Escolar Documentos
Profissional Documentos
Cultura Documentos
Universidad de Navarra
Facultad de Ciencias
Universidad de Navarra
Facultad de Ciencias
A mis padres
Al amor de mi vida
A mis directores de tesis
AGRADECIMIENTOS
Esta tesis doctoral ha podido realizarse gracias a la participacin y el apoyo de
muchas personas. En este apartado intentar dejar constancia de lo que han aportado
cada una de ellas, esperando no dejarme a nadie en el tintero.
Para empezar, querra agradecer al Departamento de Bioqumica de la Clnica
Universidad de Navarra el haberme dado la oportunidad de realizar una tesis doctoral,
compatibilizando mi formacin como Biloga Interna Residente en Bioqumica Clnica
con la formacin investigadora. Del mismo modo, me gustara agradecer al grupo de
Terapia Gnica y Hepatologa del Centro de Investigacin Mdica Aplicada el
acogerme dentro de sus proyectos de investigacin, como una parte ms del equipo.
Dentro de este grupo me gustara resaltar a mis compaeros de experimentacin: Carlos
Alfaro y Lorena Erro, sin los que no habra sido capaz de realizar todo este trabajo.
Tambin me gustara mencionar al Grupo de Terapia Celular de la Clnica Universidad
de Navarra, que no slo me han enseado a trabajar en entorno GMP, sino que me han
permitido llevar a cabo la preparacin de las vacunas de clulas dendrticas presentadas
en la primera de las publicaciones.
Pasando al lado ms personal quisiera reconocer el valor que ha tenido para m el
apoyo de mis compaeros de residencia y amigos, en especial Sara Martnez, con quien
he pasado muy buenos momentos durante estos aos de aprendizaje y Alicia de Lzar
que me ha acompaado y cuidado en estos ltimos duros meses de escritura. No puedo
olvidar el papel de mi familia y de mi marido, que han estado a mi lado en todo
momento, aconsejndome y escuchndome aunque no entendieran muy bien todo
este gran mundo de las clulas dendrticas.
Por ltimo, pero no menos importante, quiero agradecer profundamente el trabajo
que han desarrollado mi director y codirector de tesis as como las horas que me han
dedicado durante todos estos aos. Esto es fruto de ellos.
NDICE
11
NDICE
11
1- INTRODUCCIN
17
19
19
20
21
1.2.1.1-
22
1.2.1.2-
22
23
24
1.2.1.3-
24
1.2.1.4-
24
1.2.1.5-
25
1.2.1.6-
26
1.2.2-
26
28
29
1.4.1-
VEGF
29
1.4.2-
30
1.4.3-
31
1.4.4-
VEGF y cncer
32
1.4.4.1-
1.4.5-
32
33
33
34
35
13
1.5.1- Quimioquinas
35
36
37
42
43
1.6.1- Generalidades
43
46
48
49
49
50
2- OBJETIVOS
53
57
3.1-
3.2-
59
14
97
3.4-
115
3.5-
143
167
203
5- CONCLUSIONES
209
6- BIBLIOGRAFA GENERAL
213
7- LISTA DE ABREVIATURAS
239
15
1- INTRODUCCIN__________________________________
17
19
en el ganglio, se postula que captan antgeno que accede al ganglio de forma soluble o que los
antgenos son transportados por otra estirpe celular que migra desde los tejidos perifricos a los
rganos linfoides. As pues, las CD mieloides CD141+ se caracterizan por una alta capacidad
para capturar antgenos exgenos y presentarlos asociados a molculas presentadoras del
Complejo Mayor de Histocompatibilidad de clase I (CMH I). Este fenmeno es conocido como
presentacin antignica intermediada o cruzada (crosspresentation) (Jongbloed et al. 2010).
Adems, esta poblacin expresa en su superficie celular el receptor de quimioquinas XCR1
(necesario para responder al estmulo de XCL1, secretado por las clulas natural killer (NK) y
linfocitos T CD8+ activados) y la molcula de adhesin Necl2 [protena de unin a la molcula
asociada a linfocitos T restringida a clase I (CRTAM), que se expresa principalmente en las
clulas NK, NK-T y linfocitos T CD8+]. As, las CD mieloides CD141+ estn muy bien
equipadas para la generacin de LTC en la inmunidad celular (Palucka et al. 2010). Las CD
mieloides CD1c tambin pueden presentar de forma cruzada antgenos y secretar IL-12
(Jongbloed et al. 2010; Poulin et al. 2010).
B)
20
21
Existen mltiples evidencias experimentales que indican que estos linfocitos T reguladores
estn encargados de suprimir o inhibir la actividad de los linfocitos T activados (Roncarolo et
al. 2001; Steinman 2003) .
Las CD se encuentran en el organismo en dos estadios diferentes: por un lado estn las
CD inmaduras, que presentan una elevada capacidad fagoctica pero un escaso potencial
activador de linfocitos T, y las CD maduras, que tienen muy desarrollada su capacidad para
migrar desde el foco de lesin o inflamacin a los rganos linfoides secundarios. Una vez all
son capaces de inducir una respuesta celular antgeno-especfica por parte de linfocitos T. Se
piensa que mientras las CD inmaduras son tolerognicas, las maduras son, por el contrario,
inmunognicas (Mahnke et al. 2002; Steinman et al. 2003). Por otra parte, existen estadios
intermedios entre las CD inmaduras y maduras, en los cuales podran no ser totalmente
funcionales y por tanto inducir tolerancia. La tolerancia perifrica que inducen est mediada por
deleccin clonal o por induccin de anergia de clulas T (Mahnke et al. 2002).
22
Una vacuna de CD se define como aquella formada por CD cargadas con un antgeno de
inters, por ejemplo un antgeno asociado al tumor (Figdor et al. 2004). Tras su administracin
a los pacientes, la vacuna est pensada para inducir una respuesta celular T especfica frente a
los antgenos del tumor presentados por las CD. El primer estudio clnico de una vacuna de CD
fue publicado en Nature Medicine en el ao 1986 (Hsu et al. 1996). El grupo de R. Levy en la
Universidad de Stanford describi de forma pionera una pauta de vacunacin repetida en cuatro
pacientes con linfoma no-Hodgkin utilizando CD de sangre perifrica y la molcula de
inmunoglobulina producida por el linfoma de cada paciente con el objetivo de inducir
inmunidad antiidiotpica. Desde entonces, la vacunacin con CD se ha aplicado en mltiples
ensayos clnicos en pacientes con neoplasias malignas y en pacientes con infecciones virales
crnicas (por ejemplo VIH) (Miro et al. 2004; Banchereau y Palucka 2005). Se ha demostrado
la capacidad inmunizante de las CD y su seguridad en voluntarios sanos (Dhodapkar y
Bhardwaj 2000).
23
24
necesidad de obtener CD maduras que migraran a ganglio (para lo que necesitan expresar
CCR7, que es inducido por PGE2), pero su empleo en la mezcla de estmulos de maduracin ha
sido criticado debido a la capacidad de la PGE2 para favorecer una respuesta de tipo Th2 en el
microambiente tumoral. Esto es as debido a que la PGE2 promueve la secrecin de IL-10 por
las CD (Morelli y Thomson 2003). Debido a la necesidad de una mezcla madurativa eficaz,
Kaliski y col desarrollaron una mezcla, consistente en el empleo de 5 estmulos: TNF-, IL-1,
poly I:C, IFN- e IFN- (Mailliard et al. 2004), que efectivamente maduraba CD con una gran
capacidad inmunognica como inductoras de la respuesta de LTC. Adems posean una elevada
capacidad migratoria in vitro y una intensa produccin de IL-12p70. El poly I:C acta como un
anlogo de ARN viral de doble cadena, estimulando la va TLR3 en los endosomas y RIG-1 en
el citoplasma (Schulz et al. 2005).
Hoy da contina sin haber consenso sobre cual es la mejor combinacin de citoquinas
para madurar las CD. Nuestro grupo emplea para esos fines una mezcla madurativa que consta
de IFN-, TNF- y poly I:C, en grado GMP, obteniendo buenos resultados.
25
As pues, parece que podra ser til la combinacin de varias rutas de administracin de
las vacunas de CD en los pacientes con cncer a la hora de inducir una respuesta inmune
sistmica capaz de erradicar los focos tumorales existentes en el organismo (Adema et al. 2005).
Adems, la repeticin de inmunizaciones con las vacunas tambin parece un punto clave
(Ochsenbein et al. 1999; Tirapu et al. 2004). Sin embargo, por el momento no hay consenso en
los protocolos ni en el intervalo entre las dosis, ni en el nmero de repeticiones.
26
Aunque hoy da los datos de la eficacia en los ensayos clnicos en humanos son modestos,
se est trabajando en una mejora de los mismos mediante estrategias de inmunoterapia
combinada (Melero et al. 2007; Prez-Gracia et al. 2009).
27
28
1.4.1- VEGF
El VEGF es una glicoprotena homodimrica de 34-46 KDa, producida principalmente
por las clulas del estroma tumoral (Jain 2005) y las propias clulas tumorales. Acta
principalmente sobre clulas endoteliales vasculares y sus precursores, unindose a receptores
especficos con dominios sealizadores con actividad tirosina-quinasa (VEGFR-1 y VEGFR-2).
Esta interaccin activa rutas de transduccin de seales intracelulares, dando lugar a: (i)
proliferacin y migracin de clulas endoteliales vasculares; (ii) supervivencia de clulas
29
30
31
progenitores hematopoyticos CD34+ a travs del receptor VEGFR-1 e inhibe la activacin del
factor de trascripcin NF-B (Dikov et al. 2005), que est asociado a la maduracin de las CD.
Todos estos experimentos demostraron la conveniencia de bloquear al VEGF o a sus
receptores para mejorar la respuesta inmunitaria frente al cncer (Fricke et al. 2007). As,
cuando se emplean inhibidores de la angiognesis junto con inmunoterapia basada en vacunas
de CD, parece que el efecto antitumoral es ms pronunciado y duradero (Osada et al. 2008).
Se han desarrollado frmacos neutralizantes de la va de VEGF, que actan a nivel de la
propia molcula (Bevacizumab) o bien a nivel de la sealizacin intracelular (inhibiendo los
receptores tirosina-quinasas). Estos agentes son testados previamente tanto in vitro como in vivo
(Osada et al. 2008; Alfaro et al. 2009), para posteriormente ser incluidos en ensayos clnicos
con pacientes oncolgicos, demostrando su eficacia solamente cuando se combinan con
quimioterapia (Yang et al. 2003). Algunos autores buscan establecer terapias combinadas de
estos agentes con vacunas de CD (Alfaro et al. 2009).
Sin duda, la patologa en la que mejor se ha estudiado el papel del VEGF es el cncer,
donde desempea un papel decisivo en el desarrollo de la angiognesis tumoral (Ferrara y
Gerber 2001). La mayor parte de las clulas tumorales sobreexpresan VEGF. Estudios de
hibridacin in situ han demostrado la sobreexpresin del ARNm que codifica para VEGF en
muchos tumores humanos (Ferrara et al. 2003). A pesar de que las clulas tumorales son las
principales productoras de VEGF, el estroma asociado al tumor tambin proporciona una
importante cantidad de VEGF en condiciones de hipoxia (Ferrara et al. 2003; Jain 2005). Se ha
demostrado que la inactivacin del gen que codifica para VEGF suprime la angiognesis
tumoral en el modelo Rip-Tag (un modelo gentico bien establecido de insulinoma) (Inoue et al.
2002).
El gen que codifica para VEGF se expresa en una gran variedad de tumores
hematolgicos, como por ejemplo el mieloma mltiple, el linfoma de clulas T, la leucemia
linfoblstica aguda, el linfoma de Burkitt, el linfoma histioctico y la leucemia mieloctica
crnica (Gerber y Ferrara 2003). As mismo, sus receptores VEGFR-1 y VEGFR-2 se expresan
32
en las clulas de algunas lneas de leucemia, encontrndose con mayor frecuencia VEGFR-1
que VEGFR-2.
Otro tipo de tumores en los que se sobreexpresa el VEGF es en el carcinoma renal de
clulas claras (RCC). En esta patologa la sobreproduccin de VEGF viene determinada por una
alteracin en la expresin del gen supresor de tumores VHL. La consecuencia de la inactivacin
del gen VHL es la presencia de tumores muy vascularizados debido a la estimulacin aberrante
de la angiognesis inducida por el descontrol de la respuesta a hipoxia. Del mismo modo, esta
alteracin determina la produccin de VEGF en tumores vasculares de retina y
hemangioblastomas del sistema nervioso central (Lonser et al. 2003).
El VEGF acta conjuntamente con otras sustancias, como las angiopoyetinas y otros
factores de crecimiento, estimulando la formacin de nuevos vasos a partir de vasos
preexistentes, y permitiendo que el tumor reciba oxgeno y nutrientes. Estos mecanismos
tambin son cruciales en el proceso de metastatizacin tanto para la salida de clulas a partir del
tumor primario, como para el anidamiento en el rgano colonizado (Lee et al. 2010).
33
aprobado por la Food and Drug Administration (FDA) en febrero del 2004, en combinacin con
5-fluorouracilo intravenoso como primera lnea de tratamiento en pacientes con cncer de colon
y recto metastsico (CRC) (Cohen et al. 2007). Adems, Bevacizumab en combinacin con 5fluorouracilo y oxiplatino ha sido aprobado en junio del 2006 como segunda lnea de
tratamiento en pacientes con CRC avanzado o metastsico, que haban sido tratados
previamente con irinotecan y 5-fluorouracilo. Estudios posteriores han definido el beneficio de
su uso en carcinoma renal de clulas claras (de Gramont y Van Cutsem 2005; McDermott y
George 2010), en el cncer avanzado de pulmn de clulas no pequeas en combinacin con
otros agentes teraputicos (Cohen et al. 2007; Di Costanzo et al. 2008), as como en el cncer
de pncreas y cncer de mama (de Gramont y Van Cutsem 2005; Petrelli y Barni 2010).
34
Figura 1. Representacin esquemtica de las isoformas de VEGF y las interacciones con sus
receptores. Se sealan (en rojo) las dianas de los agentes antiangiognicos: Bevacizumab,
Sorafenib y Sunitinib. Abreviaturas: PGF, Factor de crecimiento de placenta; VEGF, Factor de
crecimiento endotelio-vascular; Y, tirosina.
35
Los efectos biolgicos de las quimioquinas se producen por la unin a receptores que
pertenecen a la superfamilia de receptores con siete dominios transmembrana tipo serpina o
rodopsina, la mayora de ellos acoplados a protenas G. Las quimioquinas muestran gran
redundancia en la utilizacin de sus receptores. Segn esto, varias quimioquinas pueden
acoplarse a un mismo receptor y una misma quimioquina puede unirse a varios receptores.
36
La transcripcin del gen que codifica para la IL-8 da lugar primeramente a una protena
de 99 aminocidos, que ser procesada a continuacin para dar la protena activa de 77
aminocidos en el caso de clulas que no pertenecen al sistema inmune, o de 72 aminocidos en
las clulas del sistema inmunitario (Waugh y Wilson 2008). As, la IL-8 est formada por la
unin no covalente de dos monmeros de 72 aminocidos cada uno, formando un homodmero
(Figura 2). Las dos unidades del dmero forman una estructura de 6 lminas- dispuestas de
forma antiparalela. La estructura secundaria de la IL-8 tiene similitud con la que se encuentra en
la estructura cristalina de protenas relacionadas con el factor 4 plaquetario y otras
quimioquinas.
Los receptores funcionales identificados para la IL-8 son CXCR1 y CXCR2, unidos en su
regiones citoplasmticas/transmembrana a protena G. Ambos receptores presentan una gran
37
La IL-8 es secretada por diferentes tipos celulares, siendo los principales productores los
macrfagos. Otros productores importantes de IL-8 son las clulas endoteliales, que retienen la
IL-8 en unas vesculas de almacenamiento, denominadas cuerpos de Weibel-Palade (van
Mourik et al. 2002).
38
A pesar de que los granulocitos neutrfilos son las principales clulas diana de la IL-8,
hay varios tipos celulares (como clulas endoteliales, macrfagos, mastocitos, queratinocitos,
CD, etc.) que tambin van a ser capaces de responder a IL-8 gracias a la expresin de sus
receptores en la membrana (Stillie et al. 2009).
Las quimioquinas IL-8, MCP-1 y el pptido del complemento activado C5a estimulan a
sus clulas diana (principalmente neutrfilos) de modo que se incrementa su capacidad
germicida. Concretamente, los neutrfilos que han sido expuestos a la IL-8 y a TNF- se
activan para producir un estallido respiratorio (una serie de reacciones que generan radicales
libres de oxgeno y xido ntrico, y la liberacin del contenido lisosomal) contribuyendo as
tanto a la defensa del husped como a la destruccin del tejido.
39
Muchas clulas tumorales humanas tienen la capacidad de producir IL-8 con o sin estrs
proinflamatorio. As la IL-8 juega un papel muy importante en los procesos de angiognesis y
metstasis (De Rossi et al. 2000; Xie 2001). Los experimentos que llevan a estas conclusiones
se basan en estudios comparativos de tumores que no expresan esta quimioquina y variantes que
han sido transfectadas para expresar IL-8. La relevancia de la IL-8 en los mecanismos
patognicos del cncer se ha experimentado analizando la progresin de los transfectantes en
ratones inmunodeficientes y por tanto se ha obviado la implicacin del sistema inmunitario
adaptativo. Esto es posible en xenoinjertos de tumores humanos en ratones inmunodeficientes
porque la IL-8 es capaz de estimular los receptores CXCR1 y CXCR2 de ratn.
40
parece que la expresin de IL-8 puede servir como un factor pronstico de la progresin de
varios tipos de cncer humano (Shahzad et al. 2010).
Cabe resaltar, adems, que tanto el estroma tumoral como las clulas malignas producen
factores solubles y expresan protenas de membrana que deterioran las funciones inmunitarias
que podran destruir al tumor (Gabrilovich 2004; Zitvogel et al. 2006; Zitvogel et al. 2008). La
disrupcin de las funciones quimiotcticas que gobiernan la migracin de los linfocitos
efectores o de las CPA pueden conformar un conjunto de mecanismos de escape del tumor al
sistema inmunitario cuya importancia solamente empezamos a entender en la actualidad. Estos
mecanismos aunque complejos y multifactoriales nos ofrecen nuevas dianas teraputicas en
oncologa.
41
42
43
clulas T citotxicas murinas (Sagerstrom et al. 1993; Henao J 1999). Su analoga con CD28,
tanto en la localizacin cromosmica como en la organizacin exn-intrn, sugiere que ambos
genes provienen de un ancestro comn. Tanto CD28 como CTLA-4 contienen una regin
altamente conservada (un hexapptido, MYPPPY) en el sitio de unin a CD80 y CD86. CTLA4, se expresa en superficie como dmero o monmero y consta de un nico dominio extracelular
tipo IgV, una regin transmembrana y una cola citoplasmtica.
De este modo, CTLA-4 se expresa en los linfocitos T efectores (donde alcanza una
expresin mxima a las 48-72 horas despus de la activacin del linfocito T), as como en las
clulas Treg, una poblacin linfocitaria inmunorreguladora que coexpresa CD4+CD25+FoxP3+.
La principal diferencia en la expresin de CTLA-4 entre ambas poblaciones est en que en las
clulas reguladoras la expresin es constitutiva, sin embargo la expresin sobre los linfocitos
efectores solamente es inducida tras la activacin celular por antgeno. Otra diferencia est en el
trfico intracelular de CTLA-4, ya que en las Treg se expresa constitutivamente en la superficie
celular, mientras que en la poblacin efectora tiene una seal de retencin en los grnulos
secretores (Linsley et al. 1996; Iida et al. 2000).
Sin embargo, parece que el mecanismo competitivo de la unin de CD28 a sus ligandos
es el ms importante ya que en ratones genticamente deficientes en CTLA-4, un transgen de
CTLA-4 sin la cola citoplasmtica protege del fenotipo autoinmune (Sharpe 2009).
44
esenciales para la expresin mxima y la regulacin eficiente del ARNm de CTLA-4 (Tai et al.
2007). Asimismo, los antagonistas de CD28 bloquean la induccin de CTLA-4 en respuesta a
antgeno. Es ms, los ratones dobles knock out para CD28 y CTLA-4 no presentan
autoinmunidad (Buhlmann et al. 2003), lo que es compatible con la hiptesis de que el principal
papel de CTLA-4 es limitar la funcin de CD28.
45
autoinmunes (Greenwald et al. 2005). Lanier y col. corroboraron que tanto CD80 como CD86
proveen seales coestimuladoras eficientes a los linfocitos T para la proliferacin, la produccin
de IL-2 y la generacin de clulas citotxicas (Lanier et al. 1995; Greenwald et al. 2005; Zang y
Allison 2007).
La regulacin de CD80 y CD86 es ejercida de manera diferente por diversos factores
(Greenwald et al. 2005). El entrecruzamiento del receptor antignico de las clulas B y el
estmulo de la va de sealizacin de CD40/CD40L inducen la expresin de CD80 y CD86,
mientras que la ligacin del receptor FcR II en monocitos las regula negativamente. La IL-4 es
un potente inductor de CD86 y en menor grado de CD80. La IL-10 bloquea la expresin de
CD80 y CD86 en macrfagos peritoneales y regula negativamente a CD86, pero no a CD80, en
clulas dendrticas humanas. El IFN- tambin exhibe efectos diversos sobre la expresin de
CD80 y CD86: incrementa la expresin de CD86 en linfocitos B, macrfagos peritoneales y
monocitos de sangre perifrica, al tiempo que hace una modulacin positiva de CD80 en estas
ltimas clulas, mostrando sorprendentemente una accin contraria sobre la expresin de este
ligando en macrfagos peritoneales.
Adems de con CD28 y CTLA-4, CD80 tambin interacciona con la molcula PD-L1
(B7-H1) presente en la superficie de las CPA (Freeman et al. 1995; Butte et al. 2007; Butte et
al. 2008). Parece ser que la unin de CD80 a este receptor transmite seales inhibidoras al
interior del linfocito T que expresa CD80 tras la activacin por antgeno (reverse signaling).
46
et al. 2006). La transfeccin de clulas T con CTLA-4 carente del tallo citoplsmico o con
mutaciones en el mismo, proporciona evidencia en el sentido de que la cola citoplasmtica de
CTLA-4 no es siempre necesaria para inhibir la funcin linfocitaria y que la competicin con
los ligandos que comparte con CD28 (CD80 y CD86) puede ser el mecanismo ms importante
de inhibicin mediado por CTLA-4 (Figura 3). Hay dos modelos diferentes, pero no
mutuamente excluyentes, para intentar explicar los efectos de CTLA-4 cuando se estimula por
sus ligandos: (i) el modelo del umbral y (ii) el modelo de atenuacin (Chambers et al. 2001). En
el modelo del umbral, CTLA-4 incrementa la seal necesaria a travs de TCR y CD28, evitando
que las clulas se activen completamente tras recibir bajas intensidades de estimulacin. Segn
el modelo de atenuacin habra una inhibicin de linfocitos T ya ptimamente activados. Es
muy posible que ambos fenmenos coexistan. Los linfocitos T con un TCR transgnico en
ratones CTLA-4-/- permiten estudiar el papel de CTLA-4 en la regulacin de las respuestas
antgeno-especficas. Tales estudios muestran que el efecto inhibitorio de CTLA-4 es mayor tras
un segundo contacto con el antgeno, que en la respuesta inmune primaria. Adems, se observa
un importante papel de CTLA-4 tanto en la poblacin de linfocitos T CD4 como CD8 (Korman
et al. 2006). Todo ello indica que la estimulacin crnica de linfocitos T resulta en una
elevacin de la expresin de CTLA-4. Es por ello que el bloqueo de CTLA-4 ofrece un
mecanismo potencial para aumentar la respuesta inmunolgica de los linfocitos T ya
estimulados frente a antgenos del tumor, bien reduciendo el umbral de activacin y/o
potenciando la linfoproliferacin y adquisicin de funciones efectoras.
47
48
49
Existen evidencias de que los neutrfilos no slo participan en la inmunidad innata, sino
que pueden interpretar un papel directo en la inmunidad adaptativa reclutando clulas del
sistema inmune tales como linfocitos T y CD. Los neutrfilos son capaces de migrar desde el
foco inflamatorio a una zona prxima al ganglio linftico (Miyazaki et al. 2004) donde entrarn
en apoptosis y pueden ser captados por las CD, que de ese modo sern capaces de presentar los
antgenos capturados por los neutrfilos a los linfocitos T. El grupo de Megiovani demostr en
el ao 2006 que los neutrfilos eran capaces de transferir antgenos directamente a las CD
(Megiovanni et al. 2006). Para ello realiz un cocultivo de neutrfilos (pre-expuestos a C.
albicans) y CD. Tales CD fueron posteriormente capaces de activar a linfocitos T especficos
para C. albicans, del mismo modo que si las levaduras hubieran estado en contacto directo con
las CPA.
50
Las relaciones de las CD con otras estirpes leucocitarias es muy posible que sea de gran
importancia para entender sus mecanismos de actuacin en condiciones de salud y enfermedad.
Adems de sus interacciones con linfocitos T y NK (Zitvogel et al. 1996; Pallandre et al. 2008),
es muy posible que interrelaciones de CD con macrfagos y leucocitos polimorfonucleares sean
51
Figura 4. Esquema de las interacciones moleculares de DC-SIGN. Adems de las protenas humanas
autlogas sealadas, DC-SIGN es receptor/correceptor para biomolculas de mltiples microorganismos
patgenos. Figura publicada en Dendritic cells and C-type lectin receptors: coupling innate to adaptive
immune responses.van Vliet S.; Garca-Vallejo JJ and van Kooyk Y. Immunology and Cell Biology 86,
580-587.2008. Abreviaturas: CEA, Antgeno Carcinoembrionario; CEACAM, Carcinoembryonic
Antigen-Related Cell Adhesion Molecule; DC-SIGN, Dendritic Cell-Specific Intercellular adhesion
molecule-3-Grabbing Non-integrin; ICAM, molclas de adhesin intercelular; MGL, Macrophage
Galactose-Type Lectin; MUC1, mucina 1.
52
2- OBJETIVOS
53
2.1- Objetivos
Los objetivos del presente trabajo de investigacin son los siguientes:
1- Comprobar la eficacia y seguridad clnica del tratamiento combinado con una vacuna de
clulas dendrticas (basada en la estimulacin in vitro de las mismas con lisado tumoral
autlogo previamente procesado) y el pretratamiento con un agente quimioterpico
(ciclofosfamida).
2- Realizar estudios encaminados a potenciar el efecto de las clulas dendrticas in vitro e
in vivo mediante el empleo de anticuerpos monoclonales inmunoestimulantes.
3- Estudiar factores tumorales que reprimen la funcin inmunoestimuladora de las clulas
dendrticas.
4- Estudiar experimentalmente las interacciones funcionales entre clulas dendrticas y
leucocitos polimorfonucleares, definiendo su posible papel en inmunologa/
inmunoterapia del cncer.
55
57
C. Alfaro
1,6
1,3
1, 2
1,6
Gene Therapy and Hepatology Unit. Centro de Investigacin Mdica Aplicada.2 Oncology
Department. Clnica Universidad de Navarra.3 Biochemistry Department. Clnica Universidad
de Navarra.4 Hepatology Department. Clnica Universidad de Navarra.5 Oncology Division.
Centro de Investigacin Mdica Aplicada. 6 Cell Therapy Unit. Clnica Universidad de
Navarra.7 Radiology Department. Clnica Universidad de Navarra.8 Nuclear Medicine
Department. Clnica Universidad de Navarra.University of Navarra, Pamplona, Spain.
1
Manuscrito enviado
59
1,6
1,3
1, 2
1,6
Gene Therapy and Hepatology Unit. Centro de Investigacin Mdica Aplicada.2 Oncology Department.
Clnica Universidad de Navarra.3 Biochemistry Department. Clnica Universidad de Navarra.4
Hepatology Department. Clnica Universidad de Navarra.5 Oncology Division. Centro de Investigacin
Mdica Aplicada. 6 Cell Therapy Unit. Clnica Universidad de Navarra.7 Radiology Department. Clnica
Universidad de Navarra.8 Nuclear Medicine Department. Clnica Universidad de Navarra.University of
Navarra, Pamplona, Spain.
ABSTRACT
This study assesses the biological effects and safety of dendritic cell (DC) immunizations
combined with GM-CSF, Peginterferon and cyclophosphamide pre-treatment in patients with
solid tumors. Twenty-four patients with metastatic cancer received two cycles of four daily
immunizations with monocyte-derived DC. DC were incubated with autologous tumor lysate,
IFN-, TNF- and poly I:C. One dose was delivered intranodally, under ultrasound control, and
the rest intradermally. Cyclophosphamide (day -7), GM-CSF (days 1-4) and Peginterferon (days
1 and 8) completed each cycle. Extensive immunological and imaging studies were performed
to reveal the biological effects of the treatment. Pre-treatment with cyclophosphamide decreased
regulatory T cells to levels observed in healthy subjects. Treatment induced sustained elevations
of Interleukin-12 in serum and increased NK activity in peripheral blood. Circulating
endothelial cells (CEC) decreased in 17/18 patients and circulating tumor cells (CTC) markedly
dropped in 6/19 cases. IFN--ELISPOT among freshly isolated peripheral blood T lymphocytes
responding to DC+tumor lysate were observed in 4/11 cases. Tracing DC migration with 111Inscintigraphy showed that intranodal injections reached deeper lymphatic chains in 61% of
patients, while intradermal injections almost constantly showed arrival of a small fraction of DC
to draining inguinal lymph nodes. Five patients experienced disease stabilization. One patient
with completely resected disease before treatment has not relapsed after 12+ months. This
combinatorial immunotherapy strategy is feasible and suggests potential activity in patients with
minimal residual disease. A randomized trial exploring this hypothesis is currently ongoing.
61
INTRODUCTION
Dendritic cells (DC) present antigen to nave and memory T lymphocytes (Steinman y
Banchereau 2007; Melief 2008). DC artificially presenting tumor antigens are efficacious antitumor vaccines for mouse transplanted tumors (Melief 2008; Palucka et al. 2011). Many DCbased clinical trials have been performed in cancer patients with evidence of increased immune
responses and clinical activity (Su et al. 2003; Avigan et al. 2004; Fay et al. 2006; Melief 2008;
Okada et al. 2011), but efficacy is unfortunately lower than that one observed in mouse models
(Mayordomo et al. 1995; Nair et al. 2000). A key difference might be that cancer patients
present multiple immunosuppressive regulatory mechanisms (Rabinovich et al. 2007), such as
the augmentation of CD4+CD25+FoxP3+ regulatory T cells (Treg) (Dranoff 2005; de Vries et al.
2011). DC for clinical trials are most often differentiated in cultures from monocytes with GMCSF and IL-4 (Schuler 2010). Other protocols have substituted IL-4 by IFN- (Gabriele et al.
2004) or IL-15 (Dubsky et al. 2007) with encouraging preclinical results (Palucka et al. 2011).
DC become highly immunogenic, as opposed to their steady state tolerogenic model (Steinman
2010) when they sense in their microenviromment inflammatory cytokines and/or the presence
of moieties denoting microbial infection such as viral nucleic acids (Melief 2008).
DC can be artificially manipulated to present tumor antigens either in the form of defined
protein sequences (Hsu et al. 1996; Thurner et al. 1999) or as antigenic material obtained from
autologous tumor cells (Nestle et al. 1998). Defined tumor antigenic sequences facilitate
experimental assessment of tumor immunity (Aarntzen et al. 2008), but likely miss tumor
specific mutations that ought to be drivers of the malignant phenotype.
DC are also important regulators of the activity of Natural Killer (NK) cells (Walzer et al.
2005). These cells lyse tumor target cells in an MHC-unrestricted fashion, produce
proinflammatory mediators and regulate angiogenesis (Yao et al. 1999). NK cells also play an
important role in the orchestration of the adaptive immune response (Vivier et al. 2011). IL-12
(Borg et al. 2004) and some surface-attached receptor-ligand pairs have been found to be
involved in the DC-NK interplay (Walzer et al. 2005; Ebihara et al. 2010).
Autologous tumor lysates have been used as a source of antigen (Palmer et al. 2009; Schwaab et
al. 2009). The abundance of immunosuppressive factors (Hatfield et al. 2008; Tirapu et al.
2008; Alfaro et al. 2009) is a potential drawback of freeze/thaw tumor lysates as antigen
sources. Some of such factors should be thermo labile and therefore pre-heating the lysates to
boiling temperatures (Speidel et al. 1997) might deactivate such immunosuppressants, while
preserving the primary aminoacid sequences of the polypeptide antigens (Speidel et al. 1997).
62
Kalinski et al. have reported that the DC optimal at inducing cellular immunity are those
activated by IFN- and those which have sensed viral RNA or viral RNA analogues (Kalinski y
Okada 2010). Such DC were termed type-1 DC (Kalinski y Okada 2010) since they are
powerful producers of IL-12, migrate to lymph nodes guided by their expression of CCR7 and
induce immune responses dominated by Th1 and cytotoxic T lymphocytes (Okada et al. 2011).
Type-1 DC are also powerful at activating NK cells (Ebihara et al. 2010).
We have tested the safety and biological activity of immunotherapy based on type-1 DC for
advanced cancer patients. Our objective was to imitate the strong immunity that typically occurs
following an acute viral infection, by attaining sustained antigen presentation in lymphoid tissue
by DC which are endowed with type-1 features.
63
6 weeks thereafter. Imaging tests were repeated every 12 weeks during treatment. Follow-up
after treatment discontinuation was performed every 3 months.
Dendritic cell production
Monocytes selected by CD14+ immunomagnetic selection (Miltenyi Biotec) (Mazzolini et al.
2005) were differentiated to DC by incubation with GM-CSF and IL-4 for 7 days using GMP
standard procedures (Mazzolini et al. 2005). DC were exposed to autologous tumor lysate
generated by 5 rounds of freezing/thawing and 10Gy irradiation with a 5 min-long heating step
at 100 C during the first thawing step. DC-loading with lysate was carried out at 200-100 g/ml
of protein during 2h and later DC were matured with clinical-grade tumour necrosis factor-
(TNF-; 50 ng/ml; Boehringer Ingelheim, Ingelheim, Germany), IFN- (1,000 IU/ml;
Schering-Plough, Kenilworth, NJ, USA) and poly I:C (20 mg/ml; Ampligen, Bioclones, Tokai,
South Africa) for 24 to 48 hours.
FACS analyses and ELISAs
Before immune staining, cells were incubated with PBS/human IgG (50 g/ml; Beriglobina P;
Behring, Barcelona, Spain) for 10 min on ice to block Fc receptors. Subsequently, DCs (105)
were washed in cold PBS and incubated 15 min at 4C with specific FITC and PE-labeled mAb
for CD80, CD83, CD86, CCR7, B7H1 and CD40 (BD Biosciences, Erembodegem, Belgium).
Treg were analyzed by intracellular FoxP3 staining following CD4 and CD25 surface
immunostaining (BD Biosciences). NK cells were identified as CD56+ CD3-negative
lymphocytes. Samples were analyzed using a FACSCalibur flow cytometer (BD Biosciences).
Concentrations of IL-12 and IFN- were assessed by commercial sandwich ELISA kits (BD
Biosciences).
NK Cell Cytotoxicity Assays
Cytotoxic activity of NK cells against K562 cells was measured by standard 5h sodium
51
51
Cr
(PerkinElmer, Boston, MA, USA) for 1 h at 37 C, and labelled cells were then washed and
resuspended in RPMI 1640 (Invitrogen, Paisley, UK) containing 10% fetal bovine serum (FBS)
from Invitrogen. Isolated PBMCs from different days before and after the treatments were used
as effector cells. These cells were resuspended in the same medium and placed at various
effector:target ratios (E:T). Labelled target cells were added to each well at a concentration of 3
x 103 cells/well for a total volume of 0.2 ml per well. After 5 h incubation, release of 51Cr into
the supernatant was quantified with a microplate scintillation counter (Packard TopCount,
PerkinElmer). The percentage of cytotoxicity was calculated as the percent
64
51
Cr release using
65
DC migration was tracked in vivo by scintigraphy. DCs were labelled with 500-700 Ci of 111Inoxinate for 15 min at room temperature. Cells were washed twice, resuspended in saline and
mixed with the non labelled DCs. Scintigraphic and Single Photon Emission Computed
Tomography (SPECT) studies were performed in a hybrid system (Symbia Truepoint,
SIEMENS TM, Munich, Germany) using a fast acquisition protocol. Images were taken 4, 24,
48 and 72 h post-intranodal injection.
RESULTS
Treatment plan
The treatment schedule is presented in Figure 1A. Patients underwent apheresis to obtain
peripheral blood leukocytes and received a single dose of cyclophosphamide 600 mg/m2 (day 7). DC were administered in two cycles of four daily immunizations, separated by 3-6 weeks.
The first dose was delivered inside an inguinal lymph node, under ultrasound control and the
rest intradermally in the opposite upper thigh. GM-CSF 100 g/24 h (days 1-4) and
Peginterferon 80 mg (days 1 and 8) were injected subcutaneously in the upper thigh region.
Patients could receive additional DC doses contingent to the presence of clinical benefit and DC
availability according to investigators criteria.
66
67
68
immunogens is challenging. Sufficient material for these experiments was available in 11 cases
and increases in IFN--ELISPOT reactivity from freshly isolated PBMC to DC loaded with
autologous tumor lysate (without any antigen-driven pre-culture) were observed in four out of
those eleven cases (Figure 3C).
Treatment effects on circulating endothelial cells (CET), and circulating tumor cells
(CEC)
The well-known anti-angiogenic effects of IL-12 (Mazzolini et al. 2001; Romagnani et al.
2001) supported the evaluation of the number of CEC as a surrogate marker for angiogenesis
and vasculogenesis(Mancuso y Bertolini 2010). CEC were evaluated in 18 patients, and a
dramatic decrease in circulating CD45-CD31+VEGFR-2+ endothelial cells was noted in most
cases (Figure 4A).
The increase in NK activity that we observed could also result in lysis of CTC. In samples from
19 patients quantitative RT-PCR tests with primers for mRNAs selectively expressed by tumor
cells were performed to comparatively evaluate the presence of CTC before and after treatment.
In six of the 19 cases (32%) marked decreases of CTC were observed, including two
hepatocellular carcinoma patients (Figure 4B). Results are summarized in Supplementary Table
2.
DC migration following intranodal and intradermal injections
With the first intranodal injection and the first subcutaneous DC dose, 18 patients received a
tracing dose of 106 DC labelled with 111Indium oxynate (Feijoo et al. 2005). This allowed using
scintigraphy to monitor the anatomic biodistribution of the tracing dose (Figure 5A). SPECT
permitted clear identification of lymph node anatomy (Figure 5B). The biodistribution from
intranodal and subcutaneous injections is summarized in Supplementary Table 3. In 11 of the 18
patients studied (61%), the intranodal injections reached deeper lymph node chains and constant
arrival of a small fraction of the radioactive tracing isotope to draining lymph nodes from
subcutaneous injections was observed.
DISCUSSION
Immunotherapy has shown activity in several types of human cancers (Finn 2008). Cancer
vaccines, adoptive T cell therapy and immunostimulatory monoclonal antibodies are among the
most relevant strategies. Careful observation of biological effects induced by immunologicalbased strategies is required to improve current paradigms and to develop the most promising
combination regimens. This DC-based clinical trial tested a number of innovative features such
69
as the maturation cocktail, the daily administration, cyclophosphamide pre-treatment and the
accompanying cytokines.
Our results indicate that pre-treatment with cyclophosphamide decreased Treg cells, mainly in
patients with higher baseline numbers. There is controversy regarding the optimal dose and
schedule (Ghiringhelli et al. 2007) to achieve these selective Treg-decreasing effects of
cyclophosphamide that are related to low content of ATP in this lymphocyte subset (Zhao et al.
2010). The decreasing effects on Treg cells are likely to involve cyclophosphamide but may also
involve combined effects of the strategy and of IL-12 as described (Cao et al. 2009).
Repeated daily immunizations were chosen to deliver antigen to lymph nodes during several
days, thereby mimicking the conditions expected for a replicating virus causing an acute
infectious disease. When we designed our trial, we thought of the evidence suggesting that
exogenous DC need to transfer the antigen to lymph node-resident DC (Shortman y Heath
2010), which are hypothesized to be main actual performers of antigen presentation (Poulin et
al. 2010). In addition, the incoming DCs, such as those that we injected into the patients, would
stimulate lymph node-resident DC with secreted proinflammatory cytokines and microbialdenoting molecules that they may carry such as poly I:C.
GM-CSF was administered at a site near each DC injection to sustain DC viability and enhance
crosspresentation (Ferrantini et al. 2008). Patients received IFN- to promote antigen
presentation at the tumor microenvironment and to foster cytotoxic lymphocyte responses
(Bracci et al. 2007; Schwaab et al. 2009; Okada et al. 2011).
No objective radiological responses were observed. However, five patients showed disease
stabilization. These patients presented rapid disease progression before entering the trial.
Another patient who underwent a complete resection of metastatic disease has not relapsed after
at least 12 months. Yet, no clear conclusions on efficacy can be drawn based on these data, and
randomized data are needed. The decrease in the number of CEC and CTC clearly supports that
this strategy might be especially relevant in the setting of minimal residual disease.
Consequently, a randomized clinical trial in colorectal cancer patients following complete
surgical resection of liver metastasis is ongoing at our institution.
Treatment was well tolerated. The most frequently observed toxicities were grade 1 and 2 fever,
asthenia and pain at the injection site. These reactions are probably related to the endogenous
and exogenously administered inflammatory mediators. One patient died of a Fourniers
gangrene that developed from a perineal abscess but relation to treatment is doubtful.
Amazingly high concentrations of IL-12 were observed in the plasma of all patients. The type-1
DC used in the study produced IL-12 and thus are very likely to be the main source of IL-12 in
the patients organism although maybe not the only one. IL-12 has been used as an efficacious
anticancer agent but systemic administration at high doses was because of serious toxicity
(Alatrash et al. 2004). IL-12 is a powerful NK activating factor (Trinchieri 2003) that in our
70
treatment would act in concert with Peginterferon to strongly raise NK activity. As a result of
NK activity and the downstream IFN-CXCL10 axis, angiogenesis and vasculogenesis are
inhibited (Romagnani et al. 2001). Indeed, we observed a clear decline of circulating endothelial
cells that likely denotes these trains of phenomena (Mancuso y Bertolini 2010). The decline of
circulating endothelial cells (Mancuso y Bertolini 2010) could be also interpreted as a result of
NK activity (Yao et al. 1999), activities of type I interferons(Bracci et al. 2007) and
cyclophosphamide (Wong et al. 2010). Type-1 DC are known to produce type I IFN and control
NK functions through direct cell to cell contact (Ebihara et al. 2010; Kalinski y Okada 2010).
Indeed, IL-12 and other surface molecules are involved in this cross-talk of NK and DC (Borg
et al. 2004; Ebihara et al. 2010). In previous works we have tested dendritic cells adenovirally
engineered to produce IL-12 (Mazzolini et al. 2005). It is of note that the production of IL-12 in
DC matured with our cocktail is superior to that achieved by adenovirus-mediated transfection.
Tumor lysates were chosen as a source of antigen because such mixtures contain individual
tumor antigens and because of technical feasibility under GMP. Lysates were pre-heated at 100
C to counteract immunosuppressive compounds, but thermo-resistant components with
suppressive effects certainly persist. A feasible alternative is to transfect mRNA encoding tumor
antigens (Su et al. 2003), a procedure that offers the possibility of adding mRNAs or siRNAs
that up-regulate DC immunostimulatory functions (Bonehill et al. 2008). No direct clinical
comparison between RNA transfection and tumor lysates is available.
Regarding DC distribution upon injection, our data match those obtained by the group of Carl
Figdor and Jolanda de Vries (Verdijk et al. 2009). We noticed no obvious hardening
inflammatory reactions at the vaccination sites in any of the cases, even in the second cycle.
This may reflect the immunosuppressive mechanisms in the advanced cancer patients
(Rabinovich et al. 2007). Although in some cases peripheral blood lymphocytes obtained posttreatment showed some degree of reactivity to tumor lysate-loaded DC, the intensity of these
adaptive cellular responses is probably too weak as to permit meaningful effects on the
established tumor masses.
Indeed, our data suggest that our combined treatment would turn on immunosuppressive
mechanisms such as B7-H1 (PD-L1) (Brahmer et al. 2010) expression by antigen presenting
cells and possibly tumor cells. Integrating agents that tamper with these immunosuppressive
pathways in this therapeutic approach is considered important (Brahmer et al. 2010). Even if
our procedure normalized percentages of regulatory T cells, a transient but more drastic
reduction is likely to be required for efficacy.
In summary, we have developed a DC vaccination strategy that incorporated several novel
elements. The treatment was feasible and well tolerated and induced tumor specific cellular
immunity, as well as several relevant biological effects, including reduction of regulatory Tcells, high concentrations of IL-12, decreases in CET and CEC. This regimen deserves further
71
REFERENCES
72
73
74
Romagnani, P., F. Annunziato, L. Lasagni, E. Lazzeri, C. Beltrame, et al. (2001). "Cell cycledependent expression of CXC chemokine receptor 3 by endothelial cells mediates
angiostatic activity." J Clin Invest 107(1): 53-63.
Schuler, G. (2010). "Dendritic cells in cancer immunotherapy." Eur J Immunol 40(8): 2123-30.
Schwaab, T., A. Schwarzer, B. Wolf, T. S. Crocenzi, J. D. Seigne, et al. (2009). "Clinical and
immunologic effects of intranodal autologous tumor lysate-dendritic cell vaccine with
Aldesleukin (Interleukin 2) and IFN-{alpha}2a therapy in metastatic renal cell
carcinoma patients." Clin Cancer Res 15(15): 4986-92.
Shortman, K. y W. R. Heath (2010). "The CD8+ dendritic cell subset." Immunol Rev 234(1):
18-31.
Speidel, K., W. Osen, S. Faath, I. Hilgert, R. Obst, et al. (1997). "Priming of cytotoxic T
lymphocytes by five heat-aggregated antigens in vivo: conditions, efficiency, and
relation to antibody responses." Eur J Immunol 27(9): 2391-9.
Steinman, R. M. (2010). "Some active areas of DC research and their medical potential." Eur J
Immunol 40(8): 2085-8.
Steinman, R. M. y J. Banchereau (2007). "Taking dendritic cells into medicine." Nature
449(7161): 419-26.
Su, Z., J. Dannull, A. Heiser, D. Yancey, S. Pruitt, et al. (2003). "Immunological and clinical
responses in metastatic renal cancer patients vaccinated with tumor RNA-transfected
dendritic cells." Cancer Res 63(9): 2127-33.
Thurner, B., I. Haendle, C. Roder, D. Dieckmann, P. Keikavoussi, et al. (1999). "Vaccination
with mage-3A1 peptide-pulsed mature, monocyte-derived dendritic cells expands
specific cytotoxic T cells and induces regression of some metastases in advanced stage
IV melanoma." J Exp Med 190(11): 1669-78.
Tirapu, I., A. Lewis, M. Kreutz, H. McLinden y S. S. Diebold (2008). "Freeze-and-thawdisrupted tumour cells impair the responsiveness of DC to TLR stimulation." Eur J
Immunol 38(10): 2740-50.
Trinchieri, G. (2003). "Interleukin-12 and the regulation of innate resistance and adaptive
immunity." Nat Rev Immunol 3(2): 133-46.
Verdijk, P., E. H. Aarntzen, W. J. Lesterhuis, A. C. Boullart, E. Kok, et al. (2009). "Limited
amounts of dendritic cells migrate into the T-cell area of lymph nodes but have high
immune activating potential in melanoma patients." Clin Cancer Res 15(7): 2531-40.
Vivier, E., D. H. Raulet, A. Moretta, M. A. Caligiuri, L. Zitvogel, et al. (2011). "Innate or
adaptive immunity? The example of natural killer cells." Science 331(6013): 44-9.
Walzer, T., M. Dalod, E. Vivier y L. Zitvogel (2005). "Natural killer cell-dendritic cell crosstalk
in the initiation of immune responses." Expert Opin Biol Ther 5 Suppl 1: S49-59.
75
Wong, N. S., R. A. Buckman, M. Clemons, S. Verma, S. Dent, et al. (2010). "Phase I/II trial of
metronomic chemotherapy with daily dalteparin and cyclophosphamide, twice-weekly
methotrexate, and daily prednisone as therapy for metastatic breast cancer using
vascular endothelial growth factor and soluble vascular endothelial growth factor
receptor levels as markers of response." J Clin Oncol 28(5): 723-30.
Yao, L., C. Sgadari, K. Furuke, E. T. Bloom, J. Teruya-Feldstein y G. Tosato (1999).
"Contribution of natural killer cells to inhibition of angiogenesis by interleukin-12."
Blood 93(5): 1612-21.
Zhao, J., Y. Cao, Z. Lei, Z. Yang, B. Zhang y B. Huang (2010). "Selective depletion of
CD4+CD25+Foxp3+ regulatory T cells by low-dose cyclophosphamide is explained by
reduced intracellular ATP levels." Cancer Res 70(12): 4850-8.
76
FIGURAS_______________________________________
(An immunotherapy strategy based on type-1 dendritic cells increases circulating interleukin-12
and NK activity while decreasing circulating endothelial cells. C. Alfaro, JL. Prez-Gracia, N.
Surez et al. Manuscrito enviado)
77
Figure 1
A
78
79
80
81
Figure 2.
325
325
300
300
275
275
250
250
225
225
200
175
150
125
100
175
150
125
100
75
75
50
50
25
25
Immature DC
Mature DC
200
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Immature DC
Mature DC
Patient
B
CD80
1400
1200
1000
800
600
400
200
CD83
Immature DC
Mature DC
40
Immature DC
Mature DC
30
MFI
MFI
150
20
100
10
50
S1 S2 2
9 10 11 12 13 14 15 17 18 19 22 23 24
CCR7
10
S1 S2 2
Healthy
donor
Patient
Healthy
donor
9 10 11 12 13 14 15 17 18 19 22 23 24
Patient
B7H1
Immature DC
Mature DC
4000
Immature DC
Mature DC
MFI
MFI
3000
2000
1000
S1 S2 2
Healthy
donor
9 10 11 12 13 14 15 17 18 19 22 23 24
Patient
S1 S2
Healthy
donor
82
10 11 12 13 14 17 21 22 24
Patient
83
Figure 3
84
85
Figure 4
86
87
Figure 5
A
4h
48h
24h
72h
88
Supplementary Figure 1
89
90
Supplementary Figure 2
CD86
Immature DC
Mature DC
MFI
1000
500
S1 S2 2
10 11 12 13 14 15 17 18 19 22 23 24
Patient
CD40
200
Immature DC
Mature DC
MFI
150
100
50
S1 S2 2
9 10 11 12 13 14 15 17 18 19 22 23 24
Patient
91
Supplementary Figure 3
92
Supplementary Table 1
PATHOLOGY
GENE
AFP
Hepatocellular
carcinoma
MAGE-1
MAGE-3
MART-1
Melanoma
TYR
CEACAM5
Colon carcinoma
CK19
CK20
CK7
CA9
MMP9
PRIMER SEQUENCES
Fw
Rv
Fw
Rv
Fw
Rv
Fw
Rv
Fw
Rv
Fw
Rv
Fw
Rv
Fw
Rv
Fw
Rv
Fw
Rv
Fw
Rv
GTTCCAGAACCTGTCACAAG
CTTTGTTTGGAAGCATTCAACTGC
ACAGAGGAGCACCAAGGAGAAG
AGTTGATGGTAGTGGGAAAGGC
CTCCAGCAACCAAGAAGAGG
GCAAGGAACTGGAAGCTTTG
GCTCATCGGCTGTTGGTATT
ATAAGCAGGTGGAGCATTGG
ACTTACTCAGCCCAGCATCATTC
ACTGATGGCTGTTGTACTCCTCC
CTGTCCACCAAGATCAAGCA
GCGACCACATAGGGAGAAAA
GGTCAGTGTGGAGGTGGATT
TCAGTAACCTCGGACCTGCT
CACCTCCCAGAGCCTTGAGAT
GGGCCTTGGTCTCCTCTAGAG
ATTCCACTGGTGGCAGTAGC
GGGTGGGAATCTTCTTGTGA
CTGCGCCTGCGCAACAATGG
CTCGGCAGGGAAACGGTGGC
GACAAGAAGTGGGGCTTCTG
GCCATTCACGTCGTCCTTAT
93
Supplementary Table 2
Pathology
Patient
19
21
MELANOMA
22
23
2
HEPATOCELLULAR
3
CARCINOMA
4
10
COLON
CARCINOMA
11
12
13
14
15
16
RENAL CARCINOMA 17
18
Gene
Basal
MART-1
TYR
MART-1
TYR
MART-1
TYR
MART-1
TYR
AFP
MAGE-1
MAGE-3
AFP
MAGE-1
MAGE-3
AFP
MAGE-1
MAGE-3
CEACAM5
CK19
CK20
CEACAM5
CK19
CK20
CEACAM5
CK19
CK20
CEACAM5
CK19
CK20
CEACAM5
CK19
CK20
CEACAM5
CK19
CK20
CEACAM5
CK19
CK20
CEACAM5
CK19
CK20
CEACAM5
CK19
CK20
CA9
CK7
CA9
CK7
CA9
CK7
94
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
Post 1st DC
cycle
1,004
0,518
1,288
1,207
1,137
0,799
6,881
1,753
0,003
0,762
0,460
ND
ND
ND
1,194
5,970
5,045
0,626
0,032
0,122
1,686
0,795
0,548
0,524
0,732
0,128
3,158
2,865
99,090
2,301
2,345
9,344
2,236
1,691
2,264
0,857
0,778
1,281
1,262
1,142
0,807
0,106
0,061
0,253
7,601
3,035
0,194
0,166
1,116
0,820
Post 2nd DC
cycle
2,626
3,880
0,778
0,939
2,539
1,915
2,754
2,240
ND
ND
ND
0,100
0,775
0,392
2,508
8,035
8,439
2,010
0,036
0,294
0,872
0,900
0,742
0,360
0,336
0,300
1,918
1,361
17,377
8,585
9,757
72,277
2,134
2,044
0,913
5,593
4,172
0,168
0,768
0,734
1,494
0,609
0,333
0,099
3,488
4,541
ND
ND
0,648
193,985
Supplementary Table 2.
Monitorization of circulating tumor cells (CTCs) in patients using specific primers for each
tumor type and RT-PCR analysis. Data indicate fold-change compared to basal values. ND: Not
determined due to lack of appropriate sample.
95
Supplementary Table 3
Patient
N
3
4
5
6
7
8
9
11
12
13
14
17
18
20
21
22
23
24
TOTAL
+++
++
+
Migration in 4h
Migration in 24h
Migration in 48h
96
INTRADERMAL (distribution to
local/regional lymph nodes)
YES ++
YES +++
YES ++
YES +
YES +++
YES +++
YES +++
YES ++
YES ++
YES +++
YES +++
YES ++
YES +++
NO
NO
YES +++
YES +++
YES +++
YES / NO = 16 / 2
59 %
37 %
4%
C. Alfaro
1,6
; N. Surez
2,6
1,5,7
; J.L.
Prez-Gracia 3,7.
Gene Therapy and Hepatology Division, CIMA, Universidad de Navarra, Pamplona 31008,
Spain; 2 Biochemistry Department, Clnica Universidad de Navarra, Universidad de Navarra,
Pamplona 31008, Spain; 3 Medical Oncology Department, Clnica Universidad de Navarra,
Universidad de Navarra, Pamplona 31008, Spain; 4 Clnical Research Department, Pfizer Inc,
Madrid 28006, Spain; Universidad de Navarra. 5 Internal Medicine Department, Clnica
Universidad de Navarra, Universidad de Navarra, Pamplona 31008, Spain.
97
www.bjcancer.com
Full Paper
Gene Therapy and Hepatology Division, CIMA, Universidad de Navarra, Pamplona 31008, Spain; 2Biochemistry Department, Clnica Universitaria de
Navarra, Universidad de Navarra, Pamplona 31008, Spain; 3Medical Oncology Department, Clnica Universitaria de Navarra, Universidad de Navarra,
Pamplona 31008, Spain; 4Clinical Research Department, Pf izer Inc., Madrid 28006, Spain; 5Internal Medicine Department, Clnica Universitaria de
Navarra, Universidad de Navarra, Pamplona 31008, Spain
Vascular endothelial growth factor (VEGF) inhibits differentiation and maturation of dendritic cells (DC), suggesting a potential
immunosuppressive role for this proangiogenic factor. Bevacizumab, sorafenib and sunitinib target VEGF-mediated angiogenesis and
are active against several types of cancer, but their effects on the immune system are poorly understood. In this study, VEGF and
supernatants of renal carcinoma cell lines cultured under hypoxia were found to alter the differentiation of human monocytes to DC.
Resulting DC showed impaired activity, as assessed by the alloreactive mixed T-lymphocyte reaction. Bevacizumab and sorafenib, but
not sunitinib, reversed the inhibitory effects of VEGF, but not of those mediated by tumour supernatants. Dendritic cells matured
under the influence of VEGF expressed less human leukocyte antigen-DR (HLA-DR) and CD86, and this effect was restored by
bevacizumab and sorafenib. Finally, tumour-cell supernatants decreased interleukin-12 (IL-12) production by mature DC, and such
inhibition was not restored by any of the tested drugs, delivered either as single agents or in combination. The deleterious effects of
tumour-cell supernatants were mainly mediated by thermostable molecules distinct from VEGF. These results indicate that inhibition
of the differentiation of monocytes to DC is a multifactorial effect, and that they support the development of combinations of
angiogenesis inhibitors with immunological modulators.
British Journal of Cancer advance online publication, 10 March 2009; doi:10.1038/sj.bjc.6604965 www.bjcancer.com
& 2009 Cancer Research UK
Keywords: dendritic cells; renal cell carcinoma; VEGF; bevacizumab; sunitinib; sorafenib
2
without any therapeutic effect on tumour growth (Gabrilovich
et al, 1999). Nevertheless, a combined treatment with anti-VEGF
antibodies and DC pulsed, with p53 peptides that contained
specific mutations of the implanted tumours, produced a sustained
antitumour effect, indicating potential synergism between antiangiogenic drugs and DC-based immunotherapy treatments for
cancer (Gabrilovich et al, 1999). Other groups have suggested that
angiogenic factors at the tumour microenvironment differentiate
DC that display features of vascular cells and are immunosuppressive (Conejo-Garcia et al, 2004). In addition, VEGF has
been described to mediate immunosuppression (Ohm et al, 2003),
which depends on the inhibition of differentiation and migration
of thymic lymphocyte progenitors from the bone marrow
and subsequent reduction of the numbers of CD4 and CD8
thymocytes, which can be reverted when exposure to VEGF ceases.
Cancer therapeutic vaccines formulated with DC artificially
presenting tumour antigens are being extensively tested in clinical
trials in several tumour types (Vulink et al, 2008), including RCC
(Dannull et al, 2005). The possibility to overcoming potential
interactions of VEGF on the immune system through clinically
available angiogenesis inhibitors led us to evaluate the influence of
such drugs on DC differentiation from monocytes. A recent report
has documented the inhibitory effects of sorafenib, but not of
sunitinib, on DC maturation (Hipp et al, 2008). Maturation is the
gene expression programme that renders DC capable of mediating
T-cell expansion and activation (Steinman, 2008). Maturation is
triggered by microbial biomolecules (such as, lipopolysaccharide
(LPS) or bacterial DNA), proinflammatory cytokines and ongoing
T-cell responses. In spite of the reports on the effects of VEGF on
DC, little is known about the effects of these compounds on the
differentiation of DC from myeloid precursors. In this study, the
effects of soluble VEGF and of VEGF-containing supernatants from
RCC cells were assessed on monocytes to DC differentiation
cultures. The influence of bevacizumab, sorafenib and sunitinib on
such cultures was defined.
MLR
Dendritic cells were cultured in 96-well plates in an AIM-V
medium. A total of 2 105 lymphocytes from a distinct donor were
added on day 9 at different Tcell/DC ratios (80 : 1, 40 : 1 and 20 : 1).
After 3 days, the [methyl-3H]thymidine uptake was determined by
the addition of 1 mCi of [methyl-3H]thymidine (25 Ci mmol1;
Amersham, Uppsala, Sweden) for 16 20 h. At the end of this
labelling time, the [methyl-3H]thymidine uptake was determined
by transferring cells to 96-well filter microplates (Unifilter-96
GF/C, PerkinElmer, Boston, MA, USA) and adding 25 ml of liquid
scintillation (Microscint O, PerkinElmer) to measure radioactivity.
Technical controls were from phytohemagglutinin (PHA)-stimulated human lymphocyte populations from a single individual.
Cytokine measurement
Renal cell carcinoma culture supernatants (106 cells/ml) were
assayed for VEGF production at 24 and 48 h with an enzyme-linked
immunoabsorbent assay (ELISA) kit (R&D Systems). Interleukin6, IL-8, IL-10, TNF-a and IL-12 were simultaneously analysed by
microparticle-based flow cytometry (Cytometric Bead Array) in
supernatant samples of DC cultures at baseline and on day 2,
according to the manufacturers instructions (BD Bioscience, San
Jose, CA, USA).
C
on
tro
ls
up
R
er
C
na
C
-1
ta
nt
0
co
nt
R
ro
C
l2
C
-1
4
0
h
co
R
nt
C
ro
C
l4
-1
0
8
hy
h
po
R
C
x
ia
C
-1
24
0
h
hy
po
VH
xi
a
L+
48
53
h
co
nt
VH
o
l2
L+
4
53
h
co
VH
n
to
L+
l4
53
8
h
hy
po
VH
x
L+
ia
24
53
h
hy
po
xi
a
48
h
1200
1000
800
600
400
200
0
20 000
20:1
40:1
80:1
16 000
12 000
8000
4000
C
c
ni
ith
PB
um
iz
be
va
c
l 1
)
ge
ta
llo
ou
(1
ab
(1
ab
m
zu
be
va
ci
g
00
g
00
m
re
53
L+
53
+
0
L+
-1
C
Su
p.
V
C
Su
p.
R
m
l 1
)
96
ov
ed
ov
ed
m
re
53
L+
Su
p.
VH
H
p.
V
h
24
h
96
h
C
C
Su
Su
p.
R
p.
R
-1
-1
re
re
VH
p)
Su
t(
Su
an
ov
ed
L+
ov
ed
53
0
-1
C
C
R
p)
Su
rn
at
Su
pe
24
1:
1:
tro
on
C
t(
an
rn
at
pe
Su
0
l
3H-Thymidine uptake
(c.p.m. )
Figure 1 Tissue culture supernatants from RCC cells contain VEGF and suppress differentiation of MLR-stimulating DC from monocytes. (A) Vascular
endothelial growth factor concentrations measured by ELISA in the 24 and 48 h conditioned media from B80% confluent cultures of the indicated cell lines.
Renal cell carcinoma-10 is a renal cell carcinoma with VHL deficiency. VHL 53 is a stable transfectant recovering the VHL expression. Cultures were
carried out in normoxia (21% O2) or hypoxia chambers (1% O2) as indicated. HT-29 human colon carcinoma cell supernatants were used as control
supernatant. (B) Lymphocyte proliferation at the indicated DC to allogenic PBL ratios, as induced by DC differentiated for 7 days from monocytes in the
presence of GM-CSF and IL-4 with or without 1 : 5 (v/v) of the indicated conditioned media. After differentiation, DC were matured for 48 h with TNF-a,
IFN-a and poly I:C. Conditioned media were removed when indicated by three washes. Anti-VEGF mAb (bevacizumab) was added at the indicated
concentrations for the duration of the differentiation culture. Mature DC differentiated without additives were used as positive control. Data represent
means.d. from three experiments. ***Po0.001, statistical analyses were performed by the Kruskal Wallis statistical test.
RESULTS
RCC culture supernatants contain abundant VEGF that is
increased by hypoxia
Vascular endothelial growth factor levels were measured in the
culture supernatant from RCC-10 and VHL 53 tumour cell lines
under normal and hypoxic (1% O2) conditions (Figure 1A). Renal
British Journal of Cancer (2009), 1 9
4
Tcell: DC ratio
100 000
90 000
80 000
70 000
60 000
50 000
40 000
30 000
20 000
10 000
0
C
-1
0
be
Su
va
p
ci
1:
zu
5
m
ab
Su
(1
p
+
g
so
m
ra
l 1
fe
)
ni
b
(1
Su
0
p
ng
+
su
m
l 1
ni
tin
)
Su
ib
(1
p
+
0
be
ng
va
m
ci
l 1
zu
)
m
Su
ab
p
/
s
+
or
be
af
en
va
ci
ib
zu
m
ab
Su
/s
un
p
+
iti
ni
so
b
ra
fe
ni
b/
su
O
ni
nl
tin
y
al
ib
lo
ge
ni
c
PB
L
80:1 40:1
20:1
Su
p
C
on
tro
l
3H-Thymidine uptake
(c.p.m.)
100 000
90 000
80 000
70 000
60 000
50 000
40 000
30 000
20 000
10 000
0
Tcell: DC ratio
VE
G
F
VE
VE
G
F
(2
5
ng
m
l 1
)
F
(1
00
be
ng
va
VE
ci
m
z
l 1
G
um
F
)
ab
+
be
(1
va
g
ci
zu
m
l 1
m
ab
)
VE
(
10
G
F
0
+
g
so
m
ra
l 1
f
en
VE
)
i
b
G
(1
F
0
+
ng
so
ra
m
fe
l 1
ni
)
b
VE
(1
G
0
0
F
ng
+
su
m
ni
l 1
tin
VE
)
i
b
G
(1
F
0
+
ng
su
m
ni
l 1
tin
ib
)
(1
00
ng
m
l 1
)
80:1 40:1
20:1
C
on
tro
l
3H-Thymidine uptake
(c.p.m.)
Figure 2 Vascular endothelial growth factor and RCC supernatants during monocyte differentiation to DC inhibit MLR-stimulating activity of resulting DC.
Vascular endothelial growth factor-mediated inhibition is reversible by bevacizumab and sorafenib. (A) CD14 monocyte cultures as in Figure 1 were set
up in the presence of VEGF and the indicated VEGF inhibitors. In all the experiments, TNF-a, IFN-a and poly I:C were added to induce DC maturation for
48 h, including the control culture. (B) Anti-VEGF agents in different combinations are tested at the indicated concentrations to reverse the inhibition in the
MLR from mature DC that had been differentiated in the presence of RCC supernatants. Mature DC without VEGF or RCC supernatants were used as
positive controls. Microcultures of allogenic PBL without DC are plotted as negative controls. Results in panels a and b represent the means.d. from four
different experiments.
from other cell lines in Figure 1 showed similar effects (data not
shown).
5
CD1a
75
75
50
25
B 100
50
50
50
25
0
0
A
75
25
0
A
CD11c
100
75
25
CD1a
MFI
100
MFI
100
MFI
MFI
CD11c
**
CD83
CD80
40
MFI
30
20
10
0
CD83
75
55
50
45
40
35
30
25
20
15
10
5
0
50
MFI
50
MFI
MFI
CD80
55
50
45
40
35
30
25
20
15
10
5
0
25
0
A
***
HLA-DR
CD86
MFI
75
50
25
0
A
**
**
***
**
HLA-DR
100
70
60
50
40
30
20
10
0
75
MFI
100
MFI
MFI
CD86
55
50
45
40
35
30
25
20
15
10
5
0
50
25
0
**
**
D: mDC+VEGF/Bevacizumab (1 g ml1)
E: mDC+VEGF/Sorafenib (10 ng
F: mDC+VEGF/Sunitinib (10 ng
ml1)
ml1)
Figure 3 Vascular endothelial growth factor and RCC supernatants added to DC differentiation cultures inhibit maturation-induced surface markers on
DC: effects of bevacizumab, sorafenib and sunitinib. Dendritic cells obtained from monocytes in 7-day cultures with GM-CSF and IL-4 were analysed by
surface immunostaining and flow cytometry for the indicated leukocyte differentiation antigens before and after maturation in the presence of TNF-a, IFN-a
and poly I:C. As indicated, recombinant VEGF (A) or RCC supernatants (B) were added during differentiation. When indicated, bevacizumab, sorafenib or
sunitinib was also added during the differentiation cultures. Values are expressed as means.e.m. of four different experiments. **Po0.01,***Po0.001,
statistical analyses were performed by the Kruskal Wallis statistical test. In all cultures set up with CD14 cells, the expression of CD14 was lost, so at the
end of the cultures o1% cells were CD14 .
6
Tcell:DC ratio
80:1
40:1
20:1
80 000
70 000
60 000
50 000
40 000
30 000
20 000
10 000
ng
Be
m
va
l 1
ci
zu
)
m
ab
VE
(1
G
g
F
+
m
So
l 1
ra
)
fe
ni
b
VE
(1
G
0
F
ng
+
m
Su
l 1
ni
)
tin
ib
(1
0
ng
m
l 1
)
R
C
C
-1
0
Su
p
O
1:
nl
5
y
al
lo
ge
ni
c
PB
L
(1
00
m
at
ur
at
io
n
VE
G
F
VE
G
F
VE
du
rin
du
rin
g
at
ur
at
io
(2
ng
l 1
)
C
on
tro
l
Figure 4 Vascular endothelial growth factor and RCC supernatants, when added during maturation, cannot inhibit the MLR-stimulating activity of already
differentiated DC. Vascular endothelial growth factor and RCC supernatants were added to differentiated DC during the 48 h maturation culture with TNF-a,
IFN-a and poly I:C. When indicated, VEGF-inhibiting drugs were also added. The mitogenic activity on allogenic T cells of DC from the different conditions was
monitored. Mature DC without further additives were used as positive control.
and poly I:C (Figure 4). This indicates that once differentiated, DC
are less sensitive to the effects of VEGF or RCC supernatants with
regard to activation/maturation, at least when triggered by these
powerful maturation-inducing agents.
DISCUSSION
The treatment of metastatic kidney cancer has rapidly evolved
during the last few years, and a large number of targeted molecules
have either already shown efficacy in phase III trials or are
in advanced stage of clinical development, replacing former
immunotherapeutic approaches (Schrader and Hofmann, 2008).
Nevertheless, immunotherapy may retain a role in the treatment of
this disease. It must be remembered that the only treatment that
can induce cure in some patients with metastatic renal cell
cancer is high-dose intravenous IL-2 (Yang et al, 2003b;
McDermott et al, 2005). Moreover, immunotherapy with vaccines
is the only treatment that has shown clinical efficacy as an adjuvant
treatment of resected RCC (Jocham et al, 2004). Finally, a large
number of treatments based on the modulation of immunotherapy
are being developed (Melero et al, 2007) and some of them
are being tested in patients with metastatic RCC, suggesting
that, in the near future, combinations of targeted agents with
new immunotherapeutic approaches might become a reality
& 2009 Cancer Research UK
7
Immature DC (iDC)
Mature DC (mDC)
mDC+VEGF (25 ng ml1)
mDC+VEGF/Bevacizumab (1 g ml1)
mDC+VEGF/Sorafenib (10 ng ml1)
mDC+VEGF/Sunitinib (10 ng ml1)
(pg ml1)
A 20 000
15 000
10 000
5000
1500
1200
900
300
200
100
0
IL-12
IL-6
IL-10
IL-8
Control
RCC-10 supernatant (Sup) 1:5
Sup+bevacizumab (1 g ml1)
Sup+sorafenib (10 ng ml1)
Sup+sunitinib (10 ng ml1)
Sup+bevacizumab/sorafenib
Sup+bevacizumab/sunitinib
Sup+sorafenib/sunitinib
(pg ml1)
10 000
5000
200
100
0
IL-12
IL-10
IL-6
IL-8
Figure 5 Dendritic cell differentiation in the presence of RCC supernatants or sunitinib shows less IL-12 production. Cytokines were measured by CBA
assays in the supernatant of the indicated DC cultures treated for the length of their differentiation from monocytes as indicated. All the experiments were
performed with mature DC except when indicated as immature DC. (A) The effect of VEGF and drug inhibitors is shown, whereas the effect of RCC
supernatants, along with bevacizumab, sorafenib, sunitinib or its combinations, at the indicated concentrations is shown (B).
despite the fact that the concentrations used were in the range as
those observed in cancer patients (31.8 65.9 ng ml1) (Faivre et al,
2006). The immune phenomena of these kinds in RCC patients
might be crucial.
To mimic in vivo conditions, we assessed the effects of
differentiating DC in the presence of VEGF-containing supernatants from RCC cell lines cultured under hypoxic conditions.
The supernatants induced a strong inhibition of DC differentiated
in such a manner that it was not reverted by the addition of any of
the anti-VEGF tested drugs. Moreover, combinations of the drugs
did not have any restoring effects on the MLR decrease induced by
the supernatants. Fractionation of those supernatants showed that
small molecule/s 43.5 kDa and o10 kDa suppressed the MLR
activity of DC, and that such molecules were thermostable. For this
reason, metabolic products, such as tryptophan metabolites, can
British Journal of Cancer (2009), 1 9
8
3H-Thymidine uptake (c.p.m.)
120 000
100 000
Control
RCC-10 Supernatant (Sup) 1:5
80 000
60 000
40 000
20 000
0
100
1000
No. of DC
10 000
ACKNOWLEDGEMENTS
This study was supported by the Spanish Society of Medical
Oncology (SEOM), Departamento de Salud del Gobierno de
Navarra (Beca Ortiz de Landazuri), Ministerio de Sanidad (Fondo
de Investigacion Sanitaria, PI060932), Ministerio de Sanidad
& 2009 Cancer Research UK
9
(Fondo de Investigacion Sanitaria, EC07/90133) and by Pfizer Inc.
We are indebted to Leyre Urruticoechea for providing sorafenib.
REFERENCES
Conejo-Garcia JR, Benencia F, Courreges MC, Kang E, Mohamed-Hadley A,
Buckanovich RJ, Holtz DO, Jenkins A, Na H, Zhang L, Wagner DS,
Katsaros D, Caroll R, Coukos G (2004) Tumor-infiltrating dendritic cell
precursors recruited by a beta-defensin contribute to vasculogenesis
under the influence of Vegf-A. Nat Med 10: 950 958
Coppin C (2008) Immunotherapy for renal cell cancer in the era of targeted
therapy. Expert Rev Anticancer Ther 8: 907 919
Cuevas Y, Hernandez-Alcoceba R, Aragones J, Naranjo-Suarez S,
Castellanos MC, Esteban MA, Martn-Puig S, Landazuri MO, del Peso
L (2003) Specific oncolytic effect of a new hypoxia-inducible factordependent replicative adenovirus on von Hippel Lindau-defective renal
cell carcinomas. Cancer Res 63: 6877 6884
Dannull J, Su Z, Rizzieri D, Yang BK, Coleman D, Yancey D, Zhang A,
Dahm P, Chao N, Gilboa E, Vieweg J (2005) Enhancement of vaccinemediated antitumor immunity in cancer patients after depletion of
regulatory T cells. J Clin Invest 115: 3623 3633
Das T, Sa G, Paszkiewicz-Kozik E, Hilston C, Molto L, Rayman P, Kudo D,
Biswas K, Bukowski RM, Finke JH, Tannenbaum CS (2008) Renal cell
carcinoma tumors induce T cell apoptosis through receptor-dependent
and receptor-independent pathways. J Immunol 180: 4687 4696
Escudier B, Eisen T, Stadler WM, Szczylik C, Oudard S, Siebels M,
Negrier S, Chevreau C, Solska E, Desai AA, Rolland F, Demkow T,
Hutson TE, Gore M, Freeman S, Schwartz B, Shan M, Simantov R,
Bukowski RM, TARGET Study Group (2007a) Sorafenib in advanced
clear-cell renal-cell carcinoma. N Engl J Med 356: 125 134
Escudier B, Pluzanska A, Koralewski P, Ravaud A, Bracarda S, Szczylik C,
Chevreau C, Filipek M, Melichar B, Bajetta E, Gorbunova V, Bay JO,
Bodrogi I, Jagiello-Gruszfeld A, Moore N, AVOREN Trial investigators
(2007b) Bevacizumab plus interferon alfa-2a for treatment of metastatic
renal cell carcinoma: a randomised, double-blind phase III trial. Lancet
370: 2103 2111
Finke JH, Rini B, Ireland J, Rayman P, Richmond A, Golshayan A, Wood L,
Elson P, Garcia J, Dreicer R, Bukowski R (2008) Sunitinib reverses type-1
immune suppression and decreases T-regulatory cells in renal cell
carcinoma patients. Clin Cancer Res 14: 6674 6682
Faivre S, Delbaldo C, Vera K, Robert C, Lozahic S, Lassau N, Bello C,
Deprimo S, Brega N, Massimini G, Armand JP, Scigalla P, Raymond E
(2006) Safety, pharmacokinetic, and antitumor activity of SU11248 a
novel oral multitarget tyrosine kinase inhibitor, in patients with cancer.
J Clin Oncol 24: 4 5
Gabrilovich DI, Chen HL, Girgis KR, Cunningham HT, Meny GM, Nadaf S,
Kavanaugh D, Carbone DP (1996) Production of vascular endothelial
growth factor by human tumors inhibits the functional maturation of
dendritic cells. Nat Med 2: 1096 1103
Gabrilovich D, Ishida T, Oyama T, Ran S, Kravtsov V, Nadaf S, Carbone DP
(1998) Vascular endothelial growth factor inhibits the development of
dendritic cells and dramatically affects the differentiation of multiple
hematopoietic lineages in vivo. Blood 92: 4150 4166
Gabrilovich DI, Ishida T, Nadaf S, Ohm JE, Carbone DP (1999) Antibodies
to vascular endothelial growth factor enhance the efficacy of cancer
immunotherapy by improving endogenous dendritic cell function. Clin
Cancer Res 5: 2963 2970
Hipp MM, Hilf N, Walter S, Werth D, Brauer KM, Radsak MP, Weinschenk
T, Singh-Jasuja H, Brossart P (2008) Sorafenib, but not sunitinib, affects
function of dendritic cells and induction of primary immune responses.
Blood 111: 5610 5620
Jocham D, Richter A, Hoffmann L, Iwig K, Fahlenkamp D, Zakrzewski G,
Schmitt E, Dannenberg T, Lehmacher W, von Wietersheim J, Doehn C
(2004) Adjuvant autologous renal tumour cell vaccine and risk of tumour
progression in patients with renal-cell carcinoma after radical nephrectomy: phase III, randomised controlled trial. Lancet 363: 594 599
Karaman MW, Herrgard S, Treiber DK, Gallant P, Atteridge CE, Campbell
BT, Chan KW, Ciceri P, Davis MI, Edeen PT, Faraoni R, Floyd M, Hunt
JP, Lockhart DJ, Milanov ZV, Morrison MJ, Pallares G, Patel HK,
Pritchard S, Wodicka LM, Zarrinkar PP (2008) A quantitative analysis of
kinase inhibitor selectivity. Nat Biotechnol 26: 127 132
FIGURAS SUPLEMENTARIAS________________________
(Influence of bevacizumab, sorafenib and sunitinib as single agents or in combination on the
inhibitory effects of vegf on human dendritic cell differentiation from monocytes. C Alfaro, N
Surez et al. British Journal of Cancer, 2009 Abril 7; 100 (7): 1111-9)
109
Supplementary Figure 1
110
Supplementary Figure 2
111
Supplementary Figure 3
Supplementary Figure 3.
DC differentiated with VEGF did not repress MLR stimulating activity when added at different
ratios to DC:T co-cultures.
Supplementary Figure 4
Supplementary Figure 4.
Effects on IL-12 production of lower concentrations of sunitinib, than those shown in figure 5
under identical conditions to promote maturation with TNF-, IFN- and poly I:C.
112
Supplemenatry Figure 5
Supplementary Figure 5.
FACS analysis by indirect immunofluorescencce with specific mAb of surface VEGFRs
expression on monocytes and DC derived from monocytes
113
Gene Therapy and Hepatology Division, Centro de Investigacin Mdica Aplicada (CIMA),
Pamplona, Spain; 2 Biochemistry Department, Clnica Universidad de Navarra, Pamplona,
Spain; 3 Medical Oncology Department, Clnica Universidad de Navarra, Pamplona, Spain.
115
Abstract
Background: Interleukin-8 (IL-8, CXCL8) is readily produced by human malignant cells. Dendritic cells (DC) both produce IL-8
and express the IL-8 functional receptors CXCR1 and CXCR2. Most human colon carcinomas produce IL-8. IL-8 importance in
malignancies has been ascribed to angiogeneis promotion.
Principal Findings: IL-8 effects on human monocyte-derived DC biology were explored upon DC exposure to recombinant
IL-8 and with the help of an IL-8 neutralizing mAb. In vivo experiments were performed in immunodeficient mice
xenografted with IL-8-producing human colon carcinomas and comparatively with cell lines that do not produce IL-8.
Allogenic T lymphocyte stimulation by DC was explored under the influence of IL-8. DC and neutrophil chemotaxis were
measured by transwell-migration assays. Sera from tumor-xenografted mice contained increasing concentrations of IL-8 as
the tumors progress. IL-8 production by carcinoma cells can be modulated by low doses of cyclophosphamide at the
transcription level. If human DC are injected into HT29 or CaCo2 xenografted tumors, DC are retained intratumorally in an IL8-dependent fashion. However, IL-8 did not modify the ability of DC to stimulate T cells. Interestingly, pre-exposure of DC to
IL-8 desensitizes such cells for IL-8-mediated in vitro or in vivo chemoattraction. Thereby DC become disoriented to
subsequently follow IL-8 chemotactic gradients towards malignant or inflamed tissue.
Conclusions: IL-8 as produced by carcinoma cells changes DC migration cues, without directly interfering with DC-mediated
T-cell stimulation.
Citation: Alfaro C, Suarez N, Martnez-Forero I, Palazon A, Rouzaut A, et al. (2011) Carcinoma-Derived Interleukin-8 Disorients Dendritic Cell Migration Without
Impairing T-Cell Stimulation. PLoS ONE 6(3): e17922. doi:10.1371/journal.pone.0017922
Editor: R. Mosley, University of Nebraska Medical Center, United States of America
Received August 18, 2010; Accepted February 17, 2011; Published March 14, 2011
Copyright: 2011 Alfaro et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Financial support was from MEC/MICINN (SAF2005-03131 and SAF2008-03294), Departamento de Educacion del Gobierno de Navarra, Departamento
de Salud del Gobierno de Navarra (Beca Ortiz de Landazuri), Redes tematicas de investigacion cooperativa RETIC (RD06/0020/0065), Fondo de investigacion
sanitaria (FIS PI060932), European commission 7th framework program (ENCITE) and SUDOE-IMMUNONET, Fundacion Mutua Madrilena, and UTE for project
FIMA. CA is supported by Fundacion Cientfica de la Asociacion Espanola Contra el Cancer (AECC). SH-S receives a Ramon y Cajal contract from Ministerio de
Educacion y Ciencia and AP a scholarship from FIS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the
manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: imelero@unav.es
. These authors contributed equally to this work.
" These authors also contributed equally to this work.
Chemokine receptors guide DC in physiology and in inflammation [7,8]. DC migration from inflamed/infected [9] or
malignant tissues [10,11] is important for the orchestration of
immune responses. Chemokine receptors do not only regulate
motility but also control other cellular functions such as activation
or survival in various cell types [11,12]. Therefore it would not be
a surprise if the chemokine microenvironment modified DC
functions other than migration [12].
Human tumor cells produce IL-8 in most cases [1,13] as a
biological dirty trick played by the malignant tissue to promote
angiogenesis [3,13,14,15] and possibly to support the type of
smoldering inflammation that promotes tumor progression and
metastasis [14,16,17]. Tumor growth in human patients statistically correlates with IL-8 serum concentrations [3,18]. Recently, a
role for IL-8 has been described in the resistance to antiangiogenic
Introduction
111
Mouse tumors
Methods
Ethics statement
Animal studies have been performed in accordance with
Spanish legislation under specific approval from the institutional
ethics board by the Comite de Etica para la Experimentacion Animal of the
University of Navarra (Study 03/007 approval). Human cells are
obtained from Blood donors (public blood bank of Navarra) under
written informed consent for research.
In vivo migration
Dendritic cells were generated from filter buffy coats (FBC)derived monocytes donated by healthy donors [30] who explicitly
sign a written informed consent. To generate immature DCs from
monocytes, human peripheral blood was isolated by Ficoll-Paque
gradient centrifugation from FBC. Isolated mononuclear cells
from these sources were subjected to positive selection using antiCD14-conjugated paramagnetic beads and purified using the
AutoMacs system according to the manufacturers instructions
(Miltenyi Biotec, Bergisch Gladbach, Germany). Purified monocytes were cultured for 7 days in RPMI-1640 with 5% (v/v) heat
inactivated FCS. To differentiate dendritic cells from CD14+ cells,
culture medium was supplemented with GM-CSF (1000 U/mL;
Novartis, Basel, Switzerland) and IL-4 (500 U/mL; R&D Systems,
Minneapolis, MN). DCs were matured adding clinical grade TNFa (50 ng/mL; Boehringer Ingelheim, Ingelheim, Germany), IFN-a
(1,000 IU/mL; Schering-Plough, Kenilworth, NJ) and Poly I:C
(10 mg/mL; Ampligen, Bioclones, Tokai, South Africa) for 48 h.
Statistics
FACS analysis
Results
HT29 and CaCo2 tumor cell lines xenografted into
immunodeficient mice generate tumors that produce
IL-8
A panel of human colon carcinomas was tested in order to
identify cultures that produce high amounts of IL-8 to the
supernatant [1]. All clonal subcultures of HT29 showed high
homogeneous outputs of IL-8 while the SW48 cell line did not
reach detectable levels in any experiment, and CaCo2 subcultures
showed around one half of the production when compared to the
levels attained by HT29 cells cultured at identical density for the
same period of time (Figure S1). Microenvironment conditions
and therapy may modify the ability of tumor cells to produce IL-8.
Figure 1A shows that the production of IL-8 secreted to culture
supernatants by viable HT29 cells was reduced in 24 h by
exposure to low concentrations cyclophosphamide, while cells still
preserved membrane integrity (.90% viability by trypan blue
exclusion). Interestingly, the low range of cyclophosphamide
concentrations was more effective at preventing IL-8 bioproduction and secretion to the supernatant. Gemcitabine and radiation
did not or more weakly affected IL-8 secretion (Figure 1A and data
not shown). Moreover, in a repeated set of experiments
semiquantitative RT-PCR for IL-8 in comparison with the house
keeping mRNA b-actin showed that cyclophosphamide inhibits
IL-8 production at the mRNA level in a dose-dependent manner
(Figure 1B), in such a way that low dose cyclophosphamide was
better at mediating this effect than higher concentrations.
These results open the possibility that IL-8 production can be
acutely reduced by cyclophosphamide for therapeutic purposes.
Indeed, metronomic cyclophosphamide is becoming an attractive
alternative for cancer management [31] and potentiation of a
variety of immunotherapies [32].
When HT29 was xenografted in athymic nude mice, it gave rise
to subcutaneous nodules that grew steadily over time (Figure 1C).
Sequential sera samples from such animals contained increasing
concentrations of IL-8 (Figure 1C) that correlated with tumor
progression as reported in human patients [3].
CaCo2 failed to graft as subcutaneous nodules in two thirds of
cases (data not shown), but grafted homogeneously as multiple
peritoneal nodules if injected intraperitoneally (Figure S2). CaCo2grafted animals also showed circulating IL-8 (Figure S2) but at
lower concentrations if compared to HT29-bearing mice, as
expected from the productions of IL-8 in the cell line cultures.
Apart from this quantitative difference, the tendency was similar in
tumors from both cell lines.
Importantly, treatment of mice with a single dose of 3 mg/mouse
of cyclophosphamide reduced the serum concentration of IL-8 in
the next 24 h in a range from 48 to 100% (Figure 1D), while those
concentrations rapidly rebound in 4872 h. It is of note that for this
experiment mice with 7-day palpable tumor xenografts were used,
so the concentrations of IL-8 in plasma were still low.
In conclusion, xenografted colon carcinomas retain the property
of producing high amounts of human IL-8, and our results
indicate that such a function could be modified by cyclophosphamide.
Figure 1. HT29 cells when xenografted secrete IL-8 to the plasma of the mice. ELISA determination of IL-8 in the supernatant of HT29
confluent cultures in the presence of indicated concentrations of cyclophosphamide (1000 to 0.001 mg/mL), or gemcitabine (1000 to 0.1 mg/mL)
during the 24 h prior to supernatant collection. When indicated the solution vehicle of both drugs was added at the highest concentration. Results
represent mean6SEM from three experiments. (B) Separate set of experiments as in A but in this case HT29 were collected and IL-8 mRNA was
quantified by RT-PCR. PCR bands are shown in the upper panel and densitometry quantitative data given in the lower panel representing relative
expression of IL-8 mRNA in comparison with b-actin mRNA. (C) Subcutaneously xenografted HT29 cells in Rag2/2 IL-2Rc2/2 mice gave rise to
progressing tumors (left axis depicting mean tumor diameter) and increasing serial serum concentrations of human IL-8 (right axis). Results represent
mean6SEM of three independent experiments with 6 mice per experiment. Similar results were observed with CaCo2 tumors xenografted in the
peritoneal cavity (Figure S1). (D) IL-8 serum concentrations of three individual Rag2/2 IL-2Rc2/2 mice bearing HT29 tumors for seven days before a
single intraperitoneal injection of 3 mg of cyclophosphamide and 24 and 48 h after treatment. The percentages of reduction at 24 h are indicated.
Experiments were repeated at least three times with the exception of (D) that was performed with three individual animals.
doi:10.1371/journal.pone.0017922.g001
Figure 2. IL-8 produced by tumor cells in vivo retains DC inside xenografted tumor nodules. (A) HT29 was xenografted into Rag2/2 IL2Rc2/2 double KO mice. Tumor nodules, 812 mm in diameter, were injected with 56106 PKH26-labeled monocyte-derived DC. When indicated, the
100 mL DC suspensions contained 100 mg/mL of mouse IgG (control antibody) or anti-IL-8 neutralizing mAb. The figure shows the proportion of
PKH26+ events with respect to total tumor cells upon FACS analysis, three days after DC injection. Four mice with two bilateral xenografted tumors
each per condition were used. Of note, DC cultured in the presence of the anti-IL-8 mAb at 100 mg/mL did not show loss of viability at least in 72 h
(data not shown). (B) Representative FACS dot plots from A in two tumor nodules from two mice are shown as an example. Similar data were
obtained with xenografts of the CaCo2 cell line (Figure S2). (C) Absence of PKH26-labeled DC in 3 out of 3 SW48 xenografts processed as in A,
following injection of fluorescence labeled human DC. In the left dot-plot, the fluorescence intensity of injected PKH26-labeled DC is shown for
reference. Dot plots are from representative experiment of two actually performed with three animals per group each.
doi:10.1371/journal.pone.0017922.g002
Figure 3. IL-8 does not impair T cell stimulation by DC that express functional CXCR1 and CXCR2. (A) Human monocyte-derived DC and
T-cells were seeded in the indicated proportions. Functional recombinant IL-8 was added at different concentrations as indicated in the graph
legends. T-cell proliferation was measured by 3H-thymidine incorporation 3 days later. A representative case out of three independently performed
experiments with cells from different combinations of donors is shown. (B) Experiments as in A, but in this case DC were incubated with the indicated
amounts of IL-8 added to monocytes during the 7-day differentiation culture in the presence of GM-CSF+IL-4. A representative experiment out of at
least three is shown. (C) Similar experiments as in B but in this case IL-8 at the indicated concentrations was added during the maturation 48 h culture
onto differentiated DC matured for 48 h with IFN-a, TNF-a and poly I:C. A representative experiment out of at least three performed is shown. As a
control every IL-8 batch was shown to readily attract human PMNs in chemotaxis assays (Figure S3). (D) Mature DC as those used for the MLRs were
tested by indirect immunofluorescence for the expression of CXCR1 and CXCR2. Incubation with 100 ng/mL of IL-8 during 2 h resulted in a loss of
fluorescence intensity upon immunostaining of the surface receptors indicating receptor internalization. The mean fluorescence intensity (MFI) of
each histogram is provided. FACS Experiments were repeated in two occasions with similar results.
doi:10.1371/journal.pone.0017922.g003
Figure 4. Impairment of DC-induced human T-cell proliferation inside the peritoneum of HT29 xenografted mice. (A) Rag2/2 IL-2cR2/2
mice (3 per group) were xenografted with HT29 cells or remained tumor-free. Four weeks later mice received intraperitoneal injections of human PKH2labeled PBLs and fully allogenic mature DC (ratio 5:1 to a total of 66106 cells). Proliferation was monitored four days later by dye dilution on FACS-gated
lymphocytes from peritoneal lavages by dilution of the fluorescent dye. In the group of indicated mice an intraperitoneal injection of 100 mg of neutralizing
anti-IL-8 mAb was provided immediately following the injection of PBLs and DC. Percentages of dividing lymphocytes in each log cursor interval are shown
in the histograms. Fluorescence intensity in the input undivided PBL was over 95% above the third log interval (upper histogram). (B) Similar experiments as
in A, quantifying PKH2-dilution as the percentage of cells that reach the 3rd and 4th log scales of the flow cytometry histograms. Log regions are depicted in
the upper histogram of A. Data from animals bearing subcutaneous SW48 xenografts, that do not produce IL-8, have been included. Data represent
mean6SD.
doi:10.1371/journal.pone.0017922.g004
should be attracted to the tumor nodule. Indeed, fluorescencelabelled DC were recovered from the tumor tissue and such
migratory behaviour was inhibited if DC were co-injected with the
neutralizing anti-IL-8 mAb (Figure 7B). More importantly, preexposure of the DC cultures to IL-8 for 24 h prior to injection also
greatly impaired the migration towards the tumor. Therefore
tumors can attract DC by means of IL-8 but chronic exposure to
IL-8 desensitizes DC for this in vivo migration. Owing to these
effects, IL-8 produced at malignant lesions profoundly impairs the
migratory orientation of DC.
Figure 5. DC pre-exposed to IL-8 become desensitized to respond to carcinoma-derived IL-8 as a chemoattractant. (A) Chemotaxis
assays were set up with HT29 confluent monolayers in the lower chamber and fluorescent DC in the upper chamber. Phase contrast microscopy
images and the corresponding UV fluorescence microscopic fields of the lower chamber are shown. When indicated the lower chamber contained
neutralizing anti-IL-8 mAb (20 mg/mL) or the DC had been pre-exposed for 24 h to recombinant IL-8 (1 mg/mL). (B) In the upper panel representation
of data from three independent experiments similarly performed to those in A with HT29 cells represented as mean6SD in which four random fields
were counted for each triplicate well. In the lower panel experiments performed as in A, but in this case the confluent monolayers in the lower
chamber were formed by SW48 cells that do not produce IL-8. (C) Experiments as in A, but in this case HT29 cells had been pretreated with various
cyclophosphamide concentrations for 24 h as indicated in the figure. Results represent mean6SD.
doi:10.1371/journal.pone.0017922.g005
Discussion
By producing IL-8, tumors may profoundly alter the migrationguiding gradients of this important chemokine in the tissues of
tumor-bearing hosts [33]. Indeed, the chemokine network is well
known to modify cancer biology in multiple ways from metastasis
and angiogenesis to the attraction of a nurturing leukocyte
infiltrates [33]. In this study, we demonstrate that IL-8 as
produced by human tumor cells is capable of attracting (or
retaining) human DC in vivo, but that IL-8 does not functionally
affect the ability of DC to stimulate alloreactive T cells.
We found that at least in vitro, IL-8 production by tumor cells
can be decreased by low dose cyclophosphamide at the protein
and mRNA level. In vivo this is reflected by transient decreases in
PLoS ONE | www.plosone.org
Figure 6. DCs retain neutrophils in migration assays towards IL-8 and attract neutrophils in an IL-8-dependent fashion. (A) Transwell
chemotaxis assays were set up with PKH2-labeled neutrophils. Neutrophils migrated to recombinant IL-8 added to the lower chamber. However, if
neutrophils are seeded in the upper chamber together with DC (1:1) migration is totally impaired. Of note there is IL-8 by the DC as shown in figure
S6A. This experiment is representative of two independently performed in triplicate wells with migration lasting for 120 min. (B) Percentage of
migration of PKH2-labeled neutrophils that were seeded into the upper chamber of transwell migration assays towards recombinant IL-8 or DC
placed in the lower chamber. When indicated, IL-8-neutralizing mAb (20 mg/mL) was added to the lower chamber along with the DC. Migration was
analyzed at 120 minutes. Similar experiments analyzed as early as 60 minutes rendered similar results (data not shown). Results are representative of
two separate triplicate experiments independently performed. Asterisks indicate statistical significance p,0.01 in students t tests.
doi:10.1371/journal.pone.0017922.g006
10
Figure 7. HT29 xenografts attract human DC injected in the subcutaneous tissue which surrounds the tumor. (A) Mice bearing HT29
established xenografts as the one shown in the pictures were injected approximately 5 mm away from the tumor lesion with 56106 human
immature DC labelled with PKH2 that were resuspended in 50 ml of saline buffer to form a small subcutaneous bump which disappeared in less than
2 hours. (B) 24 hours later tumors were surgically removed and a cell suspension was obtained in which the number of fluorescent DC were
enumerated by flow cytometry and normalized as the percentage of injected DC that were recovered from the tumor. When indicated DC were pretreated for 24 hours in culture with 1 mg/ml of rIL-8 or DC were co-injected with 100 mg of neutralizing anti-IL8 mAb.
doi:10.1371/journal.pone.0017922.g007
11
Supporting Information
Figure S1 Colon carcinoma cell lines HT29 and CaCo2
produce high levels of IL-8 in a clonal stable fashion
while SW48 does not produce IL-8. Clonal limiting dilution
subcultures (four for each cell line) of the colon cancer-derived cell
lines HT29, CaCo2 and SW48 were tested for the production of
IL-8 as measured in 24 h culture supernatants by ELISA.
(TIF)
Figure S2 CaCo2 carcinoma cells xenografted in immunodeficient mice develop progressive intraperitoneal
tumors that correlate with raising serum concentrations
of IL-8. Intraperitoneally xenografted CaCo2 cells developed
progressive peritoneal colon carcinomas in athymic nude mice
(measured as weight increase in the left axis) and accumulated
increasing concentrations of serum IL-8 (right axis).
(TIF)
Figure S3 DC are retained inside CaCo2 tumors in a IL8-dependent fashion. CaCo2 cells were xenografted in athymic
nude mice. Only 1/3 of such animals successfully xenografted
tumor lesions. Tumor nodules, 812 mm in diameter, were
injected with CFSE-labeled human DC derived from monocytes,
as in A. DC were injected in 100 mL of saline buffer with control
antibody or neutralizing anti-IL-8 mAb. In these cases, tumors
were homogenated and cleared of debris by centrifugation.
Fluorescence in the lysate was measured in a fluorimeter. The
amount of fluorescence remaining in the tumor compared to that
present in the lysate from an identical number of DC before being
injected in the tumor was quantitated. Data are presented as the
percentage of fluorescence lost from the tumor. Experiments were
performed with four mice bearing a single tumor nodule. The inset
shows a correlation of fluorescence (arbitrary units) and number of
DC in lysates containing increasing amounts of CFSE-labeled DC.
(TIF)
Figure S4 Recombinant IL-8 rendering negative results
at modifying DC functionality is capable of attracting
PMNs. Migration transwell assays with purified neutrophils in the
upper chamber and different concentrations of the recombinant
IL-8 in the lower chamber to prove that IL-8 used in figure 3A, B,
C and D was fully functional.
(TIF)
Figure S5 IL-8 does not modify IL-12 nor IL-10 secretion
by DC matured in the presence of LPS+R848 or
trimerized CD40L. IL-12 and IL-10 were quantified in the
supernatant of DC cultures treated with the indicated concentrations of IL-8 during the 48 h maturation culture. Concentrations
(mean6SD) represent triplicate wells from a single experiment.
(TIF)
Figure S6 Activation of antigen specific murine CD4 T
cells by DC in mice bearing HT29 tumors is suppressed
by factors distinct from IL-8. (A) Mouse BM-derived DC
[50,55] were subjected to classical transwell chemotaxis assays
towards culture medium (control), 105 heat-inactivated E. coli
bacteria used as a positive control, or recombinant IL-8 as
indicated. Data show a modest but reproducible attraction of
mouse DC by human recombinant IL-8. (B) Schematic representation of experiments in which HT29-bearing Rag2/2 IL-2Rc2/2
mice were injected in the peritoneal cavity with 56106 CFSElabelled CD4 OT-2 cells [56] and 106 syngeneic DC pulsed with
the OVA323-339 synthetic peptide. (C) Assessment of OT-2 T-cell
proliferation by dilution of CFSE as in figure 4. Experiments were
performed in mice bearing or not HT29 tumors with or without
12
Acknowledgments
Elena Ciordia and Eneko Elizalde are acknowledged for excellent animal
facility management, as well as technical help by Arantza Azpilikueta,
Manuela Gonzalez-Aparicio and Ana Larraga.
Author Contributions
Conceived and designed the experiments: IM JLP-G AG CA NS AR.
Performed the experiments: CA NS AP LE SS EB JD EF. Analyzed the
data: IM SH-S JLP-G IM-F AR AG. Contributed reagents/materials/
analysis tools: IM EF AR. Wrote the paper: IM JLP-G CA NS.
References
16. Lin WW, Karin M (2007) A cytokine-mediated link between innate immunity,
inflammation, and cancer. J Clin Invest 117: 11751183.
17. Rolny C, Capparuccia L, Casazza A, Mazzone M, Vallario A, et al. (2008) The
tumor suppressor semaphorin 3B triggers a prometastatic program mediated by
interleukin 8 and the tumor microenvironment. J Exp Med 205: 1155
1171.
18. Ueda T, Shimada E, Urakawa T (1994) Serum levels of cytokines in patients
with colorectal cancer: possible involvement of interleukin-6 and interleukin-8 in
hematogenous metastasis. J Gastroenterol 29: 423429.
19. Huang D, Ding Y, Zhou M, Rini BI, Petillo D, et al. Interleukin-8 mediates
resistance to antiangiogenic agent sunitinib in renal cell carcinoma. Cancer Res
70: 10631071.
20. Baggiolini M, Moser B, Clark-Lewis I (1994) Interleukin-8 and related
chemotactic cytokines. The Giles Filley Lecture. Chest 105: 95S98S.
21. Baggiolini M, Loetscher P (2000) Chemokines in inflammation and immunity.
Immunol Today 21: 418420.
22. Stillie R, Farooq SM, Gordon JR, Stadnyk AW (2009) The functional
significance behind expressing two IL-8 receptor types on PMN. J Leukoc Biol
86: 529543.
23. Melero I, Vile RG, Colombo MP (2000) Feeding dendritic cells with tumor
antigens: self-service buffet or a la carte? Gene Ther 7: 11671170.
24. Guo J, Zhu J, Sheng X, Wang X, Qu L, et al. (2007) Intratumoral injection of
dendritic cells in combination with local hyperthermia induces systemic
antitumor effect in patients with advanced melanoma. Int J Cancer 120:
24182425.
25. Triozzi PL, Khurram R, Aldrich WA, Walker MJ, Kim JA, et al. (2000)
Intratumoral injection of dendritic cells derived in vitro in patients with
metastatic cancer. Cancer 89: 26462654.
26. Alfaro C, Suarez N, Gonzalez A, Solano S, Erro L, et al. (2009) Influence of
bevacizumab, sunitinib and sorafenib as single agents or in combination on the
inhibitory effects of VEGF on human dendritic cell differentiation from
monocytes. Br J Cancer 100: 11111119.
27. Verdijk P, Aarntzen EH, Lesterhuis WJ, Boullart AC, Kok E, et al. (2009)
Limited amounts of dendritic cells migrate into the T-cell area of lymph nodes
but have high immune activating potential in melanoma patients. Clin Cancer
Res 15: 25312540.
28. de Vries IJ, Lesterhuis WJ, Barentsz JO, Verdijk P, van Krieken JH, et al. (2005)
Magnetic resonance tracking of dendritic cells in melanoma patients for
monitoring of cellular therapy. Nat Biotechnol 23: 14071413.
29. Melief CJ (2008) Cancer immunotherapy by dendritic cells. Immunity 29:
372383.
13
30. Meyer TP, Zehnter I, Hofmann B, Zaisserer J, Burkhart J, et al. (2005) Filter
Buffy Coats (FBC): a source of peripheral blood leukocytes recovered from
leukocyte depletion filters. J Immunol Methods 307: 150166.
31. Gasparini G (2001) Metronomic scheduling: the future of chemotherapy? Lancet
Oncol 2: 733740.
32. Ghiringhelli F, Menard C, Puig PE, Ladoire S, Roux S, et al. (2007)
Metronomic cyclophosphamide regimen selectively depletes CD4+CD25+
regulatory T cells and restores T and NK effector functions in end stage cancer
patients. Cancer Immunol Immunother 56: 641648.
33. Balkwill F (2004) Cancer and the chemokine network. Nat Rev Cancer 4:
540550.
34. Gross MD, Shapiro B, Fig LM, Steventon R, Skinner RW, et al. (2001) Imaging
of human infection with (131)I-labeled recombinant human interleukin-8. J Nucl
Med 42: 16561659.
35. Rossi D, Zlotnik A (2000) The biology of chemokines and their receptors. Annu
Rev Immunol 18: 217242.
36. Tirapu I, Huarte E, Guiducci C, Arina A, Zaratiegui M, et al. (2006) Low
surface expression of B7-1 (CD80) is an immunoescape mechanism of colon
carcinoma. Cancer Res 66: 24422450.
37. Rabinovich GA, Gabrilovich D, Sotomayor EM (2007) Immunosuppressive
strategies that are mediated by tumor cells. Annu Rev Immunol 25: 267296.
38. Zou W, Chen L (2008) Inhibitory B7-family molecules in the tumour
microenvironment. Nat Rev Immunol 8: 467477.
39. Suarez N, Alfaro C, Dubrot J, Palazon A, Bolanos E, et al. Synergistic effects of
CTLA-4 blockade with tremelimumab and elimination of regulatory T
lymphocytes in vitro and in vivo. Int J Cancer.
40. Belladonna ML, Orabona C, Grohmann U, Puccetti P (2009) TGF-beta and
kynurenines as the key to infectious tolerance. Trends Mol Med 15: 4149.
41. Rutella S, Danese S, Leone G (2006) Tolerogenic dendritic cells: cytokine
modulation comes of age. Blood 108: 14351440.
42. Conejo-Garcia JR, Benencia F, Courreges MC, Kang E, Mohamed-Hadley A,
et al. (2004) Tumor-infiltrating dendritic cell precursors recruited by a betadefensin contribute to vasculogenesis under the influence of Vegf-A. Nat Med
10: 950958 Epub 2004 Aug 2029.
43. Gabrilovich DI, Chen HL, Girgis KR, Cunningham HT, Meny GM, et al.
(1996) Production of vascular endothelial growth factor by human tumors
inhibits the functional maturation of dendritic cells. Nat Med 2: 10961103.
44. Aspord C, Pedroza-Gonzalez A, Gallegos M, Tindle S, Burton EC, et al. (2007)
Breast cancer instructs dendritic cells to prime interleukin 13-secreting CD4+ T
cells that facilitate tumor development. J Exp Med 204: 10371047.
45. Herber DL, Cao W, Nefedova Y, Novitskiy SV, Nagaraj S, et al. Lipid
accumulation and dendritic cell dysfunction in cancer. Nat Med 16: 880886.
46. Bell D, Chomarat P, Broyles D, Netto G, Harb GM, et al. (1999) In breast
carcinoma tissue, immature dendritic cells reside within the tumor, whereas
mature dendritic cells are located in peritumoral areas. J Exp Med 190:
14171426.
47. Kikuchi T, Moore MA, Crystal RG (2000) Dendritic cells modified to express
CD40 ligand elicit therapeutic immunity against preexisting murine tumors.
Blood 96: 9199.
48. Miller PW, Sharma S, Stolina M, Butterfield LH, Luo J, et al. (2000)
Intratumoral administration of adenoviral interleukin 7 gene-modified dendritic
cells augments specific antitumor immunity and achieves tumor eradication.
Hum Gene Ther 11: 5365.
49. Nishioka Y, Hirao M, Robbins PD, Lotze MT, Tahara H (1999) Induction of
systemic and therapeutic antitumor immunity using intratumoral injection of
dendritic cells genetically modified to express interleukin 12. Cancer Res 59:
40354041.
50. Tirapu I, Arina A, Mazzolini G, Duarte M, Alfaro C, et al. (2004) Improving
efficacy of interleukin-12-transfected dendritic cells injected into murine colon
cancer with anti-CD137 monoclonal antibodies and alloantigens. Int J Cancer
110: 5160.
51. Gabrilovich DI, Nagaraj S (2009) Myeloid-derived suppressor cells as regulators
of the immune system. Nat Rev Immunol 9: 162174.
52. van Gisbergen KP, Sanchez-Hernandez M, Geijtenbeek TB, van Kooyk Y
(2005) Neutrophils mediate immune modulation of dendritic cells through
glycosylation-dependent interactions between Mac-1 and DC-SIGN. J Exp Med
201: 12811292.
53. Melero I, Arina A, Murillo O, Dubrot J, Alfaro C, et al. (2006) Immunogenic
cell death and cross-priming are reaching the clinical immunotherapy arena.
Clin Cancer Res 12: 23852389.
54. Murillo O, Dubrot J, Palazon A, Arina A, Azpilikueta A, et al. (2009) In vivo
depletion of DC impairs the anti-tumor effect of agonistic anti-CD137 mAb.
Eur J Immunol 39: 24242436.
55. Melero I, Duarte M, Ruiz J, Sangro B, Galofre J, et al. (1999) Intratumoral
injection of bone-marrow derived dendritic cells engineered to produce
interleukin-12 induces complete regression of established murine transplantable
colon adenocarcinomas. Gene Ther 6: 17791784.
56. Barnden MJ, Allison J, Heath WR, Carbone FR (1998) Defective TCR
expression in transgenic mice constructed using cDNA-based alpha- and betachain genes under the control of heterologous regulatory elements. Immunol
Cell Biol 76: 3440.
14
FIGURAS SUPLEMENTARIAS________________________
(Carcinoma-Derived Interleukin-8 Disorients Dendritic Cell Migration without Impairing TCell Stimulation. C. Alfaro; N. Surez et al. PloSONE, 2011; 6(3)).
131
Supplementary Figure 1
Supplementary Figure 1. Colon carcinoma cell lines HT29 and CaCo2 produce high levels
of IL-8 in a clonal stable fashion while SW48 does not produce IL-8.
Clonal limiting dilution subcultures (four for each cell line) of the colon cancer-derived cell
lines HT29, CaCo2 and SW48 were tested for the production of IL-8 as measured in 24 h
culture supernatants by ELISA.
132
Supplementary Figure 2
133
Supplementary Figure 3
134
Supplementary Figure 4
135
Supplementary Figure 5
Supplementary Figure 5. IL-8 does not modify IL-12 nor IL-10 secretion by DC matured
in the presence of LPS+R848 or trimerized CD40L.
IL-12 and IL-10 were quantified in the supernatant of DC cultures treated with the indicated
concentrations of IL-8 during the 48 h maturation culture. Concentrations (meanSD) represent
triplicate wells from a single experiment.
136
Supplementary Figure 6
137
138
Supplementary Figure 7
139
Supplementary Figure 7. DC produce IL-8 and such autocrine IL-8 modulates in part the
surface expression of CXCR1 and CXCR2.
(A) Left axis: IL-8 concentration in the supernatant of mature (mDC) and immature DC (iDC);
Right axis: mRNA encoding IL-8 in the corresponding DC cultures assessed by semi
quantitative RT-PCR.
(B and C) IL-8 concentration in the supernatant (left axes) and CXCR1 (B) and CXCR2 (C)
surface expression as mean fluorescence intensity (MFI) analyzed by FACS (right axes). In B
and C a mAb neutralising IL-8 (20 g/ml) was added when indicated, or the DC were cultured
under gentle agitation at the cellular densities given. Results are presented as meanSD from
triplicate experiments. IL-8 neutralisation or lower IL8 concentrations in the supernatants
correlate with higher MFIs for CXCR1 and CXCR2 on the DC.
(D) Shows representative FACS histograms from B and C.
140
Supplementary Figure 8
141
Supplementary Table 1
142
143
IJC
International Journal of Cancer
Tumor Immunology
Anti-CTLA-4 monoclonal antibodies (mAb) that block the interaction of CTLA-4 with CD80 and CD86 such as tremelimumab and
ipilimumab are currently being tested in the clinic for cancer treatment exploiting their properties to de-repress tumor-specific
cellular immunity. Addition of the fully human anti-CTLA-4 (tremelimumab) to cultures of human T cells with allogenic
dendritic cells (DCs) did not increase proliferation. Magnetic bead-mediated elimination of CD41 CD251 regulatory T cells
(Treg) before setting up those alloreactive cultures also largely failed to increase primary proliferation. In contrast,
predepletion of CD41 CD251 Treg and culture in the presence of tremelimumab synergistically resulted in increased
proliferation and DC:T-cell aggregation. These effects were much more prominent in CD4 than in CD8 T cells. The synergy
mechanism can be traced to enhanced CTLA-4 expression in effector cells as a result of Treg elimination, thereby offering more
targets to the blocking antibody. Human T cells and allogenic DCs (derived both from healthy donors and advanced cancer
patients) were coinjected in the peritoneum of Rag22/2 IL-2Rc2/2 mice. In these conditions, tremelimumab injected
intravenously did not significantly enhance alloreactive proliferation unless Treg cells had been predepleted. Synergistic effects
in vivo were again largely restricted to the CD4 T-cell compartment. In addition, Treg depletion and CTLA-4 blockade
synergistically enhanced specific cytotoxicity raised in culture against autologous EBV-transformed cell lines. Taken together,
these experiments indicate that tremelimumab therapy may benefit from previous or concomitant Treg depletion.
hundred fold more avidity than CD28 for the CD80 and
CD86 countereceptors.1 CTLA-4 has been demonstrated to
be an inhibitory (or co-inhibitory) molecule for T cells in
culture.3 It is expressed on the surface of regulatory T cells
(Treg), and becomes intracellularly expressed in activated
effector T cells. Indeed, its absence from the genome in
mice determines a severe autoimmunity phenotype that
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
Suarez et al.
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
Peripheral Blood mononuclear cells (PBMC) from FBC were isolated by Ficoll-Paque Plus (GE Healthcare, Piscataway, NJ) gradient centrifugation. To obtain CD8 T cells, PBMC were subjected
to positive selection using anti-CD8-conjugated paramagnetic
beads (Miltenyi Biotec). To obtain CD4 T cells and CD4
CD25 T cells, PBMC were isolated using a CD4 CD25 Regulatory T Cell Isolation Kit, according to the manufacturers manual (Miltenyi Biotec). T cells were routinely analyzed by ow
cytometry and the purity of selections were >98%.
Cell culture and reagents
Tumor Immunology
375
376
specic lysis at the indicated effector to target cell ratios was analyzed using lymphocytes from day 7 of cocultures as effector
cells. Cytotoxicity performed in triplicate U-bottomed wells and
calculations were performed as published previously.36
Statistical analysis
Tumor Immunology
Results
In vitro mixed lymphocyte reactions
Human peripheral blood lymphocyte (PBL) or PBL without
Treg were stained with 2.5 lM of CFSE (Invitrogen). To have
a reference of CFSE intensity, a sample of PBL was xed
with paraformaldehyde 10% the rst day of experiment.
A total of 106 DC and 107 PBL or PBL without Treg (1:10
ratio) were injected into the peritoneum of Rag2/ IL-2Rc/
mice (on the basis of protocol approval by the animal experimentation committee of the University of Navarra). AntiCTLA-4 mAb (tremelimumab, 10 mg/kg) were administrated
intravenously to the indicated the mice. As a control antibody, other mice were treated with human IgG (Beriglobina
P). After 3 days, intraperitoneal lavages were obtained, cells
were stained with anti-human CD4 and anti-human CD8
and xed with paraformaldehyde 10% to be analyzed by ow
cytometry using a FACSCalibur Flow Cytometer (Benton
Dickinson). The number of T-cell divisions is proportional to
dilution of CFSE intensity.
FACS and enumeration of DC:T-cell aggregates
As shown in Figure 1a, with four representative cases, combination of alloreactive co-cultures of PBL and mature DC
from different donors undergo an intense degree of DNA
replication in the lymphocyte compartment. In none of the
cases (all of 8), did addition of 15 lg/mL of the human antiCTLA-4 mAb (tremelimumab) increase proliferation over
baseline at the different DC to PBL ratios. When magnetic
beads were used to eliminate CD25 cells prior to culture, a
slight increase was observed in some, but not all cases, in spite
of complete elimination of FoxP3 T cells, as routinely
checked by ow cytometry (Supporting Information Figure 1).
In contrast, pre-elimination of CD4 CD25 T cells and
addition of 15 lg/mL of tremelimumab to the cultures,
resulted in clear increases in proliferation in all of 8 experiments using leukocyte combinations from various healthy
donors (Fig. 1a). This increase was not seen when polyclonal
human IgG was used as control antibody (data not shown).
Such an increase was also seen but less clearly when immature DCs were used (Supporting Information Figure 2 shows
a representative experiment).
A dose response of tremelimumab in these MLR cultures was
performed in several experiments as the one shown Figure 1b.
Concentrations of tremelimumab as low as 15 lg/mL were already able to mediate the maximal effect on alloreactive proliferation enhancement. Again such enhancement only takes place
when Treg have been predepleted. Similar serial concentrations
of clinical grade polyclonal human IgG (Beriglobina P) used as a
control did not modify the proliferation (data not shown).
Next, we examined the concentration of IFN-c in the
supernatants of these alloreactive mixed leukocyte cultures
(MLR). In this case, tremelimumab did not increase the production of IFN-c in the 3-day co-cultures, while Treg elimination induced a slight increase as shown in Figure 1c.
CTLA-4 is expressed on Treg and in a fraction of activated
T cells in the alloreactive cultures and Treg predepletion
enhances the levels of CTLA-4 expressed by
effector T cells
The main target of tremelimumab in the alloreactive co-cultures was questioned by experiments in Figure 1. It was clear
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
377
Tumor Immunology
Suarez et al.
Figure 1. Treg depletion and anti-CTLA-4 mAb enhance proliferation of T cells in response to mature allogenic DC. (a) PBLs from healthy
donors were mixed at the indicated ratios with fully allogenic mature DC and proliferation of the cultures was assessed by [methyl-3H]
thymidine nuclear uptake. When indicated, Treg (CD25 cells) were magnetically depleted and/or anti-CTLA-4 mAb (15 lg/mL) was added to
the cultures. Data from four representative co-cultures out of eight are presented in different panels indicating the donors of T cells and
DC. (b) Experiment as those in (a) checking the effects of a range of different concentrations of tremelimumab or control immunoglobulin
up to 250 lg/mL. A representative dose-response experiment out of four similarly performed is presented. (c) IFN-c concentration in tissue
culture supernatants of a representative MLR set up as in (a).
Tumor Immunology
378
Productive T-cell activation takes place in molecularly structured interactions across the plasma membranes of T lymphocytes and DC (immunological synapses). Duration and
strength of the synapses have been reported to involve
CTLA-4 function11 and Treg.37
To conrm if the in vitro ndings were sustained in vivo settings, immunodecient mice were adoptively transferred intraperitoneally with PBL and allogenic mature DC (at 10:1
ratio) (Fig. 4a). PBLs were labeled with CFSE so they could
be followed and the dilution of CFSE was used as a correlate
of the experienced proliferation. In some cases, CD4 CD25
Treg cells were magnetically removed from the PBL. When
indicated 10 mg/kg of tremelimumab were injected intravenously immediately following adoptive transfer of the human
cells. Human leukocytes were recovered 3 days later by peritoneal lavages and proliferation was assessed by ow cytometry
(Fig. 4a). Prior to transfer, PBL did not show any proliferation
(Fig. 4b). However, even if injected without DC a number of
T cells undergo a cycle of proliferation (Fig. 4b). When allogenic mature DC are cotransfered into the peritoneal cavity
along with the PBL, lymphocytes readily proliferated. In these
experiments, 10 mg/kg of human IgGs were injected intravenously as a control with no evidence of any enhancing effect.
Intravenous administration of anti-CTLA-4 mAb increased
proliferation with a slight effect that was observed both on
CD4 and CD8-gated lymphocytes (Fig. 4c). Treg predepletion before injection of the PBL also increased proliferation to
some extent in the CD4 and CD8 compartments (Fig. 4c).
It is important to note that FoxP3 events were gated out in
the analysis of the CD4 lymphocyte population.
Strikingly, simultaneous predepletion of Treg and intravenous administration of tremelimumab resulted in a very
intense proliferation during the 72-hr period, which resulted
in marked dilution of CFSE. This marked increase in proliferation was seen only in the gated CD4 T cells, whereas
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
379
Tumor Immunology
Suarez et al.
Figure 2. CTLA-4 is expressed on the surface of FoxP3 cells and in activated effector alloreactive T cells mainly intracellularly. Treg
predepletion leads to higher levels of CTLA-4 expression on CD4 and CD8 effector T lymphocytes. (a) Multicolor FACS staining of
permeabilized cells. FoxP3, CD4 and CD8 co-stainings were used for gating the indicated subpopulations. Experiments were performed on
resting PBL and on MLR cultures on day 5. (b) Similar stainings in cells that were not permeabilized prior to anti-CTLA-4 staining so only
surface expression of this molecule is detected at the same time points analyzed in (a). (c) Intracellular staining of CTLA-4 in FoxP3negative lymphocytes on day 3 of MLRs set up with T cells predepleted or not from Treg cells.
380
Tumor Immunology
Discussion
Our study highlights that the immunotherapeutic effects of
Treg depletion/inactivation in humans may not overlap with
the effects of CTLA-4 blockade with antibodies, thereby
opening up the opportunity for combination treatments. This
is in spite of bright CTLA-4 surface expression on human
and mouse Treg cells that would offer a site of action for
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
Figure 4. Depletion of Treg and administration of tremelimumab synergize to enhance CD4 T-cell alloreactive proliferation in vivo. (a) Rag2/ IL2Rc/ mice were injected intraperitoneally with 107 PBL and 106 mature DC from unrelated donors. PBL were stained with CFSE and cells were
harvested from peritoneal lavages 48 hr later as schematically indicated in (a). In some conditions, Treg were depleted from PBL. When indicated,
anti-CTLA-4 mAb or control antibody was intravenously injected into the mice. (b) Control of CFSE labelling intensity depicting spontaneous
proliferation in 72 hr when PBL were injected without DC and when coinjected with DC and/or human IgG intravenously as a control. (c) CFSE
intensity of expression in total CFSE cells, CD4 FoxP3 gated cells and CD8 gated cells from peritoneal lavages drained from mice
intraperitoneally injected with PBL and mature allogenic DC. When indicated, intravenous treatment with anti-CTLA-4 mAb or control was provided.
When indicated, Treg cells were magnetically predepleted from the input PBL population. Data represent one experiment with two animals per group.
Tumor Immunology
382
Figure 5. Synergy of Treg depletion and treatment with anti-CTLA-4 mAb for the in vivo enhancement of alloreactive proliferation of T cells
from healthy donors and cancer patients. (a) Two experiments as those shown in Figure 5 were performed with four mice per group and
results from individual mice are pooled in this gure. CFSE uorescence was monitored by FACS in CD11c-negative cells eluted from
peritoneal lavages as in Figure 5. Data are presented as the relative number of events in the indicated arbitrary uorescence intensity FL-1
regions (regions 4 and a sum of regions 4 and 3). Such regions as in Figure 5 (depicted in the upper diagram) were set in such a way that
in the case of undivided PBL (those injected without allogenic DC) >95% of events were in region 1. Data on total and gated CD4 and CD8
PBL are individually provided along with the mean represented by a line. (b) Similar experiments as in (a) but with combinations of PBL
and mature DC obtained from advanced metastatic cancer patients (two melanoma cases and three colorectal carcinoma cases). *Indicates
p < 0.01 according to MannWhitney U tests.
CTLA-4 blocking drugs. Paradoxically, elegant genetic evidence in mice pinpoint a critical role for CTLA-4 expression
for the function of Treg cells,6,18 since Treg lacking CTLA-4
molecules fail to control effector T cells and Treg-selective
deciency of CTLA-4 results in lethal autoimmunity.19 However, Allison et al. have elegantly reported using Rag/
reconstituted mice, whose mouse Treg cells express human
CTLA-4 while effector T cells express the murine version,18
that most of the effect of anti-CTLA-4 mAb to enhance antitumor immunity in mice is exerted on effector T cells with a
modest therapeutic effect when only Treg CTLA-4 is blocked
with mAb. Therefore we do not contradict the compelling
genetic evidence that CTLA-4 is a key functional moiety for
Treg. However, our results clearly indicate that blockade of
CTLA-4 with mAb tampers insufciently with Treg functions
while satisfactorily relieving effector T cells from CTLA-4mediated restrain.
We made our observations employing a relatively simple
method to stimulate human T lymphocytes as a result of
allogenic recognition of foreign HLAs on mature DC. This
system allows us to look at the effect of CTLA-4 blockade at
productive T-cell activation events leading to clonal expansion. Although articial, these experiments may represent
events pertaining to activation by other types of antigens
such as tumor or viral antigens presented by DC. The
advantage of the system is that a high fraction CD4 and
CD8 T cells are antigen reactive because of the bias in the
TCR repertoire to recognize foreign HLA molecules. Our
data using these human alloreactive lymphocytes are in
agreement both with those by Rosenberg et al. on the treatment of cancer patients with ipilimumab in whom no
numeric or functional changes of Treg were observed9 and
with our own preliminary results in a clinical trial with tremelimumab. Furthermore, our data are in agreement with the
mentioned weak functional effects exerted by CTLA-4 mAb
blocking antibodies on mouse Treg cells.18
The molecular/cellular mechanism behind the synergy of
Treg depletion and CTLA-4 blockade is interpreted in the
sense that Treg depletion before stimulation of effector T cells
results in enhanced levels of CTLA-4 expression on the effector-to-be lymphocytes. Enhanced CTLA-4 expression on
effector T cells, as we observe in vitro and in vivo, would
more efciently counteract activation, unless blocked with the
anti-CTLA-4 neutralizing mAb. This series of effects provides
a simple and plausible explanation to the synergy between
Treg depletion and CTLA-4 blockade. Indeed, quantitative
changes in the CTLA-4/CD28 competition for their counterreceptors have been described to be functionally important.38
The combined effects of Treg depletion and CTLA-4
blockade with mAb seems to be largely restricted to CD4 T
cells as it is not observed in CD8 counterparts either in
vitro or in vivo. The unexplained molecular reasons behind
these differences between lymphocyte subsets are being currently addressed and do not seem to involve differences in
the levels of CTLA-4 expression on effector cells following
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
383
Tumor Immunology
Suarez et al.
Tumor Immunology
384
Figure 6. CTLA-4 blockade and Treg predepletion enhance cytotoxicity raised in culture against autologous EBV-transformed cells lines.
(a) Two EBV transformed cell lines from independent donors were co-cultured with autologous PBL for 7 days in the presence or
absence of 15 lg/mL of tremelimumab or following CD25 Treg depletion. (b) Cytotoxicity assessed by 5 hr51 Chromium-release assays as
percentage of specic lysis against autologous EBV-transformed B cells is presented at a series of effector to target ratios. HT29 colon
carcinoma cell targets which were used as a specicity control remained under 10% of specic lysis for every condition and E:T ratio
(data not shown). (c) Viable lymphocyte cell recovery (absolute number) upon 7 day co-cultures. Results show a representative of
three independent experiments performed with the two donors.
4. Considering recognition of alloantigens, these phenomena could be also important for graft versus host and
graft versus leukemia effects in bone-marrow transplantation, as suggested by experiments in mice.47
Overall, our results are in agreement with preclinical evidence for such a Treg depletion plus anti-CTLA-4 mAb synergy as reported by the group of Melief in mouse B16 melanoma.31 Importantly, our in vivo observations on this
synergy also take place when using T cells and DC from
advanced cancer patients. The enhancing effect is also
observed against autologous transformed cells at least
in vitro. Moreover, clinical response to anti-CTLA-4 mAb
treatment correlates with high ratios of effector to regulatory cells in the tumor microenvironment further suggesting the appropriateness of approaches tilting this delicate
balance.23 As a consequence, combined approaches consisting of CTLA-4 blockade and depletion/inactivation of Treg
are going to be applied either sequentially or simultaneously to cancer patients in planned clinical trials at our
institution and elsewhere.
Acknowledgements
Enrique Grande-Pulido (Pzer) is acknowledged for the supply of tremelimumab and scientic support. Collaborations and scientic discussions pertaining CTLA-4-related research with Drs. Jesus Prieto, Jose I. Riezu, Pablo
Sarobe and Juan J. Lasarte are also acknowledged including the kind gift
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
Suarez et al.
385
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
Tumor Immunology
References
386
33.
34.
35.
36.
Tumor Immunology
37.
38.
39.
40.
41.
C 2010 UICC
Int. J. Cancer: 129, 374386 (2011) V
FIGURAS SUPLEMENTARIAS________________________
(Synergistic effects of CTLA-4 blockade with tremelimumab and elimination of regulatory T
lymphocytes in vitro and in vivo. N. Surez ; C. Alfaro et al.International J of Cancer, 2010;
129: 374-386).
159
160
Supporting Information Figure 2. CTLA-4 blockade and Treg depletion also enhance
alloreactive proliferation induced by immature DC.
Representative experiment of those in figure 1 but performed with immature monocyte-derived
DC (iDC) that were not exposed to maturation agents prior to setting up the MLR culture.
161
162
163
Supporting Information Figure 4. Series of representative FACS dot plots show the
fractions of the two-colour fluorescent aggregates.
(A) Representative dot plots from experiments presented in figure 4A to assess T cell:DC
aggregates in MLR cultures.
(B) PKH2 fluorescence (FL-1) represented in histograms assessing the dilution of the dye
staining in T lymphocytes due to proliferation.
164
165
Dendritic cells take up and present antigens from viable and apoptotic
polymorphonuclear leukocytes.
Manuscrito en preparacin
167
Dendritic cells take up and present antigens from viable and apoptotic
polymorphonuclear leukocytes.
ABSTRACT
Dendritic cells (DC) are endowed with the ability to cross-present antigens from other cell types
to cognate T cells. DC are poised to meet polymorphonuclear leukocytes (PMNs) as a result of
being co-attracted by interleukin-8 (IL-8), for instance as produced by tumor cells or infected
tissue. Human and mouse DC can readily internalize viable or UV-irradiated PMNs. Such
internalization was abrogated at 4 C and partly inhibited by anti-CD18 mAb. In mice, DC
which had internalized PMNs containing electroporated ovalbumin (OVA) protein, were able to
cross-present the antigen to CD8 (OT-1) and CD4 (OT-2) TCR-transgenic T cells. Moreover, in
humans, tumor cell debris is internalized by PMNs and the tumor-cell material can be
subsequently taken up from the immunomagnetically re-isolated PMNs by DC. Importantly, if
human neutrophils had endocytosed bacteria, they were able to trigger the maturation program
of the DC. Moreover, when mouse PMNs with E. coli in their interior are co-injected in the foot
pad with DC, many DC loaded with fluorescent material from the PMNs reach draining lymph
nodes. Using CT26 (H-2d) mouse tumor cells, it was observed that if tumor cells are
intracellularly loaded with OVA protein, and UV-irradiated, they become phagocytic prey of H2d PMNs. If such PMNs, that cannot present antigens to OT-1 T cells, are immunomagnetically
re-isolated and phagocytosed by H-2b DC, such DC productively cross-present OVA antigen
determinants to OT-1 T cells. In summary, our results indicate that antigens phagocytosed by
short-lived PMNs can be in turn internalized and cross-presented by DC.
169
INTRODUCTION
Neutrophils are the first defense barrier against bacteria or fungi that have penetrated the body
surfaces. Many features equip these cells to perform such a critical function (Borregaard 2010).
Originating in the bone marrow, neutrophils have a short 4h half life in circulation and readily
extravasate upon infection or inflammation in any infected tissue (Ley et al. 2007; Summers et
al. 2010). Neutrophils sense and migrate in response to chemotactic gradients at inflammatory
sites (Ley et al. 2007). Interleukin-8 (Mukaida 2000; Waugh y Wilson 2008), bacterial formyl
peptides and complement factors are the main chemotactic stimuli, while extravasation is
guided by LFA-1 integrin interactions with ICAM-1 (Ley et al. 2007(Ley et al. 2007;
Vestweber 2007). Once in contact with the invading microorganisms, leukocytes degranulate
microbiocide substances, perform phagocytosis and oxidative killing of microorganisms (ElBenna et al. 2009; Borregaard 2010), take up tissular debris, and entrap bacteria by means of
forming trapping nets with their own DNA (Brinkmann et al. 2004; Borregaard 2010). Pus as it
appears in acute inflamed foci is a collection of exudates rich in the remains of neutrophils,
microorganisms, and tissular debris.
Adaptive immune responses rely on antigen presentation to T-cells as performed by
professional dendritic cells (DC) (Steinman 2007). At least some of the DC subsets present in
the body can take-up antigen from third party cells and present them to lymphocytes
(Villadangos y Schnorrer 2007). This process is referred to as antigen cross-presentation
(Carbone y Heath 2010) and can be performed both through the MHC class II and I pathways.
The paucity of cross-presenting DC in human peripheral blood or mouse lymphoid organs has
precluded direct experimentation and therefore most experiments have been performed with DC
differentiated in vitro from their precursors. The ability of DC to stimulate a T-cell response is
not constitutive (Steinman et al. 2003). On the contrary, DC depend on detection of microbial
molecular patterns (Granucci et al. 2005), tissue damage denoting molecules (Klune et al. 2008)
and proinflamatory cytokines to experience their maturation program. Maturation means
migration towards lymphoid organs triggered by CCR7 ligands (MartIn-Fontecha et al. 2003),
brighter surface expression of co-stimulatory molecules for T cells and production of T-cell
stimulating cytokines(Granucci et al. 2005).
An interesting article indicated that DC and neutrophils may interact in the body in sites of
acute inflammation such as a phlegmonous appendicitis (van Gisbergen et al. 2005).
Importantly the Van Kooyk group demonstrated that a molecular interaction dependent on DCSIGN on the DC side and siayil Lewis-Y sugars anchored on the CD11b integrin mediated the
heterotypic adhesion of human PMN to DC (van Gisbergen et al. 2005; van Gisbergen et al.
2005). Other authors have shown that neutrophils enhance the expression of co-stimulatory
170
molecules on DC (van Gisbergen et al. 2005; Yang et al. 2009). There have been also reports of
the ability of neutrophils to directly present antigen to T cells (Beauvillain et al. 2007).
From our point of view, it makes physiological and economic sense that scanty DC would be
able to interact with abundant neutrophils that bear signs of having internalized relevant
microbiological antigens. Such stressed PMN leukocytes would be thereby a concentrated
source of microbiological antigens. Even under sterile conditions neutrophil granule proteins
have been observed to elicit maturation of DC (Soehnlein 2009; Yang et al. 2009; Tewary et al.
2010). However, it is clear that if DC internalized infected neutrophils this would not only
constitute a rich source of microbial antigens, but also a concentrated source of microbial
molecular patterns to elicit DC maturation. If this hypothesis is correct, the ability of PMNs to
ferry antigenic material for DC efficient cross-presentation might be useful in cancer
immunotherapy.
We found that human and mouse DC internalize viable and dead PMNs. Interestingly, if such
PMN had been pre-exposed to dying tumor cells, the tumor-related material ends up being taken
up by DC. We demonstrate in mice that antigens internalized by PMNs can be cross-presented
by DC. Furthermore, intracellular antigens from dead tumor cells can be ferried by PMNs to be
readily up-taken by DC and subsequently cross-presented to CD8+ T cells. The importance of
second and third hand antigen presentation might have been overlooked, and PMN leukocytes
may play a critical role as a source of concentrated antigen and in providing maturation stimuli
to DC.
171
cytospins was performed. Neutrophil purity was >95% (CD15bright neutrophils) (Alfaro et al.
2011).
Purification of mouse neutrophils
BALB/c mice neutrophils were obtained from bone marrow as follows. Hind limbs were
collected in ethanol and bones were cleaned with a scalpel (peeling off as much flesh as
possible). When all bones were cleaned, their ends were cut and a 27G1/2 needle placed in the
central cavity of the long bones to flush them with mouse complete medium [RPMI 10% FBS
(Gibco) + penicillin/ streptomycin (Gibco) + -mercaptoethanol (Gibco)]. An immunomagnetic
selection was made with Ly6G AutoMACS microbeads (Miltenyi Biotec, Bergisch Gladbach,
Germany) obtaining the positive and the negative fractions to monitor cell population
enrichment. Anti-Ly6C-biotine plus Streptavidine-PE was used for monitoring enrichment by
flow cytometry using a FACSCalibur Flow Cytometer (Benton Dickinson).
Human DC generation and maturation
DC were generated from filter buffy coat (FBC)-derived monocytes donated by healthy human
donors (Mazzolini et al. 2005). The protocol for obtaining FBC was approved by the Ethics
Committee of our institution and donors gave informed consent. Isolated mononuclear cells
were subjected to positive selection using anti-CD14-conjugated paramagnetic beads and
purified using the AutoMACSs system according to manufacturers instructions (Miltenyi
Biotec, Bergisch Gladbach, Germany). Purified monocytes were cultured for 7 days in complete
medium (RPMI 10% FBS + penicilin/streptomycin + -mercaptoethanol) supplemented with
GM-CSF (1000 U/ml; Leukine) and IL-4 (500 U/ml; R&D Systems, Minneapolis, MN).
Cytokines were added every other day. DC were matured with clinical grade TNF- (50 ng/ml;
Boehringer Ingelheim, Ingelheim, Germany), IFN- (1,000 IU/mL; Schering-Plough,
Kenilworth, NJ) and Poly I:C (20 g/ml; Ampligen, Bioclones, South Africa) during 48 h
(Alfaro et al. 2009).
Murine DC generation
Mice DC precursors were obtained from bone marrow. Cells were put in culture [RPMI 10%
FBS (Gibco) + penicillin/streptomycin (Gibco) + -mercaptoethanol (Gibco)] at a density of 2 x
106 cells/mL in 10 ml per petri dish in the presence of 20 ng/ml of rmGM-CSF (R&D) (Tirapu
et al. 2004). After 72 h, recombinant mouse GM-CSF (rmGM-CSF) at 10ng/ml was added in 10
ml in RPMI complete medium per dish. On 6th day of culture, 10 ml of medium were
withdrawn per dish. On 9th culture day, non adherent cells were collected by thoroughly
pipetting with RPMI medium. Adherent cells were collected by adding 2ml of accutase (L11007 PAA laboratories) per dish and incubated 15 minutes at 37 C.
172
173
objective. Sequential excitation at 488 nm and 543 nm was provided by argon and helium-neon
gas lasers, respectively. Emission filters BP500-550 and LP560 were used for collecting green
(PKH2) and red (PKH26) in channels one and two, respectively. After sequential excitation,
green and red fluorescent images of the same cell were saved with Laser Sharp software. Images
were analyzed by Zeiss software. The term colocalization refers to the coincidence of green and
red fluorescence, as measured by the confocal microscope.
Protein quantification
After culturing the neutrophils in complete medium supplemented with 1mg/ml of OVA protein
(Calbiochem) for 2h, the supernatants of serial centrifugations were collected to verify the
complete elimination of extracellular OVA. Protein concentration was measured in a Nanodrop
Spectrometer ND-1000 at 280nm. Stock solution was used as control.
Chemokine production
Supernatants were collected in the indicated culture time points, and the cytokine concentration
was determined by immunoassay. Commercially available ELISA kits were used for the
detection of human IL-12p70 and mouse IFN- (BD Biosciences Pharmingen. San Diego. CA.).
Tumor cell lines
HT29 and CT26 tumor cell lines were obtained from American Type Culture Collection
(Rockville, MD).
Elicitation of DC maturation by E coli associated to neutrophils
2x105 human neutrophils were incubated with heat-inactivated E. coli bacteria in various
numbers ranging from 105-102 for 60 min. The neutrophils were then washed eight times and the
pellets and the supernatants collected. Washed PMN and the supernatants were added to human
immature DC (iDC) cultures and 48h later IL-12 concentrations in the supernatants were
monitored. Subsequently, such DC (105) were washed in cold PBS and incubated 15 min at 4
C with specific FITC or PE-labeled mAbs to measure the mean fluorescence intensity for CD80,
CD83 and CD86 surface immunostaining as assessed by flow cytometry. Mature DC (mDC) in
the presence of poly I:C and TNF- and IFN- were used as a positive control.
OVA-specific T cell response analysis
Splenocytes from OT-1 and OT-2 transgenic mice were stained with CFSE solution 2.5uM.
After 24 h co-culture DC plus live or UV-irradiated neutrophils (cultured during 2 h with or
without OVA at 1mg/ml), OT-1 or OT-2 splenocytes were added to the co-culture. The capacity
of DC to cross-present OVA from neutrophils was measured as the dilution of membrane CFSE
174
from CD4+ (OT-2 mice) or CD8+ (OT-1mice) splenocytes that were gated by immunostaining
with CD8 or CD4 specific mAb in a FACS Scalibur.
OVA protein electroporation in the tumor cell line CT26
For electroporation, CT26 (3.5x106 cells/ 500 l RPMI without serum and antibiotics) were
incubated with 500 l OVA at 2mg/mL for 10 minutes at room temperature. Electroporation
was carried out using Gene Pulser II Electroporation System (BioRad): two pulses 200V/cm
and 300 F of capacitance. Immediately after electroporation, CT26 cells were cultured in
RPMI complete medium during at least 1 h. To ensure the internalisation of OVA in CT26 cells,
a control fluorochrome-labelled protein (Streptavidine-PE) was electroporated in the same
cuvette with OVA, and its internalisation was assessed by flow cytometry after extensive
washing of non internalized protein.
Co-injection of DC and PMN into the mouse foot pad
Mouse PMNs were co-cultured for 2h with 105 heat-inactivated E. Coli bacteria. After 8
extensive washes, 5x106 PMN-PKH26 and 107 mouse DC-PKH2 were injected into the foot
pads of mice in separate syringes with 30 l PBS for each injection. 24 h later, popliteal and
inguinal lymph nodes were surgically excised and were disaggregated to give single cell
suspensions. Cells were immunomagnetically selected to enrich CD11c+ cells. Immunoselected
cells were processed for subsequent analysis using flow cytometry and confocal microscopy.
Statistics
All data are presented as the mean SD. For comparisons, unpaired Students t-tests or Mann
Whitney U tests were used [Prism software (GraphPad Software)].
RESULTS
DC and PMN are co-attracted by IL-8 derived from tumor cells.
We have previously shown that human carcinoma cells produce functional IL-8 (Feijoo et al.
2005). One of the corollaries is that such IL-8 might attract human PMNs and monocyte-derived
DC (Alfaro et al. 2011). Indeed, in classical transwell chemotaxis assays towards IL-8producing monolayers of HT-29 human colon carcinoma cells, both PKH26-labelled DC and
PKH2-labelled PMNs are actively co-attracted to the lower chamber containing a confluent
monolayer of HT29 cells (Figure 1 A and B). The effect was mediated by IL-8 as demonstrated
175
by the abrogation of the migration by adding a neutralizing anti-IL8 mAb to the lower chamber
(Figure 1A and B).
DC take up live and UV-irradiated PMN leukocytes that might carry microbial
maturation signals.
Human DC and PMN were florescence-labelled and as can be seen in supplementary figure 1,
fluorescence was readily observed by flow cytometry and confocal microscopy. In figure 2
confocal microscopy pictures of short 4h co-cultures of PMN and DC show that fluorescencent
material from human PMNs was internalized by human DC (Figure 2). This phenomenon
occured both when the PMN had been irradiated with UV-light or when live untouched PMNs
were used. Evidence for internalization in confocal planes is shown at different magnifications
and summarized in a video reconstruction of multiple confocal planes in the Z axis
(Supplementary Video 1).
In figure 3A a two color FACS dot plot shows the single stained cultures and the double
positive events corresponding to DC that have internalized green-fluorescent material from
PMNs. Using this technique, we looked at the requirements for internalization. We observed
that neither an anti-DC-SIGN antibody not and anti-CD11b antibody were able to decrease
internalization (Figure 3B). It is of note that such adhesion molecules have been described as
the main mediators of the DC-neutrophil heterotypic aggregation (van Gisbergen et al. 2005). In
contrast, anti-CD18 integrin common chain mAb clearly decreased double staining. When the
experiment was performed at 4 C to repress metabolism, internalization was drastically reduced
(Figure 3B).
If PMN have internalized bacteria they are likely to contain microbiological biomolecules that
activate/ mature DC (i.e: LPS or bacterial DNA). In fact, we exposed PMNs to E. coli bacteria
which were rapidly internalized. We removed bacteria from cells by extensive washing and
centrifugation (up to 8 washing cycles with 50 ml of culture medium each). PMN that had been
exposed to E. coli were able to mature DC in terms of IL-12 production and enhancement of
CD80, CD83 and CD86 surface expression. The maturation activity was only present in the
cellular pellets since the supernatant of the eighth wash was not able to trigger DC maturation in
any case (Figure 4). These findings are important since extravasated PMN that would capture
gram negative bacteria would concentrate LPS and bacterial DNA for a subsequently interacting
DC.
Internalization of mouse bone marrow PMN by mouse DC.
To study the consequences of PMN internalization by DC, it was of interest to move on to
mouse experimental systems. Consequently, we purified Ly6G cells from bone marrow cells by
immunomagnetic selection (Supplementary Figure 2A) and DC were derived from bone marrow
176
in the presence of GM-CSF for 9 days. Supplementary figure 2 shows immunostainings for
Ly6C and Giemsa stainings of cytospins from the enriched PMN population. Mouse DC and
PMNs were also differentially labelled with fluorescent dyes. Co-cultures of DC and PMN for 4
h showed evidence of internalization by flow cytometry and confocal microscopy
(Supplementary Figure 2B and Figure 5A at 24 h of co-culture). Pictures in figure 5B show
confocal microscopy evidence in the sense that internalization of PMN by DC is inhibited at 4
C both in 4 h and 24 h co-cultures. Summarized data are presented in figure 5C. Therefore the
phenomena observed with human DC and PMN seems to be similar in both humans and mice.
Dead carcinoma cells are internalized by PMN leukocytes that if subsequently
phagocytosed by DC ferry carcinoma cell material.
Human DC can take up fluorescent material from apoptotic tumor cells (Hoffmann et al. 2000).
We confirmed this point in figure 6A that shows that red-labelled DC can take up green
fluorescent apoptotic bodies from UV-irradiated HT29 colon carcinoma cells (Figure 6A).
Apoptotic tumor cells can be prey of PMN phagocytes as well. We reasoned that if PMN
leukocytes take up carcinoma cell debris, this material will end up inside DC, in the case that
such DC eventually internalized a PMN with HT29 material inside. To test this idea we labelled
HT29 colon carcinoma cells with PKH2 and following UV-irradiation fed them to PMN
leukocytes. After 2 h of co-culture, CD15+ cells were immunomagnetically selected to re-isolate
the PMNs. Subsequently CD15+ PMNs were co-cultured with PKH26-labelled DC for 24 hours.
The experimental approach is summarized in figure 6B. As can be seen in figure 6C, green
fluorescent material from HT29 cells is found inside red-labelled DC. Furthermore, quantitative
data from FACS analysis indicated that the internalization phenomenon is quite efficient with
more than half of the DC taking up green fluorescent material derived from the carcinoma cells
(Figure 6). Such internalizing activity was abolished if the co-incubation of PMN and DC took
place at 4 C.
Accordingly it could be envisaged that PMN exposed to debris from tumor cells could transfer
this debris to third party antigen-presenting DC. However, to explore the role in antigen crosspresentation we needed to use mouse models.
Antigen carried by PMN can be cross-presented by DC in vitro.
In order to demonstrate that DC could cross-present antigen material from internalized PMNs,
we performed experiments with bone-marrow neutrophils derived from the bone marrow of
BALB/c mice (H-2d) from which PMN were isolated as shown in supplementary figure 2. Such
PMN were given OVA protein for two hours in culture followed by extensive washes (x 5
times). These PMNs were then co-cultured overnight with DC from C57Bl/6 mice (H-2b) and
exposed to OT-1 or OT-2 TCR-transgenic lymphocytes. Proliferation of OT-1 or OT-2 T cells
177
was monitored by CFSE dilution 72 h later. An schematic representation of the approach based
on the fact that H-2d class I and II antigen presenting molecules cannot present to OT-1 or OT-2
T lymphocytes is presented in figure 7A. In figure 7B a representative case shows the dilution
of CFSE that was triggered by the cognate peptides pulsed on DC as a positive control and by
DC that had been incubated with PMNs preloaded with OVA. T cell division did not take place
in the rest of control conditions including PMN that had not been exposed to OVA fed to DC
(Figure 7B). Analysis of IFN- concentrations released to the tissue culture supernatants showed
a comparable result with both CD8 OT-1 and CD4 OT-2 lymphocytes (Supplementary Figure
3).
Carcinoma cells loaded with OVA transfer antigen to PMNs, then PMNs to DC and such
DC cross-present antigen to T lymphocytes.
In order to study antigen transfer to DC via a PMN intermediate, experiments were set up as
summarized in figure 8A. CT26 colon carcinoma cells of BALB/c origin (H-2d) were
electroporated in the presence of soluble OVA protein. Electroporation in the presence of a
soluble protein leads to internalization of protein as checked with a mixture of OVA with
streptavidin-PE. Supplementary figure 4 shows internalization of PE fluorescence by CT-26
contingent on the electrical shock. Once CT26 had been electroporated with or without OVA,
they were extensively washed, UV-irradiated and fed to PMN of BALB/c origin. Such PMN
were recovered 2 h later from the cultures by Ly6G magnetic immunoselection (taking
advantage of the magnetic beads still bound to the cells). Immunoselected PMN were then cocultured overnight with DC of C57Bl/6 (H-2b) origin. Subsequently these DC were used to
stimulate CFSE-loaded OT-1 T lymphocytes. As can be seen in a representative experiment
shown in figure 8B, dilution of OT-1 CFSE only took place when the CT26 tumor cells had
been electroporated with OVA, but not in the remaining control co-cultures. As a positive
control DC pulsed with the cognate peptide were used and elicited strong proliferation of OT-1
lymphocytes. A summary of replicate experiments is provided in supplementary figure 5. This
correlated with IFN- release to the co-culture supernatant as shown in Supplementary figure 6.
These data indicate that it is possible that tumor derived antigens can end up productively
presented by DC to T cells after being transiently ferried by PMNs that are internalized by the
DC.
DC co-injected in the foot pad with PMN that have internalized bacteria reach draining
Lymph nodes with PMN-derived material.
To present antigen to T cells DC need to reach lymph nodes through afferent lymphatic vessels
(Rouzaut et al. 2010). This is a function tightly controlled upon maturation of the DC by the
induction of CCR7 expression (MartIn-Fontecha et al. 2003; Granucci et al. 2005). If DC and
PMN are injected in the foot pad they should be able to meet thus mimicking inflamed tissue. In
178
the experimental approach shown in figure 9A, differentially fluorescence labelled bone marrow
derived DC and PMN preloaded with E. coli bacteria were injected with separate syringes into
the foot pad. 24 h later draining lymph nodes were surgically excised and CD11c cells enriched
by immunomagnetic selection. Double immunofluorescence events analyzed by flow cytometry
and summarized in figure 9B indicate that about 2% of the injected DC were recovered from the
draining LN carrying fluorescent material from the PMNs while about 5% of the injected DC
were recovered from the lymph nodes with no evidence of carrying PMN-derived fluorescent
material. These data indicate that is possible for DC which internalize PMN material to reach T
cell compartments. It is of note that if PMN had not been exposed to bacteria very few CD11c+
fluorescent events were recovered from lymph nodes and virtually no double positive cells were
found (data not shown). Confocal microscopy images of cytospins made with CD11c+ selected
cells from draining lymph nodes indicated co-localization of fluorescent dyes in the same cells.
DISCUSSION
In the defence of the organism against infection it makes sense that the early innate response
would cue the adaptive immune responses. In the bridge between innate and adaptive immune
responses dendritic cells play a pivotal role (Janeway y Medzhitov 2002). We reasoned that
pyocytes (neutrophils forming pus) would be an excellent source of concentrated microbial
antigens and microbial molecular pattern signals, if eventually internalized by DC.
Therefore we first found that both human and mouse DC avidly internalize PMNs in co-culture.
Both apoptotic and viable PMN are internalized although with more efficiency in the case of
apoptotic PMN. It is postulated that under steady state conditions this phenomenom should feed
DC with innocuous self antigens that if presented by the immature DC should lead to tolerance
(Steinman et al. 2003).
The nature of the surface molecules playing a role in the internalization is unclear. We found
partial inhibition by blocking the CD18 integrin chain but not upon blockade of DC-SIGN and
CD11b in many attempts. This is in disagreement with a paper from the group of Van Kooyk
whose findings indicated a role for DC-SIGN on DC and sialyl Lewis X decorating CD11b in
the heterotypic cellular interaction (van Gisbergen et al. 2005; van Gisbergen et al. 2005). Since
internalization rather than aggregation is our read out, reasons for this difference could come
from various sources. Internalization requires active metabolism since it was nearly abolished at
low temperatures.
Under acute inflammation, extravasated PMN would be full of phagocytosed microbes and
microbial material. An important aspect is that such pyocytes, if entering into contact with and
become internalized by DC, would transmit to DC both the presence of the biomolecules
179
denoting a microbial pathogen and microbial antigens. In our proof of concept experiments, E.
coli bacteria actively loaded into PMN was able to intensely mature the subsequently
encountered DC. This makes sense because ingestion of PMN by DC or their tissular precursors
will launch the proper maturation program in DC. In mice these events also elicit migration of
DC to draining lymph nodes. It remains to be seen which molecular patterns of bacteria are
detected, but most likely these involve LPS detection by TLR4 and bacterial DNA detection by
TLR9 in our experiments.
DC have been in the limelight of tumor immunology and immunotherapy (Steinman y
Banchereau 2007). In solid tumors multiple myeloid cells nest in the stroma including cells
resembling PMN. Such PMN have the opportunity to phagocytose apoptotic or necrotic tumor
cells. We thought that it was interesting to determine if PMN could take up antigen from
carcinoma cells and then transfer it to DC, in such a way that the relevant antigens would end up
cross-presented to T cells. To start exploring these possibilities we moved to mouse systems in
which we can probe for antigen presentation with TCR-transgenic T cells. Our data in humans
strongly argued in favour of this possibility because HT29 fluorescent carcinoma cell debris
taken up by PMNs is internalized by DC, if those PMN are subsequently phagocytosed.
However, it could be argued that the PMN-associated fluorescent material could be degraded
and is thereby become not suitable for antigen presentation. However, in the mouse system we
found that PMN which had internalized OVA protein from soluble sources or OVAelectroporated tumor cells efficiently cross-presented antigens to either OT-1 or OT-2
lymphocytes. Direct presentation by PMN or tumor cells was ruled out because of incompatible
antigen presenting molecules although in other circumstances this can take place according to
published reports (Beauvillain et al. 2007; Culshaw et al. 2008).
The study of the intercellular crosstalk between DC and PMN leukocytes is in its infancy. A
recent report indicates that PMN could deactivate DC upon arrival to lymph nodes in aseptic
conditions (Yang et al. 2010). This makes sense for immature DC but it remains to be seen if it
is the case in vivo under septic conditions that ought to be more relevant for the defence of the
body against infection. Our data showing the ability of DC loaded with material derived from
PMN with internalized bacteria to reach the lymph nodes argue in favour of DC-maturing role
of PMNs under acute infection. Our current research is addressing if the DC which reach lymph
nodes ferrying PMN material can be operational in terms of antigen presentation of PMNassociated antigens to T cells in vivo.
Our current research is focused on unravelling the implications of these PMN-DC interactions
by carrying out in vivo experiments in mouse models. In humans these events are much more
difficult to dissect in vivo. However, there is published evidence of DC-PMN interactions in
appendicitis surgical samples (van Gisbergen et al. 2005; van Gisbergen et al. 2005) and we
180
have found that DC and PMN can be co-attracted to solid malignancies by means of the IL-8
chemokine.
All in all, our experiments point to an entangled and complex relationship between PMN and
DC. PMN greatly outnumber DC and therefore could act as concentrators of antigen and
microbial molecules for DC. If PMN leukocytes become accessible to DC they can be
internalized and then modulate DC functions while transferring the antigens that PMN may
carry. However, exactly how relevant are these functions for the overall physiology of the
immune system still remains to be seen.
REFERENCES
Alfaro, C., N. Suarez, A. Gonzalez, S. Solano, L. Erro, et al. (2009). "Influence of bevacizumab,
sunitinib and sorafenib as single agents or in combination on the inhibitory effects of
VEGF on human dendritic cell differentiation from monocytes." Br J Cancer 100(7):
1111-9.
Alfaro, C., N. Suarez, I. Martinez-Forero, A. Palazon, A. Rouzaut, et al. (2011). "Carcinomaderived interleukin-8 disorients dendritic cell migration without impairing T-cell
stimulation." PLoS One 6(3): e17922.
Beauvillain, C., Y. Delneste, M. Scotet, A. Peres, H. Gascan, et al. (2007). "Neutrophils
efficiently cross-prime naive T cells in vivo." Blood 110(8): 2965-73.
Borregaard, N. (2010). "Neutrophils, from marrow to microbes." Immunity 33(5): 657-70.
Brinkmann, V., U. Reichard, C. Goosmann, B. Fauler, Y. Uhlemann, et al. (2004). "Neutrophil
extracellular traps kill bacteria." Science 303(5663): 1532-5.
Carbone, F. R. y W. R. Heath (2010). "Cross-priming: its beginnings." J Immunol 185(3): 13534.
Culshaw, S., O. R. Millington, J. M. Brewer y I. B. McInnes (2008). "Murine neutrophils
present Class II restricted antigen." Immunol Lett 118(1): 49-54.
El-Benna, J., P. M. Dang, M. A. Gougerot-Pocidalo, J. C. Marie y F. Braut-Boucher (2009).
"p47phox, the phagocyte NADPH oxidase/NOX2 organizer: structure, phosphorylation
and implication in diseases." Exp Mol Med 41(4): 217-25.
Feijoo, E., C. Alfaro, G. Mazzolini, P. Serra, I. Penuelas, et al. (2005). "Dendritic cells
delivered inside human carcinomas are sequestered by interleukin-8." Int J Cancer
116(2): 275-81.
Granucci, F., M. Foti y P. Ricciardi-Castagnoli (2005). "Dendritic cell biology." Adv Immunol
88: 193-233.
181
182
Tewary, P., D. Yang, G. de la Rosa, Y. Li, M. W. Finn, et al. (2010). "Granulysin activates
antigen-presenting cells through TLR4 and acts as an immune alarmin." Blood 116(18):
3465-74.
Tirapu, I., A. Arina, G. Mazzolini, M. Duarte, C. Alfaro, et al. (2004). "Improving efficacy of
interleukin-12-transfected dendritic cells injected into murine colon cancer with antiCD137 monoclonal antibodies and alloantigens." Int J Cancer 110(1): 51-60.
van Gisbergen, K. P., T. B. Geijtenbeek y Y. van Kooyk (2005). "Close encounters of
neutrophils and DCs." Trends Immunol 26(12): 626-31.
van Gisbergen, K. P., I. S. Ludwig, T. B. Geijtenbeek y Y. van Kooyk (2005). "Interactions of
DC-SIGN with Mac-1 and CEACAM1 regulate contact between dendritic cells and
neutrophils." FEBS Lett 579(27): 6159-68.
van Gisbergen, K. P., M. Sanchez-Hernandez, T. B. Geijtenbeek y Y. van Kooyk (2005).
"Neutrophils mediate immune modulation of dendritic cells through glycosylationdependent interactions between Mac-1 and DC-SIGN." J Exp Med 201(8): 1281-92.
Vestweber, D. (2007). "Adhesion and signaling molecules controlling the transmigration of
leukocytes through endothelium." Immunol Rev 218: 178-96.
Villadangos, J. A. y P. Schnorrer (2007). "Intrinsic and cooperative antigen-presenting functions
of dendritic-cell subsets in vivo." Nat Rev Immunol 7(7): 543-55.
Waugh, D. J. y C. Wilson (2008). "The interleukin-8 pathway in cancer." Clin Cancer Res
14(21): 6735-41.
Yang, C. W., B. S. Strong, M. J. Miller y E. R. Unanue (2010). "Neutrophils influence the level
of antigen presentation during the immune response to protein antigens in adjuvants." J
Immunol 185(5): 2927-34.
Yang, D., G. de la Rosa, P. Tewary y J. J. Oppenheim (2009). "Alarmins link neutrophils and
dendritic cells." Trends Immunol 30(11): 531-7.
183
FIGURAS____________________________________________
(Dendritic cells take up and present antigens from viable and apoptotic polymorphonuclear
leukocytes. N. Surez; C. Alfaro et al. Manuscrito en preparacin)
185
Figure 1
Figure 1. DC and PMNs are co-attracted by IL-8 secreted by HT29 colon cancer cells.
(A) Chemotactic migration of DC (labeled with PKH26) and PMN (labeled with PKH2) from
the upper chamber towards confluent monolayers of HT29 cells in the lower chamber. When
indicated, control IgG mAb or anti IL-8 mAb were added to the lower chamber. Microscopy
photographs represent visible light and UV illumination fields with filters for red and green
fluorescence showing the lower chamber when taken 24h later.
(B) Quantitative data based on experiments as in A, representing three independent triplicate
experiments counting four microscopic fields per well (meanSD).
186
Figure 2
DC + UV-irradiated PMNs
DC + Alive PMNs
x100
x200
x200
x200
x400
x200
x200
x400
187
Figure 3
188
Figure 4
189
190
Figure 5
191
192
Figure 6
Figure 6. Fluorescent material from human carcinoma cell debris can be taken up by
PMN and transferred to DC.
(A) PKH2-labeled HT29 cells were UV-Irradiated and co-cultured for 24 h with human PKH26labelled DC and confocal images were taken indicating internalization by DC. (B) Summary of
the experimental approach of co-cultures consisting of HT29 carcinoma cells previously labeled
with PKH2 and UV-irradiated with PMNs which were subsequently retrieved 2 h later by CD15
immunomagnetic selection. Then PMN were co-cultured for 24 h with PKH26-labeled DC.
(C) Confocal microscopy images of the indicated co-culture conditions.
(D) FACS dot plots showing each cell type labeled with the corresponding fluorescent dye and
co-cultures performed at 37 C and 4 C.
193
Figure 7
194
Figure 8
Figure 8. Internal antigens can be ferried from tumor cells to DC via PMNs and then be
subsequently cross-presented to T lymphocytes.
(A) Schematic representation of the experiments in which CT26 tumor cells were electroporated
in the presence or not of soluble OVA protein, extensively washed 30 min later and then UVirradiated. Such apoptotic tumor cells were co-cultured with Ly6G-immunoselected PMN from
the bone marrow of BALB/c mice (H-2d) during 2 h. These PMN that kept labeled with the
immunomagnetic beads were re-isolated in columns under a magnetic field and subsequently
exposed to DC from C57BL/6 mice, whose H-2Kb antigen presenting molecules can present
antigen to OT-1 T cells. Following overnight DC culture with the PMNs, CFSE OT-1
lymphocytes were added to the cultures and CFSE dilution in CD8 cells was monitored 72 h
later.
(B) Representative histograms of CFSE dilution in the indicated conditions including DC pulsed
with the cognate peptide of OT-1 T cells as a positive control.
(C) Summary (meanSD) of three experiments similarly performed.
195
Figure 9
196
Supplementary Figure 1
Supplementary Figure 1. Labelling of human PMN and DC with the indicated fluorescent
dyes visualized by FACS and by confocal microscopy.
197
Supplementary figure 2
A
198
Supplementary Figure 2.
(A) Immunomagnetic selection of Ly6G cells from single cell suspensions from mouse femur
and tibia bone-marrow before and after immunomagnetic selection (Automacs). Purity was
assessed by cells showing bright Ly6C immunestaining and upon May-Grnwald Giemsa
staining of cytospins.
(B) FACS dot plot analysis of mouse DC and PMN labeled with PKH2 and PKH26 as a single
cell type or in co-culture as indicated. 4 h co-cultures were performed at 37C or 4C as
indicated. Representative confocal images of co-cultures set up with the PMN and DC at the
indicated temperature conditions.
199
Supplementary Figure 3
A
Supplementary Figure 3.
(A) INF- concentrations released in 72 and 96 h to the supernatant of cultures by OT-1 and
OT-2 lymphocytes in conditions identical to those in figure 7 as indicated in the figure.
(B) Shows the extent of CFSE dilution in OT-1 and OT-2 cells in the same experiment in which
INF- concentrations in the supernatant were monitored in A.
200
Supplementary Figure 4
Supplementary Figure 4.
Dot plots FSC/SSC and red fluorescence (FL2) of CT26 tumor cells set in the presence of a
mixture of OVA and Streptavidin-PE and given or nor electroporation as indicated. Cells were
analyzed by flow cytometry 2 h following electroporation or mock electroporation
201
203
205
En este momento existen en el mundo una enorme cantidad de ensayos clnicos basados
en inmunizaciones con CD para pacientes oncolgicos. Los datos de eficacia ms prometedores
se observaron en glioblastoma multifocal (Okada et al. 2011) donde varios estudios muestran
evidencia de efectos teraputicos, en ausencia de ensayos aleatorizados publicados hasta el
momento (Liau et al. 2005; Wheeler 2010; Prins et al. 2011).
Tras aos de desarrollo sigue an en debate cual es la mejor ruta de administracin del
tratamiento, cual es el mejor cctel de maduracin de las CD y si es necesario transfectar ciertos
genes a las clulas dendrticas. En inmunoterapia se percibe cada vez ms claramente la
necesidad de terapias combinadas con diferentes agentes. La vacunacin con CD es sinrgica en
varios modelos preclnicos con anticuerpos anti-CTLA-4 (Hodi y Dranoff 2006; Pedersen y
Ronchese 2007; Saha y Chatterjee 2010), anti-CD137 (Lynch 2008) y anti-PD1 (Alexandrescu
et al. 2010; Weber 2010; Wolchok et al. 2010). Estas combinaciones tienen indudable inters
traslacional.
Es importante resaltar que la eliminacin quirrgica de carga tumoral es muy conveniente
para eliminar mecanismos inmunosupresores dependientes del tumor y puede dar lugar a un
nuevo paradigma segn el cual las vacunaciones antitumorales se apliquen a pacientes en
estadios de enfermedad mnima residual.
El grupo de Ralph Steinman ha sido pionero en la dianizacin de antgenos in vivo a
clulas dendrticas mediante anticuerpos y protenas quimricas, para luego promover la
maduracin sistmica de las CD con agonistas de receptores TLR o con anticuerpos anti-CD40.
Estas ideas pueden tener especial inters tras el descubrimiento de las clulas BDCA-3+ cCLEC9+ como las principales inductoras de linfocitos T citotxicos (Jongbloed et al. 2010). Esto se
deduce por analoga con las funciones de las clulas CD11chighCD8+ de ratn.
No es fcil aventurar cul ser la estrategia de vacunacin que muestre mayor eficacia en
cncer. El beneficio clnico con Provenge (vacunaciones repetidas con clulas mononucleares
cultivadas con una protena de fusin GM-CSF-PSLA) (Madan y Gulley 2011) en cncer de
prstata resistente a bloqueo hormonal, ha motivado una gran expectacin. Sin embargo, su
coste es prohibitivo para conseguir un alargamiento en la mediana de supervivencia de tan slo
cuatro meses. El conocimiento de los mecanismos celulares y moleculares de las CD, que
incluya informacin fehaciente sobre los mecanismos de migracin y de inmunosupresin
tumoral, ser un elemento importante para la toma de decisiones en el diseo de los ensayos
clnicos.
206
teraputicas
est
claro
que
es
crucial
interferir
con
mecanismos
inmunosupresores y quiz los mejores mtodos de carga antignica para CD estn an por
desarrollarse. En nuestra institucin se est apostando por cuatro aspectos: (i) tratamiento en
estadios de enfermedad mnima residual; (ii) inflamacin del tejido tumoral con anlogos de
sustancias microbianas; (iii) combinacin con anticuerpos monoclonales inmunoestimulantes;
iv) uso de CD equivalentes a las clulas CD11c highCD8+ de ratn.
El futuro dir si estas aproximaciones son las acertadas.
207
5- CONCLUSIONES
209
5- Conclusiones
211
11. Las clulas dendrticas y los neutrfilos pueden ser quimiotcticamente coatrados por
las clulas tumorales de un modo dependiente de interleuquina-8.
212
6- BIBLIOGRAFA GENERAL
213
6- Bibliografa General
Aarntzen, E. H., C. G. Figdor, G. J. Adema, C. J. Punt y I. J. de Vries (2008). "Dendritic cell
vaccination and immune monitoring." Cancer Immunol Immunother 57(10): 1559-68.
Achen, M. G. y S. A. Stacker (1998). "The vascular endothelial growth factor family; proteins
which guide the development of the vasculature." Int J Exp Pathol 79(5): 255-65.
Adema, G. J., I. J. de Vries, C. J. Punt y C. G. Figdor (2005). "Migration of dendritic cell based
cancer vaccines: in vivo veritas?" Curr Opin Immunol 17(2): 170-4.
Akira, S., K. Takeda y T. Kaisho (2001). "Toll-like receptors: critical proteins linking innate
and acquired immunity." Nat Immunol 2(8): 675-80.
Alatrash, G., T. E. Hutson, L. Molto, A. Richmond, C. Nemec, et al. (2004). "Clinical and
immunologic effects of subcutaneously administered interleukin-12 and interferon alfa2b: phase I trial of patients with metastatic renal cell carcinoma or malignant
melanoma." J Clin Oncol 22(14): 2891-900.
Alexandrescu, D. T., T. E. Ichim, N. H. Riordan, F. M. Marincola, A. Di Nardo, et al. (2010).
"Immunotherapy for melanoma: current status and perspectives." J Immunother 33(6):
570-90.
Alfaro, C., N. Suarez, A. Gonzalez, S. Solano, L. Erro, et al. (2009). "Influence of bevacizumab,
sunitinib and sorafenib as single agents or in combination on the inhibitory effects of
VEGF on human dendritic cell differentiation from monocytes." Br J Cancer 100(7):
1111-9.
Alfaro, C., N. Suarez, I. Martinez-Forero, A. Palazon, A. Rouzaut, et al. (2011). "Carcinomaderived interleukin-8 disorients dendritic cell migration without impairing T-cell
stimulation." PLoS One 6(3): e17922.
Alfaro, C., Suarez N., Martinez-Forero I., Palazn A., Rouzaut A., Solano S., Feijoo E., Grpide
A., Bolaos E., Erro L., Dubrot J., Hervs-Stubbs S., Gonzalez A., Perez-Gracia J L.,
Melero I (2011). "Carcinom-derived interleukin-8 disorients dendritic cell migration
without impairing T-cell stimulation." PlosONE 6 (3).
Alvarez, D., E. H. Vollmann y U. H. von Andrian (2008). "Mechanisms and consequences of
dendritic cell migration." Immunity 29(3): 325-42.
Apetoh, L., F. Ghiringhelli, A. Tesniere, A. Criollo, C. Ortiz, et al. (2007). "The interaction
between HMGB1 and TLR4 dictates the outcome of anticancer chemotherapy and
radiotherapy." Immunol Rev 220: 47-59.
Appelmelk, B. J., I. van Die, S. J. van Vliet, C. M. Vandenbroucke-Grauls, T. B. Geijtenbeek y
Y. van Kooyk (2003). "Cutting edge: carbohydrate profiling identifies new pathogens
215
216
Bonehill, A., S. Tuyaerts, A. M. Van Nuffel, C. Heirman, T. J. Bos, et al. (2008). "Enhancing
the T-cell stimulatory capacity of human dendritic cells by co-electroporation with
CD40L, CD70 and constitutively active TLR4 encoding mRNA." Mol Ther 16(6):
1170-80.
Bonifaz, L. C., D. P. Bonnyay, A. Charalambous, D. I. Darguste, S. Fujii, et al. (2004). "In vivo
targeting of antigens to maturing dendritic cells via the DEC-205 receptor improves T
cell vaccination." J Exp Med 199(6): 815-24.
Borg, C., A. Jalil, D. Laderach, K. Maruyama, H. Wakasugi, et al. (2004). "NK cell activation
by dendritic cells (DCs) requires the formation of a synapse leading to IL-12
polarization in DCs." Blood 104(10): 3267-75.
Borregaard, N. "Neutrophils, from marrow to microbes." Immunity 33(5): 657-70.
Borregaard, N. (2010). "Neutrophils, from marrow to microbes." Immunity 33(5): 657-70.
Bracci, L., E. Proietti y F. Belardelli (2007). "IFN-alpha and novel strategies of combination
therapy for cancer." Ann N Y Acad Sci 1112: 256-68.
Brahmer, J. R., C. G. Drake, I. Wollner, J. D. Powderly, J. Picus, et al. (2010). "Phase I study of
single-agent anti-programmed death-1 (MDX-1106) in refractory solid tumors: safety,
clinical activity, pharmacodynamics, and immunologic correlates." J Clin Oncol 28(19):
3167-75.
Brinkmann, V., B. Laube, U. Abu Abed, C. Goosmann y A. Zychlinsky (2010
). "Neutrophil extracellular traps: how to generate and visualize them." J Vis Exp(36).
Brinkmann, V., U. Reichard, C. Goosmann, B. Fauler, Y. Uhlemann, et al. (2004). "Neutrophil
extracellular traps kill bacteria." Science 303(5663): 1532-5.
Buckanovich, R. J., A. Facciabene, S. Kim, F. Benencia, D. Sasaroli, et al. (2008). "Endothelin
B receptor mediates the endothelial barrier to T cell homing to tumors and disables
immune therapy." Nat Med 14(1): 28-36.
Buhlmann, J. E., S. K. Elkin y A. H. Sharpe (2003). "A role for the B7-1/B7-2:CD28/CTLA-4
pathway during negative selection." J Immunol 170(11): 5421-8.
Burgdorf, S. K., A. Fischer, P. S. Myschetzky, S. B. Munksgaard, M. B. Zocca, et al. (2008).
"Clinical responses in patients with advanced colorectal cancer to a dendritic cell based
vaccine." Oncol Rep 20(6): 1305-11.
Butler, L. M., S. Khan, G. Ed Rainger y G. B. Nash (2008). "Effects of endothelial basement
membrane on neutrophil adhesion and migration." Cell Immunol 251(1): 56-61.
Butte, M. J., M. E. Keir, T. B. Phamduy, A. H. Sharpe y G. J. Freeman (2007). "Programmed
death-1 ligand 1 interacts specifically with the B7-1 costimulatory molecule to inhibit T
cell responses." Immunity 27(1): 111-22.
Butte, M. J., V. Pena-Cruz, M. J. Kim, G. J. Freeman y A. H. Sharpe (2008). "Interaction of
human PD-L1 and B7-1." Mol Immunol 45(13): 3567-72.
217
Cao, W., D. B. Rosen, T. Ito, L. Bover, M. Bao, et al. (2006). "Plasmacytoid dendritic cellspecific receptor ILT7-Fc epsilonRI gamma inhibits Toll-like receptor-induced
interferon production." J Exp Med 203(6): 1399-405.
Cao, X., K. Leonard, L. I. Collins, S. F. Cai, J. C. Mayer, et al. (2009). "Interleukin 12
stimulates IFN-gamma-mediated inhibition of tumor-induced regulatory T-cell
proliferation and enhances tumor clearance." Cancer Res 69(22): 8700-9.
Carbone, F. R. y W. R. Heath (2010). "Cross-priming: its beginnings." J Immunol 185(3): 13534.
Carroll, V. A. y M. Ashcroft (2006). "Role of hypoxia-inducible factor (HIF)-1alpha versus
HIF-2alpha in the regulation of HIF target genes in response to hypoxia, insulin-like
growth factor-I, or loss of von Hippel-Lindau function: implications for targeting the
HIF pathway." Cancer Res 66(12): 6264-70.
Casares, N., M. O. Pequignot, A. Tesniere, F. Ghiringhelli, S. Roux, et al. (2005). "Caspasedependent immunogenicity of doxorubicin-induced tumor cell death." J Exp Med
202(12): 1691-701.
Celis, E. (2007). "Toll-like receptor ligands energize peptide vaccines through multiple paths."
Cancer Res 67(17): 7945-7.
Cohen, M. H., J. Gootenberg, P. Keegan y R. Pazdur (2007). "FDA drug approval summary:
bevacizumab (Avastin) plus Carboplatin and Paclitaxel as first-line treatment of
advanced/metastatic recurrent nonsquamous non-small cell lung cancer." Oncologist
12(6): 713-8.
Culshaw, S., O. R. Millington, J. M. Brewer y I. B. McInnes (2008). "Murine neutrophils
present Class II restricted antigen." Immunol Lett 118(1): 49-54.
Culley, F. J., E. J. Fadlon, A. Kirchem, T. J. Williams, P. J. Jose y J. E. Pease (2003).
"Proteoglycans are potent modulators of the biological responses of eosinophils to
chemokines." Eur J Immunol 33(5): 1302-10.
Chambers, C. A., M. S. Kuhns, J. G. Egen y J. P. Allison (2001). "CTLA-4-mediated inhibition
in regulation of T cell responses: mechanisms and manipulation in tumor
immunotherapy." Annu Rev Immunol 19: 565-94.
Chen, J. J., P. L. Yao, A. Yuan, T. M. Hong, C. T. Shun, et al. (2003). "Up-regulation of tumor
interleukin-8 expression by infiltrating macrophages: its correlation with tumor
angiogenesis and patient survival in non-small cell lung cancer." Clin Cancer Res 9(2):
729-37.
Chung, A. S., J. Lee y N. Ferrara (2010). "Targeting the tumour vasculature: insights from
physiological angiogenesis." Nat Rev Cancer 10(7): 505-14.
218
Chung, D. J., M. Rossi, E. Romano, J. Ghith, J. Yuan, et al. (2009). "Indoleamine 2,3dioxygenase-expressing mature human monocyte-derived dendritic cells expand potent
autologous regulatory T cells." Blood 114(3): 555-63.
de Gramont, A. y E. Van Cutsem (2005). "Investigating the potential of bevacizumab in other
indications: metastatic renal cell, non-small cell lung, pancreatic and breast cancer."
Oncology 69 Suppl 3: 46-56.
De Rossi, M., P. Bernasconi, F. Baggi, R. de Waal Malefyt y R. Mantegazza (2000). "Cytokines
and chemokines are both expressed by human myoblasts: possible relevance for the
immune pathogenesis of muscle inflammation." Int Immunol 12(9): 1329-35.
de Vries, I. J., C. Castelli, C. Huygens, J. F. Jacobs, J. Stockis, et al. (2011). "Frequency of
circulating Tregs with demethylated FOXP3 intron 1 in melanoma patients receiving
tumor vaccines and potentially Treg-depleting agents." Clin Cancer Res.
Dhodapkar, M. V. y N. Bhardwaj (2000). "Active immunization of humans with dendritic
cells." J Clin Immunol 20(3): 167-74.
Di Costanzo, F., F. Mazzoni, M. Micol Mela, L. Antonuzzo, D. Checcacci y M. Saggese (2008).
"Bevacizumab in non-small cell lung cancer." Drugs 68(6): 737-46.
Dikov, M. M., J. E. Ohm, N. Ray, E. E. Tchekneva, J. Burlison, et al. (2005). "Differential roles
of vascular endothelial growth factor receptors 1 and 2 in dendritic cell differentiation."
J Immunol 174(1): 215-22.
Dranoff, G. (2005). "The therapeutic implications of intratumoral regulatory T cells." Clin
Cancer Res 11(23): 8226-9.
Dubsky, P., H. Saito, M. Leogier, C. Dantin, J. E. Connolly, et al. (2007). "IL-15-induced
human DC efficiently prime melanoma-specific naive CD8+ T cells to differentiate into
CTL." Eur J Immunol 37(6): 1678-90.
Dzionek, A., A. Fuchs, P. Schmidt, S. Cremer, M. Zysk, et al. (2000). "BDCA-2, BDCA-3, and
BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral
blood." J Immunol 165(11): 6037-46.
Ebihara, T., M. Azuma, H. Oshiumi, J. Kasamatsu, K. Iwabuchi, et al. (2010). "Identification of
a polyI:C-inducible membrane protein that participates in dendritic cell-mediated
natural killer cell activation." J Exp Med 207(12): 2675-87.
Eggert, A. A., M. W. Schreurs, O. C. Boerman, W. J. Oyen, A. J. de Boer, et al. (1999).
"Biodistribution and vaccine efficiency of murine dendritic cells are dependent on the
route of administration." Cancer Res 59(14): 3340-5.
Eken, C., O. Gasser, G. Zenhaeusern, I. Oehri, C. Hess y J. A. Schifferli (2008).
"Polymorphonuclear neutrophil-derived ectosomes interfere with the maturation of
monocyte-derived dendritic cells." J Immunol 180(2): 817-24.
219
220
Frank, J. A., S. A. Anderson, H. Kalsih, E. K. Jordan, B. K. Lewis, et al. (2004). "Methods for
magnetically labeling stem and other cells for detection by in vivo magnetic resonance
imaging." Cytotherapy 6(6): 621-5.
Freeman, G. J., V. A. Boussiotis, A. Anumanthan, G. M. Bernstein, X. Y. Ke, et al. (1995).
"B7-1 and B7-2 do not deliver identical costimulatory signals, since B7-2 but not B7-1
preferentially costimulates the initial production of IL-4." Immunity 2(5): 523-32.
Fricke, I., N. Mirza, J. Dupont, C. Lockhart, A. Jackson, et al. (2007). "Vascular endothelial
growth factor-trap overcomes defects in dendritic cell differentiation but does not
improve antigen-specific immune responses." Clin Cancer Res 13(16): 4840-8.
Friedline, R. H., D. S. Brown, H. Nguyen, H. Kornfeld, J. Lee, et al. (2009). "CD4+ regulatory
T cells require CTLA-4 for the maintenance of systemic tolerance." J Exp Med 206(2):
421-34.
Gabellini, C., D. Trisciuoglio, M. Desideri, A. Candiloro, Y. Ragazzoni, et al. (2009).
"Functional activity of CXCL8 receptors, CXCR1 and CXCR2, on human malignant
melanoma progression." Eur J Cancer 45(14): 2618-27.
Gabriele, L., P. Borghi, C. Rozera, P. Sestili, M. Andreotti, et al. (2004). "IFN-alpha promotes
the rapid differentiation of monocytes from patients with chronic myeloid leukemia into
activated dendritic cells tuned to undergo full maturation after LPS treatment." Blood
103(3): 980-7.
Gabrilovich, D. (2004). "Mechanisms and functional significance of tumour-induced dendriticcell defects." Nat Rev Immunol 4(12): 941-52.
Gabrilovich, D., T. Ishida, T. Oyama, S. Ran, V. Kravtsov, et al. (1998). "Vascular endothelial
growth factor inhibits the development of dendritic cells and dramatically affects the
differentiation of multiple hematopoietic lineages in vivo." Blood 92(11): 4150-66.
Gabrilovich, D. I., H. L. Chen, K. R. Girgis, H. T. Cunningham, G. M. Meny, et al. (1996).
"Production of vascular endothelial growth factor by human tumors inhibits the
functional maturation of dendritic cells." Nat Med 2(10): 1096-103.
Gabrilovich, D. I. y S. Nagaraj (2009). "Myeloid-derived suppressor cells as regulators of the
immune system." Nat Rev Immunol 9(3): 162-74.
Garcia, F., N. Climent, L. Assoumou, C. Gil, N. Gonzalez, et al. (2011). "A therapeutic
dendritic cell-based vaccine for HIV-1 infection." J Infect Dis 203(4): 473-8.
Garrido, F., F. Ruiz-Cabello, T. Cabrera, J. J. Perez-Villar, M. Lopez-Botet, et al. (1997).
"Implications for immunosurveillance of altered HLA class I phenotypes in human
tumours." Immunol Today 18(2): 89-95.
Geijtenbeek, T. B., D. S. Kwon, R. Torensma, S. J. van Vliet, G. C. van Duijnhoven, et al.
(2000). "DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances transinfection of T cells." Cell 100(5): 587-97.
221
Gerber, H. P. y N. Ferrara (2003). "The role of VEGF in normal and neoplastic hematopoiesis."
J Mol Med 81(1): 20-31.
Geva, R., H. Prenen, B. Topal, R. Aerts, J. Vannoote y E. Van Cutsem (2010). "Biologic
modulation of chemotherapy in patients with hepatic colorectal metastases: the role of
anti-VEGF and anti-EGFR antibodies." J Surg Oncol 102(8): 937-45.
Ghiringhelli, F., L. Apetoh, F. Housseau, G. Kroemer y L. Zitvogel (2007). "Links between
innate and cognate tumor immunity." Curr Opin Immunol 19(2): 224-31.
Ghiringhelli, F., C. Menard, P. E. Puig, S. Ladoire, S. Roux, et al. (2007). "Metronomic
cyclophosphamide regimen selectively depletes CD4+CD25+ regulatory T cells and
restores T and NK effector functions in end stage cancer patients." Cancer Immunol
Immunother 56(5): 641-8.
Gilboa, E. (2004). "The promise of cancer vaccines." Nat Rev Cancer 4(5): 401-11.
Gilboa, E. (2007). "DC-based cancer vaccines." J Clin Invest 117(5): 1195-203.
Goger, B., Y. Halden, A. Rek, R. Mosl, D. Pye, et al. (2002). "Different affinities of
glycosaminoglycan oligosaccharides for monomeric and dimeric interleukin-8: a model
for chemokine regulation at inflammatory sites." Biochemistry 41(5): 1640-6.
Gonzalez, A., N. Varo, E. Alegre, A. Diaz y I. Melero (2008). "Immunosuppression routed via
the kynurenine pathway: a biochemical and pathophysiologic approach." Adv Clin
Chem 45: 155-97.
Granucci, F., M. Foti y P. Ricciardi-Castagnoli (2005). "Dendritic cell biology." Adv Immunol
88: 193-233.
Greenwald, R. J., G. J. Freeman y A. H. Sharpe (2005). "The B7 family revisited." Annu Rev
Immunol 23: 515-48.
Guermonprez, P., J. Valladeau, L. Zitvogel, C. Thery y S. Amigorena (2002). "Antigen
presentation and T cell stimulation by dendritic cells." Annu Rev Immunol 20: 621-67.
Hatfield, P., A. E. Merrick, E. West, D. O'Donnell, P. Selby, et al. (2008). "Optimization of
dendritic cell loading with tumor cell lysates for cancer immunotherapy." J Immunother
31(7): 620-32.
Henao J, M. C. (1999). "Molculas de adhesin: bases fisiolgicas y modelos fisiopatolgicos
para su estudio." Revista de la Asociacin Colombiana de Alergia, Asma e
Inmunologa(8): 7.
Hensley, C., S. Spitzler, B. E. McAlpine, M. Lynn, J. C. Ansel, et al. (1998). "In vivo human
melanoma cytokine production: inverse correlation of GM-CSF production with tumor
depth." Exp Dermatol 7(6): 335-41.
Higano, C. S., P. F. Schellhammer, E. J. Small, P. A. Burch, J. Nemunaitis, et al. (2009).
"Integrated data from 2 randomized, double-blind, placebo-controlled, phase 3 trials of
222
223
224
Krummel, M. F. y J. P. Allison (1995). "CD28 and CTLA-4 have opposing effects on the
response of T cells to stimulation." J Exp Med 182(2): 459-65.
Kumar, H., T. Kawai y S. Akira (2011). "Pathogen recognition by the innate immune system."
Int Rev Immunol 30(1): 16-34.
Lanier, L. L., S. O'Fallon, C. Somoza, J. H. Phillips, P. S. Linsley, et al. (1995). "CD80 (B7)
and CD86 (B70) provide similar costimulatory signals for T cell proliferation, cytokine
production, and generation of CTL." J Immunol 154(1): 97-105.
Lanzavecchia, A. (1998). "Immunology. Licence to kill." Nature 393(6684): 413-4.
Lanzavecchia, A. y F. Sallusto (2001). "Antigen decoding by T lymphocytes: from synapses to
fate determination." Nat Immunol 2(6): 487-92.
Lasarte, J. J., N. Casares, M. Gorraiz, S. Hervas-Stubbs, L. Arribillaga, et al. (2007). "The extra
domain A from fibronectin targets antigens to TLR4-expressing cells and induces
cytotoxic T cell responses in vivo." J Immunol 178(2): 748-56.
Laverman, P., I. J. de Vries, N. M. Scharenborg, A. de Boer, M. Broekema, et al. (2006).
"Development of 111In-labeled tumor-associated antigen peptides for monitoring
dendritic-cell-based vaccination." Nucl Med Biol 33(4): 453-8.
Leach, D. R., M. F. Krummel y J. P. Allison (1996). "Enhancement of antitumor immunity by
CTLA-4 blockade." Science 271(5256): 1734-6.
Lee, Y. J., D. L. Karl, U. N. Maduekwe, C. Rothrock, S. Ryeom, et al. (2010). "Differential
effects of VEGFR-1 and VEGFR-2 inhibition on tumor metastases based on host organ
environment." Cancer Res 70(21): 8357-67.
Ley, K., C. Laudanna, M. I. Cybulsky y S. Nourshargh (2007). "Getting to the site of
inflammation: the leukocyte adhesion cascade updated." Nat Rev Immunol 7(9): 67889.
Liau, L. M., R. M. Prins, S. M. Kiertscher, S. K. Odesa, T. J. Kremen, et al. (2005). "Dendritic
cell vaccination in glioblastoma patients induces systemic and intracranial T-cell
responses modulated by the local central nervous system tumor microenvironment."
Clin Cancer Res 11(15): 5515-25.
Linsley, P. S., J. Bradshaw, J. Greene, R. Peach, K. L. Bennett y R. S. Mittler (1996).
"Intracellular trafficking of CTLA-4 and focal localization towards sites of TCR
engagement." Immunity 4(6): 535-43.
Liu, Y. J. (2005). "IPC: professional type 1 interferon-producing cells and plasmacytoid
dendritic cell precursors." Annu Rev Immunol 23: 275-306.
Lodish, H. F., B. Zhou, G. Liu y C. Z. Chen (2008). "Micromanagement of the immune system
by microRNAs." Nat Rev Immunol 8(2): 120-30.
Lohela, M., M. Bry, T. Tammela y K. Alitalo (2009). "VEGFs and receptors involved in
angiogenesis versus lymphangiogenesis." Curr Opin Cell Biol 21(2): 154-65.
225
226
227
of
lipopolysaccharide
induces
dynamic
migration
of
Gr-1high
228
229
Pallandre, J. R., K. Krzewski, R. Bedel, B. Ryffel, A. Caignard, et al. (2008). "Dendritic cell
and natural killer cell cross-talk: a pivotal role of CX3CL1 in NK cytoskeleton
organization and activation." Blood 112(12): 4420-4.
Parmiani, G., C. Castelli, L. Pilla, M. Santinami, M. P. Colombo y L. Rivoltini (2007).
"Opposite immune functions of GM-CSF administered as vaccine adjuvant in cancer
patients." Ann Oncol 18(2): 226-32.
Payne, A. S. y L. A. Cornelius (2002). "The role of chemokines in melanoma tumor growth and
metastasis." J Invest Dermatol 118(6): 915-22.
Pedersen, A. E. y F. Ronchese (2007). "CTLA-4 blockade during dendritic cell based booster
vaccination influences dendritic cell survival and CTL expansion." J Immune Based
Ther Vaccines 5: 9.
Peggs, K. S., S. A. Quezada y J. P. Allison (2008). "Cell intrinsic mechanisms of T-cell
inhibition and application to cancer therapy." Immunol Rev 224: 141-65.
Prez-Gracia, J. L., P. Berraondo, I. Martinez-Forero, C. Alfaro, N. Suarez, et al. (2009).
"Clinical development of combination strategies in immunotherapy: are we ready for
more than one investigational product in an early clinical trial?" Immunotherapy 1(5):
845-53.
Petrelli, F. y S. Barni (2010). "Bevacizumab in advanced breast cancer: an opportunity as
second-line therapy?" Med Oncol.
Poulin, L. F., M. Salio, E. Griessinger, F. Anjos-Afonso, L. Craciun, et al. (2010).
"Characterization of human DNGR-1+ BDCA3+ leukocytes as putative equivalents of
mouse CD8alpha+ dendritic cells." J Exp Med 207(6): 1261-71.
Prins, R. M., H. Soto, V. Konkankit, S. K. Odesa, A. Eskin, et al. (2011). "Gene expression
profile correlates with T-cell infiltration and relative survival in glioblastoma patients
vaccinated with dendritic cell immunotherapy." Clin Cancer Res 17(6): 1603-15.
Qureshi, O. S., Y. Zheng, K. Nakamura, K. Attridge, C. Manzotti, et al. (2011). "Transendocytosis of CD80 and CD86: a molecular basis for the cell-extrinsic function of
CTLA-4." Science 332(6029): 600-3.
Rabinovich, G. A., D. Gabrilovich y E. M. Sotomayor (2007). "Immunosuppressive strategies
that are mediated by tumor cells." Annu Rev Immunol 25: 267-96.
Radke, J., D. Schmidt, M. Bohme, U. Schmidt, W. Weise y J. Morenz (1996). "-Cytokine level
in malignant ascites and peripheral blood of patients with advanced ovarian carcinoma."
Geburtshilfe Frauenheilkd 56(2): 83-7.
Ribas, A. (2008). "Overcoming immunologic tolerance to melanoma: targeting CTLA-4 with
tremelimumab (CP-675,206)." Oncologist 13 Suppl 4: 10-5.
Rini, B. I., S. C. Campbell y B. Escudier (2009). "Renal cell carcinoma." Lancet 373(9669):
1119-32.
230
231
Schwaab, T., A. Schwarzer, B. Wolf, T. S. Crocenzi, J. D. Seigne, et al. (2009). "Clinical and
immunologic effects of intranodal autologous tumor lysate-dendritic cell vaccine with
Aldesleukin (Interleukin 2) and IFN-{alpha}2a therapy in metastatic renal cell
carcinoma patients." Clin Cancer Res 15(15): 4986-92.
Seaton, A., P. Scullin, P. J. Maxwell, C. Wilson, J. Pettigrew, et al. (2008). "Interleukin-8
signaling promotes androgen-independent proliferation of prostate cancer cells via
induction of androgen receptor expression and activation." Carcinogenesis 29(6): 114856.
Shahzad, A., M. Knapp, I. Lang y G. Kohler (2010). "Interleukin 8 (IL-8) - a universal
biomarker?" Int Arch Med 3: 11.
Sharpe, A. H. (2009). "Mechanisms of costimulation." Immunol Rev 229(1): 5-11.
Shortman, K. y W. R. Heath (2010). "The CD8+ dendritic cell subset." Immunol Rev 234(1):
18-31.
Shortman, K. y Y. J. Liu (2002). "Mouse and human dendritic cell subtypes." Nat Rev Immunol
2(3): 151-61.
Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, et al. (1999). "The
nature of the principal type 1 interferon-producing cells in human blood." Science
284(5421): 1835-7.
Simonet, W. S., T. M. Hughes, H. Q. Nguyen, L. D. Trebasky, D. M. Danilenko y E. S.
Medlock (1994). "Long-term impaired neutrophil migration in mice overexpressing
human interleukin-8." J Clin Invest 94(3): 1310-9.
Singh, R. K. y M. L. Varney (2000). "IL-8 expression in malignant melanoma: implications in
growth and metastasis." Histol Histopathol 15(3): 843-9.
Singh, R. K., M. L. Varney, C. D. Bucana y S. L. Johansson (1999). "Expression of interleukin8 in primary and metastatic malignant melanoma of the skin." Melanoma Res 9(4): 3837.
Singh, S., A. Sadanandam, M. L. Varney, K. C. Nannuru y R. K. Singh (2010). "Small
interfering RNA-mediated CXCR1 or CXCR2 knock-down inhibits melanoma tumor
growth and invasion." Int J Cancer 126(2): 328-36.
Singh, S., A. P. Singh, B. Sharma, L. B. Owen y R. K. Singh (2010). "CXCL8 and its cognate
receptors in melanoma progression and metastasis." Future Oncol 6(1): 111-6.
Skubitz, K. M. y R. W. Snook, 2nd (1987). "Monoclonal antibodies that recognize lacto-Nfucopentaose III (CD15) react with the adhesion-promoting glycoprotein family (LFA1/HMac-1/gp 150,95) and CR1 on human neutrophils." J Immunol 139(5): 1631-9.
Societies, C. o. t. I. U. o. I. (2001). "Chemokine/chemokine receptor nomenclature." J Leukoc
Biol 70(3): 465-6.
232
Soehnlein, O. (2009). "An elegant defense: how neutrophils shape the immune response."
Trends Immunol 30(11): 511-2.
Speidel, K., W. Osen, S. Faath, I. Hilgert, R. Obst, et al. (1997). "Priming of cytotoxic T
lymphocytes by five heat-aggregated antigens in vivo: conditions, efficiency, and
relation to antibody responses." Eur J Immunol 27(9): 2391-9.
Springer, T. A. (1994). "Traffic signals for lymphocyte recirculation and leukocyte emigration:
the multistep paradigm." Cell 76(2): 301-14.
Steinman, R. M. (2003). "Some interfaces of dendritic cell biology." APMIS 111(7-8): 675-97.
Steinman, R. M. (2007). "Dendritic cells: understanding immunogenicity." Eur J Immunol 37
Suppl 1: S53-60.
Steinman, R. M. (2010). "Some active areas of DC research and their medical potential." Eur J
Immunol 40(8): 2085-8.
Steinman, R. M. y J. Banchereau (2007). "Taking dendritic cells into medicine." Nature
449(7161): 419-26.
Steinman, R. M. y Z. A. Cohn (1973). "Identification of a novel cell type in peripheral lymphoid
organs of mice. I. Morphology, quantitation, tissue distribution." J Exp Med 137(5):
1142-62.
Steinman, R. M., D. Hawiger, K. Liu, L. Bonifaz, D. Bonnyay, et al. (2003). "Dendritic cell
function in vivo during the steady state: a role in peripheral tolerance." Ann N Y Acad
Sci 987: 15-25.
Steinman, R. M., D. Hawiger y M. C. Nussenzweig (2003). "Tolerogenic dendritic cells." Annu
Rev Immunol 21: 685-711.
Stephan, M. T., V. Ponomarev, R. J. Brentjens, A. H. Chang, K. V. Dobrenkov, et al. (2007). "T
cell-encoded CD80 and 4-1BBL induce auto- and transcostimulation, resulting in potent
tumor rejection." Nat Med 13(12): 1440-9.
Stillie, R., S. M. Farooq, J. R. Gordon y A. W. Stadnyk (2009). "The functional significance
behind expressing two IL-8 receptor types on PMN." J Leukoc Biol 86(3): 529-43.
Stocks, S. C., M. Albrechtsen y M. A. Kerr (1990). "Expression of the CD15 differentiation
antigen (3-fucosyl-N-acetyl-lactosamine, LeX) on putative neutrophil adhesion
molecules CR3 and NCA-160." Biochem J 268(2): 275-80.
Su, Z., J. Dannull, A. Heiser, D. Yancey, S. Pruitt, et al. (2003). "Immunological and clinical
responses in metastatic renal cancer patients vaccinated with tumor RNA-transfected
dendritic cells." Cancer Res 63(9): 2127-33.
Summers, C., S. M. Rankin, A. M. Condliffe, N. Singh, A. M. Peters y E. R. Chilvers (2010).
"Neutrophil kinetics in health and disease." Trends Immunol 31(8): 318-24.
233
Tai, X., F. Van Laethem, A. H. Sharpe y A. Singer (2007). "Induction of autoimmune disease in
CTLA-4-/- mice depends on a specific CD28 motif that is required for in vivo
costimulation." Proc Natl Acad Sci U S A 104(34): 13756-61.
Takeda, K., T. Kaisho y S. Akira (2003). "Toll-like receptors." Annu Rev Immunol 21: 335-76.
Terme, M., E. Ullrich, N. F. Delahaye, N. Chaput y L. Zitvogel (2008). "Natural killer celldirected therapies: moving from unexpected results to successful strategies." Nat
Immunol 9(5): 486-94.
Tesniere, A., L. Apetoh, F. Ghiringhelli, N. Joza, T. Panaretakis, et al. (2008). "Immunogenic
cancer cell death: a key-lock paradigm." Curr Opin Immunol 20(5): 504-11.
Tewary, P., D. Yang, G. de la Rosa, Y. Li, M. W. Finn, et al. (2010). "Granulysin activates
antigen-presenting cells through TLR4 and acts as an immune alarmin." Blood 116(18):
3465-74.
Theoret, M. R., P. M. Arlen, M. Pazdur, W. L. Dahut, J. Schlom y J. L. Gulley (2007). "Phase I
trial of an enhanced prostate-specific antigen-based vaccine and anti-CTLA-4 antibody
in patients with metastatic androgen-independent prostate cancer." Clin Genitourin
Cancer 5(5): 347-50.
Thurner, B., I. Haendle, C. Roder, D. Dieckmann, P. Keikavoussi, et al. (1999). "Vaccination
with mage-3A1 peptide-pulsed mature, monocyte-derived dendritic cells expands
specific cytotoxic T cells and induces regression of some metastases in advanced stage
IV melanoma." J Exp Med 190(11): 1669-78.
Tirapu, I., A. Arina, G. Mazzolini, M. Duarte, C. Alfaro, et al. (2004). "Improving efficacy of
interleukin-12-transfected dendritic cells injected into murine colon cancer with antiCD137 monoclonal antibodies and alloantigens." Int J Cancer 110(1): 51-60.
Tirapu, I., A. Lewis, M. Kreutz, H. McLinden y S. S. Diebold (2008). "Freeze-and-thawdisrupted tumour cells impair the responsiveness of DC to TLR stimulation." Eur J
Immunol 38(10): 2740-50.
Tirapu I., H. E., Alfaro C., Arina A., Murillo O., Inoges S., Bendandi M., Mazzolini G. and
Melero I (2005). "Critical appraisal of the current status of dendritic cell based therapy."
Inmunologa 24(1): 10.
Tivol, E. A., F. Borriello, A. N. Schweitzer, W. P. Lynch, J. A. Bluestone y A. H. Sharpe
(1995). "Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan
tissue destruction, revealing a critical negative regulatory role of CTLA-4." Immunity
3(5): 541-7.
Tol, J. y C. J. Punt (2010). "Monoclonal antibodies in the treatment of metastatic colorectal
cancer: a review." Clin Ther 32(3): 437-53.
Trinchieri, G. (2003). "Interleukin-12 and the regulation of innate resistance and adaptive
immunity." Nat Rev Immunol 3(2): 133-46.
234
Trombetta, E. S. y I. Mellman (2005). "Cell biology of antigen processing in vitro and in vivo."
Annu Rev Immunol 23: 975-1028.
van Elsas, A., A. A. Hurwitz y J. P. Allison (1999). "Combination immunotherapy of B16
melanoma using anti-cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and
granulocyte/macrophage colony-stimulating factor (GM-CSF)-producing vaccines
induces rejection of subcutaneous and metastatic tumors accompanied by autoimmune
depigmentation." J Exp Med 190(3): 355-66.
van Gisbergen, K. P., T. B. Geijtenbeek y Y. van Kooyk (2005). "Close encounters of
neutrophils and DCs." Trends Immunol 26(12): 626-31.
van Gisbergen, K. P., I. S. Ludwig, T. B. Geijtenbeek y Y. van Kooyk (2005). "Interactions of
DC-SIGN with Mac-1 and CEACAM1 regulate contact between dendritic cells and
neutrophils." FEBS Lett 579(27): 6159-68.
van Gisbergen, K. P., M. Sanchez-Hernandez, T. B. Geijtenbeek y Y. van Kooyk (2005).
"Neutrophils mediate immune modulation of dendritic cells through glycosylationdependent interactions between Mac-1 and DC-SIGN." J Exp Med 201(8): 1281-92.
van Mourik, J. A., T. Romani de Wit y J. Voorberg (2002). "Biogenesis and exocytosis of
Weibel-Palade bodies." Histochem Cell Biol 117(2): 113-22.
Van Nuffel, A. M., J. Corthals, B. Neyns, C. Heirman, K. Thielemans y A. Bonehill (2010).
"Immunotherapy of cancer with dendritic cells loaded with tumor antigens and activated
through mRNA electroporation." Methods Mol Biol 629: 405-52.
Verdijk, P., E. H. Aarntzen, W. J. Lesterhuis, A. C. Boullart, E. Kok, et al. (2009). "Limited
amounts of dendritic cells migrate into the T-cell area of lymph nodes but have high
immune activating potential in melanoma patients." Clin Cancer Res 15(7): 2531-40.
Vestweber, D. (2007). "Adhesion and signaling molecules controlling the transmigration of
leukocytes through endothelium." Immunol Rev 218: 178-96.
Villadangos, J. A. y P. Schnorrer (2007). "Intrinsic and cooperative antigen-presenting functions
of dendritic-cell subsets in vivo." Nat Rev Immunol 7(7): 543-55.
Vivier, E., D. H. Raulet, A. Moretta, M. A. Caligiuri, L. Zitvogel, et al. (2011). "Innate or
adaptive immunity? The example of natural killer cells." Science 331(6013): 44-9.
Walzer, T., M. Dalod, E. Vivier y L. Zitvogel (2005). "Natural killer cell-dendritic cell crosstalk
in the initiation of immune responses." Expert Opin Biol Ther 5 Suppl 1: S49-59.
Waterhouse, P., J. M. Penninger, E. Timms, A. Wakeham, A. Shahinian, et al. (1995).
"Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4." Science
270(5238): 985-8.
Waugh, D. J. y C. Wilson (2008). "The interleukin-8 pathway in cancer." Clin Cancer Res
14(21): 6735-41.
235
Weber, J. (2010). "Immune checkpoint proteins: a new therapeutic paradigm for cancer-preclinical background: CTLA-4 and PD-1 blockade." Semin Oncol 37(5): 430-9.
Wheeler, C. J. (2010). "Dendritic cell vaccines to combat glioblastoma." Expert Rev Neurother
10(4): 483-6.
Wolchok, J. D., A. Hoos, S. O'Day, J. S. Weber, O. Hamid, et al. (2009). "Guidelines for the
evaluation of immune therapy activity in solid tumors: immune-related response
criteria." Clin Cancer Res 15(23): 7412-20.
Wolchok, J. D. y Y. Saenger (2008). "The mechanism of anti-CTLA-4 activity and the negative
regulation of T-cell activation." Oncologist 13 Suppl 4: 2-9.
Wolchok, J. D., A. S. Yang y J. S. Weber (2010). "Immune regulatory antibodies: are they the
next advance?" Cancer J 16(4): 311-7.
Wong, N. S., R. A. Buckman, M. Clemons, S. Verma, S. Dent, et al. (2010). "Phase I/II trial of
metronomic chemotherapy with daily dalteparin and cyclophosphamide, twice-weekly
methotrexate, and daily prednisone as therapy for metastatic breast cancer using
vascular endothelial growth factor and soluble vascular endothelial growth factor
receptor levels as markers of response." J Clin Oncol 28(5): 723-30.
Wu, L. y Y. J. Liu (2007). "Development of dendritic-cell lineages." Immunity 26(6): 741-50.
Xie, K. (2001). "Interleukin-8 and human cancer biology." Cytokine Growth Factor Rev 12(4):
375-91.
Yang, C. W., B. S. Strong, M. J. Miller y E. R. Unanue (2010). "Neutrophils influence the level
of antigen presentation during the immune response to protein antigens in adjuvants." J
Immunol 185(5): 2927-34.
Yang, D., G. de la Rosa, P. Tewary y J. J. Oppenheim (2009). "Alarmins link neutrophils and
dendritic cells." Trends Immunol 30(11): 531-7.
Yang, J. C., L. Haworth, R. M. Sherry, P. Hwu, D. J. Schwartzentruber, et al. (2003). "A
randomized trial of bevacizumab, an anti-vascular endothelial growth factor antibody,
for metastatic renal cancer." N Engl J Med 349(5): 427-34.
Yang, L. y D. P. Carbone (2004). "Tumor-host immune interactions and dendritic cell
dysfunction." Adv Cancer Res 92: 13-27.
Yao, L., C. Sgadari, K. Furuke, E. T. Bloom, J. Teruya-Feldstein y G. Tosato (1999).
"Contribution of natural killer cells to inhibition of angiogenesis by interleukin-12."
Blood 93(5): 1612-21.
Yuan, A., J. J. Chen, P. L. Yao y P. C. Yang (2005). "The role of interleukin-8 in cancer cells
and microenvironment interaction." Front Biosci 10: 853-65.
Yuan, A., C. J. Yu, K. T. Luh, S. H. Kuo, Y. C. Lee y P. C. Yang (2002). "Aberrant p53
expression correlates with expression of vascular endothelial growth factor mRNA and
236
237
239
241
LPS: Lipopolisacrido
LTC: Linfocitos T Citotxicos
LYNAP: Lymphocyte Derived Neutrophil Activating Peptide
MAC-1: Antgeno de macrfagos-1 (tambin CD11b/CD18)
MAP: Protenas Activadas por Mitgenos
MCP-1: Protena Quimiotctica de Monocitos-1
MDSD: Clulas Supresoras inmaduras Gr1+ de origen Mieloide
MGL: Macrophage Galactose-Type Lectin
MLR: Reaccin Mixta Linfocitaria
MTOC: Centro Organizador de Microtbulos
MUC: Mucina
NK: Natural Killer
NOS: xido Ntrico Sintasa
PGE2: Prostaglandina E2
PDGF: Factor de Crecimiento Derivado de las Plaquetas
PDL1: Programmed cell Death Ligand 1 (tambin B7-H1)
PGF: Factor de Crecimiento de Placenta
PI3K: Fosfatidil inositol 3 Quinasa
PKC: Protena Quinasa C
PMAP: Patrones Moleculares Asociados a Patgenos
PMN: Leucocitos Polimorfonucleares
Poly I:C: cido Poliinosnico-Policitidinico
RECIST: Response Evaluation Criteria In Solid Tumors
RMN: Resonancia Magnetica Nuclear
TCR: Receptor de Clulas T
TGF: Factor de Crecimiento Trasformante
TIL: Linfocitos Infiltrantes de Tumor
TLR: Receptores Tipo Toll
TNF: Factor de Necrosis Tumoral
VEGF: Factor de Crecimiento Endotelio Vascular
VHL: Von Hippel-Lindau
VIH: Virus de la Inmunodeficiencia Humana
242