Você está na página 1de 128

BIOLOGIA

SUMRIO
1)BIOMOLCULAS (CARBOIDRATOS, GUA, SAIS, PROTEINAS...)...........................03
2)CIDOS NCLEICOS...........................................................................................................09
3)VITAMINAS...........................................................................................................................12
4)ORGANELAS CITOPLASMTICAS E MEMBRANA CELULAR....................................13
5)METABOLISMO CELULAR (RESPIRAO, FOTOSSNTESE, FERMENTAO)......16
6)NCLEO CELULAR E DIVISES CELULARES................................................................20
7)TAXONOMIA..........................................................................................................................26
8)PROTOZORIOS.....................................................................................................................28
9)REINO ANIMAL......................................................................................................................31
10)VRUS E FUNGOS.................................................................................................................46
11)DOENAS (VERMINOSES, PROTOZOOSES, INFECES VIRAIS E BAC~~)............48
12)CORPO HUMANO(HISTOLOGIA E FISIOLOGIA HUMANA)........................................54
13)REPRODUO HUMANA...................................................................................................63
14)EMBRIOLOGIA E ANEXOS EMBRIONRIOS.................................................................65
15)ALGAS....................................................................................................................................67
16)BOTNICA.............................................................................................................................68
17)GENTICA.............................................................................................................................81
18)ECOLOGIA E CICLOS BIOGEOQUMICOS......................................................................94
19)EVOLUCIONISMO E PROCESSOS ADAPTATIVOS.....................................................111
20)MULTIDISCIPLINAR..........................................................................................................116

BIOMOLCULAS (CARBOIDRATOS, GUA, SAIS, PROTEINAS...)


UNIOSTE (2006) 1) Relativo aos componentes qumicos das clulas correto afirmar que:
(01) O teor de gua nos tecidos de animais superiores maior quanto maior seu metabolismo e
menor com o aumento da idade.
(02) Os lipdeos so molculas orgnicas formadas da associao entre cidos graxos e lcool e
formam um material de isolamento trmico nas aves e mamferos.
(04) O amido o polissacardeo que representa a principal forma de armazenamento intracelular
de glicdios nas clulas animais.
(08) Os carboidratos so os compostos orgnicos mais abundantes da matria viva, constitudos
de unidades denominadas aminocidos e so responsveis pela estruturao dos tecidos.
(16) Os cidos nuclicos so as maiores molculas intracelulares encontradas em todos os seres
vivos, e so responsveis pelo controle dos processos metablicos vegetais.
(32) Os sais minerais presentes na clula apresentam-se sob a forma imobilizada como
principais componentes de estruturas esquelticas.
(64) Algumas protenas atuam como enzimas catalisando uma reao biolgica e apresentando
especificidade de substratos e dependncia de temperatura
UEPG (2007_1) 2) Os lipdios constituem um dos grupos formados pelas principais substncias
orgnicas que compem a matria viva. Dentre as suas vrias funes destacam-se a energtica
e a estrutural. Com base nestas informaes, analise as alternativas abaixo e assinale o que for
correto.
01) So formados pela reao entre cido graxo (longa cadeia de tomos de carbono ligados a
tomos de hidrognio apresentando um grupamento cido carboxlico na extremidade terminal)
e lcool (uma ou mais hidroxilas ligadas a tomos de carbono
saturados).
02) Um dos lcoois mais comumente encontrados na formao dos lipdios o glicerol.
04) Na formao de um lipdio, lcool e cido graxo estabelecem uma ligao na qual uma
hidroxila do primeiro reage com o grupo cido carboxlico do segundo, liberando uma molcula
de gua. Esse processo conhecido como reao de esterificao.
08) Na reao de esterificao, se o lcool for o glicerol, o produto ser um glicerdeo (leo ou
gordura). Caso se trate de um outro lcool de cadeia aberta, o lipdio formado ser um cerdeo
(cera). lcoois de cadeia fechada caracterizam os lipdios classificados
como esterides ou esterdeos.
16) Ao serem degradados, os lipdios liberam grandes quantidades de energia. Cada grama
fornece o dobro da energia que a mesma quantidade de glicdio.
UEPG (2008_1) 3) As protenas, que so molculas grandes, apresentam estrutura complexa, j
que uma molcula de protena constituda por v-rias unidades menores, ligadas entre si, que
so os aminocidos. A respeito dos aminocidos, assinale o que for correto.
01) So exemplos de aminocidos naturais: glicina, alanina, serina, cistena, tirosina,
fenilalanina, valina, lisina e leucina.
02) Os seres vivos necessitam de 20 aminocidos para promover a sntese de suas protenas. Os
vegetais so capazes de pro-duzir todos eles, ao passo que os animais, tendo em vista que suas
clulas s sintetizam 12 deles, obtm os 8 restantes a partir dos alimentos.
04) Toda molcula de aminocido tem um grupo cido carboxlico (COOH) e um grupo amina
(NH2) ligado a um tomo de car-bono. A esse mesmo carbono se liga ainda um tomo de
hidrognio e um radical (R), que pode ser um simples tomo de hi-drognio (na glicina), um
CH3 (na alanina), ou grupos mais complexos (em outros aminocidos). Assim, os aminocidos
exis-tentes na natureza diferem entre si apenas quanto aos seus radicais.

08) Na molcula de protena, dois aminocidos se unem por meio de uma ligao peptdica entre
as suas carboxilas, com a perda de uma molcula de gua, caracterizando uma sntese por
desidratao.
UFMS (2008) 4) Os carboidratos apresentam importantes funes, entre as quais destacam-se as
energticas e as estruturais. Classificam-se em: monossacardeos, oligossacardeos (os
dissacardeos so os mais conhecidos nesse grupo) e polissacardeos. Em relao aos
carboidratos, correto afirmar:
(001) A glicose classificada como dissacardeo.
(002) A celulose exerce importante funo estrutural, participando da parede celular dos
vegetais.
(004) O amido classificado como polissacardeo e desempenha importante funo de reserva
energtica em vegetais.
(008) A sacarose, encontrada na cana-de-acar e na beterraba, classificada como
monossacardeo.
(016) A quitina, classificada como polissacardeo, exerce importante funo estrutural, a
exemplo do exoesqueleto dos artrpodes e da parede celular dos fungos.
(032) O glicognio classificado como oligossacardeo e apresenta funes energticas e
estruturais em animais e vegetais.
UFMS (2010) 5) As protenas, formadas pela unio de aminocidos, so componentes qumicos
fundamentais na fisiologia e na estrutura celular dos organismos. Em relao s protenas,
assinale a(s) proposio(es) correta(s).
(001) O colgeno a protena menos abundante no corpo humano apresentando forma globular
como a maioria das protenas.
(002) A ligao peptdica entre dois aminocidos acontece pela reao do grupo carboxila de um
aminocido com o grupo amino de outro aminocido.
(004) A ptialina, enzima produzida pelas glndulas salivares, atua na digesto de protenas.
(008) A anemia falciforme, causada por fatores nutricionais, atribuda ao rompimento das
hemcias em funo da desnaturao da molcula protica de hemoglobina em decorrncia do
aumento da temperatura corporal.
(016) A insulina, envolvida no metabolismo da glicose, um exemplo de hormnio protico.
(032) As protenas casena e albumina so encontradas no leite e na clara do ovo,
respectivamente.
UEM (2009_1) 6) Assinale o que for correto sobre a constituio das clulas.
01) O tomo de carbono faz parte da constituio das molculas de vitaminas e dos
fosfolipdios.
02) As unidades bsicas formadoras de enzimas, de polissacardeos e de cidos nucleicos so
aminocidos, monossacardeos e nucleotdeos, respectivamente.
04) A autoduplicao de molculas de DNA e de RNA origina cpia exata de si mesma.
08) As bases nitrogenadas adenina, citosina e timina constituem tanto o DNA quanto o RNA.
16) Os triglicerdeos so lipdios solveis em gua e formados por glicerol e cidos graxos.
UEM (2009_2) 7) A qumica da vida conduzida por molculas que permitem a organizao e a
funcionalidade das clulas. Identifique o que for correto sobre algumas dessas molculas.
01) A semipermeabilidade da membrana plasmtica a gases, como o O2 e o CO2, atribuda ao
carter hidroflico dos componentes da sua dupla camada lipdica.
02) Frutose, ribose e sacarose so carboidratos classificados como dissacardeos.

04) Apesar de a gua ser o componente qumico mais abundante na matria viva, a sua
quantidade varivel nas diferentes partes de um organismo. Nos humanos, as clulas nervosas,
por apresentarem maior atividade metablica, contm mais gua do que
as clulas sseas.
08) Aminocidos, amido e clorofila exercem funes distintas nas clulas. Porm, todos
apresentam os tomos de C e de H em suas molculas.
16) Cada enzima apresenta um pH timo para a sua atividade. Assim, uma enzima X qualquer
pode apresentar o pH timo igual a 2,0 (meio cido) e outra enzima Z pH 8,0 (meio bsico).
UEM (2011_1) 8) As protenas so componentes fundamentais de todos os seres vivos,
formadas por dezenas de aminocidos. Sobre esse assunto, assinale o que for correto.
01) Uma molcula de aminocido formada por tomos de carbono, hidrognio, oxignio e
nitrognio.
02) Toda molcula de aminocido apresenta um tomo de carbono (%), ao qual se ligam um
grupo amina (NH2), um grupo carboxila (COOH), um tomo de hidrognio (H) e um quarto
grupo Radical (R).
04) A ligao entre dois aminocidos vizinhos denominada ligao peptdica.
08) A sequncia de aminocidos na cadeia polipeptdica a estrutura secundria da protena.
16) Todo ser vivo capaz de fabricar os vinte tipos de aminocidos existentes para sintetizar
suas protenas.
UEM (2011_2) 9) Carboidratos (glicdios ou hidratos de carbono) so molculas orgnicas
constitudas fundamentalmente por tomos de carbono, hidrognio e oxignio. Sobre essas
molculas, correto afirmar que
01) os monossacardeos mais abundantes nos seres vivos so as hexoses (frutose, galactose,
glicose), que, quando degradadas, liberam energia para uso imediato.
02) ribose e desoxirribose so polissacardeos que compem os cidos nucleicos.
04) a quitina um polissacardeo que constitui o exoesqueleto dos artrpodes e apresenta
tomos de nitrognio em sua molcula.
08) a maioria dos carboidratos apresenta funo energtica, como a celulose e a quitina;
entretanto, alguns podem apresentar funo estrutural, como o amido e o glicognio.
16) os animais apresentam grande capacidade de estocagem de carboidratos, quando
comparados s plantas, que armazenam apenas lipdios.
UEM (2008_1) 10) Retirando-se a gua da matria viva, verifica-se a presena de protenas
(72%), de lipdios (14,5%), de glicdios (4,5%), de cidos nuclicos (4,5%) e de outras
substncias (4,5%). Sobre a constituio qumica dos organismos vivos, assinale o que for
correto.
01) As protenas so formadas por molculas de aminocidos constitudos por tomos de
carbono, oxignio, hidrognio e nitrognio.
02) Nos seres humanos, os lipdios so utilizados como reserva energtica e auxiliam na
manuteno da temperatura corporal.
04) Clcio, ferro, fsforo e magnsio so elementos minerais encontrados no corpo humano.
08) A frao que representa a quantidade de lipdios na constituio qumica dos organismos
vivos, desconsiderando a gua, 29/200 .
16) cidos nuclicos so constitudos de DNA e de RNA e o DNA corresponde a 2,25% do total
de cidos nuclicos.

UEM (2008_2) 11) Considere um grupo de clulas animais colocadas em diferentes solues e
assinale o que for correto.
01) Se a soluo for isotnica, aps alguns minutos, a presso hidrosttica ser a mesma tanto no
interior quanto no exterior da clula, e a presso osmtica ser nula.
02) Se a soluo for hipertnica, aps alguns minutos, a presso hidrosttica ser a mesma tanto
no interior quanto no exterior da clula.
04) Hemceas colocadas em soluo hipertnica perdem gua e murcham.
08) Em soluo hipotnica, o processo de transporte ativo ocorre contra o gradiente de
concentrao, consumindo energia.
16) Em soluo hipertnica, o processo de transporte passivo no envolve o movimento de
partculas.
UEM (2008_2) 12) Assinale o que for correto.
01) Amido e glicognio so polissacardeos que atuam como substncias de reserva de energia.
02) Amido e glicognio so polissacardeos que, por hidrlise, produzem glicose.
04) Amido e glicognio so encontrados principalmente em razes e em caules de plantas.
08) Os glicdios com frmulas moleculares C7H12O6, C3H6O3 e C6H12O6 so,
respectivamente, um monossacardeo, um monossacardeo e um dissacardeo.
16) A gua, presente em 75% dos corpos dos seres vivos, tem, em seu alto calor especfico, uma
das principais propriedades que proporciona variaes bruscas de
temperatura no interior das clulas.
UEM (2009_1) 13) Com relao aos constituintes qumicos da matria orgnica, assinale o que
for correto.
01) O mineral clcio, presente nos vegetais verdes e no leite, essencial coagulao do sangue
e contrao muscular no organismo humano.
02) A unio entre dois aminocidos se d por uma reao de sntese por desidratao e as
molculas resultantes so genericamente chamadas de peptdeos.
04) A vida na Terra baseia-se essencialmente no elemento hidrognio, tomo tetravalente, que
constitui a estrutura bsica de todas as molculas orgnicas.
08) Na espcie humana, os ons de sdio (Na+) e de potssio (K+) so responsveis pelas
alteraes eltricas na membrana plasmtica do neurnio durante o impulso nervoso.
16) Os seres humanos so capazes de produzir todos os vinte tipos de aminocidos necessrios
para a composio das protenas.
UEM (2009_1) 14) Sabendo-se que a maior parte da energia de que o corpo humano necessita
vem dos carboidratos e das gorduras, assinale a(s) alternativa(s) correta(s).
01) O amido, um carboidrato, hidrolisado no intestino humano, formando glicose e frutose.
02) A decomposio dos carboidratos rpida, portanto sua energia fornecida rapidamente ao
corpo.
04) As gorduras so os melhores acumuladores de energia no corpo humano, pois so solveis
em gua, o que facilita o transporte at as clulas.
08) A energia liberada quando 1 grama de uma substncia sofre combusto chamada de calor
especfico de combusto.
16) A celulose, por apresentar estrutura qumica similar do amido, serve como alimento rico
em energia para a dieta humana.

UEM (2010_1) 15) Sacarose, ribose e colesterol so biomolculas que desempenham


importantes funes no metabolismo celular. Assinale o que for correto sobre elas e suas
funes.
01) Sacarose um acar redutor porque possui radicais aldedos livres e o acar mais
simples que circula no sangue dos mamferos.
02) Ribose a base nitrogenada do RNA.
04) O colesterol no produzido pelas clulas humanas. Assim, devemos obt-lo diretamente
dos alimentos de origem animal ou vegetal, como castanhas e nozes.
08) A hidrlise da sacarose produz os monossacardeos, glicose e frutose.
16) Todas as biomolculas mencionadas acima so substncias orgnicas.
UEM (2010_1) 16) Sobre as protenas, assinale o que for correto.
01) Somente vinte tipos de aminocidos so usados pelas clulas na montagem das protenas nos
seres vivos.
02) A frmula geral envolve o grupo amina e o grupo carboxilamida.
04) A lista dos aminocidos essenciais a mesma para todos os animais.
08) A desnaturao de protenas causada exclusivamente por elevao de temperatura ou
mudanas de pH.
16) As pontes dissulfeto so ligaes muito fortes que se estabelecem entre molculas do
aminocido cistena e fazem a cadeia dobrar sobre si mesma.
UEM (2010_02) 17) Assinale o que for correto.
01) A gua uma molcula polar, por apresentar zonas positivas e negativas, em lados opostos.
02) A frmula geral dos monossacardeos (CH2O)n, em que o valor de n varia de 3 a 7.
04) O colesterol um esteroide presente na composio qumica da membrana plasmtica de
animais, alm de atuar como substncia precursora dos hormnios testosterona e progesterona.
08) Os fosfolipdios possuem caractersticas qumicas semelhantes a detergentes, apresentando
uma cauda hidrofbica (parte apolar) e uma cabea hidroflica (parte polar).
16) Os dissacardeos no so solveis em gua, mas so imediatamente aproveitveis como
fonte de energia pelos organismos vivos.
UEM (2011_2) 18) Tendo em vista que o consumo excessivo de alimentos gordurosos
prejudicial sade, um vestibulando, quando foi ao mercado, leu a seguinte inscrio no rtulo
de uma determinada margarina: Fabricada com leos vegetais hidrogenados. Sobre esse
assunto, correto afirmar que
01) so chamados de cidos graxos de cadeia saturada aqueles que apresentarem dupla ligao
entre um ou mais pares de carbonos da cadeia, sendo considerados um leo.
02) uma dieta saudvel deve conter certa quantidade de gorduras e leos, pois so necessrios
para o organismo absorver as vitaminas lipossolveis (A, D, E, K).
04) glicerdeos so constitudos por molculas do lcool glicerol, ligadas a uma, a duas, ou a trs
molculas de cidos graxos.
08) leos e gorduras so glicerdeos e diferem quanto ao ponto de fuso: leos so lquidos
temperatura ambiente e gorduras so slidas.
16) atravs de uma reao qumica, por adio de hidrognio s molculas de leos vegetais,
obtm-se produtos de consistncia pastosa temperatura ambiente.

UEM (2011_2) 19) A substituio de um hidrognio alfa do cido actico por um grupo amina
(NH2) gera o aminocido glicina. Uma outra substituio de um hidrognio alfa da glicina pelo
radical CH2SH gera o aminocido cistena. A partir dessas informaes e outras caractersticas
dos aminocidos correto afirmar que
01) a formao de um peptdeo a partir de dois aminocidos envolve uma reao de desidratao
e o estabelecimento de uma funo amida.
02) todos os alfa aminocidos existentes podem ser gerados a partir da substituio de um
hidrognio alfa da glicina por um grupamento R especfico.
04) exceto a glicina, todos os alfa aminocidos so substncias quirais.
08) diferentes protenas apresentam sequncias e quantidades diferentes de alfa aminocidos, e
isso determina a sua funo biolgica.
16) o processo de desnaturao de uma protena ocorre somente quando h a quebra de todas as
suas ligaes peptdicas.
UEM (2011_2) 20) A respeito de alguns minerais, de suas funes no organismo humano e suas
principais fontes na alimentao, assinale o que for correto.
01) O ferro um componente da hemoglobina, da mioglobina e das enzimas respiratrias. O
fgado de boi uma fonte rica desse componente, na forma oxidada.
02) O sdio o principal ction no lquido intracelular; apresenta-se como um ction bivalente e
tem no sal de cozinha sua principal fonte.
04) O iodo um dos componentes dos hormnios da tireoide e encontrado na substncia NaCl.
08) O enxofre um componente essencial na produo de lipdios e sua fonte principal so os
sulfatos presentes em guas minerais.
16) O clcio um elemento essencial coagulao sangunea, sendo encontrado em leites.
GABARITO:
1-GAB: 01+02+16+64=83
2-GAB: 01+02+04+08+16=31
3-GAB: 02+04=06
4-GAB: 02+04+16=22
5-GAB: 02+16+32=50
6-GAB: 01+02=03
7-GAB: 04+08+16=28
8-GAB: 01+02+04=07
9-GAB: 01+04=05
10-GAB: 01+02+04+08=15
11-Gab: 01+04+08=13
12-GAB: 01+02=03
13-GAB: 01+02+08=11
14-GAB: 02+08=10
15-GAB: 08+16=24
16-GAB: 01+16=17
17-GAB: 01+02+04+08=15
18-GAB: 02+04+08+16=30
19-GAB: 01+02+04+08=15
20-GAB: 01+16=17

CIDOS NUCLEICOS
UNIOESTE (2006) 1) O esquema abaixo representa o modelo da estrutura do DNA proposto por
Watson e Crick em 1953. Relativo s estruturas indicadas no esquema abaixo, assinale a(s)
alternativa(s) correta(s).

(01) 1 representa uma base pirimdica.


(02) 2 representa a ligao inica que ocorre entre os dois filamentos de DNA.
(04) 3 representa uma base prica.
(08) 4 representa a pentose, que no DNA pode ser tanto a ribose quanto a desoxirribose.
(16) 5 representa um grupo fosfato, responsvel pela carga negativa do DNA.
(32) 6 e 7 esto emparelhados mas em sentidos opostos.
(64) Um par de nucleotdeos composto apenas pelas estruturas 1, 2 e 3.
UNIOESTE (2005) 2) A dupla hlice como modelo de estrutura tri-dimensional do DNA foi
proposta por Watson e Crick em 1953. Relativo a esta estrutura, correto afirmar:
(01) que os dois filamentos de DNA esto unidos um ao outro por ligaes fosfodister.
(02) que a quantidade de bases pricas igual quantidade de bases pirimdicas.
(04) que a seqncia de nucleotdeos de um filamento sempre idntica seqncia de
nucleotdeos do filamento complementar.
(08) que, em uma dupla fita de DNA com 200 pares de nucleotdeos, encontram-se 400
desoxirriboses, 400 grupos fosfatos, 200 bases pricas e 200 bases pirimdicas.
(16) que bases pricas e bases pirimdicas possuem 1 e 2 anis, respectivamente.
(32) que citosina e timina so bases pirimdicas; guanina e adenina so bases pricas.
(64) que o DNA possui carga positiva.
UEPG (2008_1) 3) A respeito da molcula de DNA, assinale o que for correto.
01) Durante a duplicao do DNA, as pontes de hidrognio que ligam as bases nitrogenadas se
rompem, e as duas fitas se separam. Cada uma das fitas originais, ento separadas, serve agora
como molde para a produo de fitas novas.

02) Alm da capacidade de se duplicar, o DNA tambm fabrica RNA. A duplicao uma
propriedade que permite a transmisso da informao gentica s clulas-filhas, ao passo que a
produo de RNA relaciona-se sntese de protenas, no citoplasma.
04) O DNA uma molcula constituda por duas cadeias de nucleotdeos, em cada uma das
quais os nucleotdeos esto ligados uns aos outros pelos fosfatos. As duas cadeias esto ligadas
uma outra pelas suas bases nitrogenadas, por meio de pontes de hidrognio, e essas ligaes
ocorrem entre pares de bases especficas. Sendo assim, a adenina liga-se somente timina, e a
citosina liga-se sempre guanina. Toda essa estrutura apresenta-se torcida e em forma de duplahlice.
08) O DNA sempre tem a forma de dupla-hlice e sempre constitudo por apenas quatro tipos
de nucleotdeos. Na verdade, uma molcula de DNA pode diferir da outra pelo numero total de
nucleotdeos. Embora o menor DNA conhecido tenha ao redor de 5.500 nucleotdeos, a maioria
das molculas de DNA tem algumas centenas de milhares de nucleotdeos. Assim, varia muito o
tamanho de uma molcula para outra. Alm do tamanho, as molculas de DNA diferem pela
seqncia dos pares de bases.
UEPG (2009_1) 4) A respeito do DNA e do RNA, assinale o que for correto.
01) Os dois se originam a partir da unio dos nucleotdeos compostos por cido fosfrico, acar
e base nitrogenada.
02) Embora o DNA e o RNA sejam estruturalmente bem distintos, a unio entre os nucleotdeos
dessas duas molculas ocorre por meio da radical fosfato (cido fosfrico) com a pentose.
04) As bases nitrogenadas que compem os nucleosdeos do DNA so adenina, guanina,
citosina e uracila, e as bases nitrogenadas que compem os nucleosdeos do RNA so adenina,
guanina, citosina e timina.
08) Eles podem ser distinguidos por meio de suas bases piramdicas. A timina exclusiva do
RNA e a uracila s aparece no DNA.
16) O RNA geralmente composto por uma fita simples, e o DNA se apresenta como uma dupla
hlice numa configurao espacial denominada helicoidal.
UFSC (2008) 5) Todas as formas de vida do nosso planeta tm suas informaes genticas
codificadas nas seqncias de bases nitrogenadas dos cidos nuclicos. Assinale a(s)
proposio(es) CORRETA(S), considerando as informaes abaixo:
Seqncia 1 AAAGATCCCGAATCGGTCGGCGATTTATCG
Seqncia 2 TTTCTAGGGCTTAGCCAGCCGCTAAATAGC
01. As seqncias 1 e 2 so complementares no DNA e, juntas, representam um segmento de
molcula de DNA.
02. Se considerarmos 1 a seqncia molde, o RNAm formado por esta seqncia conter as
mesmas bases nitrogenadas da seqncia 2, trocando-se a timina pela uracila.
04. Na seqncia 1 esto representados 30 cdons e 10 nucleotdeos.
08. A seqncia 1 pode ser a representao de um DNA ou de um RNA, dependendo de como
for lida.
16. O cdigo gentico exclusivo de cada espcie. Prova disso que determinados
aminocidos, como por exemplo a fenilalanina, so encontrados apenas na espcie humana.
32. Adenina, timina, citosina e guanina so aminocidos essenciais, presentes em todos os seres
vivos.
64. Com o seqenciamento do genoma humano foi possvel determinar a seqncia de
aminocidos de todas as protenas humanas.

10

UFSC (2009) 6) O DNA a molcula biolgica responsvel pela codificao da informao


gentica nos seres vivos.
Sobre esse assunto, CORRETO afirmar que:
01. a molcula de DNA formada por duas cadeias caracterizadas por seqncias de bases
nitrogenadas.
02. na molcula de DNA podem existir oito diferentes tipos de complementao de bases
nitrogenadas.
04. a quantidade de adenina presente em uma das cadeias exatamente igual quantidade de
timina da cadeia complementar.
08. na molcula de DNA podem existir cinco diferentes tipos de bases nitrogenadas.
16. no processo de mitose, cada molcula de DNA d origem a quatro molculas de DNA
exatamente iguais.
UEM (2009_2) 7) Identifique o que for correto sobre a molcula do DNA e do RNA.
01) A duplicao do DNA semiconservativa.
02) Se em uma molcula de DNA 30% dos nucleotdeos apresentam a guanina, 20% dos
nucleotdeos apresentaro a timina.
04) As quatro bases nitrogenadas do RNA mensageiro, reunidas trs a trs, formam 64 trincas
distintas.
08) Na molcula de RNA, o pareamento das bases nitrogenadas descrito pela relao
(U+C) + (G+A)= 1.
16) O fluxo da informao gentica nas clulas eucariticas ocorre do DNA para o RNA e, na
maioria das vezes, do RNA para um polipeptdio ou uma protena.
GABARITO
1-GAB: 16+32=48
2-GAB: 02+08+32=42
3-GAB: 01+02+04+08=15
4-GAB: 01+02+16=19
5-GAB: 01+02=03
6-GAB: 01+04=05
7-GAB: 01+02+04+16=23

11

VITAMINAS
UFMS (2007) 1) Em relao s vitaminas humanas, leia atentamente as afirmativas abaixo e
assinale a(s) proposio(es) correta(s).
(001) A vitamina C tem a funo de manter os epitlios e de formar os pigmentos visuais.
(002) A vitamina B1 pode ser encontrada nos levedos, na gema de ovo, nas cascas dos cereais e
responsvel pelo metabolismo dos acares.
(004) A vitamina D responsvel pela oxidao celular.
(008) A vitamina cuja deficincia causa o raquitismo em crianas de 4 meses a 2 anos de idade
a vitamina K.
(016) A vitamina E previne infeces e mantm a integridade dos vasos sangneos.
(032) A deficincia da vitamina D causa raquitismo.
UFMS (2009) 2) As vitaminas podem ser classificadas, quanto solubilidade, em hidrossolveis
ou lipossolveis. Considerando tal classificao e observando que as deficincias vitamnicas,
ou seja, as hipoavitaminoses ou avitaminoses, podem causar doenas, assinale a(s)
proposio(es) correta(s).
(001) A deficincia de vitamina B1 (tiamina), classificada como hidrossolvel, causa o beribri.
(002) A pelagra causada pela deficincia de vitamina E (tocoferol), classificada como
hidrossolvel.
(004) O escorbuto causado pela deficincia de vitamina B9 (cido flico), classificada como
lipossolvel.
(008) A vitamina A (retinol), classificada como hidrossolvel, previne a anemia perniciosa.
(016) A deficincia de vitamina D (calciferol), classificada como lipossolvel, causa o
raquitismo.
(032) A vitamina C (cido ascrbico), classificada como lipossolvel, previne a cegueira
noturna.
UEM (2009_2) 3) Vitaminas so substncias orgnicas necessrias ao funcionamento adequado
do organismo humano. Assim, identifique o que for correto sobre os seus sintomas de
deficincia e as suas fontes alimentares.
01) A coagulao do sangue prejudicada pela carncia da vitamina K, cuja fonte alimentar so
os vegetais verdes, entre outros exemplos.
02) O escorbuto surge no organismo humano em consequncia de alimentao deficitria em
vitamina C.
04) Vegetais vermelhos, como a beterraba e o pimento, so as principais fontes alimentares da
vitamina D.
08) A vitamina E previne a doena conhecida como pelagra.
16) A doena conhecida por beribri surge em decorrncia da deficincia de vitamina A.
GABARITO:
1-GAB: 32+02=34
2-GAB: 01+16=17
3-GAB: 01+02=03

12

ORGANELAS CITOPLASMTICAS E MEMBRANA PLASMTICA


UEPG (2009_1) 1) A respeito das especializaes da membrana plasmtica, que garantem o
desempenho das clulas, assinale o que for correto.
01) As microvilosidades e invaginaes de base aumentam a superfcie de absoro, como
ocorre nas clulas do intestino delgado, cuja principal funo absorver os nutrientes dos
alimentos digeridos.
02) As interdigitaes e os desmossomos aumentam a adeso intercelular, como ocorre nos
diversos tecidos que constituem os organismos pluricelulares.
04) Os plasmodesmos facilitam a comunicao intercelular, proporcionando um contato muito
mais ntimo entre as clulas adjacentes e permitindo a livre movimentao de ons e molculas
pequenas, tais como nucleotdeos, glicdios e vitaminas.
08) Em virtude de ser espessa e resistente, a parede celular desempenha funes de proteo e
suporte mecnico. Ela est presente em clulas vegetais e em algumas bactrias.
16) A znula oclusiva atua como uma barreira difuso de substncias por ser constituda por
celulose, pectina ou lignina.
UFMS (2010) 2) A membrana plasmtica da clula desempenha diversas funes, apresentando
importantes especializaes alm de capacidade seletiva. Em relao membrana plasmtica,
assinale a(s) proposio(es) correta(s).
(001) Estruturas lipdicas, ligadas membrana citoplasmtica com funo de reduo da coeso
entre as clulas, so denominadas desmossomos.
(002) A passagem de soluto pela membrana plasmtica contra um gradiente de concentrao,
com gasto de energia pela clula, denominada transporte ativo.
(004) Osmose a passagem de soluto de um meio hipertnico para um meio hipotnico por uma
membrana permevel.
(008) As microvilosidades so especializaes da membrana plasmtica que aumentam a
superfcie de absoro celular, a exemplo das clulas de revestimento da mucosa intestinal.
(016) Na difuso facilitada, ocorre a passagem de soluto sem gasto de energia pela membrana,
do meio mais concentrado para o menos concentrado com o auxlio de permeases presentes na
membrana plasmtica.
(032) Hemcias humanas, mergulhadas em meio hipotnico, apresentam reduo de volume.
UFMS (2010) 3) Em relao s seguintes estruturas celulares:
I. Mitocndrias
II. Lisossomos
III. Peroxissomos
IV. Cloroplastos
V. Complexo Golgiense
VI. Ribossomos
Assinale a(s) proposio(es) correta(s).
(001) A estrutura II est relacionada com a heterofagia e com a autofagia celular.
(002) A estrutura VI est relacionada sntese protica.
(004) A doena Silicose e a doena de Tay-Sachs esto relacionadas estrutura I.
(008) A estrutura V abundante em clulas secretoras como as clulas das glndulas que
produzem enzimas digestivas.
(016) O processo de fotossntese est relacionado estrutura IV.
(032) A estrutura III est relacionada ao transporte de substncias e sntese de esterides na
clula.

13

UEM (2008_2) 4) Sobre a organizao estrutural e funcional das clulas, assinale o que for
correto.
01) Na membrana plasmtica das clulas vegetais, o principal carboidrato a celulose.
02) Cloroplastos e mitocndrias apresentam ribossomos, cuja funo a sntese de protenas.
04) Dictiossomo, tilacides e nuclolo so formaes, respectivamente, do complexo golgiense,
cloroplastos e ncleo.
08) Vacolos so organelas citoplasmticas delimitadas por uma membrana denominada de
tonoplasto e exclusivas de clulas vegetais.
16) A funo autofgica dos lisossomos refere-se digesto de substncias capturadas por
fagocitose ou pinocitose.
UEM (2009_2) 5) Identifique o que for correto sobre a organizao e o funcionamento das
clulas.
01) Os cloroplastos apresentam organizao interna que lembra pilhas de moedas, local das
reaes que convertem o CO2 em glicose.
02) Por apresentarem a capacidade de autoduplicao, as mitocndrias das clulas humanas so
descendentes daquelas que estavam tanto no gameta masculino quanto no feminino.
04) Glicoclix, um envoltrio externo membrana plasmtica, constitudo por glicoprotenas e
glicolipdios.
08) Em algumas reaes metablicas, ocorre a formao de H2O2 que, apesar de no ser txico
para as clulas, rapidamente transformado em gua e oxignio. A degradao dessa molcula
ocorre no vacolo da clula vegetal e no peroxissomo da clula animal.
16) Nos vulos humanos, o complexo golgiense origina a estrutura denominada de acrossomo,
importante para permitir a penetrao do espermatozoide.
UEM (2010_1) 6) Assinale o que for correto.
01) A membrana plasmtica est presente em todas as clulas eucariticas vivas.
02) O mecanismo de transporte dos ons Na+ e K+ (bomba de sdio-potssio) um processo
ativo que opera tanto na membrana plasmtica quanto na parede celular.
04) Plasmodesmos so pontes citoplasmticas que, em clulas vegetais e animais, atravessam a
membrana plasmtica, propiciando troca de substncias entre clulas adjacentes.
08) A parede celular impede a ruptura das clulas vegetais, se estas forem mergulhadas em gua
pura ou solues hipotnicas.
16) A membrana plasmtica apresenta a propriedade chamada de permeabilidade seletiva.
Assim, a dupla camada de lipdios permevel a ons e impermevel a gases.
UEM (2010_2) 7) Sobre a estrutura, composio qumica e funo dos componentes celulares,
assinale o que for correto.
01) A membrana plasmtica de fundamental importncia para a vida. Delimita o espao
interno da clula, impedindo totalmente a entrada de qualquer substncia.
02) As clulas procariticas so constitudas por citosol, uma regio entre a membrana
plasmtica e o ncleo.
04) A sntese de cidos graxos, de fosfolipdios e de esteroides ocorre nas bolsas e nos tubos do
retculo endoplasmtico no granuloso.
08) Em clulas animais e vegetais, as cisternas do complexo golgiense concentram-se prximas
s paredes do retculo endoplasmtico no granuloso.
16) Uma diferena marcante entre clulas procariticas e eucariticas que as ltimas
apresentam citoesqueleto.

14

UEM (2011_2) 8) Sobre a membrana plasmtica, assinale o que for correto.


01) A parede celular um revestimento externo da membrana plasmtica e est relacionada
sustentao das clulas de vegetais, de algas, de fungos e de bactrias.
02) Durante o transporte passivo, a clula transporta substncias contra o gradiente de
concentrao, o que envolve gasto de energia e consumo de ATP.
04) Microvilosidades so modificaes da membrana plasmtica, encontradas nas clulas do
tecido de revestimento interno do intestino, que aumentam a superfcie de absoro.
08) A troca gasosa realizada nas brnquias de um peixe um exemplo de difuso simples,
processo que ocorre diretamente pela bicamada lipdica da membrana, sem gasto de energia.
16) Ciclose o processo de entrada e de movimento de partculas slidas no citoplasma,
realizado pelas expanses citoplasmticas.
GABARITO:
1-GAB: 01+02+04+08=15
2-GAB: 02+08+16=26
3-GAB: 01+02+08+16=27
4-GAB: 02+04=06
5-GAB: 04
6-GAB: 01+08=09
7-GAB: 04+16=20
8-GAB: 01+04+08=13

15

METABOLISMO CELULAR (RESPIRAO, FERMENTAO, FOTOSSNTESE...)


UNIOESTE (2006) 1) Considerando os processos de metabolismo energtico da clula:
respirao, fermentao, fotossntese e quimiossntese, escolha a(s) alternativa(s) correta(s).
(01) No processo de fotossntese a liberao de oxignio ocorre na etapa qumica e a formao
de carboidratos ocorre na etapa fotoqumica.
(02) A fermentao lctica um processo de obteno de energia e pode ser constatado em
algumas bactrias, alguns protozorios e fungos.
(04) No processo de respirao celular ocorre a converso de glicose em cido pirvico com
atuao de enzimas desidrogenases.
(08) Cadeia respiratria a fase da respirao celular que ocorre na membrana externa da
mitocndria com ausncia de FAD (flavina adenina dinucleotdeo).
(16) A fotossntese e a respirao celular so processos antagnicos. Enquanto o primeiro
fabrica matria orgnica com armazenamento de energia, o segundo desdobra sua matria
orgnica e libera energia.
(32) Na fermentao alcolica inicialmente uma molcula de glicose sofre gliclise e origina
uma molcula de cido pirvico, e na fermentao lctica inicialmente origina-se uma molcula
de cido ltico.
(64) As sulfobactrias, as ferrobactrias e as nitrobactrias so organismos que se utilizam do
CO2 e H2O da oxidao de compostos inorgnicos para a formao de compostos inorgnicos.
UNIOESTE (2005) 2) As figuras abaixo representam o cloroplasto ( esquerda) e a mitocndria
( direita).
Relativo s estruturas e funes destas organelas, assinale a(s) alternativa(s) correta(s).

(01) 1 e 2 representam os ribossomos e o estroma, respectivamente.


(02) 3 e 4 representam tilacide e lamela do estroma, respectivamente.
(04) Em 5 ocorrem as clorofilas, responsveis pela fotossntese.
(08) 6 e 7 representam a membrana externa e a matriz mitocondrial, respectivamente.
(16) Em 8 ocorrem enzimas responsveis pelas reaes qumicas da respirao.
(32) Em 9 ocorrem os ribossomos e os RNAs responsveis pela sntese protica.
(64) 10 representa os lisossomos que ocorrem na mitocndria.
UEPG (2006_1) 3) A respeito da fotossntese, assinale o que for correto.
01) Do espectro eletromagntico da luz branca, a clorofila capaz de absorver apenas as
radiaes componentes do chamado espectro visvel, que compreende as radiaes cujos
comprimentos de onda esto entre 390 e 760 mm.
02) O ponto de compensao luminoso corresponde taxa de luz em que a atividade
fotossintetizante igual atividade respiratria.

16

Isso significa que, nesse ponto, a planta consome, na respirao, uma quantidade de O 2
equivalente produzida na fotossntese; ou que consome na fotossntese uma quantidade de CO
2 equivalente liberada pela respirao.
04) Uma planta encontra-se acima do ponto de compensao quando a intensidade luminosa
tal que a fotossntese supera a respirao. Por outro lado, est abaixo do ponto de compensao
quando a atividade respiratria supera a atividade fotossintetizante, devido carncia de luz.
08) Uma planta no sobreviver se for mantida indefinidamente no ponto de compensao ou
abaixo dele. Nestas circunstncias, no ir dispor de alimento suficiente para garantir a
manuteno de suas atividades vitais.
16) O oxignio produzido na fotossntese vem do CO 2 absorvido pelas plantas.
UEPG (2008_1) 4) A fotossntese o processo nutritivo fundamental dos vegetais, ocorrendo
tambm nas algas e em muitas bactrias. Consiste basicamente na produo de substncias
orgnicas a partir de CO2 , H2O e energia luminosa. A respeito desse fenmeno, assinale o que
for correto.
01) O oxignio liberado na fotossntese provm do gs carbnico assimilado pelas plantas por
intermdio dos estmatos.
02) As clorofilas a e b, presentes nos cloroplastos dos parnquimas das folhas, so os pigmentos
responsveis pela captao da energia da luz solar. Nesses cloroplastos existem ainda pigmentos
auxiliares, que absorvem determinados comprimentos de onda, transferindo energia para as
clorofilas.
04) As clorofilas absorvem a luz na faixa de 400 nm a 760 nm, comprimentos de onda que
correspondem luz visvel, a qual pode ser decomposta nas cores do arco-ris. Na faixa do
verde, a fotossntese acentuada, uma vez que as clorofilas, sendo verdes, refletem esse
comprimento de onda, absorvendo sua energia.
08) Como a fotossntese tem uma etapa qumica (fase de escuro), ela altamente influenciada
pela temperatura, atingindo um timo rendimento entre 30 graus Celsius e 40 graus Celsius.
Acima desses valores h um decrscimo acentuado, especialmente pela destruio de enzimas
que catalisam as reaes do processo.
UEPG (2008_1) 5) No metabolismo celular existem dois processos predominantes de obteno
de energia: a respirao celular e a fermentao. A respeito deste assunto, assinale o que for
correto.
01) Um processo que permite obter energia a partir do acar a fermentao, que ocorre em
condies anaerbias, ou seja, na ausncia de oxignio.
02) A respirao celular ocorre principalmente nas mitocndrias. Nesse processo a glicose
combina-se com o oxignio do ar, transforma-se em dois resduos: gs carbnico e gua, e libera
energia.
04) A energia liberada pela respirao ou pela fermentao nunca usada diretamente no
trabalho celular. Ela inicialmente armazenada numa molcula especial, o ATP (adenosina
trifosfato), sob a forma de ligaes qumicas muito ricas em energia. O ATP constitudo pela
substncia adenina, ligada a uma ribose e a trs grupos fosfricos. O ATP pode perder um grupo
fosfrico e transformar-se em ADP (adenosina difosfato), liberando energia. O ATP tem duas
ligaes de alta energia e o ADP tem somente uma dessas ligaes. Pode-se considerar o ATP
como uma bateria celular "carregada" de energia, enquanto o ADP representa a forma
"descarregada".
08) Os resduos que a respirao produz so molculas menores (gua e gs carbnico) do que
os da fermentao (lcool e gs carbnico). A fermentao libera muito menos energia do que a
respirao, porque na fermentao boa parte da energia da glicose no fica disponvel por estar
armazenada no lcool.

17

UEM (2008_1) 6) Sobre as mitocndrias, que fornecem cerca de 90% da energia para o
funcionamento das clulas, assinale o que for correto.
01) As mitocndrias so observadas nas clulas de todos os organismos eucariontes, inclusive
nos gametas.
02) O DNA mitocondrial forma cromossomos circulares que no se duplicam durante a diviso
celular.
04) As doenas relacionadas com os distrbios mitocondriais no so hereditrias, porque o
DNA mitocondrial no se duplica.
08) O sistema nervoso central pode ser afetado pela deficincia na produo de energia,
causando doenas como diabetes melito.
16) Devido presena de DNA, as mitocndrias tm capacidade de autoduplicao.
UEM (2011_2) 7) Sobre o processo de respirao celular, assinale o que for correto.
01) Alm da respirao celular, existem na natureza outros processos que permitem obter
energia a partir de carboidratos. Um deles a fermentao, processo mais eficiente do que a
respirao celular, por produzir maior quantidade de ATP.
02) Uma das fases da respirao celular a partir da glicose a gliclise, que ocorre no
hialoplasma. Nessa fase, uma molcula de glicose transforma-se em duas molculas de cido
pirvico com produo de dois ATP.
04) Havendo oxignio em quantidade suficiente, as clulas musculares realizam o processo de
respirao celular aerbico; porm, em situaes de atividade intensa, na falta de oxignio, elas
podem realizar quimiossntese.
08) Na cadeia respiratria, ocorre transferncia de hidrognio de um componente para o outro,
fazendo com que esses componentes percam energia gradativamente e possam, ao final da
cadeia, combinar-se com o oxignio, formando gua e liberando grande quantidade de energia.
16) Existe relao entre respirao pulmonar e respirao celular, no sentido de que o gs
carbnico capturado pela respirao pulmonar levado at as clulas, as quais iro participar da
respirao celular.
UEM (2008_1) 8) Assinale o que for correto.
01) A respirao celular corresponde a uma reao de oxi-reduo na qual as molculas
orgnicas so oxidadas pelo oxignio.
02) Na forma oxidada do NAD, ou seja, no NAD+, a carga positiva resultante do estado
oxidado do nitrognio da nicotinamida.
04) Uma reao exergnica e exotrmica aquela na qual os produtos possuem menor energia
do que os reagentes.
08) As enzimas funcionam como catalisadores, que diminuem a energia de ativao em algumas
reaes biolgicas.
16) No ATP, existem trs grupos fosfatos ligados entre si.
UEM (2009_1) 9) Assinale a(s) alternativa(s) correta(s).
01) As sulfubactrias, que oxidam compostos de enxofre, e as ferrobactrias, que oxidam
compostos de ferro, so denominadas bactrias quimiossintetizantes.
02) O envenenamento por Cd2+ nos seres humanos se deve troca dos ons Zn2+ por Cd2+,
ons de metais de transio que apresentam o mesmo nmero de eltrons em sua ltima camada
d, pois a diferena de tamanho entre esses ons modifica a estrutura e, consequentemente, a ao
da enzima anidrase carbnica no processo de eliminao de CO2.

18

04) Os processos de fermentao alcolica nas leveduras e de fermentao ltica no tecido


muscular dos vertebrados em atividade fsica intensa geram 6 mols de CO2 e 38 ATP por mol
de glicose consumida.
08) Visando retardar o apodrecimento de frutos estocados, deve-se mant-los em baixas
temperaturas e em recipientes com altas concentraes de gs etileno, que inibem a produo de
CO2.
16) As cianobactrias conseguem transformar o N2 atmosfrico em uma forma utilizvel pelos
seres vivos: a amnia, que tem frmula NH2OH.
GABARITO:
1-GAB: 02+04+16+64=86
2-GAB: 01+04+08+16=29
3-GAB: 01+02+04+08=15
4-GAB: 02+08=10
5-GAB: 01+02+04+08=15
6-GAB: 01+16=17
7-GAB: 02+08=10
8-GAB: 01+02+04+08+16=31
9-GAB: 01+02=03

19

NCLEO CELULAR E DIVISES


UNIOESTE (2006) 1) O ncleo nas clulas desempenha o papel de portador dos fatores
hereditrios e controlador das atividades metablicas. Em relao a essa importante estrutura e
seus constituintes correto afirmar que:
(01) O ncleo interfsico de clulas vegetais apresenta uma carioteca cuja estrutura no permite
a comunicao com o citoplasma.
(02) O ncleo de clulas eucariticas animais durante a interfase apresenta-se desprovido de
carioteca, cariolinfa e nuclolo.
(04) O nuclolo uma estrutura intranuclear, desprovida de membranas, composto por DNA,
RNA ribossmico e protenas.
(08) No ncleo eucaritico o conjunto haplide de cromossomos denominado caritipo,
enquanto que o nmero, forma e tamanho dos cromossomos denominado genoma.
(16) O nmero de cromossomos constante para cada espcie, porm o nmero de
cromossomos e o grau evolutivo das espcies no esto relacionados.
(32) Nos cromossomos, a heterocromatina corresponde a regies que permanecem muito
condensadas na interfase e apresenta-se inativa na transcrio do DNA em RNA.
(64) Nas clulas vegetais durante a interfase no possvel identificar o ncleo dotado de
carioteca, nuclolo e cromatina, atravs de qualquer tcnica de preparao utilizada.
UNIOESTE (2005) 2) O desenho abaixo representa um ciclo celular mittico

Relativo ao ciclo acima, analise as alternativas e assinale a(s) correta(s).


(01) Em 1 ocorrem a duplicao do DNA, a transcrio e a sntese protica.
(02) Em 2 ocorrem o crossing-over e o paquteno.
(04) Em 3 o DNA no se encontra enrolado ao redor das histonas, mas exclusivamente ao
redor de um esqueleto protico.
(08) Em 4 ocorre a separao dos cromossomos homlogos para plos opostos.
(16) Em 5 os cromossomos encontram-se com 2 cromtides cada um.
(32) 6 representa a fase em que ocorre a citocinese.
(64) A partir da clula diplide com 4 cromossomos, so formadas 2 clulas com 2
cromossomos cada.

20

UEPG (2008_1) 3) A respeito da mitose, um dos processos fundamentais da diviso celular, em


que uma clula se divide, originando duas clulas-filhas exatamente iguais clula inicial no
que toca qualidade e quantidade de material gentico, assinale o que for correto.
01) Quando se estuda a mitose em clulas vegetais, percebem-se diferenas em relao ao
processo que ocorre nas clulas a-nimais. Inicialmente, no h centrolos nem steres; mesmo
assim, ocorre a formao das fibras do fuso.
02) A mitose um processo contnuo de diviso celular em que ocorre uma duplicao
cromossmica para cada diviso celular. Assim, o nmero e a qualidade dos cromossomos da
clula-me so mantidos nas clulas-filhas. A mitose se divide nas se-guintes fases ou etapas:
prfase, metfase, anfase e telfase.
04) A mitose permite que os organismos pluricelulares cresam, por meio do aumento do
nmero de clulas, e substituam clulas mortas. Assim, as clulas da nossa pele, de um embrio
em desenvolvimento e das pontas das razes e caules esto em constante mitose.
08) A diviso do citoplasma da clula vegetal no se processa por estrangulamento, como na
clula animal. Em vez disso, apare-ce no equador da clula um esboo de parede, a lamela
mdia, constituda por um polissacardeo, a pectina. Mais tarde, for-mam-se duas membranas
celulsicas, de um lado e do outro da lamela mdia.
UFSC (2007) 4) As anomalias cromossmicas so bastante freqentes na populao humana;
um exemplo disso que aproximadamente uma a cada 600 crianas no mundo nasce com
sndrome de Down. Na grande maioria dos casos, isso se deve presena de um cromossomo 21
extranumerrio. Quando bem assistidas, pessoas com sndrome de Down alcanam importantes
marcos no desenvolvimento e podem estudar, trabalhar e ter uma vida semelhante dos demais
cidados.
Sobre as anomalias do nmero de cromossomos, CORRETO afirmar que:
01. podem ocorrer tanto na espermatognese quanto na ovulognese.
02. ocorrem mais em meninas do que em meninos.
04. ocorrem somente em filhos e filhas de mulheres de idade avanada.
08. esto intimamente ligadas separao incorreta dos cromossomos na meiose.
16. ocorrem ao acaso, devido a um erro na gametognese.
32. ocorrem preferencialmente em populaes de menor renda, com menor escolaridade e
pouca assistncia mdica.
64. podem acontecer devido a erros na duplicao do DNA.
UFSC (2009) 5) Aproximadamente uma a cada 600 crianas nasce com sndrome de Down, pois
anomalias cromossmicas so freqentes na populao. Na grande maioria dos casos, isso se
deve presena de um cromossomo 21 extranumerrio. Quando bem assistidas, pessoas com
sndrome de Down alcanam importantes marcos no desenvolvimento e podem estudar,
trabalhar e ter uma vida semelhante dos demais cidados.
Sobre as anomalias no nmero de cromossomos, CORRETO afirmar que:
01. ocorrem ao acaso, sempre devido a um erro na ovulognese.
02. podem acontecer devido a erros na transcrio do RNA.
04. podem ocorrer tanto na espermatognese quanto na ovulognese.
08. ocorrem mais em meninas do que em meninos.
16. ocorrem somente em filhos e filhas de mulheres que do luz em idade avanada.
32. ocorrem preferencialmente em populaes de menor renda, com menor escolaridade e pouca
assistncia mdica.
64. esto intimamente ligadas separao incorreta dos cromossomos na meiose.

21

UFMS (2008) 6) Na meiose, acontecem duas divises celulares sucessivas denominadas meiose
I e meiose II. Observe o esquema abaixo e considere que a clula-me (clula 1) apresente o
nmero de dezesseis cromossomos (2n = 16).

Em relao meiose, correto afirmar:


(001) As clulas 4, 5, 6 e 7 apresentam 8 cromossomos.
(002) As clulas 1, 2 e 3 apresentam 16 cromossomos.
(004) A clula 1 passa por diviso reducional e equacional para formar as clulas 2 e 3.
(008) As clulas 2 e 3 sofrem diviso reducional para formar as clulas 4, 5, 6 e 7.
(016) As clulas 2, 3, 4, 5, 6 e 7 apresentam a metade do nmero de cromossomos da clula 1.
(032) As clulas 2 e 3 so originadas da clula 1 por diviso reducional.
UFMS (2009) 7) Analise os processos A, B e C, conforme esquema abaixo, relacionados aos
eventos celulares de sntese de DNA, RNA e protenas. Sobre tais processos, correto afirmar:

(001) O processo A corresponde traduo.


(002) O processo B corresponde replicao (duplicao).
(004) O processo C corresponde traduo.
(008) O processo B corresponde transcrio.
(016) O processo A corresponde replicao (duplicao).
(032) O processo C corresponde transcrio.
UFMS (2009) 8) Cada espcie animal apresenta um nmero determinado de cromossomos.
Nesse sentido, o homem, o bovino e o eqino apresentam nmero haplide de 23, 30 e 32
cromossomos, respectivamente. Com relao ao nmero normal de cromossomos, autossomos e
sexuais, de gametas (haplides) e clulas somticas (diplides), assinale a(s) proposio(es)
correta(s).
(001) Uma clula epitelial eqina apresenta 62 cromossomos autossomos e 2 sexuais.
(002) Um neurnio bovino apresenta 1 cromossomo sexual e 59 autossomos.
(004) Um leuccito humano apresenta 44 cromossomos autossomos e 2 sexuais.
(008) Um espermatozide eqino apresenta 2 cromossomos sexuais e 30 autossomos.
(016) Um vulo humano apresenta 2 cromossomos sexuais e 21 autossomos.
(032) Um espermatozide bovino apresenta 29 cromossomos autossomos e 1 sexual.

22

UEM (2008_1) 9) Nos seres humanos, as clulas do duodeno apresentam um ciclo celular de 24
horas, a maior parte dele passada em interfase, sendo de 9 a 11 horas em G1, de 8 a 10 horas em
S e de 4 a 5 horas em G2. O perodo de diviso celular ocorre em um
intervalo de 30 minutos a uma hora. Sobre o ciclo celular das clulas duodenais, assinale o que
for correto.
01) As clulas do duodeno so somticas, portanto sofrem divises meiticas.
02) Durante o perodo de interfase, os filamentos cromossmicos permanecem descondensados.
04) Durante o perodo S, ocorre a sntese de DNA e a duplicao dos cromossomos.
08) No incio da diviso (prfase), ocorre a condensao dos cromossomos e a formao do
fuso acromtico.
16) Os cromossomos ligam-se ao fuso durante a metfase e separam-se durante a anfase.
UEM (2008_2) 10) Identifique o que for correto sobre a meiose e a mitose.
01) O processo de mitose dos procariontes garante a reproduo sexuada.
02) Por mitose, uma clula divide-se em duas, cada uma com metade dos cromossomos da
clula inicial.
04) Na telfase, ltima fase da mitose, os cromossomos condensam-se e a carioteca
desorganiza-se.
08) Na metfase I, os cromossomos deslocam-se para os plos das clulas.
16) No ciclo reprodutivo da espcie humana, a meiose origina gametas com a metade do nmero
de cromossomos da clula inicial.
UEM (2009_1) 11) Identifique o que for correto sobre a interfase, a mitose e a meiose de clulas
eucariticas.
01) A separao do centrmero acontece na anfase da mitose e na anfase da meiose I.
02) A prfase da mitose termina com o rompimento da carioteca.
04) Na interfase, a atividade metablica das clulas cessa.
08) Na meiose, ocorrem duas divises celulares sucessivas, mas apenas a meiose I reducional,
decrescendo o nmero de cromossomos metade.
16) A sntese de DNA nuclear ocorre durante a fase S da interfase.
UEM (2010_1) 12) Assinale o que for correto a respeito do ncleo, do citoplasma e seus
constituintes.
01) Os ribossomos, presentes em todos os seres vivos, so formados por duas subunidades de
tamanho e densidades iguais.
02) Em clulas vegetais, molculas de DNA so encontradas no ncleo, nos cloroplastos e nas
mitocndrias.
04) Durante a metamorfose dos anfbios, o desaparecimento da cauda dos girinos devido
ao de enzimas digestivas liberadas dos lisossomos.
08) O ncleo, por meio dos cromossomos, coordena e comanda todas as funes vitais das
clulas. Assim, todas as clulas vivas eucariticas possuem ncleo.
16) O centrolo responsvel pela formao de flagelos e de clios.
UEM (2010_1) 13) Acerca do significado da mitose para os seres vivos, assinale o que for
correto.
01) Quando uma alga unicelular, uma ameba ou um paramcio se dividem por mitose, esto
originando dois novos indivduos. Para esses organismos formados por uma nica clula,
diviso celular significa reproduo.
02) Todos os organismos pluricelulares tm a mitose ocorrendo no apenas para o
desenvolvimento, crescimento, renovao e regenerao, mas tambm para a reproduo.

23

04) No fim da telfase, em clulas animais e de alguns protozorios, tem incio um processo de
estrangulamento na regio mediana que termina por dividir a clula. Por comear na periferia e
avanar para o centro da clula, esse tipo de diviso citoplasmtica chamado de citocinese
centrfuga.
08) Como a clula animal tem centrolo e forma ster, sua mitose astral. A mitose da clula
vegetal anastral.
16) A mitose pode ocorrer com clulas de qualquer ploidia, n, 2n, 3n, etc. Todas originam
clulas-filhas com o mesmo nmero de cromossomos da clula me
UEM (2010_2) 14) Identifique o que for correto sobre as caractersticas gerais dos
cromossomos.
01) Durante a interfase, ocorre a duplicao dos cromossomos, e essas cpias unidas de um
cromossomo duplicado so denominadas cromtidesirms.
02) A posio do centrmero serve de critrio para classificar os cromossomos em trs tipos:
metacntrico, acrocntrico e telocntrico.
04) Os genes da espcie humana distribuem-se em cromossomos autossomos e sexuais. Cada
pessoa herda dois conjuntos de 23 desses cromossomos, um proveniente da me e outro do pai.
08) Nos eucariontes, o material gentico chamado de cromatina separado do citoplasma pela
membrana nuclear.
16) As alteraes cromossmicas estruturais correspondem a modificaes na sequncia dos
genes ao longo do filamento, podendo ser provocadas por vrus, radiao ou substncias
qumicas.
UEM (2011_1) 15) Nos organismos sexuados, ocorrem dois tipos de diviso celular: a mitose,
que uma diviso equacional, ou seja, as clulas-filhas tm nmero de cromossomos igual ao da
clula-me; e a meiose, uma diviso reducional, ou seja, o nmero de cromossomos das clulasfilhas reduzido metade em relao ao da clula-me. Com relao a essas divises, assinale o
que for correto.
01) A intrfase um perodo em que a clula est em repouso.
02) As clulas cancerosas no respondem aos mecanismos de controle que fazem uma clula
iniciar e parar o ciclo celular de acordo com as necessidades do organismo.
04) Um recm-nascido tem cerca de um bilho de clulas. Quando adulto apresentar o mesmo
nmero de clulas, porm elas sero maiores em decorrncia de especializao, nutrientes e
organelas.
08) Enquanto a mitose produz dois ncleos idnticos entre si e idnticos ao ncleo inicial, a
meiose produz quatro no idnticos entre si.
16) A anfase I da meiose e a anfase da mitose so idnticas, os centrmeros dos cromossomos
so duplicados e as cromtides se separam.
GABARITO:
1-GAB: 04+16+32=52
2-GAB: 01+32=33
3-GAB: 01+02+04+08=15
4-GAB: 01+08+16=25
5-GAB: 04+64=68
6-GAB: 01+16+32=49
7-GAB: 04+08+16=28
8-GAB: 01+04+32=37
9-GAB: 02+04+08+16=30

24

10-GAB: 16
11-GAB: 02+08+16=26
12-GAB: 02+04+16=22
13-GAB: 01+08+16=25
14-GAB: 01+04+08+16=29
15-GAB: 02+08=10

25

TAXONOMIA
UNIOESTE (2006) 1) Com relao taxonomia, ou seja, o ramo da biologia que estuda a
classificao dos seres vivos, correto afirmar
(01) que, para a classificao de um grupo, no se deve considerar a filogenia, mas
exclusivamente as semelhanas.
(02) que, entre os recursos utilizados para a taxonomia, podemos citar a anlise
morfolgica, a anlise gentica e a anlise comportamental.
(04) que a espcie humana denominada sapiens.
(08) que o gnero no deve ser escrito em itlico, ou sublinhado, ou negritado.
(16) que, embora dois gneros possam pertencer a diferentes famlias, ambos podem
pertencer aos mesmos reino, filo, classe e ordem.
(32) que os nomes cientficos devem ser escritos em grego.
(64) que, nas nomenclaturas trinomiais, Ramphastos vitellinus culminatus e Centris
(Hemisiella) tarsata, as palavras culminatus e Hemisiella representam subgnero e
subespcie, respectivamente.
UEPG (2007_1) 2) Analise as espcies:
I - Homo erectus
II - Homo sapiens
III - Homo sapiens neanderthalensis
Podemos dizer que os indivduos acima pertencem:
01) Ao mesmo gnero e famlia, e todos esto escritos corretamente de acordo com as regras de
nomenclatura cientfica.
02) mesma classe e ordem, e todos esto escritos corretamente.
04) Ao mesmo reino, e todos esto escritos corretamente.
08) Ao mesmo filo, e o ltimo deles contm gnero, espcie e subespcie de acordo com a
nomenclatura trinominal.
16) mesma espcie e filo, e nem todos esto escritos de forma correta.
UEPG (2009_1) 3) A classificao dos seres vivos feita com base nas suas semelhanas e
diferenas. O ramo da biologia que trata da classificao e nomenclatura dos organismos
chamado de sistemtica ou taxonomia. Sobre taxonomia animal, assinale o que for correto.
01) As famlias encontram-se agrupadas em reinos, que so monera, protista, plantae e animlia.
02) Em biologia define-se "espcie" como um grupo de indivduos semelhantes entre si que se
cruzam e produzem descendentes frteis.
04) O termo "filo", que empregado atualmente na classificao zoolgica, tem como
equivalente na classificao botnica o ter-mo "diviso".
08) Atualmente a taxonomia adota o sistema binrio, criado pelo professor, mdico e naturalista
Karl von Linne (1707-1778). Na composio do chamado nome cientfico, a primeira palavra
refere-se ao gnero, e a segunda, que funciona como um adjetivo, constitui um epteto
especfico. O conjunto das duas palavras designa a espcie.
16) Os nomes das famlias recebem sufixos distintos para as classificaes botnica e zoolgica.
Na botnica o sufixo "idae" e na zoolgica, "aceae".

26

UEM (2010_1) 4) Assinale o que for correto sobre a nomenclatura dos seres vivos.
01) As regras de nomenclatura que so utilizadas at hoje, embora com algumas modificaes,
foram estabelecidas por Charles Darwin.
02) As regras de nomenclatura dos seres vivos no se aplicam a alfabetos diferentes do latino.
Assim, em textos publicados na lngua japonesa ou na chinesa, os nomes cientficos so
grafados de acordo com os seus respectivos alfabetos.
04) Dois organismos da mesma classe podem pertencer a ordens diferentes.
08) A categoria taxonmica gnero apresenta maior nmero de indivduos do que a categoria
famlia.
16) No nome cientfico dos seres vivos, a primeira palavra indica o nome do gnero e deve ser
escrita com inicial maiscula.
GABARITO:
1-GAB: 02+16=18
2-GAB: 01+02+04+08=15
3-GAB: 02+04+08=14
4-GAB: 04+16=20

27

PROTOZORIOS
UEM (2011_2) 1) A clula de um protozorio bastante especializada, podendo at ser
comparada complexidade de um animal. Cada organela da clula de um protozorio tem uma
funo vital especfica. Com relao aos protozorios correto afirmar que
01) nas espcies marinhas os vacolos contrteis so importantes na eliminao da gua.
02) a conjugao a reproduo sexuada que ocorre na maioria dos esporozorios.
04) o complexo apical a organela de locomoo apresentada pelo causador da leishmaniose.
08) tricocistos so estruturas de defesa apresentadas pelo Paramecium.
16) foraminferos, radiolrios, sarcodinos e heliozorios so protozorios que emitem expanses
citoplasmticas para captura de alimento.
GAB: 08+16=24
UEPB (2010) 2) Observe o esquema representativo do Paramecium, um protista ciliado de gua
doce; numere a primeira coluna de acordo com a numerao atribuda s estruturas na figura
abaixo, estabeleendo a relao correta entre as informaes distribudas nas colunas.

( ) Citstoma
( ) Vacolo contrtil
( ) Clios
( ) Microncleo
( ) Vacolo digestivo
( ) Citopgeo
( ) Macroncleo
a) regula as atividades do metabolismo celular, alm de participar da reproduo assexuada.
b) localizado no interior do sulco oral, o local por onde o alimento penetra na clula.
c) utilizado para a locomoo e a ingesto de alimento.
d) participa da osmorregulao.
e) regio da clula por onde so eliminados os restos no aproveitveis do alimento.
f) participa apenas dos processos de reproduo assexuada e sexuada.
g) em seu interior ocorre a digesto do alimento.
Assinale a alternativa que apresenta a relao correta entre estrutura/funo.
a) 3-C, 1-G, 6-E, 5-A, 2-D, 4-B, 7-F
b) 3-E, 1-D, 6-C, 5-F, 2-G, 4-B, 7-A
c) 3-B, 1-D, 6-C, 5-A, 2-G, 4-E, 7-F
d) 3-E, 1-G, 6-B, 5-F, 2-D, 4-C, 7-A
e) 3-B, 1-D, 6-C, 5-F, 2-G, 4-E, 7-A
28

(UEMS) 3) Estrutura presente nos protozorios utilizada para ingesto de alimentos:


a) Citstoma
b) Axonema
c) Microtbulos
d) Vacolo contrtil
e) Corpsculo basal
(UFMS) 4) No que se refere ao Reino Protista, assinale a(s) alternativa(s) correta(s).
01. Todos os protozorios atuam como parasitas do homem e de outros seres vivos.
02. Os protozorios so eucariontes unicelulares que vivem isolados ou formando colnias, nos
mais variados tipos de habitat.
04. Os protozorios podem ser fixos ou se deslocar atravs de clios, flagelos ou pseudpodes.
De acordo com o tipo e a presena ou no dessas organelas locomotoras, os protozorios so
classificados em rizpodes, mastigforos, ciliados e esporozorios.
08. A malria e a disenteria amebiana so doenas ocasionadas por protozorios que so
inoculados no homem atravs da picada das fmeas de um mosquito.
16. As algas euglenofceas, pirrofceas e as crisofceas so exemplos de organismos pertencentes
ao Reino Protista.
32. Os protozorios de ambiente marinho apresentam um vacolo pulstil que recolhe o excesso
de gua que penetra na clula e, atravs de movimentos de pulsao, elimina essa gua para o
meio externo.
(UEPG) 5) Os protozorios so seres muito pequenos, a maioria deles s pode ser visto ao
microscpio. Tm uma estrutura muito simples. Mesmo assim, seu organismo capaz de
realizar todas as atividades necessrias para seu metabolismo. Sobre os protozorios, assinale o
que for correto.
01. Se originaram das bactrias, e por sua vez, deram origem aos fungos, s plantas e aos
animais.
02. Pertencem ao reino protista, bem como as algas unicelulares eucariontes, visto que ambos
so capazes de realizar fotossntese, sendo auttrofos.
04. Podem reproduzir-se exclusivamente de forma assexuada, por bipartio, uma diviso
celular simples.
08. So encontrados na gua, em locais midos e na matria em decomposio. Muitos so
parasitas do ser humano causando doenas como: amebase, doena de Chagas, leishmaniose,
malria e clera.
16. So classificados conforme a estrutura locomotora em rizpodes que se movimentam por
pseudpodes, flagelados que se movimentam por flagelos, ciliados que se movimentam por
clios, e esporozorios que no apresentam estrutura locomotora.
(Aleatria) 6) Observe os organismos representados nas figuras abaixo, para julgar os itens a
seguir:

29

01. Todos os organismos representados na figura so seres unicelulares procariontes.


02. Os procariontes so incapazes de realizar a fotossntese.
04. No organismo nmero I, os vacolos contrteis expulsam a gua excedente do citoplasma.
08. Os organismos representados nas figuras apresentam diferentes formas de locomoo e
captura de alimentos.
16. Ao contrrio dos organismos representados nas figuras, as clulas dos protistas
multicelulares apresentam alto grau de diferenciao.

GABARITO:
1-GAB: 08+16=24
2-GAB: E
3-GAB: A
4-GAB: 02+04+16=22
5-GAB: 01+16=17
6-GAB: 04+08=12

30

REINO ANIMAL
UNIOESTE (2006) 1) Analise as alternativas abaixo relativas a alguns gneros e algumas
espcies dos diferentes reinos e escolha as corretas.
(01) Na antiguidade era comum o uso de substncia extrada da espcie Hirudo medicinalis para
fazer sangrias em pessoas com presso arterial elevada.
(02) Demodex folliculorum um inseto que, ao parasitar os folculos pilosos e glndulas
sebceas no homem, pode causar a escabiose.
(04) Os escorpies mais freqentes no Brasil e muito perigosos ao homem so o Tityus
bahiensis e o Tityus serrulatus, popularmente denominados escorpies marrom e preto
respectivamente.
(08) Trypanosoma Cruzi o agente etiolgico da malria, cujo vetor o mosquito Anopheles,
muito comum em canaviais.
(16) Amanita muscaria e Amanita phalloides so cogumelos que produzem substncias
venenosas.
(32) Sphagnum um musgo que forma a turfa usada no melhoramento da capacidade de
reteno de gua nos solos.
(64) Os gneros Brotrops, Crotalus e Micrurus so exemplos de cobras no peonhentas e no
ocorrem no Brasil.
UEPG (2006_1) 2) Sobre os mamferos, assinale o que for correto.
01) Os ungulados so mamferos que possuem cascos e um nmero par de dedos, como o
cavalo, burro, rinoceronte, zebra e anta.
02) Os morcegos so, em sua maioria, insetvoros ou frutvoros, sendo teis na polinizao de
certas plantas. Classificam-se como quirpteros.
04) Os mamferos marinhos, como as baleias e golfinhos, e os de gua doce, como o boto, tm
respirao branquial e so classificados como cetceos.
08) Os mamferos sirnios se reproduzem atravs de ovos e no so animais conhecidos no
Brasil. Eles vivem na Austrlia e Nova Zelndia.
16) Os cangurus, gambs, coalas e cucas tm em comum o fato de seu desenvolvimento fetal terminar fora do tero, no marspio, onde se localizam as glndulas mamrias.
UEPG (2006_1) 3) Os moluscos bivalvos (ostras e mexilhes) so organismos economicamente
importantes como fonte de alimento para o homem, por possuir alto valor nutritivo. Eles
conseguem filtrar grandes volumes de gua em poucas horas, da serem comumente chamados
"organismos filtradores". Como conseqncia, podem acumular, no seu trato digestrio, altas
concentraes de microrganismos e compostos qumicos txicos, eventualmente presentes na
gua onde vivem, assim pondo em risco a sade pblica e exercendo grande impacto social e
econmico nas reas de sua criao. A respeito deste tema, assinale o que for correto.
01) O nome molusco vem do latim mollis, que significa mole, caracterstica de seu corpo,
que geralmente est protegido por uma concha calcria e orgnica, resistente, de uma ou mais
peas. A malacologia o ramo da zoologia que estuda as mais de 100 mil espcies de moluscos
existentes, na maioria marinhos.
02) Nos mexilhes, as brnquias tm funo respiratria e importante papel na nutrio.
04) Os mexilhes possuem concha com apenas uma valva.
08) Os moluscos so animais de simetria bilateral, diblsticos, acelomados e deuterostmios,
diferindo dos aneldeos e artrpodes pela ausncia de segmentao.
16) Os moluscos so sempre hermafroditas.

31

UEPG (2008_1) 4) A respeito dos vertebrados, que apresentam excepcional biodiversidade,


especialmente quanto a tamanho, forma, comportamento, metabolismo e reproduo, assinale o
que for correto.
01) A classificao dos vertebrados inclui os agnatos, animais sem mandbula (como as
lampreias), e os gnatostmios, animais com mandbula (como os peixes e tetrpodos).
02) A classe dos ciclstomos, entre os quais esto includos muitos parasitas de peixes,
apresenta corpo alongado e boca sugadora, com dentes crneos e raspadores.
04) Todos os vertebrados so classificados como amniotas, visto que apresentam mnio como
um de seus anexos embrionrios.
08) Na evoluo dos vertebrados, a notocorda foi substituda pelo desenvolvimento da coluna
vertebral, que, mais resistente, sem do formada por uma srie de peas articuladas (as vrtebras),
permite maior mobilidade e proteo mais eficiente da medula espinhal.
GAB: 01+02+08=11
UFSC (2007) 5) Com relao ao Reino Animal, assinale a(s) proposio(es) CORRETA(S).
01.
Formado por animais ssseis e geralmente hermafroditas, a maioria das espcies do filo
Porferos so aquticas, apesar de existirem algumas espcies terrestres.
02.
A lombriga e a solitria (tnia), parasitas do intestino humano, pertencem aos filos
Platelmintos e Nematelmintos, respectivamente.
04.
Animais cujo corpo formado por numerosos anis repetidos (metmeros) pertencem ao
filo Aneldeos, do qual a minhoca o representante mais conhecido.
08.
O filo Cnidrios formado, basicamente, por dois tipos morfolgicos de indivduos, que
so: plipos, cujo principal representante a gua-viva, e medusas, representadas pelos corais.
16.
No filo Moluscos existem indivduos com concha externa, como o caso das ostras e
mexilhes, e tambm indivduos sem ela, como o caso da lula e do polvo.
32.
De todo o reino animal, o filo Artrpodes o que apresenta o maior nmero de espcies.
64. No filo Cordados, somente a classe Mamferos apresenta circulao dupla e completa.
UFSC (2008) 6) O Reino Animal apresenta grande variedade de organismos, com cerca de um
milho de espcies catalogadas.
Sobre os principais grupos animais, assinale a(s) proposio(es) CORRETA(S).
01. Todas as espcies do grupo Equinodermos so exclusivamente marinhas.
02. A tnia e a lombriga, vermes que causam doenas ao ser humano, pertencem ao grupo dos
Nematdeos.
04. Apesar de terem organizao corporal muito simples, os Porferos apresentam trs folhetos
germinativos.
08. Espcies que apresentam exoesqueleto podem ser observadas nos grupos Moluscos,
Artrpodes e Equinodermas.
16. Todos os Cordados possuem vrtebras.
32. Os Aneldeos so parasitas obrigatrios.
64. Anmonas, guas-vivas e corais so representantes dos Cnidrios.
UFSC (2009) 7) Sobre os vermes do gnero Taenia, assinale a(s) proposio(es) correta(s).
01. A Taenia solium um asquelminto do grupo trematoda.
02. A tenase causada pela ingesto de cisticercos em carne bovina ou suna.
04. A Taenia solium no causa a cisticercose humana.
08. A higiene pessoal e o saneamento bsico so importantes medidas na preveno das
parasitoses causadas por Taenia sp.

32

16. A Taenia solium adulta hermafrodita, apresenta o corpo segmentado, esclex com 4
ventosas e uma coroa de acleos. Os ltimos segmentos so cheios de ovos, que ficam
encistados no tecido muscular de sunos.
32. A cisticercose humana ocasionada pela presena da larva da Taenia solium e adquirida
pela ingesto de ovos do parasito liberados nas fezes de pessoas infectadas.
UFSC (2010) 8) A figura abaixo representa uma das hipteses para explicar a filogenia animal

Aps analisar o grfico, assinale a(s) proposio(es) CORRETA(S) quanto evoluo dos
animais.
01. Todos os animais representados possuem ancestralidade comum.
02. A caracterstica mais importante usada para separar os animais em filos distintos a sua
distribuio no ambiente.
04. Os equinodermos so representados na figura acima por animais como minhocas, caramujos
e vermes cilndricos.
08. Peixes, anfbios e cobras so animais cordados.
16. Os rpteis no aparecem representados nesta figura.
32. Os cnidrios, representados pelas esponjas do mar, so animais muito simples e no
apresentam tecidos verdadeiros.
64. Os animais se caracterizam por serem pluricelulares, eucariontes e hetertrofos.
UFMS (2007) 9) Os caros formam um verdadeiro batalho. Para voc ter uma idia, um nico
grama de poeira pode abrigar mais de mil desses microscpicos organismos. So eles os
responsveis por oito em cada dez casos de problemas respiratrios que atingem cerca de 30%
dos brasileiros (Moo, A., Artigo: caro sai do armrio. O texto acima se refere a um
organismo pertencente ao filo Chelicerata. Sobre esse filo, correto afirmar:
(001) O corpo dos organismos pertencentes a este filo revestido externamente por um
exoesqueleto que se constitui de protenas e de um polissacardeo, a quitina. Apresenta sistema
digestivo incompleto com digesto intracelular e a excreo ocorre atravs de estruturas
especiais denominadas glndulas verdes.
(002) Os caros, juntamente com as aranhas e os escorpies, so representantes da classe
Arachnida que pertence ao filo Chelicerata. Os aracndeos no tm antenas e o corpo geralmente
dividido em cefalotrax e abdome.

33

(004) Os quelicerados apresentam o primeiro par de apndices (quelceras) com a funo de


capturar o alimento. O segundo par de apndices denominado pedipalpos e executa diversas
funes.
(008) O filo engloba organismos que vivem em ambiente terrestre e aqutico. Alguns
representantes produzem veneno que utilizado para imobilizar a presa.
(016) A reproduo dos aracndeos sexuada com fecundao somente externa; o
desenvolvimento pode ser direto ou indireto com metamorfose ou no. No desenvolvimento
indireto, os ovos desenvolvem-se em formas jovens semelhantes aos pais.
(032) O sistema nervoso dos quelicerados consiste de um anel nervoso situado na parte anterior
do corpo do qual partem nervos radiais que se ramificam e atingem todo o corpo. Os
quelicerados no possuem sistema sensorial.
UFMS (2007) 10) Assinale a(s) alternativa(s) correta(s) em relao ao habitat, respirao, ao
sistema nervoso e reproduo dos filos abaixo relacionados.

(001) A reproduo dos aneldeos sexuada com fecundao cruzada, apresentando espcies
monicas e diicas.
(002) Os nematelmintos esto presentes somente no solo e na gua doce.
(004) O sistema nervoso dos equinodermos formado por um nervo anelado de onde partem
nervos radiais.
(008) Os nematelmintos apresentam reproduo assexuada.
(016) A respirao no filo dos moluscos bem diversificada. Algumas espcies tm trocas
gasosas pela epiderme, outras pelo manto e outras por brnquias.
(032) A respirao dos equinodermos feita somente pelos ps ambulacrais.
UFMS (2008) 11) As aranhas so aracndeos muito comuns e podem ser encontradas em reas
bem preservadas, rurais e urbanas. Sobre as aranhas, correto afirmar:
(001) Todas as aranhas so carnvoras.
(002) A maioria das espcies tem peonha.
(004) Somente as fmeas possuem estruturas especiais para produo de seda, localizadas na
regio posterior do abdmen, denominadas fiandeiras.
(008) O sistema respiratrio extremamente especializado com a presena de uma rede de
traquias que desembocam em brnquias foliares no abdmen.
(016) O corpo dividido em cefalotrax e abdmen.
(032) As fiandeiras podem ser utilizadas como ovipositores em algumas espcies.

34

UFMS (2008) 12) Anmonas e corais ... podem causar dermatites to severas como aquelas
provocadas por guas-vivas e caravelas. No local estabelecem-se edema e eritema que podem
persistir por dias, sendo o acidente muito doloroso no incio.
(Fonte: http://www.anaisdedermatologia.org.br/artigo_imprimir.php?artigo_id=122, texto
adaptado).
Todos os animais citados no trecho acima esto includos no Filo Cnidaria. Sobre os cnidrios,
correto afirmar:
(001) So animais triploblsticos.
(002) No ciclo de vida, h uma forma livre natante, a medusa, e uma forma fixa com pouco
movimento, o plipo. Uma das formas pode estar ausente em algumas espcies.
(004) Todas as espcies se alimentam de partculas de origem vegetal.
(008) Possuem clulas chamadas de cnidcitos que abrigam estruturas urticantes localizadas
principalmente nos tentculos.
(016) Possuem um sistema nervoso perifrico em forma de malha e um crebro pouco
desenvolvido prximo da boca.
(032) Todas as espcies so aquticas, sendo a maioria marinha.
UFMS (2008) 13) Atualmente, foram descritas 4.500 espcies viventes de mamferos. Entre
essas espcies, est includo o Homo sapiens (o ser humano). Assinale abaixo a(s)
caracterstica(s) que o ser humano divide com os outros mamferos.
(001) Tegumento com uma epiderme mucosa.
(002) Presena de plos e glndulas mamrias.
(004) Respirao pulmonar.
(008) Alimentao onvora.
(016) Corao com quatro cavidades, portanto, com o sistema circulatrio duplo e completo.
(032) Presena de eritrcitos ovais e nucleados.
UFMS (2009) 14) Cientistas dos institutos Adolfo Lutz e Butantan isolam, a partir das toxinas
da pele do sapo-cururu, dois esterides capazes de matar o parasita causador da leishmaniose,
cujos casos esto aumentando no Brasil. Uma das molculas tambm eficaz contra a doena de
Chagas.
(Fonte: http://www.agencia.fapesp.br/materia/9276/especiais/esteroide-anfibio.htm).
Sobre o anfbio citado na notcia acima, assinale a(s) proposio(es) correta(s).
(001) Esto includos no grupo natural Anura.
(002) Respiram pela pele e atravs dos pulmes.
(004) O corao de um adulto apresenta dois ventrculos e um trio e nele no ocorre mistura do
sangue venoso com o arterial.
(008) As toxinas da pele so geralmente associadas a uma estrutura inoculadora de veneno
semelhante aos dentes de uma cobra.
(016) A cauda est ausente em todas as fases do ciclo de vida.
(032) A dieta de um adulto composta principalmente por itens com baixa quantidade de
protenas, como algas e musgos.
UFMS (2009) 15) O mexilho-dourado tem causado certo pnico entre a comunidade cientfica
e empresrios, principalmente do setor eltrico. (...) O prejuzo, tanto ambiental como
econmico, ser incalculvel se medidas de controle da disperso no forem tomadas. Este
informativo tem o objetivo de deixar a sociedade esclarecida sobre a ocorrncia no mexilhodourado para que a mesma possa ajudar no controle da disperso. O mexilho-dourado
(Limnoperna fortunei) um bivalve da famlia Mytilidae de no mximo 4cm de comprimento.
(...). O mexilho-dourado foi registrado no rio Miranda recentemente, em 2003, e foi observado

35

at a altura do Passo do Lontra. Provavelmente veio do rio Paraguai e chegou ao Miranda,


incrustado nos cascos das embarcaes, em plantas e equipamentos de pesca (adultos) ou
dentro de reservatrios de gua (larvas) abastecidos no rio Paraguai. Outra forma de disperso
atravs de barcos transportados em rebocadores via terrestre pela BR 262. Larvas e adultos do
mexilho dourado podem ficar em plantas e gua, no motor e dentro do barco, e na vegetao
presa ao reboque.
Estima-se que o mexilho-dourado pode sobreviver at 7 dias fora do seu ambiente natural.
Sobre o mexilho-dourado, correto afirmar:
(001) Como a maioria dos moluscos, possui no estgio imaturo uma larva trocfora.
(002) A troca gasosa realizada por brnquias.
(004) So predadores ativos apresentando uma cabea e uma rdula bem desenvolvidas.
(008) So identificados por apresentar uma concha de carbonato de clcio espiralada.
(016) O adulto pode-se fixar no substrato (casco das embarcaes, plantas, equipamento de
pesca, etc) por meio de uma estrutura filamentosa denominada bisso.
(032) So moluscos bivalves, os bivalves podem ser encontrados em guas marinhas e
continentais.
UFMS (2009) 16) Denomina-se sistema excretor o conjunto de rgos responsveis, num
organismo, pela manuteno do meio interno, regulao do teor de gua e sais minerais e
eliminao de resduos nitrogenados formados durante o metabolismo celular. Os resduos
nitrogenados, que podem ser formados, so amnia, uria e cido rico.
So exemplos de animais que excretam amnia, uria e cido rico, respectivamente:
(001) sapo, grilo, tubaro.
(002) anmona-do-mar, cavalo e formiga.
(004) peixe, crocodilo e rato.
(008) mexilho, co e urubu.
(016) homem, polvo e minhoca.
(032) gua-viva, porco e escorpio.
UFMS (2010) 17) Leia o texto abaixo e, a seguir, assinale a(s) proposio(es) correta(s).
"Um sapo sem pulmo acaba de ser descoberto na ilha de Bornu, na Indonsia. Trata-se do
primeiro caso confirmado do tipo e, segundo os cientistas responsveis pelo estudo, a espcie
aqutica Barbourula kalimantanensis aparentemente respira atravs da pele. (...) Duas
populaes da espcie, sobre a qual havia relatos, foram encontradas durante recente expedio
dos pesquisadores. (...) De todos os tetrpodes, vertebrados terrestres com quatro membros,
sabe-se que a ausncia de pulmes ocorre apenas em anfbios. So conhecidas algumas espcies
de salamandras sem o rgo, alm de uma de cobra-cega. Para os autores do estudo, a
descoberta em uma rara espcie de sapo em Bornu refora a idia de que pulmes sejam uma
caracterstica malevel nos anfbios. Como a B. kalimantanensis vive em gua corrente e fria, a
ausncia de pulmes poderia ser uma adaptao para uma combinao de fatores, como um
meio com mais oxignio, o baixo metabolismo do animal, o achatamento do corpo que aumenta
a rea superfcial da pele e a preferncia por afundar em relao a
boiar."
Fonte: Agncia FAPESP (http://www.agencia.fapesp.br/materia/8679/divulgacaocientifica/sapo-sem-pulmao-e-descoberto.htm)
(001) Os sapos, as salamandras e as cobras-cegas so anfbios.
(002) Alm dos anfbios, minhocas tambm possuem respirao cutnea.
(004) Apesar do baixo metabolismo, a B. kalimantanensis animal endotrmico, como todos os
anfbios.

36

(008) Por ter somente respirao cutnea, a B. kalimantanensis precisa manter a pele sempre
mida. Por essa razo, sua dependncia de viver no meio aqutico maior do que a dos sapos
que possuem pulmes.
(016) Nos anfbios, quando os pulmes esto ausentes, h apenas a circulao do sangue venoso.
(032) O baixo metabolismo est associado com rpida digesto do alimento e alta taxa de
natalidade.
UFMS (2010) 18) "Os olhos de um crustceo marinho podero inspirar o desenvolvimento de
futuros aparelhos leitores de discos digitais, como o DVD. O camaro mantis, Odontodactylus
scyllarus, encontrado na Grande Barreira de Coral, na Austrlia, e tem o sistema de viso mais
complexo de que se tem notcia. Os indivduos da espcie so capazes de enxergar 12 cores o
homem v em apenas trs e podem distinguir entre formas diferentes de luz polarizada. No
seria o primeiro crustceo a inspirar produtos do tipo. Em 2006, um componente presente no
olho da lagosta inspirou o desenho de um detector de raio X
para um telescpio europeu (...)."
Sobre os olhos dos crustceos, como camares e lagostas, assinale a(s) proposio(es)
correta(s):
(001) Os olhos so estruturas sensoriais que permitem detectar luz e transformar essa percepo
em impulsos nervosos.
(002) O tipo de olho encontrado nos crustceos denominado olho composto.
(004) Lulas e planrias so animais que possuem olhos compostos.
(008) O olho composto formado por unidades pticas denominadas omatdios.
(016) O olho composto possui uma retina com funes semelhantes s do olho humano.
(032) O olho composto do camaro mantis percebe uma grande quantidade de cores, mas no
capaz de formar imagens.
UEM (2008_1) 19) Identifique o que for correto sobre os vertebrados.
01) Os rgos excretores dos peixes so um par de rins que retira as excretas nitrogenadas do
sangue, principalmente a uria.
02) Durante o desenvolvimento embrionrio dos rpteis, das aves e dos mamferos, formam-se
anexos embrionrios.
04) Os pulmes dos anfbios so mais desenvolvidos que os dos rpteis, com relao
ao nmero de dobras internas.
08) O corao das aves, como o dos mamferos, tem duas cmaras, um trio e um ventrculo,
completamente separados.
16) Nos mamferos, na camada superficial do crebro, em que se localiza a maioria dos corpos
celulares dos neurnios, que ocorre o processamento das informaes captadas pelos
rgos sensitivos.
UEM (2008_1) 20) Relacione as colunas e indique o que for correto nas
associaes propostas.
A. Porifera
B. Cnidaria
C. Platyhelminthes
D. Nemathelminthes
E. Mollusca
F. Annelida
G. Arthropoda
H. Echinodermata
1. Primeiros animais triblsticos da escala zoolgica.

37

2. Quanto estrutura corporal, podem ser ascanides, siconides e leuconides.


3. O saco visceral fica ligado ao p e onde se alojam os rgos internos.
4. O celoma tem origem enteroclica.
5. Primeiros animais da escala zoolgica a apresentarem uma cavidade corporal.
6. O crescimento descontnuo; a cada muda, a epiderme secreta novo exoesqueleto.
7. Diversas espcies so parasitas de plantas e de animais.
8. composto pelas classes Oligochaeta, Polychaeta
e Hirudinea.
01) C1 E3 F8
02) D1 E8 F3
04) A2 B5 H4
08) B1 G4 D5
16) A5 B2 C7
UEM (2008_2) 21) Com relao morfologia e fisiologia dos vertebrados, assinale o que for
correto.
01) A digesto sempre extracelular e o sistema digestrio apresenta nus ou cloaca.
02) Produzem amnia que, no fgado, pode ser transformada em uria ou em cido rico.
04) Aves e mamferos apresentam corao com quatro cmaras distintas e circulao dupla e
completa.
08) Os pulmes so estruturas tpicas de respirao area, portanto no esto presentes nas
tartarugas, nos golfinhos, nas baleias e nos peixes-boi.
16) O encfalo, que constitui o grande centro de comando do corpo, tem origem no tubo neural.
UEM (2008_2) 22) Sobre os protostmios, assinale o que for correto.
01) Nos cnidrios, existem basicamente dois tipos morfolgicos, as medusas e os plipos.
02) A estrela-do-mar pertence aos protostmios com sistema circulatrio fechado e intestino
com uma dobra denominada tiflossole.
04) As minhocas pertencem ao grupo que apresenta crescimento descontnuo, regulado pelo
hormnio da muda.
08) Nos moluscos, a concha pode ser externa, abrigando e protegendo o animal, pode ser
reduzida e interna ou mesmo ausente.
16) Pelo nmero de antenas, os insetos assemelham-se aos aracndeos e aos crustceos e
diferenciam-se dos diplpodes e dos quilpodes.
UEM (2008_2) 23) Em relao aos animais, assinale o que for correto.
01) A seqncia zigotomrulablstula ocorre no desenvolvimento embrionrio de todos os
animais.
02) O sistema digestrio dos animais sempre tem boca, mas nem sempre tem nus.
04) A excreo um processo que ocorre em todos os animais e est relacionada eliminao
de produtos resultantes do metabolismo celular.
08) As trocas gasosas ocorrem em todos os animais, mas nem todos tm sistema respiratrio.
16) Uma das hipteses evolutivas considera o reino animal como polifiltico e derivado de
porferos primitivos.

38

UEM (2009_1) 24) Considere os sistemas respiratrio e nervoso dos animais, bem como seus
aspectos evolutivos e assinale o que for correto.
01) Os tipos bsicos de respirao cutnea, branquial, traqueal e pulmonar relacionam-se
com as diversas maneiras com que os animais realizam as trocas gasosas com o ambiente.
02) A superfcie pulmonar altera-se nos diferentes grupos. Nos mamferos, os pulmes adquirem
uma superfcie interna que supera a superfcie corporal.
04) A conquista dos ambientes terrestres pelos animais foi acompanhada de uma constante e
crescente disponibilidade de gs oxignio e implicou a presena de rgos respiratrios
aperfeioados.
08) Na escala evolutiva animal, surge, nos platelmintos, um sistema nervoso central constitudo
de gnglios nervosos, sugerindo um rudimento de cefalizao.
16) O crtex cerebral liso em peixes, em anfbios, em rpteis e em aves e apresenta uma srie
de circunvolues nos mamferos, particularmente nos primatas.
UEM (2009_1) 25) Considerando as caractersticas de aneldeos, moluscos, artrpodes e
equinodermatas, assinale o que for correto.
01) Moluscos e equinodermatas so providos de rdula, estrutura dotada de dentculos, situada
entre o esfago e o estmago.
02) Moluscos e aneldeos so triblsticos, protostmios e esquizocelomados.
04) Aneldeos e artrpodes apresentam crescimento descontnuo, ou seja, trocam o revestimento
corporal, inclusive na fase adulta.
08) A metameria, presente em aneldeos e em artrpodes, consiste na organizao do corpo em
uma srie de segmentos.
16) A semelhana entre artrpodes e equinodermatas o celoma com origem enteroclica e a
boca com origem no blastporo.
UEM (2009_1) 26) Sobre os animais classificados como cordados, assinale o que for correto.
01) O corpo dos urocordados revestido por um envoltrio espesso denominado de tnica, que
apresenta os sifes exalante e inalante.
02) Os cefalocordados, conhecidos como anfioxos, so animais marinhos que filtram partculas
de alimento da gua.
04) Os vertebrados apresentam esqueleto interno bem desenvolvido e de origem desodrmica.
08) As mandbulas esto presentes em todos os cordados; por isso, no inovao surgida
durante a histria evolutiva dos vertebrados.
16) Os anexos embrionrios de rpteis, de aves e de mamferos so o saco vitelnico, o mnio, o
alantoide e o crio.
UEM (2009_2) 27) Considerando os processos fisiolgicos dos animais, assinale o que for
correto.
01) Os sucos digestivos que participam da digesto so basicamente enzimas, produzidas pelas
paredes do tubo digestrio ou por glndulas especiais associadas ao sistema digestrio.
02) Nos artrpodes, o exoesqueleto, que constitudo principalmente pelo polissacardeo
quitina, envolve totalmente o corpo do animal e o crescimento s ocorre por meio de muda.
04) Na respirao humana, o O2 difunde-se dos tecidos para o sangue, e parte dele une-se
hemoglobina livre, formando um composto, tambm instvel, denominado carboemoglobina.
08) Nos mamferos prototrios, a placenta propicia que o embrio receba nutrientes e oxignio
da me e que passe para o corpo materno os resduos de seu metabolismo.
16) No organismo humano, a desaminao de aminocidos ocorre principalmente no fgado,
onde os grupos amina so utilizados na produo da ureia.

39

UEM (2009_2) 28) Com relao aos animais protostmios, assinale o que for correto.
01) Nos porferos do tipo leuconoide, a digesto extracelular ocorre no trio ou espongiocele,
que uma cavidade digestria.
02) Nos platelmintos de vida livre, como a planria, a respirao ocorre por meio de clulaflama, que realiza tanto a captao do oxignio quanto a eliminao do gs carbnico.
04) Os cnidrios, tanto os plipos quanto as medusas, so carnvoros e, geralmente, capturam
suas presas por meio dos tentculos localizados ao redor da boca.
08) Nos moluscos, na cavidade do manto ou palial, abrem-se o nus e os poros excretores, e se
localizam as estruturas relacionadas com as trocas gasosas.
16) Os aneldeos, animais exclusivamente marinhos e de vida livre, apresentam o sistema
nervoso difusamente espalhado pela camada interna da epiderme.
UEM (2009_2) 29) Com relao aos animais vertebrados, assinale o que for correto.
01) Nos peixes, incluindo os cartilaginosos e os sseos, a nica forma de reproduo a ovpara
com fecundao externa e desenvolvimento direto.
02) Presena de membros locomotores e hbito alimentar onvoro so caractersticas comuns s
trs classes de anfbios: Anura, Urodela e Gymnophiona.
04) Com relao alimentao, a diferena entre as serpentes venenosas e as no venenosas
que as primeiras usam os dentes para a inoculao do veneno, e as segundas usam os dentes para
a mastigao de suas presas.
08) Os pulmes das aves so compactos, mas expandem-se em bolsas de ar, os sacos areos, que
contribuem para reduzir o peso, alm de servir como reservatrio de ar.
16) Na pele dos mamferos, existem anexos de origem epidrmica que no ocorrem nos demais
vertebrados, como as glndulas sebceas e as glndulas sudorparas.
UEM (2010_1) 30) Uma caracterstica compartilhada pela maioria dos animais a capacidade
de movimentar-se por meio de contraes dos msculos corporais. Entretanto, para que a
contrao resulte em movimento, os msculos precisam ter pontos de apoio fornecidos pelo
esqueleto. Com base nessas afirmaes, assinale o que for correto.
01) Existem dois tipos de esqueleto: exoesqueleto e endoesqueleto.
02) O exoesqueleto completo dos artrpodes constitudo de uma carapaa de placas articuladas
compostas basicamente de quitina.
04) O exoesqueleto incompleto pode ser encontrado em ostras, mexilhes, caracis e caramujos.
08) O processo de troca do endoesqueleto e exoesqueleto a muda ou ecdise, que pode ocorrer
vrias vezes na vida do animal.
16) Em equinodermos, como em estrelas-do-mar, o exoesqueleto formado por pequenos
ossos articulados, cuja funo proteger os rgos internos e dar apoio aos msculos.
UEM (2010_1) 31) Considerando a reproduo e o desenvolvimento dos parasitas pertencentes
aos platelmintos ou nematelmintos, assinale o que for correto.
01) Nesses dois grupos, so registradas espcies monicas e diicas, que realizam ou no
cpula.
02) Apenas nematelmintos tm dimorfismo sexual, sendo que os machos so mais curtos que as
fmeas e apresentam a regio posterior curvada, formando um gancho com o qual seguram a
fmea durante a cpula.
04) O hospedeiro em que ocorre a fase adulta (sexualmente madura) de um parasita digentico
chamado de hospedeiro definitivo, enquanto aquele(s) em que ocorre(m) as fases larvais e
sexualmente imaturas chamado de hospedeiro(s) intermedirio(s).
08) Nas progltides sexualmente maduras de uma tnia, ocorre autofecundao, tanto entre
rgos reprodutores da mesma progltide quanto de progltides vizinhas.

40

16) No caso dos nematelmintos, os ovos, ao serem ingeridos, eclodem e libertam as larvas no
intestino, que prontamente se instalam no intestino delgado, completando, nesse rgo, seu
desenvolvimento at a fase adulta.
UEM (2010_1) 32) Sobre os rgos sensoriais de vertebrados, assinale o que for correto.
01) As linhas laterais correspondem a dois finos canais ao longo das laterais do corpo. Esses
canais tm aberturas por onde penetra a gua e so exclusivos de peixes sseos.
02) As serpentes tm rgo olfativo especial no teto da boca, o rgo de Jacobson.
04) As glndulas paratides, que se abrem nos lados da boca dos anfbios, tm funo gustativa.
08) A viso das aves muito boa, e sua audio bastante aguada. Esta possibilita a
comunicao por meio de sons.
16) Ampolas de Lorenzini, ou lorenzianas, localizam-se na regio da cabea de caes, por
exemplo, e nelas existem clulas sensoriais que captam as fracas correntes eltricas geradas pela
atividade dos msculos de outros animais.
UEM (2010_2) 33) No que se refere ao desenvolvimento embrionrio dos animais, assinale o
que for correto.
01) Os porferos so os nicos animais que no formam gstrula, nem folhetos germinativos.
02) Nos nematdeos (vermes cilndricos), o mesoderma cresce aderido ao ectoderma, deixando
um espao entre si e o endoderma. Esse espao chamado de pseudoceloma.
04) Moluscos, aneldeos e os artrpodes apresentam celoma enteroclico e por isso so
chamados enterocelomados.
08) Aqueles animais em que o blastporo d origem boca so chamados protostmios.
16) Equinodermos e cordados so deuterostmios.
UEM (2010_2) 34) Sobre a reproduo e o desenvolvimento dos artrpodes, assinale o que for
correto.
01) Zoea e Misis so fases de vida de aracndeos.
02) A maioria dos crustceos monoica, sempre com desenvolvimento direto.
04) Os aracndeos so dioicos, a fecundao interna e a fmea deposita os ovos dentro de um
casulo de seda tecido por ela, chamado de ovissaco.
08) Insetos so dioicos. Ocorre cpula e os espermatozoides passam para um reservatrio
denominado espermateca.
16) Em alguns insetos, a poro terminal do abdome da fmea forma uma projeo denominada
de ovopositor, que lhe permite perfurar o solo, frutas ou mesmo o corpo de outros animais para a
postura dos ovos.
UEM (2010_2) 35) Assinale o que for correto sobre a alimentao e o sistema digestrio de
vertebrados.
01) Desde a fase larval at a fase adulta, as lampreias so ectoparasitas de peixes, cuja boca tem
forma de ventosa e sua glndula salivar produz uma substncia anticoagulante.
02) A funo da vlvula espiral em condrictes a de retardar o trnsito dos alimentos, dando
mais tempo digesto, alm de aumentar a rea intestinal de absoro de nutrientes.
04) Os actinoptergios tm sistema digestrio incompleto, semelhante ao dos condrictes,
inclusive com vlvula espiral.
08) Os anuros adultos so carnvoros, alimentando-se, em geral, de insetos, vermes e outros
invertebrados.
16) O estmago das aves, independente do hbito alimentar, dividido em trs partes: papo,
proventrculo e moela.

41

UEM (2011_1) 36) Sobre os cnidrios, correto afirmar que so animais que apresentam:
01) dois folhetos germinativos, a ectoderme e a mesogleia.
02) cavidade gastrovascular e sistema nervoso difuso.
04) nematocistos e porcitos.
08) cnidoblastos e digesto extracelular.
16) formas medusoides e polipoides.
UEM (2011_1) 37) Com relao aos cordados, correto afirmar que:
01) os anfbios foram os primeiros vertebrados a ocupar o ambiente terrestre, graas presena
de pulmes e dois pares de patas.
02) as penas das aves, constitudas de quitina, so importantes para manuteno da homeotermia
e para o voo.
04) uma das adaptaes dos rpteis para serem bem sucedidos no ambiente terrestre terem o
corpo recoberto por queratina, o que torna a pele seca e impermevel.
08) uma das adaptaes dos mamferos a dentio diferenciada em dentes incisivos, caninos,
prmolares e molares.
16) os peixes cartilaginosos apresentam brnquias na regio anterior do corpo, cobertas por uma
placa mvel, o oprculo.
UEM (2011_1) 38) O desenvolvimento da simetria bilateral foi um importante avano para a
evoluo dos animais. Sobre esse assunto, pode-se afirmar corretamente que
01) possibilitou a cefalizao.
02) permitiu a ocupao de ambientes terrestres pelo movimento de rastejamento.
04) garantiu o equilbrio e diminuiu a resistncia do ar ou da gua ao movimento.
08) possibilitou que animais fixos (ssseis) entrem em contato com o ambiente em vrias
direes.
16) todos os metazorios apresentam esse tipo de simetria.
UEM (2011_1) 39) O filsofo grego Aristteles (384 a.C. 322 a.C.) chamava as minhocas de
intestinos da Terra, em referncia ao importantssimo papel que esses animais desempenham
no solo. Os antigos egpcios atribuam poderes especiais a esses animais devido ao
extraordinrio trabalho de regenerao do solo que executam. E tinham razo: hoje sabemos que
a grande fertilidade do solo s margens do rio Nilo deve-se principalmente ao trabalho das
minhocas que, ano aps ano, transformam milhes de toneladas de matria
orgnica despejada pelas guas das enchentes em adubo mineral de alta qualidade. Com relao
a esses organismos, assinale a(s) alternativa(s) correta(s).
01) A metameria, isto , a diviso do corpo em metmeros, foi um importante avano evolutivo
que permitiu o movimento de escavao.
02) A minhoca possui sistema circulatrio aberto, com pigmentos respiratrios, como a
hemoglobina e a hemocianina.
04) Na reproduo das minhocas, o clitelo das fmeas secreta um casulo, dentro do qual
eliminam os vulos maduros.
08) O tubo digestrio da minhoca constitudo de boca, faringe, esfago, papo, moela, intestino
e nus.
16) Dentre os resduos que a minhoca produz, destacam-se os carbonatos, que deixam o solo
mais cido, favorecendo a penetrao da gua.

42

UEM (2011_2) 40) A presena de uma cavidade corporal interna nos animais uma importante
caracterstica evolutiva. Sobre as vantagens que essa cavidade oferece, assinale o que for
correto.
01) Possibilita o transporte de nutrientes e de excretas e a proteo dos rgos internos.
02) Permite uma melhor acomodao dos rgos internos e fornece sustentao ao animal.
04) Organiza o corpo em segmentos iguais e melhora a flexibilidade.
08) Possibilita o crescimento dos rgos internos e a cefalizao.
16) Facilita a distribuio dos nutrientes e o acasalamento.
UEM (2011_2) 41) A maioria dos animais possui um esqueleto que sustenta e protege o corpo e
os rgos internos e serve como ponto de apoio para os msculos. A esse respeito,
assinale o que for correto.
01) O esqueleto axial dos vertebrados constitudo pelas estruturas esquelticas que do
sustentao aos apndices corporais, tais como asas, pernas ou braos e nadadeiras.
02) Os artrpodos tm um exoesqueleto de queratina, com partes articuladas que permitem os
movimentos, e substitudo periodicamente.
04) Nos animais como as minhocas e os nematoides, a sustentao feita pela presso dos
lquidos existentes na cavidade do corpo, ou seja, pelo esqueleto hidrosttico.
08) A concha da maioria dos moluscos constituda por carbonato de slica.
16) Os quelnios apresentam carapaa ssea recoberta por placas crneas.
UEM (2011_1) 42) A zona costeira brasileira, considerada patrimnio nacional pela
Constituio de 1988, um grande berrio natural, com enorme riqueza biolgica. Porm, a
intensidade do processo de ocupao desordenada dos recursos naturais vem colocando em risco
diversos recifes, que se encontram em acelerado processo de degradao. Com relao aos
recifes de corais, correto afirmar que:
01) sob o ponto de vista geomorfolgico o recife de coral uma estrutura rochosa, rgida,
resistente ao mecnica de ondas e correntes marinhas, e constituda por organismos
marinhos, portadores de esqueleto calcrio.
02) so constitudos principalmente pelos esqueletos calcrios das formas medusoides dos
cnidrios.
04) necessitam de guas quentes para desenvolver-se adequadamente, pois obtm boa parte de
seu alimento de algas ue vivem dentro de seu corpo.
08) so considerados ecossistemas novos, pois os novos plipos esto sempre crescendo sobre
os esqueletos dos plipos mortos.
16) o branqueamento dos corais um indicativo de que o ambiente marinho est saudvel.
UEPG (2011) 43)O Reino Animal rene organismos hetertrofos multicelulares que possuem
tecidos corporais bem
definidos. Com relao histologia e organologia animal, assinale o que for correto.
01) A parede do corpo de uma esponja delimita uma cavidade central denominada trio ou
espongiocela.
02) Nas esponjas, os coancitos promovem a circulao de gua com o batimento de seus
flagelos e que fagocitam partculas de alimentos suspensas na gua.
04) Os cnidrios so os primeiros animais na escala zoolgica a apresentar uma cavidade
digestiva na qual ocorre parte da digesto dos alimentos.
08) O corpo de um molusco revestido por uma epiderme rica em glndulas. Em muitas
espcies existem glndulas epidrmicas que fabricam a concha, responsvel pela proteo e pela
sustentao esqueltica do animal.

43

16) A minhoca e outros aneldeos possuem sistema circulatrio fechado, ou seja, o sangue nunca
sai dos vasos sanguneos.
UEM (2008_2) 44) Na tabela abaixo, constam as caractersticas do subfilo Vertebrata e os
grupos que o compem. Analise a tabela e assinale o que for correto.

01) Uma das caractersticas comum a apenas dois grupos.


02) Uma das caractersticas exclusiva de um dos grupos.
04) Apenas uma das caractersticas comum a todos os grupos.
08) A caracterstica presena de crnio comum para menos de 50% dos grupos.
16) 1/7 dos grupos apresenta 100% das caractersticas.
GABARITO: 1-GAB: 01+04+16+32=53
2-GAB: 02+16=18
3-GAB: 01+02=03
4-GAB: 01+02+08=11
5-GAB: 04+16+32=52
6-GAB: 01+64=65
7-GAB: 02+08+32=42
8-GAB: 01+08+64=73
9-GAB: 02+04+08=14
10-GAB: 01+04+16=21
11-GAB: 01+02+16=19
12-GAB: 02+08+32=42
13-GAB: 02+04+16=22
14-GAB: 01+02=03
15-GAB: 01+02+16+32=51
16-GAB: 02+08+32=42
17-GAB: 01+02+08=11
18-GAB: 01+02+08=11
19-GAB: 01+02+16=19
20-GAB: 01+04=05
21-GAB: 01+02+04+16=23
22-GAB: 01+08=09
23-GAB: 01+02+04+08=15
24-GAB: 01+02+04+08+16=31
25-GAB: 02+08=10
26-GAB: 01+02+04+16=23
27-GAB: 01+02+16=19
28-GAB: 04+08=12
29-GAB: 08+16=24
30-GAB: 02+04=06
31-GAB: 01+04+08=13
32-GAB: 02+08+16=26
44

33-GAB: 01+02+08+26=27
34-GAB: 08+16=24
35-GAB: 02+08=10
36-GAB: 02+08+16=26
37-GAB: 01+04+08=13
38-GAB: 01+02+04=07
39-GAB: 01+08=09
40-GAB: 01+02=03
41-GAB: 04+16=20
42-GAB: 01+04=05
43-GAB: 01+02+04+08+16=31
44-GAB: 01+02+16=19

45

VRUS E FUNGOS
UFMS (2008) 1) A Aids uma doena que representa um dos maiores problemas de sade da
atualidade em virtude de sua gravidade e de seu carter pandmico. Sobre essa doena, correto
afirmar:
(001) Os vrus HIV-1 e HIV-2 pertencem ao grupo dos retrovrus oncognicos e no citopticos,
necessitando de uma enzima denominada transcriptase reversa para multiplicarem-se.
(002) Esses vrus so inativados por uma variedade de agentes fsicos (calor), mas so
resistentes a agentes qumicos.
(004) O HIV pode ser transmitido pelo sangue (via parenteral e vertical), esperma, secreo
vaginal (via sexual), mas no pelo leite materno (via vertical).
(008) O indivduo infectado pode transmitir o HIV durante todas as fases da infeco, risco esse
proporcional magnitude da viremia, principalmente na doena avanada e na infeco aguda.
(016) Com os testes atualmente disponveis, o tempo necessrio para que a sorologia anti-HIV
se torne positiva de 6 a 12 semanas, aps a aquisio do vrus, com perodo mdio de
aproximadamente 2 meses. Esse tempo, compreendido entre a aquisio da infeco e a
deteco da soroconverso, chamado de janela imunolgica.
(032) So vrias as doenas oportunistas que esto associadas Aids, podendo ser causadas por
vrus, bactrias, fungos e protozorios. S no h, por enquanto, descrio de neoplasias
associadas AIDS.
UEM (2008_2) 2) Sobre fungos, assinale o que for correto.
01) So eucariontes aclorofilados e incorporam os alimentos por absoro.
02) Sua substncia de reserva o glicognio.
04) No processo de fermentao, como na fabricao de vinhos, transformam acar em lcool
etlico e CO2.
08) Fungos micorrzicos so organismos parasitas que provocam, nas plantas, doenas
genericamente conhecidas como ferrugem.
16) Nos liquens, o fungo sempre um basidiomiceto.
UEM (2009_2) 3) Sobre fungos e plantas, correto afirmar que
01) apenas as pteridfitas, dentre as plantas vasculares, dependem da gua para o processo de
fecundao.
02) nas samambaias e nas gimnospermas o esporfito (2n).
04) angiospermas, as nicas plantas com flores e frutos, no apresentam reproduo assexuada.
08) rizoide, filoide e cauloide fazem parte do gametfito dos musgos.
16) fungos no estabelecem relao de parasitismo com organismos clorofilados.
UEM (2011_1) 4) Sobre os fungos, correto afirmar que:
01) so organismos eucariontes, uni ou pluricelulares e auttrofos, uma vez que se nutrem por
absoro.
02) as hifas cenocticas no apresentam septos transversais; portanto, seus ncleos ficam
dispersos em uma massa citoplasmtica comum.
04) no processo de reproduo sexuada os fungos produzem esporos haploides denominados
zigsporos, ascporos e basidisporos.
08) muitas espcies so importantes para a alimentao humana; dentre eles, destacam-se as
espcies de Penicillium, utilizadas em grande escala para fermentao alcolica.
16) as micorrizas so fungos parasitas que crescem no interior das clulas das razes de algumas
plantas.

46

GABARITO:
1-GAB: 08+16=24
2-GAB: 01+02+04=07
3-GAB: 01+02+08=11
4-GAB: 02+04=06

47

DOENAS (VERMINOSES, PROTOZOOSES, INFECES VIRAIS E


BACTERIANAS)
UNIOESTE (2005) 1) Assinale a(s) alternativa(s) que associa(m) corretamente parasita, filo e
doena.
(01) Trypanosoma cruzi - Platyhelminthes - esquistossomose
(02) Wuchereria bancrofti - Nematodea - filariose
(04) Schitosoma mansoni - Nematodea - amarelo
(08) Balantidium coli - Anellida - elefantase
(16) Fasciola hepatica - Anellida - cirrose
(32) Enterobius vermiculares - Platyhelminthes - ascaridase
(64) Equinococcus granulosus - Platyhelminthes hidatidose
UEPG (2008_1) 2) A respeito de protozooses e os agentes causadores dessas doenas, assinale o
que for correto.
01) A leptospirose causada por um protozorio rizpode denominado Leptospira
icterohemorrhagiae, transmitido por ferimentos e mucosas em contato com gua contaminada
por urina de rato. Esta protozoose ocasiona febre, dores musculares e leses hepticas que
podem ser fatais.
02) A giardase uma complicao intestinal causada pela ingesto de cistos de Giardia lamblia
eliminados com as fezes huma nas. Trata-se de um protozorio esporozorio que, aps romper a
forma de cisto pela ao de enzimas digestivas do hospe deiro, pode reproduzir-se
assexuadamente por bipartio, originando formas mais ativas, chamadas trofozotos.
04) No Brasil, a doena de Chagas e a malria so as duas maiores e mais graves endemias
causadas por protozorios. Nos l timos anos, a incidncia anual da malria em nosso pas
chegou mdia de 500 mil novos casos. Existem tambm milhes de brasileiros chagsicos,
incapacitados para o trabalho e com reduo do tempo de vida por causa de problemas
cardacos.
08) A toxoplasmose uma doena causada por um protozorio esporozorio denominado
Toxoplasma gondii, transmitido pela in-gesto de cistos expelidos com as fezes de gatos.
UFSC (2007) 3) As DSTs (doenas sexualmente transmissveis) constituem um dos grandes
problemas de sade pblica mundial. direito e dever de todo cidado manter-se informado
sobre as doenas sexualmente transmissveis, de forma a se proteger do contgio e evitar a sua
transmisso.
Sobre elas, CORRETO afirmar que:
01.
caso uma gestante tenha DST, seu filho no corre perigo de contrair a doena, pois
no h contato entre o sangue da me e o do beb.
02.
a AIDS (em portugus, sndrome da imunodeficincia adquirida) sempre causa leses
nos rgos genitais.
04.
a grande maioria das DSTs pode ser prevenida com o uso de preservativo (camisinha)
durante a relao sexual.
08.
as DSTs ocorrem apenas em pessoas que mantm relaes sexuais.
16.
toda DST causa leso nos rgos genitais.
32.
a AIDS pode ser transmitida atravs do contato direto com o paciente, como um
aperto de mo, ou atravs do contato indireto, como o uso dos mesmos pratos, copos e talheres.
64.
a AIDS causada pelo vrus HIV (em portugus, vrus da imunodeficincia humana),
que ataca as clulas do sistema imunolgico diminuindo a capacidade do organismo de reagir s
infeces mais comuns.
48

UFSC (2008) 4) Bactrias, protozorios e fungos so microorganismos responsveis por muitas


doenas humanas. Assinale a(s) proposio(es) CORRETA(S) a respeito deste assunto.
01. A toxina botulnica produzida por uma bactria que pode estar presente em alimentos
industrializados mal processados (enlatados, conservas e embutidos). Sua ingesto causa o
botulismo, cujo principal sintoma a paralisia muscular.
02. Para combater as infeces causadas por bactrias utilizamos os antibiticos, os quais no
so efetivos no combate s infeces causadas por vrus.
04. Frieiras e outras micoses so causadas por fungos.
08. A doena de Chagas causada pelo Tripanosoma cruzi, um protozorio presente nas
fezes do barbeiro. A doena grave e no h tratamento ou preveno.
16. A giardase causada por uma bactria que provoca diarria e dores abdominais, e pode ser
contrada pela ingesto de carne crua ou mal cozida.
32. O ttano, a pneumonia e a leishmaniose so doenas causadas por bactrias e podem ser
prevenidas atravs de vacinao.
64. A malria causada por um protozorio transmitido ao homem pela picada do mosquito
Aedes aegypti.
UFSC (2009) 5) Assinale a(s) proposio(es) que indica(m) CORRETAMENTE doena(s)
causada(s) por protozorio.
01. Raiva
02. Doena de Chagas
04. Toxoplasmose
08. Esquistossomose
16. Giardase
32. Dengue
64. Febre amarela
UFMS (2007) 6) Assinale a(s) proposio(es) correta(s) em relao s doenas e suas formas
de transmisso.
(001) A ancilostomose ocorre pela penetrao de larvas rabditides, atravs da pele. Essas larvas
contaminam o solo e so originrias de ovos provenientes das fezes de um hospedeiro.
(002) A elefantase ocorre atravs da penetrao da larvamigrans na pele.
(004) A penetrao da larva migrans na pele origina a denominada doena geogrfica.
(008) O mosquito Culex pica uma pessoa doente recebendo o sangue com as larvas
(microfilrias).
Essas larvas se desenvolvem no sistema digestivo do inseto e instalam-se na probscide at uma
nova picada. Aps a picada, as larvas so liberadas e se instalam em vasos linfticos onde os
parasitas tornam-se adultos. Essa descrio refere-se forma de transmisso da Ascaridase.
(016) A enterobiose ocorre atravs da penetrao de larvas rabditides, originrias de ovos
provenientes das fezes de um hospedeiro contaminado.
(032) A ancilostomose ocorre pela ingesto de ovos de um nematelminto ou atravs da autoinfestao.
UFMSN (2008) 7) A Malria uma doena infecciosa, febril, aguda, causada por protozorios
transmitidos por vetores e com elevado potencial de disseminao em reas com densidade
vetorial que favorea a transmisso. Causa considerveis perdas sociais e econmicas na
populao sob risco, concentrada na regio amaznica. Sobre a Malria, ainda correto afirmar:
(001) O homem considerado o nico reservatrio com importncia epidemiolgica para a
malria.

49

(002) Popularmente, os vetores da malria so conhecidos por carapan, murioca,


sovela, mosquito-prego e bicuda.
(004) Pode-se pegar malria mais de uma vez, e indivduos que tiveram vrios episdios de
malria podem atingir um estado de imunidade parcial, apresentando quadro subclnico ou
assintomtico.
(008) O quadro clnico tpico caracterizado por febre alta, aumento do fgado e do bao e
importante distenso da barriga, dependendo da espcie de plasmdio infectante.
(016) O diagnstico laboratorial de rotina especfico caracteriza-se pela demonstrao de
parasitos atravs do mtodo denominado Xenodiagnstico, usado preferencialmente em reas de
baixa endemicidade.
(032) A espcie Anopheles darlingi considerada como o principal vetor no Brasil e se destaca
na transmisso da doena devido sua distribuio geogrfica, antropofilia e pela capacidade de
ser infectada por diferentes espcies de plasmdios.
UFMS (2009) 8) Assinale a(s) alternativa(s) que indica(m) doenas, nos seres humanos,
causadas por bactrias.
(001) Rubola e Catapora.
(002) Clera e Botulismo.
(004) Febre Tifide e Difteria.
(008) Mononucleose e Poliomielite.
(016) Sfilis e Hansenase.
(032) Dengue e Febre Amarela.
UFMS (2009) 9) Com relao aos protozorios que afetam a populao brasileira, assinale a(s)
alternativa(s) correta(s):
(001) A doena de Chagas, nome adotado em homenagem ao pesquisador Carlos Chagas,
causada pelo protozorio Trypanosoma cruzi.
(002) A Amebase (Disenteria Amebiana) e a Giardase so causadas, respectivamente, pela
Entomoeba histolytica e pela Giardia lamblia, sendo a transmisso para o ser humano, de ambas
as doenas, causada pela ingesto de gua e alimentos contaminados por cistos desses
protozorios.
(004) A Leishmaniose Tegumentar Americana (LTA), conhecida por calazar, causada pelo
protozorio Leishmania chagasi.
(008) A Malria causada por protozorio do gnero Plasmodium do qual existem trs espcies
encontradas no Brasil: Plasmodium vivax, Plasmodium malariae e Plasmodium falciparum.
(016) A transmisso da Toxoplasmose, causada pelo Toxoplasma gondii, realizada por um
mosquito do gnero Anopheles, conhecido popularmente como mosquito-prego.
(032) A Malria transmitida por um mosquito do gnero Lutzomyia (flebtomos), denominado
popularmente mosquito-palha.
UFMS (2010) 10) Em relao s doenas parasitrias que afetam o homem, correto afirmar:
(001) O nematdeo Necator americanus causador da oxiurose no homem.
(002) O popular bicho-geogrfico causado por larvas do nematdeo Ancylostoma duodenale
que penetram na pele humana causando intensa coceira e deixam linhas sobre o corpo
semelhantes a traados de mapas.
(004) O trematdeo Schistosoma mansoni provoca no homem a esquistossomose, caracterizada
por aumento abdominal, popularmente conhecido como barriga dgua.
(008) No Brasil, o nematdeo Wuchereria bancrofti causa a filariose doena tambm conhecida
como elefantase.

50

(016) No caso da tenase no homem, o bovino hospedeiro intermedirio da Taenia solium, e o


suno hospedeiro intermedirio da Taenia saginata.
(032) A doena ancilostomase, conhecida por amarelo, causada pelo nematdeo Ascaris
Lumbricoides
UEM (2008_1) 11) Considerando algumas interaes entre a espcie humana e outros
organismos, assinale o que for correto.
01) O HIV, vrus causador da Aids, parasita intracelular obrigatrio.
02) A amebase e a malria so doenas causadas por organismos do reino Monera.
04) Os antibiticos foram obtidos pioneiramente de ascomicetos do gnero Penicillium, que so
organismos heterotrficos.
08) O amarelo, ou ancilostomose, e as tenases so doenas tpicas do sistema circulatrio, em
especial das artrias.
16) A tuberculose uma doena pulmonar causada por um organismo unicelular e procarionte.
UEM (2008_2) 12) Considerando as doenas humanas, seus patgenos e seus transmissores,
assinale o que for correto.
01) A gastrenterite rotaviral transmitida por diminutos caros parasitas.
02) A cisticercose humana adquirida pela ingesto de ovos de tnia, com conseqente
formao de cisticercos na musculatura ou no crebro.
04) Insetos hematfagos e parasitas, como a pulga, tambm podem ser transmissores de
doenas.
08) A ascaridiose e a ancilostomose so doenas intestinais causadas por parasitas do mesmo
filo.
16) A filariose, doena do sistema linftico, causada por vermes transmitidos por mosquitos.
UEM (2009_1) 13) Com relao s doenas humanas e aos seus agentes, assinale o que for
correto.
01) A sndrome da imunodeficincia adquirida causada por um retrovrus, assim denominado
pela capacidade de realizar retrotranscrio.
02) A sfilis, doena sexualmente transmitida, tem por agente um organismo procarionte e
heterotrfico do reino Monera.
04) A disenteria amebiana, causada pelo protozorio sarcodneo do gnero Plasmodium, pode
ser controlada pelo combate ao mosquito do gnero Aedes.
08) Os parasitas que causam a esquistossomose e a filariose pertencem ao mesmo filo.
16) O reino dos organismos causadores de micoses engloba, tambm, outros organismos que
possuem ao fermentativa e alguns que so usados na indstria de antibiticos.
UEM (2009_2) 14) Sobre os agentes causadores de doenas e suas relaes com a espcie
humana, assinale o que for correto.
01) A gripe uma doena causada por variedades do vrus Influenzavirus, que so altamente
mutagnicos e, por isso, as vacinas contra gripe devem ser tomadas todos os anos.
02) No ciclo do Plasmodium, causador da malria, o mosquito o hospedeiro intermedirio e o
ser humano o hospedeiro definitivo, pois nesse que o parasita se reproduz sexuadamente.
04) As riqutsias so bactrias que vivem no interior ou na superfcie de artrpodes e de
vertebrados. Uma das doenas que elas causam em seres humanos o tifo epidmico.
08) Os protozorios flagelados, causadores da giardase, da tricomonase e da leishmaniose, so
transmitidos pelo mesmo mosquito.
16) O nematdeo Taenia saginata, um parasita do sistema muscular, desenvolve todo o seu ciclo
de vida no interior de um nico hospedeiro, o homem ou o boi.

51

UEM (2010_1) 15) As doenas sexualmente transmissveis (DSTs) englobam diferentes


patologias e, at 1983, eram denominadas de doenas venreas. Assinale o que for correto sobre
essas doenas e seus agentes.
01) Algumas DSTs, como herpes genital e sfilis, podem afetar, alm da rea genital, o sistema
nervoso central.
02) O HIV (vrus da imunodeficincia humana), o causador da AIDS (sndrome da
imunodeficincia adquirida), composto de RNA e ataca os linfcitos T.
04) Vacinas e uso de preservativos (camisinhas) so mtodos de preveno para no contrair
tanto o HIV quanto os vrus da hepatite C.
08) DSTs, como a AIDS e o herpes genital, somente podem ser transmitidas de um indivduo
para outro mediante o ato sexual.
16) Vrus, bactrias, fungos e protozorios so agentes causadores de DSTs.
UEM (2010_2) 16) Sobre as doenas parasitrias no homem, responda o que for correto.
01) O Schistossoma mansoni causa a esquistossomose, e a entrada do parasita em sua fase
larval, no organismo humano, se d pela pele ou pelas mucosas.
02) A cisticercose ocorre quando os ovos eliminados por um indivduo infestado pela Taenia
solium passam para ele prprio ou para outras pessoas, por meio das mos sujas, gua ou frutas
e verduras contaminadas.
04) Na ascaridase ou ascarase, o homem passa a ter o verme adulto no intestino, aps ingerir a
larva existente em carne mal cozida.
08) A ancilostomose, ancilostomase, amarelo ou opilao pode ser causada pelo Ancylostoma
duodenale e pelo Necator americanus.
16) A filariose ou elefantase causada pelo verme Wuchereria bancrofti, cujas larvas so
transmitidas pela ingesto de larvas de inseto encontradas em verduras mal lavadas.
UEM (2011_1) 17) No Brasil, as verminoses tm grande importncia socioeconmica, estando
diretamente vinculadas s condies precrias de saneamento bsico e de moradia.
urgente que o governo canalize recursos financeiros para esse setor. Dentre as verminoses que
ocorrem em nosso pas, correto afirmar que
01) a cisticercose transmitida pelo consumo de carne contaminada por larvas encistadas, os
cisticercos.
02) a esquistossomose pode ser evitada pela destruio dos criadouros de larvas dos mosquitos
transmissores.
04) a lombriga, Ascaris lumbricoides, adquirida ao andar-se descalo, visto que a larva penetra
pelos ps.
08) o amarelo, causado pelo Ancylostoma, uma doena que se pode adquirir pela picada do
bicho barbeiro.
16) a tenase uma doena causada pelo verme adulto de Taenia saginata, atravs da ingesto de
carne bovina contaminada com os cisticercos.
GABARITO:
1-GAB: 02+64=66
2-GAB: 04+08=12
3-GAB: 04+64=68
4-GAB: 01+02+04=07
5-GAB: 02+04+16=22
6-GAB: 04

52

7-GAB: 01+02+04+32=47
8-GAB: 02+04+16=22
9-GAB: 01+02+08=11
10-GAB: 08+04=12
11-GAB: 01+04+16=21
12-GAB: 02+04+08+16=30
13-GAB: 01+02+16=19
14-GAB: 01+04=05
15-GAB: 01+02+16=19
16-GAB: 01+02+08=11
17-GAB: 16

53

CORPO HUMANO (FISIOLOGIA E HISTOLOGIA HUMANA)


UNIOESTE (2005) 1) Numerando-se glndulas com algarismos romanos, hormnios com
algarismos arbicos e aes por letras maisculas:

Assinale a(s) alternativa(s) em que todas as associaes glndula/hormnio/ao esto


corretas.
(01) I 1 A, II 3 B, III 2 G, IV 6 E
(02) I 4 H, II 5 F, III 8 D, IV 7 C
(04) I 3 F, II 4 E, III 7 A, IV 1 C
(08) I 2 G, II 7 H, III 3 B, IV 4 D
(16) I 1 A, II 5 F, III 2 G, IV 7 C
(32) I 4 H, II 3 B, III 8 D, IV 6 E
(64) I 5 B, II 6 G, III 4 C, IV 8 F
UEPG (2006_1) 2) As clulas musculares podem obter energia por meio da respirao aerbica
ou da fermentao.
02) Nos msculos do atleta desmaiado deve haver acmulo de cido ltico.
04) Nos movimentos da corrida os msculos estriados esquelticos, que se prendem aos nossos
ossos, contraem-se rpida e fortemente sob ao controlada conscientemente pela nossa vontade.
Por esse motivo dizemos que so voluntrios.
08) A contrao dos msculos provocada pela contrao de suas fibras que se contraem devido
ao encurtamento de centenas de miofibrilas contidas no citoplasma da clula muscular.
16) As miofibrilas dos msculos exercitados so constitudas, principalmente por dois tipos de
protenas: a miosina, mais espessa, e a actina, mais fina. Durante a corrida, nos msculos, essas
protenas organizam-se em filamentos que ficam alinhados de modo a formar regies, as estrias,
claras e escuras. A contrao muscular causada pelo encurtamento dessas estrias.
UEPG (2007_1) 3) Encontram-se listadas abaixo, algumas propriedades caractersticas ou
funes dos elementos constituintes do sangue humano.
Analise-as e assinale o que for correto.
01) Os linfcitos so elementos figurados do sangue, envolvidos com o processo de coagulao
sangnea.
02) As hemcias so clulas sangneas ricas em hemoglobina que transportam oxignio.
04) Os leuccitos possuem a capacidade de atravessar intactos a parede dos capilares para
atingir uma regio infectada do organismo.
08) Os leuccitos so clulas relacionadas com a defesa do organismo, mais pela produo de
anticorpos do que pela fagocitose.
16) A hemoglobina uma protena capaz de combinar-se com o oxignio e transport-lo a todas
as clulas do corpo humano.

54

UEPG (2008_1) 4) O papel da digesto transformar as molculas grandes e complexas dos


alimentos em molculas pequenas, simples e solveis. Depois de algumas modificaes, os
nutrientes so distribudos por todo o organismo, atravs do sangue e da linfa. Sobre as enzimas
digestivas, assinale o que for correto.
01) O amido comea a ser digerido j na boca, sob a ao da amilase presente na saliva, e a
digesto prossegue no duodeno, sob a ao da amilase, tambm presente no suco pancretico. O
produto destes dois processos digestivos a maltose, que ainda dever ser digerida pela enzima
maltase, presente no suco entrico, resultando em glicose no interior do intestino delgado.
02) O quimo, rico em gorduras, estimula a parede do duodeno a liberar o hormnio
enterogastrona, que vai provocar fortes contraes na musculatura lisa da vescula biliar,
permitindo a expulso da bile, que, atuando na digesto das gorduras, formar glicerol e cidos
graxos.
04) Ao sair do estmago, o quimo acidificado estimula a parede do duodeno a produzir o
hormnio colecistocinina. A colecistocinina levada pelo sangue ao pncreas, estimulando-o a
liberar o suco pancretico no duodeno. Esto presentes no suco gstrico as enzimas sacarase,
lactase e maltase, que obtm glicose, frutose e galactose dos alimentos ingeridos.
08) A chegada do alimento ao estmago faz com que as clulas da sua mucosa produzam um
hormnio, a gastrina, que levada por via sangunea s glndulas gstricas, estimulando-as a
produzir suco gstrico. Esto presentes no suco gstrico as enzimas pepsina e lipase, que atuam,
respectivamente, nos substratos protenas e gorduras.
UEPG (2009_1) 5) Nos animais, durante o desenvolvimento do embrio, os folhetos
embrionrios diferenciam-se em pequenos agrupamentos celulares, constitudos por um ou mais
tipos de clulas. O conjunto formado por essas clulas denominado tecido. A respeito dos
tecidos animais, assinale o que for correto.
01) A maior parte do tecido epitelial no irrigada por vasos sanguneos e a nutrio das clulas
ocorre por difuso a partir do tecido conjuntivo subjacente, atravs da lmina basal.
02) O tecido sseo um tipo de tecido conjuntivo denso, de consistncia rgida, que apresenta
grande quantidade de fibras colgenas, o que lhe confere colorao branca e o torna mais
resistente e menos flexvel.
04) Os tecidos conjuntivos apresentam grande quantidade de material intercelular, composto por
fibras e substncia fundamental amorfa. Os tecidos adiposo, cartilaginoso e sseo fazem parte
desse grupo.
08) A derme, camada inferior da pele, um tipo de tecido epitelial flexvel, de consistncia
delicada e pouco resistente a traes.
16) Na poro em que o tecido epitelial encontra-se com o tecido conjuntivo, as clulas
epiteliais secretam o colgeno.
UFSC (2007) 6) Em relao conduo do impulso nervoso e considerando os desenhos abaixo,
assinale a(s) proposio(es) CORRETA(S).

V
NK

K N

II

55

01.
As regies I, II e III do desenho representam, respectivamente, o axnio, o corpo
celular e o dendrito.
02.
A regio V do desenho o local onde ocorre a Sinapse.
04.
A regio VI do desenho indica que aquela parte da fibra est polarizada.
08.
A regio VII do desenho mostra que aquela parte da fibra est em potencial de ao.
16.
A propagao do impulso nervoso em um neurnio ocorre sempre no sentido III, II, I.
32.
A regio IV do desenho representa um ndulo de Ranvier. Tais ndulos so vistos
somente nos neurnios mielinizados e so responsveis pelo aumento da velocidade do impulso
nos mesmos. Como a inverso da polaridade na fibra ocorre somente nesses ndulos, o impulso
se propagar saltando de ndulo em ndulo e aumentando sua velocidade na fibra.
UFSC (2008) 7) Com relao ao Sistema Cardiovascular e com base no esquema abaixo, cujas
setas indicam o trajeto do sangue no corpo, assinale a(s) proposio(es) CORRETA(S).
Pulmes
B

Corao

Tecidos do
Corpo

01. As cavidades I e II representam os ventrculos e as cavidades III e IV representam os trios


(ou aurculas).
02. O sangue que leva o oxignio para as clulas musculares do corao (miocrdio) atravs das
artrias coronrias impulsionado pela cavidade IV.
04. Os vasos sangneos representados pelas setas B e C correspondem s veias e os vasos
sangneos representados pelas setas A e D correspondem s artrias.
08. O trajeto que o sangue faz da cavidade III at a cavidade II corresponde circulao
sistmica, tambm chamada grande circulao.
16. Nas cavidades I e III circula sangue arterial, ao passo que nas cavidades II e IV circula
sangue venoso.
32. Quando as cavidades III e IV esto em distole, as cavidades I e II esto em sstole, e viceversa.
64. Entre as cavidades I e II localiza-se a vlvula bicspide (ou mitral) e entre as cavidades III
e IV localiza-se a vlvula tricspide.
UFSC (2008) 8) Os tecidos conjuntivos derivam do mesoderma do embrio e caracterizam-se
por apresentar diversos tipos de clulas imersas em material extracelular sintetizado por elas.
Com relao aos tecidos conjuntivos, assinale a(s) proposio(es) CORRETA(S).
01. Dentre as vrias funes dos tecidos conjuntivos, podemos citar a absoro e a secreo de
substncias atravs de glndulas.
02. Entre os vrios tipos de clulas existentes nos tecidos conjuntivos encontramos os fibroblastos, adipcitos, melancitos e neurnios.
04. Em indivduos adultos, os elementos figurados do sangue se originam do tecido conjuntivo
encontrado na medula ssea vermelha, a qual apresenta clulas-tronco pluripotentes (ou
56

multipotentes) que aps se multiplicarem ativamente se diferenciam em leuccitos, hemcias e


plaquetas.
08. O tecido conjuntivo denso modelado, tambm chamado de tecido tendinoso, formado por
fibras grossas orientadas paralelamente, especialmente fibras colgenas, o que confere grande
resistncia a estruturas como tendes e ligamentos.
16. Os condrcitos, aps formarem a matriz cartilaginosa, sofrem uma pequena retrao de
volume e passam a ser chamados de condroblastos.
32. Os ossos de uma criana so mais flexveis que os ossos de um adulto pois apresentam
maior quantidade de osteoblastos, os quais produzem muitas fibras colgenas.
UFSC (2010) 9) A jovem me suspendeu o filho teta; mas a boca infantil no emudeceu. O
leite escasso no apojava o peito.
O sangue da infeliz dilua-se todo nas lgrimas incessantes que no estancavam dos olhos; pouco
chegava aos seios, onde se forma o primeiro licor da vida
Aps ler o excerto acima, analise e assinale a(s) proposio(es) CORRETA(S).
01. O leite materno, tratado na obra Iracema como licor da vida, considerado um alimento
completo para o recm-nascido, contendo gua, sais minerais e at anticorpos fundamentais para
sua sade.
02. As glndulas sudorparas, que produzem o suor, so um exemplo de glndula endcrina.
04. Quando o autor diz que o sangue dilua-se todo nas lgrimas e no chegava aos seios, est
afirmando que o funcionamento da glndula mamria no tem relao com a circulao
sangunea.
08. A oxitocina o hormnio que, alm de estimular os movimentos de contrao uterina no
parto, estimula a contrao da musculatura lisa das glndulas mamrias na expulso do leite
materno.
16. A produo do leite materno no tem relao direta com o ato de suco do seio materno
pelo recm-nascido.
32. As lgrimas e o leite produzidos pela me so exemplos de secrees produzidas pelas
glndulas excrinas.
UFMS (2007) 10) As proposies mostradas a seguir fazem referncia ao sistema respiratrio
humano. Assinale a(s) alternativa(s) correta(s).
(001) Alteraes na posio do diafragma e das costelas provocam aumento ou diminuio no
volume da caixa torcica, determinando a entrada ou a sada de ar dos pulmes. Durante a
inspirao, o diafragma eleva-se, as costelas abaixam-se, os msculos intercostais relaxam e o
volume da caixa torcica aumenta, forando o ar a entrar nos pulmes.
(002) Nos alvolos pulmonares, ocorre a hematose, isto , o gs oxignio do ar difunde-se para
os capilares sangneos que envolvem a parede externa dos alvolos e penetram nas hemcias,
onde se combinam com a hemoglobina. Nos tecidos, ocorre um processo inverso, o gs oxignio
se dissocia da hemoglobina e, por difuso, passa para o interior das clulas.
(004) A traquia, um rgo do sistema respiratrio humano, um tubo sustentado por peas
cartilaginosas articuladas e situado na parte superior do pescoo. A entrada da traquia chama-se
glote. Quando h passagem de alimento, a traquia sobe e sua entrada fechada pela epiglote
impedindo que o alimento engolido penetre nas vias respiratrias.
(008) A respirao controlada automaticamente por um centro nervoso localizado na medula
espinhal. Quando o sangue torna-se mais cido devido ao aumento da concentrao do gs
carbnico, o centro respiratrio medular induz a acelerao dos movimentos respiratrios. Com
a diminuio no teor de gs oxignio no sangue, o ritmo respiratrio tambm aumentado.

57

(016) O sistema respiratrio humano constitudo por um par de pulmes e por vrios rgos
que conduzem o ar para dentro e para fora das cavidades pulmonares. Caso ocorra uma
obstruo nos brnquios, o ar com oxignio ser impedido de chegar at a laringe.
(032) Dentro das hemcias, o gs carbnico reage com a gua formando o cido carbnico
(H2CO3), que se dissocia e d origem a ons hidrognio (H+) e ons bicarbonato (HCO3). Os
ons H+ associam-se hemoglobina, enquanto os ons bicarbonatos disseminam-se pelo plasma
sangneo. Outra parte do gs carbnico associa-se prpria hemoglobina e a outras protenas
do sangue e uma pequena parte dissolve-se no plasma sangneo.
UFMS (2007) 11) A tabela abaixo apresenta os valores padres dos elementos figurados do
sangue humano de um indivduo adulto sadio do sexo feminino. Com base nos dados
apresentados nessa tabela e nos conhecimentos em fisiologia humana, assinale a(s) afirmativa(s)
correta(s).

(001) Os eritrcitos, tambm chamados glbulos vermelhos ou hemcias, so clulas


especializadas no transporte de gs oxignio. Indivduos adultos do sexo feminino que
apresentarem valores de eritrcitos prximos ou inferiores a 4 milhes mm3 podero apresentar
quadro de anemia.
(002) Os leuccitos so os elementos figurados do sangue mais numerosos em comparao com
os demais elementos. A produo de leuccitos ocorre no interior dos ossos, a partir de clulas
da medula ssea vermelha.
(004) Em todos os vertebrados, as hemcias so anucleadas e contm milhes de molculas de
hemoglobina que so responsveis pelo transporte de gs oxignio. Em determinadas
circunstncias, em que disponibilidade de gs oxignio baixa, o nmero de hemcia se reduz
no organismo.
(008) Leuccitos so capazes de englobar e digerir clulas diversas ou partculas estranhas ao
organismo. Em portadores de infeco, a taxa de leuccitos modifica-se consideravelmente
chegando a 20.000 cls/mm3. Como uma atitude de defesa, diante da entrada de agentes
patognicos, o organismo aumenta a produo de leuccitos.
(016) A diapedese o fenmeno caracterizado pelo baixo teor de hemcias no sangue. Essa
situao responsvel pelo aumento da suscetibilidade do organismo s doenas em geral.
(032) O sangue humano constitudo por um lquido amarelado, o plasma, e por trs tipos de
clulas: hemcias (clulas vermelhas), leuccitos (clulas brancas) e plaquetas (trombcitos). O
plasma sangneo contm protenas, sais e substncias, tais como nutrientes, hormnios,
resduos e gases respiratrios.
UFMS (2008) 12) Em relao ao tecido muscular, correto afirmar:
(001) Os discos intercalares so complexos juncionais encontrados no tecido muscular estriado
cardaco.
(002) O estmago, o intestino e os vasos sangneos so exemplos de rgos que apresentam
tecido muscular do tipo liso.
(004) As clulas que formam o msculo estriado esqueltico so mononucleadas, ou seja,
possuem apenas um ncleo por clula.

58

(008) O msculo liso apresenta movimentos voluntrios e rpidos.


(016) O perimsio e o epimsio, de origem epitelial, envolvem as fibras musculares estriadas e os
feixes musculares, respectivamente.
(032) O msculo liso apresenta capacidade regenerativa, por meio de mitoses de suas fibras
musculares.
UFMS (2009) 13) Com relao ao tecido epitelial, correto afirmar:
(001) O tecido epitelial caracterizado por conter grande quantidade de matriz extracelular
(material intercelular), com pouca justaposio entre as clulas.
(002) O estmago revestido internamente por tecido epitelial classificado como simples
prismtico.
(004) A nutrio do tecido epitelial realizada por sua rica vascularizao sangunea.
(008) As glndulas sebceas, salivares e sudorparas, as quais apresentam origem epitelial, so
exemplos de glndulas excrinas.
(016) A derme constituda por tecido epitelial e forma uma das camadas da pele.
(032) O epitlio de revestimento interno dos vasos sanguneos denominado endotlio.
UEM (2008_2) 14) Sobre tecidos, rgos e sistemas que constituem o corpo humano, assinale o
que for correto.
01) A epiderme um epitlio estratificado pavimentoso que reveste externamente o corpo e
constitui uma das formas de defesa.
02) Uma das funes do sistema esqueltico, constitudo de tecido conjuntivo sseo, a
produo de clulas sanguneas.
04) O tecido muscular liso presente nas paredes de rgos ocos, como o intestino, contrai-se de
forma involuntria.
08) Os estmulos do ambiente, captados pelos rgos sensoriais, so transformados em impulsos
nervosos pelos neurnios aferentes.
16) O sistema imunolgico realiza a defesa do organismo contra agentes invasores; os
responsveis por essa funo so os linfcitos.
UEM (2008_2) 15) Assinale o que for correto.
01) No corao humano, o sangue chega por grandes vasos e penetra nos trios cardacos ou
aurculas.
02) Os aminocidos essenciais aos seres humanos devem ser obtidos a partir da ingesto de
alimentos ricos em lipdios.
04) mero, metacarpos, fmur e mandbula so ossos, respectivamente, do brao, da mo, da
coxa e da cabea.
08) O problema de viso denominado miopia decorrente da focalizao da imagem antes da
retina.
16) O sistema nervoso autnomo constitudo por neurofibrilas motoras que conduzem
impulsos do sistema nervoso central aos msculos no-estriados das vsceras e musculatura
estriada do corao.
UEM (2009_1) 16) Com relao nutrio e s necessidades energticas da espcie humana,
assinale o que for correto.
01) Os sais minerais, como os cloretos e os fosfatos, por serem inorgnicos, no so
considerados nutrientes.
02) Alimentos de origem vegetal, como a soja e o feijo, so desprovidos de nutrientes plsticos,
ou seja, de protenas.

59

04) Vitaminas so substncias orgnicas necessrias em quantidades relativamente pequenas,


mas que exercem grandes efeitos no organismo.
08) Glicdios e lipdios so nutrientes orgnicos cuja funo principal fornecer energia s
clulas.
16) Uma dieta balanceada aquela que fornece a quantidade de energia necessria, dispensando
as gorduras e os carboidratos.
UEM (2009_1) 17) Assinale o que for correto sobre rgos e sistemas do organismo humano.
01) Duodeno, jejuno e leo so divises do intestino delgado.
02) A faringe um conduto comum tanto ao sistema digestrio quanto ao sistema respiratrio.
04) A circulao do sangue fechada e nela o sangue passa duas vezes pelo corao em um
circuito completo pelo corpo.
08) Insulina, tiroxina e adrenalina so hormnios produzidos pelo pncreas, pela glndula
tireoidea e pelas suprarrenais, respectivamente.
16) O produto predominante da excreo nitrogenada o cido rico.
UEM (2010_1) 18) Acerca da propagao do impulso nervoso, assinale o que for correto.
01) A despolarizao de uma rea da membrana causa alterao de permeabilidade da rea
vizinha sua frente.
02) O impulso nervoso nada mais do que a propagao do potencial de ao ao longo do
neurnio.
04) O impulso nervoso bidirecional em uma neurofibra.
08) Nos dendritos, o impulso nervoso se propaga das extremidades dendrticas para o corpo
celular, sendo chamado de celulpeto. No axnio, o impulso nervoso se propaga de sua juno
com o corpo celular para a extremidade axnica, sendo chamado de celulfugo.
16) Os estmulos so captados pelos dendritos ou pelo prprio corpo celular. Algumas vezes, at
mesmo pelo axnio.
UEM (2010_1) 19) Considerando que os tecidos musculares originam-se do mesoderma do
embrio e esto relacionados aos movimentos dos membros e das vsceras, assinale o que
for correto acerca desses tecidos.
01) As clulas musculares so alongadas e recebem o nome de fibras musculares ou micitos.
02) As fibras musculares tm caractersticas to peculiares que seus elementos estruturais
recebem nomes especiais: a membrana plasmtica chamada de sarcolema; o citoplasma, de
sarcoplasma, e o retculo endoplasmtico liso, de retculo sarcoplasmtico.
04) As fibras musculares estriadas esquelticas podem ser lentas ou brancas, rpidas ou
vermelhas. As primeiras so ricas em mioglobina e pobres em mitocndrias.
08) As clulas musculares cardacas so incapazes de autoestimulao, dependendo de um
estmulo nervoso para iniciar a contrao.
16) As clulas musculares lisas possuem ncleo nico e central, so pobres em mitocndrias e
glicognio, no possuem sistema T, e o retculo sarcoplasmtico reduzido.
UEM (2010_2) 20) No que se refere estrutura da fibra muscular estriada esqueltica, assinale o
que for correto.
01) As fibras musculares estriadas esquelticas se formam durante o desenvolvimento
embrionrio a partir de clulas precursoras denominadas mioblastos.
02) Uma fibra muscular estriada esqueltica apresenta um padro bem definido de faixas (ou
estrias) transversais claras e escuras alternadas, decorrente do arranjo peculiar das protenas
actina e miosina nas miofibrilas.
04) Cada fibra muscular estriada esqueltica revestida por um envoltrio, o sinccio.

60

08) Os msculos de cor avermelhada tm essa colorao devido presena da fibroxantina, uma
protena sintetizada pelo perimsio.
16) Os vasos sanguneos nutrem e oxigenam as fibras e removem dos espaos entre elas o gs
carbnico e as excrees geradas no metabolismo celular.
UEM (2011_1) 21) Sobre o sistema digestrio, assinale o que for correto.
01) As vilosidades intestinais, ricamente supridas por capilares sanguneos e linfticos, tm
como principal funo aumentar a superfcie de contato, favorecendo a absoro dos nutrientes.
02) Em ruminantes, a obteno de glicose dos alimentos favorecida por bactrias e
protozorios simbiontes que vivem em seus estmagos produzindo enzimas para a digesto de
celulose.
04) O pncreas uma glndula que, alm de secretar enzimas digestivas, secreta tambm os
hormnios insulina e glucagon.
08) Aps uma cirurgia de emergncia, uma pessoa teve sua vescula biliar retirada. Dessa forma,
espera-se que essa pessoa deixe de produzir a bile.
16) No intestino delgado do homem, as clulas das paredes internas secretam vrios tipos de
fluidos, entre os quais, a pepsina e o cido clordrico.
UEM (2011_2) 22) Logo aps a morte da cantora britnica Amy Winehouse, em 23 de julho
passado, teorias sobre as causas do bito comearam a aparecer. Alm da tese bvia de uma
overdose de drogas, havia a possibilidade, levantada pela famlia, de a cantora ter morrido por
abstinncia de lcool. Sobre o alcoolismo, correto afirmar que
01) durante a abstinncia do lcool a presso sangunea pode aumentar, a pessoa pode ter
taquicardia, tremores, ficar ansiosa, suar frio.
02) o grau mximo da abstinncia do lcool chamado de Delirium tremens, caracterizado por
crises convulsivas.
04) o sistema nervoso parassimptico o responsvel pela taquicardia, pela ansiedade e pelo
aumento da presso sangunea.
08) o lcool altera a atividade de neurotransmissores, estimulando o indivduo a procurar doses
cada vez maiores para atingir o efeito prazeroso.
16) a ingesto de lcool altera as atividades autnomas controladas pelo sistema nervoso
perifrico somtico.
UEM (2011_2) 23) Sobre os tecidos epiteliais, correto afirmar que
01) o tecido epitelial glandular formado por agrupamento de clulas especializadas na
produo de secreo.
02) o tecido epitelial de revestimento classificado de acordo com o nmero de camadas e com
a morfologia de suas clulas.
04) os tecidos epiteliais so vascularizados na epiderme e no intestino.
08) o tecido epitelial se origina, embriologicamente, da ectoderme.
16) no intestino encontrado o tecido epitelial do tipo pseudo estratificado ciliado.
UEM (2008_1) 24) Com relao ao funcionamento do neurnio, assinale o que for correto.
01) O impulso nervoso que percorre o neurnio de natureza eltrica.
02) Ao receber um estmulo com intensidade adequada, o neurnio despolariza-se, igualando
a quantidade de ons no interior e no exterior da membrana plasmtica.
04) Quando o neurnio est em repouso, a diferena de potencial eltrico entre o interior e o
exterior da membrana plasmtica zero.
08) A membrana plasmtica de um neurnio em repouso polarizada, portanto o campo eltrico
diferente de zero.

61

16) A diferena de potencial entre a parte externa e a interna da membrana plasmtica deve-se
passagem de eltrons livres.
UEM (2009_1) 25) Com relao natureza do impulso nervoso que percorre as clulas do
tecido nervoso, assinale o que for correto.
01) Nas sinapses, h transporte de carga eltrica e formao de corrente eltrica ao longo do
neurnio.
02) As sinapses eltricas permitem a contrao sincrnica, de frequncia relativamente bem
definida, como no caso do batimento cardaco.
04) O impulso nervoso pode ser visto como a propagao do potencial de ao ao longo do
neurnio.
08) A diferena de potencial entre o potencial de repouso do neurnio, que -70 mV, e o
potencial de despolarizao, que + 40 mV, 0,11 V.
16) Em um neurnio em repouso, o interior do axnio eletricamente negativo, fazendo que o
campo eltrico esteja direcionado para a superfcie externa do axnio.
GABARITO:
1-GAB: 01+02+16+32=51
2-GAB: 01+02+04+08+16=31
3-GAB: 02+04+16=22
4-GAB: 01+08=09
5-GAB: 01+04+16=21
6-GAB: 02+32=34
7-GAB: 02+04+32=38
8-GAB: 04+08+32=44
9-GAB: 01+08+32=41
10-GAB: 02+32=34
11-GAB: 01+08+32=41
12-GAB: 01+02+32=35
13-GAB: 02+08+32=42
14-GAB: 01+02+04+08+16=31
15-GAB: 01+04+08+16=29
16-GAB: 04+08=12
17-GAB: 01+02+04+08=15
18-GAB: 01+02+08+16=27
19-GAB: 01+02+16=19
20-GAB: 01+02+16=19
21-GAB: 01+02+04=07
22-GAB: 01+02+08=11
23-GAB: 01+02=03
24-GAB: 01+08=09
25-GAB: 02+04+08=14

62

REPRODUO HUMANA
UNIOESTE (2005) 1) Assinale a(s) alternativa(s) correta(s) com relao reproduo humana.
(01) A espermiognese desencadeada pela ao do hormnio luteinizante sobre os
espermatcitos primrios.
(02) O ciclo menstrual pode ser dividido em trs fases: menstrual, proliferativa e
secretria.
(04) As clulas de Sertoli so responsveis pela produo de testosterona.
(08) O crescimento do folculo provocado por estrognios.
(16) As clulas de Leydig so responsveis pela nutrio dos espermatozides.
(32) A progesterona, secretada pelo corpo lteo, estimula o desenvolvimento dos vasos
sanguneos e das glndulas do endomtrio.
(64) A ovulao consiste na liberao de um ocito secundrio.
UEPG (2006_1) 2) A respeito dos gmeos bivitelinos, assinale o que for correto.
01) Podem ser chamados tambm de gmeos fraternos e no obrigatoriamente so do mesmo
sexo.
02) So, obrigatoriamente, um casal de crianas.
04) Em alguns casos raros podem nascer unidos por alguma parte do corpo, compartilhando ou
no rgos vitais, sendo chamados gmeos xifpagos ou siameses.
08) So provenientes de um vulo fecundado por dois espermatozides.
16) So provenientes de dois vulos fecundados por dois espermatozides.
UEPG (2009_1) 3) A respeito da gametognese, processo de formao dos gametas, assinale o
que for correto.
01) Nos animais, o gameta masculino recebe o nome de espermatozide. Trata-se, na maior
parte das vezes, de uma clula flagelada que possui grande mobilidade em meios lquidos. Pode
tambm assumir a forma amebide.
02) Os espermatozides originam-se de clulas diplides especiais denominadas clulas
germinativas, que se localizam em rgos denominados gnadas. As gnadas masculinas
recebem o nome de testculos.
04) A partir da quinta semana de vida, um embrio j tem clulas germinativas primitivas em
suas gnadas. Aos sete anos de idade, aproximadamente, as clulas germinativas realizam
inmeras mitoses, dando origem a clulas chamadas espermatognias, que so diplides.
08) Na adolescncia, algumas espermatognias evoluem para um outro tipo de clula, o
espermatfito primrio. Estes sofrem a meiose I, transformando-se em espermatcitos
secundrios, os quais ento sofrem meiose II, originando as espermtides, que so haplides.
16) Por meio de um processo denominado espermiognese, as espermtides passam por
profundas transformaes, evoluindo finalmente para espermatozides.
UEPG (2009_1) 4) A fecundao ocorre no momento em que o material gentico masculino
funde-se com o material gentico feminino, originando uma nova vida. Sobre este assunto,
assinale o que for correto.
01) A cada 28 dias, aproximadamente, a mulher elimina um vulo produzido em um de seus
dois ovrios. Ao ser expulso do ovrio, o vulo interrompe a diviso meitica na metfase II e
captado pelas fmbrias existentes na extremidade das tubas uterinas, que o transportam em
direo ao tero.
02) Uma vez transposta por um ou mais espermatozides, a zona pelcida sofre alteraes
fsico-qumicas que neste ponto a tornam impermevel a qualquer outro gameta masculino. Est
iniciada a fecundao.

63

04) A primeira barreira a ser transposta pelos espermatozides so as clulas que compem a
corona radiata. Esta atravessada graas ao de enzimas presentes no acrossomo, tambm
necessrias para que o espermatozide atravesse a zona pelcida.
08) Os espermatozides eliminados no canal vaginal nadam ativamente para o interior uterino e,
ao atingi-lo, seguem em direo s tubas at encontrar o futuro gameta feminino. Os que
sobrevivem ao trajeto iniciam ento uma tentativa de fecund-lo.
16) Uma vez formado, o zigoto sofre uma primeira diviso mittica, em cuja metfase os
cromossomos paternos e maternos emparelham-se, regenerando o nmero cromossmico
caracterstico da espcie.

GABARITO:
1-GAB: 02+32+64=98
2-GAB: 01+16=17
3-GAB: 01+02+04+08+16=31
4-GAB: 04+08+16=28

64

EMBRIOLOGIA E ANEXOS EMBRIONRIOS


UEPG (2008_1) 1) Durante o seu desenvolvimento, os embries dos vertebrados apresentam
algumas membranas anexas, originadas dos folhetos embrionrios, que desempenham
importantes funes, como proteo, nutrio, excreo e respirao. A respeito dessas estruturas, chamadas de anexos embrionrios, assinale o que for correto.
01) Nos mamferos, a placenta o anexo responsvel pela fixao do embrio no tero e por
todas as trocas metablicas entre a me e o embrio. A placenta uma regio especial do crio,
com aspecto de uma grande esponja, dotada de muitas vilosida-des, ricas em capilares, que
garantem uma grande superfcie de trocas de gua, gases respiratrios, hormnios, enzimas e
muitas outras substncias que circulam no sangue materno e no do embrio.
02) O mnio uma membrana que envolve completamente o corpo do embrio, delimitando
uma cmara cheia de um lquido a-quoso. Ele protege o embrio contra choques mecnicos,
alm de lhe proporcionar um meio interno mais ou menos constante em condies fsicoqumicas.
04) O alantide uma espcie de vescula ligada ao intestino do embrio. Nas aves, alm de
servir de depsito dos excretas pro-duzidos pelo embrio, o alantide possui uma rede de vasos
sanguneos que permite a troca de gases respiratrios atravs da casca porosa do ovo.
08) O saco vitelnico o nico anexo embrionrio de rpteis, peixes e anfbios. Ele envolve todo
o vitelo, material nutritivo dos o-vos, e, atravs de seus vasos sanguneos, absorve os nutrientes
que sero consumidos pelo embrio em desenvolvimento.
UEPG (2009_1) 2) A respeito dos anexos embrionrios, que so responsveis pela manuteno
da vida do novo ser at o seu nascimento, assinale o que for correto.
01) Nos seres que apresentam desenvolvimento externo, a vescula vitelnica nutre o embrio
durante toda a formao. Nos mamferos, ela atrofiada, mas ainda assim produz os primeiros
glbulos vermelhos do novo ser.
02) A placenta uma estrutura achatada que apresenta uma face repleta de vasos sanguneos,
voltada para o embrio. A outra face, voltada para o tero e nele implantada, estabelece contato
entre os vasos sanguneos da me e os do embrio, promovendo mistura de sangue e trocas
gasosas, alm da troca da nutrio pela excreo do embrio e do futuro feto.
04) O alantide um anexo cuja funo proteger o embrio contra a ao de microrganismos,
choques mecnicos e resseca-mento.
08) O crion, que se desenvolve prximo ao cordo umbilical, promove trocas gasosas e
transporte de clcio e elimina excretas.
16) A decdua, que se localiza externamente ao crion liso, tem origem a partir do revestimento
uterino que envolve o ovo na nidao. Juntamente com o crion e o mnio, ela exerce funo
protetora.
UFMS (2008) 3) Em relao aos folhetos embrionrios, tambm denominados folhetos
germinativos, que durante o desenvolvimento do organismo daro origem a diferentes tecidos,
assinale a(s) proposio(es) correta(s).
(001) Animais diploblsticos apresentam apenas o ectoderma e o endoderma.
(002) Os msculos apresentam origem endodrmica.
(004) Os ossos e o sistema urogenital apresentam origem mesodrmica.
(008) A fase de segmentao (clivagem) do embrio caracterizada pela formao de uma
cavidade denominada blastocele e pelo incio da formao do endoderma e do ectoderma.
(016) O sistema nervoso apresenta origem ectodrmica.
(032) Animais triploblsticos apresentam somente o mesoderma e o ectoderma.

65

UFMS (2010) 4) Considere os seguintes organismos: anfioxo (animal A); galinha (animal B);
jacar (animal C); aranha (animal D); sapo (animal E) e co (animal F). Em funo da
quantidade e da distribuio do vitelo nos vulos, correto afirmar:
(001) O animal C apresenta vulo do tipo alcito.
(002) O animal B apresenta vulo do tipo telolcito.
(004) O animal A apresenta vulo do tipo heterolcito.
(008) O animal D apresenta vulo do tipo centrolcito.
(016) O animal E apresenta vulo do tipo heterolcito.
(032) O animal F apresenta vulo do tipo telolcito.
UEM (2008_1) 5) Sobre o desenvolvimento embrionrio da espcie humana, assinale o que for
correto.
01) A organognese corresponde ao perodo que vai da fecundao at a oitava semana de
gestao, ocorrendo a formao dos rgos.
02) Embrio o termo utilizado para o ser em formao no perodo da organognese; aps
esse perodo, passa a chamar-se feto.
04) No cordo umbilical, h vasos que levam o sangue venoso da me para o feto e h vasos
que levam o sangue arterial do feto para a me.
08) Pela placenta, a me fornece alimento e oxignio para o feto, o qual passa gs carbnico
e excretas nitrogenadas para a circulao materna.
16) Os gmeos, independentemente de serem dizigticos ou monozigticos, desenvolvem-se
em uma nica placenta.
UEM (2009_2) 6) Com relao origem e evoluo dos animais, assinale o que for correto.
01) Umas das hipteses filogenticas que os animais tenham derivado de um grupo ancestral
formado por protistas flagelados hetertrofos.
02) Nos animais chamados eumetazorios, ocorre a gastrulao. Nesses animais, desde o
surgimento da gastrulao, o ectoderma e o endoderma esto presentes.
04) Um dos caracteres evolutivos dos animais o celoma, comum aos moluscos, aneldeos,
artrpodes e deuterostmios. O celoma uma cavidade delimitada pelo mesoderma.
08) A notocorda uma caracterstica evolutiva dos cordados e que persiste em todos os grupos
desde a fase embrionria at a fase adulta.
16) A independncia da gua foi um marco na evoluo dos animais e foi conquista das aves,
que foram os primeiros a apresentar o ovo amnitico.
GABARITO:
1-GAB: 01+02+04=07
2-GAB: 01+16=17
3-GAB: 01+04+16=21
4-GAB: 02+08+16=26
5-GAB: 02+08=10
6-GAB: 01+02+04=07

66

ALGAS
UEM (2008_1) 1) O nitrognio molecular (N2) o elemento qumico mais abundante na
atmosfera e, no entanto, a maioria dos seres vivos no consegue utiliz-lo nessa forma. Sobre o
ciclo do nitrognio no ambiente, assinale o que for correto.
01) Bactrias de vida livre so capazes de fixar o N2 atmosfrico na forma de amnia.
02) Bactrias associadas s razes de plantas leguminosas realizam a fixao do N2 em
nitratos e nitritos.
04) A maioria dos vegetais absorve o nitrognio do solo na forma de amnia.
08) No solo, a formao de nitrato realizada pelas bactrias quimiossintetizantes.
16) Bactrias nitrificantes degradam compostos nitrogenados, liberando N2 para a atmosfera.
GAB: 02+04+08=14

67

BOTNICA
UNIOESTE (2006) 1) O esquema abaixo representa a evoluo dos vegetais.

Baseado no esquema acima, correto afirmar que


(01) 1, 2, 3, 4 e 5 so, respectivamente, clorofceas, brifitas, pteridfitas, gimnospermas e
angiospermas.
(02) a pode representar a presena de clorofilas a e b.
(04) b pode representar o surgimento do tecido vascular.
(08) c pode representar o surgimento do arquegnio e do anterdio.
(16) d pode representar o surgimento da raiz.
(32) e pode representar o surgimento da semente.
(64) 1, 2 e 3 so criptgamas; 4 e 5 so fanergamas.
UNIOESTE (2005) 2) Referente aos tecidos vegetais, considere as colunas I e II e assinale a(s)
alternativa(s) em que todas as associaes esto corretas.

(01) a2, b3, c4, d1


(02) a3, b2, c1, d5
(04) a3, b4, c5, d6
(08) a3, b2, c6, d5
(16) a2, b3, c5, d6
(32) a2, b3, c1, d6
(64) a5, b6, c3, d5.
UEPG (2006_1) 3) Assinale as alternativas que contenham a relao correta entre o tecido
vegetal e suas caractersticas.
01) Meristema primrio: localizado nos pices de caules e razes e no interior de feixes lberolenhosos.
02) Parnquima: preenchimento de espaos internos, com funes de reserva de substncias e
fotossntese.
04) Lenho: clulas alongadas e mortas, com paredes espessas, impregnadas de lignina e com
reforos adicionais.

68

08) Colnquima: clulas alongadas e mortas, com paredes reforadas de lignina.


16) Lber: clulas alongadas que se dispem em cordes desde as folhas at as razes. Os
elementos de tubos crivados apresentam citoplasma e grande vacolo central, mas no possuem
ncleo.
UEPG (2007_1) 4) Durante o movimento fotoativo de abertura dos estmatos, observa-se nas
clulas-guarda:
01) Aumento da taxa de fotossntese.
02) Diminuio do turgor celular.
04) Variao do pH.
08) Transformao de amido em glicose.
16) Aumento do consumo de gs carbnico pelos cloroplastos.
UEPG (2007_1) 5) Observe as afirmaes com relao ao pinheiro-do-paran e assinale o que
for correto.
01) Pertencem ao grupo das gimnospermas, plantas que produzem sementes nuas.
02) O fruto, conhecido como pinho, comestvel
04) A raiz do tipo fasciculada.
08) As flores encontram-se reunidas em inflorescncias compactas.
16) O caule um tronco.
UEPG (2008_1) 6) O estudo da morfologia vegetal, mediante a descrio da anatomia interna e
microscpica das estruturas vegetais, procura mostrar a distribuio dos diferentes tecidos na
estrutura dos rgos. Isso favorece o entendimento de que as caractersticas de adaptao e as
funes dos diferentes rgos esto diretamente relacionadas organizao de seus tecidos.
Com relao morfologia do caule, assinale o que for correto.
01) Nas gimnospermas, o aspecto do caule muito uniforme, destacando-se, no cilindro
vascular, as traquedes, que formam os anis anuais. Eles permitem o clculo dos anos de vida
da planta. Durante a poca em que a gua abundante, as traquedes formadas so grandes e
constituem um largo anel escuro (lenho estival). Nas estaes mais secas, as traquedes formam
um anel mais claro e estreito (lenho primaveril). Cada ano de vida da planta representado pela
soma de um anel claro e um escuro.
02) Na regio do crtex entra em atividade um meristema secundrio, o felognio, que permite
casca acompanhar o crescimento do cilindro central. Em direo periferia, o felognio produz
clulas suberificadas, que se destacam em placas, o ritidoma, quando o caule se encontra em
ativo crescimento. Isso bem visvel em jabuticabeiras, eucaliptos, goiabeiras e muitas outras
plantas.
04) Logo abaixo do pice de uma gema, aps a zona de alongamento, pode-se observar, em
cortes transversais, a organizao dos tecidos condutores no caule, o qual se apresenta diferente
nas monocotiledneas e nas dicotiledneas. Nas monocotiledneas, os caules so geralmente
finos, sem muito crescimento em espessura, e seus feixes vasculares ficam dispostos
irregularmente num parnquima de preenchimento, de aspecto bem homogneo. Nas
dicotiledneas h um cilindro vascular que forma quase toda a espessura do caule, e seus feixes
vasculares esto dispostos em anel.
08) Um caule pode ser identificado pela presena de gemas, que do origem a ramificaes,
botes florais e at razes. A gema um meristema protegido por primrdios de folhas em forma
de pequenas e delicadas escamas.

69

UEPG (2009_1) 7) Sobre histologia vegetal, assinale o que for correto.


01) Nos vegetais, o revestimento feito por uma epiderme, que pode conter uma ou vrias
camadas de clulas fortemente unidas. Essas clulas, que so de forma hexagonal, ondulada ou
retangular, possuem um grande vacolo central, que limita o citoplasma a uma delgada regio
perifrica prxima parede celular. A parede celular funciona como um revestimento extra,
alm de proporcionar a sustentao da clula vegetal.
02) A epiderme revestida externamente por um lipdio chamado cutina, que a torna
impermevel.
04) So comuns nas clulas vegetais os plos uni ou pluricelulares, com funo de defesa,
secreo e controle da respirao; nas folhas das plantas carnvoras, esses plos promovem a
sntese de enzimas proteolticas.
08) Em muitos vegetais o revestimento mais externo da epiderme constitudo por vrias
camadas de clulas mortas, dotadas de uma parede bastante espessa formada por uma cera
chamada suberina. Essas clulas do origem a um tecido de sustentao vegetal chamado sber.
16) O sber pode apresentar lenticelas, pequenos relevos com uma passagem na regio central,
por onde ocorrem as trocas gasosas entre o vegetal e o meio externo.
UEPG (2009_1) 8) Com base no sistema atual de classificao vegetal, assinale o que for
correto.
01) Entre as criptgamas figuram algas de gua doce, unicelulares, que se apresentam nas cores
vermelho, pardo e azul, caractersticas que na classificao lhes renderam as denominaes
rodofceas, feofceas e clorofceas, respectivamente.
02) O reino Plantae composto por dois grandes grupos: as criptgamas e as fanergamas. Nas
criptgamas, as estruturas produtoras de gametas so pouco evidentes, e nas fanergamas, elas
so bem visveis.
04) O reino Plantae engloba todos os organismos auttrofos que possuem clorofila A e que
armazenam amido.
08) As brifitas, que figuram entre as criptgamas, so vegetais de pequeno porte dotados de
folhas verdes e desprovidos de razes e tecidos condutores. J as pteridfitas, que pertencem ao
mesmo grupo das criptgamas, so plantas vasculares, sem flores e sem sementes.
16) O grupo das plantas fanergamas inclui as gimnospermas, que no produzem frutos, e as
angiospermas, que produzem frutos.
UFSC (2007) 9) As plantas so seres vivos pluricelulares e organizados que apresentam
diferentes tecidos.
Com relao aos tecidos vegetais, assinale a(s) proposio(es) CORRETA(S).
01.
Em plantas vasculares, o tecido condutor especializado na conduo da seiva bruta o
floema e, na conduo da seiva elaborada, o xilema.
02.
Os tecidos meristemticos so formados por clulas diferenciadas que, por
desdiferenciao destas clulas, originam todos os demais tecidos da planta.
04.
O colnquima e o esclernquima constituem os tecidos de sustentao do vegetal.
08.
Os tecidos parenquimticos executam numerosas tarefas, tais como o preenchimento
de espaos, a realizao da fotossntese e o armazenamento de substncias.
16.
As cactceas apresentam parnquima aerfero bem desenvolvido. J as plantas
aquticas, como, por exemplo, o aguap, apresentam o parnquima aqfero bem desenvolvido.

70

UFSC (2008) 10) Os principais grupos vegetais (Brifitas, Pteridfitas, Gimnospermas e


Angiospermas) apresentam em comum um ciclo de vida que ocorre atravs de alternncia de
geraes (metagnese), em que uma gerao haplide alterna-se com outra diplide.
Com relao a este ciclo e considerando o esquema abaixo, assinale a(s) proposio(es)
CORRETA(S).

01. O esquema representa um ciclo de vida haplodiplobionte (ou haplonte-diplonte) tpico dos
principais grupos de vegetais.
02. Os eventos que ocorrem em I e III do esquema correspondem, respectivamente, meiose e
mitose.
04. Neste ciclo, o esporfito forma o gametfito por reproduo assexuada e o gametfito
forma o esporfito por reproduo sexuada.
08. Nas gimnospermas e angiospermas, o esporfito originado pela fuso dos gametas
masculino e feminino que so, respectivamente, o androceu e o gineceu.
16. Os eventos II e IV do esquema correspondem, respectivamente, fecundao e
germinao.
32. Nas brifitas e pteridfitas, a fase gametoftica duradoura e evidente e a fase esporoftica,
ao contrrio, reduzida e pouco evidente.

71

UFSC (2010) 11) A figura abaixo representa, ao centro, o esquema de uma estrutura vegetal
chamada estmato.

A respeito da estrutura acima e de seu papel fisiolgico, assinale a(s) proposio(es)


CORRETA(S).
01. O funcionamento dos estmatos est associado aos mecanismos de transporte de seiva
no vegetal.
02. A seta II da figura indica a presena de cloroplastos nas clulas estomticas.
04. Os estmatos so estruturas encontradas em vrias partes do vegetal, especialmente no caule.
08. A seta III indica as clulas-acessrias ou subsidirias; atravs delas ocorre a eliminao da
gua por transpirao para o exterior do vegetal.
16. Os estmatos so estruturas muito versteis, participando inclusive dos mecanismos de
defesa vegetal, pois podem produzir e eliminar substncias txicas.
32. A seta I indica a abertura estomtica que ocorre entre as clulas-guarda e por onde se
realizam as trocas gasosas nos vegetais.
64. O funcionamento do estmato controlado por fatores intracelulares, sendo independente de
fatores externos como a luminosidade e a umidade.
UFMS (2007) 12) A tabela abaixo apresenta a influncia de fatores ambientais sobre os
mecanismos de abertura e fechamento dos estmatos.

Assinale a(s) afirmativa(s) que completa(m) e justifica(m) corretamente a(s) informao(es)


ausente(s) na tabela acima.
(001) A: Estmatos fecham e B: Estmatos abrem. A alta disponibilidade de gua acelera, na
planta, a produo de auxina que estimula o fechamento dos estmatos. Em situao inversa, ou
seja, em baixo suprimento hdrico, a baixa concentrao de auxina inibe a abertura dos
estmatos.
72

(002) III: Alta e IV: Baixa. Quando a taxa de fotossntese diminui, a concentrao de gs
carbnico tambm diminui nas clulas da folha, o que faz os estmatos se fecharem. Com a
retomada do processo de fotossntese, a concentrao de gs carbnico aumenta na planta e os
estmatos se abrem.
(004) A: Estmatos abrem e B: Estmatos fecham. Caso a planta esteja com gua suficiente em
suas clulas, as clulas-guardas estaro trgidas e os estmatos abertos. A baixa disponibilidade
de gua para a planta diminui o turgor das clulas-guardas e os estmatos se fecham.
(008) E: Estmatos fecham e F: Estmatos abrem. A luz ativa a produo de amido. Em alta
intensidade luminosa, a quantidade de amido presente no citoplasma das clulas-guardas
aumenta. O aumento de amido no citoplasma celular diminui a entrada de ons potssio na
clula, o que eleva a presso osmtica e, conseqentemente, o turgor da clula diminui e os
estmatos se fecham. Em baixa intensidade luminosa, esse processo inverso e os estmatos se
abrem.
(016) III: Baixa e IV: Alta. Em baixa concentrao de gs carbnico, ons potssio so
bombeados para o interior das clulas-guardas. Isso acarreta um aumento da turgidez das
clulas-guardas e, conseqentemente, os estmatos se abrem. Em altas concentraes de gs
carbnico, as clulas-guardas perdem potssio, seu turgor diminui e os estomtos se fecham.
(032) E: Estmatos fecham e F: Estmatos abrem. A maioria das plantas fecha seus estmatos
na presena de alta intensidade luminosa. Essa medida impede a transpirao e a perda de gua.
Em baixa intensidade luminosa, os estmatos se abrem para deixar entrar gs carbnico, o qual
ser utilizado na fotossntese.
UFMS (2007) 13) O crescimento e o desenvolvimento das plantas so controlados por
complexas interaes de fatores internos e externos. Os hormnios so exemplos de fatores
internos. Com relao aos hormnios vegetais e seus efeitos, assinale a(s) proposio(es)
correta(s).
(001) As giberelinas so hormnios produzidos principalmente nas razes e nos brotos das folhas
e estimulam o crescimento de caule e folhas. Atuando na presena de auxinas, as giberelinas
induzem o desenvolvimento de frutos sem sementes.
(002) O cido abscsico produzido nas folhas e nesse local que se concentra e estimula a
abertura das flores e a maturao dos frutos. Esse hormnio tambm retarda o envelhecimento
das plantas.
(004) Os hormnios vegetais so produzidos em pequenas quantidades em determinadas regies
da planta onde atuam, ou seja, no so transportados para outras partes da planta.
(008) O etileno um hormnio vegetal liberado por frutos em amadurecimento. Outro efeito
desse hormnio a regulao da absciso das folhas juntamente com as auxinas.
(016) As auxinas tm como principais efeitos o estmulo e o alongamento das clulas dos
meristemas primrios de razes e caules. O principal tipo de auxina encontrado nas plantas o
cido indolactico (AIA).
(032) A sensibilidade das clulas vegetais auxina varia nas diferentes partes da planta. As
razes so, geralmente, menos sensveis ao desse hormnio do que o caule. Isso significa que
a concentrao de auxina exigida pelas razes para a induo do crescimento maior do que a
exigida pelo caule.
UFMS (2008) 14) A bocaiva uma palmeira de ampla distribuio no Brasil e freqente no
Pantanal sul-mato-grossense, sendo utilizada na alimentao, na construo e tambm no
artesanato regional. Sobre as palmeiras, correto afirmar:
(001) So Angiospermas, monocotiledonares.
(002) So Angiospermas, dicotiledonares.
(004) Apresentam caule tipo estipe, feixes vasculares dispostos em anel e raiz pivotante.

73

(008) Apresentam caule tipo estipe, feixes vasculares difusos e raiz fasciculada.
(016) Apresentam caule tipo colmo, feixes vasculares difusos e raiz pivotante.
(032) Apresentam caule tipo colmo, feixes vasculares dispostos em anel e raiz fasciculada.
UFMS (2008) 15) Com relao ao processo de fotossntese, correto afirmar:
(001) Os principais pigmentos responsveis pela captao da energia luminosa so as clorofilas.
(002) A etapa bioqumica ocorre no cloroplasto, na membrana do tilacide.
(004) A etapa fotoqumica ocorre no cloroplasto, na membrana do tilacide.
(008) Os produtos da etapa fotoqumica so as molculas de ATP, NADPH e gliceraldedo.
(016) A Rubisco (ribulose bifosfato carboxilase) a enzima que catalisa a reao final do Ciclo
de Calvin.
(032) O oxignio liberado para a atmosfera provm da fotlise da gua.
UFMS (2009) 16) Alguns estudantes realizaram um experimento para testar o sistema
reprodutivo de determinada espcie vegetal, que possui flores hermafroditas. Com essa
finalidade, eles procederam da seguinte maneira: para cada tratamento foram utilizadas 500
flores. No tratamento I, as flores foram usadas como testemunhas, no recebendo nenhuma
interveno por parte dos estudantes; no tratamento II, as flores foram polinizadas manualmente
com plen proveniente da mesma flor (autopolinizao) e protegidas
posteriormente; no tratamento III, as flores foram inicialmente emasculadas (remoo das
anteras), polinizadas com o plen proveniente de flores diferentes da mesma espcie e,
posteriormente, protegidas; no tratamento IV, as flores foram emasculadas (remoo das
anteras) e, posteriormente, protegidas, evitando-se assim o processo de polinizao. Os
resultados obtidos podem ser visualizados no grfico abaixo:

Analisando-se o grfico, correto afirmar:


(001) A planta possui mecanismo que impede a autofecundao.
(002) A planta possui mecanismo que impede a polinizao cruzada.
(004) A planta no apresenta frutos partenocrpicos.
(008) O sucesso reprodutivo maior nas plantas com polinizao cruzada em relao
autopolinizao.
(016) As plantas s se reproduzem atravs da polinizao cruzada.
(032) As plantas reproduzem-se tanto atravs da polinizao cruzada como por autofecundao.

74

UFMS (2009) 17) Os vegetais apresentam diferentes tipos de adaptaes relacionadas ao


ambiente que ocupam. Com relao a essas adaptaes, assinale a(s) proposio(es) correta(s).
(001) Os pneumatforos protegem a planta contra ataque de microorganismos.
(002) As lenticelas favorecem as trocas gasosas.
(004) As gavinhas auxiliam no processo de fotossntese
(008) Os espinhos tem funo de proteo.
(016) Os haustrios servem para fixao na planta hospedeira.
(032) As razes escoras auxiliam na sustentao da planta.
UEM (2008_1) 18) Assinale o que for correto sobre a estrutura das plantas.
01) O crescimento secundrio das razes resultante da atividade do meristema apical e do
cmbio vascular.
02) O crtex, nos caules e nas razes, apresenta o parnquima palidico com clulas
clorofiladas.
04) Os tubos crivados que constituem o xilema transportam matria orgnica e gua das folhas
para as razes.
08) As traquedes que constituem o floema so destrudas durante o crescimento secundrio das
razes.
16) O interior das folhas constitudo por um tecido parenquimtico e por tecidos condutores.
UEM (2008_1) 19) Sobre as cinco categorias principais de hormnios que regulam o
desenvolvimento das plantas, assinale o que for correto.
01) Um dos principais efeitos das auxinas o alongamento das clulas formadas a partir dos
meristemas.
02) As giberelinas exercem papel na germinao das sementes e estimulam a diviso e o
alongamento celular.
04) As citocininas so abundantes nos rgos em que h proliferao celular, como as sementes
em germinao e os frutos em desenvolvimento.
08) O principal papel do cido abscsico induzir a queda das folhas.
16) O etileno um hormnio gasoso relacionado com o amadurecimento de frutos carnosos.
UEM (2008_1) 20) Assinale o que for correto sobre os ciclos de vida dos vegetais.
01) Ocorre meiose na formao dos micrsporos e dos megsporos nas gimnospermas e nas
angiospermas.
02) Ocorre a formao dos gros de plen nas gimnospermas e nas angiospermas.
04) Ocorre a formao da oosfera nas gimnospermas e nas angiospermas.
08) No ocorre formao de gametfitos em brifitas e pteridfitas.
16) No ocorre formao de esporos em brifitas e pteridfitas.
UEM (2008_2) 21) Identifique o que for correto sobre os processos fisiolgicos das clulas
vegetais.
01) Os elementos nitrognio, fsforo e potssio so requeridos pelos vegetais em quantidades
relativamente pequenas, sendo, por isso, chamados de micronutrientes.
02) A capilaridade a principal fora responsvel pela ascenso da seiva do floema.
04) Fitocromo um pigmento relacionado aos processos de germinao de sementes e de
florao.
08) Inibio do crescimento, induo dormncia de gemas e de sementes so efeitos das
giberelinas.
16) A fotossntese exemplo de processo anablico e a respirao, de processo catablico.

75

UEM (2008_2) 22) Considere uma samambaia, uma araucria como o pinheiro-do-Paran e uma
planta de feijo e assinale o que for correto.
01) A primeira pertence ao grupo das plantas avasculares.
02) As estruturas relacionadas com a reproduo sexuada na araucria so denominadas de
estrbilos.
04) No ciclo de vida da samambaia, a fase mais desenvolvida e predominante representada
pelo gametfito.
08) O feijo pertence ao grupo das angiospermas.
16) Nas plantas de feijo, a semente corresponde ao vulo fecundado e desenvolvido.
UEM (2008_2) 23) Com relao aos tecidos e aos rgos vegetais, correto afirmar que
01) a epiderme substituda pela periderme em rgos com crescimento secundrio.
02) gemas apicais e laterais so estruturas de razes associadas ao crescimento longitudinal.
04) xilema, parnquima aqfero e esclernquima so, respectivamente, tecido de conduo, de
reserva e de sustentao.
08) o androceu e o gineceu esto presentes em uma flor monclina.
16) tomate, morango e abacaxi so exemplos de pseudofrutos.
UEM (2009_1) 24) Identifique o que for correto sobre uma planta de feijo e outra de milho.
01) O tecido de revestimento das folhas de ambas as plantas a epiderme.
02) No milho, o caule areo do tipo estipe.
04) As atividades do meristema fundamental e do procmbio propiciam o crescimento
secundrio nas duas plantas.
08) O fruto das plantas de milho classificado como seco, indeiscente do tipo cariopse.
16) No feijo, o sistema radicular pivotante e a germinao, epgea.
UEM (2009_1) 25) Com relao fisiologia das plantas, assinale o que for correto.
01) A sensibilidade das clulas s auxinas diferente nos vrios rgos das plantas. Assim, os
caules so menos sensveis que as razes.
02) Em uma peroba com 30 m de altura, a gua absorvida chega at copa por capilaridade.
04) A transpirao estomtica um processo relacionado tanto fotossntese (entrada de CO2)
quanto ao resfriamento das plantas, mas nunca ao transporte de seiva pelo xilema.
08) Em intensidade luminosa acima do ponto de compensao ftico, a taxa de respirao
menor que a taxa de fotossntese.
16) Na fotossntese, a absoro da energia luminosa realizada por pigmentos localizados no
estroma do cloroplasto.
UEM (2009_1) 26) Identifique o que for correto sobre os diversos grupos de organismos.
01) Os organismos conhecidos como algas so exclusivamente aquticos e microscpicos.
02) O pinho, fruto da gimnosperma pinheiro-do-Paran, o estrbilo feminino desenvolvido
dessa planta.
04) Em uma angiosperma, como o milho, o zigoto (2n) e o endosperma (3n).
08) Liquens so associaes harmoniosas em que os fungos apresentam nutrio autotrfica.
16) Nas pteridfitas conhecidas como samambaias, as sementes so pequenas, formadas na face
inferior das folhas e dispersas pelo vento.

76

UEM (2009_2) 27) Identifique o que for correto sobre tecidos e rgos das plantas.
01) No caule de uma dicotilednea de porte arbreo, o floema secundrio ocupa posio mais
interna do que o xilema secundrio.
02) As folhas das plantas xerfitas, como medida de economia de gua, apresentam o tecido
denominado de sber com grande espessura.
04) Colnquima um tecido de sustentao com paredes constitudas de celulose e impregnadas
de lignina.
08) Clulas com paredes finas, citoplasma denso, ncleo volumoso e com grande capacidade de
diviso constituem os tecidos meristemticos.
16) Os elementos frteis das flores so os carpelos (formam os gros de plen) e os estames
(formam os vulos).
UEM (2009_2) 28) O crescimento e o desenvolvimento das plantas so regulados por um grupo
de compostos denominados de fitormnios. Identifique o que for correto sobre eles.
01) Num caule iluminado unilateralmente, o decrscimo na concentrao de auxina no lado noiluminado faz com que o caule se volte para a fonte de luz.
02) As auxinas, assim como as citocininas, promovem a partenocarpia nos mesmos frutos.
04) O etileno transportado, dos locais de sua sntese para os locais de sua ao, sempre
acompanhando o fluxo da seiva do xilema ou do floema.
08) O cido abscsico um fitormnio no orgnico, por isso controla, por inibio, os
processos de crescimento e de desenvolvimento.
16) Giberelinas so sintetizadas por plantas e por fungos.
UEM (2010_1) 29) Sobre os diversos aspectos da fisiologia dos vegetais, assinale o que for
correto.
01) O etileno, nico hormnio vegetal gasoso, atua no amadurecimento de frutos e na absciso
foliar.
02) O fitocromo est envolvido em processos fisiolgicos, como germinao de sementes e
florao.
04) Quando o solo est encharcado e a umidade relativa do ar elevada, a seiva do xilema
transportada das razes at as folhas, devido fundamentalmente transpirao.
08) Organismos clorofilados no realizam fotossntese e respirao simultaneamente. A
fotossntese ocorre durante o dia e a respirao noite.
16) Ao abrir os estmatos, permitindo a sada de gua na forma de vapor, as plantas passam a
perder maior quantidade de gs carbnico, diminuindo a fotossntese.
UEM (2010_1) 30) Assinale o que for correto sobre os diversos tecidos vegetais.
01) O colnquima formado por clulas vivas, cujas paredes so constitudas de celulose,
pectina e lignina.
02) O conjunto formado por sber-felognio-feloderme constitui o tecido de revestimento
denominado de periderme.
04) Nas folhas, o parnquima paliadico e o parnquima lacunoso (ou esponjoso) so formados
por clulas clorofiladas, portanto, com capacidade de realizar fotossntese.
08) Em rgos completamente desenvolvidos, as clulas que transportam as seivas do xilema e
do floema so, respectivamente, clulas mortas e clulas vivas.
16) Os tecidos meristemticos originam novas clulas devido a sua grande capacidade de
dividir-se por meiose.

77

UEM (2010_2) 31) Sobre as estruturas especiais utilizadas na reproduo sexuada dos diferentes
grupos vegetais, assinale o que for correto.
01) No arquegnio do gametfito de Bryophyta (musgo), a fecundao entre a oosfera e o
anterozoide resultar no zigoto diploide, e este, aps divises mitticas sucessivas, originar o
esporfito.
02) Em Pterophyta (samambaias e avencas), os esporngios reunidos em soros liberam os
esporos haploides que, aps divises mitticas sucessivas, originaro os gametfitos.
04) Nos vegetais produtores de sementes nuas (sem a proteo do pericarpo), a micrpila do
vulo recebe o gro de plen que formar o tubo polnico, atravs do nucelo, at atingir a
oosfera.
08) Nos vegetais produtores de frutos, o ovrio impede a livre chegada do gro de plen at a
micrpila do vulo. O estigma oferecer as condies para a germinao do gro de plen.
16) A dupla fecundao que ocorre no gametfito das angiospermas (Magnoliophyta) produz
dois embries diploides, que sero os esporfitos, quando atingirem a fase adulta.
UEM (2010_2) 32) Com relao aos tecidos e aos rgos vegetais, assinale o que for correto.
01) As trocas gasosas que ocorrem no caule spero e rugoso de uma planta com crescimento
secundrio so possveis graas aos estmatos presentes na epiderme.
02) A epiderme substituda pela endoderme nos vegetais que apresentam sber na fase de
crescimento secundrio.
04) Os pulges, parasitas de plantas, so alimentados pela seiva retirada do floema, em que h
substncias orgnicas.
08) Ao ser cortado o pice de um caule, surgem ramos novos em decorrncia da ao dos
meristemas secundrios (cmbio vascular e felognio).
16) Um ramo com flores brancas apresentou algumas ptalas coloridas ao ser colocado em um
recipiente contendo gua de cor vermelha. O xilema o tecido envolvido diretamente nesse
processo.
UEM (2011_1) 33) Sobre o ciclo de vida das plantas, correto afirmar que
01) gametfito a fase haploide que possui gametngios, onde so produzidos os gametas por
mitose.
02) esporfito a fase diploide, que possui esporngios, onde so produzidos os esporos por
meiose.
04) gametngios so estruturas diploides responsveis pela produo de esporos.
08) gimnospermas e angiospermas apresentam homosporia, uma vez que formam dois tipos de
esporos, os micrsporos e os megsporos.
16) nas brifitas a fase gametoftica haploide e tambm a mais duradoura, sendo independente
do esporfto.
UEM (2011_1) 34) No que se refere aos rgos vegetativos e reprodutivos que compem o
vegetal, correto afirmar que
01) os caules encontrados no abacateiro, na palmeira, no milho e no feijo so classificados,
respectivamente, de haste, tronco, colmo e estipe.
02) quando outras partes da flor, que no o ovrio, acumulam substncias nutritivas aps a
fecundao, tornando-se carnosas e comestveis, tem-se o pseudofruto.
04) os tecidos do vegetal constitudos por clulas vivas, com paredes finas que podem realizar
funes como fotossntese, so os parnquimas.
08) os frutos carnosos so aqueles que apresentam pericarpo suculento, dentre eles, citam-se o
legume e a smara.

78

16) estmatos so estruturas responsveis pelas trocas gasosas encontradas no tecido de


revestimento das folhas, razes e caules com crescimento secundrio.
UEM (2011_2) 35) Sobre as plantas, assinale a(s) alternativa(s) correta(s).
01) Levando em considerao a presena de tecido de conduo, as plantas podem ser divididas
em dois grupos: as avasculares, que incluem as brifitas e pteridfitas, e as vasculares, que
incluem as gimnospermas e angiospermas.
02) As plantas apresentam reteno do zigoto e dos estgios iniciais de desenvolvimento do
embrio dentro do gametngio feminino; assim, so conhecidas como embrifitas.
04) Nas plantas, a fase gametoftica formada por indivduos chamados gametfitos, que
produzem gametas por meiose, e a fase esporoftica composta por indivduos chamados
esporfitos, que produzem esporos por mitose.
08) As plantas classificadas como fanergamas apresentam estruturas produtoras de gametas
bem visveis, alm de produzirem sementes, e, por isso, so tambm denominadas de
espermatfitas.
16) Ao longo da escala evolutiva das plantas, observa-se a reduo do gametfito, representado
nas angiospermas pelo saco embrionrio (feminino) e pelo gro de plen e tubo polnico
(masculino).
UEM (2011_2) 36) O corpo do vegetal composto por rgos vegetativos e reprodutivos.
Levando em considerao a estrutura e a funo desses rgos, assinale o que for correto.
01) As flores so formadas por verticilos florais protetores, representados pelo gineceu e pelo
androceu e pelos verticilos reprodutores, representados pelo clice e pela corola.
02) A conduo da seiva bruta nas angiospermas ocorre das razes at as folhas; esse transporte
realizado pelo floema, no interior do qual as molculas de gua se mantm unidas por presso
osmtica.
04) As clulas dos meristemas apicais do caule e da raiz originam os tecidos meristemticos
primrios, representados pela epiderme, meristema fundamental e cmbio fascicular.
08) Os feixes vasculares no caule dos representantes de monocotiledneas encontram-se
espalhados pelo parnquima fundamental, enquanto que, nos representantes de dicotiledneas,
esto dispostos em anel, ao redor da medula.
16) A estrutura de uma folha de plantas terrestres composta pela epiderme superior, pelo
parnquima clorofiliano do tipo palidico, por outro do tipo lacunoso e pela epiderme inferior
com estmatos.
UEM (2008_2) 37) Assinale o que for correto sobre a relao da radiao solar e das zonas
climticas com seus efeitos nos vegetais.
01) Plantas de dias curtos (fotoperodo crtico de 16 horas de luz) e de dias longos (fotoperodo
crtico de 10 horas de luz) florescero se expostas a dias com 14 horas de luz.
02) As plantas que realizam o Metabolismo cido das Crassulceas, denominadas de plantas
MAC ou CAM, so caractersticas das regies polares.
04) Uma planta de dia longo, com fotoperodo crtico de 17 horas de luz, florescer na latitude
do Equador apenas no vero.
08) Durante o equincio de primavera, os raios solares incidem perpendicularmente sobre o
Trpico de Capricrnio, gerando dias mais curtos do que aqueles de vero, favorecendo a
formao do xilema primaveril.
16) As florestas homogneas, como a taiga, esto associadas s altas latitudes, em que o longo e
rigoroso inverno fator limitante para muitas espcies vegetais.

79

GABARITO:
1-GAB: 01+02+64=67
2-GAB: 02+04+08=14
3-GAB: 01+02+04+16=23
4-GAB: 01+04+08+16=29
5-GAB: 01+08+16=25
6-GAB: 02+04+08=14
7-GAB: 01+02+16=19
8-GAB: 02+04+08+16=30
9-GAB: 04+08=12
10-GAB: 01+04+16=21
11-GAB: 01+02+32=35
12-GAB: 04+16=20
13-GAB: 01+08+16=25
14-GAB: 01+08=09
15-GAB: 01+04+32=37
16-GAB: 04+08+32=44
17-GAB: 02+08+32=42
18-GAB: 16
19-GAB: 01+02+04+16=23
20-GAB: 01+02+04=07
21-GAB: 04+16=20
22-GAB: 02+08+16=26
23-GAB: 01+04+08=13
24-GAB: 01+0816=25
25-GAB: 01+08=09
26-GAB: 04
27-GAB: 08
28-GAB: 16
29-GAB: 01+02=03
30-GAB: 02+04+08=14
31-GAB: 01+02+04+08=15
32-GAB: 04+16=20
33-GAB: 01+02+16=19
34-GAB: 02+04=06
35-GAB: 02+08+16=26
36-GAB: 08+16=24
37-GAB: 01+16=17

80

GENTICA
UNIOESTE (2006) 1) O carter colorao de plos (preto, amarelo ou branco) da espcie
Hipoteticus hipotetica condicionado por apenas um gene. Dos seguintes cruzamentos entre
animais puros, obteve-se: pretos x amarelos (F1:100% pretos, F2: 75% pretos e 25% amarelos),
preto x branco (F1: 100% pretos, F2: 75% pretos e 25% brancos), amarelo x branco (F1: 100%
amarelos, F2: 75% amarelos e 25% brancos), branco x branco (F1 e F2: 100% brancos). A partir
destes cruzamentos, correto afirmar que:
(01) trata-se de uma herana com epistasia do alelo para colorao preta sobre o alelo para
colorao amarela.
(02) trata-se de uma herana monognica com polialelismo.
(04) trata-se de uma herana monognica com dominncia completa entre os alelos para
colorao preta > colorao amarela > colorao branca.
(08) trata-se de uma herana monognica com co-dominncia entre os alelos para colorao
preta e branca.
(16) trata-se de uma herana monognica com dominncia incompleta entre os alelos para
colorao preta e amarela.
(32) do cruzamento entre o heterozigoto (F1) de animais puros pretos x puros amarelos com o
heterozigoto (F1) de animais puros amarelos x puros brancos, espera-se uma prole de 50%
pretos, 25% amarelos e 25% brancos.
(64) do cruzamento entre o heterozigoto (F1) de animais puros pretos x puros amarelos com o
heterozigoto (F1) de animais puros pretos x puros brancos, espera-se uma prole de 75% pretos e
25% amarelos.
UEPG (2006_1) 2) Joo, filho de Rodrigo e Ana, teve eritroblastose fetal ao nascer. Sabendo-se
que Rodrigo tambm teve eritroblastose fetal, assinale
o que for correto.
01) Joo e Rodrigo tm seguramente o mesmo gentipo para o fator Rh.
02) Se Rodrigo tivesse um irmo, haveria 25% de chance de esse irmo tambm apresentar
eritroblastose, se o pai deles fosse Rh+.
04) A me de Rodrigo Rh e o pai Rh+.
08) Ana Rh+.
16) Existe no mximo 25% de chance de Rodrigo e Ana terem outro filho com eritroblastose
fetal.
UEPG (2006_1) 3) Considerando o individuo Y com o gentipo AaBb, e o indivduo X com o
gentipo aaBb, assinale o que for correto.
01) O indivduo Y produzir 4 tipos de gametas diferentes.
02) O indivduo X produzir 3 tipos de gametas diferentes.
04) Do cruzamento de X com Y pode-se obter indivduos duplo-heterozigotos.
08) Do cruzamento de X com Y, espera-se que metade dos indivduos sejam descendentes Aa e
a outra metade aa.
16) Do cruzamento de X com Y pode-se obter indivduos homozigotos para os alelos a e b,
simultaneamente.
UEPG (2007_1) 4) Sobre os cromossomos diretamente relacionados s caractersticas sexuais,
assinale o que for correto.
01) O cromossomo sexual denominado cromossomo X. Fmeas possuem dois cromossomos X
em cada uma de suas clulas. Machos apresentam somente um cromossomo X.

81

02) Os genes que aparecem no cromossomo X e no tm correspondentes no cromossomo Y


esto em hemizigose nos machos.
04) Os genes para a hemofilia e o daltonismo esto localizados no cromossomo X.
08) O gene que determina a hemofilia dominante e encontra-se no cromossomo X. Sendo
assim, manifesta-se nas mulheres tanto em homozigose (XhXh) quanto em heterozigose
(XHXh).
16) O daltonismo uma anomalia causada por um gene recessivo localizado no cromossomo Y;
portanto, manifesta-se apenas no sexo masculino.
UEPG (2007_1) 5) A possibilidade de combinao de trechos de DNA de organismos distintos
deu incio a uma nova rea da Gentica: a Engenharia Gentica. A respeito desta cincia,
assinale o que for correto.
01) O projeto Genoma uma iniciativa de localizar, seqenciar e identificar a funo dos genes
de um organismo. O primeiro grande passo foi dado quando uma bactria teve as bases de seu
RNA seqenciadas.
02) Ao inserir um trecho de DNA em uma clula bacteriana ou de levedura, propicia-se no s a
sua expresso, mas tambm a produo de grande quantidade de cpias idnticas a ele, processo
denominado clonagem.
04) possvel realizar exames para verificar se filhos de um casal so portadores de genes
anormais ou at mesmo se o embrio resultar em indivduo normal ou afetado por anomalia.
Neste ltimo caso, o exame feito a partir de clulas coletadas do
prprio embrio, ainda no primeiro trimestre da gestao.
08) Suspeitos de haverem cometido crimes podem ter o DNA de seus linfcitos ou plaquetas
comparado com o de linfcitos e espermatozides encontrados junto s vtimas, o que permitir
confirmar ou no a participao do suspeito no delito.
16) Em 1972 alguns cientistas conseguiram fazer com que trechos de DNA de diferentes
organismos soldassem-se no interior de tubos de ensaio. Pela primeira vez, era possvel criar
combinaes gnicas totalmente novas a partir do DNA de organismos
distintos. Era o incio da tecnologia do DNA recombinante ou da Engenharia Gentica, como
mais conhecida.
UEPG (2008_1) 6) Com base nos dados contidos na tabela abaixo, assinale o que for

correto.
01) O macho do cruzamento 2 homozigoto.
02) Entre os descendentes do cruzamento 3, a cada fentipo corresponde um gentipo diferente.
04) 70% dos descendentes do cruzamento 3 so heterozigotos.
08) Todos os descendentes do cruzamento do macho de 2 com a fmea de 1 apresentam um
nico gentipo e um nico fentipo.

82

UEPG (2009_1) 7) A respeito do fenmeno da polialelia, em gentica, que ocorre quando mais
de dois alelos ocupam o mesmo lcus gnico, assinale o que for correto.
01) Na polialelia, um carter condicionado por trs ou mais genes alelos, originados por
mutao a partir de um gene original. Entretanto, como s h dois lcus para os genes alelos, um
em cada cromossomo homlogo, cada indivduo s pode ter dois alelos de cada vez.
02) A polialelia comum tambm em vegetais, particularmente em genes para a autoesterilidade, condio que impede a autofecundao ou a fecundao entre indivduos de padro
gentico muito prximo.
04) Os mecanismos deflagrados pela polialelia diminuem a variedade gentica da populao e
aumentam a chance de ocorrerem doenas provocadas por genes recessivos em dose dupla.
08) A cor da pelagem dos coelhos, que controlada por quatro alelos, constitui um exemplo
clssico de polialelia. O gene que determina plo selvagem ou aguti (marrom) sofreu mutaes,
produzindo mais trs genes: chinchila (cinza), himalaia (branco e preto) e albino (totalmente
branco).
16) H um exemplo clssico de polialelia na espcie humana: o sistema ABO de grupos
sanguneos, com os genes alelos A, B, O e os grupos sanguneos A, B, AB e O.
UEPG (2009_1) 8) Cada tipo de caracterstica de um ser condicionado por um par de alelos.
No entanto, em muitos casos, vrios pares de genes no-alelos podem influenciar na
determinao de uma mesma caracterstica. A respeito deste fenmeno, conhecido como
interao gnica, assinale o que for correto.
01) O fenmeno dos genes complementares um caso de interao gnica em que dois genes
no alelos atuam sobre uma mesma caracterstica, produzindo um fentipo diferente dos
fentipos produzidos por cada um deles isoladamente.
02) Quando um gene impede a manifestao de outro, no-alelo, ocorre um tipo de interao
gnica chamada epistasia.
04) No fenmeno da poligenia, que constitui um caso de interao gnica, os pares de genes
no-alelos acumulam seus efeitos. A relao no de dominncia entre os alelos, o que permite
uma maior variao fenotpica. Tendo em conta que a poligenia produz uma srie de fentipos
gradativamente diferentes entre si, ela tambm chamada de herana quantitativa ou polimeria,
ou ainda, herana multifatorial.
08) s vezes um nico gene tem efeito simultneo sobre vrias caractersticas do organismo.
Esse gene denomina-se gene pleiotrpico e o fenmeno de sua ao chamado pleiotropia.
16) Exemplo de epistasia: a cor das penas de certas raas de galinha; exemplo de poligenia: a
determinao da cor dos olhos e da pele na espcie humana; exemplo dos efeitos da pleiotropia:
a doena fenilcetonria.
UFSC (2007) 9) Considere um gene que apresenta 3 alelos, aqui denominados alfa, beta e gama.
Considere que os alelos alfa e beta so co-dominantes e gama recessivo em relao a ambos.
Tal gene deve determinar:
01.
trs fentipos, correspondentes a cinco gentipos.
02.
trs fentipos, cada um correspondente a um gentipo.
04.
quatro fentipos, cada um correspondente a dois gentipos.
08.
seis fentipos, correspondentes a quatro gentipos.
16.
quatro fentipos, correspondentes a seis gentipos.

83

UFSC (2008) 10) Sobre os cromossomos X e Y, responsveis pela determinao cromossmica


do sexo da espcie humana, CORRETO afirmar que:
01. todos os homens normais receberam o cromossomo Y de seu av paterno, mas nem todos
receberam o cromossomo X de sua av materna.
02. todas as mulheres normais receberam um cromossomo X de sua av paterna, mas nem todas
receberam um cromossomo X de sua av materna.
04. todos os genes presentes nos cromossomos X e Y so responsveis pelo desenvolvimento
sexual de um indivduo.
08. apenas o cromossomo X tem genes responsveis pelo desenvolvimento sexual, pois o
cromossomo Y tem poucos genes.
16. todos os genes do cromossomo Y so responsveis pelo desenvolvimento sexual masculino.
32. o sistema XY de determinao cromossmica do sexo est presente apenas na espcie
humana.
64. os cromossomos X e Y so assim denominados porque apresentam a forma de um X e de
um Y.
UFSC (2009) 11) Ao final da gravidez, comum haver pequenas rupturas placentrias que
permitem a passagem de hemcias fetais para o sangue materno. A me, assim, pode ser
sensibilizada e, dependendo de seu tipo sangneo e do tipo sangneo do feto em relao ao
sistema Rh, gerar uma doena denominada eritroblastose fetal.
Com relao ao fenmeno descrito e suas conseqncias, CORRETO afirmar que:
01. a me tem que ser Rh negativo.
02. o pai tem que ser Rh positivo.
04. a criana , obrigatoriamente, homozigota.
08. a me , obrigatoriamente, homozigota.
16. o pai pode ser heterozigoto.
32. a criana Rh negativo.
64. o pai pode ser homozigoto.
UFSC (2009) 12) Enzimas convertem sangue de todos os tipos em sangue O.
Um mtodo capaz de transformar em O sangue dos tipos A, B e AB foi criado por uma equipe
internacional de pesquisadores. A tcnica pode pr fim aos problemas de suprimento nos bancos
de sangue, onde falta frequentemente o tipo O negativo o mais procurado, pois pode ser
recebido por qualquer paciente. A compatibilidade fundamental para a transfuso, pois esses
antgenos podem reagir com anticorpos presentes no plasma e levar morte em alguns casos. A
equipe de Qiyong Liu, da empresa ZymeQuest (EUA), obteve enzimas capazes de remover da
superfcie dos glbulos vermelhos as molculas responsveis pela reao imune. As enzimas
foram desenvolvidas em laboratrio a partir de protenas produzidas por bactrias.
Sobre esse assunto, CORRETO afirmar que:
01. a incompatibilidade entre grupos sanguneos deve-se a uma reao imunolgica entre
protenas dissolvidas no plasma sanguneo e molculas presentes na membrana das hemcias.
02. ao obter enzimas capazes de suprimir a reao imune, os cientistas podem alterar a herana
gentica das pessoas quanto ao tipo sanguneo.
04. a herana dos grupos sanguneos do sistema ABO determinada por um gene com alelos
mltiplos (polialelia).
08. o sangue das pessoas que apresentam o tipo O recebe essa denominao pois no apresenta o
antgeno A ou B (aglutinognio A ou aglutinognio B) nem as aglutininas anti-A ou anti-B.

84

16. existe um pequeno nmero de pessoas na populao mundial que pode ser erroneamente
classificado como pertencente ao grupo sanguneo O (falso O), embora no possuam gentipo
correspondente a esse grupo (fentipo Bombaim).
32. para cada fentipo sanguneo existente no sistema ABO s existe um gentipo possvel que
o determine.
UFSC (2010) 13) Seu Jos da Silva, um pequeno criador de porcos do Oeste do Estado de Santa
Catarina, desejando melhorar a qualidade de sua criao, comprou um porco de raa diferente
daquela que ele criava. Preocupado com as consequncias de criar este animal junto com os
outros porcos, ele discute com seu um vizinho sobre o assunto.
Parte de seu dilogo transcrito abaixo:
SR. JOS O porco que comprei e apelidei de Napoleo maior, mais forte e possui peso
acima da mdia da raa que crio. Alm disso, possui manchas marrons pelo corpo todo. Gostaria
que boa parte de minha criao tivesse estas caractersticas.
VIZINHO Seu Jos, isto vai ser muito difcil de conseguir; melhor o senhor comprar outros
porcos com esse jeito.
Com base nos conhecimentos de gentica, assinale a(s) proposio(es) CORRETA(S) sobre o
assunto.
01. As preocupaes do Sr. Jos no se justificam, pois animais com fentipos distintos
apresentam, obrigatoriamente, gentipos distintos para as mesmas caractersticas.
02. O vizinho do Sr. Jos tem razo, pois no se pode obter mistura de caractersticas cruzando
animais de raas diferentes na mesma espcie.
04. Atualmente no se pode criar e cruzar porcos de raas diferentes, pois impossvel controlar
a seleo das caractersticas geneticamente desejadas.
08. As manchas na pele do porco Napoleo so uma caracterstica determinada geneticamente;
j o peso e o tamanho resultam somente da oferta de boa alimentao.
16. Quando duas raas distintas entram em contato e seus membros passam a cruzar-se
livremente, as diferenas raciais tendem a desaparecer nos descendentes devido mistura de
genes.
32. O melhoramento gentico em animais que apresentam caractersticas de valor comercial
necessariamente prejudicial ao ser humano, j que no ocorre naturalmente.
64. Muitas caractersticas animais, como a fertilidade, a produo de carne e a resistncia a
doenas, so condicionadas por genes e dependem muito das condies nas quais os animais so
criados.
UFMS (2007) 14) A hemofilia uma doena hereditria condicionada por um gene ligado ao
sexo. Analise o heredograma abaixo e assinale a(s) afirmativa(s) correta(s).

85

(001) Os gentipos dos indivduos 1 e 2 so respectivamente XHXh e XHY.


(002) Os gentipos possveis do indivduo 3 so XHXh e XHXH.
(004) Os gentipos dos indivduos 4 e 5 so respectivamente XhY e XHXh.
(008) Caso o indivduo 4 se case com uma mulher normal homozigota, tendo um filho homem, a
probabilidade de esse filho vir a ser hemoflico de 50%.
(016) A probabilidade de o casal 5 e 6 ter uma filha mulher daltnica de 25%.
(032) Se o casal 1 e 2 tiver outro filho homem, a probabilidade de esse filho ser normal de
25%.
UFMS (2007) 15) Um gato preto (A) cruzou com uma gata tambm preta (B) gerando 8 filhotes
pretos. Porm, o mesmo gato preto (A), quando cruzou com outra gata preta (C), produziu 6
filhotes pretos e 2 amarelos. Assinale a(s) proposio(es) correta(s):
(001) A cor preta dominante.
(002) A cor preta recessiva.
(004) A gata (B) heterozigtica.
(008) A gata (C) homozigtica.
(016) O gato (A) e a gata (C) so heterozigticos.
(032) A gata (B) homozigtica.
UFMS (2008) 16) A herana gentica do sistema ABO dada por alelos mltiplos (polialelia),
representados pelos genes alelos IA;IB e i, os quais proporcionam diferentes tipos de
fentipos e gentipos sangneos em humanos. Em relao ao tipo de herana do sistema ABO,
correto afirmar:
(001) O grupo AB apresenta 2 tipos de fentipos e 4 tipos de gentipos.
(002) Indivduos do grupo sangneo B possuem aglutinognios B e aglutininas anti-A.
(004) Os genes alelos IA e IB so dominantes em relao a i.
(008) Uma mulher e um homem, ambos pertencentes ao grupo sangneo do tipo O, no
apresentam possibilidades de terem filhos do tipo A, B ou AB, mas somente do tipo O.
(016) Indivduos do grupo sangneo do tipo A apresentam apenas 1 (um) tipo de gentipo e
dois tipos de fentipos.
(032) A produo de aglutinognios condicionada pelo gene alelo i.
UFMS (2009) 17) O padro fenotpico da pelagem de coelhos determinado por uma srie de 4
alelos (alelos mltiplos), como demonstrado na tabela abaixo:

Com relao escala de dominncia, o alelo C dominante sobre todos os outros alelos; o alelo
cch dominante sobre o alelo ch e o alelo ca. Por sua vez, o alelo ch dominante sobre o alelo
ca. Em funo dos gentipos de cada casal de coelhos, analise os cruzamentos propostos e
assinale a(s) alternativa(s) que indica(m) a(s) possibilidade(s) correta(s).
(001) Do cruzamento chch X caca, espera-se que 75% dos descendentes sejam Himalaias.
(002) Do cruzamento cchcch X chca, espera-se que 25% dos descendentes sejam Albinos.
(004) Do cruzamento chca X caca, espera-se que 50% dos descendentes sejam Himalaias.
86

(008) Do cruzamento Ccch X caca, espera-se que 25% dos descendentes sejam Albinos.
(016) Do cruzamento cchca X cchca, espera-se que 75% dos descendentes sejam Chinchilas.
(032) Do cruzamento CC X cchcch, espera-se que 100% dos descendentes sejam Agutis.
UFMS (2010) 18) A galactosemia uma doena que leva a problemas na metabolizao da
galactose e causada por um gene autossmico recessivo. Para anlise, considere G para o
alelo dominante e g para o alelo recessivo. Nesse sentido, um homem heterozigoto (Gg)
casou-se com uma mulher tambm heterozigota (Gg). Em relao s probabilidades de os
descendentes desse casal apresentarem galactosemia, assinale a(s) proposio(es) correta(s).
(001) Espera-se que nenhum dos descendentes apresente galactosemia.
(002) Espera-se que 50 % dos descendentes sejam galactosmicos.
(004) Espera-se que todos os descendentes apresentem galactosemia.
(008) Espera-se que 25 % dos descendentes sejam normais homozigotos (GG).
(016) Espera-se que 100 % dos descendentes sejam normais heterozigotos (Gg).
(032) Espera-se que 25 % dos descendentes apresentem galactosemia.
UEM (2008_1) 19) O teste de paternidade foi um dos principais fatores de popularizao da
sigla DNA. Sobre as aplicaes desse teste, assinale o que for correto.
01) O teste possvel porque enzimas de restrio reconhecem e cortam molculas de DNA em
fragmentos com determinadas seqncias de nucleotdeos.
02) O teste possvel porque analisa e compara fragmentos de DNA tpicos de cada pessoa.
04) O teste possvel porque fragmentos de DNA presentes na criana esto presentes no DNA
de um dos pais.
08) O teste aplicvel em casos nos quais os provveis pais so gmeos dizigticos.
16) O teste no aplicvel em casos nos quais os provveis pais so gmeos univitelinos.
UEM (2008_1) 20) Sobre os conceitos de Gentica, assinale o que for correto.
01) O feijo e a soja possuem o mesmo caritipo.
02) Os genes so transmitidos pelos gametas; cada gameta contm um conjunto completo de
genes, tpico de cada espcie.
04) Em qualquer DNA, a equivalncia entre as bases expressa por A/G=C/T=1.
08) O cdigo gentico reforou a idia de que as espcies de seres vivos atuais descendem de
ancestrais comuns.
16) O milho bt, que tem incorporado em seu genoma um gene da bactria Bacillus thuringiensis,
um organismo transgnico.
UEM (2008_2) 21) Sobre experimentos que se relacionam com a segunda lei de Mendel,
assinale o que for correto.
01) A probabilidade de um indivduo com gentipo AaBb produzir gametas AB ou ab a
mesma, ou seja, 25%.
02) Sendo o pai do grupo sanguneo AB e a me heterozigota do grupo B, 50% dos filhos
podero ser do grupo B.
04) Um indivduo com gentipo AaBbCcDD produzir 3/8 de gametas ABCD.
08) O cruzamento entre heterozigotos com gentipo AaBbCc resultar em descendentes com
trs gentipos diferentes.
16) O cruzamento entre os homozigotos puros amarelo/rugoso (AAbb) e verde/liso (aaBB)
resultar em descendentes com dois fentipos diferentes.

87

UEM (2008_2) 22) Com relao aos conceitos de gentica, assinale o que for correto.
01) Ocorre interao gnica quando dois ou mais genes, localizados ou no no mesmo
cromossomo, agem conjuntamente na determinao de uma caracterstica.
02) Na reproduo sexuada, um indivduo transmite a seus descendentes combinaes gnicas
diferentes das que recebeu de seus pais.
04) Daltonismo, hemofilia e distrofia muscular so doenas hereditrias ligadas ao cromossomo
Y.
08) A unidade de transcrio gnica definida como um segmento de DNA que transcrito em
uma molcula de RNA.
16) A variabilidade gentica no influencia na capacidade da populao em se adaptar
eficientemente s alteraes do ambiente.
UEM (2009_1) 23) Considere os conceitos genticos sobre o sistema ABO e sobre as
transfuses sanguneas e assinale o que for correto.
01) O sangue do grupo O pode ser doado para indivduos com sangue dos grupos O, A, B e AB.
02) Se o sangue do doador contm aglutinognios A, o sangue do receptor pode conter
aglutininas anti-A.
04) No havendo aglutinao do sangue com o soro anti- A e nem com o soro anti-B, o
indivduo pertence ao grupo AB.
08) Indivduos pertencentes ao grupo O so destitudos de aglutininas e possuem aglutinognios
A e B.
16) O sangue do grupo B pode ser doado para indivduos com sangue dos grupos AB e B.
UEM (2009_1) 24) Considerando o sistema XY de determinao do sexo e as doenas
hereditrias ligadas ao sexo, assinale o que for correto.
01) O sistema XY de determinao do sexo no ocorre entre os vegetais.
02) No daltonismo, 50% dos filhos do sexo masculino de uma mulher heterozigtica podem ser
daltnicos.
04) O gene que determina a cor do olho em Drosophila melanogaster est localizado no
cromossomo X.
08) Na espcie humana, os filhos de sexo masculino herdam genes do cromossomo X de seus
dois genitores.
16) As filhas do casamento entre uma mulher hemoflica e um homem normal sero
hemoflicas.
UEM (2009_1) 25) Com relao aos conceitos de gentica, assinale o que for correto.
01) Nos eucariontes, cada gene formado por regies que codificam e regies que no
codificam aminocidos.
02) O alelo recessivo determina o mesmo fentipo, tanto em homozigose como em heterozigose.
04) A primeira lei de Mendel enuncia que cada carter determinado por um par de fatores que
se separam na formao dos gametas.
08) A terapia gnica substitui o alelo anormal que causa doena pelo alelo normal.
16) Testes de maternidade podem ser feitos pela anlise do DNA mitocondrial, pois as
mitocndrias dos descendentes so herdadas apenas da me.
UEM (2010_1) 26) O conjunto de tcnicas baseadas na manipulao do DNA constitui a
Engenharia Gentica. A esse respeito, assinale o que for correto.
01) A ligao do DNA transplantado ao DNA hospedeiro, com a consequente formao do
DNA
recombinante, efetuada numa clula sob o comando da enzima DNA ligase.

88

02) O material gentico da ovelha Dolly era idntico ao do animal doador de ovcito.
04) Plantas transgnicas so todas aquelas que apresentam elevada tolerncia a herbicidas.
08) Quando os animais trangnicos se reproduzem, os genes incorporados so transmitidos aos
descendentes, como qualquer outro gene.
16) A tcnica do DNA recombinante no possvel entre seres de diferentes reinos.
UEM (2010_1) 27) Assinale o que for correto sobre o cruzamento de cobaias X, em que a cor
preta da pelagem condicionada por um gene dominante B, e a cor cinza pelo seu alelo
recessivo b.
01) Cobaias de cor cinza s produzem gametas portadores do alelo b.
02) Basta um alelo funcional para produzir, em quantidades adequadas, os pigmentos que do
cor preta aos pelos das cobaias X.
04) A proporo genotpica do cruzamento de dois animais pretos heterozigotos 1/4 BB, 1/2
Bb e bb.
08) A proporo fenotpica do cruzamento de um macho preto heterozigoto e uma fmea cinza
1/2 preta e 1/2 cinza.
16) O mecanismo hereditrio que explica as propores fenotpicas e genotpicas dos
cruzamentos propostos foi elucidado por Mendel e conhecido hoje como Segunda Lei de
Mendel.
UEM (2010_1) 28) Prximo a uma das extremidades do cromossomo 9 (nove) humano,
localiza-se o gene que condiciona os tipos sanguneos do sistema ABO, o qual pode se
apresentar sob trs formas distintas: IA, IB e i. Nesse contexto, assinale a(s) alternativa(s)
correta(s).
01) As diferentes verses de um mesmo gene so denominadas alelos, e o local que elas ocupam
no cromossomo denominado loco gnico.
02) Os alelos do gene, para o sistema ABO, determinam a presena ou a ausncia de
determinadas substncias na superfcie externa da membrana plasmtica das hemcias.
04) O alelo IA determina a presena da substncia conhecida como antgeno A; o alelo IB
determina a presena do antgeno B; e o alelo i concidiona a presena dessas duas substncias.
08) Alm dos aglutinognios nas hemcias, podem ser encontrados, no plasma, anticorpos
contra esses aglutinognios, chamados aglutinogeninas, que provocam a separao das
hemcias.
16) A formao dos anticorpos (aglutininas) inicia-se logo aps a concepo, devido fuso do
material gentico dos pais.
UEM (2010_2) 29) Sobre os cidos nucleicos, assinale o que for correto.
01) Na engenharia gentica, as enzimas de restrio, produzidas por diversos organismos, so
utilizadas para cortar uma sequncia especfica de DNA.
02) A produo de insulina, via atividade bacteriana, foi possvel ao se introduzir fragmentos de
DNA humano no plasmdio das bactrias.
04) Os trangnicos (organismos geneticamente modificados) contm, em seus cromossomos,
DNA de outra espcie.
08) Na clonagem de animais e vegetais, necessrio reduzir o nmero de cromossomos para
evitar a poliploidia.
16) A paternidade pode ser comprovada quando houver coincidncia das bandas obtidas do
RNA do homem e da criana.

89

UEM (2010_2) 30) Relacionado Gentica, assinale o que for correto.


01) Uma mulher daltnica, filha de me daltnica, mesmo sem saber quem era seu pai, concluiu
que ele tambm seria daltnico.
02) A hemofilia, dificuldade de coagulao do sangue, manifesta-se principalmente no homem,
porque um carter ligado ao cromossomo Y.
04) A eritroblastose fetal est associada ao fator ABO, manifestada pela me no primeiro filho,
se este apresentar o anticorpo anti-Rh.
08) A cor da pele na espcie humana determinada pela interao gnica, dita poligenia, que
resulta em gradativa variao de fentipos.
16) H 50% de chance de uma menina com sndrome de Down (alterao no nmero de
cromossomos) ter recebido dois cromossomos X de sua me.
UEM (2011_1) 31) Atualmente, existe uma polmica envolvendo o uso de organismos
transgnicos, como a soja transgnica, por exemplo. Sobre esse assunto, correto afirmar que
01) a transgenia uma tcnica da Engenharia Gentica que permite transferir genes de uma
espcie para outra com o objetivo de alterar determinadas qualidades de espcies de animais ou
vegetais, tendo em vista sua utilizao pela humanidade.
02) organismos que doam seus genes a outra espcie, a fim de aumentar a variabilidade gentica
desta outra, so chamados transgnicos.
04) a soja transgnica possui um gene que confere resistncia a determinados herbicidas, mas
este gene no transmitido s geraes seguintes, diminuindo, assim, a sua produtividade.
08) supe-se que os alimentos transgnicos no representam nenhuma ameaa sade humana
e, por isso, no necessitam ser testados em outras espcies de animais antes de chegarem ao
homem.
16) o organismo transgnico capaz de produzir substncias que, em condies naturais, no o
seria.
UEM (2011_1) 32) No heredrograma, esto assinalados os membros de uma famlia afetados
por uma doena hereditria. Com base nas informaes obtidas no heredrograma a seguir,
assinale a(s) alternativa(s) correta(s).

01) A doena em questo determinada por alelo recessivo.


02) O indivduo 1 heterozigoto, pois normal, mas tem uma filha doente.
04) A mulher 6 tem gentipo homozigoto recessivo, pois ela tem um filho com a doena.
08) A probabilidade de o casal 5-6, em outra gestao, ter um descendente afetado pela doena
de 1/4 ou 25%.
16) Se o homem 7 tiver um descendente com uma mulher heterozigota, a probabilidade de esse
descendente nascer com a doena de 75%.

90

UEM (2011_2) 33) Sobre a eletroforese de DNA, correto afirmar que


01) realizada utilizando-se uma placa com gel especial, fragmentos de DNA e aplicao de
corrente eltrica.
02) os fragmentos de DNA que possuem cargas negativas se deslocam para o polo positivo,
quando aplicada uma descarga eltrica na placa de gel.
04) a eletroforese de DNA tem sido utilizada para a identificao de pessoas, nas investigaes
policiais, em processos judiciais e na determinao da paternidade.
08) gmeos monozigticos podem ser distinguidos pela anlise do DNA nuclear.
16) os fragmentos separados por eletroforese so formados por DNA com cadeia dupla.
UEM (2011_2) 34) Considerando as heranas ligadas ao sexo, assinale o que for correto.
01) Os cromossomos sexuais de indivduos com sndrome de Klinefelter so XXY e daqueles
com sndrome de Turner so XO.
02) Um homem hemoflico casado com uma mulher normal homozigota ter 25% de
probabilidade de ter um descendente hemoflico.
04) A determinao do sexo, em todas as espcies animais, definida pela constituio de um
par de cromossomos sexuais, sendo que as fmeas apresentam cromossomos XX e os machos
XY.
08) Uma mulher normal, cujo pai daltnico, casada com um homem daltnico, apresenta 50%
de probabilidade de ter um descendente com essa caracterstica.
16) Genes com expresso limitada ao sexo so aqueles que, apesar de estarem presentes em
ambos os sexos, s se expressam em um deles.
UEM (2011_2) 35) Sobre os conceitos utilizados em gentica, correto afirmar que
01) na polialelia um carter condicionado por trs ou mais genes alelos, que surgem por
mutao de um gene original; entretanto, cada indivduo s pode ter dois alelos de cada vez.
02) codominncia o fenmeno em que os alelos de um gene impedem a expresso dos alelos
de outro par, que pode ou no estar no mesmo cromossomo.
04) penetrncia gnica definida como a porcentagem de indivduos com determinado gentipo
que expressa o fentipo correspondente.
08) um nico gene que exerce efeito simultneo sobre vrias caractersticas do organismo
denominado de pleiotrpico. Um exemplo para o organismo humano a fenilcetonria.
16) herana quantitativa o termo utilizado para descrever situaes em que o fentipo dos
indivduos heterozigticos intermedirio, em termos quantitativos, entre o fentipos dos dois
homozigticos.
UEM (2008_1) 36) A espessura dos lbios humanos uma caracterstica gentica em que no h
dominncia entre os genes alelos: os indivduos homozigotos tm lbios grossos ou lbios finos
e os heterozigotos tm lbios intermedirios. Assinale o que for correto sobre os
descendentes de um casal em que a mulher tem lbios grossos e o homem apresenta lbios
intermedirios.
01) H 50% de probabilidade de nascerem descendentes com lbios grossos,
independentemente do sexo.
02) H 25% de probabilidade de nascer menina com lbios grossos.
04) H 25% de probabilidade de nascer menino com lbios intermedirios.
08) No h probabilidade de nascerem descendentes com lbios finos.
16) A probabilidade de nascer um menino com lbios grossos e uma menina com lbios
intermedirios de 1/16.

91

UEM (2009_1) 37) Sabendo que cada gameta contm apenas um alelo de cada gene e
considerando uma populao em equilbrio gnico, na qual as frequncias dos alelos dominante
e recessivo no ligados ao sexo so, respectivamente, 0,6 e 0,4, correto afirmar que
01) 50% dos gametas produzidos pelos membros da populao sero portadores do alelo
dominante e 50% sero portadores do alelo recessivo.
02) a probabilidade de se formar um indivduo homozigoto dominante na populao 36%.
04) a probabilidade de se formar um indivduo heterozigoto na populao 24%.
08) a probabilidade de se formar um indivduo homozigoto recessivo na populao 40%.
16) a expresso matemtica da populao, de acordo com o princpio de Hardy-Weinberg, ser
0,36 + 0,48 + 0,16 = 1.
UEM (2009_2) 38) A hemofilia uma doena hereditria em que h uma falha no sistema de
coagulao do sangue. A hemofilia A causada pela deficincia no fator VIII de coagulao e
segue a herana ligada ao cromossomo X. O alelo normal do gene (H) atua como dominante,
condicionando fentipo no hemoflico e o alelo mutante (h) atua como recessivo,
condicionando fentipo hemoflico. Considere o casamento entre um homem normal (XHY)
com uma mulher normal portadora (XHXh) cujos descendentes podem ser normais, portadores e
hemoflicos. Sobre o que esperado desse casamento, assinale o que for correto.
01) 25% dos descendentes do sexo masculino sero normais.
02) 50% dos descendentes do sexo masculino sero hemoflicos.
04) 50% dos descendentes do sexo feminino sero portadores.
08) 25% dos descendentes do sexo feminino sero hemoflicos.
16) 25% dos descendentes do sexo feminino e 25% dos descendentes do sexo masculino sero
portadores.
UEM (2011_1) 39) O daltonismo ligado ao cromossomo sexual uma anomalia visual de
carter hereditrio ligado ao cromossomo X causado por um gene recessivo. Sobre esse tipo de
daltonismo, correto afirmar que
01) toda mulher daltnica , necessariamente, filha de pai daltnico.
02) todo homem daltnico , necessariamente, filho de me daltnica.
04) para um casal formado por pai no-daltnico e me daltnica a probabilidade de gerar um
menino daltnico igual de gerar uma menina daltnica.
08) homens daltnicos sempre geraro descendentes daltnicos, independente da parceira.
16) para um casal formado por um homem daltnico e uma mulher no-daltnica, portadora do
gene recessivo, a probabilidade de gerar um descendente daltnico de 50%.
UEM (2011_2) 40) Joo e Roberta se casaram. Ambos so normais e tm casos de albinismo na
famlia. Como planejam ter filhos, resolveram procurar um geneticista para tirarem suas
dvidas. Joo informou que sua me era homozigota dominante para o albinismo e seu pai era
normal, porm seu av paterno era albino. Roberta informou que seus pais eram normais, porm
tem uma irm albina. Considerando essas informaes e que o albinismo tipo 1,
na espcie humana, condicionado por um alelo recessivo, assinale o que for correto.
01) Joo e Roberta apresentam a mesma probabilidade de serem portadores do alelo para o
albinismo.
02) A probabilidade de Joo ser portador do alelo para o albinismo de 50%.
04) A probabilidade de o av e de a av paternos de Roberta serem homozigotos dominantes
de 25%.
08) Se o casal tiver um filho albino, a probabilidade de o segundo filho ser albino ser de 1/4.

92

16) Se o casal tiver um filho albino, a probabilidade de o segundo filho ser homozigoto a
mesma de ele ser heterozigoto.
GABARITO:
1-GAB: 02+04+64=70
2-GAB: 01+04=05
3-GAB: 01+04+08+16=29
4-GAB: 01+02+04=07
5-GAB: 02+16=18
6-GAB: 01+02+08=11
7-GAB: 01+02+08+16=27
8-GAB: 01+02+04+08+16=31
9-GAB: 16
10-GAB: 01+02=03
11-GAB: 01+02+08+16+64=91
12-GAB: 01+04+16=21
13-GAB: 16+64=80
14-GAB: 04
15-GAB: 01+16+32=49
16-GAB: 02+04+08=14
17-GAB: 04+16+32=52
18-GAB: 08+32=40
19-GAB: 01+02+04+08+16=31
20-GAB: 02+08+16=26
21-GAB: 01+02=03
22-GAB: 01+02+08=11
23-GAB: 01+16=17
24-GAB: 02+04=06
25-GAB: 01+04+08+16=29
26-GAB: 01+08=09
27-GAB: 01+02+04+08=15
28-GAB: 01+02=03
29-GAB: 01+02+04=07
30-GAB: 01+08=09
31-GAB: 01+16=17
32-GAB: 01+02+08=11
33-GAB: 01+02+04+16=23
34-GAB: 01+08+16=25
35-GAB: 01+04+08=13
36-GAB: 01+02+04+08=15
37-GAB: 02+16=18
38-GAB: 02+04=06
39-GAB: 01+16=17
40-GAB: 02+08+16=26

93

ECOLOGIA E CICLOS BIOGEOQUMICOS


UNIOESTE (2006) 1) A Ecologia (oikos = casa; logos = estudo) a cincia que estuda a relao
entre os seres vivos e o ambiente. Analise as alternativas abaixo e assinale a(s) correta(s).
(01) Comunidade o conjunto de indivduos pertencentes a uma nica espcie em um
determinado ambiente.
(02) Populao o conjunto das diferentes espcies que ocupam o mesmo ambiente.
(04) Biosfera o conjunto formado pelas diferentes populaes de um determinado ambiente.
(08) Ecossistema o conjunto das diferentes biosferas da Terra.
(16) Entre os componentes biticos de um ecossistema, encontramos os produtores, os
consumidores e os decompositores.
(32) O fluxo de energia em um ecossistema unidirecional e mantm-se constante nos
diferentes nveis trficos, iniciando pelos decompositores, passando pelos consumidores e
terminando nos produtores.
(64) A produtividade primria lquida de um ecossistema a diferena entre o total de matria
orgnica acumulada e a biomassa consumida na respirao.
UNIOESTE (2005) 2) Relativo a cadeias e teias alimentares, correto afirmar que
(01) a transferncia de energia no ecossistema unidirecional.
(02) a produtividade primria a quantidade de matria orgnica produzida pelos
consumidores primrios.
(04) um ecossistema fechado com relao energia e aberto com relao matria.
(08) a pirmide de energia possui vrtice para cima devido perda de energia que ocorre
em cada nvel da cadeia.
(16) um consumidor quaternrio nunca poder ser um consumidor secundrio.
(32) a eliminao de um dos componentes da teia alimentar no causa desequilbrio na
cadeia.
(64) um decompositor age somente sobre os consumidores (primrios, secundrios e
tercirios), e no sobre os produtores.
UEPG (2006_1) 3) Sabe-se que os organismos esto constantemente retirando da natureza os
elementos qumicos de que necessitam. No entanto,
de uma forma ou de outra, esses elementos acabam sempre voltando ao ambiente. O processo
contnuo de retirada e devoluo de elementos qumicos natureza constitui os chamados ciclos
biogeoqumicos. A respeito deste tema, assinale o que for correto.
01) O nitrognio um elemento qumico fundamental para o ser vivo, pois entra na constituio
das protenas e dos cidos nuclicos, entre outros. 78% da atmosfera constituda de nitrognio,
que tambm aparece dissolvido na gua e no solo, podendo ser absorvido por vegetais ou
ingeridos direta ou indiretamente pelos animais, participando da formao de seu corpo.
02) As cadeias de carbono so fabricadas pelos seres vivos autotrficos atravs da fotossntese, a
partir do gs carbnico do ambiente. Representando cerca de 0,035% dos gases da atmosfera,
encontrado, em proporo semelhante, dissolvido na gua.
04) Da mesma maneira que o ciclo do clcio, o ciclo do fsforo no tem envolvimento da
atmosfera, ao contrrio dos ciclos da gua, do carbono, do oxignio e do nitrognio. O fsforo
aparece principalmente no solo, na forma de fosfato, obtido com a dissoluo das rochas. A
maioria dos seres vivos no pode utilizar diretamente suas reservas. A fixao desse elemento
deve ocorrer pela ao de bactrias existentes nas razes das plantas leguminosas.
08) Ainda que o ecossistema necessite da energia fornecida pelo Sol, essa perptua reciclagem
de elementos como o carbono, o nitrognio, o oxignio e outros, confere uma certa autosuficincia biosfera, permitindo a manuteno da vida ao longo dos tempos.

94

16) Encontramos tomos de oxignio nos mais variados compostos minerais e orgnicos, mas
sua presena na forma de molculas de oxignio livre (O2) a forma como usada na
respirao e na combusto depende da fotossntese. Nessa forma ele ocupa cerca de 20% da
composio atmosfrica.
UEPG (2006_1) 4) Existe hoje uma preocupao mundial com o uso indiscriminado de
compostos do tipo clorofluorcarbono. Sobre esse elemento, assinale o que for correto.
01) Acumula-se na atmosfera e cai com as chuvas cidas, intoxicando os animais e destruindo o
plncton marinho.
02) Causa buracos na camada de oznio na mesosfera, permitindo a passagem da radiao
infravermelha que estimula o crescimento de tumores de pele.
04) Conhecido como CFC, encontrado nas embalagens de aerossis e nas geladeiras.
08) Exerce ao mutagnica sobre microrganismos, com conseqncias imprevisveis, como o
surgimento de novos agentes patognicos.
16) Destri a camada de oznio da estratosfera, diminuindo a proteo dos seres vivos da ao
mutagnica da radiao ultravioleta do Sol.
UEPG (2007_1) 5) A respeito da cadeia alimentar, assinale o que for correto.
01) A cadeia alimentar formada por produtores, consumidores e decompositores. Um dos
elementos fundamentais para a manuteno da vida o alimento que pode ter origem orgnica
ou inorgnica.
02) O segundo nvel trfico de uma cadeia alimentar ocupado por um ser consumidor
secundrio, que obtm seus nutrientes alimentando-se de consumidores primrios.
04) Os organismos auttrofos so capazes de produzir seus prprios compostos orgnicos a
partir dos inorgnicos. Os processos de fabricao de alimento so a fotossntese e a
quimiossntese. Por esse motivo, a ecologia os classifica como produtores.
08) Compondo o elo final da cadeia alimentar, existe uma categoria especial de consumidores.
Eles alimentam-se de excrementos e seres mortos. Fazem parte desta categoria os detritvoros
(minhoca e camaro), decompositores (microrganismos, fungos e urubus) e musgos.
16) A transferncia de energia e substncias ao longo da cadeia alimentar no pode ser
considerada um processo cclico pois as plantas no se alimentam por ingesto de outros seres
vivos.
UEPG (2007_1) 6) No que respeita aos conceitos ecolgicos, assinale o que for correto.
01) Entre os seres vivos, a transferncia energtica ao longo da cadeia alimentar um processo
cclico. A produo de matria orgnica pelos vegetais resulta da converso de energia luminosa
em energia qumica, que fica armazenada nas ligaes entre
os tomos de carbono e fsforo.
02) Dividindo um mesmo espao, ao mesmo tempo, normalmente existem vrias populaes
distintas. O conjunto destas populaes chamado comunidade ou biocenose.
04) O espao, geogrfico ou no, ocupado por determinada comunidade denominado bitopo.
08) Ao conjunto de relaes que os componentes da comunidade estabelecem entre si e com o
espao que ocupam (biocenose bitopo) d-se o nome de ecossistema ou sistema ecolgico.
16) Organismos de uma mesma espcie, sejam uni ou pluricelulares, quando habitam juntos
determinado espao, no mesmo intervalo de tempo, constituem uma populao.

95

UEPG (2008_1) 7) Percorrendo a orla martima, freqentemente nos deparamos com placas
alertando que a gua imprpria para o banho. O banho de mar pode ser, portanto, um perigo
para a sade. A respeito deste assunto, assinale o que for correto.
01) A gua do mar tem certa capacidade depuradora, o que significa que as bactrias
provenientes de contaminao pelo ser humano so destrudas por bacterifagos, protozorios
ou antibiticos produzidos por organismos marinhos.
02) Uma medida importante para a resoluo parcial do problema da poluio da gua do mar
a construo de interceptores submarinos, chamados de emissrios submarinos, cuja funo
levar os esgotos a grandes distncias, mar adentro.
04) Para saber o grau de poluio da gua do mar, as autoridades sanitrias fazem contagem da
bactria Escherichia coli, "mora-dora" habitual do intestino humano. Ela geralmente no causa
doenas. No entanto, sua presena em alta concentrao na gua do mar um indicador seguro
de contaminao por fezes. Nesse caso, grande a probabilidade de haver tambm outros
microorganismos que parasitam a espcie humana e que podem ser causadores de doenas.
08) Na historia da humanidade, as cidades litorneas sempre despejaram seu esgoto no mar. Isso
ocorre ainda hoje, e os dejetos so jogados no mar sem tratamento prvio. Esse procedimento
representa um grande risco de sade para milhes de banhistas, pois muitos microorganismos
causadores de doenas, presentes nas fezes humanas, so encontrados na gua. Os casos de
diarria, micoses, hepatite infecciosa e dengue aumentam muito no vero em cidades litorneas,
em conseqncia da contaminao pelo banho de mar.
UEPG (2008_1) 8) Com referncia Amaznia, assinale o que for correto.
01) o maior ecossistema do planeta, com grande diversidade de plantas e animais. O clima
quente e mido favorece o rpido crescimento das plantas.
02) A maior parte dos solos das terras firmes extremamente frtil, o que torna a Amaznia o
virtual celeiro do mundo.
04) uma tpica floresta pluvial tropical. As precipitaes so bem distribudas no decorrer do
ano, e as temperaturas so mais ou menos constantes. Trata-se de um ecossistema de grande
complexidade, no estgio clmax, e com inmeros nichos ecolgicos.
08) Da grande riqueza vegetal da Amaznia, destacam-se inmeras espcies de trepadeiras,
epfitas, cips lenhosos, palmeiras, seringueiras e castanheiras. Plantas de grande porte,
produtoras de boa madeira, como o angelim, a sucupira, a amburana e a copaba, tambm podem
ser encontradas na regio.
UEPG (2009_1) 9) A respeito do fenmeno da especiao, que se caracteriza pela formao de
duas ou mais novas espcies a partir de uma nica espcie, assinale o que for correto.
01) A especiao se inicia quando uma espcie pr-existente separada em dois grupos, ou
populaes, por algum tipo de barreira geogrfica impossvel de ser atravessada, como uma
montanha, uma ilha ou um deserto que no existiam antes.
02) Com a separao da espcie, cada populao passa a viver em condies ambientais
diferentes, que, com o tempo, selecionam determinados alelos. Depois, as mutaes e a
oscilao gnica tendem a transformar o pool gnico dessas populaes, acentuando as
diferenas entre elas.
04) Ocorre isolamento reprodutivo quando populaes resultantes de especiao desenvolvem
caractersticas que impedem o cruzamento delas. Neste caso, as populaes so consideradas
espcies distintas.
08) Se depois de muito tempo as populaes de uma mesma espcie que passou pelo processo
de especiao vierem a se encontrar, e os seus integrantes, ao se cruzarem entre si, gerarem
descendentes frteis e misturando diferentes alelos, estar comprovado que no ocorreu

96

isolamento reprodutivo, e as populaes so diferenciadas entre si como raas geogrficas ou


subgneros.
16) As espcies tornam-se mais bem adaptadas ao ambiente quando, com o tempo, tornam-se
comuns os genes que determinam caracteres favorveis para a sobrevivncia.
UEPG (2009_1) 10) Sobre conceitos bsicos de ecologia, assinale o que for correto.
01) Quando organismos de uma mesma espcie, sejam uni ou pluricelulares, habitam juntos
determinado espao, no mesmo intervalo de tempo, eles constituem uma comunidade.
02) Normalmente existem vrias populaes distintas dividindo um mesmo espao, ao mesmo
tempo. O conjunto dessas populaes recebe o nome de comunidade ou biocenose.
04) O espao ocupado por determinada comunidade, seja ele geogrfico ou no, denominado
sistema ecolgico.
08) Ecossistema o conjunto das relaes que os componentes de uma comunidade estabelecem
entre si e com o espao que ocupam.
16) A cadeia alimentar formada por seres produtores, consumidores e decompositores. Todos
eles utilizam alimentos de origem orgnica.
UEPG (2009_1) 11) A respeito de interaes ecolgicas entre organismos, assinale o que for
correto.
01) As interaes inter-especficas, que ocorrem entre organismos pertencentes a espcies
diferentes, so: mutualismo, protocooperao, comensalismo, amensalismo, predao,
parasitismo e competio.
02) As interaes intra-especficas, que ocorrem entre organismos de uma mesma espcie, so:
competio, colnias e sociedades. Elas tm as mesmas causas da competio entre espcies
diferentes: disputas por espao, luz e alimento, entre outras.
04) Colnias so interaes intra-especficas em que os componentes no sobrevivem
isoladamente.
08) O amensalismo se caracteriza por interaes inter-especficas em que apenas uma das
espcies se beneficia, enquanto a outra no chega a ser afetada.
16) No mutualismo, a relao intra-especfica no constitui uma interao obrigatria, pois cada
espcie envolvida pode viver na ausncia da outra.
UEPG (2009_1) 12) Sobre poluio, assinale o que for correto.
01) A poluio resulta do ato de introduzir no meio ambiente fatores qumicos ou fsicos em
nveis que comprometem o equilbrio dos ecossistemas.
02) Fosfatos, monxido e dixido de carbono, hidrocarbonetos e oznio so poluentes do ar.
04) H uma grande variedade de metais pesados cujo efeito txico para os seres vivos. Entre
eles figuram o nquel, o cromo, o cdmio, o mercrio e o chumbo. Todos eles so poluentes da
gua.
08) xidos de enxofre, nitratos, esgoto domstico e defensivos agrcolas so poluentes da gua.
16) O monxido de carbono, conhecido como gs carbnico, um dos produtos da respirao
celular aerbia. Presente no ar atmosfrico numa concentrao de cerca de 0,03%, ele
necessrio para o processo da fotossntese.

97

UFSC (2007) 13) Considere que em determinada regio existam 6 populaes de seres vivos. A
populao 1 constituda de vegetais e a populao 6 de microorganismos decompositores. A
populao 2 se alimenta da populao 4 que, por sua vez, se alimenta somente da populao 1.
A populao 5 se alimenta da populao 2 e da populao 4. Por fim, a populao 3 se alimenta
da populao 5.
De acordo com estas informaes, assinale a(s) proposio(es) CORRETA(S).
01.
Se a populao 3 desaparecer, espera-se que as populaes 2 e 4 diminuam.
02.
A nica populao que ocupa mais de um nvel trfico a 3.
04.
A populao 3 ocupa o primeiro nvel trfico e a populao 1 ocupa o ltimo.
08.
Existem relaes de predatismo e competio entre as populaes 2 e 5.
16.
Todas as populaes, exceto a 1, so carnvoras.
32.
A situao apresentada caracteriza uma teia com duas cadeias alimentares.
UFSC (2008) 14) Sobre estas relaes, assinale a(s) proposio(es) CORRETA(S).
01. Relaes interespecficas so aquelas estabelecidas entre indivduos de mesma espcie e
relaes intra-especficas so aquelas estabelecidas entre indivduos de espcies dife-rentes.
02. O predatismo e o parasitismo so exemplos de relaes desarmnicas.
04. Colnia uma associao entre indivduos da mesma espcie, que se mantm ligados
anatomicamente formando uma unidade estrutural.
08. O mutualismo um tipo de relao desarmnica interespecfica.
16. A bactria Mycobacterium tuberculosis um ectoparasita que causa a tuberculose no ser
humano.
32. Apesar do predatismo ser uma relao interespecfica desarmnica, ela pode ser benfica e
importante para o controle da populao de presas e a manuteno do equilbrio do ecossistema.
UFSC (2009) 15) O uso domstico dos recursos hdricos tem preocupado as autoridades
ambientais de todo o mundo, tanto no que diz respeito ao desperdcio de gua quanto sua
conservao.
Um estudo publicado recentemente na Revista Biotemas (www.biotemas.ufsc.br) d conta de
que possvel criar peixes (tilpias) em lagoas de estabilizao de efluentes domsticos tratados.
Segundo o artigo: O sistema de criao de peixes melhorou a qualidade do efluente gerado,
reduzindo as concentraes de nitrognio orgnico total e diminuindo os slidos suspensos. As
anlises de coliformes fecais, Salmonella sp. e Staphylococcus aureus dos efluentes e da carne
dos peixes produzidos ficaram dentro dos padres exigidos pela OMS (Organizao Mundial de
Sade).
A respeito do assunto, assinale a(s) proposio(es) CORRETA(S).
01. Quando uma quantidade excessiva de matria orgnica lanada nos rios e lagos pode haver
um fenmeno biolgico conhecido como eutrofizao.
02. O nitrognio, sob qualquer forma que se apresente na natureza, no participa da
composio qumica dos seres vivos.
04. A anlise quanto variao e quantificao de coliformes fecais um importante
indicador do grau de poluio da gua por esgotos domsticos.
08. Salmonelas e estafilococos presentes nas guas so bactrias muito comuns, responsveis
pelo fenmeno biolgico conhecido como mar vermelha.
16. Existem bactrias capazes de fixar o nitrognio atmosfrico e transferi-lo para o solo e para
algumas plantas, como o feijo e a soja.
32. A gua tratada dos efluentes domsticos das lagoas de estabilizao citadas no texto acima,
por ser txica no pode ser usada para nenhuma finalidade humana.

98

UFSC (2010) 16) Sobre as formaes fitogeogrficas ou Biomas existentes no Brasil, assinale
a(s) proposio(es) CORRETA(S).
01. O Cerrado uma formao fitogeogrfica caracterizada por uma floresta tropical que
cobre cerca de 40% do territrio brasileiro, ocorrendo na Regio Norte.
02. O Mangue ocorre desde o Amap at Santa Catarina e desenvolve-se em esturios, sendo
utilizados por vrios animais marinhos para reproduo.
04. A Caatinga caracterizada por ser uma floresta mida da regio litornea do Brasil, hoje
muito devastada.
08. O Pampa ocorre na Regio Centro-Oeste onde o clima quente e seco. A flora e a fauna
dessa regio so extremamente diversificadas.
16. A Floresta Amaznica est localizada nos estados do Maranho e do Piau e as rvores
tpicas dessa formao so as palmeiras e os pinheiros.
32. O Pantanal ocorre nos estados do Mato Grosso do Sul e do Mato Grosso, caracterizando-se
como uma regio plana que alagada nos meses de cheias dos rios.
64. A Mata Atlntica uma formao que se estende de So Paulo ao Sul do pas, onde
predominam rvores como o babau e a carnaba, e est muito bem preservada.
UFMS (2007) 17) Em relao ao denominado fluxo de energia em ecossistemas, assinale a(s)
proposio(es) correta(s):
(001) O processo de decomposio ocorre quando os produtores se alimentam dos
consumidores.
(002) A primeira fase da transferncia de energia ocorre por meio da herbivoria.
(004) Uma pequena parte da energia adquirida pelos consumidores transferida aos
decompositores.
(008) Os consumidores no so capazes de capturar energia.
(016) O fluxo de energia o caminho percorrido pela energia no ecossistema.
(032) O fluxo de energia no um fenmeno reconhecido no ecossistema, um processo apenas
intracelular.
UFMS (2008) 18) Sobre as relaes harmnicas e desarmnicas entre seres vivos de uma
comunidade, correto afirmar:
(001) Simbiose, sinnimo de mutualismo, uma relao harmnica, em que os participantes se
beneficiam e mantm relao de dependncia.
(002) Um exemplo de amensalismo (um tipo de relao desarmnica) a produo de
substncias por fungos que inibem o crescimento de bactrias.
(004) No parasitismo, os componentes dessa relao so denominados parasito (a espcie que se
beneficia) e hospedeiro (a espcie que no prejudicada). Os parasitos que vivem dentro do
corpo do hospedeiro so os endoparasitos, e os que vivem sobre o corpo do hospedeiro so os
ectoparasitos.
(008) A forsia considerada uma categoria de comensalismo. Como exemplo dessa relao, os
piolhos que vivem sobre pombos e podem utilizar moscas da famlia Hippoboscidae para serem
transportados de um pombo para outro.
(016) Alguns protozorios vivem no sistema digestrio de cupins, degradando a celulose, e o
resultado dessa degradao utilizado como alimento pelos cupins. A associao entre
protozorios e cupins denominada mutualismo.
(032) O canibalismo um caso de predao que ocorre quando um animal mata um outro
indivduo da mesma espcie e se alimenta dele.

99

UFMS (2008) 19) Ainda no ms de junho devem comear as obras de construo de duas usinas
hidroeltricas no Rio Madeira, no Estado de Rondnia. As usinas de Jirau e So Benedito tero
capacidade para gerar 6 mil megawatts de energia, o equivalente a 8% do consumo nacional. O
tamanho do projeto proporcional aos impactos que ele deve causar no meio ambiente, que
segundo especialistas, tero dimenses jamais vistas.
A criao de usinas hidreltricas, em que uma grande rea alagada de forma relativamente
rpida, pode causar a(s) seguinte(s) alterao(es) e conseqncia(s) ao meio ambiente:
(001) O corpo dgua passa de uma provncia ltica para lntica.
(002) No altera a composio dos organismos que ocorrem no corpo dgua.
(004) Diminui a quantidade de matria orgnica no corpo dgua.
(008) Impede o fenmeno da piracema se nenhuma medida reparadora for feita.
(016) Vrios organismos, sobretudo invertebrados, com pequena capacidade de deslocamento,
morrem por no conseguirem fugir da gua durante a formao do lago da usina.
(032) A formao do lago da usina favorece a colonizao de animais encontrados normalmente
em guas salobras.
UFMS (2009) 20) Vrias espcies de roedores silvestres foram infectadas por uma virose,
causando a morte de centenas de indivduos. Na carcaa desses roedores, h compostos
nitrogenados. Sobre o destino desses compostos nitrogenados no meio ambiente, assinale a(s)
proposio(es) correta(s).
(001) Os compostos nitrogenados do corpo dos roedores so transformados em amnia por ao
de fungos e bactrias decompositores.
(002) A amnia transformada em nitrito por ao de enzimas digestivas de minhocas que se
alimentam de amnia e excretam nitrito.
(004) O nitrito transformado em nitrato por bactrias quimiossintetizantes do gnero
Nitrobacter.
(008) O nitrato um dos compostos nitrogenados que podem ser assimilados pelas razes das
plantas.
(016) O nitrato absorvido pelas razes das plantas transforma-se novamente em amnia e
consumido por animais pastadores.
(032) A amnia, formada por ao de fungos e bactrias decompositoras, pode ser transformada
em nitrognio por bactrias desnitrificantes e retornar atmosfera.
UFMS (2010) 21) Leia o trecho a seguir, extrado e adaptado do Informativo Notcias da Onapintada, do Instituto Onapintada. "No Rio Araguaia, os pesquisadores tm observado botos
acuando peixes em guas rasas com parte de seu corpo para fora da gua. durante esse
momento, de acordo com os pescadores locais, que as onas-pintadas pulam, mordem e arrastam
os botos para fora do rio. Eles dizem ter visto a ona sobre o boto se alimentando da carcaa ao
longo do dia, e defendendo-a dos jacars. Sobre os animais que participam do episdio acima,
assinale a(s) proposio(es) correta(s).
(001) A ona-pintada, o boto-rosa e o jacar so animais tpicos encontrados no Pantanal sulmatogrossense. (002) Apesar de ser um animal aqutico, o boto-rosa apresenta, como rgo
responsvel pelas trocas gasosas, o pulmo.
(004) Na cadeia trfica, quando a ona-pintada preda o boto-rosa, ela um consumidor de
terceira ordem ou de qualquer nvel acima.
(008) O boto-rosa, por ser um animal aqutico, ovparo, como o jacar e a maioria dos peixes
de gua-doce.
(016) O boto-rosa e a ona-pintada so mamferos, e as fmeas alimentam seus filhotes com
leite produzido por glndulas mamrias.

100

(032) A interao entre a ona-pintada e o jacar, na disputa pela carcaa do boto-rosa,


benfica para ambos e denominada amensalismo.
UFMS (2010) 22) O Cerrado, que o segundo maior Bioma brasileiro, ocupa aproximadamente
2 milhes de hectares e apresenta grande biodiversidade, devido principalmente influncia de
outros biomas com os quais mantm contato (Floresta Amaznica, Floresta Atlntica, Caatinga,
Matas Secas e Pantanal). Entretanto, o Cerrado vem sofrendo com grandes desmatamentos
desde a dcada de 70, uma vez que no protegido por lei, e sua rea plana fez com que fosse
considerado o local ideal para o desenvolvimento de grandes culturas e pastagens. Assim, o
Cerrado sempre foi visto como uma fronteira agropastoril, onde, atravs da correo do solo
cido, tudo se produz.
Com relao ao aspecto geral da vegetao do Cerrado, correto afirmar:
(001) Apresenta rvores altas, de tronco retilnio e com casca lisa.
(002) Apresenta rvores baixas, com tronco retorcido e casca grossa como proteo ao fogo.
(004) As folhas so grandes e membranceas, para realizar maior quantidade de fotossntese.
(008) As razes so superficiais para facilitar a sua fixao.
(016) As folhas so pequenas e coriceas, para evitar a transpirao excessiva.
(032) As razes so profundas para facilitar a absoro de gua.
UEM (2008_1) 23) O nitrognio molecular (N2) o elemento qumico mais abundante na
atmosfera e, no entanto, a maioria dos seres vivos no consegue utiliz-lo
nessa forma. Sobre o ciclo do nitrognio no ambiente, assinale o que for correto.
01) Bactrias de vida livre so capazes de fixar o N2 atmosfrico na forma de amnia.
02) Bactrias associadas s razes de plantas leguminosas realizam a fixao do N2 em
nitratos e nitritos.
04) A maioria dos vegetais absorve o nitrognio do solo na forma de amnia.
08) No solo, a formao de nitrato realizada pelas bactrias quimiossintetizantes.
16) Bactrias nitrificantes degradam compostos nitrogenados, liberando N2 para a atmosfera.
UEM (2008_1) 24) Apenas no vo de ida e volta entre So Paulo e Paris emitida mais de uma
tonelada de CO2. Essa emisso pode ser compensada com o plantio de
rvores, pois os vegetais transformam gs carbnico em oxignio durante a fotossntese.
Considerando o exposto, assinale o que for correto.
01) A afirmao sobre a fotossntese est correta, pois o oxignio liberado pelos vegetais
retirado do CO2.
02) A afirmao sobre a fotossntese est errada, pois o CO2 no participa da fotossntese, que
depende apenas da energia luminosa.
04) A afirmao sobre a fotossntese est errada, pois, durante a fotossntese, no ocorre
liberao de oxignio.
08) A afirmao sobre a fotossntese est correta, pois o oxignio liberado pelos vegetais
retirado das molculas de gua.
16) A afirmao sobre a emisso de CO2 est correta, pois esse gs liberado durante a
queima do combustvel utilizado nas aeronaves.

101

UEM (2008_1) 25) Com relao distribuio dos organismos na biosfera, assinale o que for
correto.
01) Quando duas espcies exploram nichos ecolgicos semelhantes, estabelece-se, entre
elas, competio por um ou mais recursos do meio.
02) A comunidade de uma floresta compe-se de populaes de vrias espcies que convivem
umas com as outras e que se inter-relacionam.
04) Em ambientes equilibrados, no h interferncia de fatores abiticos sobre as populaes.
08) A distribuio dos organismos independe da radiao solar que atinge a Terra.
16) A biosfera o conjunto de ecossistemas de terra firme.
UEM (2008_2) 26) Sobre o fluxo de energia nos ecossistemas, assinale o que for correto.
01) A produo primria bruta a quantidade de biomassa produzida pelos auttrofos em
determinada rea, durante dado intervalo de tempo.
02) As pirmides ecolgicas, inclusive a de energia, no representam o nvel dos
decompositores.
04) A produo primria lquida corresponde matria orgnica que incorporada aos tecidos
dos herbvoros.
08) A produo secundria lquida a energia utilizada pelos consumidores primrios para
manuteno de suas atividades.
16) A luz solar captada e transformada pelos produtores e transferida de um organismo para
outro, ao longo das cadeias alimentares.
UEM (2008_2) 27) Sobre os biomas brasileiros, assinale o que for correto.
01) Os manguezais podem penetrar vrios quilmetros no continente, seguindo o curso de rios,
cujas guas se misturam com o mar durante as mars cheias.
02) O pantanal mato-grossense ou complexo do pantanal uma vasta plancie inundada que
abriga uma das mais ricas reservas de vida selvagem do mundo.
04) O estrato ou andar superior das florestas amaznica, atlntica e de araucria composto
pelas mesmas espcies de rvores.
08) O cerrado situado, por exemplo, em Minas Gerais um tipo de savana, geralmente com
rvores de troncos retorcidos.
16) A vegetao da caatinga formada por plantas com marcante adaptao ao clima seco,
como aquelas cujas folhas se transformaram em espinhos.
UEM (2008_2) 28) Identifique o que for correto sobre as relaes ecolgicas entre os seres
vivos de uma comunidade.
01) A competio intra-especfica, na qual os indivduos de uma mesma espcie competem por
recursos do ambiente, no ocorre entre vegetais.
02) Sociedade uma relao entre indivduos de uma mesma espcie, em que h diviso de
trabalho, como observado em abelhas e em formigas.
04) No inquilinismo e no comensalismo, ambos os participantes da relao so prejudicados.
08) A relao entre a lombriga e o ser humano do tipo parasitismo.
16) A relao entre herbvoros ruminantes e as bactrias que digerem a celulose no seu tubo
digestrio exemplo de predatismo.
UEM (2008_2) 29) Considere os ciclos biogeoqumicos e assinale o que for correto.
01) O gs oznio (O3) constitui uma camada que protege a Terra de radiao nociva,
relacionada com mutao de genes e cncer de pele.
02) Na Terra, s h formas no-renovveis de carbono, como o carvo mineral e o petrleo.
04) Na desnitrificao, compostos nitrogenados so convertidos para nitrato ou nitrito.

102

08) Na prtica agrcola de rotao de culturas, as gramneas aumentam o teor de nitrognio


assimilvel para as leguminosas.
16) Fungos e bactrias decompem a matria orgnica, independentemente dos ciclos
biogeoqumicos dos quais faam parte.
UEM (2009_1) 30) Identifique o que for correto.
01) As chuvas cidas formadas a partir dos poluentes atmosfricos SO2 e NO2 provocam danos
vegetao, contaminam solo e gua e corroem construes e monumentos.
02) Na protocooperao, a unio entre os organismos obrigatria e permanente.
04) Em uma regio de intenso garimpo de ouro, o mercrio concentra-se mais no fitoplncton do
que nos peixes carnvoros.
08) Baleias e tubares so organismos bentnicos de ecossistemas marinhos.
16) A resistncia do meio ou resistncia ambiental, definida como o conjunto de fatores que
limitam o crescimento de uma populao, decresce proporcionalmente com o aumento da
densidade populacional.
UEM (2009_1) 31) Considere que a constituio da atmosfera atual da Terra seja CO2 (0,03%),
N2 (79%) e O2 (21%) e assinale o que for correto.
01) A transformao do NO3 para N2, o qual retorna para a atmosfera, realizada por
bactrias nitrificantes.
02) O efeito estufa, fenmeno presente na atmosfera terrestre apenas a partir do sculo XIX,
resulta da presena excessiva de gases atmosfricos como o CO2.
04) A manuteno da quantidade dos gases que compem a atmosfera da Terra independe da
atuao dos seres vivos.
08) A atmosfera primitiva da Terra era constituda pelos mesmos gases citados no enunciado.
Porm a quantidade de O2 era maior que a do CO2.
16) O oxignio participa da formao da camada de oznio da atmosfera, exercendo importante
papel na filtrao da energia ultravioleta longa.
UEM (2009_1) 32) Assinale o que for correto.
01) O ambiente em que vive determinada espcie ou comunidade, caracterizado por suas
propriedades fsicas e biticas, o habitat dessa espcie.
02) De acordo com o princpio de Gause, ou princpio da excluso competitiva, a coexistncia
de duas ou de mais espcies em um mesmo habitat requer que seus nichos ecolgicos sejam
iguais.
04) A transferncia de energia entre os produtores e os consumidores de uma cadeia alimentar
unidirecional.
08) Representantes da espcie humana, apesar de terem dieta onvora, ocupam sempre o mesmo
nvel trfico, em todas as cadeias alimentares de que participam.
16) O processo de sucesso ecolgica que se inicia em uma rocha nua conhecido como
sucesso primria.
UEM (2009_2) 33) Identifique o que for correto em Ecologia, a cincia que estuda as relaes
dos organismos com os componentes biticos e abiticos dos ecossistemas.
01) O conjunto das perobas e dos ips-roxos presentes no Horto Florestal Dr. Lus Teixeira
Mendes, em Maring-PR, constituem uma populao heterognea de vegetais.
02) As pirmides ecolgicas podem ser de nmeros, de biomassa ou de energia. Qualquer que
seja o ecossistema analisado, a pirmide de energia no pode ser invertida.

103

04) A sucesso que ocorre em uma duna (primria) demora menos tempo do que a observada em
uma floresta recm-derrubada (secundria), para o estabelecimento de uma comunidade estvel
ou comunidade clmax.
08) A radiao solar, ao contrrio da umidade e dos ventos, no considerada um componente
abitico dos ecossistemas da Terra, visto ter origem fora da nossa biosfera.
16) A relao entre uma orqudea e o tronco de uma rvore, onde a epfita estiver crescendo,
representa um caso de inquilinismo.
UEM (2010_1) 34) Sobre o fluxo de energia e matria nos ecossistemas, assinale o que for
correto.
01) Um banco de coral rene uma comunidade de seres marinhos, na qual energia e matria
fluem entre os nveis trficos.
02) A transferncia de energia ao longo das cadeias alimentares unidirecional. A energia
gradualmente dissipada ao passar pelos nveis trficos.
04) Em uma cadeia alimentar, os herbvoros (consumidores primrios) tm a sua disposio toda
a energia originalmente armazenada nas substncias orgnicas produzidas pela fotossntese.
08) A produtividade primria lquida relativamente maior em uma floresta do que no ambiente
marinho, porque as rvores crescem lentamente e acumulam muita matria orgnica em seus
troncos.
16) As pirmides ecolgicas constituem maneiras de expressar, graficamente, a estrutura dos
nveis trficos de uma cadeia alimentar, em termos de energia, biomassa e nmero de
indivduos.
UEM (2010_1) 35) No que se refere s colnias, assinale o que for correto.
01) Correspondem a relaes interespecficas harmnicas em que os indivduos associados se
acham unidos por um substrato comum, revelando um pequeno grau de liberdade em termos de
deslocamento de seus componentes e uma profunda interdependncia fisiolgica.
02) Existem dois tipos de colnias: homomorfas, tambm denominadas isomorfas ou
homotpicas, e heteromorfas, tambm denominadas polimorfas ou heterotpicas.
04) A caravela-portuguesa (Physalia sp) um cnidrio marinho em que se encontram indivduos
especializados em promover proteo, defesa, flutuao, natao e reproduo.
08) Volvox sp vive em gua doce e forma uma esfera oca de centenas de indivduos unicelulares
biflagelados, dispostos lado a lado. Dentro dessa esfera, h indivduos sem flagelos, capazes de
originar, assexuadamente, colnias menores que ficam contidas por certo tempo no interior da
colnia-me.
16) Diversos tipos de bactrias formam colnias relativamente simples, em que um conjunto de
organismos compartilha uma massa gelatinosa, produzida pela colaborao de todos.
UEM (2010_1) 36) Identifique o que for correto em Ecologia, uma cincia multidisciplinar.
01) A introduo de espcies em determinado local sempre vantajosa, pois aumenta a
biodiversidade.
02) A agricultura, ao utilizar o controle biolgico como alternativa ao uso excessivo de
inseticidas, contribui para no aumentar a poluio das guas e dos solos.
04) A floresta atlntica um dos biomas brasileiros que apresenta maior diversidade, tanto de
vegetais quanto de animais. A alta diversidade atribuda reduzida explorao humana.
08) A espcie humana no participa do ciclo do carbono, pois no somos produtores, como os
organismos clorofilados, nem decompositores, como as bactrias e os fungos.
16) Quando afirmamos que certa espcie vive na praia e que outra vive na copa das rvores,
estamos nos referindo aos hbitats dessas espcies.

104

UEM (2010_2) 37) O lixo urbano vem sendo produzido em quantidade cada vez maior, devido
produo crescente de embalagens descartveis e ao consumo de produtos industrializados.
Considerando a poluio ambiental causada pelo lixo,
assinale o que for correto.
01) Pilhas e baterias de aparelhos eletrnicos, que contm produtos txicos, podem ser
descartadas junto com o lixo orgnico residencial somente se estiverem bem embaladas, para
evitar o vazamento desses produtos.
02) A coleta seletiva do lixo, realizada em vrias cidades, contribui para a melhoria da qualidade
de vida, porque emprega mais pessoas como mo de obra na separao dos itens recolhidos.
04) O lixo residencial, quando separado, pelo menos em orgnico e reciclado, permite a
produo de adubo, atravs da compostagem, e tambm o reaproveitamento do papel, do
plstico, do vidro e do metal, que retornaro s indstrias como matriaprima
08) Os lixes, formados pelo acmulo indiscriminado do lixo a cu aberto, so responsveis por
intensa proliferao de moscas, baratas e ratos. Alm disso, o solo ser contaminado por metais
e outros produtos txicos.
16) Os aterros sanitrios devem ser evitados, porque o gs metano, resultado da decomposio
orgnica, no pode ser aproveitado como combustvel natural em residncias e indstrias.
UEM (2010_2) 38) Considerando as relaes entre os seres vivos e sucesso ecolgica, assinale
o que for correto.
01) No parasitismo, o hospedeiro recebe benefcios do parasita, como proteo decorrente da
sua presena.
02) O controle biolgico uma tcnica no poluente usada no controle de muitos insetos, como
pulges ou lagartas prejudiciais s plantaes de milho, trigo e soja, por exemplo.
04) As plantas carnvoras, capazes de aprisionarem e digerirem insetos, so enquadradas na
relao desarmnica predatismo, tal qual os animais herbvoros.
08) As plantaes de caf e laranja, em fase de produo, so exemplos tpicos de comunidade
clmax, pois outras espcies vegetais no tero espao para se desenvolverem nessas reas.
16) Um exemplo de sucesso secundria verificado em uma determinada ilha que recuperou a
vegetao arbustiva aps 100 anos da ocorrncia de uma erupo vulcnica, quando as lavas
destruram toda a vegetao nativa.
UEM (2010_2) 39) Sobre os ciclos biogeoqumicos, assinale o que for correto.
01) A gua que incorporada nos tecidos dos vegetais e dos animais e que devolvida ao
ambiente, aps a morte destes, faz parte do pequeno ciclo ou ciclo curto, uma vez que o
deslocamento da gua fica restrito proximidade do solo.
02) A evaporao dos lagos, rios e mares e a transpirao oriunda dos seres vivos participam do
ciclo hidrolgico, e a gua que retorna ao solo, em forma de chuva, ter imprescindvel papel na
formao do lenol fretico.
04) O elemento qumico carbono, presente nas molculas orgnicas, disponibilizado na
atmosfera na forma de gs carbnico liberado pela respirao, decomposio de vegetais e
animais mortos e pela queima dos combustveis fsseis.
08) O mtodo de fertilizar o solo com leguminosas aumenta a quantidade de nitrognio fixado,
porque a adubao verde estimula a atividade fotossinttica pelo acrscimo de clorofila ao meio.
16) A atmosfera terrestre disponibiliza o gs oxignio, o gs carbnico, o oznio e o vapor de
gua como elementos participativos no ciclo do oxignio.

105

UEM (2011_1) 40) Sobre ecossistemas e sucesso ecolgica, analise as alternativas e assinale o
que for correto.
01) Nos ecossistemas onde os fatores abiticos so adequados e disponveis, verifica-se maior
nmero de espcies, como ocorre nas faixas litorneas, esturios de rios e nas florestas pluviais.
02) O aparecimento de novos nichos durante a sucesso ecolgica leva ao aumento da
biodiversidade, diminuindo a biomassa do ecossistema em sucesso.
04) Uma elevada diversidade de espcies torna o ecossistema mais complexo, com maior
nmero de nichos ecolgicos, garantindo o equilbrio da comunidade clmax, diminuindo a
probabilidade de ocorrer mudanas drsticas.
08) As queimadas, comuns na estao seca em diversas regies brasileiras, podem provocar a
destruio da vegetao natural, e na sequncia ocorre o processo denominado sucesso
primria.
16) No ambiente marinho, as comunidades so divididas em trs grandes grupos: plncton,
ncton e bentos, de acordo com a capacidade de movimentao dos organismos e os locais que
ocupam.
UEM (2011_1) 41) Sobre cadeias e teias alimentares, assinale o que for correto.
01) A transferncia de energia no ecossistema unidirecional: comea com a captura da energia
luminosa pelos produtores e prossegue diretamente para os consumidores tercirios.
02) Os organismos consumidores so hetertrofos, isto , no produzem matria orgnica a
partir de substncias inorgnicas.
04) Os herbvoros ocupam o mesmo nvel trfico, porm, nichos diferentes.
08) Um determinado organismo dentro de uma teia alimentar pode ocupar diferentes nveis
trficos.
16) A coruja, ao se alimentar de um rato, que se alimentou de plantas, considerada um
consumidor secundrio e ocupa o segundo nvel trfico de uma cadeia alimentar.
UEM (2011_1) 42) Em relao ao parasitismo, assinale o que for correto.
01) uma relao desarmnica, em que o parasito se nutre do hospedeiro at lev-lo
rapidamente morte.
02) O desenvolvimento de estruturas de fixao e a grande capacidade reprodutiva so algumas
adaptaes vida parasitria.
04) As orqudeas so consideradas ectoparasitas de plantas, pois se nutrem da planta hospedeira.
08) Em geral, parasitos e hospedeiros adaptam-se uns aos outros, a fim de que a relao cause
poucos prejuzos ao organismo parasitado.
16) O controle biolgico de pragas utilizando parasitos mais eficiente do que o uso de
agrotxicos, por ser mais especfico e no poluir o ambiente.
UEM (2011_1) 43) O filme Rio conta a histria de Blu, o ltimo espcime macho de ararinhaazul (apesar de na sinopse do filme constar arara-azul), que foi contrabandeado para os EUA,
onde se torna bastante domesticado. Sobre esse assunto, correto afirmar que
01) a retirada de uma espcie de seu ambiente de origem e a sua introduo em outro
recomendada para que possa garantir a manuteno da biodiversidade.
02) a eliminao de espcies silvestres bastante danosa, pois desestabiliza as cadeias
alimentares, diminui a biodiversidade e reduz o banco gentico do planeta.
04) a ararinha-azul j foi declarada oficialmente extinta pelo IBAMA.
08) a fim de recuperar a diversidade biolgica seria adequado acasalar Blu com uma fmea de
outra espcie.
16) aes antrpicas, como a introduo de espcies e a extino de espcies, causam grande
desequilbrio ambiental.

106

UEM (2011_2) 44) No vero, muitas pessoas apreciam ficar se bronzeando ao sol, nas praias ou
piscinas, por acharem que um bom bronzeado sinal de bem-estar e de vitalidade. Mas no
bem assim. A radiao solar podem trazer srias consequncias para o corpo, como queimaduras
e at cncer de pele. Sobre isso, assinale a alternativa correta.
01) A radiao ultravioleta capaz de alterar a molcula de DNA, levando ao desenvolvimento
do cncer de pele.
02) A destruio da camada de oznio aumenta a incidncia de radiao ultravioleta sobre a
superfcie da Terra.
04) Os agentes mutagnicos, fsicos ou qumicos, podem elevar a incidncia das mutaes.
08) Mutaes provocadas pela radiao solar fazem com que o organismo adquira resistncia a
esse tipo de radiao.
16) Parte da radiao solar que chega Terra refletida pelas nuvens e pela superfcie terrestre;
outra parte absorvida pelo solo e reirradiada para a atmosfera na forma de calor. Esse
fenmeno natural denominado inverso trmica.
UEM (2011_2) 45) A separao dos continentes por grandes massas de gua, desertos ou
cordilheiras impede ou dificulta a disperso das espcies animais, que tendem a se estabelecer
em reas compatveis com suas caractersticas adaptativas. A esse respeito, correto afirmar
que:
01) a regio faunstica tropical abrange a frica e parte da sia, tendo como animais tpicos
elefantes, gorilas, onas, tatus e uma imensa variedade de aves.
02) o bioma taiga situa-se no hemisfrio norte e apresenta fauna composta por alces, ursos,
lobos, raposas, martas e esquilos.
04) alguns animais do deserto saem das tocas apenas noite, produzem urina concentrada, e
outros passam a vida inteira sem beber gua, extraindo-a do alimento que ingerem.
08) o lobo do rtico, do bioma tundra, apresenta a pelagem acinzentada no vero e branca no
inverno, camuflando-se para facilitar a captura de presas.
16) o bioma savana caracteriza-se por apresentar rvores de grande porte e tem uma fauna
composta de grandes herbvoros (antlopes, zebras, girafas).
UEM (2011_2) 46) Sobre os ciclos do carbono, do oxignio e da gua, assinale a(s)
alternativa(s) correta(s).
01) No ciclo do carbono, a forma inorgnica transformada na forma orgnica pela fotossntese.
02) No ciclo da gua, alm da passagem vapor-lquido e vice-versa, em funo de fatores
fsicos, ocorre tambm a interferncia dos seres vivos, pois, durante a fotossntese, ocorre o
consumo e, durante a respirao, ocorre a liberao de gua.
04) O carbono um elemento essencial na composio dos seres vivos e retorna atmosfera sob
forma de gs carbnico, atravs da combusto, da transpirao e da oxidao.
08) O gs oznio pode ser formado em baixas altitudes e resultado do aumento de certos gases
poluentes, como xidos de nitrognio, hidrocarbonetos e perxidos de hidrognio.
16) Os seres auttrofos utilizam oxignio livre para construir suas biomolculas atravs da
fotossntese.

107

UEM (2011_2) 47) Sobre a dinmica populacional, correto afirmar que


01) o equilbrio dinmico de uma populao atingido quando a resistncia do meio est em
equilbrio com seu potencial bitico.
02) as oscilaes peridicas nas populaes de alguns predadores tambm so provocadas pelas
oscilaes nas populaes de presas.
04) quando duas espcies ocupam o mesmo habitat, mas no ocupam o mesmo nicho, ocorre
entre elas competio intraespecfica.
08) quando uma populao vive em situao de espao limitado e de alimentao abundante se
espera que ocorra um crescimento seguindo seu potencial bitico.
16) a taxa de crescimento populacional pode ser definida como o nmero de indivduos de uma
mesma espcie que vivem em determinada rea ou volume.
UEM (2011_2) 48) Vive-se hoje a era dos descartveis. O descarte de objetos aumenta cada
vez mais, motivado pelo crescimento da sofisticao de embalagens, de computadores e de
eletrodomsticos a cada ano mais obsoletos e por propagandas que estimulam o consumismo.
Assim, os lixes nas cidades vo ficando cada vez mais cheios. A esse respeito, assinale o que
for correto.
01) Queimar os detritos a melhor alternativa para solucionar o problema do lixo, pois essa
ao reduz bastante o seu volume, destri organismos causadores de doenas e diminui as reas
para aterro.
02) Os lixes a cu aberto favorecem a transmisso de doenas e a poluio.
04) Nos aterros sanitrios, bactrias aerbias decompem a matria orgnica, liberando o gs
metano.
08) A coleta seletiva e a reciclagem dos materiais so alternativas que evitam a derrubada de
milhares de rvores, alm de se constiturem em fonte de renda para muitas pessoas.
16) O biogs produzido no processo de incinerao do lixo pode ser utilizado para gerao de
energia, como combustvel residencial, industrial ou de veculos motorizados, contribuindo para
reduzir as emisses de carbono para a atmosfera.
UEM (2009_1) 49) Sobre as relaes entre florestas, desmatamento e biodiversidade, assinale o
que for correto.
01) O desmatamento em grande escala pode provocar alteraes locais e/ou regionais do clima e
reduzir o abastecimento dos reservatrios de gua subterrneos.
02) A grande biodiversidade das florestas tropicais e equatoriais tem estimulado a biopirataria.
Isto , o contrabando de espcies e o patenteamento dos seus princpios ativos, com o objetivo
de desenvolver medicamentos e outras matrias-primas.
04) A explorao de minrios a principal responsvel pelo desmatamento nas reas de florestas
equatoriais e tropicais. A Amaznia Brasileira um exemplo dessa situao.
08) Cerca de 80% das espcies animais e vegetais j esto catalogadas, o que indica um grande
conhecimento do patrimnio gentico do planeta.
16) As florestas equatoriais e tropicais tm sua ocorrncia restrita aos continentes sul-americano
e africano. O Brasil e a Nigria abrigam 40% do que resta dessas florestas no globo.

108

UEM (2010_02) 50) Considerando os diferentes biomas e ecossistemas, assinale o que for
correto.
01) No deserto, como o Saara, a vegetao pouco abundante e vrias plantas se desenvolvem
apenas nos curtos perodos de disponibilidade de gua. A fauna pobre, sendo constituda
basicamente por alguns artrpodes, rpteis e mamferos.
02) No cerrado brasileiro, as rvores so de tronco liso, formam agrupamentos densos,
compactos e alcanam grandes alturas. O lobo-guar e o tamandu-bandeira no so
encontrados nesse bioma.
04) Na tundra, que ocorre prxima calota polar do hemisfrio Norte, o clima muito frio e
seco, e as plantas herbceas dividem o ambiente com musgos e liquens, que servem de alimento
para o boi almiscarado.
08) Nas florestas temperadas, com rvores caduciflias, como o carvalho, o clima
caracterizado por quatro estaes bem definidas, o solo rico em matria orgnica e, enquanto
muitas aves migram no inverno, os ursos hibernam.
16) O pantanal apresenta fauna muito rica e grande nmero de indivduos por espcie. O
material orgnico trazido pelas inundaes peridicas ocasionadas pelas guas que extravasam
dos rios da bacia do rio Paraguai contribui para a fertilidade do solo.
GABARITO:
1-GAB: 16+64=80
2-GAB: 01+08=09
3-GAB: 02+08+19=26
4-GAB: 04+16=20
5-GAB: 01+04=05
6-GAB: 02+04+08+16=30
7-GAB: 01+02+04=07
8-GAB: 01+04+08=13
9-GAB: 01+02+04+16=23
10-GAB: 02+08=10
11-GAB: 01+02+04=07
12-GAB: 01+04=05
13-GAB: 01+08+32=41
14-GAB: 02+04+32=38
15-GAB: 01+04+16=21
16-GAB: 02+32=34
17-GAB: 04+16=20
18-GAB: 02+08+16+32=58
19-GAB: 01+08+16=25
20-GAB: 01+04+08+32=45
21-GAB: 02+04+16=22
22-GAB: 02+16+32=50
23-GAB: 01+08=09
24-GAB: 16
25-GAB: 01+02=03
26-GAB: 01+02+16=19
27-GAB: 01+02+08+16=27
28-GAB: 02+08=10
29-GAB: 01+06=17
30-GAB: 01
31-GAB: 16

109

32-GAB: 01+04+16=21
33-GAB: 02+16=18
34-GAB: 01+02+16=19
35-GAB: 02+04+08+16=30
36-GAB: 02+16=18
37-GAB: 04+08=12
38-GAB: 02
39-GAB: 02+04+16=22
40-GAB: 01+04+16=21
41-GAB: 02+04+08=14
42-GAB: 02+08+16=26
43-GAB: 02+04+16=22
44-GAB: 01+02+04=07
45-GAB: 02+04+08=14
46-GAB: 01+02+08=11
47-GAB: 01+02=03
48-GAB: 02+08=10
49-GAB: 01+02=03
50-GAB: 01+04+08+16=29

110

EVOLUCIONISMO E PROCESSOS ADAPTATIVOS


UFSC (2008) 1) Jean-Baptiste Antoine de Monet (1744-1829), tambm chamado Jean-Baptiste
Lamarck, e Charles Darwin (1809-1882) deram importante contribuio para o pensamento
evolucionista.
Sobre suas idias, CORRETO afirmar que:
01. Lamarck acreditava que a adaptao dos seres vivos ao ambiente era resultado de
modificaes lentas e graduais ao longo de inmeras geraes.
02. de acordo com Darwin, os indivduos sofrem mutaes com o propsito de melhor se
adaptarem ao meio em que vivem, e assim deixarem descendentes mais bem adaptados.
04. de acordo com Lamarck, o uso freqente e repetido de um rgo o fortalece, enquanto o
desuso de tal rgo o enfraquece, processo que atualmente conhecido como evoluo
divergente.
08. Darwin apresentou as observaes de fsseis das ilhas Galpagos em defesa de suas idias.
UFSC (2009) 2) Existem vrias provas da evoluo e dentre elas podemos citar as
embriolgicas.
Sobre o tema, CORRETO afirmar que:
01. as nadadeiras dos golfinhos, assim como brao e mo humanos, so ditos rgos homlogos
e so herdados de um ancestral comum.
02. as nadadeiras dos golfinhos e as asas das aves tm a mesma origem embrionria e diferentes
funes, decorrentes da adaptao a diferentes modos de vida, processo conhecido como
divergncia evolutiva.
04. as nadadeiras dos golfinhos e as nadadeiras das tainhas so rgos de diferentes origens
embrionrias e tm a mesma funo, o que chamado de convergncia evolutiva.
08. as asas dos insetos e as asas das aves so ditos rgos homlogos, pois tm a mesma origem
embrionria.
16. as nadadeiras dos golfinhos, as asas dos morcegos e os braos e as mos dos humanos tm
origem embrionria diferente.
32. as baleias, os golfinhos, os peixes-boi e as focas pertencem ordem dos cetceos, pois
possuem rgos anlogos e sinrgicos em comum, como as nadadeiras e a bexiga natatria.
UFSC (2010) 3) Em 2009 comemora-se 200 anos do nascimento de Charles Darwin e 150 anos
da publicao do livro A Origem das Espcies, obra que coroou um extenso trabalho de Darwin
e foi um marco no estudo da Biologia.
Sobre evoluo, assinale a(s) proposio(es) CORRETA(S).
01. O francs Jean Baptiste Lamarck contribuiu de maneira significativa com o trabalho de
Darwin, pois ele j defendia a ideia de que a modificao das espcies era devido seleo
natural.
02. Uma das bases da teoria de Darwin foi a Lei da Herana dos Caracteres Adquiridos, que,
embora com mais de 200 anos, se mantm atual at os dias de hoje.
04. Segundo a hiptese da seleo natural, grandes modificaes nos indivduos so transmitidas
de pai para filho.
08. No livro A Origem das Espcies, Darwin formulou a hiptese de que o ambiente selecionava
os mais aptos (seleo natural), que tinham mais chances de sobreviver e deixar descendentes.
16. Os fsseis, a semelhana embriolgica entre as espcies e a existncia de estruturas
vestigiais desprovidas de funo nos animais so evidncias da evoluo.
32. Segundo Darwin, o aparecimento de novas mutaes influenciado pelo meio ambiente.

111

UFMS (2007) 4) Lembre-se dos conceitos de especiao e assinale a(s) alternativa(s) que se
adeqe(m) a esse conceito.
(001) A especiao o nome dado ao processo de surgimento de novas espcies a partir de uma
espcie ancestral.
(002) Para que ocorra a especiao, no necessrio que grupos da espcie original se separem
e deixem de cruzar. Ela pode ocorrer sem isolamento geogrfico.
(004) Se, aps certo tempo de isolamento geogrfico, os descendentes dos grupos originais
voltarem a se encontrar, fatalmente ainda haver possibilidade de reproduo entre eles.
(008) O sucesso do processo de especiao ocorrer se o isolamento reprodutivo se confirmar.
(016) O isolamento geogrfico a separao fsica de organismos da mesma espcie por
barreiras geogrficas intransponveis e que impedem o seu encontro e cruzamento.
(032) Quando as barreiras geogrficas so rompidas precocemente, mas os grupos j
acumularam diferenas que os distinguem entre si, ao se reproduzirem, do origem a raas.
Portanto, raas ocorrem quando essas diferenas no so suficientemente significativas para
originarem novas espcies.
UEM (2008_1) 5) Considerando os conceitos de evoluo, assinale o que for correto.
01) A sndrome de Down resultado de mutao induzida por radiaes ionizantes.
02) As alteraes de freqncias gnicas de uma populao no so afetadas pela seleo
natural.
04) Na deriva gnica, os sobreviventes de uma alterao climtica, por exemplo, podem no
representar a composio gentica da populao primitiva.
08) A especiao se completa com o surgimento de isolamento reprodutivo, cujos processos
podem ser pr-zigticos ou ps-zigticos.
16) Anagnese o processo pelo qual duas populaes isoladas diferenciam-se no decorrer do
tempo, originando duas novas espcies.
UEM (2008_2) 6) Identifique o que for correto sobre a evoluo biolgica das espcies.
01) As mutaes no ocorrem para adaptar o indivduo ao ambiente, elas podem ocorrer por
acaso e serem mantidas ou eliminadas.
02) No mimetismo, uma ou mais caractersticas corporais se assemelham ao ambiente,
dificultando a localizao do organismo pelas demais espcies com as quais convive.
04) Estruturas anlogas so aquelas que derivam de estruturas presentes em um mesmo grupo
ancestral comum, refletindo, portanto, parentesco evolutivo.
08) A ao da seleo natural aumenta a variabilidade gentica de uma populao.
16) A lei do uso e do desuso est presente nas teorias de evoluo propostas por Darwin e por
Lamark.

112

UEM (2009_2) 7) Com relao evoluo biolgica e especiao, assinale o que for correto.
01) Um dos princpios bsicos das ideias evolucionistas por seleo natural que os organismos
com variaes favorveis s condies do ambiente onde vivem tm maiores chances de
sobreviver, quando comparados aos organismos com variaes menos favorveis.
02) As mutaes podem ocorrer em clulas somticas ou em clulas germinativas, sendo estas
ltimas de fundamental importncia para a evoluo, pois so transmitidas aos descendentes.
04) A resistncia de bactrias a antibiticos e de insetos a inseticidas, por terem a interferncia
humana na fabricao dessas substncias, no podem ser exemplos de seleo natural.
08) A cladognese um processo envolvido na especiao que, pela ruptura da coeso original
em uma populao, gera duas ou mais populaes que no podem mais trocar genes entre seus
indivduos.
16) O desenvolvimento de mecanismos que determinam o isolamento reprodutivo importante
na especiao. A inviabilidade do hbrido e a esterilidade do hbrido so mecanismos pszigticos de isolamento reprodutivo.
UEM (2010_1) 8) Vrias teorias evolutivas surgiram, destacando-se as de Lamarck e de DarwinWallace. Posteriormente, foi formulada a teoria sinttica da evoluo, que incorpora os
conceitos modernos da Gentica queles conceitos essenciais de evoluo por seleo natural.
Nesse contexto, assinale o que for correto.
01) A lei do uso ou desuso foi elaborada por Lamarck, com base na observao de certos rgos
corporais que se desenvolvem, quando so muito utilizados, e atrofiam-se, quando pouco
solicitados.
02) A lei da transmisso de caracteres adquiridos foi proposta por Wallace em 1809 e, por
complementar as idias de Lamarck, constitui, juntamente com a lei do uso e desuso, a essncia
do lamarkismo.
04) Muitas das observaes que levaram Charles Darwin a elaborar a teoria evolucionista
ocorreram durante sua viagem ao redor do mundo, a bordo do navio ingls Beagle.
08) Em seu livro, Darwin propunha duas idias centrais: (1) todos os organismos no descendem
de ancestrais comuns, pois (2) um dos agentes de modificao a ao da seleo natural sobre
as variaes individuais.
16) A tese de Thomas Malthus (1766-1834) sobre a disparidade entre a tendncia de
crescimento das populaes em progresso geomtrica e a tendncia de aumento dos recursos
alimentares em progresso aritmtica despertou a ateno de Darwin para o mecanismo de luta
pela vida na natureza.
UEM (2010_2) 9) Assinale a(s) alternativa(s) correta(s) sobre a teoria sinttica e a especiao.
01) A teoria sinttica foi proposta por Darwin como aperfeioamento da teoria da evoluo.
02) A teoria sinttica demonstra que a evoluo resultado da ao de vrios fatores, como a
seleo natural, a mutao e a migrao. Esses fatores alteram a frequncia relativa dos genes.
04) A mutao pode ser explicada como uma mudana na sequncia de bases nitrogenadas do
DNA e pode ser provocada por um defeito no prprio mecanismo de duplicao do DNA ou por
fatores ambientais.
08) O processo pelo qual uma espcie se espalha por vrios ambientes e origina um nmero
grande de espcies diferentes chamado de irradiao adaptativa.
16) A especiao em populaes de uma mesma espcie vivendo na mesma rea dita
aloptrica, enquanto aquela que ocorre entre populaes da mesma espcie isoladas
geograficamente chamada simptrica.

113

UEM (2010_2) 10) Darwin foi o primeiro a propor nossa relao de parentesco evolutivo com
os grandes macacos, incluindo definitivamente a espcie humana no Reino Animal e, de
certa forma, rebaixando-a do ponto mais alto da criao. Nesse sentido, assinale o que for
correto.
01) Os resultados das anlises comparativas mostraram que, de fato, os chimpanzs so mais
semelhantes a ns, do ponto de vista molecular, que qualquer outro ser vivo.
02) Os seres humanos fazem parte do Filo Chordata, Sub filo Vertebrata, Classe Mammalia,
Ordem Primata, Famlia Anthropoidea, Gnero Homo e Espcie sapiens.
04) Os primatas desenvolveram, entre outros atributos, mos dotadas de grande mobilidade e
flexibilidade. As suas mos apresentam o primeiro dedo oponvel, funcionando como pina para
agarrar.
08) Um grande avano, na passagem evolutiva de australopiteco para a espcie humana atual,
o desenvolvimento do sistema nervoso e, consequentemente, da inteligncia.
16) Admite-se que o salto mais prodigioso da humanidade rumo ao conhecimento tenha sido o
desenvolvimento da fala, que ocorreu h cinco mil anos. As geraes humanas passaram, desde
ento, a deixar, para as geraes futuras, informaes sobre seu modo de vida e suas realizaes.
UEM (2011_1) 11) A enorme variedade de seres vivos tem fascinado a humanidade, desafiandonos a compreend-la e a explicla. Como surgem as novas espcies?, questiona-se. Com
relao a esse assunto, assinale o que for correto.
01) A Teoria da Evoluo admite que todas as espcies hoje existentes compartilham um
ancestral comum, em um processo denominado especializao.
02) Uma etapa fundamental no processo evolutivo que d origem a novas espcies o
isolamento geogrfico de populaes.
04) Novas espcies surgem quando duas populaes ficam isoladas uma da outra de modo que
no haja intercmbio gentico entre elas.
08) O processo pelo qual uma espcie se espalha por vrios ambientes e origina um grande
nmero de espcies diferentes chamado de irradiao adaptativa.
16) Novas espcies podem surgir em consequncia de mutaes cromossmicas.
UEM (2011_2) 12) No incio do sculo XIX, o criacionismo foi severamente confrontado com o
evolucionismo, possibilitando estudos que fornecessem evidncias sobre a evoluo biolgica.
Sobre esse assunto, assinale o que for correto.
01) Lamark foi um dos primeiros a divulgar as idias evolucionistas, baseado na lei do uso ou do
desuso, na lei da transmisso dos caracteres adquiridos e na seleo natural.
02) A ideia de que os seres vivos vo se modificando ao longo do tempo, com novas espcies
surgindo a partir de espcies ancestrais, a base do evolucionismo.
04) Os fsseis so formados em condies especiais, sendo suas substncias orgnicas
substitudas por minerais. Esse processo chamado de contramolde.
08) Segundo Charles Darwin, um organismo mais adaptado aquele com mais chances de se
reproduzir, passando suas caractersticas vantajos as para um maior nmero de descendentes.
16) As evidncias utilizadas nos estudos de evoluo biolgica so a presena de rgos
vestigiais e as mudanas ambientais.

114

UEM (2009_2) 13) Considere os aspectos evolutivos dos seres vivos e assinale o que for correto.
01) Diversas variedades de plantas so produzidas por seleo artificial, como acontece com
repolho, couveflor, couve-de-bruxelas e brcolis, todas derivadas de uma espcie selvagem, a
Brassica oleracea.
02) Um dos princpios bsicos da evoluo por seleo natural que os indivduos de uma
mesma populao no apresentam variaes em seus caracteres, sendo, portanto, idnticos.
04) Um dos vrios processos de fossilizao ocorre em rochas sedimentares, sendo que suas
camadas podem reservar fsseis de diferentes idades geolgicas.
08) O registro fssil sugere que os ancestrais da maioria dos filos animais atuais surgiram
durante a fase de transio entre a era Pr-cambriana e a era Paleozoica.
16) Estruturas anlogas refletem parentesco evolutivo e so decorrentes de modificaes de uma
forma primitiva, por um processo denominado de irradiao adaptativa.
GABARITO:
1-GAB: 01
2-GAB: 01+02+04=07
3-GAB: 08+16=24
4-GAB: 01+08+16+32=57
5-GAB: 04+08=12
6-GAB: 01
7-GAB: 01+02+08+16=27
8-GAB: 01+04+16=21
9-GAB: 02+04+08=14
10-GAB: 01+04+08=13
11-GAB: 02+04+08+16=30
12-GAB: 02+08=10
13-GAB: 01+04+08=13

115

MULTIDISCIPLINAR
UNIOESTE (2006) 1) Relativo a histologia e fisiologia animal e vegetal correto afirmar que:
(01) O tecido conjuntivo hematopoitico, responsvel pela formao de glbulos vermelhos e
glbulos brancos, encontrado no fgado e no corao.
(02) O bao e o timo constituem parte do sistema linftico e, entre outras funes, tambm
contribuem para a defesa do organismo.
(04) A adenosina trifosfato (ATP) fornece a energia imediata que supre a contrao muscular,
enquanto o glicognio fonte primria para a contrao muscular.
(08) Nos vegetais o sber um tecido morto e descamativo que assume as funes de
revestimento e proteo do caule.
(16) Os tecidos meristemticos localizados nas gemas do caule, no subpice das razes ou nas
folhas, podem ser utilizados na cultura de tecidos que venham a contribuir em processos de
melhoramento vegetal.
(32) Esclernquima um tecido vegetal vivo, pouco rgido, constitudo de clulas dotadas de
lignina que entram na constituio de vasos condutores.
(64) A queratina nas clulas animais e a cutina nas clulas vegetais fazem parte de tecidos de
revestimento e contribuem para evitar a desidratao excessiva, regulando o intercmbio de
substncias com o meio.
UNIOESTE (2006) 2) Assinale a(s) alternativa(s) em que a correlao estrutura, localizao,
funo est correta.

UEPG (2007_1) 3) A respeito da respirao branquial, assinale o que for correto.


01) A maioria dos animais aquticos est adaptada a retirar o oxignio dissolvido na gua. Para
isso, possuem brnquias, estruturas constitudas por finos filamentos recobertos por uma
epiderme delicada que apresenta extensa rede de vasos capilares.
02) A difuso gasosa acontece diretamente por meio da brnquia, entre a gua e o sangue e viceversa.
04) So exemplos de animais que respiram por brnquias: sapo na fase larval (girino), atum,
estrela-do-mar, moluscos bivalves e larvas de insetos.
08) Quando submersos, os animais aquticos utilizam para sua respirao o oxignio resultante
do desdobramento de molculas de gua e oxignio resultante da fotossntese das plantas
aquticas.
16) As brnquias so reservatrios de ar que permitem aos animais manter, durante o perodo
em que esto submersos, reservas do oxignio obtido na atmosfera.

116

UEPG (2008_1) 4) A respeito da comunicao entre as clulas promovida pela membrana


plasmtica, assinale o que for correto.
01) Na membrana plasmtica existem duas camadas de molculas de lipdios, com molculas de
protenas embutidas entre elas. Algumas dessas protenas so transportadoras, agindo na difuso
facilitada e no transporte ativo, duas formas de comunica-o celular.
02) As falhas de comunicao entre as clulas podem originar diversas doenas. No diabete do
tipo II, por exemplo, o problema pode estar, no numa produo deficiente de insulina, mas sim,
na incapacidade de as clulas do corpo responderem a esse hormnio, devido a alguma
mudana, provavelmente gentica, nos receptores que reconhecem a insulina.
04) Um exemplo de comunicao entre clulas a adrenalina, hormnio fabricado pelas
glndulas supra-renais em situaes de emergncia, ao atuar sobre diversos rgos do nosso
corpo. Entre outros efeitos, ela acelera os batimentos cardacos, contrai os vasos sanguneos da
pele e favorece, no fgado, a transformao do glicognio em glicose, que secretada no sangue.
Portanto, conclui-se que as clulas do corao e dos msculos no-estriados dos vasos da pele e
do fgado possuem recepto-res especficos para a adrenalina, j que todos esses rgos
"responderam" substncia.
08) Os receptores de membrana constituem uma categoria de protenas. Devido sua "forma",
eles conseguem ser reconhecidos por determinadas substncias mensageiras, que se encaixam
neles como uma chave na fechadura, como ocorre com uma enzima e seu substrato. Uma vez
encaixada a substncia mensageira, so desencadeadas vrias reaes no interior da clu-la, que
promovem uma determinada resposta celular. Cada tipo de clula possui receptores de
membranas especficos, com uma forma prpria. Assim, uma determinada mensagem s ser
"recebida" se a clula tiver o receptor adequado.
UFSC (2007) 5) A perpetuao da vida em nosso planeta deve-se caracterstica mais tpica dos
seres vivos: sua capacidade de se reproduzir.
Sobre os mecanismos de reproduo, assinale a(s) proposio(es) CORRETA(S).
01.
Os gametas so formados por diviso meitica; a gametognese feminina d origem a
quatro vulos e a gametognese masculina d origem a quatro espermatozides.
02.
A reproduo assexuada d origem a clones de um indivduo e pode ser observada em
bactrias, algas, fungos, plantas e animais.
04.
A reproduo assexuada d origem a clones de um indivduo e s acontece em
bactrias, algas e fungos.
08.
A reproduo sexuada importante porque promove a variabilidade gentica da
descendncia.
16.
A clonagem de seres vivos uma tcnica muito recente, que s pde ser concretizada
com o avano da biotecnologia.
32.
Gmeos monozigticos podem ser considerados clones um do outro.
64.
A fertilizao in vitro (tcnica para a formao de bebs de proveta) um tipo de
clonagem.

117

UFSC (2009) 6) ERRO!


UFSC (2010) 7) O meio ambiente pode influenciar o funcionamento do nosso organismo de
vrias formas, desde a alterao de funes fisiolgicas, das quais geralmente no nos damos
conta, at alteraes na nossa percepo sensorial e estado de nimo. Por exemplo, nas grandes
festas musicais que se estendem madrugada adentro, conhecidas como raves, o consumo de
lcool e bebidas estimulantes, como os energticos, chega a nveis alarmantes. No contexto da
ideia de diverso, a mistura destas duas substncias pode trazer consequncias devastadoras para
o organismo humano. A pessoa que consome o energtico junto com o lcool reduz o efeito
deste, uma vez que o estimulante diminui o efeito depressor do lcool sobre o sistema nervoso.
Esta ao dos energticos reduz a percepo da embriaguez, e leva as pessoas a ingerir mais
lcool, as quais no se do conta dos riscos envolvidos. Uma superdosagem desta substncia
aumenta a frequncia cardiorrespiratria e pode provocar irritao estomacal e intestinal. O que
a princpio euforia e excitao, pode transformar-se em tontura e desmaio.
Sobre o assunto do texto acima, pode-se afirmar CORRETAMENTE que:
01. O sistema nervoso responde pela coordenao e controle do funcionamento do organismo,
independentemente da ao do sistema endcrino.
02. O efeito estimulante das bebidas energticas consequncia da liberao de
neurotransmis-sores, como a dopamina, que provocam sensao de prazer.
04. Glicdios ou carboidratos so fontes de energia para o nosso organismo.
08. Em nvel celular, a organela citoplasmtica responsvel pela produo de energia o
lisossomo.
16. A longo prazo, o consumo de lcool em grandes quantidades no provoca alteraes
cardiovas-culares, nem prejuzo nas funes hepticas.
32. O controle da frequncia cardiorrespiratria uma das funes que podem ser atribudas ao
sistema nervoso autnomo.
64. A interao entre o consumo excessivo de lcool e bebida energtica no traz danos
fisiolgicos ao organismo.
UFSC (2010) 8) Para o alto e avante! Mecanismo nico permite que um inseto salte mais de
cem vezes sua prpria altura.
Um inseto de apenas seis milmetros de comprimento capaz de pular proporcionalmente mais
alto que qualquer outro animal na natureza. O salto da cigarra da espuma (Philaenus spumarius)
pode chegar a 70 centmetros mais de 100 vezes sua prpria altura. Isso seria o equivalente a
um homem que saltasse uma altura de 200 metros, ou um prdio de cerca de 70 andares. A
execuo dos enormes saltos da cigarra da espuma requer uma grande quantidade de energia,
que no pode ser obtida pela contrao direta dos msculos em um curto espao de tempo. A
fora muscular do inseto gerada lentamente antes do pulo e estocada. Assim que os msculos
da cigarra geram fora suficiente para o salto, ela solta suas pernas, que disparam como um
gatilho e a projetam no ar.
Sobre o assunto do texto, assinale a(s) proposio(es) CORRETA(S).
01. A energia necessria para o movimento descrito gerada pela musculatura do tipo lisa, j
que o movimento lento e contnuo.
02. A fonte primria de energia dos msculos provm da molcula de adenosina trifosfato
(ATP), presente nas clulas.
04. A cigarra mencionada no texto (Philaenus spumarius) um artrpode, pertencente ao grupo
dos aracndeos.
08. Os mecanismos de produo de energia na clula envolvem a participao direta de
organelas celulares, como os lisossomos.

118

16. O exemplo de movimento citado no texto (salto) incomum e pode parecer desnecessrio
entre os insetos, j que todos possuem asas e podem voar.
32. Em geral uma contrao muscular resultado da interao entre filamentos contrteis que
deslizam em direes contrrias.
UFMS (2007) 9) Sobre o rgo tegumentar, assinale a(s) alternativa(s) correta(s).
(001) So funes atribudas pele: revestimento, proteo, respirao, nutrio e excreo.
(002) Os animais homeotrmicos (aves e mamferos) possuem uma camada subcutnea repleta
de gordura, denominada hipoderme.
(004) O tegumento nos invertebrados possui apenas uma camada que a derme.
(008) A presena de uma grossa camada crnea, que reveste a pele dos rpteis, no permitiu a
esses animais uma adaptao perfeita ao ambiente terrestre.
(016) Os plos e as glndulas sudorparas, nos mamferos, esto ambos relacionados com a
manuteno da temperatura corprea.
(032) A pele das aves possui diversas glndulas anexas, que se relacionam: com a adaptao
contra o ressecamento interno do animal, com a temperatura corporal estvel (homeotermia) e
com a demarcao de territrio (glndulas odorferas).
UEM (2008_1) 10) O essencial invisvel aos olhos, disse a raposa ao Pequeno Prncipe, na
fbula de Antoine de Saint- Exupry. Embora o autor estivesse se referindo aos
sentimentos, pode-se relacionar essa afirmao com aspectos essenciais da vida dos organismos.
Sobre isso, assinale o que for correto.
01) Todos os organismos vivos apresentam a clula como unidade estrutural e funcional.
02) As clulas so delimitadas pela membrana plasmtica constituda por protenas e por
fosfolipdios.
04) As vitaminas funcionam como enzimas necessrias em grande quantidade na respirao
celular.
08) Os ribossomos presentes no citoplasma participam da sntese de protenas importantes
para o funcionamento celular.
16) Nos seres humanos, as clulas reprodutoras so produzidas por meiose gamtica.
UEM (2008_1) 11) Em biologia, correto afirmar que:
01) Karl von Linne (1707-1778) adotou a espcie como categoria taxonmica bsica e agrupou
espcies semelhantes em gneros.
02) a febre aftosa, uma virose que atinge o rebanho bovino, e a brucelose, cujo tratamento feito
com antibiticos especficos, so causadas por organismos da mesma famlia.
04) a vacina antigripe usada no Brasil feita com uma mistura de formas virais mais comuns,
em particular aquelas que causaram gripes nos ltimos anos.
08) o potencial biotecnolgico das bactrias cresceu nas ltimas dcadas devido ao
desenvolvimento da tecnologia do DNA recombinante, tambm chamada de Engenharia
Gentica.
16) os protozorios so heterotrficos, utilizando como alimento tanto a matria orgnica morta
quanto microorganismos vivos.

119

UEM (2008_1) 12) Relacionando o comportamento animal com os fatores ambientais, assinale o
que for correto.
01) A velocidade das reaes qumicas, ou seja, a taxa metablica, no varia em funo da
temperatura ambiente.
02) Uma grossa camada de gordura sob a pele uma das adaptaes de animais homeotrmicos
a baixas temperaturas.
04) O esqueleto de quitina dos artrpodes auxilia no controle da evaporao da gua corprea.
08) Nos vertebrados, a produo de melatonina pela glndula pineal independente da luz ou
dos ritmos circadianos.
16) Hibernao e estivao expressam reaes de alguns animais, principalmente em funo da
umidade relativa do ar.
UEM (2008_2) 13) Assinale o que for correto.
01) Pela filogenia, o grau de parentesco entre o co e o cavalo maior do que entre o co e o
leo.
02) Pela forma de nutrio, os fungos esto mais prximos dos vegetais do que dos animais.
04) Os indivduos infectados com o vrus da AIDS, mesmo sem a manifestao de sintomas, so
considerados transmissores da doena.
08) Entre as aes benficas das bactrias, citam-se o auxlio na fabricao de alimentos, como
queijos, e a limpeza de ambientes poludos.
16) A doena de Chagas provocada por um protozorio flagelado e transmitida por um inseto
de hbito noturno.
UEM (2009_1) 14) Com relao s caractersticas dos grupos de seres vivos mencionados,
assinale o que for correto.
01) A digesto dos protozorios extracelular, independente do recurso alimentar ser matria
orgnica morta ou viva.
02) Os vrus so agentes infecciosos microscpicos constitudos por cido nucleico e protenas.
04) As bactrias no apresentam reproduo sexuada, mas h recombinao gentica.
08) No ciclo de vida de muitas algas multicelulares, alternam-se geraes de indivduos
haploides e diploides.
16) Em fungos unicelulares coloniais, o conjunto de miclios forma a hifa.
UEM (2009_1) 15) Identifique o que for correto sobre classificao e evoluo de organismos.
01) Os conhecimentos de classificao e de parentesco evolutivo negam a ideia de que os seres
vivos atuais compartilham ancestrais comuns.
02) Segundo o sistema de classificao proposto por Lineu, as ordens semelhantes so reunidas
em famlias e os gneros semelhantes so reunidos em classes.
04) Segundo a nomenclatura binomial, os nomes cientficos dos organismos devem ser escritos
em latim e impressos em itlico ou grifados.
08) Os bilogos distinguem dois tipos de processos de especiao: a especiao aloptrica e a
especiao simptrica.
16) A teoria moderna prope que a evoluo pode ser explicada pela mutao e pela
recombinao gentica, orientadas pela seleo natural.

120

UEM (2009_2) 16) Uma nica clula, por divises sucessivas, pode originar todas as demais
clulas de um organismo, mesmo que o nmero delas atinja trilhes, como no organismo
humano. A respeito da diviso celular, assinale o que for correto.
01) A citocinese nas clulas animais centrpeta e nas clulas das angiospermas centrfuga.
02) Quando uma clula diploide (2n) sofre mitose, formam-se duas clulas-filhas haploides (n).
04) Nos animais, a meiose ocorre imediatamente aps a formao do zigoto, sendo denominada
de meiose zigtica.
08) Nas clulas das bactrias, no ocorre o processo da mitose.
16) A permutao ou crossing-over um fenmeno que ocorre na prfase I da meiose.
UEM (2009_2) 17) Sobre as clulas, tecidos e rgos que constituem os organismos, assinale o
que for correto.
01) Nas bactrias, as funes essenciais vida, como captura de alimento, digesto, excreo,
percepo do ambiente, so realizadas por clulas que se diferenciam e se especializam.
02) Os tecidos epiteliais desempenham funes diversas, dependendo do rgo onde se
localizam. As principais funes so: proteo, absoro e secreo de substncias.
04) O tecido adiposo um tipo especial de tecido conjuntivo frouxo no qual h clulas
especializadas no armazenamento de gordura. Sua principal localizao no corpo sob a pele.
08) Os linfcitos, os plasmcitos e os rgos linfoides, como o timo, o bao, as tonsilas e os
linfonodos, fazem parte do sistema de defesa do organismo humano.
16) O tecido muscular estriado esqueltico, que constitui a maior parte da musculatura do corpo
dos vertebrados, tem contrao involuntria, ou seja, contrai-se independente de comando.
UEM (2009_2) 18) Com relao reproduo e aos ciclos de vida, assinale o que for correto.
01) Os animais apresentam ciclo de vida haplobionte diplonte, em que um novo ser surge pela
fuso dos gametas, duas clulas haploides, com formao do zigoto diploide.
02) No ciclo haplobionte haplonte, que ocorre em certos protozorios, os adultos so indivduos
haploides e os zigotos so diploides.
04) Certos fungos e certas algas formam clulas especializadas, os esporos, que so liberados no
ambiente e germinam ao encontrar condies favorveis.
08) Alguns animais e algumas plantas reproduzem-se por brotamento, ou seja, o indivduo
forma brotos que, ao se separarem, passam a ter vida independente, constituindo um novo
indivduo.
16) As plantas e diversas algas apresentam ciclo de vida diplobionte, em que se alternam
geraes de indivduos haploides e de indivduos diploides.
UEM (2010_1) 19) Assinale o que for correto sobre os diversos grupos de organismos vivos.
01) Cogumelos e orelhas-de-pau so corpos de frutificao de fungos.
02) No ciclo de vida dos organismos conhecidos popularmente como algas, no ocorre
alternncia de geraes, isto , os indivduos so sempre diplides.
04) Pteridfitas so plantas dotadas de tecidos vasculares, mas no formam sementes.
08) Os rgos reprodutores das gimnospermas e das angiospermas so, respectivamente, os
estrbilos e as flores.
16) Em brifitas, o gametfito haplide a gerao mais desenvolvida e persistente.

121

UEM (2010_2) 20) Considerando as adaptaes ou caractersticas prprias dos vegetais, assinale
o que for correto.
01) Aps a germinao da semente, a plntula torna-se estiolada (mais alongada) se, no
ambiente em que estiver, houver luz em demasia.
02) Os cactos, plantas tpicas de locais ridos, absorvem o gs carbnico atmosfrico durante o
dia e sintetizam o amido durante a noite.
04) Em matas midas, os estmatos das plantas de sombra (umbrfilas) permanecem abertos na
ausncia de luz.
08) A maior intensidade luminosa determinante para uma maior taxa de fotossntese, at
atingir o ponto de saturao luminosa.
16) Durante a fotossntese, em plantas aquticas submersas, como a Elodea, o teor de oxignio
produzido nas folhas aumenta, se houver maior concentrao de CO2 dissolvido na gua.
UEM (2010_2) 21) Considerando a importncia ecolgica, medicinal e alimentcia dos fungos,
assinale o que for correto.
01) Os liquens so associaes mutualsticas com algas ou cianobactrias. Desempenham
importante papel na colonizao e degradao de rochas e na indicao da poluio do ar
atmosfrico.
02) Penicillium notatum possibilitou a extrao da penicilina, importante antibitico utilizado
amplamente na Segunda Guerra Mundial, enquanto Aspergillus flavus, presente em produtos
agrcolas contaminados, produz micotoxinas prejudiciais aos humanos.
04) Alimentos, como o po e o queijo, e bebidas, como o vinho e a cerveja, so produzidos
graas ao de fungos ditos decompositores saprfitos.
08) Quando uma determinada planta no se desenvolve normalmente, possvel que a raiz no
esteja aproveitando adequadamente o nitrognio atmosfrico fixado pelo fungo Rhizobium.
16) O ttano e a sfilis so doenas graves causadas pelos fungos Clostridium tetani e
Treponema pallidum, respectivamente.
UEM (2010_2) 22) Sobre a clula, assinale o que for correto.
01) A fagocitose e a pinocitose so processos que evidenciam a permeabilidade da parede
celular, antes da deposio de celulose.
02) Testes de identificao de parentesco utilizando o DNA mitocondrial humano permitem
rastrear somente linhagem materna.
04) A lamela mdia, fina camada formada principalmente por celulose, une clulas vegetais
adjacentes destitudas de parede celular.
08) Quando comemos uma poro de fritas (batata), estamos ingerindo grande quantidade de
leucoplastos desprovidos de pigmentos e repletos de amido.
16) Os lisossomos associados aos cromossomos atuam na lise das bases nitrogenadas e impedem
a duplicao dos genes.
UEM (2010_2) 23) Considerando as caractersticas gerais dos seres vivos, assinale o que for
correto.
01) Nos seres vivos, alm das substncias orgnicas, existem as inorgnicas, representadas
principalmente por gua e sais minerais.
02) A clula, unidade morfolgica e funcional dos seres vivos, possui quatro componentes
bsicos: membrana plasmtica, citoplasma, ribossomos e material gentico (DNA), podendo ser
classificada como procaritica ou eucaritica.
04) Outra caracterstica dos seres vivos o metabolismo, conjunto de reaes qumicas que
ocorrem nos seres vivos e que so responsveis pela transformao e utilizao da matria e da
energia.

122

08) O processo de crescimento dos seres vivos pode ocorrer por aumento em peso de sua nica
clula, nos organismos unicelulares, e por aumento de volume e peso das clulas, nos
multicelulares.
16) Todos os seres vivos tm capacidade de percepo de estmulos do meio, mas no tm
capacidade de reagir a eles.
UEM (2011_1) 24) O terremoto no Japo fez com que onze dos 54 reatores nucleares do pas
fossem desativados automaticamente, para evitar um acidente. Mais tarde, uma empresa de
eletricidade informou que pode ter havido um vazamento radioativo na usina de Fukushima. Um
posto de controle na sada do complexo registrava nveis de radioatividade oito vezes superiores
ao normal (Revista Veja, 16/03/2011). Sobre as contaminaes ambientais com material
radioativo, correto afirmar que elas:
01) podem alterar o material gentico, originando as mutaes.
02) possibilitam alteraes nas clulas reprodutoras, mas que no sero transmitidas s geraes
seguintes.
04) prejudicam a renovao das clulas.
08) favorecem o surgimento de leses no sistema nervoso.
16) constituiro o lixo radioativo, originando os transgnicos, alterando o equilbrio ecolgico.
UEM (2011_1) 25) Com relao s afirmativas a seguir, assinale o que for correto.
01) As angiospermas (Magnoliophyta) constituem o grupo vegetal de maior sucesso evolutivo,
devido presena de vasos condutores especializados.
02) Os vrus so parasitas intracelulares, atacando clulas de diferentes organismos. Quando
esto fora das clulas hospedeiras adequadas, no apresentam nenhum tipo de atividade
metablica.
04) As algas renem um grupo de organismos que apresentam embrio; por isso, so chamadas
de espermatfitas.
08) As bactrias quimioautotrficas utilizam oxidaes inorgnicas como fonte de energia, tal
como sulfeto de hidrognio, para sintetizar substncias orgnicas.
16) Os protoctistas so organismos eucariontes, uni ou pluricelulares, auttrofos ou hetertrofos,
que se reproduzem de forma assexuada ou sexuada.
UEM (2011_2) 26) Sobre a Sndrome da Imunodeficincia Adquirida (Aids), assinale a(s)
alternativa(s) correta(s).
01) Existem diferentes tipos de clulas no sistema imunitrio, dentre os quais, os macrfagos,
que so capazes de fagocitar partculas estranhas, e os linfcitos, que podem produzir antgeno.
02) Crianas so infectadas com o HIV (Human Immunodeficiency Virus) durante a gestao,
no parto ou na amamentao.
04) Uma importante caracterstica do HIV a freqncia de mutaes em seu patrimnio
gentico, o que determina o aparecimento de tipos ligeiramente diferentes, dificultando a
obteno de vacinas eficazes.
08) A imunossupresso causada pelo HIV decorrente da produo de grande quantidade de
linfcitos T ou linfcitos T auxiliadores.
16) Os linfcitos T, produzidos na medula, coordenam a resposta imunolgica contra as
infeces, por meio da produo de interleucinas.

123

UEM (2008_1) 27) Considerando alguns aspectos qumicos relacionados ao funcionamento de


organismos animais, assinale o que for correto.
01) A amnia insolvel em gua, o que dificulta sua rpida difuso e eliminao por animais
que vivem no ambiente aqutico.
02) Os microorganismos que auxiliam na digesto dos ruminantes produzem o poluente gs
metano.
04) Na espcie humana, os principais agentes da imunidade humoral so os anticorpos, que so
protenas do grupo das imunoglobulinas.
08) O oxignio e a glicose so os principais produtos resultantes do processo da respirao
celular, que uma reao de hidrlise.
16) A adrenalina, hormnio neurotransmissor, sintetizada a partir do aminocido tirosina.
UEM (2008_1) 28) Assinale o que for correto.
01) Em uma representao de energia potencial do ecossistema em forma de pirmide, um
produtor, na base da pirmide, transformou energia luminosa em energia qumica.
02) Em um produtor, tomos de C de molculas de CO2 so transformados em substncias
orgnicas, em um processo que chamado de oxidao.
04) Um consumidor primrio consome parte da energia para sua prpria manuteno, atravs de
oxidao de compostos orgnicos que resultam na liberao de energia.
08) Bactrias que vivem em ambientes anaerbicos so capazes de obter energia atravs da
oxidao do gs H2, segundo a seguinte equao: CO2 + H2 CH4 + 2H2O + Energia.
16) As arqueas metanognicas obtm energia a partir da reao CO2 + H2 CH4 + 2H2O +
Energia, em que a substncia orgnica obtida por reduo do CO2.
UEM (2008_2) 29) Estima-se que as clulas humanas mantenham em seu interior uma
concentrao de ons de potssio (K ) variando de 20 a 40 vezes o valor da concentrao
existente no exterior. Estima-se, tambm, que a concentrao de ons de sdio (Na ) no exterior
varia de 8 a 12 vezes a concentrao no interior das clulas. Nesse contexto, assinale o que for
correto.
01) Para manter as diferenas citadas, as clulas despendem energia, o que caracteriza o
transporte ativo.
02) A energia consumida no processo conhecido como bomba sdio-potssio fornecida pelas
molculas de ATP s protenas transportadoras dos ons.
04) A manuteno das diferenas de concentrao de ons de potssio e de sdio ou de outros
no fundamental para o funcionamento celular.
08) A concentrao de ons de potssio no exterior ultrapassa 20% da concentrao do interior
da clula.
16) A razo entre as concentraes de ons de sdio do interior e do exterior das clulas varia em
um intervalo de amplitude 1/24 .
UEM (2008_2) 30) Assinale o que for correto.
01) Fosfolipdios so molculas compostas por glicerol esterificado com duas cadeias de cidos
graxos e com um cido fosfrico.
02) Membrana plasmtica ou membrana celular tem como constituinte bsico uma bicamada de
fosfolipdio com suas partes apolares (cadeia hidrofbica dos cidos graxos) voltadas para seu
interior.
04) Molculas de O2 e de CO2, pequenas e apolares, permeiam a membrana plasmtica. O O2
permeia para dentro da clula e o CO2, produzido na respirao celular, permeia para fora da
clula.
08) ons e molculas solveis em gua tm dificuldade para permear a membrana plasmtica.

124

16) Uma protena com grupos carboxilas e amino em sua constituio e que tem seu ponto
isoeltrico (equivalncia de cargas) em pH 4,75 foi colocada em tampo de pH 6,2; nessa
condio, a protena passa a ter carga positiva.
UEM (2009_1) 31) Assinale o que for correto.
01) A luz solar, que nos vegetais absorvida por pigmentos como a clorofila e os carotenoides,
constituda de ftons.
02) As folhas da maioria das plantas so enxergadas como verdes porque os pigmentos mais
abundantes nelas, as clorofilas, absorvem a maior parte da radiao visvel com frequncias
correspondentes s outras cores do espectro solar, mas refletem a radiao correspondente
nossa sensao do verde.
04) Na miopia, os raios paralelos so focalizados antes da retina, formando uma imagem sem
nitidez. A correo por meio de culos exige lentes divergentes.
08) Uma folha com temperatura de 25 oC transfere calor, espontaneamente, para outra folha
com temperatura de 30 oC, desde que a primeira esteja iluminada e a segunda esteja na sombra.
16) Se um organismo homeotermo, cuja temperatura corprea normal 40 oC, estiver
temperatura de 104 oF, dever estabelecer estratgias para aumentar
a sua temperatura corprea.
UEM (2009_1) 32) Considerando a influncia das condies ambientais sobre os animais e,
ainda, os grandes biomas, assinale o que for correto.
01) Nos mamferos, a pelagem atua como isolante trmico; por isso, os mamferos das regies
tropicais so desprovidos de pelos.
02) Na floresta pluvial tropical, h grande quantidade de nichos ecolgicos, o que permite a
existncia de fauna rica e variada.
04) Alguns dos componentes da fauna do deserto podem passar a vida inteira sem beber gua,
extraindo-a do alimento que ingerem.
08) Diversas espcies de peixes, moluscos e crustceos, alm de aves, obtm alimento, direta ou
indiretamente, dos manguezais.
16) Aves de biomas como a Tundra e a Taiga migram para regies mais quentes durante os
meses de inverno.
UEM (2009_1) 33) A gua fundamental para manter a vida na Terra. Com relao s suas
propriedades e aos processos a ela relacionados, assinale o que for correto.
01) Para a gua passar do estado lquido para o gasoso, necessrio romper as ligaes de
hidrognio que mantm as molculas unidas entre si, o que demanda grande quantidade de
energia.
02) No ciclo da gua, a condensao e a conseqente formao de nuvens ocorre nas camadas
altas e quentes da atmosfera.
04) A alta tenso superficial da gua permite que alguns insetos sejam capazes de pousar sobre a
gua sem afundar.
08) Substncias presentes nas clulas, como o cloreto de sdio e a sacarose, so solveis em
gua e genericamente chamadas de hidroflicas.
16) O alto calor especfico da gua permite que a temperatura se mantenha equilibrada dentro
das clulas, sem variaes bruscas.

125

UEM (2009_2) 34) Assinale o que for correto.


01) O composto formado por dois aminocidos ligados chamado de dipeptdeo.
02) A cistena um aminocido que pode formar uma ligao covalente chamada de ligao
dissulfeto.
04) A desnaturao proteica pode ser provocada pelo rompimento de ligaes qumicas ou de
interaes existentes na estrutura secundria ou terciria das protenas.
08) Os aminocidos cido 2-amino-3-hidrxi-butanoico e cido 2,6-diamino-hexanoico so
exemplos de aminocidos polares e apolares, respectivamente.
16) O grupamento R que ligado ao carbono alfa de um aminocido que constitui as protenas
dos seres vivos pode ser qualquer grupamento orgnico.
UEM (2009_2) 35) Considerando os componentes inorgnicos que so encontrados no
organismo humano, assinale o que for correto.
01) A perda excessiva de gua por transpirao devida ao calor exagerado ou ao clima muito
seco uma das causas de desidratao.
02) O hbito de fumar e de ingerir bebidas alcolicas, a falta de exerccios fsicos e uma
alimentao deficiente em clcio so fatores que favorecem o surgimento da osteoporose.
04) O bcio endmico, popularmente conhecido como papo, uma doena que se estabelece no
organismo quando a dieta pobre em sais de ferro.
08) O sal mineral mais conhecido popularmente o cloreto de sdio (NaCl), solvel em gua e
muito utilizado no preparo de alimentos.
16) Os sais de iodo so necessrios para a produo de hormnios na glndula tireoide. Esses
hormnios aceleram o metabolismo celular e tm papel fundamental no crescimento e
desenvolvimento do organismo humano.
UEM (2009_2) 36) A planta de cenoura, o homem e os artrpodes utilizam diversos
componentes qumicos comuns para a formao e o funcionamento de seus organismos. A esse
respeito, assinale o que for correto.
01) As membranas celulares da cenoura apresentam duas vezes menos colesterol do que as
membranas celulares do homem.
02) Amido, glicognio e quitina so polissacardeos de reserva, respectivamente, na cenoura, no
homem e nos artrpodes.
04) Nos cidos nucleicos, presentes em todos os seres vivos, os monossacardeos so a
desoxirribose e a ribose.
08) O -caroteno, pigmento alaranjado da cenoura, no organismo humano precursor da
vitamina B1, essencial para o bom funcionamento dos olhos.
16) As enzimas presentes na cenoura, no homem e nos artrpodes catalisam reaes qumicas.
Ao trmino das reaes, apresentam-se quimicamente inalteradas.
UEM (2010_1) 37) A quantidade de oxignio dissolvida na gua um importante indicador da
qualidade da gua. Sobre os processos qumicos e biolgicos que ocorrem na gua, na presena
e na ausncia de oxignio, correto afirmar que
01) as bactrias aerbicas consomem o oxignio dissolvido na gua para oxidar a matria
orgnica e satisfazer suas necessidades energticas.
02) a dissoluo de oxignio na gua um processo endotrmico, ento quanto menor a
temperatura da gua menor ser a quantidade de oxignio dissolvida.
04) em guas que contm teor suficiente de oxignio, a matria orgnica biodegradvel que
contm carbono, hidrognio, nitrognio, enxofre e fsforo convertida em CO2, HCO3
-, H2O, NO3 -, SO4 2- e fosfatos, pela ao das bactrias anaerbicas.

126

08) os nutrientes nitrognio e fsforo contribuem para a poluio da gua, pois aceleram o
crescimento de plantas aquticas, como as algas flutuantes.
16) o tratamento de gua coletada de rios e lagos, em estaes de tratamento de gua municipais
para consumo humano, geralmente envolve o uso do gs cloro, que atua como esterilizante.
UEM (2010_2) 38) Assinale o que for correto.
01) O inseticida DDT (dicloro-difenil-tricloroetano) um composto organoclorado cumulativo
nos tecidos dos animais.
02) A fermentao ltica produz 2 ATP, CO2 e CH3CH2OH, e a fermentao alcolica produz
2 ATP e cido actico.
04) Nos processos A e B, simplificados abaixo, reconhecemos reaes associadas ao ciclo
fundamental de energia, em que A se refere respirao e B, fotossntese. A) CO2 + H2O +
energia solar glicose + O2 B) glicose + O2 CO2 + H2O + energia
08) Alguns insetos conseguem andar sobre a gua e teriam maior facilidade se suas patas fossem
revestidas com detergente ou sabo, que facilitariam seu deslizamento.
16) A ao da enzima pepsina sobre as protenas ocorre no estmago, onde o suco gstrico
alcana pH ao redor de 2,0, devido ao do cido clordrico (HCl).
GABARITO:
1-GAB: 02+04+08+64=78
2-GAB: 01+32+64 = 97
3-GAB: 01+02=03
4-GAB: 01+02+04+08=15
5-GAB: 02+08+32=42
6-GAB: 02+32=34
7-GAB: 02+04+32=38
8-GAB: 02+32=34
9-GAB: 16+02+01=19
10-GAB: 01+02+08+16=27
11-GAB: 01+04+08+16=29
12-GAB: 02+04=06
13-GAB: 04+08+16=28
14-GAB: 02+04+08=14
15-GAB: 04+08+16=28
16-GAB: 01+08+16=25
17-GAB: 02+04+08=14
18-GAB: 01+02+04+08+16=31
19-GAB: 01+04+08+16=29
20-GAB: 08+16=24
21-GAB: 01+02=03
22-GAB: 02+08=10
23-GAB: 01+02+04=07
24-GAB: 01+04+08=13
25-GAB: 02+08+16=26
26-GAB: 02+04+16=22
27-GAB: 02+04+16=22
28-GAB: 01+04=05
29-GAB: 01+02+16=19
30-GAB: 01+02+04+08=15

127

31-GAB: 01+02+04=07
32-GAB: 02+04+08+16=30
33-GAB: 01+04+08+16=29
34-GAB: 01+02+04=07
35-GAB: 01+02+08+16=27
36-GAB: 04+16=20
37-GAB: 01+16=17
38-GAB: 01+16=17

LINKS PARA AS PROVAS:


http://cac-php.unioeste.br/cogeps/index.php/provasegabaritos/63-2006
http://cac-php.unioeste.br/cogeps/index.php/provasegabaritos/62-2005
http://www.cps.uepg.br/vestibular/provas/1%C2%BA_2006/provas.asp
http://www.cps.uepg.br/vestibular/provas/1%C2%BA_2007/provas.asp
http://www.cps.uepg.br/vestibular/provas/1%C2%BA_2008/provas.asp
http://www.cps.uepg.br/vestibular/provas/1%C2%BA_2009/provas.asp
http://www.vestibular2007.ufsc.br/index.php?s=provas
http://www.vestibular2008.ufsc.br/index.php?s=provas
http://www.vestibular2009.ufsc.br/index.php?s=provas
http://www.vestibular2010.ufsc.br/index.php?s=provas
http://www.copeve.ufms.br/Vst2007v/
http://www.copeve.ufms.br/Vst2008v/
http://www.copeve.ufms.br/Vst2009v/
http://www.copeve.ufms.br/vst2010v/
http://www.vestibular.uem.br/2008-I/
http://www.vestibular.uem.br/2008-V/
http://www.vestibular.uem.br/2009-I/
http://www.vestibular.uem.br/2009-V/
http://www.vestibular.uem.br/2010-I/
http://www.vestibular.uem.br/2010-V/
http://www.vestibular.uem.br/2011-I/
http://www.vestibular.uem.br/2011-V/

Material feito por Bruno Alan.

128