Você está na página 1de 34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
Ol themafia

Trabalhos e Monografias

Gerador de Citao

Mais

Pesquise 1.500.000 Trabalhos

Pgina Inicial Biologia

Resoluo de todos os exerccios propostos no livro


''Gentica na Agropecuria"
Enviado por THIAGO_M, set. 2013 | 24 Pginas (5739 Palavras) | 208 Consultas|

CLIQUE TRS
VEZES PARA
DAR BOA
SORTE

Exerccios do livro Gentica na agropecuria

Capitulo 2 Variao e seu significado biolgico


Envie

164 mil
Curtir

1 Porque a partir da existncia da variao que pode ocorrer a seleo


natural ou artificial. Tambm a partir da variao que pode ser estudado o
modo como um carter herdado.

1.551
Tw eetar

3.347

Voc no tem nenhum trabalho salvo


at o momento.

2 A variao gentica resultado da informao contida nos genes, que so


repassados aos descendentes. J a variao ambiental resultado dos

Trabalhos Relacionados
Lista de exerccios extrada do livro algoritmos
estruturados harry farrer e outros ltc- pg 89103
..... )-------------~....::.;;:.::::::~ ) .:......,.,.' ~ .. ' '-~'" ... ....
33 Pginas agosto de 2012

efeitos do ambiente sobre o desenvolvimento dos organismos e essa


informao no est contida nos genes.

3 A variao entre os bezerros gentica, j que eles no so idnticos


entre si, e ambiental j que h fatores como a alimentao da vaca, que
influenciam nos diferentes pesos adquiridos pelos bezerros. Os leites
tambm tm variao de peso tanto gentica, j que cada leito vem de um
vulo e em espermatozide diferentes, quanto ambiental, j que h fatores
como o local no tero onde o leito se desenvolve que influenciam no peso que
ele adquire.

Estudo dirigido exerccios propostos


...ESTUDO DIRIGIDO EXERCCIOS PROPOSTOS
DIREITO APLICADO: AVALIAO E PERCIAS 2
Mdulo...
19 Pginas outubro de 2012

Clculo estequiomtrico: rendimento escolar na


resoluo de problemas e exerccios com
clculos
...Clculo estequiomtrico: rendimento escolar na
resoluo de problemas e exerccios com
clculos...
12 Pginas abril de 2013

Exerccios propostos de fsica


...Exerccios Propostos: 1- ( CEFET-PR/04)2
Considere as seguintes afirmaes tratadas na...

4 A natureza da variao dos gros de milho gentica, pois cada gro


possui um gentipo, e ambiental, pois a localizao do gro na espiga pode
influenciar no seu tamanho, por exemplo. No caso do trigo, por ser uma
espcie autgama, tem os gros genotipicamente iguais, e a variao de
natureza ambiental.

10 Pginas maio de 2013

Exerccios Propostos
...
UNIVERSIDADE FEDERAL DA PARABA
ENGENHARIA DE PRODUO GESTO DA CADEIA
DE SUPRIMENTOS...
9 Pginas dezembro de 2013

5 Conservar a variabilidade gentica de espcies de interesse para o Brasil:


O profissional que trabalha nesse centro realiza vrias atividades relacionadas
a conservao de germoplasma, como a prospeco, coleta, introduo dos
acessos aos bancos, intercmbio e quarentena de materiais, multiplicao e
regenerao de materiais.

Capitulo 3 Gentica molecular

1 1. A + G = 20 + 30 = 50 DNA de fita dupla


T + C = 20 + 30 = 50

2. A + G =
40 + 10 = 50 DNA de fita dupla
T + C = 40 + 10 = 50

3. RNA presena de uracila


http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

1/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
3. RNA presena de uracila

4. RNA

5. A + G = 30 + 20 = 50 A T DNA de fita simples


T + C = 20 + 30 = 50 C G

2 Clula haplide -> 1,3 x 10^-12 g de DNA


A = 28 %
a) citosina = ?
A = 28% G + C = 100 56 = 44%
T = 28% =>56% C = 22%

b) 1 nucleotdeo P = 1,6 x 10^-24 x 330 1 dalton = 1,6 x 10 ^-24


P = 5,5 x 10 ^-22
Cl. somtica 1,3 x 10 ^-12 g x 2 = 2,6 x 10^-12

Nmero de nucleotdeos = 2,6 x 10^-12 / 5,5 x 10^-22


= 4,7 x 10^9 g
c) DNA de clula haplide
1nm = 10^-9 m
1A = 0,1 nm
3,4 A = 0,34 nm

Clula haplide = 2,35 x 10 ^9 nucleotdeos em cada fita = 1,17 x 10^9


nucleotdeos
Comprimento = 0,34 x 10^-9 x 1,17x10^9
c = 0,4 m

d) Significa que o DNA deve sofrer grande empacotamento e condensao,


para que possa preencher as dimenses da clula.

3 clula haplide = 2,35 x 10^9 nucleotdeos


Tipos de molcula = 4 ^n n= nmero de pares
0 Tipos = 4^(1,17 x 10^9) de nucleotdeos

4 a)

b) 200 aminocidos
200 cdons + 1 cdon metionina + 1 cdon sem sentido
202 x 3 = 606

2016 nucleotdeos
hnRNA = 1008 nucleotdeos
ntrons = 1008 606
ntrons = 402 nucleotdeos

5 Fita de DNA
20% A 20% T DNA dupla hlice
30% C 30% G A = 20 + 10 = 30/2 = 15%
40% G 40% C T = 20 + 10 = 30/2 = 15%
10% T 10% A G = 40 + 30 = 70/2 = 35%
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

2/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

C = 40 + 30 = 70/2 = 35%

6 genoma haplide
10^9 molculas de filerona
10^4vezes de transcrio do gene
RNAm traduzida = 10^9/10^4 = 10^5
vezes
7 60 protenas ; 120 aminocidos = 120 cdons + 1 cdon metionina + 1
cdon finalizador = 122 cdons

122 x 60 = 7320 cdons 7320 x 3 (nucleotdeos) = 21960 nucleotdeos nos


xons.

8 A presena de amido ou de acares solveis em gua pode ser resultado


da ao de diferentes enzimas na formao de agrupados de unidades de
acar.

9 1212 bases no gen ( nos xons)


a) 1212 / 2 = 606 nucleotdeos no RNAm
606 / 3 = 202 cdons
202 1 cdon de terminao = 201 aminocidos

b) 606 bases RNAm


e) 201 RNAts
1 ribossomo

10- a) 5 AUGCACCGAAGAAUUCCACCACCACCACCAUAGA
b) 10, incluindo a metionina
c) 10x10 = 100 RNAt
10 molculas -> 10 ribossomos
d) met his arg aqrg ili pro pro pro pro pro
e) met his arg arg ili arg thr thr thr thr

Captulo 4 Organizao do material gentico e diviso celular

1 Na propagao assexuada, so gerados indivduos idnticos ao que lhes


deu origem e na propagao sexuada os indivduos gerados so resultado da
unio de gametas de dois genitores, sendo portanto d istintos.

2 Porque permite a formao de novas combinaes genticas entre alelos


de diferentes cromossomos e at mesmo dos mesmos cromossomos devido
a permuta gentica.

3 a) 3 pares heterozigotos n = 3
Nmero de orientaes na metfase 1 = 2^(n-1) = 2^(3-1) = 4
4 orientaes

b) nmero de orientaes = 4
60 clulas clulas = 60 / 4 = 15

c) 60x4 = 240 gametas


tipos de gametas : 2^3 = 8
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

3/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

MDF = 240 / 8 = 30 gros de plen

d)2 = 8 tipos

4 Todos os alhos gerados a partir de um indivduo sero idnticos.

5 2048 orientaes
a) 2^(n-1) = 2048 2^11 = 2048
n = 11 + 1 = 12
genoma = x(nmero bsico) = 12

b) 2^12 = 4096 gametas diferentes

6 Porque isso um caso de


reproiduo assexuada, onde a diviso celular para originar a borbulha foi
mittica, gerando clulas idnticas e assim os frutos so idnticos aos da
planta matriz.

7 a) 2^n = 2^20 40 cromossomos , n = 20


Probabilidade de um gameta igual ao que deu origem ao porco = 1 / 2^20

b) 2n = 40 -> n = 20 (10 pai; 10 me)


C = 20! / (15!x5!) x (1/2)^20
C = 15504 / 1048576
C = 1,48 %

8 Isso ocorre porque o burro um animal com 2n = 63 e como tem metade


dos cromossomos do jumento e metade da gua, o pareamento de homlogos
na meiose no ocorre, alem de haver um cromossomo sobrando, e assim
no formam-se gametas viveis.

Captulo 5 Mendelismo

1 a) Carter controlado por um gene ( monognico), sendo o alelo de


semente lisa dominante sobre o alelo da semente enrugada.

b) Possvel fecundao de plen com gentipo diferente de Aa.

c) sementes lisas = sementes AA = 1/3


sementes Aa = 2/3

300AA 300 = (1/3)x


X = 900 sementes

d) Sim, atravs do retrocruzamento entre o parental recessivo e os indivduos


F1, onde espera-se a freqncia de 1 liso : 1 enrugado.

e) Sementes lisas 1/3 AA ; 2/3 Aa

1/3 AA x AA = 100% AA

2/3 Aa x Aa -> AA = x 2/3 = 1/6


Aa = 2/4 x 2/3 = 1/3
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

4/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
Aa = 2/4 x 2/3 = 1/3

Aa = 2/3 x = 1/6

AA = 2/6 + 1/6 = 3/6 fentipo lisas = 5/6


Aa = 2/6
aa = 1/6 enrugadas = 1/6

2 100% Aa ( 70% Aa e 30% AA)


Aa x Aa = 7/10 AA = x 7/10 = 7/40
Aa = 2/4 x 7/10 = 14/40
Aa x 7/10 = 7/40
3/10 AA x Aa
AA 3/10 x 2/4 = 6/40
Aa = 3/10 x 2/4 = 6/40

AA = 7/40 + 6/40 = 13/40

82,5 % lisa

Aa = 6/40 + 14/40 = 20/40 --|

Aa = 7/40 ->
17,5 % enrugada

3 Realizar o cruzamento teste, ou seja, cruzas as galinhas de pescoo


pelado com galinhas de percoo com penas, que so homozigticas
recessivas. Se no for produzido nenhum descendente homozigoto recessivo,
a galinha homozigota para pescoo pelado.

4 a) touro Mm ; Vaca A mm; Vaca B mm; Vaca C Mm

b) Mm x Mm
MMMm -> mochos
Realizar cruzamentos testes destes animais mochos com animais chifrudos e
selecionar os animais homozigticos e realizar cruzamento entre eles at
atingir os 20 animais.

5 C -> folha crespa ; c -> folha lisa ;


Heterozigotos = (1/2)^g g = nmero de geraes com autofecundao
Het = ()^4 = 1/16

AA = aa = [1 (1/2)^g]/ 2

AA = aa = [1 1/16] = (15/16) / 2 = 15 / 32

Genotpicas: AA = 15/32 ; Aa = 1/16; aa = 15/32


Fenotpicas: folha crespa = 17/32; folha lisa = 15/32

6 Seriam mantidas as freqncias de F2 :


Genotpicas: AA = ; Aa = 2/4; aa =
Fenotpicas: folha crespa = ; folha lisa =

7 a) Carter monognico, sendo o alelo da folha normal dominante sobre o


alelo da folha batata.
b) 1 NN x nn ; 2- Nn x Nn ; 3 nn x nn ; 4 Nn x nn ; 5 NN x N_
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

5/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

8 a) Presume-se que o carter seja monognico, sendo o alelo do


florescimento precoce dominante sobre o alelo do florescimento tardio. Para
que isso seja verdadeiro, a proporo fenotpica na F2 deve ser 3:1.

F2 -> 281 p + 80 t = 361 -> 361 / 4 -> 90,25 -> 90,25 x 3 = 270,75

F2
observado
Esperado
r

Precoce
281
270,75
(10,25)/270,75 =
0,39
Tardio
80
90,25
(10,25)/ 90,25 =
1,16

1,55
G.L. = 130% > P>20%
R = O desvio no foi significativo, logo a hiptese de carter monognico
verdadeira.
b) F2 -> 150 sementes com florescimento tardio
150 = (1/4)x x = 600 sementes
9 O carter da cor do hipoctilo monognico, sendo a cor rosa dominante
sobre a cor verde e o carter do tipo de folha tambm monognico, sendo
que a folha normal dominante sobre a folha batata. Cada carter se expressa
independentemente um do outro, sendo que os alelos de cada gene se
combinam na proporo (3:1)(3:1) = 9:3:3:1

b)
F1:
BBVV x bbvv
F2:
BbVv x BbVv
RC1:
BbVv x BBVV
RC2:
BbVv x bbvv

10 a) Os resultados de F2 e de RC2
b) Na metfase I (onde ocorre a orientao dos cromossomos homlogos) e a
anfase I ( onde ocorre a segregao dos homlogos) da meiose. Gerao F1
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

6/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

11 arroz 2n = 24 12 pares
a) recessivos -> autofecundao de heterozigoto
()^12
b) gentipo heterozigoto (1/2)^12
c) fentipo (3/4)^12
d) (1/2)^2 = ou 2/8
AA = 3/8 aa = 3/8

Recessivos (3/8)^12
Gentipo (1/4)^12
Fentipo (3/8 + 2/8)^12 = (5/8)^12

12 B -> raiz marrom; b -> raiz branca


L -> fruto estreito; l -> fruto largo

B_L_ x bbll
40 f. estreitos Bb
Ll /_ bb

BbLL x bbll
Bb x bb
Bb -> 50% BbLl
Bb -> 50 % bbLl
13 T trote ; t marcha ; A baio ; a preto
Ttaa x TTAA = TtAa
Marchadores e baios ttAA

Realizar o cruzamento entre os heterozigotos TtAa e selecionar os animais


ttA_. Realizar o cruzamento teste entre estes indivduos e indivduos pretos e
selecionar os que no geraram nenhum indivduo preto.

14 BBCCTTNN x bbccttnn
F1 BbCcTtNn
a) bbccttnn (1/4)^4
b) b) B_C_T_N_ (3/4)^4
c) BbCcTtNn(1/2)^4
d) as mesmas

15- Bb (1/2)^3 = 1/8 BB = (1-1/8) /2 = 7/16

a) (7/16)^4
b) (7/16) + (2/16) = (9/16)^4
c) (1/8)^4

16 R -> resistente
r - > susceptvel
Rr x Rr
Rr -> 31/64
Rr -> 2/64 = 1/32 = (1/ 2^5)

5 autofecundaes
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

7/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

17 O alelo recessivo, pois dois indivduos


no afetados geraram prole com indivduos normais e afetados, indicando que
so heterozigotos para o gene.

18 a) Os caracteres so controlados por um gene cada, sendo que em


ambos, o fentipo resistente o dominante.

b) IV

c) 3/8 resistente as 2 doenas


1/8 resistente a 1 e susceptvel a 2
1/8 resistente a 2 e susceptvel a 1
3/8 susceptivel as 2 doenas

Captulo 6 Interaes allicas e no allicas

1 Pena normal -> ff


Penas acentuadamente onduladas -> FF
Penas medianamente onduladas Ff

12 por ninhada
36 (18 Ff; 15 FF ; 3 ff)

Ff x Ff (1/4 FF; Ff; 1/4ff)

x 12 = 3 FF ; 3 ff
x 12 = 6 Ff

Ff x FF => = Ff ; FF -> x 12 = 6 FF e 6 Ff

FF = 6+3+6 = 15 Gentipos das galinhas : FF , Ff e ff


Ff = 6+6+6 = 18
ff = 3

2 m -> chifre
M -> mocho a) MmRr (3:1) x MmRr (1:2:1)

RR -> Vermelho 3 vermelho mocho : 6 mocho ruo : 3 mocho branco: 1 chifre


Rr -> ruo vermelho: 2 chifre ruo : 1 chifre branco.
Rr -> branco

b) F2 20 animais vermelhor e mochos homozigotos


MMRR = x = 1/16
20 = (1/16)x -> x = 320 animais

c) F2 RrMm 2/3
RrMM 1/3
2/3 Mm x MM 1/3
MM = 1/3 x 2/3 x 2/4 = 4/36
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

8/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
MM = 1/3 x 2/3 x 2/4 = 4/36

Mm = 4/36

2/3 Mm x Mm 2/3
MM = mm = 2/3 . 2/3 . = 4 / 36
Mm = 2/3 . 2/3 . 2/4 = 8/36

1/3 MM . MM 1/3
MM = 1/9 = 4/36
MM = 4/36 + 4/36 + 4/36 + 4/36 = 16/36
Mm= 4/36 + 8/36 + 4/36 = 16/36
Mm = 4/36

MMRR = . 16/36 = 16/144


MMRr = 2/4 . 16/36 = 32/144
MMrr = 16/144
mmRR = 4/144
MmRR = 16/144
mmRr = 8/144
MmRr = 32/144
Mmrr = 4/144
Mmrr = 16/144

Mocho vermelho = 16/144 + 16/144 = 32 / 144 = 4/18


Mocho ruo = 32/144 + 32/144 = 64/144 = 8/18
Mocho branco = 16/144 + 16/144 =
32/144 = 4/18
Chifre vermelho = 4/144 = 1/36
Chifre ruo = 8/144 = 1/18
Chifre branco = 4/144 = 1/36

3 F2 11 vermelhos esfricos
20 vermelhos ovais
9 vermelhos alongados
21 rosas esfricos
39 rosas ovais
19 rosas alongadas
10 brancos esfricos
22 brancos ovais
11 brancos alongados

Corda raiz
Vermelhas : 40 1
Rosas: 19 2
Brancas: 43 1
Total: 162

Forma da raiz
Esfricos : 42 1
Ovais : 81 2
Alongados: 39 1
Total: 162
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

9/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

a)Dominncia parcial ou incompleta, indicado pelo fentipo do heterozigoto


que intermedirio aos dois homozigotos.
b) facilita, pois permite identificar os homozigotos
c) VVAA x vvaa ou VVaa x vvAA
d) 50 plantas vvaa=1/4 . = 1/16
50=(1/16)x -> x= 800 plantas

4 abbora : branca, amarela e verde


Puras brancas x puras verdes
F1 todas brancas -> AaBb
F2 42 brancas : 13 amarelas: 3 verdes -> 61
12:3:1

a) carter regulado por 2 genes que segregam independentemente, cada um


com 2 alelos, sendo o alelo A episttico dominante sobre o alelo B.
b) frutos amarelos
frutos brancos
27b : 16a : 16v -> 59
2: 1 : 1

AaBb x aaBb
AaBb + Aabb -> 2 brancos

aaBb -> 1 amarelo


aabb -> 1 verde

5 branca x branca ->100 prpura


245 -> 110 brancas : 135 prpuras
7:9

9 { P_V_
7 { P_ vv ; ppV_; ppvv
R: Carter controlado por 2 genes que se segregam independentemente um
do outro, sendo a interao entre eles do tipo epistasia recessiva dupla.

6 amarela, roxa ou branca


Roxa x branca
F2 : 9 roxas :3 amarelas : 4 brancas
9 { C_D_ -> roxo
3 { ccD_ -> amarelo
4 { C_dd -> branco ; ccdd -> branco

a) carter controlado por 2 genes que so independentes, sendo a interao


do tipo epistasia recessiva, sendo o alelo d episttico ao alelo C.
.
1d 1c
b) sub ----- PI --------- PF
branco amarelo roxo

7
a) IiAAMm -> branco
IiaaMM -> branco
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

10/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

IIAAMM -> branco


iiAAMM -> prpura
iiAAmm -> vermelho

b)IiAaMm x IiAaMm
I_A_M_ = (3/4)^3 = 27/64
I_A_mm = (3/4)^2.1/4 = 9/64
I_aamm = . (1/4)^2 = 3/64
Iiaamm = 1/64
I_aaM_ = (3/4)^2.1/4 = 9/64
iiaaM_ = (1/4)^2.3/4 = 3/64
iiA_M_ = 9/64
iiA_mm = 3/64

branca = 52/64
prpura = 9/64
vermelho = 3/64

8A+B
510 brancas : 176 purpuras
3:1
A autofecundada
76 purpuras : 58 brancas
9:7
PpVv x ppvv
Ppvv } B -> 3:1
PpVv } P
Ppvv; ppVV } B

a) PpVv x ppvv
b) ppvv
100% ppvv
100% branca

9 C 1 -> raa 1 ; C2 -> raa 2 } codominantes

Altura = A_B_ ; A_bb } alta


aaB_} mdia
aabb } baixa

a) AaBbC1C2 x aabbC1C2

b) Para o carter resistncia, o carcter monognico, com 2 alelos com


codominancia. Para o carter altura, controle de 2 genes independentes,
sendo A e a, B e b os alelos de cada genes, sendo A episttico dominante
sobre B. Os 3 genes so independentes.

10 a) A cor da plumagem controlada por 3 genes


B) F1 100% brancas
F2 13/16 brancas; 3/16 coloridas

Captulo 8 Alelismo mltiplo


http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

11/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

1 a) 2 alelos
NGD= 2(2+1)/2 ----> NGD = 3 gentipos

b) n de fentipos = m
n de fentipos = 2
c) n de fentipos = NGD
n de f = 3
d) m = 10 alelos
gentipos = 10(10+1)/2
gentipos = 55

10 fenotipos (dom completa)


55 fenotipos (dominncia incompleta)
e) 10 genotipos homozigotos

2 Porque um individuo diplide s pode ter no maximo 2 alelos

3 12 alelos
a) 12/2 = 6 indivduos
b) NGD = 12 (12+1)/2
NGD = 6.13 = 78 gentipos

4 5 alelos p^g > p5 > p 0 > pt > p


a) gentipos homozigotos = 5
gentipos heterozigotos = 5 (5-1)/2 = (5 .
4)/2 = 10

b) 5 fenotipos
vagem prpura com suturas verdes
p^gp^g, p^gp5, p^gp0; p^gpt; p^gp
vagem verde com suturas prpuras
p5p5, p5p0; p5pt; p5p
vagem verde com sutura ventral prpura
p0p0; p0pt; p0p
vagem extremidade prpura
ptpt; ptp
vagem verde
pp

5 3 alelos (A, A, A)
A = A > A
a)Gho = 3 (3-1)/2 = 3
Gho =3
b) 3+1 = 4 fenotipos
c) A4>A5 = A6> A=A > A
Gho = 6 Ghe = 6 (6-1)/2 = 15
Fentipos = 6 + 2 = 8

6 R> rr
35% RR
20% rr
45% rr
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

12/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

RR x rr
Rr = 0,45 x 0,35 x 2
Rr = 31,5
Rr x rr
Rr = 0,45 x 0,45
Rr = 20,25 %
RR x RR
RR = 0,35 x 0,35
RR = 12,5%
rr x rr
rr = 0,2 . 0,2
rr = 4%
RR . rr
Rr = 0,35 . 0,2 . 2
Rr = 14%
rr . rr
rr = 0,2 . 0,45 x 2
rr = 18%

Fentipos
Vermelho = (RR, Rr, Rr) = 57,75%
Manchas averm (rr, rr) = 22%
Verm. Claro (rr) = 20,25 %

7 O segundo agricultor, pois utiliza diferentes cultivares, sendo que estas tm


mais chances de ter alelos de incompatibilidade diferentes, possibilitando
maior nmero de fecundaes.
8 a) no se considera os homozigotos
NGD = NGhe = 6(6-1)/2
NGD = 15 gentipos

b) 2/n = 2/6 = 1/3 dos gametas abortaro.

10
a) S>S > S > S4
SS
SS
SS4

Cruzamentos = 3 = 9
3 cruza,emtps s]ap emtre os ,es,os gentipos, logo daro 100% de aborto.

3/9
b) Obter artificialmente indivduos homozigotos SS, SS, SS e S4S4 e
utilizar duas delas para obter hbridos. Plantar cada linhagem em fileiras
alternadas. Como no poder ocorrer autofecundao, nem fecundao entre
indivduos da mesma linhagem, as sementes obtidas sero todas hbridas,
provenientes de fecundao aleatria.

11 a) Avaliar se ocorrer auto fecundao nestas plantas.


b) atravs de propagao assexuada ou atravs da autofecundao artificial,
onde
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

13/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

onde
se retira a extremidade dos pistilos ou se fecunda o plen antes da maturao
dos pistilos.
c) Usar duas linhagens autoinconpatveis e planta-las em fileiras alternadas.
Assim, s se ter fecundao aleatria entre os 2 linhagens.

12 Realizaria cruzamentos entre indivduos homozigotos de diferentes


fentipos. Se em todos os cruzamentos ocorrer na gerao F a proporo de
3:1 ou 1:2:1, ocorre uma srie allica. Se em um dos cruzamentos na gerao
F2 a proporo for diferente, ocorrem mais de um gene.

Captulo 9 Ligao, permuta gentica e pleiotropia

1 D = Planta alta
d = planta an
P = rugoso
p = liso

an lisa ddPp = 5 ; ddpp = 118 -> dp ; Ddpp = 5; DdPp = 161 -> DP ; total =
289

a) 72,25 para cada fentipo


b) Os genes so ligados, sendo a distncia entre os genes de 3,46 cM -> PG =
3,46

2 a)

b) 100 meicitos -> O nmero de clulas com permuta gentica 3,46 x 2 =


6,92. Ou seja, aproximadamente 7 meicitos apresentaro permuta entre P e
D.

3 I -> resistncia ao vrus da mancha anelar


C -> resistncia ao vrus do mosaico

IiCc x iicc
440 IiCc
450 iicc
151 Iicc
145 iiCc

Fa = (151 -145)/1186 = 25%

a) 25 cM
b)

Resistente aos 2 vrus

Suscetvel aos 2 vrus

Resistente apeas ao vrus da mancha anelar


http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

14/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

Resistente apenas ao vrus do mosaico

c) Fase de atrao

4 R -> nodulao normal


R -> sem nodulao
F -> caule cilindrico
F -> caule fasciado
P1 RRFF x p2 rrff
F1 RrFf

e
c
x
R_F_
746,4
820
(13,6)/146,4 = 7,25
R_ff
248,8
228
1,13
rrF_
248,8
227
441/248,8 = 1,77
rrff
82,9
52
954,8/82,9 = 11,5

x = 22,25

a) De acordo com os resultados de x, percebe-se que os desvios foram


altamente significativos. Sendo assim, conclui-se que os genes no so
independentes,
esto no mesmo cromossomo.
b) fase de atrao
c) FR = (68+72)/350 = 0,4 ou 40 cM

5 W -> preto fr -> folhas onduladas


w -> branco Fr -> folhas lisas
d = 34 cM

a)

F1

Wfr = 33%
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

15/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

wFr = 33%
wfr = 17%
WFr = 17%

Wfr / Wfr = 0,11


wFr / Wfr = 0,11
Wfr / wFr = 0,11
wFr / wFr = 0,11
Wfr / wfr = 0,056
wFr / wfr = 0,056
Wfr / WFr = 0,056
wFr / WFr = 0,056
wfr / wFr = 0,056
WFr / WFr = 0,029
wfr / Wfr = 0,056
WFr / wfr = 0,029
WFr / Wfr = 0,056
WFr / wFr = 0,056
wfr / wfr = 0,029
wfr / WFr = 0,029

APFL = 53,1%

APFO = 22,2 %

ABFL = 22,2%

ABFO = 2,9%

b)
APFO = 33%
APFL = 17%
ABFO = 17%
ABFL = 33%

6 P -> Pericarpo vermelho


p -> pericarpo incolor
ts2 -> sementes no pendo
Ts2 -> pendo normal

b)
FR 1 = 29 / 2422 FR 2 = 17/1207
FR1 = 1,19% FR 2 = 1,4%
a freqncia em mdia 1,29%

c)

P Ts2 = 49,35%
p Ts2 = 49,35%
p ts2 = 49,35%
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

16/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

P ts2 = 49,35%
P ts2 = 0,645
P Ts2 = 0,645%
p Ts2 = 0,645
p Ts2 = 0,645%

ppts2ts2 = 31,8%

q polpa verde
c casca verde
f fruto liso

F1 QqCcFf

F2

esp.
x
qqccff -> 42
420
0,009
QqCcFf -> 418
420
0,009
qqCcff - > 424
420
0,038
QqccFf -> 416
420
0,038

GL = 3
x=0,094

a e b) Os genes da cor da polpa e do tipo de fruto so ligados e inteiramente


ligados, pois no existem recombinantes entre elss. J o gene da cor da casca
independente dos 2 genes.

8 L e Cu = 16cM (1x)
L -> folha estreita
l -> folha larga
Cu -> folhas normais
cu -> folhas onduladas
(x2) W -> resistente ao fusarium
w -> suscetvel ao fusarium

a)
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

17/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

a)
.
_cu = 42%
W = 50%
lCu = 42%
w = 50%
Lcu = 8%

lcu = 8%

LcuW = 21%
LCuW = 4%
_cuw = 21 %
L Cuw = 4%
lCuW = 21%
lcuW = 4%
lCuw = 21%
lcuW = 4%

b) llcu cu
ww

9gl -> f. brilhantes


v -> virescentes
lg -> s/ lgula

PD =
Glgl Vv Lglg

glgl vv lglg

P1 =
Glgl vv lglg

P2 =
glgl Vv Lglg

I=
Glgl vv Lglg

glgl Vv lglg

II =
Glgl Vv lglg
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

18/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

glgl vv Lglg

I = 190/1000 = 19 cM
II = 413/1000 = 41,3 cM

a)

b) FPDE = (19 x 41,3)/100 -> FPDE = 7,84%

FPDO = (28 + 23)/1000 * 100


FPDO = 5,1 %

I = 1 (5,1/7,84) -> I = 1 0,65 -> I = 0,35


35% das pd no ocorrem

10

b) lu bm = 12cM
lu bv = 18cM
gl vp2 = 4cM
gl bm = 7cM
vp2 ps = 1cM
vp2 bm = 3cM

11
m folhas manchadas
d planta an
p fruto piloso

MeD

Mdp -> 0,022

MDP -> 0,455


MDP -> 0,022

mdp -> 0,455


MDp -> 0,022

mdP -> 0,022

http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

19/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

MdP -> 0,001

MDP/ MDP = 20,7%


MDp -> 0,001

MdP/MdP = 10^-4%

pd = 0,002

b) mDP/ Mdp

MDP/MDP = 2,25 x 2,25 = 0,05%

12 -

a)

b) h a = 20cM
a id = 17,4cM

9,3% H a id = 20 % - 2,78/2 0,2 = 1 o/e


9,3% h A Id

8% H A id = 17,4% - 2,78/2 0,2 = 1 ob/3,48


8% h a Id

1,39% H a Id = 2,75 % 0,2 = (3,48 3,48)* o /3,48


1,39 h A id

31,3% H A Id = 62,6 % 3,48 * 0,2 = 3,48 o


31,3% h a id 0,696 3,48 = o
-2,78 = - o => o = 2,78

13 - a-> distribuio independente

12cM
a)
Cr1D1 = 9%
Cr1 D1 A = 4,5%
Cr1 d1 A = 20,5%
cr1d1 = 9%
Cr1 D1 a = 4,5%
Cr1 d1 a = 20,5%
Cr1d1 = 41%
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

20/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

cr1 d1 A = 4,5%
cr1 D1 A = 20,5%
cr1D1 = 41%
cr1 d1 a = 4,5%
cr1 D1 a = 20,5%

b) Cr1 D1 A / cr1 d1 a
P = 0,045

n = [log (1 0,95)] / log (1 0,045) = (log 0,05) / log 0,955 = - 1,3 / 0,019

n = 68,42 x 50
n = 3253 plantas

14 a) herana controlada por dois genes, sendo os


alelos de resistncia dominantes sobre os alelos de susceptibilidade, sendo
que os dois genes esto no mesmo cromossomo.

b) realizar o cruzamento F2.

Captulo 10 Efeito do ambiente na expresso gnica

1 No himalaia a enzima codificada pelo alelo funcional funciona sob


condies de baixa temperatura, que so atingidas nas extremidades do
coelho, limitando esse ambiente para as demais partes corpreas do animal.
O pelo ficar preto porque se estar criando o ambiente propcio para a ao
da enzima. Dessa forma, diz-se que o ambiente influencia na expresso do
fentipo.

2 a) A ao da clorofila s ocorre com a ao da luz. Como a grama nova


no recebe luz quando estava se formando, no foi produzida clorofila e a
grama ficou branca.

b) Significa que essas plantas tem gentipo albino.


c) fenocpias.

3 a) as mdias das cultivares.


b) As mdias de todas as cultivares em cada local.
c) SQcl = 52279315,5
Sim, existe interalo gentipo x ambiente.

d) Avaliar como cada cultivar se comporta em cada ambiente.

4
Caldas -> mdia ( 1825; 2329; 2216 ; 2199 ) = 2069
Machado -> mdia (91; 595; 482; 465; 40) = 335

-1134

5 a) no houve interao.
b) houve interao do tipo complexa.
c) houve interao do tipo complexa.
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

21/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
c) houve interao do tipo complexa.

6 a) Sim, pois h evidncia de que cada cultivar responde de forma diferente


ao tipo de cultivo.
b) Indica para que cultivares o cultivo mais indicado.

7 a) Sim, pois h vrios exemplos em que a maior mdia de um ano foi


menor que a mdia menor de outro ano.
b) Recomenda-se aos produtores utilizar plantas mais velhas para a produo.

8 a) a) A penetrncia do alelo dominante no completa.

b) O alelo dominante expressa uma enzima ativa a 27, mas no a 18C.


Sendo assim, o alelo tem vrios graus de
expressividade. O alelo tem penetrncia incompleta e expressividade varivel.

9 Plantar cada grupo de sementes e avaliar se as sementes novas que estas


sementes produziro sero diferentes entre si.

10 Quer dizer que a suscetibilidade controlada por um gene que possui


expressividade varivel.

11 a) gentica, ambiental e gentica x ambiental.


B) Compreender que determinados gentipos so mais produtivos que outros
de acordo com a condio a que esto submetidos.

12 a) Ambiental, gentica e gentica x ambiental.


b) Conhecer qual espcie mais adaptada para cada regio.

13 Significa que esses alelos no se expressa em 100% dos indivduos que


tem o gentipo aa e que quando se expressa, possui vrias geraes do
fentipo.

Captulo 12 Gentica quantitativa

1 a) 12 m 2
cm

12 x 20
F1 = 16m
1/256 = 1/(4^4) = 0,004

b) c = 20 12 = 8 m
c=8m:8=1m

c) F 1 -> 4 efetivos e 4 no efetivos


c = 8!/4!4! = 70

(70/256)*20.000 = 5468,75 plantas

d) A1 = B1 = C1 = D1 = 2,5 m
A2 = B2 = C2 = D2 = 1,5 m
P1 = A1A1 B1B1 C1C1 D1D1 = 20m
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

22/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
P1 = A1A1 B1B1 C1C1 D1D1 = 20m

P2 = A2A2 B2B2 C2C2 D2D2 = 12m


F1 = A1A2 B1B2 C1C2 D1D2 = 16m
Como a interao aditiva, a heterose em F1 e F2 zero.

18 m ->6 efetivos e 2 no efetivos


c = 8!/(6!2!) = 28
(28/256)*20.000 = 21875 plantas

e ) 16m -> 4 efetivos e 4 no efetivos


A1A1 B1B1 C2C2 D2D2 X A2A2B2B2C1C1D1D1
F1 A1A2 B1B2 C1C2 D1D2
Produzir a mesma gerao F2 do cruzamento anterior.

f) 12 m -> 0,024%
1/x = 0,00024

x= 1/0,00024 4^x = 4166 = 4096


x = 4166
4^6 = 4096
6 genes -> 12 alelos - 8:12 = 0,66m

g) Que a medida que aumentam os alelos envolvidos no controle do carter,


menor a contribuio de cada um.

2 a) AA BB CC DD = 20 m
aa bb cc dd = 12 m
AA = Aa = BB = Bb = CC =
Cc = DD = Dd = 5m
aa = bb = cc = dd = 3m

b) AA bb cc DD x aa BB CC dd
P 1 = 16 m P2 = 16
F1 -> Aa Bb Cc Dd
F1 = 20 m
Ocorrem 5 fentipos, com amplitude de 12 m 20 m

c) hF1 = 20 16
hF1 = 4m
F2 = F1 h/2
hF2 = hF1/2 = 4/2
hF2 = 2 m

3 a) J que a media dos pais igual a mdia de F1 e de F3, a interao


do tipo aditiva.
b) 0,001 = 1/1024 = 1/(4^5)
n = 5 genes
c) 10 alelos C = 30 2 = 28 10 = 2,8 m
efetivo = 3 efetivo = 0,2

Nelore = A2A2 B2B2 C2C2 D2D2 E2E2


Holandesa = A1A1 B1B1 C1C1 D1D1 E1E1
Mestias = A1A2 B1B2 C1C2 D1D2 E1E2
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

23/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

a = efetivo
b = no efetivo

d) (a+b)^10 = 1/1024 = 30 c / a
10/1024 272 c / a
45/1024 = 24,4 c / a
120 / 1024 = 21,6 c / a
210 / 1024 = 18,8 c / a
252 / 1024 = 16 c / a
210/ 1024 = 13,2 c / a
120 / 1024 = 10,4 c / a
45 / 1024 = 7,6 c / a
10/1024 = 4,8 c / a
1/1024 = 2 c / a

(a + b)^10/2^10

e) 252/1024 * 2000 = 492,18 animais

4 F1 Aa BbC c Dd Ee Ff Gg Hh Ii Jj
(a + b)^20 / 2^20 = a^20 = 1 / 1048576

20 = 1/1048576 *
20 = 1 / 2097152 x
x = 41943040 animais

5 A = 30g / doa 8 genes com interao aditiva


B = 50g / dia
a) 50 30 = 20g / dia
20 16 = 1,25g / dia
(a + b)^16
A^16 50 g/dia
16A^15 B^1 48,75
120A^15 B^2 47,5
560A^13 B^3 46,25
1820A^12 B^4 45,00
4368A^11 B^5 43,75
8008A^10 B^6 42,5
11440A^9 B^7 41,25
12840A^8 B^8 40
11440 A^7 B^9 38,75
8008 A^6 B^10 37,5
4368 A^5 B^11 36,25
1820 A^4 B^12 35
560 A^3 B^13 33,75
120 A^2 B^14 32,5
16 A^1 B^15 31,25
B^16 30g/dia
total = 65536

http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

24/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

b) dominante = 50 : 8 = 6,25g/dia lcus efetivo = 2,5 g/dia


30:8 = 3,75 g/dia

( a + b)^8 =
1(3/4)^8 = 6561/65536 = 50g/dia
8(3/4)^7(1/4)^1 = 17496/65536 = 47,5 g/dia
28(3/4)^6
(1/4)^2 = 20412/65536 = 45 g/dia
56 (3/4)^5 (1/4)^3 = 13608/65536 = 42,5 g/dia
40 (3/4)^4 (1/4)^4 = 5670/65536 = 40 g/dia
56 (3/4)^3 (1/4)^5 = 1512/65536 = 37,5 g/dia
28 (3/4)^2 (1/4)^6 = 252/65536 = 35 g/dia
8 (3/4)^1 (1/4)^7 = 84 / 65536 = 32,5 g/dia
(1/4)^8 = 1/65536 = 30g/dia

6 produtividade -> 12 alelos aditivos


teor de protena -> 8 alelos aditivos
a) P = 1/(2^12) x 1/(2/8) = 1/(2^20) = 1 /1048616
P = 9 x 10^-5%

b) P = 1/(2^100)
c) Quanto mais genes esto envolvidos no controle do carter quantitativo,
maior deve ser a populao para se obter o fentipo desejado.
d) 2^10 = 1024 linhagens.

7 a) Porque alm de apresentar varincia ambiental e gentica, apresenta o


maior nmero de gentipos diferentes e portanto maior varincia gentica.
b) Porque apresentam varincia ambiental e gentica e menor nmero de
gentipos envolvidos.
c) Provavelmente interao aditiva.
d) n = (P1 - P2)^2/8 6 = (39,5 27,7)/8*16,01 = gene

variao ambiental = (8,1 + 4,34 + 3,83)/3 = 5,42

8 a) ha = variao GF2/ variao F2 = 16,01 / 21,43


herdabilidade = 74,71%

b) hr = (42,86 29,88)/ 21,43


hr = 60,6%

c) ds = 38 33,4
ds = 4,6%
GS = 4,6 * 0,606
GS = 2,78
GS% = 2,78/33,4
GS = 8,3%
d) Porque a herdabilidade no 100% e tambm porque h segregao dos
heterozigotos.

9 a) (SG x H) (SG x H)
mdia = (SGSG + SGH + SGH + HH)/4 = (175,34 + 2*216,67+177,89)/4 =
(175,34+ 433,34 + 177,85)/4 = 196,64 kg
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

25/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

(175,34+ 433,34 + 177,85)/4 = 196,64 kg

b) Do plantel bimestio, pois este apresenta maior variao genotpica.

c) HH x HSG = HH + HSG + HH + HSG (3H 1SG)

3/8H ; 3/8 SG = HSG) * (3/4H SG)


7/18H; 1/8 SG = (3/4H ; SG) * H
d) HH * HSG = HH + HSG + HH + HSG
(555,78 350,58)/3 = 176,61

HSG H SG) = (3HH + HSG + 3SGH + SGSG)/4

(533,6 + 216,67 + 650,01 + 175,34)/8


= 196,95kg
(3/4H 1/4SG)*H = (3*HH + SGH)/3 = 933,67 + 216,67 = 187,87kg ???

10 a) media = (V4 + V5)/2 = (27,1 + 25,6)/2 = 26,35


h = 29,7 26,35
h = 3,35
media = (25,6 + 18,8)/2 = 22,2
h = 27,9- 22,2
h = 5,7

b) F2 4:5 = 29,7 3,35/2 = 28,02


F2 5:6 = 27,9 5,7/2 = 25,05

d) (V1 * V2 ) * V3 = (V1V3 + V2V3)/2 = (26,8 + 28,6)/2 = 27,4


(V1*V2)*V3 = 27,7 (F1)
(V1V3 + V2V3) = (V1V3 + V2V3)(V1V3 + V2V3)
F2 = 21,7 + 107,2 + 53,2 + 115,6 + 114,4 + 28,3
F2 = 27,5

(V4*V5)*V3 = 1/2V4V3 + 1/2V5V3 = (28,5 + 27,4)/2 = 27,95


(V4*V2 + V5V3)*(V4V3 + V5V3)
F2 = 28,2 + 114 + 59,4 + 115,6 + 109,6 + 25,6 = 452,4/16
F2 = 28,27

e) (V1V2)*(V5V6) = (V1V5 + V1V6 + V2V5 + V2V6)/4

F1 = (25,1 + 22 + 28,7 + 26,2)/4 = 25,5

F2 = 21,7 + 28,3 + 25,6 + 18,8 + 53,2 + 50,2 + 44 + 57,4 + 52,4 + 55,8 = 407,4
F2 = 25,46

11 a) NHD = 3n!/4!(n-4)! = 6
NHD = (3*6!)/ 4!(2!) = (3*5*6)/1*2 = 45

b) AB + BC + BE + CE

c) (B*C)(A*E) = BA + BE + CA + CE = (7,12 + 6,85 + 6,35 + 6,4)/4


F1 = 6,68
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

26/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

F2 = 1,4 + 1,35 + 1,26 + 1,3 + 14,24 + 12,28 + 13,6 + 12,8 + 12,7 + 13,7
F2 = 5,29
A redio ser de 20,8% . Essa reduo ocorre porque na gerao F2 h
segregao e recombinao dos genes, e a freqncia de locos em
heterozigose reduzida metade. Em conseqncia a heterose manifestada
na gerao F1 reduzida tambm em 50%.
h = 6,1 5,29 = 1,41 = 21%

12 a) n = (3 * l!)/ 4!(l-4!)
n= (3*5!)/4!(5-4!) = > n = 3*5 = 15 HD
b) (A*D)(B*C)

Captulo 13 Gentica de populaes

1 a) B1B1 0,086
B1B2 0,458
B2B2 0,476

B1 = 0,086 + 0,438/2
B2 = 0,476 + 0,219 = 0,695

B1 = 0,086 + 0,219 = 0,305

b) p = (0,305) = 0,093 6000 =


2pq = 2*0,305 x 0,695 = 0,424
q = (0,695) = 0,48

obs
esp
x
BB
516
558
3,16
BB
2628
2544
2,77
BB
2856
2880
0,2

Gl = 2
x= 6,13**
A populao no est em equilbrio.
2 2000 125 brancas
a) VV = 0,0625
V = 0,25
V = 1- 0,25 = 0,75
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

27/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
V = 1- 0,25 = 0,75

b) vermelhas VV = 0,5625 * 2000


VV = 1125 plantas
rosas = VV = 2* 0,25 * 0,75
VV = 0,375 * 2000 = 750 plantas

3 VV V = 0,5 ; V = 0,5
VV = 0,25
VV = 2 * 0,5* 0,5 = 0,5
VV = 0,25
1 branca 2 rosas 1 vermelho

4 1200 -> 48 bb
a) bb = 0,04 B 0,834
b = 0,2 b = 0,166
B = 0,8 vermelho- brancas : 1200 * (1,66)
v b = 1200 * 0,0275
v b = 33 animais

b) q = q / ( 1 + q0) = 0,2 / 1,2 = 0,166

5 BB 0,64 * 1200 = 768 ->0,66


Bb 0,32 * 1200 = 384 -> 0,33
total = 1152

0,33 Bb * Bb 0,33
bb = * 0,33 * 0,33
bb -> 0,027 ou 2,7%

6 A -> roxo ; a -> amarelo W = 10.000.


a) amarelo = 1600 / 10.000
aa = 0,16
a = 0,4

b) A -> 0,6
AA -> 0,36 * 10.000
raas homozigotas -> 3600 plantas

c) q = q / (1 + 5q) -> q = 0,4 / [1+ (5*0,4)] -> q = 0,4/(1+2) = 0,4 / 3 -> q = 0,13
aa = 0,017 ou 1,7%

7 aa -> 0,49% -> 0,0049


t=?
a -> 0,09
t = 1/0,07 - 1/ 0,13

t = 14,29 7,69 = 7 geraes

8 Na popula~~ao com 0,49 % de plantas com bulbos amarelos.

9 2400 gros
a) brancas -> 1176 / 240 -> 0,49 y = 0,7 -> y = 0,3
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

28/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

enrugadas -> 808 / 2400 -> 0,34 su = 0,58 Su = 0,42


b) homozigotas lisas e amarelas
YY = (0,3) = 0,09 SuSuYY = 0,01584 = 1,58%
SuSu = 0,1764

10 a) q = 0,7 / (1+0,7) = 0,7/1,7


y = 0,41
Y = 0,59

q = 0,58 / (1 + 0,58) = 0,58 / 1,58


su = 0,37
Su = 0,63

b) Y = 0,59
Su = 0,63
y = 0,41
su = 0,57

YYSuSu = 0,3481 *
0,3969 = 0,14

YySuSu = 0,4838 * 0,3969 = 0,19

YySusu = 0,4838 * 0,4662 = 0,2255

YYSusu = 0,3481 * 0,4662 = 0,1623

total = 71,78%

11 Y -> branca ; y = amarela


20.000 -> 64% com razes brancas
5000 sementes de YY
36% amarela
0,36 -> y = 0,6 y = 1,0
M = 5.000/25.000 = 0,2

q1 = q0 + M (qm - q0)
q1 = 0,6 + 0,2 (1-0,6)
q1 = 0,6 + 0,2*0,4
q1 = 0,6 + 0,08
q1 = 0,68
yy = 0,4624 -> 46,24%

Captulo 16 Efeito materno e herana extracromossmica

1 a) R -> direita F1 -> esquerda


r -> esquerda F2 -> direita
pai -> RR F2 -> RR; Rr; rr
me rr
F1 Rr

b) fenotpica 3 direitas 1 esquerda


genotpica 38 RR ; 2/8 Rr ; 3/8 rr
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

29/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

genotpica 38 RR ; 2/8 Rr ; 3/8 rr

2 Realizar cruzamentos reprocos. Se for visto que o fentipo de F1 no


depende do fentipo da me, so genes nucleares. Se depender do fentipo
da me, efeito materno a herana citoplasmtica. Nesse caso, se em
cruzamentos seguintes, houver persistncia do fentipo, a herana
citoplasmtica. Se no houver, efeito materno. Se em vrios cruzamentos o
fentipo no aparecer em nenhum, houve influncia ambiental.

3 O carter tem herana com efeito materno.

4 Se nos cruzamentos posteriores a F1 persistir, o fentipo determinado


pela me, a herana citoplasmtica. Se aparecer um fentipo diferente em
uma gerao, a herana por genes nucleares que sofrem efeito materno.

5- (amargo) * (doce) ; (doce) * (amargo)


F1 doce -> amargo F1 -> amargo

a) o carter determinado por genes nucleares que sofrem influncia de


protenas presentes no citoplasma da me no inicio do desenvolvimento da
planta.

b) DD * dd dd * DD
F1 Dd coce -> amargo F1 Dd amargo

c) F2 : DD : 2Dd : dd F2 : DD : 2 Dd : dd
jovens
todas amargas jovens: todas amargas
adultas 3 amargas : 1 doce adultas: 3 amargas : 1 doce

6 a) Sim, pois nos dois cruzamentos o fentipo de F1 igual ao fentipo da


me.

b) Caso seja controlado por um gene nuclear, e o fentipo dominante seja 50g,
na gerao f2, j que h efeito materno, ser expressado o fentipo do
gentipo de F1, ou seja, peso 50g. Se for gerana extracromossomica, no 1
cruzamento F2 continuar com 18 g e no 2 cruzamento F2 ter 50g.

7 a) alelo cromossmico. A verde ; a amarela;


AA * aa AA * aa
F1 Aa -> verde F1 : Aa -> verde
fator citoplasmtico.
A*aa*A
F1 : A verde F1 : a amarelo.
b) cromossmico
Aa * aa Aa * AA
RC1 Aa ; aa F1 : Aa; AA
1 verde : 1 amarelo 100% verde
fator citoplasmtico

A*aa*A
RC1: 100% verde RC1: 100% amarelo.
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

30/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

c) alelo cromossmico
Aa * Aa
3 verdes : 1 amarelo
fator citoplasmtico.
A*Aa*a
F2 : 100% verde F2 : 100% amarelo

d) Aa * Aa (cromossmico)
R : 3 verdes : 1 amarelo

A*a
R: 100% verdes
a*A
R: 100% amarelos.

8 - FAAL * FNAC
F1 FAAL
F2: 309 FAAL 87 FAAC
100% folhas amarelas
3 cristas longas; 1 crista curta
FNAC * FAAL
F1 : FNAL
F
328 FNAL: 107FNAC
3 Cristas longas : 1 crista curta.
100% folhas verdes.

O carter do tipo de crista controlado por um gene nuclear que no sofre


efeito materno, sendo crista longa dominante sobre crista curta. J a cor da
folha determinada por um gene citoplasmtico, j que sempre que a me
possui uma cor de folha, seus descendentes tero a mesma cor.

9 a) LVV * Lvv
F1 : LVv ->
verde 100%
F2 : LVV ; LVv; Lvv
3 verdes: 1 amarelo

b) l vv * L VV
F1: L Vv -> verde 100%
F2 LVV ; LVv ; Lvv
3 verdes : 1 amarelo

c) LVV * L vv
F1 LVv 100% verde
F2 LVV ; LVv; Lvv
3 verdes : 1 amarelo

d) L vv * L VV
F1 LVv 100% amarelo
F2 LVV ; LVv; Lvv
100% amarelo
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

31/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
100% amarelo

e) LVv * LVv
LVV ; LVv; Lvv
3 verdes : 1 amarelo

f) L Vv * L Vv
C : LVV ; L Vv; L vv
100% amarelo.

10 a) Herana citoplasmtica.
b) 1 100% branco
2 100% verde
3 plantas verdes, variegadas e brancas.
4 100% branco.

11 Realizar cruzamentos recprocos e observar se os descendentes


possuem o fentipo da me.

12 Realizar o cruzamento entre uma planta feminina com o gene mitocondrial


da macho-esterilidade e a linhagem desejada e ao obter os descendentes
com o gene da macho-esterilidade, usar sempre as plantas femininas para
cruzar com machos das linhagens puras, at obter em uma gerao Fn os
descendentes com quase 100% da origem da linhagem desejada.

13 a) M, Rf, rf M1 -> gene da macho-esterilidade.

b) mRfRf * Mrfrf

c) A ( S rfrf ) * B ( N RfRf) C ( S rfrf) * D ( N rfrf)


AB (S Rfrf) CD ( S rfrf)

(A*B)(C*D) (S Rfrf)
50% frtil.

d) A linhagem promissora macho-frtil, se obtida de populao sem o alelo


restaurados, a sua constituio deve ser rfrf(N). Atravs de retrocruzamentos
sucessivos com uma planta macho-estril, transfere-se o gentipo da linhagem
desejada para o citoplasma macho-estril. Desse modo, consegue-se a
linhagem desejada com a constituio macho-estril. O
cruzamento delas ir produzir sempre a linhagem macho-estril.

14 Se for sempre a me que transmitir a doena aos descendentes.


15 Herana citoplasmtica, pois s as fmeas transmitem aos filhos.

Captulo 17 - Biotecnologia

1 A possibilidade de se resolver problemas no solucionados pelo


melhoramento convencional, a possibilidade de se propagar rapidamente
plantas, a obteno de plantas puras ou sem patgenos de maneira simples e
sem passar por muitas fecundaes e sem utilizar herbicidas, a possibilidade
de utilizar genes de interesse de qualquer espcie para introduzir em uma
planta, entre outros.
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

32/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M

2 A totipotncia das clulas. Qual o meio de cultivo apropriado para a


multiplicao de cada espcie. A cultura de tecidos funciona como clonagem
quando a partir de um grupo de clulas so obtidas vrios clones daquela
planta e como parte de variabilidade quando se aproveita a variao gerada
pela rpida multiplicao de clulas, sem que estas se regenerem em plantas.

3 Principalmente alteraes cromossmicas, resultantes das muitas divises


celulares

4 A fuso de protoplastos e a transformao gentica.

5 B) A enzima EcoRI, pois produz fragmentos com pontas coesivas que


podem se ligar a outras com as mesmas pontas complementares.
c) EcoRI : 6 nucleotdeos = (1/4)^4 = 1/4096
1/4096 x 10^8 = 24414 fragmentos.

Hae III 4 nucleotdeos : (1/4)^4 = 1/256


1/256 x 10^8 = 390625 fragmentos.

6 A engenharia gentica, pois permite direcionar com maior especificidade


qual gene ser inserido no DNA vegetal. Na variao semaclonal, as mutaes
que surgem so desconhecidas e muitas vezes deletrias. Na fuso dos
protoplastos, as variaes so conhecidas mas no se tem 100% de certeza
se o hbrido somtico ir possuir todas elas.

Visualizar como multi-pginas

Citar Este Trabalho


APA

MLA

MLA 7

CHICAGO

(2013, 09). Resoluo de todos os exerccios propostos no livro ''Gentica na


Agropecuria". TrabalhosFeitos.com. Retirado 09, 2013, de
http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-OsExerc%C3%ADcios-Propostos/35254927.html

Comentar...
Publicar tambm no Facebook
Publicando como Rodrigo Martins
(No voc?)

Comentar

Fernanda Bigonha Psicloga na empresa Prefeitura Municipal de


Ub
nao consigo mais visualizar o trabalho
Responder Curtir Seguir publicao 28 de abril s 19:51
Plug-in social do Facebook

Compartilhe Sua Experincia

Envie Seus Trabalhos

Nossos Produtos

Sobre Ns

Siga-nos

Trabalhos e Monografias

Sobre Trabalhos Feitos

Facebook

Gerador de Citao

Ajuda

Twitter

http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

33/34

14/5/2014

Resoluo de todos os exerccios propostos no livro ''Gentica na Agropecuria" - Trabalhos de Faculdade - Thiago_M
App Android

Google+

Contate-nos

RSS

2014 TrabalhosFeitos.com

Legal (Atualizao 25/4/14)

Mapa do Site

Divulgar

Site mvel

http://www.trabalhosfeitos.com/ensaios/Resolu%C3%A7%C3%A3o-De-Todos-Os-Exerc%C3%ADcios-Propostos/35254927.html

34/34