, P. see Gemechu, A. L. et al .................................................................................... 369
Chim-anage, P. see Tangjitjaroenkun, J. et al .............................................................................. 123
Chinawong, S. see Zewdie, K. et al ................................................................................................. 290
Chirattanayuth, P. see Chalermsan , N. et al .................................................................................. 38
Chonnipat, B. see Lopez M. T. et al ............................................................................................... 183
Chuchird, N. see Singhapan J. et al ............................................................................................... 236
Daorai, A. see Terefe, G. et al ........................................................................................................... 44

554

Kasetsart J. (Nat. Sci.) 38 (4)

Darsana P. ; K. Samphantharak and A. Silapapun


Development of Semi-exotic Maize (Zea mays L.) Inbred Lines: Performance per se
and in Hybrid Combinations ................................................................................................... 165
Darsana, P. ; K. Samphantharak and A. Silapapun
Genetic Potential of Exotic Germplasm Introduced from Different Latitudes for the
Improvement of Tropical Maize (Zea mays L.) .......................................................................... 1
Darsana, P. see Samphantharak, K. and P. Darsana ........................................................... 279, 440
Desalegn Z. ; N. Ratanadilok ; R. Kaveeta ; P. Pongtongkam and A. Kuantham
Evaluation of F1 and F2 Generations for Yield and Yield Components and Fiber Quality
Parameters on Cotton (Gossypium hirsutum L.) Under Werer, Ethiopia Condition ............... 176
Desalegn, Z. ; N. Ratanadilok ; R. Kaveeta ; P. Pongtongkam and A. Kuantham
Heterosis and Combining Ability for Yield and Yield Components of Cotton
(Gossypium hirsutum L.) ........................................................................................................... 11
Duangpatra, J. see Phyo, A. K. et al ................................................................................................. 21
Engkagul, A. ; P. Hormchan and A. Wongpiyasatid
Gamma-Irradiation Induced Alterations in Mungbean -amylase Inhibitory Activities :
Effects on -amylase and Development of Mungbean Weevil (Callosobruchus
maculatus) ............................................................................................................................... 207
Engkagul, A. see Chalermsan , N. et al ............................................................................................ 38
Engkagul, A. see Salaenoi, J. et al .................................................................................................... 74
Engkakul, A. see Surisan, S. et al ..................................................................................................... 57
Farhat, I. A. see Samuhasaneetoo, S. et al ..................................................................................... 515
Gemechu, A. L. ; P. Chiemsombat ; S. Attathom ; R. Lersrutaiyotin and K. Reanwarakorn
The Variations among Isolates of Sugarcane Mosaic Virus in Thailand as Determined
by Virus-Host Interaction ........................................................................................................ 369
Gohet, E. see Sangsing, K. et al .............................................................................................. 111, 320
Harinnasut, P. see Luanghiran, S. et al ......................................................................................... 501
Hong J. H. ; B. Manochai ; G. Trakoontivakorn and V. Na Thalang
Fibrinolytic Activity of Thai Indigenous Vegetables .............................................................. 241
Hormchan, P. see Engkagul, A. et al .............................................................................................. 207
Hormchan, P. see Surisan, S. et al .................................................................................................... 57
Hormchan, P. see Terefe, G. et al ..................................................................................................... 44
Hoshida, H. see Pukahuta, C. et al ................................................................................................... 65
Hundie, B. ; S. Sangchote and E. Sarobol
Barley Net Blotch (Pyrenophora teres Drechsl.) Epidemiology and Management ................ 380
Hywel-Jones, N. see Luangsa-ard, J. J. et al ................................................................................... 94
Impithuksa, S. see Terefe, G. et al .................................................................................................... 44
Jamornmarn, S. see Surisan, S. et al ................................................................................................ 57
Jamornmarn, S. see Terefe, G. et al ................................................................................................. 44
Jangchud K. ; M. Boonthrapong and W. Prinyawiwatkul
Effects of Composite Rice Flour and Water Content on Qualities of Thai Rice Cake ........... 247
Jantrarotai, P. ; P. Temphakdee and S. Pripanapong
Evaluation of Different Larval Feeds for Survival and Development of Early Stage

Kasetsart J. (Nat. Sci.) 38 (4)

555

Mud Crab (Scylla olivacea) ..................................................................................................... 484


Jeengool, N. and U. Boonprakob
Rescue of Peach Embryo in Culture Media with Additional of 6-benzylademine and
Gibberellic Acid ...................................................................................................................... 468
Jeyashoke, A. see Trisiriroj, A. et al .............................................................................................. 493
Julakasewee, A. see Suwanketnikom, R. and A. Julakasewee .................................................... 425
Juntakool, S. see Tekletsadik, T. et al ............................................................................................ 457
Juntakool, S. see Zewdie, K. et al ................................................................................................... 290
Kasemsap, P. see Sangsing, K. et al ....................................................................................... 111, 320
Kasemsumran, S. see Burns, D. T. et al ......................................................................................... 510
Kaveeta, R. see Desalegn Z. et al .............................................................................................. 11, 176
Kaveeta, R. see Phyo, A. K. et al ...................................................................................................... 21
Kerdkankaew, S. ; J. Luangjame and P. Khummongkol
Daily and Annual Co2 Uptake of Pterocarpus macrocarpus and Azadirachta siamensis
under Field Condition .............................................................................................................. 419
Ketsagul, S. see Pongtongkam P. et al ........................................................................................... 190
Khummongkol, P. see Kerdkankaew, S. et al ............................................................................... 419
Kimura, H. see Arai, H. et al .......................................................................................................... 523
Kitpreechavanich, V. see Tangjitjaroenkun, J. et al .................................................................... 123
Kittivorachate, R. And C. Yangyuen
Molluscs in the Ubolratana Reservoir, Khon Kaen ................................................................. 131
Klakhaeng, K. see Pongtongkam P. et al ....................................................................................... 190
Krusong, W. see Tangjitjaroenkun, J. et al ................................................................................... 123
Kuantham, A. see Desalegn Z. et al .......................................................................................... 11, 176
Laksitanonta, S. and G. Singh
Design of a Combined Propeller and Venturi Tube System for Aquaculture Ponds .............. 267
Lersrutaiyotin, R. see Gemechu, A. L. et al .................................................................................. 369
Lertsirirungson, K. see Pongtongkam P. et al ............................................................................... 190
Limsuwan, C. see Singhapan J. et al .............................................................................................. 236
Lipiwattanakarn, S. see Puttaraksa, P. et al ................................................................................. 409
Lopez M. T. ; B. Chonnipat ; T. Toojinda ; A. Vanavichit and S. Tragoonrung
Adaptability of Thermosensitive Genetic Male Sterile Rice Lines in Thailand ..................... 183
Luanghiran, S. ; P. Harinnasut ; A. Thongpan ; A. Proomboon and S. Ratanapo
Partial Purification of Mulberry (Morus rotunbiloba) Peroxidase Using Aqueous
Two-Phase Extraction Coupling with Ion-exchange and Gel-filtration Chromatography ...... 501
Luangjame, J. see Kerdkankaew, S. et al ...................................................................................... 419
Luangsa-ard, J. J. ; L. Manoch ; N. Hywel-Jones ; S. Artjariyasripong and R. A. Samson
Thermotolerant and Thermoresistant Paecilomyces and its Teleomorphic States
Isolated from Thai Forest and Mountain Soils .......................................................................... 94
Maimala, S. and A. Chandrapatya
Chemical Components of Hirsutella thompsonii Crude Filtrate and their Biological
Activities .................................................................................................................................. 331
Maketon, M. and K. Masawang

556

Kasetsart J. (Nat. Sci.) 38 (4)

Efficacies of some Beneficial Bacteria on the Colonization and Inhibition of Vibrio


harveyi in Black Tiger Shrimp (Penaeus monodon Fabricius) Larvae ................................... 393
Maneepun, S. see Tungtrakul, P. et al ........................................................................................... 531
Manoch, L. see Athipunyakom, P. et al ................................................................................... 83, 216
Manoch, L. see Luangsa-ard, J. J. et al ........................................................................................... 94
Manochai, B. see Hong J. H. et al ................................................................................................... 241
Mariam, E. G. and R. Suwanketnikom
Effect of Nitrogen Fertilizers on Branched Broomrape (Orobanche ramosa L.) in Tomato
(Lycopersicon esculentum Mill.) ............................................................................................. 311
Mariam, E. G. and R. Suwanketnikom
Screening of Tomato (Lycopersicon esculentum Mill.) Varieties for Resistance to
Branched Broomrape (Orobanche ramose L.) ........................................................................ 434
Masawang, K. see Maketon, M. and K. Masawang ..................................................................... 393
Menakanit, A. see Minea, M. et al .................................................................................................. 141
Minea, M. ; C. Piluek ; A. Menakanit and S. Tantiwiwat
A Study on Seed Germination and Seedling Development of Spathoglottis Bl. Orchids ....... 141
Mingmuang, M. see Salaenoi, J. et al ............................................................................................... 74
Morita, Y. see Arai, H. et al ............................................................................................................ 523
Na Thalang, V. see Hong J. H. et al ................................................................................................ 241
Nakamura M. and S. Sonthichai
Nesting Habits of Some Hornet Species (Hymenoptera, Vespidae) in Northern
Thailand ................................................................................................................................... 196
Nakatomi, Y. see Wongkhalaung C. et al ...................................................................................... 255
Nishizawa, Y. see Pukahuta, C. et al ................................................................................................ 65
Niyomvit, B. see Tungtrakul, P. et al ............................................................................................. 531
Nobusawa, K. see Arai, H. et al ...................................................................................................... 523
Nontananandh, S. ; S. Boonyong ; T. Yoobunpot and K. Chantawarangul
Strength Development of Soft Marine Clay Stabilized with Cement and Fly Ash ................. 539
Noochanapai, P. and A. Chandrapatya
Morphology and Biology of Phyllocoptes azadirachtae Chandrapatya (Acari :
Eriophyidae) ............................................................................................................................ 475
Osotsapar,Y. see Paudel, K. P. et al ................................................................................................. 31
Paudel, K. P. ; S. Sukprakarn ; K. Sidathani and Y. Osotsapar
Effects of Organic Manures on Production of Lettuce (Lactuca sativa L.) in Reference
to Chemical Fertilizer ................................................................................................................ 31
Peyachoknagul, S. see Pongtongkam P. et al ................................................................................. 190
Phyo, A. K. ; J. Duangpatra ; W. Chanprasert and R. Kaveeta
Storage Potential of Three Different Types of In-shell Peanut Seeds under Ambient
and Cold Room Conditions ....................................................................................................... 21
Piluek, C. see Athipunyakom, P. et al ...................................................................................... 83, 216
Piluek, C. see Minea, M. et al .......................................................................................................... 141
Pitakkingthong, D. see Salakit, C. et al .......................................................................................... 400
Pongsawatmanit, R. see Samuhasaneetoo, S. et al ........................................................................ 515

Kasetsart J. (Nat. Sci.) 38 (4)

557

Pongtongkam P. ; S. Peyachoknagul ; P. Sripichit ; A. Thongpan ; K. Klakhaeng ;


S. Ketsagul and K. Lertsirirungson
Effects of L-lysine on Callus Formation , Plant Regeneration and Flowering of Thai
Rice c.v. KDML 105 ............................................................................................................... 190
Pongtongkam, P. see Desalegn, Z. et al .................................................................................... 11, 176
Praprilong, W. see Tangjitjaroenkun, J. et al ............................................................................... 123
Prasanpanich, S. see Tekletsadik, T. et al ...................................................................................... 457
Prinyawiwatkul, W. see Jangchud K. et al .................................................................................... 247
Pripanapong, S. see Jantrarotai, P. et al ........................................................................................ 484
Proomboon, A. see Luanghiran, S. et al ........................................................................................ 501
Pukahuta, C. ; P. Suwanarit ; E. Shianagawa ; H. Hoshida and Y. Nishizawa
Combination of Laccase, Xylanase and Cellulase in Lignocellulose Degradation by
White Rot Fungi, Lentinus polychrous Lev. and L. squarrosulus Mont ................................... 65
Puttaraksa, P. ; N. Sriwongsitanon and S. Lipiwattanakarn
Development of One Dimensional Implicit Dynamic Wave Model ....................................... 409
Raksakulthai, N. ; S. Chantikul and M. Chaiyawat
Production and Storage of Chinese Style Fish Sausage from Hybrid Clarias Catfish ............ 102
Ratanadilok, N. see Desalegn, Z. et al ..................................................................................... 11, 176
Ratanapo, S. see Luanghiran, S. et al ............................................................................................ 501
Reanwarakorn, K. see Gemechu, A. L. et al ................................................................................. 369
Rochanapat, N. see Salakit, C. et al ................................................................................................ 400
Roongtanakiat, N. see Chairoj, P. and N. Roongtanakiat ........................................................... 305
Roux, X. Le see Sangsing, K. et al .................................................................................................. 111
Rukkwamsuk, T. ; S. Rungruang and T. Wensing
Fatty Liver in High Producing Dairy Cows Kept in Evaporative Cooling System in a
Commercial Dairy Herd in Thailand ....................................................................................... 229
Rungruang, S. see Rukkwamsuk, T. et al ...................................................................................... 229
Sajjaanantakul, T. see Samuhasaneetoo, S. et al .......................................................................... 515
Sakunwarin, S. ; A. Chandrapatya and S. Visetson
Synergism and Detoxification Mechanism of Crude Sugar Apple Seed Extract in
Tetranychus truncatus Ehara (Prostigmata: Tetranychidae) ................................................... 340
Salaenoi, J. ; M. Mingmuang ; A. Engkagul ; P. Tabthipwon and A. Thongpan
Chitinase and Carbonic Anhydrase Activities during Molting Cycle of Mud Crab
(Scylla serrata Forskal 1775) .................................................................................................... 74
Salakij, J. see Salakit, C. et al ......................................................................................................... 400
Salakit, C. ; J. Salakij ; N. Rochanapat and D. Pitakkingthong
Hematology, Morphology and Cytochemistry of Blood Cells in Lesser Adjutant
(Leptoptilos javanicus) and Greater Adjutant (Leptoptilos dubius) ........................................ 400
Samphantharak K. and R. Yavilads
S1 Selection in Honeycomb Design for the Improvement of High Yield Maize
(Zea mays L.) Inbreds and Hybrids ......................................................................................... 157
Samphantharak, K. and P. Darsana
Performance of Testcross Hybrids of Semi-exotic Inbred Lines Contained Different

558

Kasetsart J. (Nat. Sci.) 38 (4)

Proportions of U.S. Corn Belt Germplasm .............................................................................. 279


Samphantharak, K. and P. Darsana
Study of Maize Populations Contained Different Proportions of U.S. Corn Belt
Germplasm .............................................................................................................................. 440
Samphantharak, K. see Darsana, P. et al .................................................................................. 1, 165
Samson, R. A. see Luangsa-ard, J. J. et al ....................................................................................... 94
Samuhasaneetoo, S. ; S. Chaiseri ; I. A. Farhat ; T. Sajjaanantakul and R. Pongsawatmanit
Application of the Dual Sorption Model for Water Adsorption of Maltodextrin
Various DE .............................................................................................................................. 515
Sangchote, S. see Hundie, B. et al ................................................................................................... 380
Sangkhasila, K. see Sangsing, K. et al ............................................................................................ 111
Sangsing, K. ; P. Kasemsap ; S. Thanisawanyangkura ; E. Gohet and P. Thaler
Respiration Rate and a Two-component Model of Growth and Maintenance
Respiration in Leaves of Rubber (Hevea brasiliensis Muell. Arg.) ........................................ 320
Sangsing, K. ; X. Le Roux ; P. Kasemsap ; S. Thanisawanyangkura ; K. Sangkhasila ;
E. Gohet and P. Thaler
Photosynthetic Capacity and Effect of Drought on Leaf Gas Exchange in Two Rubber
(Hevea brasiliensis) Clones ..................................................................................................... 111
Sarobol, E. see Hundie, B. et al ....................................................................................................... 380
Shianagawa, E. see Pukahuta, C. et al ............................................................................................. 65
Sidathani, K. see Paudel, K. P. et al ................................................................................................. 31
Silapapun, A. see Darsana, P. et al .............................................................................................. 1,165
Singh, G. see Laksitanonta, S. and G. Singh ................................................................................. 267
Singhapan J. ; C. Limsuwan and N. Chuchird
Effect of Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) on
Growth, Survival Rate and Histopathological Changes of Pacific White Shrimp
(Litopenaeus vannamei) .......................................................................................................... 236
Sintuwanit, S. see Chalermsan , N. et al .......................................................................................... 38
Sonthichai, S. see Nakamura M. and S. Sonthichai ..................................................................... 196
Sornnuwat, Y. ; C. Vongkaluang and Y. Takematsu
A Systematic Key to Termites of Thailand ............................................................................. 349
Sripichit, P. see Pongtongkam P. et al ........................................................................................... 190
Sriwongsitanon, N. see Puttaraksa, P. et al ................................................................................... 409
Sukprakarn, S. see Paudel, K. P. et al .............................................................................................. 31
Surapat, S. see Chalermsan , N. et al ............................................................................................... 38
Surisan, S. ; P. Hormchan ; S. Jamornmarn ; A. Wongpiyasatid and A. Engkakul
Potential Methods for Identification the Gamma Irradiated from Unirradiated Larvae
of Helicoverpa armigera H?bner (Lepidoptera: Noctuidae) ..................................................... 57
Suthirawut, S. see Tangjitjaroenkun, J. et al ................................................................................ 123
Suwanarit, P. see Pukahuta, C. et al ................................................................................................ 65
Suwanketnikom, R. and A. Julakasewee
Hard Seededness and Germination of Small White Flower Morningglory ............................ 425
Suwanketnikom, R. see Mariam, E. G. and R. Suwanketnikom ........................................ 311, 434

Kasetsart J. (Nat. Sci.) 38 (4)

559

Suwanketnikom, R. see Zewdie, K. et al ........................................................................................ 290


Suwannarat, C. see Zewdie, K. et al ............................................................................................... 290
Tabthipwon, P. see Salaenoi, J. et al ................................................................................................ 74
Takano, H. see Wongkhalaung C. et al .......................................................................................... 255
Takematsu, Y. see Sornnuwat, Y. et al .......................................................................................... 349
Tangjitjaroenkun, J. ; V. Kitpreechavanich ; S. Suthirawut ; P. Chim-anage ;
W. Praprilong ; W. Krusong and B. Yongsmith
Improvement of High Vitamin B12 Thua nao by Mixed Cultures of Soybean
Oligosaccharide and the Use of Bacteria and Yeasts .............................................................. 123
Tantiwiwat, S. see Minea, M. et al .................................................................................................. 141
Tekletsadik, T. ; S. Tudsri ; S. Juntakool and S. Prasanpanich
Effect of Dry Season Cutting Management on Subsequent Forage Yield and Quality
of Ruzi (Brachiaria ruziziensis) and Dwarf Napier (Pennisetum purpureun L.) in
Thailand ................................................................................................................................... 457
Temphakdee, P. see Jantrarotai, P. et al ....................................................................................... 484
Terefe, G. ; S. Jamornmarn ; P. Hormchan ; A. Daorai and S. Impithuksa
Evaluating Four Bioassay Techniques for Insecticide Resistance Monitoring in
Helicoverpa armigera (Lepidoptera: Noctuidae) ...................................................................... 44
Thaler, P. see Sangsing, K. et al ...................................................................................................... 111
Thaler, P. see Sangsing, K. et al ...................................................................................................... 320
Thanisawanyangkura, S. see Sangsing, K. et al .................................................................... 111, 320
Thongpan, A. see Luanghiran, S. et al ........................................................................................... 501
Thongpan, A. see Pongtongkam P. et al ........................................................................................ 190
Thongpan, A. see Salaenoi, J. et al ................................................................................................... 74
Toojinda, T. see Lopez M. T. et al .................................................................................................. 183
Toojinda, T. see Uyprasert, S. et al ................................................................................................ 448
Tragoonrung, S. see Lopez M. T. et al ........................................................................................... 183
Tragoonrung, S. see Uyprasert, S. et al ......................................................................................... 448
Tragulrung, S. see Athipunyakom, P. et al ...................................................................................... 83
Trakoontivakorn, G. see Hong J. H. et al ...................................................................................... 241
Trisiriroj, A. ; S.Tein Chen and N. Jeyashoke
A Proteomic Approach to Analyze Rice Bran and Shoots of Kao Dawk Mail 105 and
its Mutants ............................................................................................................................... 493
Tudsri,D, S. see Tekletsadik, T. et al .............................................................................................. 457
Tungkananuruk, K. see Burns, D. T. et al ..................................................................................... 510
Tungkananuruk, N. see Burns, D. et al .......................................................................................... 510
Tungtrakul, P. ; P. Auttaviboonkul ; B. Niyomvit and S. Maneepun
Evaluation of Thai Foods Prepared with Soluble Fiber Composite from Rice Bran
and Barley Flour ...................................................................................................................... 531
Udomprasert, N. see Uyprasert, S. et al ........................................................................................ 448
Uyprasert, S. ; T. Toojinda ; N. Udomprasert ; S. Tragoonrung and A. Vanavichit
Root Responses to Water Deficit under Rain-fed Lowland Rice ............................................ 448
Vanavichit, A. see Lopez M. T. et al ............................................................................................... 183

560

Kasetsart J. (Nat. Sci.) 38 (4)

Vanavichit, A. see Uyprasert, S. et al ............................................................................................. 448


Vichukit, V. see Zewdie, K. et al ..................................................................................................... 290
Vijchulata, P. see Chalermsan , N. et al ........................................................................................... 38
Visetson, S. see Sakunwarin, S.. et al ............................................................................................. 340
Vongkaluang, C. see Sornnuwat, Y. et al ...................................................................................... 349
Wensing, T. see Rukkwamsuk, T. et al .......................................................................................... 229
Wongkhalaung C. ; Y. Nakatomi and H. Takano
Hybridization and Selection of Saccharomyces cerevisiae Strains from Industrial
BakersYeasts .......................................................................................................................... 255
Wongpiyasatid, A. see Engkagul, A. et al ...................................................................................... 207
Wongpiyasatid, A. see Surisan, S. et al ............................................................................................ 57
Yangyuen, C. see Kittivorachate, R. And C. Yangyuen ............................................................. 131
Yavilads, R. see Samphantharak K. and R. Yavilads ................................................................. 157
Yongsmith, B. see Tangjitjaroenkun, J. et al ................................................................................ 123
Yoobunpot, T. see Nontananandh, S. et al .................................................................................... 539
Zewdie, K. ; R. Suwanketnikom ; S. Chinawong ; C. Suwannarat ; S. Juntakool and V. Vichukit
Weed Population Dynamics as Influenced by Tillage, Fertilizer and Weed Management
inWheat (Triticum aestivum L.) Cropping Systems of CentralEthiopia ................................. 290

Kasetsart J. (Nat. Sci.) 38 (4)

561

Subject Index
-amylase; Gamma-irradiation; Callosobruchus maculatus; Mungbean
Gamma-Irradiation Induced Alterations in Mungbean -amylase Inhibitory Activities :
Effects on -amylase and Development of Mungbean Weevil (Callosobruchus
maculatus) ............................................................................................................................... 207
1H NMR see Maltodextrin; Sorption isotherm; Dual sorption; Microvoid ............................... 515
Acceptability; Composite rice flour; Thai rice cake; Textural quaily
Effects of Composite Rice Flour and Water Content on Qualities of Thai Rice Cake ........... 247
Acetaminophen; Paracetamol; Differential pulse voltammetry; Glassy carbon electrode
Assay of Acetaminophen in Paracetamol Tablets by Differential Pulse Voltammetry .......... 510
Animal manure see Branched broomrape; Tomato; Nitrogen fertilizer; Parasitic weeds ....... 311
Aqueous two-phase; Mulberry leaf peroxidase; Purification
Partial Purification of Mulberry (Morus rotunbiloba) Peroxidase Using Aqueous
Two-Phase Extraction Coupling with Ion-exchange and Gel-filtration Chromatography ...... 501
AUDP see Hordeum vulgare; Drechslera teres ............................................................................. 380
Ayu; Flavobacterium psychrophilum; gyr B; Sequences analysis
Prevalence of Flavobacterium psychrophilum Infection in Ayu (Plecoglossus altivelis)
in Gunma Prefecture, Japan and Comparison of the gyr B Sequences of Isolates .................. 523
Backwater effect see Saint-Venant equations; Dynamic wave; Implicit finite difference;
Nonlinear algebraic equations; Tidal effect; Bang Pakong River Basin .......................... 409
Bakers yeasts see Hybridization; Rare-mating; Freeze-tolerant; Saccharomyces cerevisiae .. 255
Banana see In vitro germination; Spathoglottis Bl.; Paclobutrazol; Seedling growth ............... 141
Bang Pakong River Basin see Saint-Venant equations; Dynamic wave; Implicit finite
difference; Nonlinear algebraic equations; Backwater effect; Tidal effect ..................... 409
Barley flour see Rice bran; Coconut cream; Low-fat; Fiber ...................................................... 531
Beneficial bacteria; Vibrio harveyi; Penaeus monodon
Efficacies of some Beneficial Bacteria on the Colonization and Inhibition of Vibrio
harveyi in Black Tiger Shrimp (Penaeus monodon Fabricius) Larvae ................................... 393
Bioassay see Hirsutella ; Chemical components; Cytotoxicity .................................................... 331
Biology see Phyllocoptes azadirachtae; Neem; Eriophyid mite; Morphology ............................ 475
Branched broomrape; Tomato varieties; Resistance; Tolerance; Parasitic weeds
Screening of Tomato (Lycopersicon esculentum Mill.) Varieties for Resistance to
Branched Broomrape (Orobanche ramose L.) ........................................................................ 434
Branched broomrape; Tomato; Animal manure; Nitrogen fertilizer; Parasitic weeds
Effect of Nitrogen Fertilizers on Branched Broomrape (Orobanche ramosa L.) in Tomato
(Lycopersicon esculentum Mill.) ............................................................................................. 311
Breeding see In vitro; Embryo culture; Plant growth regulator; Prunus persica (L.)
Batsch .................................................................................................................................... 468
Bronopol; Potassium dichromate; Sodium azide; Preservatives; Milk components;
Infrared spectrophotometry
Effects of Preservatives on Raw Milk Components Analyzed by Infrared
Spectrophotometry .................................................................................................................... 38

562

Kasetsart J. (Nat. Sci.) 38 (4)

Byssochlamys see Soil fungi; Pdecilomyces; Talaromyces; Thermoascus; Thermotolerant;


Thermoresistant ....................................................................................................................... 94
Calcium silicate hydrate (CSH) see Soil improvement; Clay; Cement; Fly ash; X-ray
diffraction analysis (XRD) .................................................................................................... 539
Callosobruchus maculatus seea-amylase; Gamma-irradiation; Mungbean ............................... 207
Carbon sequester; Fast-growing tree; Green area; Plantation; Slow-growing tree
Daily and Annual Co2 Uptake of Pterocarpus macrocarpus and Azadirachta siamensis
under Field Condition .............................................................................................................. 419
Carbonic anhydrase see Chitinase; Mud crab; Molting ................................................................ 74
Cellulase see Laccase; Xylanase; Lignocellulose degradation; White rot fungi; Lentinus
polychrous Lev.; L. squarrosulus Mont .................................................................................. 65
Cement see Soil improvement; Clay; Fly ash; X-ray diffraction analysis (XRD);
Calcium silicate hydrate (CSH) ............................................................................................ 539
Ceratorhiza; Epulorhiza; Rhizoctonia; Mycorrhizal fungi; Terrestrial orchids
Isolation and Identification of Mycorrhizal Fungi from Eleven Terrestrial Orchids .............. 216
Chemical components see Hirsutella ; Cytotoxicity; Bioassay .................................................... 331
Chemical fertilizers see Organic manures; Lettuce ....................................................................... 31
Chinese style fish sausage; Hybrid clarias catfish; Modified atmosphere packaging
Production and Storage of Chinese Style Fish Sausage from Hybrid Clarias Catfish ............ 102
Chitinase; Carbonic anhydrase; Mud crab; Molting
Chitinase and Carbonic Anhydrase Activities during Molting Cycle of Mud Crab (Scylla
serrata Forskal 1775) ............................................................................................................... 74
Clay see Soil improvement; Cement; Fly ash; X-ray diffraction analysis (XRD);
Calcium silicate hydrate (CSH) ............................................................................................ 539
Coconut cream see Rice bran; Barley flour; Low-fat; Fiber ...................................................... 531
Composite rice flour see Acceptability; Thai rice cake; Textural quaily ................................... 247
Compost see Vetiver; Plant nutrient; Mulching; Super sweet corn ........................................... 305
Corn see Sugarcane mosaic virus; Sugarcane; Sorghum; ELISA; Symptom; Virus titer ....... 369
Corn; Hybrid; Honeycomb; S1 Selection
S1 Selection in Honeycomb Design for the Improvement of High Yield Maize (Zea mays L.)
Inbreds and Hybrids ................................................................................................................ 157
Cotton; F2 hybrids; Heterosis; Yield component; Fiber quality
Evaluation of F1 and F2 Generations for Yield and Yield Components and Fiber Quality
Parameters on Cotton (Gossypium hirsutum L.) Under Werer, Ethiopia Condition ............... 176
Cotton; Heterosis; Heterobeltiosis; Diallel cross
Heterosis and Combining Ability for Yield and Yield Components of Cotton (Gossypium
hirsutum L.) ............................................................................................................................... 11
Crab see Scylla olivacea; Larval feed; Zoea; Megalopa ............................................................... 484
Cutting height see Dwarf napier; Ruzi; Forage yield; Dry season ............................................. 457
Cytochemistry; Greater adjutant; Hematology; Lesser adjutant
Hematology, Morphology and Cytochemistry of Blood Cells in Lesser Adjutant
(Leptoptilos javanicus) and Greater Adjutant (Leptoptilos dubius) ........................................ 400
Cytoplasmic genetic male sterile line see Thermosensitive genetic male sterility (TGMS);
Hybrid rice; Heterosis; Tms2 gene ....................................................................................... 183

Kasetsart J. (Nat. Sci.) 38 (4)

563

Cytotoxicity see Hirsutella ; Chemical components; Bioassay .................................................... 331


Dairy cow; Fatty liver; Triacylglycerol
Fatty Liver in High Producing Dairy Cows Kept in Evaporative Cooling System in a
Commercial Dairy Herd in Thailand ....................................................................................... 229
Detoxification mechanism see Tetranychus truncates; Synergist; Sugar apple extract ............ 340
Diallel cross see Cotton; Heterosis; Heterobeltiosis ....................................................................... 11
Differential pulse voltammetry see Acetaminophen; Paracetamol; Glassy carbon
electrode .................................................................................................................................. 510
Dissolved oxygen concentration; Standard oxygen-transfer rate; Standard aeration efficiency
Design of a Combined Propeller and Venturi Tube System for Aquaculture Ponds .............. 267
Distribution see Molluscs; Ubolratana Reservoir ........................................................................ 131
Double haploid lines see Rice; Rainfed lowland; Relative water content; Drought .................. 448
Drechslera teres see Hordeum vulgare; AUDP ............................................................................. 380
Drought see Rice; Rainfed lowland; Double haploid lines; Relative water content .................. 531
Dry season see Dwarf napier; Ruzi; Cutting height; Forage yield ............................................. 457
Dual sorption see Maltodextrin; Sorption isotherm; 1H NMR; Microvoid ............................... 515
Dwarf napier; Ruzi; Cutting height; Forage yield; Dry season
Effect of Dry Season Cutting Management on Subsequent Forage Yield and Quality of
Ruzi (Brachiaria ruziziensis) and Dwarf Napier (Pennisetum purpureun L.) in Thailand ..... 457
Dynamic wave see Saint-Venant equations; Implicit finite difference; Nonlinear algebraic
equations; Backwater effect; Tidal effect; Bang Pakong River Basin .............................. 409
ELISA see Sugarcane mosaic virus; Sugarcane; Corn; Sorghum; Symptom; Virus titer ....... 369
Embryo culture see In vitro; Plant growth regulator; Breeding; Prunus persica (L.)
Batsch ...................................................................................................................................... 468
Epulorhiza see Ceratorhiza; Rhizoctonia; Mycorrhizal fungi; Terrestrial orchids .................... 216
Eriophyid mite see Phyllocoptes azadirachtae; Neem; Morphology; Biology ............................ 475
Exotic germplasm; see Maize; Genetic diversity; Latitude ............................................................. 1
Exotic see Maize; Germplasm; Genetic diversity; Hybrid; Inbred line ..................................... 279
Exotic see Maize; Germplasm; Genetic diversity; Population .................................................... 440
Exotic see Maize; Germplasm; Transgressive segregation; Inbred line; Latitude ................... 165
F2 hybrids see Cotton; Heterosis; Yield component; Fiber quality ............................................ 176
Fast-growing tree see Carbon sequester; Green area; Plantation; Slow-growing tree ............ 419
Fatty liver see Dairy cow; Triacylglycerol .................................................................................... 229
Fertilizer see Tillage; Weed management; Wheat; Triticum aestivum L. .................................. 290
Fiber quality see Cotton; F2 hybrids; Heterosis; Yield component ............................................ 176
Fiber see Rice bran; Barley flour; Coconut cream; Low-fat ...................................................... 531
Fibrinolytic activity see Thai indigenous vegetable; Proteolytic activity; Thermal stability ... 241
Flavobacterium psychrophilum see Ayu; gyr B; Sequences analysis ........................................... 523
Fly ash see Soil improvement; Clay; Cement; X-ray diffraction analysis (XRD);
Calcium silicate hydrate (CSH) ............................................................................................ 539
Forage yield see Dwarf napier; Ruzi; Cutting height; Dry season ............................................. 457
Freeze-tolerant see Hybridization; Rare-mating; Saccharomyces cerevisiae; Bakers yeasts .. 255
Gamma radiation see Helicoverpa armigera; Haemocyte count; Phenoloxidase activity ........... 57
Gamma-irradiation seea-amylase; Callosobruchus maculatus; Mungbean ............................... 207

564

Kasetsart J. (Nat. Sci.) 38 (4)

Genetic diversity see Maize; Exotic; Germplasm; Hybrid; Inbred line ..................................... 279
Genetic diversity see Maize; Exotic; Germplasm; Population .................................................... 440
Genetic diversity; see Maize; Exotic germplasm; Latitude ............................................................. 1
Geographical distribution see Termite; Systematic key; Soldier caste ...................................... 349
Germinate see Mycorrhizal fungi; Spathoglottis plicata; In vitro .................................................. 83
Germplasm see Maize; Exotic; Genetic diversity; Hybrid; Inbred line ..................................... 279
Germplasm see Maize; Exotic; Genetic diversity; Population .................................................... 440
Germplasm see Maize; Exotic; Transgressive segregation; Inbred line; Latitude ................... 165
Glassy carbon electrode see Acetaminophen; Paracetamol; Differential pulse
voltammetry ........................................................................................................................... 510
Greater adjutant see Cytochemistry; Hematology; Lesser adjutant .......................................... 400
Green area see Carbon sequester; Fast-growing tree; Plantation; Slow-growing tree ............ 419
Growth respiration see Relative growth rate; Leaf expansion; Maintenance respiration;
Leaf greenness; Hevea and rubber ...................................................................................... 320
gyr B see Ayu; Flavobacterium psychrophilum; Sequences analysis ........................................... 523
Haemocyte count see Helicoverpa armigera; Gamma radiation; Phenoloxidase activity ........... 57
Helicoverpa armigera; Gamma radiation; Haemocyte count; Phenoloxidase activity
Potential Methods for Identification the Gamma Irradiated from Unirradiated Larvae of
Helicoverpa armigera H?bner (Lepidoptera: Noctuidae) ......................................................... 57
Helicoverpa armigera; Insecticide resistance; Monitoring
Evaluating Four Bioassay Techniques for Insecticide Resistance Monitoring in Helicoverpa
armigera (Lepidoptera: Noctuidae) ........................................................................................... 44
Hematology see Cytochemistry; Greater adjutant; Lesser adjutant .......................................... 400
Heterobeltiosis see Cotton; Heterosis; Diallel cross ....................................................................... 11
Heterosis see Cotton; F2 hybrids; Yield component; Fiber quality ............................................ 176
Heterosis see Cotton; Heterobeltiosis; Diallel cross ....................................................................... 11
Heterosis see Thermosensitive genetic male sterility (TGMS); Cytoplasmic genetic male
sterile line; Hybrid rice; Tms2 gene ..................................................................................... 183
Hevea and rubber see Relative growth rate; Leaf expansion; Growth respiration;
Maintenance respiration; Leaf greenness ........................................................................... 320
Hirsutella ; Chemical components; Cytotoxicity; Bioassay
Chemical Components of Hirsutella thompsonii Crude Filtrate and their Biological
Activities .................................................................................................................................. 331
Honeycomb see Corn; Hybrid; S1 Selection ................................................................................. 157
Hordeum vulgare; Drechslera teres; AUDP
Barley Net Blotch (Pyrenophora teres Drechsl.) Epidemiology and Management ................ 380
Hybrid clarias catfish see Chinese style fish sausage; Modified atmosphere packaging .......... 102
Hybrid rice see Thermosensitive genetic male sterility (TGMS); Cytoplasmic genetic male
sterile line; Heterosis; Tms2 gene ......................................................................................... 183
Hybrid see Corn; Honeycomb; S1 Selection ................................................................................. 157
Hybrid see Maize; Exotic; Germplasm; Genetic diversity; Inbred line ..................................... 279
Hybridization; Rare-mating; Freeze-tolerant; Saccharomyces cerevisiae; Bakers yeasts
Hybridization and Selection of Saccharomyces cerevisiae Strains from Industrial Bakers
Yeasts ...................................................................................................................................... 255

Kasetsart J. (Nat. Sci.) 38 (4)

565

IHHNV see Litopenaeus vannamei; Pacific white shrimp; Infectious hypodermal and
hematopoietic necrosis virus ................................................................................................. 236
Implicit finite difference see Saint-Venant equations; Dynamic wave; Nonlinear algebraic
equations; Backwater effect; Tidal effect; Bang Pakong River Basin .............................. 409
In vitro germination; Spathoglottis Bl.; Paclobutrazol; Banana; Seedling growth
A Study on Seed Germination and Seedling Development of Spathoglottis Bl. Orchids ....... 141
In vitro see Mycorrhizal fungi; Spathoglottis plicata; Germinate .................................................. 83
In vitro; Embryo culture; Plant growth regulator; Breeding; Prunus persica (L.) Batsch
Rescue of Peach Embryo in Culture Media with Additional of 6-benzylademine and
Gibberellic Acid ...................................................................................................................... 468
Inbred line see Maize; Exotic; Germplasm; Genetic diversity; Hybrid ..................................... 279
Inbred line see Maize; Exotic; Germplasm; Transgressive segregation; Latitude ................... 165
Infectious hypodermal and hematopoietic necrosis virus see Litopenaeus vannamei; Pacific
white shrimp; IHHNV ........................................................................................................... 236
Infrared spectrophotometry see Bronopol; Potassium dichromate; Sodium azide;
Preservatives; Milk components ............................................................................................ 38
Insecticide resistance see Helicoverpa armigera; Monitoring ........................................................ 44
Ipomoea obscura (L.) Ker-Gawl see Small white flower morningglory; Seed germination;
Seedling development; Light intensity ................................................................................. 425
Kao Dawk Mail 105 see Proteomic; Orysa sativa L. ssp. indica ................................................... 493
KDML 105 see L-lysine; SRAP technique .................................................................................... 190
L. squarrosulus Mont. see Laccase; Xylanase; Cellulase; Lignocellulose degradation;
White rot fungi; Lentinus polychrous Lev. ............................................................................ 65
Laccase; Xylanase; Cellulase; Lignocellulose degradation; White Rot Fungi; Lentinus
polychrous Lev.; L. squarrosulus Mont
Combination of Laccase, Xylanase and Cellulase in Lignocellulose Degradation by White
Rot Fungi, Lentinus polychrous Lev. And L. squarrosulus Mont ............................................. 65
Larval feed see Scylla olivacea; Zoea; Megalopa; Crab ............................................................... 484
Latitude see Maize; Exotic germplasm; Genetic diversity .............................................................. 1
Latitude see Maize; Exotic; Germplasm; Transgressive segregation; Inbred line ................... 165
Leaf expansion see Relative growth rate; Growth respiration; Maintenance respiration;
Leaf greenness; Hevea and rubber ...................................................................................... 320
Leaf greenness see Relative growth rate; Leaf expansion; Growth respiration;
Maintenance respiration; Hevea and rubber ...................................................................... 320
Leaf nitrogen see Photosynthesis; Respiration; Stomatal conductance; Rubber ...................... 111
Lentinus polychrous Lev. see Laccase; Xylanase; Cellulase; Lignocellulose degradation;
White rot fungi; L. squarrosulus Mont .................................................................................. 65
Lesser adjutant see Cytochemistry; Greater adjutant; Hematology .......................................... 400
Lettuce see Organic manures; Chemical fertilizers ....................................................................... 31
Light intensity see Small white flower morningglory; Ipomoea obscura (L.) Ker-Gawl;
Seed germination; Seedling development .......................................................................... 425
Lignocellulose degradation see Laccase; Xylanase; Cellulase; White rot fungi; Lentinus
polychrous Lev.; L. squarrosulus Mont .................................................................................. 65

566

Kasetsart J. (Nat. Sci.) 38 (4)

Litopenaeus vannamei; Pacific white shrimp; Infectious hypodermal and hematopoietic


necrosis virus; IHHNV
Effect of Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) on Growth,
Survival Rate and Histopathological Changes of Pacific White Shrimp (Litopenaeus
vannamei) ................................................................................................................................ 236
L-lysine; KDML 105; SRAP technique
Effects of L-lysine on Callus Formation , Plant Regeneration and Flowering of Thai
Rice c.v. KDML 105 ............................................................................................................... 190
Low-fat see Rice bran; Barley flour; Coconut cream; Fiber ...................................................... 531
Maintenance respiration see Relative growth rate; Leaf expansion; Growth respiration;
Leaf greenness; Hevea and rubber ...................................................................................... 320
Maize; Exotic germplasm; Genetic diversity; Latitude
Genetic Potential of Exotic Germplasm Introduced from Different Latitudes for the
Improvement of Tropical Maize (Zea mays L.) .......................................................................... 1
Maize; Exotic; Germplasm; Genetic diversity; Hybrid; Inbred line
Performance of Testcross Hybrids of Semi-exotic Inbred Lines Contained Different
Proportions of U.S. Corn Belt Germplasm .............................................................................. 279
Maize; Exotic; Germplasm; Genetic diversity; Population
Study of Maize Populations Contained Different Proportions of U.S. Corn Belt
Germplasm .............................................................................................................................. 440
Maize; Exotic; Germplasm; Transgressive segregation; Inbred line; Latitude
Development of Semi-exotic Maize (Zea mays L.) Inbred Lines: Performance per se and
in Hybrid Combinations .......................................................................................................... 165
Maltodextrin; Sorption isotherm; Dual sorption; 1H NMR; Microvoid
Application of the Dual Sorption Model for Water Adsorption of Maltodextrin
Various DE .............................................................................................................................. 515
Megalopa see Scylla olivacea; Larval feed; Zoea; Crab ............................................................... 484
Microvoid see Maltodextrin; Sorption isotherm; Dual sorption; 1H NMR ............................... 515
Milk components see Bronopol; Potassium dichromate; Sodium azide; Preservatives;
Infrared spectrophotometry ................................................................................................... 38
Mixed cultures see Thua nao production; Vitamin B12 enrichment .......................................... 123
Modified atmosphere packaging see Chinese style fish sausage; Hybrid clarias catfish .......... 102
Molluscs; Distribution; Ubolratana Reservoir
Molluscs in the Ubolratana Reservoir, Khon Kaen ................................................................. 131
Molting see Chitinase; Carbonic anhydrase; Mud crab ................................................................ 74
Monitoring see Helicoverpa armigera; Insecticide resistance ........................................................ 44
Morphology see Phyllocoptes azadirachtae; Neem; Eriophyid mite; Biology ............................ 475
Mud crab see Chitinase; Carbonic anhydrase; Molting ................................................................ 74
Mulberry leaf peroxidase see Aqueous two-phase; Purification ................................................. 501
Mulching see Vetiver; Plant nutrient; Compost; Super sweet corn ........................................... 305
Mungbean seea-amylase; Gamma-irradiation; Callosobruchus maculatus ............................... 207
Mycorrhizal fungi see Ceratorhiza; Epulorhiza; Rhizoctonia; Terrestrial orchids .................... 216
Mycorrhizal fungi; Spathoglottis plicata; Germinate; In vitro
Mycorrhizal Fungi from Spathoglottis plicata and the Use of these Fungi to Germinate

Kasetsart J. (Nat. Sci.) 38 (4)

567

Seeds of S. plicata in vitro ......................................................................................................... 83


Neem see Phyllocoptes azadirachtae; Eriophyid mite; Morphology; Biology ............................ 475
Nesting sites see Vespa spp; Vespidae ............................................................................................ 196
Nitrogen fertilizer see Branched broomrape; Tomato; Animal manure; Parasitic weeds ....... 311
Nonlinear algebraic equations see Saint-Venant equations; Dynamic wave; Implicit finite
difference; Backwater effect; Tidal effect; Bang Pakong River Basin ............................. 409
Organic manures; Chemical fertilizers; Lettuce
Effects of Organic Manures on Production of Lettuce (Lactuca sativa L.) in Reference to
Chemical Fertilizer .................................................................................................................... 31
Orysa sativa L. ssp. indica see Proteomic; Kao Dawk Mail 105 ................................................... 493
Pacific white shrimp see Litopenaeus vannamei; Infectious hypodermal and hematopoietic necrosis
virus; IHHNV ....................................................................................................................... 236
Paclobutrazol see In vitro germination; Spathoglottis Bl.; Banana; Seedling growth ............... 141
Paracetamol see Acetaminophen; Differential pulse voltammetry; Glassy carbon
electrode .................................................................................................................................. 510
Parasitic weeds see Branched broomrape; Tomato varieties; Resistance; Tolerance .............. 434
Parasitic weeds see Branched broomrape; Tomato; Animal manure; Nitrogen fertilizer ....... 311
Pdecilomyces see Soil fungi; Byssochlamys; Talaromyces; Thermoascus; Thermotolerant;
Thermoresistant ....................................................................................................................... 94
Peanut seed see Storage potential; Seed quality; Seed vigor ......................................................... 21
Penaeus monodon see Beneficial bacteria; Vibrio harveyi ............................................................ 393
Phenoloxidase activity see Helicoverpa armigera; Gamma radiation; Haemocyte count ........... 57
Photosynthesis; Respiration; Leaf nitrogen; Stomatal conductance; Rubber
Photosynthetic Capacity and Effect of Drought on Leaf Gas Exchange in Two Rubber
(Hevea brasiliensis) Clones ..................................................................................................... 111
Phyllocoptes azadirachtae; Neem; Eriophyid mite; Morphology; Biology
Morphology and Biology of Phyllocoptes azadirachtae Chandrapatya (Acari :
Eriophyidae) ............................................................................................................................ 475
Plant growth regulator see In vitro; Embryo culture; Breeding; Prunus persica (L.)
Batsch ...................................................................................................................................... 468
Plant nutrient see Vetiver; Mulching; Compost; Super sweet corn ........................................... 305
Plantation see Carbon sequester; Fast-growing tree; Green area; Slow-growing tree ............ 419
Population see Maize; Exotic;Germplasm; Genetic diversity ..................................................... 440
Potassium dichromate see Bronopol; Sodium azide; Preservatives; Milk components;
Infrared spectrophotometry ................................................................................................... 38
Preservatives see Bronopol; Potassium dichromate; Sodium azide; Milk components;
Infrared spectrophotometry ................................................................................................... 38
Proteolytic activity see Thai indigenous vegetable; Fibrinolytic activity; Thermal stability ... 241
Proteomic; Orysa sativa L. ssp. indica; Kao Dawk Mail 105
A Proteomic Approach to Analyze Rice Bran and Shoots of Kao Dawk Mail 105 and
its Mutants ............................................................................................................................... 493
Prunus persica (L.) Batsch see In vitro; Embryo culture; Plant growth regulator;
Breeding .................................................................................................................................. 468
Purification see Aqueous two-phase; Mulberry leaf peroxidase ................................................. 501

568

Kasetsart J. (Nat. Sci.) 38 (4)

Rainfed lowland see Rice; Double haploid lines; Relative water content; Drought .................. 448
Rare-mating see Hybridization; Freeze-tolerant; Saccharomyces cerevisiae; Bakers yeasts .. 255
Relative growth rate; Leaf expansion; Growth respiration; Maintenance respiration;
Leaf greenness; Hevea and rubber
Respiration Rate and a Two-component Model of Growth and Maintenance Respiration
in Leaves of Rubber (Hevea brasiliensis Muell. Arg.) ........................................................... 320
Relative water content see Rice; Rainfed lowland; Double haploid lines; Drought .................. 448
Resistance see Branched broomrape; Tomato varieties; Tolerance; Parasitic weeds .............. 434
Respiration see Photosynthesis; Leaf nitrogen; Stomatal conductance; Rubber ...................... 111
Rhizoctonia see Ceratorhiza; Epulorhiza; Mycorrhizal fungi; Terrestrial orchids .................... 216
Rice bran; Barley flour; Coconut cream; Low-fat; Fiber
Evaluation of Thai Foods Prepared with Soluble Fiber Composite from Rice Bran and
Barley Flour ............................................................................................................................. 531
Rice; Rainfed lowland; Double haploid lines; Relative water content; Drought
Root Responses to Water Deficit under Rain-fed Lowland Rice ............................................ 448
Rubber see Photosynthesis; Respiration; Leaf nitrogen; Stomatal conductance ...................... 111
Ruzi see Dwarf napier; Cutting height; Forage yield; Dry season ............................................. 457
S1 Selection see Corn; Hybrid; Honeycomb ................................................................................. 157
Saccharomyces cerevisiae see Hybridization; Rare-mating; Freeze-tolerant; Bakers yeasts .. 255
Saint-Venant equations; Dynamic wave; Implicit finite difference; Nonlinear algebraic
equations; Backwater effect; Tidal effect; Bang Pakong River Basin
Development of One Dimensional Implicit Dynamic Wave Model ....................................... 409
Scylla olivacea; Larval feed; Zoea; Megalopa; Crab
Evaluation of Different Larval Feeds for Survival and Development of Early Stage Mud
Crab (Scylla olivacea) ............................................................................................................. 484
Seed germination see Small white flower morningglory; Ipomoea obscura (L.) Ker-Gawl;
Seedling development; Light intensity ................................................................................. 425
Seed quality see Storage potential; Peanut seed; Seed vigor ......................................................... 21
Seed vigor see Storage potential; Peanut seed; Seed quality ......................................................... 21
Seedling development see Small white flower morningglory; Ipomoea obscura (L.)
Ker-Gawl; Seed germination; Light intensity .................................................................... 425
Seedling growth see In vitro germination; Spathoglottis Bl.; Paclobutrazol; Banana ............... 141
Sequences analysis see Ayu; Flavobacterium psychrophilum; gyr B ........................................... 523
Slow-growing tree see Carbon sequester; Fast-growing tree; Green area; Plantation ............ 419
Small white flower morningglory; Ipomoea obscura (L.) Ker-Gawl; Seed germination;
Seedling development; Light intensity
Hard Seededness and Germination of Small White Flower Morningglory ............................ 425
Sodium azide see Bronopol; Potassium dichromate; Preservatives; Milk components; Infrared
spectrophotometry ................................................................................................................. 38
Soil fungi; Pdecilomyces; Byssochlamys; Talaromyces; Thermoascus; Thermotolerant;
Thermoresistant
Thermotolerant and Thermoresistant Paecilomyces and its Teleomorphic States Isolated
from Thai Forest and Mountain Soils ........................................................................................ 94

Kasetsart J. (Nat. Sci.) 38 (4)

569

Soil improvement; Clay; Cement; Fly ash; X-ray diffraction analysis (XRD); Calcium
silicate hydrate (CSH)
Strength Development of Soft Marine Clay Stabilized with Cement and Fly Ash ................. 539
Soldier caste see Termite; Systematic key; Geographical distribution ...................................... 349
Sorghum see Sugarcane mosaic virus; Sugarcane; Corn; ELISA; Symptom; Virus titer ....... 369
Sorption isotherm see Maltodextrin; Dual sorption; 1H NMR; Microvoid ............................... 515
Spathoglottis Bl. see In vitro germination; Paclobutrazol; Banana; Seedling growth ............... 141
Spathoglottis plicata see Mycorrhizal fungi; Germinate; In vitro .................................................. 83
SRAP technique see L-lysine; KDML 105 .................................................................................... 190
Standard aeration efficiency see Dissolved oxygen concentration; Standard oxygen-transfer
rate .......................................................................................................................................... 267
Standard oxygen-transfer rate see Dissolved oxygen concentration; Standard aeration
efficiency ................................................................................................................................. 267
Stomatal conductance see Photosynthesis; Respiration; Leaf nitrogen; Rubber ...................... 111
Storage potential; Peanut seed; Seed quality; Seed vigor
Storage Potential of Three Different Types of In-shell Peanut Seeds under Ambient and
Cold Room Conditions .............................................................................................................. 21
Sugar apple extract see Tetranychus truncates; Synergist; Detoxification mechanism ............ 340
Sugarcane mosaic virus; Sugarcane; Corn; Sorghum; ELISA; Symptom; Virus titer
The Variations among Isolates of Sugarcane Mosaic Virus in Thailand as Determined by
Virus-Host Interaction ............................................................................................................. 369
Sugarcane see Sugarcane mosaic virus; Corn; Sorghum; ELISA; Symptom; Virus titer ....... 369
Super sweet corn see Vetiver; Plant nutrient; Mulching; Compost ........................................... 305
Symptom see Sugarcane mosaic virus; Sugarcane; Corn; Sorghum; ELISA; Virus titer ....... 369
Synergist see Tetranychus truncates; Detoxification mechanism; Sugar apple extract ............ 340
Systematic key see Termite; Soldier caste; Geographical distribution ...................................... 349
Talaromyces see Soil fungi; Pdecilomyces; Byssochlamys; Thermoascus; Thermotolerant;
Thermoresistant ....................................................................................................................... 94
Termite; Systematic key; Soldier caste; Geographical distribution
A Systematic Key to Termites of Thailand ............................................................................. 349
Terrestrial orchids see Ceratorhiza; Epulorhiza; Rhizoctonia; Mycorrhizal fungi .................... 216
Tetranychus truncates; Synergist; Detoxification mechanism; Sugar apple extract
Synergism and Detoxification Mechanism of Crude Sugar Apple Seed Extract in
Tetranychus truncatus Ehara (Prostigmata: Tetranychidae) ................................................... 340
Textural quaily see Acceptability; Composite rice flour; Thai rice cake ................................... 247
Thai indigenous vegetable; Fibrinolytic activity; Proteolytic activity; Thermal stability
Fibrinolytic Activity of Thai Indigenous Vegetables .............................................................. 241
Thai rice cake see Acceptability; Composite rice flour; Textural quaily ................................... 247
Thermal stability see Thai indigenous vegetable; Fibrinolytic activity; Proteolytic activity ... 241
Thermoascus see Soil fungi; Pdecilomyces; Byssochlamys; Talaromyces; Thermotolerant;
Thermoresistant ....................................................................................................................... 94
Thermoresistant see Soil fungi; Pdecilomyces; Byssochlamys; Talaromyces; Thermoascus;
Thermotolerant ........................................................................................................................ 94

570

Kasetsart J. (Nat. Sci.) 38 (4)

Thermosensitive genetic male sterility (TGMS); Cytoplasmic genetic male sterile line;
Hybrid rice; Heterosis; Tms2 gene
Adaptability of Thermosensitive Genetic Male Sterile Rice Lines in Thailand ..................... 183
Thermotolerant see Soil fungi; Pdecilomyces; Byssochlamys; Talaromyces; Thermoascus;
Thermoresistant ..................................................................................................................... 94
Thua nao production; Mixed cultures; Vitamin B12 enrichment
Improvement of High Vitamin B12 Thua nao by Mixed Cultures of Soybean
Oligosaccharide and the Use of Bacteria and Yeasts .............................................................. 123
Tidal effect see Saint-Venant equations; Dynamic wave; Implicit finite difference;
Nonlinear algebraic equations; Backwater effect; Bang Pakong River Basin ................ 409
Tillage; Weed management; Fertilizer; Wheat; Triticum aestivum L.
Weed Population Dynamics as Influenced by Tillage, Fertilizer and Weed Management in
Wheat (Triticum aestivum L.) Cropping Systems of Central Ethiopia ................................... 290
Tms2 gene see Thermosensitive genetic male sterility (TGMS); Cytoplasmic genetic male
sterile line; Hybrid rice; Heterosis ....................................................................................... 183
Tolerance see Branched broomrape; Tomato varieties; Resistance; Parasitic weeds .............. 434
Tomato see Branched broomrape; Animal manure; Nitrogen fertilizer; Parasitic weeds ....... 311
Tomato varieties see Branched broomrape; Resistance; Tolerance; Parasitic weeds .............. 434
Transgressive segregation see Maize; Exotic; Germplasm; Inbred line; Latitude ................... 165
Triacylglycerol see Dairy cow; Fatty liver .................................................................................... 229
Triticum aestivum L. see Tillage; Weed management; Fertilizer; Wheat .................................. 290
Ubolratana Reservoir see Molluscs; Distribution ........................................................................ 131
Vespa spp; Nesting sites; Vespidae
Nesting Habits of Some Hornet Species (Hymenoptera, Vespidae) in Northern Thailand .... 196
Vespidae see Vespa spp; Nesting sites ............................................................................................ 196
Vetiver; Plant nutrient; Mulching; Compost; Super sweet corn
Decomposition of Vetiver Shoot and Effect of Vetiver Mulching on Super Sweet Corn
Hybrid Yield ............................................................................................................................ 305
Vibrio harveyi see Beneficial bacteria; Penaeus monodon ............................................................ 393
Virus titer see Sugarcane mosaic virus; Sugarcane; Corn; Sorghum; ELISA; Symptom ....... 369
Vitamin B12 enrichment see Thua nao production; Mixed cultures .......................................... 123
Weed management see Tillage; Fertilizer; Wheat; Triticum aestivum L. .................................. 290
Wheat see Tillage; Weed management; Fertilizer; Triticum aestivum L. .................................. 290
White rot fungi see Laccase; Xylanase; Cellulase; Lignocellulose degradation; Lentinus
polychrous Lev.; L. squarrosulus Mont .................................................................................. 65
X-ray diffraction analysis (XRD) see Soil improvement; Clay; Cement; Fly ash;
Calcium silicate hydrate (CSH) ............................................................................................ 539
Xylanase see Laccase; Cellulase; Lignocellulose degradation; White rot fungi; Lentinus
polychrous Lev.; L. squarrosulus Mont .................................................................................. 65
Yield component see Cotton; F2 hybrids; Heterosis; Fiber quality ............................................ 176
Zoea see Scylla olivacea; Larval feed; Megalopa; Crab ............................................................... 484

Kasetsart Journal
Application for Membership
Name : _________________________________________________________________________
Title

: _________________________________________________________________________

Home Address : __________________________________________________________________


Tel : ___________________________________ Fax : ______________________________
Office Address : __________________________________________________________________
Tel : ___________________________________ Fax : ______________________________
E-mail Address : __________________________________________________________________
Type of application :

 New Membership
 Membership Extension

Membership type :

 Regular (non government) Membership


 Student Membership

Submission information :
Student membership (Natural Science)
 Application and 60 bahts dues payment
 Letter of Recommendation from major advisor or the copy of student ID
Student membership (Social Science)
 Application and 40 bahts dues payment
 Letter of Recommendation from major advisor or the copy of student ID
Regular membership (Natural Science)
 Application and 120 bahts dues payment
Regular membership (Social Science)
 Application and 80 bahts dues payment

Send application materials to


Manager of KU Journal
KURDI Kasetsart University
50 Paholyothin, Bangkhen Bangkok 10900
Payment information :
 Cash
 Money order made payable to KURDI , Kasetsart Post Office
Preferred mailing address
 Home
 Office

Do Not Write In This Space


For Office Use Only
Membership Number ______________________
Receipt Number __________________________

Receipt Date ________________________

___________________________ Finance Officer


( __________________________ )
Date ___________________________

Letter of Recommendation
This is to certify that _______________________________________________________
is currently the ____________________________ (first - , second -, third -, fourth year, graduate)
student majoring _________________________ , Faculty of _____________________________
, ______________________________ University.

( __________________________________)
Academic Title ______________________
Major Advisor
Date _______________________________

Text and Journal Publication Co., Ltd.


158/3 Soi Viphawadi Rangsit 5, Viphawadi Rangsit Road, Chom Phon, Chatuchak, Bangkok 10900
tel. 0-2617-8611-5 fax. 0-2617-8616


158/3 5 ( 1) 10900
. 0-2617-8611-5 fax. 0-2617-8616

close