Arch Pharm Res Vol 33, No 11, 1843-1850, 2010

DOI 10.1007/s12272-010-1117-1

Anti-inflammatory Effect of Visnagin in Lipopolysaccharide-stimulated

BV-2 Microglial Cells
Jin-Koo Lee1, Jun-Sub Jung1, Sang-Hee Park1, Soo-Hyun Park1, Yun-Beom Sim1,2, Seon-Mi Kim1,2, Tal-Soo Ha3,
and Hong-Won Suh1,2
1

Institute of Natural Medicine, Hallym University, Chuncheon 200-702, Korea, 2Department of Pharmacology, College of
Medicine, Hallym University, Chuncheon 200-702, Korea, and 3Department of Molecular Biology, College of Natural
Science, Daegu University, Gyeongbuk 712-714, Korea
(Received June 21, 2010/Revised August 10, 2010/Accepted August 16, 2010)

Visnagin, which is found in Ammi visnaga, has biological activity as a vasodilator and reduces
blood pressure by inhibiting calcium influx into the cell. The present study demonstrates the
anti-inflammatory effect of visnagin on lipopolysaccharide (LPS)-stimulated BV-2 microglial
cells. When cells were treated with visnagin prior to LPS stimulation, production of nitric
oxide and expression of iNOS were attenuated in a dose-dependent manner. Visnagin also
caused a significant decrease of mRNA expression and release of TNF-, IL-1 and IFN. In
addition, visnagin reduced LPS-induced IL-6 and MCP-1 mRNA level. We further found that
visnagin dose-dependently inhibited LPS-induced AP-1 and NF-B luciferase activities. Taken
together, our results for the first time suggest that the anti-inflammatory effect of visnagin
might result from the inhibition of transcription factors, such as AP-1 and NF-B.
Key words: Anti-inflammation, Microglial cells, Visnagin, Inducible nitric oxide synthase,
AP-1, NF-B

INTRODUCTION
Microglial cells are critical effector cells of immune
response and host defense in the central nervous
system (CNS). Under neuroinflammatory conditions,
such as brain injury, stroke, ischemia, Alzheimers disease, Parkinsons disease and HIV-associated dementia in the CNS, microglial cells become activated by
changing morphology from resting ramified cells to
amoeboid-like phagocytic cells, which proliferate, migrate to injured sites, and produce biologically active
molecules such as nitric oxide (NO), cytokines and
chemokines (Tuttolomondo et al., 2008; Graeber and
Streit, 2010). The overproduction of inflammatory
mediators such as cytokines, chemokines, NO and
prostaglandin E2 (PGE2) by microglia in the CNS
causes the neuropathological process of inflammatory
CNS diseases (Tzeng et al., 2005; Graeber and Streit,
Correspondence to: Hong-Won Suh, Department of Pharmacology, College of Medicine, Hallym University, Chuncheon 200702, Korea
Tel: 82-33-248-2614, Fax: 82-33-248-2612
E-mail: hwsuh@hallym.ac.kr

2010). Therefore, use of novel pharmacological agents

that can inhibit production of NO and PGE2 and the
expression of pro-inflammatory cytokine and chemokine genes by microglia represent a promising therapeutic strategy to control neuroinflammation.
Visnagin (Fig. 1A), 4-methoxy-7-methyl-5H-furo[3,2g][1]benzopyran-5-one (IUPAC name) is an active compound extracted from the fruits of Ammi visnaga
(Kaul and Staba, 1965). Visnagin and other related
active compounds, such as visnadin and khellin have
vasodilator effects in vascular smooth muscle and in
isolated aorta by inhibiting Ca2+ activation and the
Ca2+ channel (Ubeda et al., 1991; Rauwald et al., 1994;
Duarte et al., 1995). Visnagin also decreases blood pressure and blocks blood vessel contraction by inhibiting
calcium influx into the cell (Duarte et al., 2000). It
was also recently reported that visnagin prevents
oxalate induced cell damage in renal epithelial cells
(Vanachayangkul et al., 2010). However, the anti-inflammatory effect of visnagin on LPS-stimulated microglial cells has not been demonstrated.
In the present study, we have investigated whether
visnagin affects LPS-induced expression of iNOS, COX-

1843

1844

2, pro-inflammatory genes and chemokines in microglial cells. Visnagin inhibits LPS-induced iNOS, TNF, IL-1, IFN and IL-6 and induces expression of IL10. Our results implicate that anti-inflammatory
effects of visnagin may result from an inhibition of
transcription factors (TFs), such as AP-1 and NF-B.

MATERIALS AND METHODS

Cell culture and reagents
The BV-2 microglial cell line, generously provided
by Dr. E. H. Joe at Ajou University, was cultured in
Dulbeccos modification of Eagles medium (DMEM
high glucose) supplemented with 5% fetal bovine
serum and penicillin-streptomycin (Gibco). The cells
were incubated with serum-free DMEM for 24 h prior
to incubation with drugs. LPS was obtained from
Sigma-Aldrich. Visnagin was purchased from Acros
organics.
Cell viability assay
Cell viability was assessed using cell counting kit-8
(CCK-8) (Dojindo). Cells (5 103) were seeded in 96well culture plates for 24 h before treatment with
visnagin. The cells were treated with visnagin for 24 h
and 10 L of CCK-8 solution was added to each well of
the plate. Plates were incubated at 37oC for 1 h and
the absorbance at 450 nm was recorded.
Nitrite assay
The cells were cultured in 12-well plates. Following
the LPS treatment, NO was determined by an assay
of the culture media for nitrite. Briefly, 100 L of culture media was allowed to react with 100 L of Griess
reagent (Sigma). The optical density of the assay samples were measured at 570 nm using SpectraMax M2e
(Molecular Devices). Nitrite concentrations were calculated from a standard curve derived from the reaction of NaNO2 in fresh media.
Transient transfection and luciferase assay
AP-1 and NF-B luciferase reporter vectors were
purchased from Panomics. The 5 105 cells were cultured in 12-well plates for 24 h prior to transfection.
Transfection was performed with plasmids (2 g) and
8 L of FuGENE6 transfection reagent (Roche). One
day after transfection, the cells were placed in serumfree media for overnight. Transfection efficiency was
~20%. Following visnagin and LPS treatments, the
cells were washed with PBS, scraped, and resuspended
with 100 L of lysis buffer contained in the luciferase
assay kit (Promega). Following incubation at room
temperature for 15 min with occasional vortexing, the

J.-K. Lee et al.

samples were centrifuged and the supernatants were

isolated. The luciferase activity was measured by
using a luciferase assay kit. The emitted light and
optical absorbance were measured with a GloMax 20/
20 luminometer (Promega).

TNF-, IL-1 and IFN ELISA

Levels of TNF-, IL-1 and IFN released in media
were measured using the mouse TNF-, IL-1 and
IFN ELISA kits (R&D Systems) according to the
manufacturer's protocol.
Total RNA isolation and reverse transcription
Cells were cultured in six-well culture plates. After
drug treatment, the cells were homogenized in TRIzol
reagent (Invitrogen). Total RNA was extracted from
the cells according to the manufacturer's suggested
protocol. Total RNA concentration was determined
from spectrophotometric optical density measurement
(260 and 280 nm). Total RNA (2 g) was treated with
1 U DNase I (Promega) for 15 min at room temperature in a 18 L volume containing 1 PCR buffer and
2 mM MgCl2. The RNA was then inactivated by incubation with 2 L of 25 mM EDTA at 65oC for 15 min.
Reverse transcriptase (RT) reactions were conducted
using the SuperScrip VIVOTM cDNA synthesis kit
(Invitrogen) according to the manufacturer's protocol.
RT reactions were conducted in a DNA Thermal
Cycler 480 (Perkin Elmer) at 25oC for 10 min, 42oC for
60 min and 85oC for 5 min. The cDNA was then stored
at 20oC until use.
Quantitative real-time PCR
Real-time PCR for the analyses of iNOS, TNF-, IL1 and IFN mRNA levels were performed in a RotorGene Q (Qiagen). The primer sets for real-time PCR
(Table I) were designed using Primer-Quest (Integrated
DNA Technologies) and synthesized from Bioneer.
QuantiTect SYBR Green PCR kit was purchased from
Qiagen. The reaction mixture consisted of 2 L of
cDNA template, 10 L of SYBR Green PCR master
mix and 10 pmol of primers in a total volume of 20 L.
The cDNA was denatured at 95oC for 10 min, followed
by 45 cycles of PCR at 95oC for 10 sec, 60oC for 15 sec
and 72oC for 20 sec. Data acquisition and analysis of
real-time PCR were performed using the Rotor-Gene
Q series software (version 1.7). The Delta-delta Ct
method was used to calculate the relative quantitation
of each target gene normalized with -actin level in
each individual sample.
Western blot analysis
Cells were washed with cold Tris-buffered saline

Anti-inflammatory Effect of Visnagin

Table I. Primer sequences for real-time PCR

Gene

Primer sequence (5' - 3')

iNOS

Fa
Rb

cagctgggctgtacaaacctt
cattggaagtgaagcgtttcg

TNF-

F
R

catcttctcaaaattcgagtgacaa
tgggagtagacaaggtacaaccc

IFN

F
R

atctggaggaactggcaaaa
tgagtccattgaatgcttgg

IL-1

F
R

aagggctgcttccaaacctttgac
tgcctgaagctcttgttgatgtgc

COX-2

F
R

ttcaaaagaagtgctggaaaaggt
gatcatctctacctgagtgtcttt

MCP-1

F
R

cttctgggcctgctgttca
ccagcctactcattgggatca

KC-1

F
R

cttgaaggtgttgccctc
tggggacaccttttagcatc

IL-6

F
R

gaggataccactcccaacagacc
aagtgcatcatcgttgttcataca

IL-10

F
R

ggttgccaagccttatcgga
acctgctccactgccttgct

-actin

F
R

agagggaaatcgtgcgtgac
caatagtgacctggccgt

Forward sequence.
Reverse sequence.
KC, mouse GRO-, a mouse CC chemokine with highest
sequence identity to human GROs and interleukin-8; MCP-1,
monocyte chemoattractant protein-1, a CXC chemokine;
COX-2, cyclooxygenase-2.
b

(TBS; 20 mM Trizma base and 137 mM NaCl, pH 7.5)

and lysed in 1 SDS sample loading buffer (62.5 mM
Trizma base, 2% w/v SDS, 10% glycerol). Following
sonication and centrifugation at 15,000 g for 5 min,
the supernatant was used for detection of iNOS protein. The sample protein concentrations were determined using the detergent-compatible protein assay reagent (Bio-Rad), with bovine serum albumin (BSA) as
the standard. Samples were boiled for 5 min in a 0.1
volume of 10% -mercaptoethanol and 0.5% bromophenol blue mix. Sixty micrograms of total cellular
protein was resolved by electrophoresis on 8% polyacrylamide gels, electro-transferred to a PVDF membrane (Amersham Pharmacia) and blocked with TBST
(10 mM Trizma base (pH 7.4), 150 mM NaCl, and 1%
Tween 20) with 5% skim milk. Following incubation
with antisera against iNOS and -actin (Santacruz
biotech) for 2 h at room temperature, the membranes
were washed with TBST and then incubated with
horseradish peroxidase conjugated anti-rabbit IgG for
1 h. The membranes were autoradiographed by using
ECL-plus (Amersham Pharmacia) after washing with

1845

TBST buffer.

Statistical analysis
All values shown in the figures are expressed as the
mean S.D. obtained from at least three independent
experiments. Statistical analysis was conducted by
one-way analysis of variance (ANOVA) with Tukey's
post-hoc test using GraphPad Prism version 4.03 for
Windows (GraphPad Software). P < 0.05 was considered to indicate statistical significance.

RESULTS
Visnagin inhibits iNOS expression and NO production in LPS-stimulated BV-2 cells
In this study, we first examined the effects of visnagin
on LPS-induced iNOS gene expression and NO production in BV-2 cells. Visnagin significantly inhibited
LPS-induced NO production in a dose-dependent manner (Fig. 1C). LPS-induced expression of iNOS mRNA
(Fig. 1D) and protein level (Fig. 1E and F) were also
significantly attenuated by visnagin. To examine
whether the inhibitory effect of visnagin on iNOS induction resulted from toxicity, cell viability was measured using a CCK-8 kit at 24 h after treatment. Data
showed visnagin had no effect on cell viability up to a
concentration of 100 M (Fig. 1B). These results show
that visnagin has an inhibitory effect on iNOS induction without cell toxicity in microglial cells.
Visnagin inhibits expression of pro-inflammatory cytokines in LPS-stimulated BV-2 cells
We investigated the effect of visnagin on the expression of pro-inflammatory cytokines, such as TNF-,
IL-1 and IFN. LPS-induced expressions of TNF-,
IL-1 and IFN were significantly inhibited by visnagin
(100 M) at 6 h (Fig. 2). In addition, their release from
media was also attenuated in a dose-dependent manner
at 24 h after stimulation (Fig. 3). To confirm the antiinflammatory effect of visnagin, we further investigated the effect of visnagin on the expression of other inflammatory related genes. As shown in Table II, LPS
caused an induction of COX-2, MCP-1, KC, and IL-6
mRNA and visnagin significantly attenuated LPSinduced MCP-1 and IL-6 mRNA levels, but visnagin
had no effect on LPS-induced COX-2 mRNA (Table II)
and protein (data not shown) levels. Interestingly, stimulation with visnagin and LPS significantly increased expression of IL-10 anti-inflammatory cytokine,
compared to the LPS-treated group (Table II). Taken
together, these results indicate that visnagin may
reduce the expression of pro-inflammatory cytokines
and chemokines and induce the expression of anti-

1846

J.-K. Lee et al.

Fig. 1. Effect of visnagin on the expression of iNOS and production of NO in LPS-stimulated BV-2 cells. (A) Chemical
structure of visnagin. (B) Cell viability assay using CCK-8 kit was examined at 24 h following treatment with visnagin (0,
5, 10, 25, 50 and 100 M). Cells were pretreated with visnagin for 0.5 h prior to LPS (500 ng/mL) treatment. NO production
from media at 24 h (C) and iNOS mRNA level at 6 h (D) and iNOS protein level at 24 h (E) were determined after LPS
stimulation. Expression of iNOS protein was quantified using Multi Gauge software (Fujifilm Life Science) from Western
blot bands (F). Data are represented as mean S.D. from three independent experiments (***p < 0.001, vehicle vs LPStreated group; +p < 0.05, ++p < 0.01, +++p < 0.001, LPS vs LPS plus visnagin-treated group).

inflammatory cytokines.

NF-B dependent pathways.

Visnagin inhibits activation of AP-1 and NFB in LPS-stimulated BV-2 cells

AP-1 and NF-B are well-known as TFs which influence expression of inflammatory related genes, such
as iNOS, TNF-, IL-1 and IFN. We therefore examined the effect of visnagin on LPS-induced activation
of AP-1 and NF-B in cells transiently transfected
with their luciferase reporters. As shown in Fig. 4,
LPS-induced AP-1 (Fig. 4A) and NF-B (Fig. 4B); luciferase activities were inhibited by visnagin in a
dose-dependent manner. These results indicate that
visnagin-mediated inhibition of iNOS, TNF-, IL-1
and IFN expression might be mediated via AP-1 and

DISCUSSION
In the present study, we for the first time, have investigated the effect of visnagin on the expression of
inflammation related genes in LPS-stimulated microglial cells. Stimulation with LPS can induce the expression of iNOS, COX-2, pro-inflammatory cytokines
and chemokines in microglial cells (Saud et al., 2005;
Thompson et al., 2008; Kao et al., 2010; Lu et al., 2010).
Several lines of evidence suggest that microglial cells
can secrete pro-inflammatory cytokines, such as IL-1,
IL-6, IFN and TNF-, which in turn, can act on these
cells in an autocrine manner (Graeber and Streit,

Anti-inflammatory Effect of Visnagin

Fig. 2. Effect of visnagin on the mRNA expression of TNF, IL-1 and IFN in LPS-stimulated BV-2 cells. Cells were
pretreated with visnagin (100 M) for 0.5 h prior to LPS
(500 ng/mL) treatment. Total RNA was isolated after 6 h in
LPS-treated BV-2 cells. The mRNA levels for TNF- (A), IL1 (B) and IFN (C) were measured by quantitative realtime PCR. The gene expression was normalized with -actin
gene expression. Data are represented as mean S.D. from
three independent experiments (**p < 0.01, ***p < 0.001,
vehicle vs LPS-treated group; +p < 0.05, ++p < 0.01, LPS vs
LPS plus visnagin-treated group).

2010). IFN, however, is considered to be produced

exclusively by lymphoid cells. In accordance with our
results, microglial cells produced IFN in response to
IL-12, IL-18, and LPS (De Simone et al., 1998; Kawanokuchi et al., 2006). Thus, IFN may play an important role in the initiation of neural-immune cell
interaction in CNS pathophysiologic conditions.
Our results show that visnagin inhibited LPS-in-

1847

Fig. 3. Effect of visnagin on the release of TNF-, IL-1 and

IFN in LPS-stimulated BV-2 cells. Cells were pretreated
with visnagin (0, 50 and 100 M) for 0.5 h prior to LPS (500
ng/mL) treatment. Released TNF- (A), IL-1 (B) and IFN
(C) protein levels were measured using ELISA kits from
cultured media after 24 h stimulation. Data are represented
as mean S.D. from three independent experiments (***p <
0.001, vehicle vs LPS-treated group; +p < 0.05, +++p < 0.001,
LPS vs LPS plus visnagin-treated group).

duced iNOS expression and NO production (Fig. 1).

Additionally, visnagin attenuated LPS-induced gene
expression and release of pro-inflammatory cytokines,
such as TNF-, IL-1, IFN and IL-6, as well as CC chemokine - MCP-1 (Fig. 2, Fig. 3 and Table II). Although
several lines of evidence show that polyphenols and
flavonoids, such as quercetin, resveratrol and curcumin, extracted from natural products, have anti-inflammatory effects in neurological disorders (CandelarioJalil et al., 2007; Aquilano et al., 2008; Ray and Lahiri,

1848

J.-K. Lee et al.

Table II. Relative values of mRNA expression

Gene
COX-2
MCP-1
KC
IL-6
IL-10

Group
Vehicle

LPS (500 ng/mL)

Visnagin (100 M)

1 0.34
1 0.31
1 0.41
1 0.87
1 0.72

16.43 1.12***
19.10 2.13***
15.74 0.92***
15.65 1.71***
11.71 0.59***

0.86 0.96
1.55 0.54
0.86 1.39
1.25 0.81
1.03 0.24

Visnagin + LPS
5.48 1.41NS
4.48 0.42++
4.13 0.62NS
7.09 1.91+++
2.86 0.64#

Values are expressed as mean S.D. (n = 3, independent experiments).

***p < 0.001 vs vehicle-treated group.
NS
Not Significant, ++p < 0.01, +++p < 0.001 vs LPS-treated group.
#
p < 0.05 vs LPS-treated group.

Fig. 4. Effect of visnagin on the activation of AP-1 and NFB transcription factors in LPS-stimulated BV-2 cells. At 24
h after transient transfection of cells with AP-1 (A) and NFB (B) luciferase reporter vectors, the cells were pretreated
with visnagin (0, 50 and 100 M) for 0.5 h prior to stimulation with LPS (500 ng/mL). The cellular luciferase activity
was measured as described in Materials and Methods. Data
are represented as mean S.D. from three independent
experiments (***p < 0.001, vehicle vs LPS-treated group; ++p
< 0.01, +++p < 0.001, LPS vs LPS plus visnagin-treated group).

2009; Zhang et al., 2010), an anti-inflammatory effect

of visnagin had not been established. Recently, our
laboratory also found an neuroprotective and antiinflammatory effect of visnagin on kainic acid (KA)induced neuronal cell death in hippocampus. Visnagin
attenuated KA-induced mRNA expressions of TNF-,
IL-1, and IL-6 and OX-42 immunoreactivity (unpub-

lished data). Taken together, our results, for the first

time, suggest the anti-inflammatory effect of visnagin
on LPS-stimulated microglial cells.
Our unpublished data also show an inhibitory effect
of visnagin on KA-induced COX-2 mRNA expression
in hippocampus. However, in the present study, visnagin had no effect on LPS-induced COX-2 expression of
mRNA (Table II) and protein (data not shown) levels.
Although we have to further examine the effect of
visnagin on production of PGE2, visnagin may inhibit
the enzyme activity rather than the gene expression of
COX-2. Additionally, the pharmacokinetic effect of
visnagin on COX-2 expression may differ in vivo and
in vitro. Also, visnagin has no effect on LPS-stimulated mRNA expression of KC - a CXC chemokine.
Accordingly, our results indicate that visnagin can
selectively inhibit LPS-induced gene expression.
Anti-inflammatory cytokines such as IL-10 can produce anti-inflammatory effects by regulating expression of pro-inflammatory cytokines and chemokines
(Strle et al., 2001; Saraiva and O'Garra, 2010). Interestingly, stimulation with LPS plus visnagin caused a
synergistic increase of IL-10, an anti-inflammatory
cytokine, compared to LPS or visnagin alone-treated
groups (Table II). Although further studies will be
necessary to examine the molecular mechanism, an
anti-inflammatory effect of visnagin may be caused by
the involvement of IL-10. In accordance with our
suggestion, Jung et al. (2008) suggested that the IL-10
elevating activity of decursinol could be potentially
effective in treatment of sepsis (Jung et al., 2008). Our
results indicate that visnagin can produce an antiinflammatory effect by inducing expression of IL-10.
AP-1 and NF-B are well known as important TFs
for the expression of several inflammatory-related genes
in microglial cells. AP-1 and NF-B binding sites are
commonly located in the promoter region of iNOS,
TNF-, IL-1, IFN and IL-6 genes and are required
for induction by LPS or cytokines (Chu et al., 1998;

Anti-inflammatory Effect of Visnagin

Perez et al., 1999; Udalova and Kwiatkowski, 2001;

Wang et al., 2003; Faggioli et al., 2004). Thus, we
examined the involvement of TFs in LPS-stimulated
microglial cells using the AP-1 and NF-B cis-acting
element luciferase vectors. Our results show that visnagin significantly attenuated the elevated luciferase
activities (Fig. 4). In accordance with our data, most
compounds which produce anti-inflammatory effects
inhibit AP-1 and NF-B activation (Chen et al., 2005;
Lee et al., 2005; Bae et al., 2006; Jang et al., 2008;
Yang et al., 2009; Park et al., 2010). Our present results
indicate that visnagin can also inhibit activation of
AP-1 and NF-B in LPS-stimulated microglial cells.
In summary, we herein for the first time suggest
that visnagin attenuates LPS-induced expression of
inflammatory genes, such as iNOS, TNF-, IL-1,
IFN and IL-6 through the inhibition of AP-1 and NFB dependent pathways, and induces production of
anti-inflammatory cytokines such as IL-10. Although
further studies will be necessary to reveal the exact
molecular mechanism of the anti-inflammatory activity, this beneficial effect of visnagin can be applied to
reduce production of inflammatory cytokines in activated microglial cells in several inflammatory related
CNS diseases.

ACKNOWLEDGEMENTS
This research was supported by Priority Research
Centers Program (NRF, 2009-0094072), Basic Science
Research Program (NRF, 2010-0009147), The Regional Research Universities Program/Medical & BioMaterials Research Center, ad a grant (2010K000814)
from Brain Research Center of the 21st Century
Frontier Research Program funded by the MEST, the
Republic of Korea.

REFERENCES
Aquilano, K., Baldelli, S., Rotilio, G., and Ciriolo, M. R., Role
of nitric oxide synthases in Parkinson's disease: a review
on the antioxidant and anti-inflammatory activity of
polyphenols. Neurochem. Res., 33, 2416-2426 (2008).
Bae, E. A., Kim, E. J., Park, J. S., Kim, H. S., Ryu, J. H., and
Kim, D. H., Ginsenosides Rg3 and Rh2 inhibit the activation of AP-1 and protein kinase A pathway in lipopolysaccharide/interferon-gamma-stimulated BV-2 microglial
cells. Planta Med., 72, 627-633 (2006).
Candelario-Jalil, E., De Oliveira, A. C., Graf, S., Bhatia, H.
S., Hull, M., Munoz, E., and Fiebich, B. L., Resveratrol
potently reduces prostaglandin E2 production and free
radical formation in lipopolysaccharide-activated primary
rat microglia. J. Neuroinflammation, 4, 25 (2007).
Chen, J. C., Ho, F. M., Pei-Dawn Lee, C., Chen, C. P., Jeng,

1849

K. C., Hsu, H. B., Lee, S. T., Wen Tung, W., and Lin, W.
W., Inhibition of iNOS gene expression by quercetin is
mediated by the inhibition of IkappaB kinase, nuclear factorkappa B and STAT1, and depends on heme oxygenase-1
induction in mouse BV-2 microglia. Eur. J. Pharmacol.,
521, 9-20 (2005).
Chu, S. C., Marks-Konczalik, J., Wu, H. P., Banks, T. C., and
Moss, J., Analysis of the cytokine-stimulated human inducible nitric oxide synthase (iNOS) gene: characterization of differences between human and mouse iNOS promoters. Biochem. Biophys. Res. Commun., 248, 871-878
(1998).
De Simone, R., Levi, G., and Aloisi, F., Interferon gamma
gene expression in rat central nervous system glial cells.
Cytokine, 10, 418-422 (1998).
Duarte, J., Perez-Vizcaino, F., Torres, A. I., Zarzuelo, A.,
Jimenez, J., and Tamargo, J., Vasodilator effects of visnagin
in isolated rat vascular smooth muscle. Eur. J. Pharmacol.,
286, 115-122 (1995).
Duarte, J., Torres, A. I., and Zarzuelo, A., Cardiovascular
effects of visnagin on rats. Planta Med., 66, 35-39 (2000).
Faggioli, L., Costanzo, C., Donadelli, M., and Palmieri, M.,
Activation of the Interleukin-6 promoter by a dominant
negative mutant of c-Jun. Biochim. Biophys. Acta, 1692,
17-24 (2004).
Graeber, M. B. and Streit, W. J., Microglia: biology and
pathology. Acta Neuropathol., 119, 89-105 (2010).
Jang, S., Kelley, K. W., and Johnson, R. W., Luteolin reduces
IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1. Proc. Natl. Acad. Sci.
U.S.A., 105, 7534-7539 (2008).
Jung, J. S., Yan, J. J., and Song, D. K., Protective effect of
decursinol on mouse models of sepsis: enhancement of
interleukin-10. Korean J. Physiol. Pharmacol., 12, 79-81
(2008).
Kao, T. K., Ou, Y. C., Raung, S. L., Lai, C. Y., Liao, S. L., and
Chen, C. J., Inhibition of nitric oxide production by quercetin in endotoxin/cytokine-stimulated microglia. Life Sci.,
86, 315-321 (2010).
Kaul, B. and Staba, E. J., Visnagin: biosynthesis and isolation from Ammi visnagi suspension cultures. Science,
150, 1731-1732 (1965).
Kawanokuchi, J., Mizuno, T., Takeuchi, H., Kato, H., Wang,
J., Mitsuma, N., and Suzumura, A., Production of interferon-gamma by microglia. Mult. Scler., 12, 558-564 (2006).
Lee, C. J., Lee, S. S., Chen, S. C., Ho, F. M., and Lin, W. W.,
Oregonin inhibits lipopolysaccharide-induced iNOS gene
transcription and upregulates HO-1 expression in macrophages and microglia. Br. J. Pharmacol., 146, 378-388
(2005).
Lu, D. Y., Tang, C. H., Chen, Y. H., and Wei, I. H., Berberine
suppresses neuroinflammatory responses through AMPactivated protein kinase activation in BV-2 microglia. J.
Cell. Biochem., 110, 697-705 (2010).
Park, S. H., Kang, J. S., Yoon, Y. D., Lee, K., Kim, K. J., Lee,
K. H., Lee, C. W., Moon, E. Y., Han, S. B., Kim, B. H., Kim,

1850

H. M., and Park, S. K., Glabridin inhibits lipopolysaccharide-induced activation of a microglial cell line, BV-2, by
blocking NF-kappaB and AP-1. Phytother. Res., 24 Suppl
1, S29-S34 (2010).
Perez, R. L., Ritzenthaler, J. D., and Roman, J., Transcriptional regulation of the interleukin-1beta promoter via
fibrinogen engagement of the CD18 integrin receptor. Am.
J. Respir. Cell Mol. Biol., 20, 1059-1066 (1999).
Rauwald, H. W., Brehm, O., and Odenthal, K. P., The
involvement of a Ca2+ channel blocking mode of action in
the pharmacology of Ammi visnaga fruits. Planta Med.,
60, 101-105 (1994).
Ray, B. and Lahiri, D. K., Neuroinflammation in Alzheimer's
disease: different molecular targets and potential therapeutic agents including curcumin. Curr. Opin. Pharmacol.,
9, 434-444 (2009).
Saraiva, M. and O'garra, A., The regulation of IL-10 production by immune cells. Nat. Rev. Immunol., 10, 170-181
(2010).
Saud, K., Herrera-Molina, R., and Von Bernhardi, R., Proand anti-inflammatory cytokines regulate the ERK pathway: implication of the timing for the activation of microglial cells. Neurotox. Res., 8, 277-287 (2005).
Strle, K., Zhou, J. H., Shen, W. H., Broussard, S. R., Johnson,
R. W., Freund, G. G., Dantzer, R., and Kelley, K. W.,
Interleukin-10 in the brain. Crit. Rev. Immunol., 21, 427449 (2001).
Thompson, W. L., Karpus, W. J., and Van Eldik, L. J., MCP1-deficient mice show reduced neuroinflammatory responses
and increased peripheral inflammatory responses to
peripheral endotoxin insult. J. Neuroinflammation, 5, 35
(2008).
Tuttolomondo, A., Di Raimondo, D., Di Sciacca, R., Pinto, A.,

J.-K. Lee et al.

and Licata, G., Inflammatory cytokines in acute ischemic

stroke. Curr. Pharm. Des., 14, 3574-3589 (2008).
Tzeng, S. F., Hsiao, H. Y., and Mak, O. T., Prostaglandins
and cyclooxygenases in glial cells during brain inflammation. Curr. Drug Targets Inflamm. Allergy, 4, 335-340
(2005).
Ubeda, A., Tejerina, T., Tamargo, J., and Villar, A., Effects of
khellin on contractile responses and 45Ca2+ movements
in rat isolated aorta. J. Pharm. Pharmacol., 43, 46-48
(1991).
Udalova, I. A. and Kwiatkowski, D., Interaction of AP-1 with
a cluster of NF-kappa B binding elements in the human
TNF promoter region. Biochem. Biophys. Res. Commun.,
289, 25-33 (2001).
Vanachayangkul, P., Byer, K., Khan, S., and Butterweck, V.,
An aqueous extract of Ammi visnaga fruits and its constituents khellin and visnagin prevent cell damage caused
by oxalate in renal epithelial cells. Phytomedicine, 17,
653-658 (2010).
Wang, J., Barke, R. A., Charboneau, R., Loh, H. H., and Roy,
S., Morphine negatively regulates interferon-gamma promoter activity in activated murine T cells through two
distinct cyclic AMP-dependent pathways. J. Biol. Chem.,
278, 37622-37631 (2003).
Yang, X., Du, L., Tang, X., Jung, S. Y., Zheng, B., Soh, B. Y.,
Kim, S. Y., Gu, Q., and Park, H., Brevicompanine E reduces
lipopolysaccharide-induced production of proinflammatory cytokines and enzymes in microglia by inhibiting
activation of activator protein-1 and nuclear factorkappaB. J. Neuroimmunol., 216, 32-38 (2009).
Zhang, F., Liu, J., and Shi, J. S., Anti-inflammatory activities
of resveratrol in the brain: role of resveratrol in microglial
activation. Eur. J. Pharmacol., 636, 1-7 (2010).