Você está na página 1de 3

Disciplina: Genmica Nutricional

Responsvel: Profa. Dra. Renata de Azevedo Canevari


ESTRUTURA, COMPACTAO E DUPLICAO DO MATERIAL GENTICO
LISTA DE EXERCCIOS

1. Qual a composio qumica do monmero de DNA?


2. Qual a composio qumica do monmero de RNA?
3. Quais so as diferenas entre o DNA e o RNA?
4. Quais as bases nitrogenadas encontradas no RNA e no DNA?
5. Quais so as bases pricas (ou purinas) e quais as pirimdicas (ou pirimidinas)?
6. Baseado na complementaridade e no antiparalelismo da molcula de DNA, desenhe a fita
complementar do DNA: 5-GTACCATGCTAGGGTCTAGATATTCTGATAGCT-3.
7. Um determinado organismo possui 29% de bases de timina. Qual porcentagem de bases deste
DNA de resduos de citosina? Explique.
8. Quando separadas, as duas fitas de uma dupla-hlice so idnticas? Explique.
9. Qual a extremidade onde monmeros so adicionados?
10. Quais os 3 tipos de conformao de DNA existem? Quais os naturais? Em que condies a
conformao artificial encontrada?
11. Qual a importncia da complementaridade da molcula de DNA durante a replicao ?
12. Porque cada molcula de DNA em cromossomos eucariotos contm mltiplas origens de
replicao?
13. Muitas origens de replicao foram caracterizadas por conter seqncias ricas em A:T. Esses
ncleos ricos em A:T tm algum significado funcional? Qual?
14. Qual a extremidade onde monmeros so adicionados?
15. Esquematize uma forquilha de replicao e indique qual fita de DNA ser usada como molde
para a sntese contnua e para a sntese descontnua das fitas filhas.
16. Coloque as protenas e enzimas em ordem temporal de atuao no processo de replicao.
DNA Pol I, ligase, fragmento de Okazaki, DNA Pol III, primer, helicase, primase, exonuclease
Avenida Shishima Hifumi, 2911 - Urbanova CEP 12244-000 PABX(012) 3947-1000 FAX(012) 3949-1334
Caixa Postal 8088 So Jos Campos-SP http://www.univap.br/

17. Considerando a seqncia abaixo, e o sentido de polimerizao da esquerda para direita,


aponte qual fita ser molde para a sntese da fita contnua e qual ser da descontnua.
5 AACTGGTCGATGCTATTGATCGATGCTAG 3
3 TTGACCAGCTACGATAACTAGCTACGATC 5
18. No DNA de um organismo, 18% das bases nitrogenadas so formadas por citosina. Quais so as
porcentagens das outras bases desse DNA? Justifique.
19. Quais so as organelas citoplasmticas que contm DNA. Justifique.
20. Se considerarmos o total de bases nitrogenadas do DNA igual a 100, se nela existem 15% de
timina, qual a porcentagem das outras bases nitrogenadas.
21. Qual a poro do DNA que contm a informao para a sntese das enzimas?
22. Como so denominadas as modificaes produzidas pelo meio ambiente, que no chegam a
atingir os gametas, no sendo por isso transmissveis.
23. Defina o que um cromossomo e descreva o que difere um cromossomo de uma cromatina?
24. Qual a composio qumica da cromatina nos cromossomos eucariticos?
25. O que so histonas e cite duas funes.
26. Quais so as principais caractersticas das protenas histnicas e no histnicas?
27. Descreva a estrutura da unidade fundamental de compactao. Esquematize.
28. Caracterize os quatro nveis de compactao da cromatina.
29. Em qual fase do ciclo celular a cromatina atinge seu grau de condensao mximo?
30. Diferencie eucromatina de heterocromatina quanto estrutura e funo.
31. O que significa o termo Compactao do material gentico?
32. Nosso maior autossomo tem, em metfase, cerca de 0,01 mm de comprimento, contendo uma
molcula de DNA de 7,2 cm. Como isso possvel?
33. . Qual o papel da histona H1 na fibra nucleossmica de 110 angstrons?
34.Quais as vantagens da compactao do DNA ?
35. Porque o grau mximo de compactao do DNA ocorre no momento da diviso celular?

Avenida Shishima Hifumi, 2911 - Urbanova CEP 12244-000 PABX(012) 3947-1000 FAX(012) 3949-1334
Caixa Postal 8088 So Jos Campos-SP http://www.univap.br/

Bibliografia
GRIFFITHS, A.J.F; GELBART, W.M.; MILLER, J.H.; LEWONTIN, R.C. Uma Introduo Gentica.
Editora Guanabara koogan, 9. ed. Rio de janeiro, 2009.
PIERCE, B. A. Gentica: um enfoque conceitual. Ed Guanabara Koogan, Rio de Janeiro. 2004.
NUSSBAUM, R. L., McINNES, R. R., WILLARD, H. F. Thompson & Thompson. Gentica Mdica. 6.
ed Rio de Janeiro: Guanabara-Koogan, 2002.

Avenida Shishima Hifumi, 2911 - Urbanova CEP 12244-000 PABX(012) 3947-1000 FAX(012) 3949-1334
Caixa Postal 8088 So Jos Campos-SP http://www.univap.br/