Escolar Documentos
Profissional Documentos
Cultura Documentos
ABSTRACT
Although unglycosylated HuEpo is fully functional, it has very short serum half-life. However, the mechanism of in vivo
clearance of human Epo (HuEpo) remains largely unknown. In this study, the relative importance of protease-sensitive sites
of recombinant HuEpo (rHuEpo) has been investigated by analysis of structural data coupled with in vivo half-life measurements. Our results identify a3-a4 inter-helical loop region as a target site of lysosomal protease Cathepsin L. Consistent
with previously-reported lysosomal degradation of HuEpo, these results for the first time identify cleavage sites of rHuEpo
by specific lysosomal proteases. Furthermore, in agreement with the lowered exposure of the peptide backbone around the
cleavage site, remarkably substitutions of residues with bulkier amino acids result in significantly improved in vivo stability.
Together, these results have implications for the mechanism of in vivo clearance of the protein in humans.
Proteins 2015; 83:18131822.
C 2015 Wiley Periodicals, Inc.
V
Key words: cathepsin L; circulating half-life; inter-helical loop region; in vivo clearance; proteolysis; recombinant HuEpo.
INTRODUCTION
Human erythropoietin (HuEpo), a glycoprotein hormone produced primarily in the adult kidneys, is the key
regulator of red blood cell production and differentiation.1,2 The cognate receptor (EpoR) along with the
ligand Epo regulates erythropoiesis3,4 by triggering
intra-cellular signaling events including receptor phosphorylation, and activation of JAK-STAT, RAS, and PI3
kinase pathways.5,6 Together, these signaling events control gene expression to trigger cells to undergo proliferation and differentiation. Thus, recombinant HuEpo
(rHuEpo) is used worldwide for treatment of anemia
resulting from chronic kidney diseases, chemotherapy
and AIDS7,8 (for a review see Ref. 9).
The human epo gene encodes a 165 amino acid mature
protein comprising four long a-helices connected by two
long cross-over loops and one short loop.10 The primary
sequence contains three N-linked (N24, N38, and N83)
and one O-linked glycosylation site (S126), all of which are
normally glycosylated in vivo.11,12 Although glycosylation
of HuEpo has been shown to play an important role in the
stability, solubility, and in vivo biological activity of the
PROTEINS
1813
Table I
Oligonucleotide Primers Used in this Study
Primersa
Description
FPrHuEpo
RPrHuEpo
FPepoR55Q
RPepoR55Q
FPepoR133Q
RPepo133Q
D10A
D10E
FPM1b
RPM1
FPM2c
RPM2
TTGTTGCATATGAAAGCCCCACCACGC
TTGTTGGAATTCTCTGTCCCCTGT
GCCTGGAAGCAGATGGAGGTC
GACCTCCATCTGCTTCCAGGC
GCTCCACTCCAGACAATCACT
AGTGATTGTCTGGAGTGGAGC
TTGTTGCATATGAAAGCCCCACGCCTCATCTGTGCAAGCCGAGTC
TTGTTGCATATGAAAGCCCCACGCCTCATCTGTGAAAGCCGAGTC
CCTCCAGATGTTCTTACTCTTGTTCCACTCCGA
TCGGAGTGGAACAAGAGTAAGAACATCTGGAGG
CCTCCAGATCTTGTTACTGTTCTTCCACTCCGA
TCGGAGTGGAAGAACAGTAACAAGATCTGGAGG
Reference
This
This
This
This
This
This
This
This
This
This
This
This
work
work
work
work
work
work
work
work
work
work
work
work
glycosylated, WT rHuEpo with Darbepoietin and concluded that the latter was degraded less owing to lower
level of internalization due to its overall lower-affinity with
the Epo-R.21 Furthermore, whatever amount of Darbepoietin was internalized got degraded lesser compared to
the WT molecule due to higher number of carbohydrate
moieties protecting the protein part of the molecule. Keeping this in view, we hypothesized that identifying proteasesensitive sites of rHuEpo might be of insight into mechanisms of degradation of the protein.
rHuEpo, expressed from mammalian cells has a halflife of 413 hours following intravenous administration,
necessitating frequent administration for optimum therapeutic benefit.22 Thus, it was of interest to understand
the mechanisms of in vivo clearance of HuEpo. Although
how and where Epo gets degraded remains a matter of
much debate,23 it is generally believed that in vivo degradation of HuEpo might involve more than one mechanism.20 We hypothesized that a major mechanism for
degradation of Epo may require that the protein has
structural weak points, which most likely provide initial
nucleation sites for cleavage leading to complete degradation. We reasoned that the proteolytic analyses with trypsin might provide important insights into the structural
determinants that intrinsically control degradation of
rHuEpo. To this end, independent of glycosylation
rHuEpo was expressed and purified from E. coli. As a
primary proof-of-concept, we used trypsin to carry out
limited proteolysis of the refolded rHuEpo. We extended
this line of thought to ascertain whether specific
region(s) of rHuEpo is susceptible to proteolytic cleavage. We had already seen this to be true in case of trypsin. Next, we sought to investigate major cleavage sites of
rHuEpo by lysosomal proteases. The results reported
here identify a3a4 inter-helical loop region as a major
structural weak point of the molecule. Using structureguided rational mutagenesis coupled with in vitro cell
1814
PROTEINS
The WT and mutant rHuEpo proteins were overexpressed in E. coli BL21(DE3)star cells (Invitrogen) as
insoluble proteins. Cells carrying pET-epo plasmid was
grown to an A600 of 0.6 and protein expression was
1815
label using a P6 quick-spin purification column (BioRad). A 5 mL aliquot was TCA precipitated to assess the
radioactive counts for the pellet and supernatant fractions, and was used to calculate the efficiency of incorporation
of the label by
the equation:
%
incorporation 5 [(P S)/(P 1 S)] * 100Where P stands
for counts-per-minute in the pellet and S stands for
counts-per-minute in the supernatant. 125I labeled WT
and mutant rHuEpo proteins with >95% radioactive
incorporation were administered at a dose of 0.48 mg/kg
polypeptide equivalent and a volume of 2 mL/kg via the
tail vein. Solutions of 125I-rHuEpo (0.24 mg/mL) were
prepared in PBS containing 0.05% (w/v) Tween 20 and
0.05% (w/v) mouse serum albumin. Blood samples were
withdrawn via the retro-orbital sinus using a heparinized
capillary into heparin coated tubes at indicated time
points. The blood was centrifuged at 15,000 rpm for 3
min to isolate the plasma; 50 mL of plasma, along with
300 mg of BSA, was precipitated using 200 mL of 25%
TCA. The mixture was incubated on ice for 10 min and
then centrifuged at 13,000 rpm for 10 min. The resulting
pellet was washed with 200 mL of ice-cold acetone and
centrifuged again at 13,000 rpm for 5 min; acetone was
aspirated out from the tube and the pellet was dried.
Counts per minute (cpm) were noted from the pellets
and the amount of protein back-calculated from it. The
remaining labeled protein at varying time points when
plotted represent decline in labeled rHuEpo concentration according to its plasma half-life.
Figure 1
Structural modeling
To facilitate purification, full-length rHuEpo was overexpressed as C-terminal His6-tagged fusion protein using
pET23a (Novagen) expression plasmid. IPTG induction
resulted in high level expression of a major protein of
18.5 kDa, which was absent in IPTG-treated cells containing the vector plasmid lacking an insert [compare
lane 2 and lane 1; Fig. 1(A)]. However, major portion of
1816
PROTEINS
Figure 2
Proteolysis of rHuEpo by trypsin. (A) shows all of the probable trypsin cleavage sites within the primary sequence of rHuEpo. (B) Trypsin cleavage
sites were identified by N-terminal sequencing of peptides from lane 2 (see Results for a description of proteolytic fragments) as described under
Materials and methods; lane 1 represents undigested rHuEpo; sizes of marker proteins in kDa are indicated to the left. (C) Structural model of
rHuEpo showing trypsin cleavage sites between peptide bonds Arg55-Met56 of the a1-a2 inter-helical loop, and Arg133-Thr134 of the a3-a4
inter-helical loop, respectively. Note that in this study the position of each amino acid is assigned according to the rHuEpo primary sequence
shown in Figure 2A. (D) Far UV-CD spectra of 10 mM of WT and mutant rHuEPo proteins in 50 mM Na-phosphate buffer pH 7.20 and 300 mM
NaCl. The detail of data acquisition was as described in the Materials and methods. Inset shows SDS-PAGE analysis of 2 lg/lane of indicated
rHuEpo proteins (lanes 24), expressed and purified as described in the Materials and methods; sizes of marker proteins (lane 1) in kDa are shown
to the left. (E) 4 mg of WT and indicated mutant rHuEpo proteins were digested with 400 ng of trypsin for 15, 30 and 45 min, respectively. The
undigested proteins, as well as the digested samples as indicated on the figure, were resolved by SDS-PAGE and visualized by Coomassie blue staining. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
1817
1818
PROTEINS
Figure 3
Probing cleavage sites of rHuEpo by lysosomal proteases, Cathepsin D
and Cathepsin L, respectively. Proteolysis of rHuEpo was carried out
with Cathepsin D and Cathepsin L (Figs A and C, respectively); samples
were resolved by SDS-PAGE and visualized by Coomassie blue staining.
Protease cleavage sites were identified by N-terminal sequencing of the
indicated peptides from lane 3 (see Results for a description of fragments) as described under Materials and methods. Lane 2 shows undigested rHuEpo; sizes of marker proteins (lane 1) in kDa are indicated
to the left. Panels B and D show structural models of rHuEpo indicating the cleavage sites (in yellow) by Cathepsin D and Cathepsin L,
respectively.
Figure 4
Structural organization of rHuEPo (PDB ID: 1EER). (A) shows HuEpo structure with the a3-a4 inter-helical loop region (comprising residues
126
AASAA130 shown in sticks) within a box. (B) and (C) display expanded view of amino acid residues 126VLTLV130 and 126LVTVL130 (shown in
sticks) of the loop region as described for mutants M2 and M3, respectively (see Results for a description of the mutants). (D) shows accessible
surface area (A2) of N- and Ca- backbone atoms of indicated residues for WT and mutant proteins (M2 and M3) as measured by structural analyses (see Materials and methods for details). Note that Ser to Thr substitution at the 128th residue do not significantly influence accessibility of the
backbone atoms to the solvent. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
1819
contribute to in vivo stability of the molecule. The objective was to introduce uncharged bulkier side-chains
replacing Ala residues with the anticipation that they may
protect particularly labile peptide bonds from proteases.
Thus, mutant M2 and M3 comprising amino acid
sequence of 126VLTLV130 and 126LVTVL130, respectively
were constructed based on structural analyses of mutant
proteins. For both mutant proteins, the structural models
were generated using WT HuEpo structural coordinates
(PDB ID: 1EER; 25) (Fig. 4). The accessible surface area
(A2) of backbone atoms of indicated amino acids (spanning residues Ala126 to Ala130) strongly indicate a striking reduction in protease accessibility of the peptide
backbone as a result of mutations (for mutants M2 and
M3) [Fig. 4(D)].Note that the accessible surface area of
the backbone atoms did not display a significant change
when Ser was replaced with Thr residues. Since there are
two consecutive Ala residues (Ala129 and Ala130) next to
Ser128, which we thought could easily serve as the substitute cleavage site if we just mutated Ala126 and Ala127
(as they are equally solvent accessible in unglycosylated
rHuEpo), we also mutated these two Ala residues with
Leu and Val, or vice versa. These two mutants which we
referred to as M2 and M3 were over-expressed and purified to homogeneity to examine if jumbling the sequence
of same amino acids will have any particular advantage
(or otherwise).
Importantly, during in vitro cell proliferation assays,
over a range of protein concentrations examined,
mutants M2 and M3 were found to be comparably active
relative to WT rHuEPo [Fig. 5(A)]. Thus, we conclude
that residues spanning Ala126 to Ala130 of the a3-a4
inter-helical loop region do not appear to contribute to
structural stability and/or bioactivity of rHuEpo. Next,
we examined in vivo stability of mutant rHuEpo proteins
by injecting I125-labeled proteins into mice as described
in the Materials and methods. Quantification of the
experimental data suggests that under the conditions
examined labeled WT rHuEpo is degraded with a halflife of 2.11 6 0.3 hours [Fig. 5(B)]. Under identical conditions examined, mutant M1 (D10A) showed a comparable half-life of 2.03 6 0.2 hours. In contrast, mutant
M2 showed a strikingly longer half-life of 3.11 6 0.3
hours, reflecting 41 6 3% rise in circulating half-life of
the mutant protein (see inset to Fig. 5(B,C)]. Also,
mutant M3 (with similar substitutions within a3-a4
inter-helical loop but an altered sequence of amino
acids) showed 15 6 2% higher half-life compared to the
WT protein. As a control, under identical experimental
condition a double mutant (M4; R55QR133Q) carrying
substitutions at Arg55 of a1a2 inter-helical loop and
Arg133 of a3a4 inter-helical loop region, respectively
showed an insignificant variation (5% higher) of circulating half-life compared to WT rHuEpo. Together, these
results suggest that a3a4 inter-helical loop spanning
residues 126AASAA130 constitute a primary Cathepsin
1820
PROTEINS
Figure 5
Circulating half-lives of WT and mutant rHuEpo proteins in a mouse
model. (A) Bioactivity of varying concentrations of WT and mutant
rHuEpo proteins as compared by F-36E cell proliferation assay and
quantitated by 3[H]-thymidine incorporation as described in the Materials and methods. Average counts due to effective 3[H]-thymidine
incorporation are derived from triplicate wells and presented with SEM.
The data are representative of three independent experiments. (B)
Kinetics of decline of I125-labeled WT rHuEpo concentration in mouse
blood plasma. Values shown here represent average counts of I125labeled rHuEpo (WT) from three independent experiments. In all cases,
the radioactive labeling efficiency of rHuEPo proteins were 95% or
above. Inset shows half-lives of WT and mutant rHuEpo proteins as
measured by time-course of decline in I125-labeled rHuEpo concentration from mouse blood plasma (see Materials and methods for details).
Panel (C) shows percent enhancement of circulating half-lives of
mutant rHuEpo proteins relative to the WT rHuEpo.
L-cleavage site of rHuEpo and substitutions herein significantly influences circulating half-life of the protein in
mice.
PROTEINS
1821
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
1822
PROTEINS
22. Flaharty KK, Caro J, Erslev A, Whalen JJ, Morris EM, Bjornsson
TD, Vlasses PH. Pharmacokinetics and erythropoietic response to
human recombinant erythropoietin in healthy men. Clin Pharmacol
Ther 1990;47:557564.
23. Jelkmann W. The enigma of the metabolic fate of circulating erythropoietin (Epo) in view of the pharmacokinetics of the recombinant
drugs rhEpo and NESP. Eur J Haematol 2002;69:265274.
24. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory
manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989.
25. Syed RS, Reid SW, Li C, Cheetham JC, Aoki KH, Liu B, Zhan H,
Osslund TD, Chirino AJ, Zhang J, Finer-Moore J, Elliot S, Sitney K,
Katz BA, Matthews DJ, Wendoloski JJ, Egrie J, Stroud RM. Efficiency of signalling through cytokine receptors depends critically on
receptor orientation. Nature 1998;395:511516.
26. Laskowski RA, Moss DS, Thornton JM. Main-chain bond lengths
and bond angles in protein structures. J Mol Biol 1993; 231:1049
1067.
27. The PyMOL Molecular Graphics System, Version 1.2r3pre Ed.,
Schr
odinger, L.L.C.
28. Winn MD, Ballard CC, Cowtan KD, Dodson EJ, Emsley P, Evans
PR, Keegan RM, Krissinel EB, Leslie AG, McCoy A, McNicholas SJ,
Murshudov GN, Pannu NS, Potterton EA, Powell HR, Read RJ,
Vagin A, Wilson KS. Overview of the CCP4 suite and current developments. Acta Crystallogr D Biol Crystallogr 2011; 67:235242.
29. Roth W, Deussing J, Botchkarev VA, Pauly-Evers M, Saftig P, Hafner
A, Schmidt P, Schmahl W, Scherer J, Anton-Lamprecht I, Von
Figura K, Paus R, Peters C. Cathepsin L deficiency as molecular
defect of furless: hyperproliferation of keratinocytes and pertubation
of hair follicle cycling. Faseb J 2000;14:20752086.
30. Barrett AJ. Cellular proteolysis: an overview. Ann NY Acad Sci 1992;
674:115.
31. Boissel J-P, Lee W-R, Presnell SR Cohen FE, Bunn HF. Erythropoietin structure-function relationships. Mutant proteins that test a
model of tertiary structure. J Biol Chem 1993;268:1598315993.
32. Chmielewski C. Aranesp (darbepoetin alfa): a new erythropoiesisstimulating protein. Nephrol Nurs J 2002;29:6768.
33. Sytkowski AJ, Lunn ED, Davis KL, Feldman L, Siekman S. Human
erythropoietin dimers with markedly enhanced in vivo activity. Proc
Natl Acad Sci USA 1998;95:11841188.
34. Sytkowski AJ, Lunn ED, Risinger MA, Davis KL. An erythropoietin
fusion protein comprised of identical repeating domains exhibits
enhanced biological properties. J Biol Chem 1999;274:2477324778.
35. Schulz G, Schrimer R. In Principles of protein structure. New York:
Springer; 1979.
36. Janin J, Clothia C. Domains in proteins: definitions, location, and
structural principles. Methods Enzymol 1985;115:420430.