Você está na página 1de 5

Questes

1. No quadro abaixo informada a sequncia nucleotdica do xon 2 de um


gene que pode
estar relacionado com maior eficincia fotossinttica de plantas. Um
pesquisador
pretende verificar se esse gene est presente em outras espcies de
plantas, isolando esse
segmento pelo mtodo de PCR. Com base nessas informaes, responda as
questes sobre
esse experimento.
a. Para amplificar a sequncia de DNA em interesse, foram desenhados os
iniciadores
(primers) Foward e Reverse, tendo suas sequncias nucleotdicas indicadas
na figura.
Posicione quais seriam os locais de anelamento de cada um desses primers
na sequncia
fornecida.
Os locais de anelamento esto representados na cor laranja na figura
abaixo.

b. Para que uma PCR possa ocorrer corretamente, quais os


componentes e reagentes
devem estar presentes nessa reao?
Uma composio bsica de PCR requer vrios componentes e reagentes,
incluem:
1)Um molde de DNA extraido que contenha a regio do DNA (alvo) a ser
amplificado.
2) Dois iniciadores (prmers), que sejam complementares s regies fim da
linha 5 (primeiro 5) e fim da linha 3 (primeiro 3) da regio do DNA.
3)A DNA polimerase, tal como a polimerase Taq ou outra polimerase de
DNA, em temperatura tima de 70C.
4) Desoxinucleosdeos trifosfatos (dNTPs; tambm comumente e

erroneamente chamados desoxinucleotdeos trifosfatos, dATP, dGTP, dCTP,


dTTP), que atuam como tijolos na construo das molculas de DNA a partir
dos quais a DNA polimerase sintetiza uma nova fita de DNA.
5) Uma soluo com tampo para se garantir pH e concentraes inicas
adequadas reao
6) Ctions divalentes, ons de magnsio ou mangans; geralmente Mg2+
usado, mas Mn2+ pode ser utilizado para mutagneses do DNA mediada
por PCR, pois concentraes mais altas de Mn2+ aumentam a taxa de erro
durante a sntese de DNA.
7) ons de potssio ctions monovalentes.
8)H2O

c. Utilizando esse conjunto de primers, qual o tamanho do fragmento de


DNA, estimado
em pares de base, que espera-se que seja isolado nessa reao de PCR?

So bases esto entre os dois primers, comeando na primeira Guanina aps a regio em
que se anela o primer Foward, e termina antes da ltima Guanina, antes da regio que se
liga o primer Reverse. Estima-se que o tamanho do fragmento de DNA seja de
aproximadamente 118 pb.

d. Plantas da espcie 1, 2 e 3 apresentam delees na sequncia


nucleotdica desse
segmento gnico, representadas pelas caixas cinzas 1, 2 e 3,
respectivamente, indicadas
na sequncia acima. Caso esse pesquisador utilize esse conjunto de
primers para tentar
isola o segmento do xon2, qual o tamanho dos fragmentos ser
amplificado em cada
uma dessas plantas?
A primeira planta tem uma deleo que no est na regio que ser
amplificada, portanto, no afetar no tamanho do fragmento;
A deleo da planta 2 se encontra dentro da regio amplificada, portanto
diminuir o nmero de pares de base, afetando 13 bases, restando 105 pb;

J a planta 3, a deleo est bem em cima da regio onde o primer se


anela, portanto no haver anelamento do primer e o fragmento no ser
amplificado.
2. O homem F recusa na justia a sua responsabilidade paterna sobre os
filhos (C1, C2, C3 e C4) da me M. Para resolver o caso, exames baseados
na hibridizao de Southern blots (fingerprints de DNA) foram solicitados e o
resultado est representado ao lado. Qual a sua concluso sobre o caso?

Como observado no resultado do exame, pode se concluir que os Filhos C2,


C3 e C4 so filhos do casal da mulher M e do homem F, entretanto o C1 no
filho do homem F.
3. A Engenharia Gentica consiste numa tcnica de manipular genes, que
permite, entre outras coisas, a fabricao de produtos farmacuticos
em bactrias transformadas pela tecnologia do DNA recombinante.
Assim, j possvel introduzir em bactrias o gene que codifica o
hormnio de crescimento humano, as quais passam a fabricar
sistematicamente essa substncia. Descreva os mecanismos (passos)
para que este processo possa ser realizado.
As bactrias tm enzimas de restrio que clivam a molcula de DNA do
plasmdeo em uma determinada sequncia especifica chamadas de zonas
de restrio. Ento, com outras endonucleases de restrio abre-se outra
molcula de DNA, que vai ser a molcula doadora, e isola-se o gene que se
pretende inserir no plasmdeo. O gene que ir ser inserido colocado em
contacto com o plasmdeo, tal como a DNA-ligase. Depois de unidos, o gene

com o plasmdeo, este possui agora um gene estranho, ou seja, possui um


DNA recombinante. O plasmdeo recombinante vai-se introduzir em certas
bactrias que vo concretizar o papel de hospedeiras, aceitando o
plasmdeo bem como o gene estranho. A partir do DNA recombinante, o
gene inserido passa a comandar a sntese da protena desejada.
Passo a passo desse processo:
1. Os pesquisadores recortam (utilizando enzimas de restrio), do DNA
contendo o gene de interesse.
2. Esse fragmento de DNA contendo o gene multiplicado por PCR para
obtermos vrias cpias do mesmo fragmento (ou da mesma informao).
4. A mesma enzima que clivou o gene do DNA utilizado para clivar o
plasmdeo bacteriano. O fragmento de DNA, ao ser clivado, gera pontas
adesivas que so complementares ao plasmdeo se este for clivado com a
mesma enzima.
5. A seguir o plasmdeo clivado misturado com os fragmentos de DNA
(contendo o gene) e uma enzima chamada ligase que liga o fragmento ao
plasmdeo, produzindo o chamado DNA recombinante, que introduzido em
uma bactria hospedeira.
6. A bactria hospedeira colocada em um meio nutritivo seletivo, apenas
aquelas que possuem o DNA recombinante crescem, formando colnias.
Aps muitas geraes de bactrias, o produto da expresso dos genes, as
protenas, so purificadas das bactrias (so separadas das protenas das
bactrias).
4. A figura abaixo um mapa de restrio do plasmdeo circular YIP5. Este
plasmdeo contm 5541 pares de bases. H um stio de restrio da
EcoRI no par de base 1. As posies dos outros stios de restrio esto
demonstradas no mapa. Os nmeros aps o nome das enzimas mostram em
qual par de bases a enzima cliva o DNA. Se voc digerir o YIP5 com EcoRI,
voc vai obter um pedao de DNA com 5541 pares de bases.

a. Quais seriam os produtos de digesto com as enzimas EcoRI e EagI?

O tamanho total do plasmdeo 5541pb, ocorre o corte por duas enzimas, a


EcoRI que cliva no 1pb e a EagI que cliva no 942 pb, que iro gerar dois
fragmentos.
Um menor, que vai do 1 aos 942 pb, portanto tem 942 pb, e um maior com
5541, portanto 5541 942 = 4.599pb.
b. Quais seriam os produtos de digesto com as enzimas HindIII e ApaI?
HindIII 32 pb e ApaI 2035 pb = 2.035 32= 2.003 pb, o produto 5541
2003 = 3538pb.
c. Quais seriam os produtos de digesto com as enzimas HindIII, ApaI e
PvuI?
HindIII 32 pb, ApaI 2035 pb e Pvul 4916
HindIII 32 pb e ApaI 2035 pb = 2.035 32= 2.003 pb, o produto 5541
2003 = 3538pb.
Pvul 4916pb
4916 (PvulI) 2035 (ApaI) = 2881 pb
2035(Apal) 32 (HindIII) = 2003 pb
2881 + 2003 = 4884 pb
5541 4884= 657pb
d. Se voc pegar os produtos de digesto da questo (4. a) e digeri-los com
PvuI, quais
seriam os produtos?
Os produtos da questo 4 so = 4.599pb 625 = 3974pb.

661
5 CTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA 3
3GACCCTAATGTGTACCGTAC 5 ... REVERSE
1C: Foi isolado um fragmento com 61 pares de bases.
1D: Na planta 2 a regio onde ocorre a deleo ficar bem na regio do fragmento a ser amplificado
diminuindo o tamanho deste de 61 para 48 pares de bases.
Atenciosamente.