Você está na página 1de 3

UNIVERSIDADE ESTADUAL DE MARING

DEPARTAMENTO DE BIOTECNOLOGIA, GENTICA E


BIOLOGIA CELULAR
PROVA ONLINE DO CURSO DE ESPECIALIZAO EM
BIOTECNOLOGIA MODALIDADE DISTNCIA
DISCIPLINA VI TURMA 6
28/08/2016

1- Quais foram os avanos da descoberta das enzimas de restrio para a biologia


molecular? Se estas enzimas so produzidas por bactrias para proteger-se de uma
infeco viral, em um processo de clivagem do DNA viral, de que maneira a
Escherichia coli que produz a enzima EcoRI protege o seu DNA da degradao desta
enzima?
A descoberta das enzimas de restrio proporcionou importantes avanos para
a Gentica Molecular, pois elas funcionam como uma espcie de tesoura molecular:
identificam sequncias de pares de bases nitrogenadas especficas nas molculas de
DNA e cortam-nas nessas regies. Sendo importante, para a criao de novas molculas
de DNA, deve-se ao fato de que in vitro, pode-se cortar o DNA de interesse com uma
enzima de restrio e em seguida unir esse DNA com outra molcula de DNA de
interesse, criando assim uma molcula de DNA recombinante, podendo ser aplicados
para isolamento de um gene especfico, sequenciamento de genomas, produo de
enzimas de interesse, modificao de organismos (transgnicos) e terapia gnica.
A Escherichia coli que produz a enzima EcoRI protege o seu DNA contra
infeces virais, pois o DNA viral ao entrar numa bactria pode ser reconhecido por
uma enzima de enzima de restrio que o cortar, como uma tesoura, impedindo que ele
se duplique e mate a clula. O DNA bacteriano est livre da ao das enzimas de
restrio por diversos tipos de mecanismos, seja atravs da proteo das protenas
estabilizadoras, que envolvem o cromossomo bacteriano, seja pela metilao de bases
nitrogenadas da seqncia de DNA.
2- Fragmentei o DNA do genoma humano em grandes fragmentos (300kb) em que vetor
de clonagem vou guardar este DNA em bibliotecas genmicas? Clivei o DNA de
Haemophilus aegyptius em fragmentos de 15kb usarei o mesmo vetor de clonagem?
Justifique a sua escolha.
Como foi fragmentando o DNA do genoma humano em grandes fragmentos
(300kb) necessrio utilizar o vetor de clonagem BAC ou YAC. O YAC conhecido por
ser um cromossomo artificial, possui sequncias centromricas e telomricas, e o

hospedeiro usado para clonagem uma levedura, mais usualmente a Sacharomyces


cerevisae, esse vetor usado para replicar enormes fragmentos de DNA (100 a
2000kb), enquanto o BAC procede da mesma maneira de o vetor YAC, mas difere no
hospedeiro de clonagem, que uma bactria.
No caso do DNA de Haemophilus aegyptius que foi clivado em fragmentos de
15kb possvel utilizar os plasmdeos como vetores ou os fagemdeos, que pode receber
inseres DNA doador at 15 kb. Os plasmdeos so molculas circulares de DNA em
cadeia dupla, provenientes de bactrias, e que se reproduzem independentemente do
DNA cromossmico. Enquanto os fagemdeos um plasmdeo que contm origem de
replicao de um fago F1 e pode ser usado como um tipo de clonagem de vetor em
combinao com fago filamentoso.
3- Quero isolar e estudar um gene especfico. Qual ser o melhor procedimento,
desenvolver uma biblioteca genmica ou uma biblioteca de cDNA? Justifique a sua
escolha.
A biblioteca genmica so colees de genes clonados de uma determinada espcie de
organismo, que contem pelo menos uma cpia de todos os genes de um organismo.
Nesta biblioteca esto presentes no s as regies codificantes, mas tambm as regies
no codificantes. Desta forma, quando se pretende estudar uma zona no codificante
mas importante para a regulao da transcrio, por exemplo, recorre-se a este tipo de
biblioteca.
Entretanto, quando se quer clonar um determinado gene pode passar alguns passos e
utiliza uma biblioteca de cDNA (DNA complementar) das mensagens por ele
codificadas (mRNA) , pois este constitudo apenas pela parte codificante, uma vez que
o mRNA s contm os exons, sendo assim, este tipo de biblioteca muito til quando se
pretende isolar um gene especfico.
4- Quero multiplicar uma sequencia de DNA, para ter DNA suficiente para meus
experimentos.
Perguntas:
a- Se este um segmento de DNA desconhecido como poderei multiplicar esta
sequencia para obter quantidade de DNA suficiente?
Neste caso necessrio utilizar de primers universais que amplifica seqncias
desconhecidas de DNA ou ento utilizar uma variao do protocolo de PCR, que
contem duas caractersticas distintas: utiliza um primer nico ao invs de um par
de primers e o primer nico tem sequncia arbitrria, sendo sua sequncia alvo
desconhecida.

b- Se este segmento conhecido de que maneira posso multiplicar esta sequencia


de DNA para obter quantidade suficiente para meus estudos.

Se as sequncias de nucleotdeos das extremidades de uma dada regio de DNA


forem conhecidas, o fragmento flanqueado por essas sequncias pode ser
amplificado por PCR (polymerase chain reaction), pois utiliza-se primers
complementares s sequncias internas conhecidas.
5- Um fragmento de DNA foi analisado pela determinao de sua sequncia de
nucleotdeos pelo mtodo de Sanger usando ddNTP (didesoxinucleotideo). O resultado
est demonstrado no gel abaixo. Informe a sequncia de DNA lida (complementar) e a
usada como molde para este sequenciamento. Indique, na sequncia redigida, as
extremidades 5 e 3 do DNA.

5 TCAGTTCAGCCCAATCAGATGGGACAGGT 3 (Sequencia de DNA lida)


3 AGTCAAGTCGGGTTAGTCTACCCTGTCCA 5 (Sequencia molde)

Você também pode gostar