Você está na página 1de 19

Class

Candidate
Number

Name

ANGLO-CHINESE JUNIOR COLLEGE


Preliminary Examination 2009
BIOLOGY

9747 / 01

HIGHER 2
Paper 1 Multiple Choice

02 SEPT 2009
1 hour 15 minutes

Additional Materials:

Multiple Choice Answer Sheet

INSTRUCTIONS TO CANDIDATES
Write your name, Centre number and candidate number on the multiple choice answer sheet
provided.
There are forty questions in this paper. Answer all questions. For each question there are four
possible answers, A, B, C and D. Choose the one you consider correct and record your choice
in soft pencil on the separate answer sheet.
Read very carefully the instructions on the answer sheet.
INFORMATION FOR CANDIDATES
Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Calculators may be used.

This document consists of 19 printed pages and 1 blank page.


Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

2
1

The diagram shows a cell found in an organ in the human body.

From its structure, what are the functions of this cell?

Intracellular digestion and storage of granules of product

Phagocytosis, pinocytosis and secretion

Secretion and transport of protective mucus

Uptake and transport of ions and molecules

An enzyme is a globular protein held together by several different types of bonds, giving
the enzyme primary, secondary and tertiary levels of structure.
Which combination correctly summarises the types of bond involved in each level of
structure?
Disulphide bonds

Hydrogen bonds

Ionic bonds

Peptide bonds

Primary

Tertiary

Secondary

Tertiary

Primary,
tertiary

Primary

Secondary,
tertiary

Secondary

Secondary

Secondary

Tertiary

Primary

Tertiary

Secondary,
tertiary

Tertiary

Primary

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

3
3

In an experiment using starch and amylase, the concentrations of starch and maltose
present in the reacting mixture are measured every minute for 20 minutes. 1%
hydrochloric acid is added after 10 minutes and the mixture is heated to 60C at 14
minutes.
Which graph represents the results of this experiment?

Which of the following is not a characteristic of cancer cells?


A

Anchorage independence

Contact inhibition

Metastasis

Stimulate angiogenesis

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

4
5

The figure below shows a hypothetical diploid cell with six chromosomes.

Which of the following statements are true?


I

This cell is at prophase I of meiosis as bivalents have formed and


nuclear membrane is disintegrating.

II

This cell is at prophase of mitosis as the chromosomes are distinct and


nuclear membrane is disintegrating.

III

New combination of alleles may arise between R and S during


meiosis.

IV

R and T have the same genes and same number of genes.

R and S have the same alleles and same number of genes.

VI

Crossing over may occur between non-sister chromatids of bivalent Q.

I and IV only

I, V and VI only

II and III only

II, III and V only

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

5
6

The figure below represents the relative amount of DNA per nucleus during several cell
divisions in a plant tissue.

DNA per
nucleus/
arbitrary
units

From the graph, when does the cell become haploid?

Transcription initiation in eukaryotes requires several molecules. The diagram below


shows some of the molecules involved in the transcription process.

Which is the correct combination for labels 1 4?


1

Enhancer

Activator

DNA bending protein

RNA polymerase

Promoter

Activator

DNA bending protein

RNA polymerase

Enhancer

Activator

DNA bending protein

Mediator

Promoter

Silencer

DNA bending protein

Mediator

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

6
8

Analysis of DNA produced the following ratios of nitrogenous bases.


Source of DNA
bean seeds
cow heart
human liver
rat bone marrow

Ratio of purines to pyrimidines


0.99
1.01
1.02
1.00

Which of the following statements is true?

Animal DNA contains more purines than pyrimidines.

Different parts of an organism contain different proportions of purines and


pyrimidines.

DNA contains thymine instead of uracil.

There are variations in the accuracy of analytical techniques.

Five different amino acids (numbered 1 to 5 below) form the following sequence in part
of a polypeptide chain:
2------3------4------1------3------5------2
Messenger RNA (mRNA) codons which correspond to these amino acids are:
amino acid 1
amino acid 2
amino acid 3
amino acid 4
amino acid 5

UGU
GAU
CAC
CAA
AAG

Which one of the following DNA base sequences could provide the code for the given
section of polypeptide?
A

CTAGTGGTTACAGTGTTCCTA

CTAGTGGTTACAGTGTTGCTA

CTAGTGGTTTCTGTGTTGCTA

CTAGTGGTTACAGTGTTCCTT

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

7
10

11

Tamiflu is an antiviral drug used to treat influenza A (H1N1) patients. It works by


preventing progeny virions from detaching from infected cells. Which of the
following components of the influenza virus does Tamiflu act on?
A

Hemagglutinin

Matrix protein

Neuraminidase

Nucleoproteins

The diagram represents the structure of the human immunodeficiency virus (HIV).

Which combination correctly identifies the functions of the lettered components?


V

Attaches virus
to target cells

Fuses with
membrane of
target cells

Protects the
viral genetic
material

Synthesises
single-stranded
DNA from viral
genetic material

Attaches virus
to target cells

Fuses with
membrane of
target cells

Protects the
viral genetic
material

Synthesises
double-stranded
DNA from viral
genetic material

Attaches virus
to target cells

Protects the
viral genetic
material

Fuses with
membrane of
target cells

Synthesises
single-stranded
RNA from viral
genetic material

Fuses with
membrane of
target cells

Protects the
viral genetic
material

Attaches virus
to target cells

Synthesises
double-stranded
RNA from viral
genetic material

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

8
12

Two strains of the bacterium Streptococcus pneumoniae were used in an experiment on


mice. The smooth (S) strain is a virulent strain whereas the rough (R) strain is a nonvirulent strain. The diagram below shows the results of the experiment.

Which of the following accounts for the living S cells in the mouse blood sample, even
though the original injection mixture contained only heat-killed S cells and living R cells?

13

Binary fission

Conjugation

Transduction

Transformation

A scientist inserts the gene for human growth factor into the Escherichia coli lac operon,
replacing the structural genes with the gene for human growth factor. What substance
must be added to the culture of bacteria in order to cause them to produce the human
growth factor?
A

Human growth factor

Lactose

Operator protein

Repressor protein

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

9
14

15

The role of telomerase is to maintain the length of telomeres in germline cells. Which
statement is true about how telomerase works?
A

It has RNA polymerase that can add ribonucleotides to the parental strand.

It has reverse transcriptase that can add deoxyribonucleotides to the parental


strand.

It has a DNA template that acts as a template to add deoxyribonucleotides to


the parental strand.

It has DNA polymerase that can add deoxyribonucleotides to the parental


strand.

The table shows a comparison between the genomes of a prokaryote and


eukaryote.

Which feature of eukaryotes accounts for the differences in the number of


proteins with roles in protein synthesis?

16

17

The DNA of a eukaryote has histones.

The DNA of a eukaryote has introns.

The DNA of a eukaryote has more base pairs.

The DNA of a eukaryote is separated from the ribosomes by membranes.

Which of the following is not a requirement for the mechanism of RNA splicing?
A

Introns

Small nuclear ribonucleoproteins

5 and 3 splice sites

5 modified guanosine cap

An investigator wanted to determine the function of protein X. He cloned the gene X into
plasmid 1. He then set up another plasmid (plasmid 2) with a binding site for the product

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

10
of gene X plus a reporter gene. A reporter gene codes for the synthesis of a product that
is easily measured. The two plasmids (shown below) were then introduced into the
nucleus of a host cell.

He noted that there was an increase in the number of reporter gene transcripts. Which of
the following statements is a valid conclusion regarding gene X or product X?

18

19

Gene X is an enhancer sequence.

Gene X is the promoter sequence.

Product X is RNA polymerase.

Product X is a transcription factor.

Which of the following is a method of post-translational control in eukaryotic cells?


A

Inactivation of essential translational factors.

Prevention of ribosome attachment.

Selective degradation of mRNA transcripts.

Selective degradation of the proteins when they are transported to targeted


destinations.

A girl has blood group A and her brother has blood group B. Which combination of
genotypes cannot belong to their parents?
Mother

Anglo-Chinese Junior College

Father
9747/01/Prelim 09

[Turn over

11

20

21

IA IA

IB IO

IA IB

IA IB

IO IO

IA IB

IB IO

IA IO

In one of the experiments to test the 3:1 ratio of Mendels laws, 705 plants are
observed to have red flowers and 224 had white flowers. The P (probability) value,
associated with the calculated chi-square value of 2.668, is 0.10, under the 95%
(P=0.05) confidence level. The P refers to
A

the chance that there is a 10% probability that any deviation from the expected
result is due to a random event only.

the chance that there is a 10% probability that any deviation from the expected
result is significant.

the chance that there is no difference between the expected and observed
results.

the chance that there is a difference between the expected and observed
results.

Fruit flies homozygous for long wings were crossed with flies homozygous for vestigial
wings.
The F1 generation was raised at 3 different temperatures. The F1 flies were then
crossed with each other to produce the F2 generation. The results of the F1 and F2
generation are shown below.
Temperature
21C
26C
31C

F1 result
All long wings
All long wings
All long wings

F2 result
3/4 long wings, 1/4 vestigial wings
3/4 long wings, 1/4 intermediate wings
All long wings

Which of the following statements is correct?

22

Heterozygous flies have vestigial wings only at 21C and below, but have long
wings at 31C and above.

Long wing and vestigial wing alleles show codominance at 26C.

Long wing allele is dominant at higher temperatures, but vestigial wing allele is
dominant at lower temperature.

Vestigial wing allele is recessive but causes a vestigial wing phenotype only at
lower temperatures.

The coat colour of Labrador retrievers is controlled by two genes, B and E. Allele B
(dominant) codes for black coat, while allele b (recessive) codes for brown coat. The
coat colour of a Labrador retriever with genotype ee is yellow.

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

12
A cross between Labrador retrievers with the genotype EeBb and EeBB was
performed. What is the expected phenotype in the offspring of this cross?

23

24

75% yellow, 25% black

75% black, 25% yellow

37.5% black, 37.5% brown, 25% yellow

50% black, 25% brown, 25% yellow

Which of the following statements is true?


A

Continuous variation shows a normal distribution and is only influenced by


genetic factors.

Continuous variation is controlled by two or more genes and the traits are
qualitative.

Discontinuous variation shows traits that follow discrete distribution and is


mostly influenced by environmental factors.

Discontinuous variation shows traits that are controlled by one or two genes
and is not influenced by environmental factors.

14

C-labelled carbon dioxide was supplied to photosynthesising algae. The relative


amounts of three organic compounds were measured. The diagram shows the
results.

Which of the following compounds correspond to the respective graphs 1, 2 and 3?

25

1
2
3
A
GP
RuBP
Sugar
B
GP
Sugar
RuBP
C
RuBP
GP
Sugar
D
RuBP
Sugar
GP
When cyanide is bound to cytochrome oxidase, the cell can no longer produce ATP
aerobically. Which statement below best explains this?
A

It prevents NADPH from being oxidised to NADP+, hence preventing electron flow
down the electron transport chain.

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

13

26

It prevents oxygen from accepting electrons and protons to form water, hence
preventing electron flow down the electron transport chain.

It prevents photolysis from occurring to produce oxygen.

It prevents pyruvate from being synthesised in glycolysis, hence stopping the


Krebs cycle.

The diagram represents a cell membrane.

Which structure allows the diffusion of Cl ions between the outside and inside of the
cell?
A

A only

B only

A and B

C and D

27
The
below shows a
action potential.

Anglo-Chinese Junior College

diagram
normal

9747/01/Prelim 09

[Turn over

14

Which events are occurring at positions 2 and 4 to produce the illustrated action
potential?
Position 2

28

29

Position 4

Influx of potassium ions

Efflux of sodium ions

Influx of sodium ions

Efflux of potassium ions

Influx of sodium ions

Influx of potassium ions

Efflux of potassium ions

Influx of sodium ions

Which of the following will stop impulse transmission across a synapse?


A

A mutation of the voltage-gated calcium ion channels.

Enzyme acetylcholinesterase inhibited by nerve gas DFP.

Increased fusion of neurotransmitter vesicles with pre-synaptic membrane.

The accumulation of acetylcholine vesicles in the pre-synaptic knob.

Which of the following represents the changes that insulin brings about in the
appropriate target cells?

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

15

30

Rate of
glycogenolysis

Rate of
glycogenesis

Level of
cAMP

Increase

Decrease

Increases

Decrease

Increase

Increases

Increase

Decrease

Decreases

Decrease

Increase

Decreases

The diagram below shows a general signal transduction pathway.


Intermediate or relay
molecules
Activation of cellular
responses
Cell surface membrane

Which one of the following processes deviates from the chain of events as shown
above?

31

Epinephrine, released in response to stress, increases the availability of energy


sources by stimulating glycogen hydrolysis in muscle and the liver.

Testosterone, released by the testes, stimulates development of secondary sex


characteristics at target tissues.

Growth factors, protein molecules released by actively growing cells, stimulate cell
growth and cell division in adjacent cells.

Glucagons, released by alpha cells of the islets of Langerhans, stimulate


expression of certain genes to bring about an increase in rate of gluconeogenesis.

In which of the following scenarios would allopatric speciation occur most quickly?
A

A population of cheetahs undergoing little or no evolutionary change.

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

16

32

A population of fishes undergoing directional selection due to the introduction of


a new predator.

A population of giraffes free to roam the entire nature reserve after the artificial
removal of all predators.

A population of snails separated by a new fast-flowing river.

The table below shows the number of amino acid differences in the alpha haemoglobin
chains between the crocodile and various organisms.

Crocodile

Lungfish

Coelacanth

Shark

Goldfish

85

78

77

70

Which organism is most closely related to the crocodile?


A

Coelacanth

Goldfish

Lungfish

Shark

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

17
33

34

35

During the drought years on the island of Daphne Major, small seeds became rare,
leaving behind only large seeds as a food source for birds. In the event of a prolonged
drought lasting several years, which of the following could be a possible observation?
A

Large-beaked birds eating less, leaving food available for the small-beaked birds.

Small-beaked birds developed large beaks to feed on the large seeds.

Small-beaked birds dying, with subsequent generations having a higher percentage


of large-beaked birds.

Small-beaked birds mutating their genes to grow large beaks.

Which of the following characteristics is undesirable in cloning vectors used in genetic


engineering?
A

Ability to replicate in the host cell.

Have at least two gene markers.

Have at least two restriction sites of a particular restriction enzyme.

Small in size.

If the first three nucleotides in a six-nucleotide restriction site are CTG, what would the
next three nucleotides most likely be?
A

CAG

CTG

GAC

GTC

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

18
36

In an investigation of a gene suspected to be involved in a genetic disease,


separate PCR procedures were done using genomic DNA and RNA isolated from
healthy (wild-type WT) and diseased cells (mutant). The PCR products were analysed
on polyacrylamide gels. The sizes of the bands in the molecular weight marker (M) are
indicated in base-pairs.

Genomic DNA
M

WT

RNA

mutant

600

600

468

468

442

442

411

411

368

368

267

267

WT

mutant

Which of the following best explains the results obtained?

37

Deletion of an exon in the mutant.

Deletion of a splice site in the mutant.

Deletion of several codons in the mutant.

Deletion of several introns in the mutant.

Which of the following technique does not involve any nucleic acid hybridisation?
A

DNA fingerprinting

Gel electrophoresis

Polymerase Chain Reaction

Southern blotting

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over

19
38

39

40

Which of the following is not an example of genetically modified organisms?


A

AquaAdvantage Salmon that grow to adult size quickly.

Bt corn plants that are insect-resistant.

Golden Rice that produce high levels of beta-carotene.

Milk-producing cows injected with bovine somatotrophin (BST).

Which of the following statements about hematopoietic stem cells is false?


A

They are able to reproduce continually.

They are easy to isolate and propagate.

They are present in minute quantities in the human body.

They can be induced to differentiate under appropriate conditions.

Gene therapy is the insertion of a therapeutic gene into a target cell with nonfunctional genes. Which of the following are techniques of gene therapy to treat a
genetic disease?
I

A therapeutic gene is inserted into a non-specific location within the genome.

II

A therapeutic gene is inserted into a specific location within the genome.

III

A therapeutic gene enters the cell, but is not inserted into the genome.

IV A therapeutic gene is inserted in reverse orientation with respect to the promoter


(antisense technology).

I, II and III only

I, II and IV only

I and II only

II and IV only

- End of paper -

Anglo-Chinese Junior College

9747/01/Prelim 09

[Turn over