Você está na página 1de 11

Microbial Pathogenesis 89 (2015) 43e53

Contents lists available at ScienceDirect

Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath

Non-classical effects of prolactin on the innate immune response of


bovine mammary epithelial cells: Implications during Staphylococcus
aureus internalization
 pez-Meza, Alejandra Ochoa-Zarzosa*
Ivan Medina-Estrada, Nayeli Alva-Murillo, Joel E. Lo
s de Hidalgo,
Centro Multidisciplinario de Estudios en Biotecnologa, Facultad de Medicina Veterinaria y Zootecnia, Universidad Michoacana de San Nicola
n, Mexico
Km 9.5 Carretera Morelia-Zinap
ecuaro, Posta Veterinaria, C.P. 58893, Morelia, Michoaca

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 11 June 2015
Received in revised form
24 July 2015
Accepted 24 August 2015
Available online 2 September 2015

Staphylococcus aureus has the ability to invade mammary epithelial cells (bMECs) causing mastitis. This
event depends primarily on the a5b1 integrin in the host cell. In addition, bMECs are a target for the
hormone prolactin (PRL), which can regulate b1 integrin-dependent actions related to differentiation and
lactation. Previously, we demonstrated that bovine PRL (bPRL, 5 ng/ml) stimulates S. aureus internalization into bMECs. TLR2 is important during S. aureus infections, but its activation by PRL has not yet
been established. The objective of this study was to determine the role of a5b1 integrin and TLR2 during
S. aureus internalization into bMECs stimulated with bPRL. We demonstrated that the prolactinstimulated internalization of S. aureus decreases in response to the blockage of a5b1 integrin (~80%)
and TLR2 (~80%). bPRL increases the membrane abundance (MA) of a5b1 integrin (~20%) and induces
TLR2 MA (~2-fold). S. aureus reduces the a5b1 integrin MA in bMECs treated with bPRL (~75%) but induces TLR2 MA in bMECs (~3-fold). Bacteria and bPRL did not modify TLR2 MA compared with the
hormone alone. S. aureus induces the activation of the transcription factor AP-1, which was inhibited in
bMECs treated with bPRL and infected. In general, bPRL induces both pro- and anti-inammatory responses in bMECs, which are abated in response to bacterial challenge. Interestingly, the canonical Stat-5
transcription factor was not activated in the challenged bMECs and/or treated with bPRL. Taken together,
these results support novel functions of prolactin as a modulator of the innate immune response that do
not involve the classical prolactin pathway.
2015 Elsevier Ltd. All rights reserved.

Keywords:
Prolactin
Staphylococcus aureus
TLR2
Integrins
Mammary epithelium
Mastitis

1. Introduction
Prolactin (PRL) is a hormone involved in reproduction and
lactation that essentially stimulates the differentiation and metabolic functions of mammary epithelial cells (MECs) [1]. In bovines,
PRL maintains the concentrations of the mRNAs encoding milk
proteins and regulates milk production [2]. The bovine mammary
gland undergoes mastitis, which is characterized by an inammatory response of the udder. The main gram-positive bacterium
causing subclinical mastitis is Staphylococcus aureus, which can
persist intracellularly in this tissue [3]. The host cell invasion in
non-professional phagocytic cells (i.e., MECs) by S. aureus depends
on the presence of bronectin-binding proteins (FnBPs) on the
bacterial surface, as well as the interaction of bronectin and the
host-cell a5b1 integrin through a zipper-type mechanism, where
* Corresponding author.
E-mail addresses: ochoaz@umich.mx, aleocho@hotmail.com (A. Ochoa-Zarzosa).
http://dx.doi.org/10.1016/j.micpath.2015.08.018
0882-4010/ 2015 Elsevier Ltd. All rights reserved.

integrin is taken up together with its ligands. This mechanism of


endocytosis is employed during the internalization process of S.
aureus by different epithelial cells [4,5] and has also been described
in a mouse model of mastitis [6].
Integrins are host-cell surface receptors that facilitate the
interaction of the host cytoskeleton with proteins of the extracellular matrix (ECM) to regulate host cell differentiation, proliferation, migration, and/or adhesion [7]. These proteins consist of cell
membrane-associated glycoproteins composed of one a subunit
and one b subunit that form a heterodimeric complex [8]. The b1
integrin facilitates the endocytosis of several bacterial species by
different types of epithelial cells [7,9]. This integrin family is very
important in MECs because these proteins have been implicated in
the proliferation and differentiation of MECs. Primary MECs that
lack the b1 integrin have several defects, are unable to differentiate
into milk-producing cells, and form acinar-like structures with clear
lumens [10]. In addition, mice lacking the b1 integrin show insufcient alveolar development during pregnancy and decreased

44

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

lactation [11]. Because MECs respond to hormonal stimuli to proliferate and differentiate during pregnancy and lactation, there is a
very important crosstalk between the lactogenic trigger, such as
prolactin, and the events controlled by b1 integrin [12]. The classical PRL signaling pathway in the lactating mammary gland involves the dimerization of the PRL receptor (PRLR) and the
activation of the associated tyrosine kinase Janus kinase 2 (JAK2),
which eventually activates members of the protein family of signal
transducer and activation of transcription (Stats) that regulate the
transcriptional response to PRL related to the expression of
differentiation-related genes and genes encoding milk proteins.
This canonical PRL signaling is dependent on b1 integrins [12].
In a previous study, we showed that bovine PRL (bPRL) stimulates S. aureus internalization into bovine mammary epithelial cells
(bMECs). In addition, bMECs treated with bPRL and infected with S.
aureus show a decreased innate immune response because the
bacteria inhibit the activation of nuclear factor kappa B (NF-kB)
stimulated by bPRL (alone). These data described novel nonclassical actions of PRL [13]. However, the relationship between
bPRL and a5b1 integrin during S. aureus internalization into bMECs
has not been explored. In addition, diverse reports indicate that the
drying off and calving periods exhibit the highest incidence of
udder infection due to the establishment of mastitis; these periods
are characterized by the presence of high levels of PRL, and our data
and those of others suggest that hormonal changes may decrease
the innate immune response of calves [14,15]. Because PRL also
regulates transcription factors related to the innate immune
response, such as NF-kB, it is interesting to analyze the key elements of this signaling pathway in bMECs infected with S. aureus,
i.e., Toll-like receptor 2 (TLR2). TLR2 belongs to the family of host
receptors that recognize pathogen-associated molecular patterns
(PAMPs). In particular, TLR2 is activated by the lipid anchor of lipoteichoic acid, lipopeptides and lipoproteins which are components of the cell membrane of gram-positive bacteria [16]. In
addition, it has been shown that S. aureus strains activate TLR2 and
its gene expression in bMECs [17]. Even though PRL may regulate
many immune functions, neither a clear relationship with TLR2 nor
a crosstalk between the PRLR and TLR2 pathways have been
established. In contrast, the interaction of b1 integrin and TLR2
receptors has been demonstrated during infections [18]. In this
sense, gram-positive bacteria can be internalized more efciently
into monocytes and macrophages because these bacteria activate
integrin through the action of TLR2 [19]. In addition, the treatment
with cytokines members of the tumor necrosis factor (TNF) family
induces an upregulation and redistribution of b1 integrin in
epithelial cells [20], and the blocking of a5b1 integrin decreases
TNF-a production in response to heat-killed S. aureus [21].
Due to the relationship between integrins and TLRs during
infection and the important crosstalk between the PRL and a5b1
integrin pathways during the proliferation and differentiation of
MECs, we investigated whether bPRL stimulates the expression of
integrin a5b1 in bMECs and whether this induction is related to the
stimulation of the internalization of S. aureus by the hormone. In
addition, because PRL may compromise the innate immune
response of bMECs, we also explored whether this effect in combination with the stimulation of bacterial endocytosis can be achieved through the regulation of the expression and activation of
TLR2 as well as other signal pathways related to the innate immune
response of bMECs.
2. Materials and methods
2.1. Reagents
Native puried bovine prolactin (bPRL) (lot AFP7170E) was

provided by A. F. Parlow (NHPP, NIDDK, Torrance, CA, USA), dissolved in water, and sterilized by ltration.
2.2. Antibodies
The blocking antibody anti-a5b1 integrin (MAB2514) was purchased from Millipore. The blocking anti-TLR2 (TL2.1) and antiPRLR (U5) antibodies were obtained from Abcam. TRITC and FITCconjugated secondary antibodies against mouse and rat IgGs
were purchased from Invitrogen and Thermo Scientic,
respectively.
2.3. Staphylococcus aureus strain
To perform the invasion assays, the American Type Culture
Collection (ATCC) S. aureus subsp. aureus 27,543 strain was used.
This strain was isolated from a case of clinical mastitis and has the
capacity to invade bovine mammary epithelial cells [20]. The bacteria were grown at 37  C overnight in LuriaeBertani broth (LB,
Bioxon), and the CFUs were adjusted by measuring the optical
density at 600 nm (O. D. 0.2 9.2  107 CFU/ml).
2.4. Culture of primary bovine mammary epithelial cells
bMECs were isolated from the alveolar tissue of the udders of
healthy lactating cows as described [22]. Cells from passages 2 to 8
were used in all of the experiments. Cells were cultured in growth
medium (GM) composed by DMEM medium/nutrient mixture F12
Ham (DMEM/F12K, Sigma) supplemented with 10% fetal calf serum
(Gibco), 10 mg/ml insulin (Sigma), 5 mg/ml hydrocortisone (Sigma),
100 U/ml penicillin and streptomycin (100 mg/ml) and 1 mg/ml
amphotericin B (Invitrogen). Cells were grown in 5% CO2 atmosphere at 37  C.
2.5. Invasion assays
For the invasion assays, we used bMEC polarized monolayers
(~2  105 cells cultured in 24 well dishes) which were incubated
with bPRL (5 ng/ml) in DMEM/F12K (Sigma) without antibiotics
and serum for 24 h and then were infected with S. aureus (MOI 30:1
bacteria per cell). For this, bMECs were inoculated with 65 ml of
bacterial suspensions to 9.2  107 CFU/ml and incubated for 2 h in
5% CO2 at 37  C. Then, bMECs were washed three times with PBS
(pH 7.4) and incubated in GM without serum and penicillin and
streptomycin, but supplemented with 50 mg/ml gentamicin for 1 h
at 37  C to eliminate extracellular bacteria. Finally, bMEC monolayers were detached with trypsin (0.05%)-EDTA (0.02%) (Sigma)
and lysed with 250 ml of sterile distilled water. bMEC lysates were
diluted 100-fold, plated on LB agar in triplicates and incubated
overnight at 37  C. The number of CFU was determined by the
standard colony counting technique. Simultaneously, the number
of bMECs cultured in each well was calculated for each invasion
assay using a haemocytometer. The data are presented as the ratio
of CFU recovered per bMEC. For the RNA and nuclear protein
extraction, bMECs were processed according to the protocols
described below. For the ELISA determinations, the media of the
infection assays were collected (see below).
For the invasion assays in the presence of the blocking antibodies, one hour prior to the addition of the bacteria to the bMECs,
the blocking antibodies anti-a5b1 integrin (concentrations and
incubation times employed according to Kapetanovic et al. [21]) or
anti-TLR2 (according to the manufacturer's instructions) were
added separately to triplicate wells. Rat IgGs (puried from normal
rat serum with protein A-sepharose beads (Sigma)) or mouse IgGs
(puried from normal mouse serum purchased from Pierce) were

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

used as the negative controls. The invasion assays were performed


using gentamicin protection assays as described above [15].
2.6. DNA-protein interactions
The nuclear protein extracts from bMECs were obtained using
the Proteojet kit (Fermentas) according to the manufacturer's instructions, and the proteins were quantied by the Bradford
method. The screening of transcription factors was performed using a TranSignal Protein/DNA array I (Panomics, Fremont, CA, USA)
according to the manufacturer's instructions. A mix of biotinlabeled DNA-binding oligonucleotides (provided with the kit) was
pre-incubated with the nuclear extracts to allow the formation of
protein/DNA complexes. The bound protein/DNA complexes were
extracted from the free probes and hybridized to the protein/DNA
array. The complexes were detected using an HRP-based chemiluminescence method according to the manufacturer's kit.
2.7. RNA isolation and RT-qPCR analysis
RNA extraction from bMECs was carried out using Trizol reagent
(Invitrogen) according to manufacturer's instructions. Genomic
DNA contamination was removed from RNA samples with DNase I
treatment (Invitrogen). RNA was reverse transcribed to cDNA from
bMECs challenged with S. aureus and/or treated with bPRL in a 20 ml
reaction containing 25 mg/ml Oligo d(T) (Invitrogen) and 500 nM
dNTPs (Invitrogen). The reaction was incubated at 65  C for 5 min,
and immediately transferred to ice. Then, 1X First Strand Buffer
(Invitrogen), 10 mM dithiothreitol (Sigma) and 2 U/ml RNAse inhibitor (RNAseOUT, Invitrogen) were added to the reaction mixture
and incubated at 37  C for 2 min. Finally, 10 U/ml M-MLV reverse
transcriptase (Invitrogen) was added and the mixture was incubated again at 37  C for 50 min, followed by 70  C for 15 min.
The RT-qPCR assay was performed using the comparative Ct
method (DDCt) with a StepOne Plus Real-Time PCR System (Applied
Biosystems) according to the manufacturer's instructions. The reactions were conducted with a SYBR Green PCR Master Mix
(Applied Biosystems). Specic primers were used to amplify genes
encoding receptors, defensins, chemokines, and pro- and antiinammatory cytokines. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control [23]. The primers
(Invitrogen) and PCR conditions used to amplify the TNF-a, IL-1b,
IL-6, IL-8, IL-10, tracheal antimicrobial peptide (TAP), defensin b1
(DEFB1) and TLR2 transcripts were previously described [23,24].
The primer sequences and PCR conditions used to amplify bovine
integrin mRNAs are described in Table 1.

45

2500 rpm and 4  C for 10 min and was washed twice with PBS. The
bMECs were blocked with normal goat serum (5% in PBS, Pierce) for
30 min at 4  C with shaking, cells were then centrifuged and the cell
pellet was incubated with the primary antibodies. To analyze the
TLR2 MA, the cells were incubated with the corresponding antibody at a dilution of 1:150 (PBS containing 0.1% BSA) for 1 h at 4  C
with shaking. For the determination of integrin MA in control cells,
invasion assays were performed using different times of infection:
15, 30, 60 and 120 min, whereas bPRL-treated cells were infected
only 120 min. The invasion assay was completed as described
above. The cells were incubated with the anti-a5b1 integrin at a
concentration of 10 mg/ml for 2 h at 4  C with shaking. To analyze
the expression of PRLR, an antibody concentration of 2 mg/ml was
employed for 4 h at 4  C with shaking. The cells were then washed
three times with PBS and incubated with the TRITC (diluted 1:100)
secondary antibody to analyze the expression levels of TLR2 and
PRLR. For the analysis of integrin expression, a FITC-conjugated
secondary antibody was used (diluted 1:50). In all cases, the
bMECs were incubated with the secondary antibodies for 1 h at 4  C
with shaking in the dark. The bMEC pellet was recovered by
centrifugation, washed, xed with paraformaldehyde (4%) for
10 min at 4  C, and washed three times with PBS. The bMECs were
then suspended in 100 ml of cold PBS. The samples were analyzed
by ow cytometry, and the uorescent signals of 10,000 cells were
measured using an Accuri C6 cytometer (BD Bioscience) and
analyzed using the FlowJo software.
2.9. Enzyme-linked immunosorbent assay (ELISA)
For the measurement of the TNF-a and IL-1b concentrations in
the medium, the conditioned media from bMECs treated with bPRL
and/or S. aureus were collected. The concentrations of TNF-a were
measured using the Duoset ELISA development kit (R&D Systems)
to quantify the bovine TNF-a levels according to the manufacturer's
instructions, and the concentrations of IL-1b were assessed using
the bovine IL-1b screening kit (Thermo Scientic).
2.10. Data analysis
The data were obtained from three independent experiments,
each of which was performed in triplicate, and compared by
analysis of variance (ANOVA). The results are reported as the
means the standard errors (SE). P values of less than 0.05 were
considered signicant. The results from gene expression analyses
and receptor membrane abundance experiments are shown
normalized to the untreated cells (control).

2.8. Flow cytometry analysis

3. Results

bMECs were cultured to 80% conuence on 24-well plates


(Corning) in culture medium and were then treated with bPRL and/
or S. aureus as described above. After the treatment, the bMECs
were washed three times with cold PBS, detached with trypsin
(0.05%)-EDTA (0.02%) (Sigma), centrifuged and washed with culture medium. The cell pellet was obtained after centrifugation at

3.1. a5b1 integrin is required for the internalization of S. aureus


stimulated by bPRL
Because a5b1 integrin is one of the main ECM receptors of
epithelial cells employed during S. aureus internalization, we
wondered whether the specic functional blocking of a5b1 integrin

Table 1
Primers used in this study.
Specicity

Primer

Sequence (50 e30 )a

Fragment size (bp)

Annealing temperature ( C)

Bovine a5 integrin subunit

Forward
Reverse
Forward
Reverse

TGCAGTGTGAGGCCGTGTATGAAG CGGGAGGGAGCGTTTGAAGAAT

230

58

TGCGAGTGTGGTTGCCTGTAAGT ATTGAAGGCTCGGCACTGAACA

123

60

Bovine b1 integrin subunit


a

All oligonucleotides were designed in this study.

46

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

would reduce the number of S. aureus internalized into bMECs,


which is enhanced in the presence of bPRL. To test our hypothesis,
primary cultures of bMECs treated for 24 h with bPRL were incubated with different concentrations of a specic antibody against
a5b1 integrin (Fig. 1A). The bPRL treatment (5 ng/ml) increases the
number of CFUs internalized into bMECs (according to previous
reports from our group) [15], but the blockage of a5b1 integrin
signicantly reduces the number of S. aureus internalized. No effect
was observed in the presence of 10 mg/ml rat IgGs compared with
the control or bPRL-treated cells. The presence of 20 mg/ml antia5b1 resulted in a ~80% reduction (P < 0.05) in the bacterial
internalization by bMECs treated with bPRL compared to bMECs
treated with the hormone in the absence of antibody. The reduction
observed in control cells (untreated) was ~50% (P < 0.05). This
nding suggests that integrin a5b1 is required during the internalization of S. aureus into bMECs stimulated by bPRL. To determine
whether this effect is correlated with the a5b1 integrin MA in
bMECs, we performed a ow cytometry analysis. Typical population proles from the ow cytometry analysis are shown in Fig. 1B.
The mean uorescence intensity, which corresponds to the level of
uorescence associated with each cell, was used as an indicator of
the level of integrin expression per cell in the population. This
analysis is shown in Fig. 1C. Bovine PRL signicantly increases the
level of a5b1 integrin MA (~1.2-fold); however, after 2 h of challenge with S. aureus, the level of a5b1 integrin MA was reduced by
~75% in the bPRL-treated bMECs (P < 0.05) and by ~65% in the
control cells (P < 0.05), indicating that integrin is taken up together
with bacteria. These data are in agreement with the results of the
blockage of internalization in the presence of anti-a5b1 integrin
antibodies, highlighting that a5b1 integrin is necessary to accomplish bacterial endocytosis. In the experiments of a5b1 integrin
gene expression, S. aureus induces the expression of the a5 subunit
(~2.5-fold, P < 0.05) but decreases the expression of the b1 subunit
(P < 0.05). In contrast, bPRL does not modify the a5 mRNA levels
and signicantly reduces the b1 mRNA expression level (Fig. 1D).
However, the effect of both treatments was similar to the effect of S.
aureus. With the purpose to determine if the internalization of
bacteria results in the endocytosis of a5b1 integrin, we also evaluated the level of a5b1 integrin MA at different times of challenge
with S. aureus using the same MOI. Results from this evaluation are
shown in Fig. 1E. An evident infection time-dependent a5b1
integrin MA was observed. The presence of this receptor at the
membrane of bMECs is reduced as soon as 15 min of S. aureus
challenge.
3.2. bPRL induces TLR2 expression in bMECs, which is necessary for
S. aureus internalization
To explore whether TLR2 participates in S. aureus internalization
into bMECs, we investigated whether the blockade of this receptor
with a specic antibody would modify bacterial endocytosis. As
shown in Fig. 2A, the blockage of TLR2 results in a signicant
reduction in the number of S. aureus internalized, because the use
of 5 mg/ml anti-TLR2 resulted in a ~80% of reduction (P < 0.05) in
bacterial internalization in bMECs treated with bPRL and a ~70% of
reduction in internalization in the control cells (P < 0.05). There was
no effect in the presence of 5 mg/ml mouse IgGs in relation to the
control cells.
Bovine PRL can also modulate TLR2 expression in bMECs challenged with S. aureus. Fig. 2B shows typical membrane expression
patterns for TLR2 obtained through ow cytometry analysis. The
analysis of the mean uorescence intensity (Fig. 2C) shows that S.
aureus (~3-fold) and bPRL (~2-fold) signicantly increase the TLR2
MA, but there is no difference in the TLR2 MA in the presence of
bPRL and bacteria compared with that obtained with the hormone

alone. The TLR2 MA correlates with the expression level of its gene
(Fig. 2D), with the exception of the effect detected with both
treatments.
3.3. Activation of TLR2 signal pathways by bPRL and S. aureus
Because TLR2 is expressed in bMECs in response to treatment
with bPRL and S. aureus, we explored whether two canonical
transcriptional factors activated by TLR2 are upregulated in the
presence of bPRL and/or bacteria. The activation of the transcription
factors NF-kB and AP-1 was analyzed by 1) a transcription factor
array, 2) the expression of representative genes regulated by these
factors and 3) by ELISA measuring pro-inammatory cytokine
secretion. In a previous work, we showed that S. aureus does not
activate NF-kB in bMECs [13]. In agreement with our previous
nding, we did not detect the activation of NF-kB by S. aureus
(alone) using a transcription factor array (Fig. 3). In contrast, the
activation of the transcription factor AP-1 was induced by S. aureus
alone and by bPRL, but both treatments downregulated the activation induced by bacteria (Fig. 3).
Fig. 4 shows the RT-qPCR analysis of different genes related to
the innate immune response, such as antimicrobial peptides (bdefensins; DEFB1 and TAP), one chemokine (IL-8), proinammatory cytokines (TNF-a, IL-1b, and IL-6), and one antiinammatory cytokine (IL-10). As shown, the expression levels of
DEFB1 and TAP were unmodied in the presence of S. aureus and/or
bPRL (Fig. 4A and B). However, the analysis of the expression of proinammatory cytokines revealed that only TNF-a is signicantly
induced by S. aureus (~5-fold) and bPRL (~2-fold), but pretreatment with this hormone inhibited the bacterial induction
(Fig. 4C). Other pro-inammatory cytokines, such as IL-1b and IL-6,
were signicantly increased by bPRL (Fig. 4D and E), but their
expression was reduced in the presence of S. aureus and by the
combined treatments. We also analyzed the expression of the
chemokine IL-8, which was downregulated or unmodied by bPRL
and/or S. aureus (Fig. 4F). Interestingly, the expression of the antiinammatory cytokine IL-10 was signicantly induced by bPRL
(~5-fold) but was reduced in the presence of S. aureus (Fig. 4G). The
TNF-a and IL-1b secretion into the media was analyzed by ELISA
(Fig. 5). The secretion of both cytokines was signicantly induced
by S. aureus. bPRL increased only the secretion of IL-1b (P < 0.05);
however, the effect of both treatments on this cytokine was not
additive (Fig. 5B), whereas a signicant inhibitory effect on TNF-a
was obtained by both treatments (Fig. 5A).
3.4. PRLR signal transduction pathways in bMECs challenged with
S. aureus
It has been reported that PRL can stimulate different transcription factors in the mammary epithelium [25]; however, the relationship between these pathways and infection has been poorly
explored. Using the same transcription factor arrays shown in Fig. 3,
we demonstrated that bPRL also induces Stat-1, Stat-3 and Stat-4
activation, whereas prevents Stat-5 activation (Fig. 6A and B).
However, Stat proteins, including Stat-5, are not activated by S.
aureus (Fig. 6A and B). In addition, cells treated with bPRL and S.
aureus decreased the activation induced by the hormone alone. To
determine whether the downregulation of Stat-5 activation may be
a consequence of the amount of available PRLR, we used ow
cytometry analysis to show that bPRL signicantly reduces the
PRLR MA in bMECs compared with the control cells. S. aureus alone
also reduces PRLR MA (P < 0.05, Fig. 6C and D), but in the presence
of the hormone the effect was not signicant compared with the
reduction of the hormone alone (Fig. 6D).

Fig. 1. Participation of a5b1 integrin in the internalization of S. aureus by bMECs stimulated with bPRL. A) Primary cultures of bMECs treated for 24 h with bPRL were incubated with
different concentrations of a specic blocking antibody against a5b1 integrin for 1 h and then challenged with S. aureus (MOI 30:1 bacteria per cell). The number of internalized
bacteria is represented by the ratio of CFU/bMEC recovered after lysis of bMECs. 10 mg/ml of rat IgGs were used as the negative control. B) The abundance of a5b1 integrin in the
bMEC membrane was determined by ow cytometry analysis in cells treated for 24 h with bPRL and/or challenged with S. aureus. A total of 10,000 events were measured. Typical
population proles of non-challenged bMECs (black line) vs. challenged cells (red line) were showed. The secondary antibody control was included (blue line). C) Mean of the
uorescence of the non-challenged and challenged bMECs. Cells treated only with the secondary antibody (Ab sec) were used as the negative control. D) RT-qPCR analysis showing
the effect of bPRL and/or S. aureus challenge for 2 h on a5b1 integrin mRNA expression. Each bar shows the mean of triplicates SE of three independent experiments. The letter a
indicates signicant changes (P < 0.05) compared with the untreated control cells. The letter b indicates signicant changes (P < 0.05) compared with bMECs treated with bPRL. E)
The abundance of a5b1 integrin in the bMEC membrane determined as the mean of the uorescence of challenged bMECs at different times of infection with the same MOI (30:1
bacteria per cell). A total of 10,000 events were measured. Each bar shows the mean of triplicates SE of a representative experiment. Different symbols indicate (*, #, ) statistically signicant different means (ANOVA, P < 0.05). (For interpretation of the references to color in this gure legend, the reader is referred to the web version of this article.)

48

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

Fig. 2. Participation of TLR2 in the internalization of S. aureus stimulated by bPRL in bMECs. The cells were treated for 24 h with bPRL and/or then challenged for 2 h with S. aureus.
A) Primary cultures of bMECs were incubated with 5 mg/ml of a specic blocking antibody against TLR2 for 1 h and then challenged with S. aureus for 2 h (MOI 30:1 bacteria per cell).
The number of internalized bacteria is represented by the ratio of CFU/bMEC recovered after lysis of bMECs. 5 mg/ml of mouse IgGs were used as the negative control. The TLR2
membrane abundance was determined by ow cytometry analysis, and a total of 10,000 events were measured. B) Typical population proles of non-challenged (black line) vs.
challenged bMECs (red line). The secondary antibody control was included (blue line). C) Mean of the uorescence of non-challenged and challenged bMECs. Cells treated only with
the secondary antibody (Ab sec) were used as the negative control. D) RT-qPCR analysis showing the effect of bPRL and/or S. aureus challenge for 2 h on TLR2 mRNA expression. Each
bar shows the mean of triplicates SE of three independent experiments. The letter a indicates signicant changes (P < 0.05) compared with the untreated control cells. The letter
b indicates signicant changes (P < 0.05) compared with bMECs treated with bPRL. (For interpretation of the references to color in this gure legend, the reader is referred to the
web version of this article.)

4. Discussion
In lactating mammary epithelial cells, b1 integrin signaling is
required for prolactin differentiation effects. In addition, a5b1
integrin is a host receptor during S. aureus internalization in
different epithelial cells. We have previously performed bPRL
doseeresponse curves to determine the effect of this hormone on S.
aureus internalization by bMECs, and showed that only 5 ng/ml
bPRL stimulates bacterial endocytosis [15], in agreement with the
physiological levels of bPRL reported in cattle during lactation
[26,27]. However, it remains unclear whether a5b1 integrin is
involved in the stimulation of bacterial internalization by bPRL.
According to the results shown in Fig. 1, a5b1 integrin is necessary
for S. aureus internalization into bMECs. The participation of this
integrin during S. aureus internalization has been reported for
epithelial cells of different origins [5,9]; however, this study provides the rst demonstration of the role of this integrin during the

internalization of a clinical isolate from bovine mastitis by bMECs.


According to the availability of the a5b1 integrin in cell membranes,
bPRL may stimulate a5b1 integrin trafcking and thereby favor
bacterial endocytosis in bMECs. The regulation of a5b1 integrin
gene expression by bPRL and S. aureus does not correlate with the
availability of the protein in the membrane, probably due to the fact
that integrin receptors are regulated by recycling process [8]. In this
study, we found that S. aureus stimulates a5 integrin gene
expression. In agreement with this nding, it has been reported
that Streptococcus pyogenes, induce a5 integrin gene expression in
the human cell line HEp-2 [28]. In this sense, the a5 subunit only
binds to b1, whereas the b1 subunit is promiscuous and can bind to
different a subunits [8]. Thus, the expression of a5 integrin may
require a ner regulation than the b1 subunit. Both bPRL and S.
aureus decrease b1 integrin gene expression. Similar effects of
bacteria on the mammary epithelium have not been previously
reported. However, in a rabbit model of infective endocarditis, S.

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

49

Fig. 3. Analysis of transcription factors activated in bMECs during the internalization of S. aureus stimulated by bPRL. bMECs were treated for 24 h with bPRL and/or then challenged
for 2 h with S. aureus. The nuclear protein extracts were obtained, and the screening of transcription factors was performed using a TranSignal Protein/DNA array I (Panomics). A)
Autoradiography corresponding to membrane images. B) The relative signals from each spot on the membranes were quantied using the ImageJ software. The bars show the mean
intensity of duplicates subtracting the background intensity of the membrane. Control (C) consists in biotinylated DNA spotted on the membrane.

aureus was not found to modify a5b1 integrin gene expression, as


determined in tissue from cardiac valves [29], but comparable approaches have not been used to study the effect in the mammary
gland.
Interestingly, the presence of a5b1 integrin in challenged bMECs
was undetectable by ow cytometry, suggesting that the internalization of bacteria results in the endocytosis of this receptor.

Accordingly, the analysis of a5b1 integrin by ow cytometry at


earlier phases of the infection (15, 30 and 60 min) corroborates its
presence in the membrane; thus, the endocytosis of this receptor is
accomplished later during the infection. A reduction in the a5b1
integrin MA was detected as soon as 15 min of infection.
The presence of a5b1 integrin in the membrane of bPRL-treated
bMECs can explain the enhanced bacterial endocytosis stimulated

Fig. 4. Expression of innate immune genes in bMECs during the internalization of S. aureus stimulated by bPRL. RT-qPCR analysis showing the mRNA expression levels of DEFB1 (A),
TAP (B), TNF-a (C), IL-1b (D), IL-6 (E), IL-8 (F), and IL-10 (G). The bMECs (control) were treated with 5 ng/ml bPRL for 24 h and then challenged with S. aureus for 2 h. The data are
presented as the ratio of the target gene expression compared with the expression level of GAPDH. Each bar shows the mean of triplicates SE of three independent experiments.
The letter a indicates signicant changes (P < 0.05) compared with the untreated control cells. The letter b indicates signicant changes (P < 0.05) compared with bMECs treated
with bPRL.

50

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

Fig. 5. Secretion of pro-inammatory cytokines by bMECs during the internalization of S. aureus stimulated by bPRL. TNF-a (A) and IL-1b (B) protein concentrations in the cell
supernatants of bMECs that were treated for 24 h with bPRL and/or challenged for 2 h with S. aureus. The protein concentrations were determined by ELISA. The letter a indicates
signicant changes (P < 0.05) compared with the untreated control cells. The letter b indicates signicant changes (P < 0.05) compared with bMECs treated with bPRL.

by the hormone. However, it is also possible that the increased


internalization of S. aureus mediated through a5b1 integrin is the
result of the pro-inammatory response induced by bPRL in bMECs.
In agreement, Clark et al. [20] showed that different types of
epithelial cells enhance bacterial particle uptake under proinammatory conditions, which correlates with an upregulation
and redistribution of b1 integrin to the apical surface of the cells.
The activation of TLR2 pathways is necessary for the internalization of S. aureus into bMECs, regardless of the presence of bPRL
stimulation, because its blockage with antibodies reduces S. aureus
internalization. It is important to notice that the antibody used to
block TLR2 activation recognizes an epitope related to signal
transduction, which does not interfere with PAMP recognition [30].
Our results suggest that the S. aureus internalization induced by
bPRL depends in part on the activation of the TLR2 pathway
because the blockage of this receptor results in a 80% reduction in
bacterial internalization, whereas other mechanisms may regulate
this process in the control cells. Accordingly, the bPRL stimulated
TLR2 activation during the S. aureus internalization is not related
with the availability of this receptor in the membrane of bMECs
because the infection alone also enhances TLR2 MA. Interestingly,
we detected a lower availability of TLR2 in bMECs treated with bPRL
and S. aureus compared with the cells that were treated only with
the bacteria. Based on the results from these experiments, we
cannot conclude that TLR2 is internalized together with the bacteria. However, it has been reported that, although TLRs are not
phagocytic receptors per se, these receptors are also internalized
during the phagocytic process. This nding has been demonstrated
with the S. aureus lipoprotein SitC, which increases the level of
intracellular TLR2 and co-localizes with TLR2 in keratinocytes [31].
According to our results, the increase of TLR2 detected on the
membrane of bMECs may be the result of the expression of the gene
encoding this receptor, with exception of bMECs treated with bPRL
and S. aureus. In agreement with these results, Fu et al. [32] reported that the TLR2 mRNA level is upregulated in bMECs stimulated with heat-inactivated S. aureus, and the upregulation of the
expression of this receptor has been reported during the in vivo
infection of a bovine mammary gland with S. aureus. However, to
the best of our knowledge, this study provides the rst demonstration of a correlation between PRL and TLR2 expression and
activation in mammals, which implies that this hormone plays a
very important role during the innate immune response to infection, although further research is required to conrm this hypothesis. Furthermore, it is also important to explore other PRRs that
can be activated in our model and particularly which TLR2

heterodimer is involved because S. aureus can activate TLR2/1 and


TLR2/6 heterodimers [33], and to determine which NOD receptors
are implicated because S. aureus components are able to stimulate
the NOD2 receptor in bMECs [34].
In a previous work, we demonstrated that S. aureus internalization in bPRL-treated bMECs downregulates NF-kB activation [13].
Reports from other groups have showed similar results [35]. According to this, a poor induction of key cytokine expression in
bMECs infected with S. aureus has already been reported [36]. In
agreement, in this study we did not detect the activation of NF-kB
using a transcription factor array (Fig. 3) but did detect a considerable activation of other transcription factors related to the inammatory response, such as AP-1. In agreement with these
results, we found that NF-kB-dependent genes are not activated in
challenged bMECs treated with bPRL. For example, S. aureus
internalization downregulates b-defensin genes, such as TAP and
DEFB1, whose expression depends mainly on NF-kB activation
[37,38]. In this study, it is important to notice that some proinammatory cytokines (i.e., TNF-a) and antimicrobial peptides
(i.e., b-defensins) belong to a set of early-response genes that are
induced after bacterial stimulation. This type of genes show a rapid
transcription after stimulation, which is independent of new protein synthesis [39]. Secondary-response genes include other inammatory mediators, such as IL-6, which are differentially
regulated. Although early- and secondary-response genes typically
rely on similar transcription factors (NF-kB, AP-1, and C/EBP), the
binding of NF-kB is delayed in the secondary-response genes, and
this delay appears to reect chromatin accessibility [40]. Accordingly, Liu et al. [41] have reported that Escherichia coli infection
loosens chromatin compaction at lingual antimicrobial peptide
(LAP) promoter in the udder. Thus, the control of these genes by
epigenetic regulation is very important and needs further research,
and rarely depends on only one transcription factor [42]. In this
work, we found that S. aureus increases TNF-a secretion in bMECs,
in agreement with previously reported ndings [13], but the challenge of bPRL-treated bMECs with the bacteria decreased the
secretion of this pro-inammatory cytokine. Because we did not
detect the activation of NF-kB in our model, this induction in
challenged cells must be the consequence of other transcriptional
factors that also regulate TNF-a expression, such as AP-1. Because
the expression level of the TNF-a gene does not correlate with the
accumulation of the protein in the culture medium, other unknown
mechanisms regulate the secretion of this cytokine. However, the
levels of AP-1 activation correlated with the levels of TNF-a
expression in the different treatment groups (Fig. 4). In addition,

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

51

Fig. 6. Participation of PRLR in bMECs during the internalization of S. aureus stimulated by bPRL. A) The role of PRLR signaling was analyzed by determining the activation states of
Stats transcription factors in bMECs treated for 24 h with bPRL and/or challenged for 2 h with S. aureus. The nuclear protein extracts were obtained, and the screening of transcription factors was performed using a TranSignal Protein/DNA array I (Panomics). B) The relative signals from each spot on the membranes were quantied using the ImageJ
software. The bars show the mean intensity of duplicates subtracting the background intensity of the membrane. C) The PRLR surface expression was determined by ow cytometry
analysis (a total of 10,000 events were measured). Typical population proles of non-challenged (black line) vs. challenged bMECs (red line). The secondary antibody control was
included (blue line). D) Mean of the uorescence of the non-challenged and challenged bMECs. The letter a indicates signicant changes (P < 0.05) compared with the untreated
control cells. (For interpretation of the references to color in this gure legend, the reader is referred to the web version of this article.)

AP-1 activation in bMECs in response to S. aureus challenge has


been previously reported [43]. Additionally, S. aureus is not able to
induce the gene expression of other pro-inammatory cytokines,
such as IL-1b or IL-6. With the exception of TNF-a, S. aureus inhibits
the innate immune response of bMECs and the inammatory
response induced by bPRL (IL-1b and IL-6).
The analysis of the secretion of IL-1b performed in this study
demonstrates that bPRL and S. aureus individually increase the
secretion of this cytokine by bMECs. Accordingly, Kim et al. [43]
showed that S. aureus induces IL-1b secretion by bMECs, however
its regulation by bPRL has not been explored prior to the present
study. It is very important to highlight that IL-1b secretion comprises a very ne regulation that involves the activation of the
inammasome. To date, the activation of the inammasome by
bPRL has not been studied. Because various inammasomes can be
formed and activated by different stimuli [44], the type(s) of

inammasomes responsible for the IL-1b production induced by


bPRL or S. aureus in bMECs need to be identied through future
studies. According to our results, the levels of IL-1b secreted by
bPRL-treated bMECs may correspond to the expression of its gene.
However, this correlation was not found in the cells treated with S.
aureus, which stimulates IL-1b protein secretion but not IL-1b gene
expression. Evidence from Breyne et al. [45], deals with this
apparent contradiction using a murine model of mastitis. Their
results show that S. aureus induced a low NF-kB activity concomitant with high mammary levels of the classical IL-1b fragment. In
this model, a non-classical inammasome pathway is involved in
the activation of pro-IL-1b, but the proteases involved are unknown. Further research is necessary in order to establish if a
similar post-translational regulation of IL-1b is active in bMECs
during S. aureus infection.
Interestingly, we also detected the induction of IL-10 expression

52

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

by bPRL. Similar results have been reported in the mouse mammary


gland [46], indicating the effects of this cytokine on the differentiation of mammary tissue. As was found with the other cytokines,
S. aureus also inhibits this effect of bPRL treatment.
In addition, we showed that the canonical Stat-5 transcriptional
factor is not activated in our model, even in control cells. Accordingly, it has been suggested that Stat-3 can act as an antagonist to
Stat-5, preventing further activation in vivo when the bovine gland
shuts down milk production in response to infection or cessation of
milking [47]. In agreement, we detected the activation of Stat-3 in
our model. In addition, Murney et al. [48] have reported that Stat-5
activation correlates with the expression of b1 integrin in the
lactating udder. These results are in agreement too with the
downregulation of the membrane expression of PRLR. Accordingly,
it has been demonstrated that PRL induces the endocytosis, ubiquitination, and lysozomal degradation of PRLR (long isoform) after
receptor binding [49]. We previously reported that the gene
expression of the long isoform of PRLR is downregulated by bPRL
and S. aureus in bMECs, which corresponds with a reduction in kcasein expression [13]. It is possible that the downregulation of
Stat-5 activation could be related to the activation of AP-1. In
agreement with this possibility, Gutzman et al. [25] showed in
breast cancer cells that the reduction of Stat-5 protein increased
PRL-induced AP-1 signals, suggesting that the activation of Stat-5
and AP-1 by PRL is inversely related in mammary cell lines.

[6]

[7]

[8]
[9]

[10]

[11]

[12]

[13]

[14]

[15]

5. Conclusion
Altogether, these results show new effects of prolactin as
regulator of the innate immune response mainly through the
activation of TRL2 in one of its target tissues: the mammary
epithelium. These functions are not achieved through the canonical
activation of PRLR. In addition, our data highlight the relevance of
this hormone during bacterial infections, which has been poorly
explored. Moreover, our results strengthen the evidence that
chronic S. aureus infections maintain a low innate immune prole,
particularly in cells where the bacteria can persist intracellularly.

[16]

[17]

[18]

Conict of interest
[19]

The authors declare that they have no competing interest.


Acknowledgments
IME and NAM were supported by a scholarship from CONACyT.
rez-Gallardo for
The authors thank Dr. J. Campos-Garca and R.V. Pe
their valuable help with the ow cytometry analysis. This work was
supported by grants from CONACyT CB-2012 (178238) and CICUMSNH (14.1) to AOZ.

[20]

[21]

[22]

References
[23]
[1] J.M. Rosen, R.J. Matusik, D.A. Richards, P. Gupta, J.R. Rodgers, Multihormonal
regulation of casein gene expression at the transcriptional and posttransciptional levels in the mammary gland, Recent Prog. Horm. Res. 36 (1980)
157e193.
[2] K. Svennersten-Sjaunja, K. Olsson, Endocrinology of milk production, Domest.
Anim. Endocrinol. 29 (2005) 241e258, http://dx.doi.org/10.1016/
j.domaniend.2005.03.006.
[3] Y.H. Schukken, J. Gnther, J. Fitzpatrick, M.C. Fontaine, L. Goetze, O. Holst, et
al., Host-response patterns of intramammary infections in dairy cows, Vet.
Immunol. Immunopathol. 144 (2011) 270e289, http://dx.doi.org/10.1016/
j.vetimm.2011.08.022.
[4] C. Hoffmann, K. Ohlsen, C.R. Hauck, Integrin-mediated uptake of bronectinbinding bacteria, Eur. J. Cell Biol. 90 (2011) 891e896, http://dx.doi.org/
10.1016/j.ejcb.2011.03.001.
[5] K. Dziewanowska, A.R. Carson, J.M. Patti, C.F. Deobald, K.W. Bayles,
G.A. Bohach, Staphylococcal bronectin binding protein interacts with heat
shock protein 60 and integrins: role in internalization by epithelial cells,

[24]

[25]

[26]

[27]

Infect.
Immun.
68
(2000)
6321e6328,
http://dx.doi.org/10.1128/
IAI.68.11.6321-6328.2000.
E. Brouillette, B.G. Talbot, F. Malouin, The bronectin-binding proteins of
Staphylococcus aureus may promote mammary gland colonization in a
lactating mouse model of mastitis, Infect. Immun. 71 (2003) 2292e2295,
http://dx.doi.org/10.1128/IAI.71.4.2292-2295.2003.
A. Scibelli, S. Roperto, L. Manna, L.M. Pavone, S. Tafuri, R. Della Morte, et al.,
Engagement of integrins as a cellular route of invasion by bacterial pathogens,
Vet. J. 173 (2007) 482e491, http://dx.doi.org/10.1016/j.tvjl.2006.01.010.
R.O. Hynes, Integrins: bidirectional, allosteric signaling machines, Cell 110
(2002) 673e687, http://dx.doi.org/10.1016/S0092-8674(02)00971-6.
R.A. Ridley, I. Douglas, S.A. Whawell, Differential adhesion and invasion by
Staphylococcus aureus of epithelial cells derived from different anatomical
sites, J. Med. Microbiol. 61 (2012) 1654e1661, http://dx.doi.org/10.1099/
jmm.0.049650-0.
N. Li, Y. Zhang, M.J. Naylor, F. Schatzmann, F. Maurer, T. Wintermantel, et al.,
Beta1 integrins regulate mammary gland proliferation and maintain the
integrity of mammary alveoli, EMBO J. 24 (2005) 1942e1953, http://
dx.doi.org/10.1038/sj.emboj.7600674.
M.J. Naylor, N. Li, J. Cheung, E.T. Lowe, E. Lambert, R. Marlow, et al., Ablation of
beta1 integrin in mammary epithelium reveals a key role for integrin in
glandular morphogenesis and differentiation, J. Cell Biol. 171 (2005) 717e728,
http://dx.doi.org/10.1083/jcb.200503144.
N. Rooney, C.H. Streuli, How integrins control mammary epithelial differentiation: a possible role for the ILK-PINCH-Parvin complex, FEBS Lett. 585
(2011) 1663e1672, http://dx.doi.org/10.1016/j.febslet.2011.05.014.
rate, J.E. Lo
pez-Meza, A. Ochoa-Zarzosa, Staphylococcus aureus inL. Lara-Za
hibits nuclear factor kappa B activation mediated by prolactin in bovine
mammary epithelial cells, Microb. Pathog. 51 (2011) 313e318, http://
dx.doi.org/10.1016/j.micpath.2011.07.010.
L.M. Sordillo, K.L. Streicher, Mammary gland immunity and mastitis susceptibility, J. Mammary Gland. Biol. Neoplasia 7 (2002) 135e146, http://
dx.doi.org/10.1023/A:1020347818725.
rrez-Barroso, J.L. Anaya-Lo
 pez, L. Lara-Z
A. Gutie
arate, P.D. Loeza-Lara,
pez-Meza, A. Ochoa-Zarzosa, Prolactin stimulates the internalization of
J.E. Lo
Staphylococcus aureus and modulates the expression of inammatory
response genes in bovine mammary epithelial cells, Vet. Immunol. Immunopathol.
121
(2008)
113e122,
http://dx.doi.org/10.1016/
j.vetimm.2007.09.007.
M. Sasai, M. Yamamoto, Pathogen recognition receptors: ligands and signaling
pathways by toll-like receptors, Int. Rev. Immunol. 32 (2013) 116e133, http://
dx.doi.org/10.3109/08830185.2013.774391.
B. Griesbeck-Zilch, H.H. Meyer, C.H. Khn, M. Schwerin, O. Wellnitz, Staphylococcus aureus and Escherichia coli cause deviating expression proles of
cytokines and lactoferrin messenger ribonucleic acid in mammary epithelial
cells, J. Dairy Sci. 91 (2008) 2215e2224, http://dx.doi.org/10.3168/jds.20070752.
M.L. Marre, T. Petnicki-Ocwieja, A.S. DeFrancesco, C.T. Darcy, L.T. Hu, Human
integrin a(3)b(1) regulates TLR2 recognition of lipopeptides from endosomal
compartments, PLoS One 5 (2010) e12871, http://dx.doi.org/10.1371/
journal.pone.0012871.
I. Watanabe, M. Ichiki, A. Shiratsuchi, Y. Nakanishi, TLR2-mediated survival of
Staphylococcus aureus in macrophages: a novel bacterial strategy against host
innate immunity, J. Immunol. 178 (2007) 4917e4925, http://dx.doi.org/
10.4049/jimmunol.178.8.4917.
R.T. Clark, A. Hope, M. Lopez-Fraga, N. Schiller, D.D. Lo, Bacterial particle
endocytosis by epithelial cells is selective and enhanced by tumor necrosis
factor receptor ligands, Clin. Vaccine Immunol. 16 (2009) 397e407, http://
dx.doi.org/10.1128/CVI.00210-08.
R. Kapetanovic, M. Parlato, C. Fitting, V. Quesniaux, J.M. Cavaillon, M. AdibConquy, Mechanisms of TNF induction by heat-killed Staphylococcus aureus
differ upon the origin of mononuclear phagocytes, Am. J. Physiol. Cell Physiol.
300 (2011) C850eC859, http://dx.doi.org/10.1152/ajpcell.00187.2010.
 pez, O.E. Contreras-Guzm
rabez-Trejo, V.M. BaizabalJ.L. Anaya-Lo
an, A. Ca
pez-Meza, J.J. Valdez-Alarco
 n, et al., Invasive potential of bacAguirre, J.E. Lo
terial isolates associated with subclinical bovine mastitis, Res. Vet. Sci. 81
(2006) 358e361, http://dx.doi.org/10.1016/j.rvsc.2006.02.002.
pez-Meza, Effects of sodium octaN. Alva-Murillo, A. Ochoa-Zarzosa, J.E. Lo
noate on innate immune response of mammary epithelial cells during
Staphylococcus aureus internalization, Biomed. Res. Int. 2013 (2013) 927643,
http://dx.doi.org/10.1155/2013/927643.

llez-Pe
rez, I. Medina-Estrada, C. Alvarez-Aguilar,
N. Alva-Murillo, A.D. Te
 pez-Meza, Modulation of the inammatory response
A. Ochoa-Zarzosa, J.E. Lo
of bovine mammary epithelial cells by cholecalciferol (vitamin D) during
Staphylococcus aureus internalization, Microb. Pathog. 77 (2014) 24e30, http://
dx.doi.org/10.1016/j.micpath.2014.10.006.
J.H. Gutzman, D.E. Rugowski, S.E. Nikolai, L.A. Schuler, Stat5 activation inhibits
prolactin-induced AP-1 activity: distinct prolactin-initiated signals in
tumorigenesis dependent on cell context, Oncogene 26 (2007) 6341e6348,
http://dx.doi.org/10.1038/sj.onc.1210454.
M.E. Hockett, F.M. Hopkins, M.J. Lewis, A.M. Saxton, H.H. Dowlen, S.P. Oliver,
et al., Endocrine proles of dairy cows following experimentally induced
clinical mastitis during early lactation, Anim. Reprod. Sci. 58 (2000) 241e251,
http://dx.doi.org/10.1016/S0378-4320(99)00089-5.
P. Boutet, J. Sulon, R. Closset, J. Detilleux, J.F. Beckers, F. Bureau, et al.,

I. Medina-Estrada et al. / Microbial Pathogenesis 89 (2015) 43e53

[28]

[29]

[30]

[31]
[32]

[33]

[34]

[35]

[36]

[37]

Prolactin-induced activation of nuclear factor kappaB in bovine mammary


epithelial cells: role in chronic mastitis, J. Dairy Sci. 90 (2007) 155e164, http://
dx.doi.org/10.3168/jds.S0022-0302(07)72617-6.
M. Klenk, D. Koczan, R. Guthke, M. Nakata, H.J. Thiesen, A. Podbielski, et al.,
Global epithelial cell transcriptional responses reveal Streptococcus pyogenes
Fas regulator activity association with bacterial aggressiveness, Cell Microbiol.
7 (2005) 1237e1250, http://dx.doi.org/10.1111/j.1462-5822.2005.00548.x.
W.B. Eichinger, J.B. Grammer, B. Zhao, J. Brckner, N. Mendler, R. Lange, et al.,
Transcriptional regulation of alpha5beta1 integrin, bronectin, VCAM-1,
MCSF-1/c-fms, and MCP-1 in atrioventricular valves after valvular surgery
and Staphylococcus aureus bacteremia, Cytokine 31 (2005) 465e472, http://
dx.doi.org/10.1016/j.cyto.2005.07.005.
T.H. Flo, O. Halaas, E. Lien, L. Ryan, G. Teti, D.T. Golenbock, et al., Human tolllike receptor 2 mediates monocyte activation by Listeria monocytogenes, but
not by group B streptococci or lipopolysaccharide, J. Immunol. 164 (2000)
2064e2069, http://dx.doi.org/10.4049/jimmunol.164.4.2064.
B. Fournier, The function of TLR2 during staphylococcal diseases, Front. Cell
Infect. Microbiol. 2 (2012) 167, http://dx.doi.org/10.3389/fcimb.2012.00167.
Y. Fu, E. Zhou, Z. Liu, F. Li, D. Liang, B. Liu, et al., Staphylococcus aureus and
Escherichia coli elicit different innate immune responses from bovine mammary epithelial cells, Vet. Immunol. Immunopathol. 155 (2013) 245e252,
http://dx.doi.org/10.1016/j.vetimm.2013.08.003.
T. Goldammer, H. Zerbe, A. Molenaar, H.J. Schuberth, R.M. Brunner, S.R. Kata,
et al., Mastitis increases mammary mRNA abundance of beta-defensin 5, tolllike-receptor 2 (TLR2), and TLR4 but not TLR9 in cattle, Clin. Diagn. Lab.
Immunol. 11 (2004) 174e185, http://dx.doi.org/10.1128/CDLI.11.1.174185.2004.
T. Mele, J. Madrenas, TLR2 signalling: at the crossroads of commensalism,
invasive infections and toxic shock syndrome by Staphylococcus aureus, Int. J.
Biochem. Cell Biol. 42 (2010) 1066e1071, http://dx.doi.org/10.1016/
j.biocel.2010.03.021.
W. Yang, H. Zerbe, W. Petzl, R.M. Brunner, J. Gnther, C. Draing, et al., Bovine
TLR2 and TLR4 properly transduce signals from Staphylococcus aureus and
E. coli, but S. aureus fails to both activate NF-kappaB in mammary epithelial
cells and to quickly induce TNFalpha and interleukin-8 (CXCL8) expression in
the udder, Mol. Immunol. 45 (2008) 1385e1397, http://dx.doi.org/10.1016/
j.molimm.2007.09.004.
J. Gnther, K. Esch, N. Poschadel, W. Petzl, H. Zerbe, S. Mitterhuemer, et al.,
Comparative kinetics of Escherichia coli- and Staphylococcus aureus-specic
activation of key immune pathways in mammary epithelial cells demonstrates that S. aureus elicits a delayed response dominated by interleukin-6
(IL-6) but not by IL-1A or tumor necrosis factor alpha, Infect. Immun. 79
(2011) 695e707, http://dx.doi.org/10.1128/IAI.01071-10.
S. Bougarn, P. Cunha, A. Harmache, A. Fromageau, F.B. Gilbert, P. Rainard,
Muramyl dipeptide synergizes with Staphylococcus aureus lipoteichoic acid to
recruit neutrophils in the mammary gland and to stimulate mammary

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

53

epithelial cells, Clin. Vaccine Immunol. 17 (2010) 1797e1809, http://


dx.doi.org/10.1128/CVI.00268-10.
G. Diamond, V. Kaiser, J. Rhodes, J.P. Russell, C.L. Bevins, Transcriptional
regulation of beta-defensin gene expression in tracheal epithelial cells, Infect.
Immun. 68 (2000) 113e119, http://dx.doi.org/10.1128/IAI.68.1.113-119.2000.
der, E. Kalm, C. Looft, Bovine betaS. Roosen, K. Exner, S. Paul, J.M. Schro
defensins: identication and characterization of novel bovine beta-defensin
genes and their expression in mammary gland tissue, Mamm. Genome 15
(2004) 834e842, http://dx.doi.org/10.1007/s00335-004-2387-z.
S. Saccani, S. Pantano, G. Natoli, Two waves of nuclear factor kappaB
recruitment to target promoters, J. Exp. Med. 193 (2001) 1351e1359, http://
dx.doi.org/10.1084/jem.193.12.1351.
S. Liu, X. Shi, I. Bauer, J. Gnther, H.M. Seyfert, Lingual antimicrobial peptide
and IL-8 expression are oppositely regulated by the antagonistic effects of NFkB p65 and C/EBPb in mammary epithelial cells, Mol. Immunol. 48 (2011)
895e908, http://dx.doi.org/10.1016/j.molimm.2010.12.018.
K.E. Sullivan, A.B. Reddy, K. Dietzmann, A.R. Suriano, V.P. Kocieda, M. Stewart,
et al., Epigenetic regulation of tumor necrosis factor alpha, Mol. Cell Biol. 27
(2007) 5147e5160, http://dx.doi.org/10.1128/MCB.02429-06.
K.W. Kim, J. Im, J.H. Jeon, H.G. Lee, C.H. Yun, S.H. Han, Staphylococcus aureus
induces IL-1b expression through the activation of MAP kinases and AP-1, CRE
and NF-kB transcription factors in the bovine mammary gland epithelial cells,
Comp. Immunol. Microbiol. Infect. Dis. 34 (2011) 347e354, http://dx.doi.org/
10.1016/j.cimid.2011.04.004.
K.W. Chen, K. Schroder, Antimicrobial functions of inammasomes, Curr.
Opin.
Microbiol.
16
(2013)
311e318,
http://dx.doi.org/10.1016/
j.mib.2013.02.004.
K. Breyne, S.K. Cool, D. Demon, K. Demeyere, T. Vandenberghe,
P. Vandenabeele, et al., Non-classical proIL-1beta activation during mammary
gland infection is pathogen-dependent but caspase-1 independent, PLoS One
9 (2014) e105680, http://dx.doi.org/10.1371/journal.pone.0105680.
T.W. Kim, H.B. Moon, S.J. Kim, Interleukin-10 is up-regulated by prolactin and
serum-starvation in cultured mammary epithelial cells, Mol. Cells 16 (2003)
168e172.
~ ao, E. Kordon, A. Pecci, A. Guberman, STAT5
A.R. Granillo, J.C. Bof, L. Baran
transcriptional activity is impaired by LIF in a mammary epithelial cell line,
Biochem. Biophys. Res. Commun. 356 (2007) 727e732, http://dx.doi.org/
10.1016/j.bbrc.2007.03.040.
R. Murney, K. Stelwagen, T.T. Wheeler, J.K. Margerison, K. Singh, Activation of
signal transducer and activator of transcription 5 (STAT5) is linked to b1integrin protein abundance in unilaterally milked bovine mammary glands,
J. Dairy Sci. 98 (2015) 3133e3142, http://dx.doi.org/10.3168/jds.2014-9003.
G. Swaminathan, B. Varghese, C. Thangavel, C.J. Carbone, A. Plotnikov,
K.G. Kumar, et al., Prolactin stimulates ubiquitination, initial internalization,
and degradation of its receptor via catalytic activation of Janus kinase 2,
J. Endocrinol. 196 (2008) R1eR7, http://dx.doi.org/10.1677/JOE-07-0554.