Você está na página 1de 22
Respostas Resumidas aos Problemas SolugSes completa de todos of problemas dos capitulo eso publcadat ro Guts de esata complet defeitivo que arompanha sara Prine Dios de Biogutmicn As respesas de todos os problemas RanERCo e0 fexpressa com o numero crteto de dgtoesgiestivs. «ada uma dessa iferengas de propriedaes pode seri de bse para ‘separa (B) A molecu de gee émenor do que um nucestide; ‘teparagio pode se buseor no tamaho. A base itogenada eau 0 ‘grupo frit arab doa oe nacecdeos com etucenstica oi ‘lide, carga) que pode ser sadas para separioe da gicose Capittot 10. Binroel qno topes set coma ements 1. (epDiinewo dace plata = 500mm (9) 2110" molecu" tener pt aida epeeest ne sora de, Stren) 8 codmboctnans a) 39% I0>noteaedeieae __comouda Tre Langa css dear de sno so {Gp tonite te ice porte de heroes sont tant crm sess pasa gee 2 Demin oo mri Eiri nin ae aie Og ae 38m 00 wos mae amor da ENA ‘anane eure dco roger pets fomagioe 4. ature etna pl isto, por avn, 4, SMASH ogee tena psce oct a Aer ent inna petsen ds SeSittt 14 Semin eninge Ale reba; lags supertce-rcume 6300 vezes maior na bacta srr cont em um enantdmero simples; benaedrna conse 2x 10siomtama data inanocamonio 1 (te ai on in) Cay Ccomew Geng ateie;tmentempuvet scene pos, ele: ew fd te cd aio () Teor: 2 it saree com a fonie, 1B, (4) CH,0, 64,0, z ) @ ) y o Acton HCL6H oH oe How me ou uh a i Amino Hiden oe oe ope ‘HO’ HO” 1 2 2 © @ best se YG B0= ems OF ow on HOPAO7 Foie Amin 4-1 note” Hobe’ Hm 9 a OH Hidroxila Ho nH f—OW x Hy a" m W Carboxila ‘Metil: ‘ . . Ho on H on ° ° © © view FY) susan wed bt - tao Adu an HANH) Amine bn, droit HOR at 5 ° 3 sae uy Ho 9 ow 0 selon tense ws bon tidosa oH dou Mot [HGCE-ZOHG| testa 10 » GET] Hidroxile Ce) X contém um centro quital, elimina todos, exceto 6 e 8. (4) X . on EH Csr an go frelon Shin 8 xr 6 cose Pay a {Suecum trod o) Aes np ng 7 ‘St dap ninroe ww bs, 14, O compost moan o -ropatl eto gece 0 (0 doi nantsimeraeYém interageseierene com um receptor qa Loli (ua poten). 8. (a) Somente os aminoscios tm grupos amano; a sepsrasso pode 6: com base ma carga ou na afi de lgagao desses grupos. Os [St graoe #80 menor seve em gad Goo oe ainsi, € rupn Rios 60 qual © Syeprepandbl tem estat Ay oN rn on 1200 RESPOSTAS RESUMIDAS AOS PROBLEMAS 15. Ocomposto mostrado € (5,}-etilenidat, 0 (.R}-metienidate (0s carbonosqurais esto inticados cor asterisco 16. (a) Un AG" mals negative correponde a um malo Kara arene {40 de igago de forma que o equlio € desvado no setido a ormagio dos produtas «igus ras forte ~e, por ss, de um gosto mais dace ¢ uma DMR mae (b) sais de gost doce, eam base ‘maria, sio must demoras. Um programa de corputaor para redanr vel dedoqura, meu gue nem sempre totalmente preci so permite ae quinicor profetaradocante fcaee ro ale rapi- dumente Aa moles candidat poder eo se testadas por meio dos ensuos convencianas. (e) A vriagao de 025 9 Om corres ‘once so comprimenta de ceva e 13,3 Beacons amples A Sata 2 seguir pce ser aaa pars contra dea pia aprox {odes os stoma no rating vermelnonciaroetaaentve 0.28 ¢ Od tm done da gus —- Bxistem muitos grapor AIL porsvis nas moe alguns estio estrada oe a oD (a) Bm prev lugar, as molecules tm maiplos grupos A, de fora gue ¢ die saber qual éo importante. Br seguro lugar, uma ‘vr que o motivo AH-D 6 muito simples, mas molecu nz doces erin eae gro. (@) A rcaroee va doroinacarore, A desoXari= fatore no tem um doe prupes ALL-B qe est presente pa sacaroce (tem DIR lgetrarseate mais bits do gue ada sucazose~ como es petedo se os grupos AIFS forem importantes para o saber doce (0) EBxisem muttosdesses exemplos, aq esto alguns (1) 0 Drpttir ro.¢0 Grlorottplnfne tm o mesma grepo AB, mas or alores fle DMR sic muito frente. (2) O aparame eo netame tr 08 Inezos grupos AX-S, mut valores de DME si0 mst dizer ( Onectae tem dis grays AELB,e oabtame tem tts, oxen oneatame ¢ mais de cinco vezes mais doce do que o tame. (2) A ‘omin mens lelonegativa do quem oxi, «asim emersse que eneaquecs os grapor AUC, no entar a tleabromoszararose fmuto mas ace do que a sucarse. (g) Pade-e eaborae qualquer ‘modelo que se adapt a ure conju desinido de dados desde gue ts parivettoe jam suciertement “sprimoras™. Una vex qu 9 objetivo er erie un modelo para predizer 9 AG" de molécuas ni Aestaae v0, oe peatizadrespreiaaam mostrar que © model funciona para males que nic hair sido reisadas™O grau de snexstidso do grupoteste podria frmecer aos pesguisdores ua ‘eis de como 0 modelo v¢ comportaria paty moléculas roves. (4) ‘ADM esta relaconatla com que cts relaconado exponencial= mente com AG"; astm, a adin de ua quntade constant 4G" Imulpllea« DME por ma quatidade constant. Com tase noe ae Tres dads com af exeutuas, uma vag de 1 Real na AG” comeeponde ua variapo de 10 aes ra DMR, Capituto2 A. etanalé polar 0 ano nto ¢ 0 grupo —OH do etna pode far gag deRidogénis com » gu, 2. (a) 4.7600) 818 (6) 40) 482 (a) pt x 10") 3 10 4 5G) iinet = 6s 8 8 (09776 x 107% 1 (b) 33 (€) Ns0tl Na = 0 was 117 107 moles de sete came. (@) maior (b) mais ato (€) mas bien 11, a) RCDO™ (B) RNE, (€) 207 (@) HOOF 12. (4) 5,06 (by $28 Ce) 5.46 (A) 4.75 (6) 37 18. (4) G1 uHCL GW) 0,1 NAOH Ce) 0,1. NAOH. 14. (4) 0 bicarbonate, uma hate fae, ila —O1 a 0", fommpost mats polar ema solve em sg. 15. 0 estdmagor a form neutra da apc pees em pH mae aes € menos pole alesvesa a membrana mai fnente 16. 6 7. 74 18.) HE864206 0) 45 (6) 10: 18. 58 20. 24 an 68 1 Nall,PO, 30,58 gs NAP, 82g. ie WHAT = 0.0 tomando © (4) pH pk, 2 BER 25, Mistaze 160 de actato de x60 10 eam 380 de Sida theo 0.101 26, Acido atric, seu pc is proxi do pH desea 27. (4) 46 (8) 0 uni dep (@) Sundaes dept 28. 63 29, Aosta 1.10 eid atin 007 Zw oon 600" nacg-n nado bu, bat Cumpletmente ——_Competament nade depinade (&) completamente protoraso (e) zwiterion (4) switerion Ce) ‘oopletamente despetonade 88, (4) 0 pH do sangue ¢controlado pelo sistema tampo dxido de ‘arbono-bcarbonate, CO, + H,0 == H+ HCO, Durante 2 hi- ‘Povenblagao, a {CO,)sumenta nos pulmées © no sange aera, Jevanda o equilblo para adele, amentando o [HT balrando 0 pH (b) Durante a hepersentdapo, a (CO, durin nos pulses e ‘ho sangue atrial o que reds [H]eaumer 0 pH acima do Valor poral de 74. (€) O laetato 6 um dco mvderadamente fore, que fe dssoca completamente em condigoes scgiase desta forma echo pit do rage «do teido mela A pervert em ve Ho que eleva o pl do sangue e dos ecios atecipandose 3 seis, 3474 835, Dislvendo-ze mate C0, no sangue aumenta(H)no sangue e nos ‘Bucs extacellaes xedusndy 0 pH CO, (2) + HO H,CO, n+ 100; 136, (a) Urea substineia na aus forma surfactante pars emulsifier 0 tle derranado,coleteoSleoerulsiicdo e toque para fora ‘no surfactant. A dguase separa do cleo, e este pode ser cletado ara so posto. (b) 0 equllbri se enconta fortemen’e para a ‘iret, 0 Sco mais forte (com pK, male Bt), H,CO,, doa um pr tom para ase conjugal dei mai trae (om Pt mai 0), anita, (e) A forga de un eurtactante depende du Moflciade de seus grupes poles: quanto mais idotico, mais podercso 6 0 ficlactae. A forma so do eur ¢ ite mae idols da ‘gor afr amin, e ele € um sracante mito mai Posen {(@) Ponts amis; 0 CO, teve tempo de sora para rag om © ahldina e produ «forma aiino, Ponto Barina arginio emoveu o 60, da soho, sobraao a forma atid. (e) A con Gutsoidade aumenta quando o amano sem carga reage com 9 C0, «© produsa forma amsidina carregada.(F) A cordutvidade drut {quando o amino remove o C0, 0 que desea equi para = ove alia em carga (g) haar tur com CO, para produit» forma surtactante do amici eusilo para emusiicar 9 dears mento. Tatar aemulso com aganlo para remover 0 C0, eprodiat ‘Horta amidina nao surfactants, 0 Seo sera sopsad dss © Doders re recuperate Capitulo 1. determinar a coniquras sbsoluta no carbons a ¢comparsla com Ssformas bo leratdeid. 2 GGL UC) W Hew HUA MV GA (4) VQ) Gay Ma) VO) Lev 3. (a) Op1> pk, pars o grape a-carbotia ep © pk para grupo ‘ming de manira queue dos grape eto caregadae (onzadoe). (@) Lem 219 x 1070 pla alata € 82 Conform «Tubes 3-1 fs equapio de Hendersorellsselbalch, 14 680 grupos eatbon © 1V4680 grapas amo eto ser carga. A fasio de melécaas dala: rina com ambos 0s grupos niocaregadcs€ 0 produla dessa fase ate 6,08 grupos etboashoos da pol Gn) eto deeprovonados a repubsio entre os grupos esha carreguos natvarente eva te desdobramento. De modo similar em pl 7,0 grupos ming da Puls eso protanados;repuleto entre esses grupo carregadoe posivamene tarber lea ao desdbrarente 5. (a) As pontesdssleo sao Tagoes covalentes, que so muito mais fortes do ques rteraget ro eovalentes que esta + maioria fas protetna, Ble fers gage ntereadelas, aumento sua 10. n. 2 1 4 46. 16. ser, orga mecinica «resistin. (B) Os residues de cstina (com ‘aaee drellot) mpedem o derdbrarenta total da proteins Pecan) (4) Cuvatuss sho mals proaveis noe residue 7 19; os rsiduas ro na confgurago cis aeamedara bem as votes. (b) Os residues (Gyre posger 12 «24 pode format gages darlto, Ce) Super sie externa. re(duos parse carrgados (sp, Sl, Lt, ntetioe residues afitioseaplares (A te), Th, ember pola, tem um tice de hropati prizame de ae, portant, pode ser encontrado ‘a superticiexterna no terior da poten ‘Tn reedune de amnseido: 087 Amoglobina tod tedimensional A cetera dobrada,o “enove Tamento da lobia” um motivo encontrado enn todas as glbina ( polipepideo a dabea enum dominio co, 0 qual representa 3 ‘estruratidmenaioal nei dest protein, Protina (0), um bart ¢ desea pela curva de Ranachandvon (6), aque metre «maton dos conormagces pertidas no quadrats $eriorerquerd no qual esto concentra angus de ga ‘acteristics da conforma B (Duma see de haces a € desea pela curs (na qual amaona da condormagber permits e9 (quadrare infer esquerdo Acnsima bacteria uma clagenase deste barra de teva Conectivo do hospedeir,o que permite a meas dot tei pela tectva, actrie no tam cligene (2) 0 mimero de DNP-alinaformade por rol de poten se uala so nomero de exteenidades anncternnale, portant, ao nero Ge cates patpeptiieas(b) 4) Cadeiae diferentes provavelmer- te migram ao gle polcrlamide-SDS como bandas sepuradas (a ee tem mais restves de aminodcdos que favoocer a estrutura omc (2 abel 4). (a) Os resdaoearomstcne parecer trum papel importante na ext biiacin dae ria aes Assim, a olla em subetiintar sromaticor poem ii ormaga da amode por interferizem no femplhamento ou ra seocaqan geal Iterai artic (B) sssim como na cerebro a doenca de Alzheimer Ersbors a Sat ruloideservavam poteinaydleren‘ee naz dss doen, 3 er {ura bisa do aloe é semelharte, senda também ertabitado de {err serehante em ambas, trnanvo-se, portant, lvoe pence Ade temacos slarespruetads para romper sua estat (a) Foor de wansergio NPB, também chaado de ator de tans ‘ormagio RelA. (B) Néo. Vac pode ober eesutadosseeelhantes, ‘as ca at proteins relacionadas adn stad. €e) A pole ters dusesubunidades, Bxatem mulplas variants das suburidades, das quae as mais bem caractenzas s40 a8 de 50, 52.04 85 XDa Blas pateam mas cm a obras e rma ut rand vce de ho fodineroe ehetorcdieron As estates de dveras variate po Aer ser encontradas no PDB. () 0 ator da ranscrgao NFB 6a sdmero que se ga «sequéncasespcticas le DNA, itensifeand « transcigao doe genes prinamce Um desee genes ein cela eve x ca hemoglobins, de onde se originouo name dnt (a) Abs 6 um subtistoadequad pata Gye, poraue ambos tn cei laters com aproximaamente © meemn tsmanho © #0 ‘guaimentenkrofbicor Contd, Aba nin forma pontes deen (cans ro serum substitute adequado r esa orem requerdae| {b) Exist mista dferengar importantes ene a poteina inte tina es proteare de HIV prota por ma eis human, eda ‘ama dele pode rerltar em uma enim sree (1) Ape tnovelecoretamente, (2) A protease de HIV pode euererpontes Alzueto para um Tuncionamento alequado, (3) Mutat proteinat ‘ntetizadaa nos thessomor ve dobramb media que sa produ ‘ass pretna deste ext ge dobrou somente eps qu cadela fertava completa. (4) As protetnassintetindas nos rboscmnos po lem interage com eles 3 medica que ze dobram; isso mio € pos vel no easo da protein em estudo. (5) O stove € uma salseso ‘mals compless do que otampso ueado no estado aguas proteins RESPOSTAS RESUMIDAS AOS PROBLEMAS 1203. poser requererostraxproeinaseapecficasdegconheria pars fo enovelamento correto,() As poteinas sintetizaas nag eéluas ‘com requtncia equesem chaperona para enovelamento conte; fessas nao esto presets no tampio Go estado. (7) Nas els, « protease de HIV snetizada como parte de ura cadea mais Loge {Gee €procersada proteolitieamente;s protein do eet oi sintt ala como uma meal simples. (€) Una ves que + enzima € fan ‘ional com a substtuigio de Cys por Abs, as pontesdiseuleto 0 ‘én papel importante na eters da protease. (4) Modelo J ela ‘alse novela como a rpnotese.Aryuinono afr a estubite covalente ¢a mesma (exceto pela uialidade, assim ela deve se {novela como a leproteate rgumonto contr: a quiralade n0¢ a molecule biologie. A ensima snes nao ae enovelara cao {Sbpnoteage, Mode 2: ela vteeenovelr como agen expect {Gauprotease. A favor uma vex que os componentes individuals s80 Imagens eepeculares daquces da proteina nativa, ela se enovelats com eta forma. Contr: a ntragiesenvolia no enovelame nto {de una pstelna sie muito complexas, assim € male provsel au + protelnasitetia se enoele de outa forma, Medste ela 26 en ‘eat de outa forma. favor as interagoes envoladas no novel smen’o de una protesna S40 muta complena, asim é mais provsel {gees proteinasnttica ee dobre de tra forma, Contra: uma Yee {Gur os componente indus aio imagens eepecslresdagvelet (a protein mativa elas dobrar com eat forma (e) Modelo Ia tena ¢ atv, nas com «frm enatibmera do eubetrato ne tale € indbida pela forma enarcimera do inibidor natural 850 ‘onsistente com skis des txproveage sera imagem expect {2 Lprotease (1) 0 azul de Evan 6 nao girl sae his 4 ambat 2s formas do eins. (g) No. Ura vex que as proteases cont ‘emsente Laninosetdote recanhecem somente L-peptdeot, ad motrpsna nao Wa digest bprotease. (h) Nao necessararente Depeadede da erzima, qualquer um dos problemas lstaes em (0) odes esultar era eri inatta Capitulo 1. AprotenaB tem maior anidade polo tian Xela estrd eto str ‘atcom una concentra de Xora bata do qe aot 2, (a), (8) € (©) tem ny = 10. A cooperatndade negative sparente ‘a intragao com o igante pode se eausuda pela presenga de ds, (mais, sios de nteragao com o gant com afinitadessferentes el igante, na mesa protena oem diferentes potent na mes Plucso. A cooperate negatsa aparerte ¢comumente observa K, para esta enna) curv iver, ez A 9. (4) 40027 (4) 10 te) 9 = 2,02 = 5G) lid isto 10. (a) 24.06 (b) 4p (V6 exatamente a metade de Vy asim (A) B.) (010 04, Goxatarmente a metade e Vay ecm [Al = 10 ‘ace Ks preeenga do nbn) (A) Niobe, = (053 #77 Goto 8.25% 10M, ber abo do ie de ditusio centroad, BL. Ya. 140 pin: 1 107 12, V4, ~ 51S mini, K, ~ 0.89 mM () bio competi 1B. K, = 22 0 Va, ~ 0.50 olin B5 fg 20% 10° mi 16. A hipstese basics ds equagso de Michael Mente sind prsete A Vy # (BS) As equagies a seem ecoilas prea [BS]si0 im % Pa) = 8S) + Ne = If) pote ser ota po rearrajo da Rquac 619.0 retante segue ‘peso da deduio da equagso de Michaels Menten no ex. 17. Misia = 26.000. 1s. ws. 20. ative ds ens protiea 6 igus atid total de forsare famosa de tangue desconcando shedade da enna nobis portale, pois tatarto ibe cmplelamente a fxatase did de pret Ainibigio & mista Uma vex que o Ky parece no s alterar areca ‘wamente, eae pe ver cao expecta denis mista derounada ao campetiea A[S}na qual ¥ = Vqu/2a 6 obide quando todos a termos do lato iret da Bquagso 50, exeato Vg ito 6 (S/U0K, + (SD = 20 ‘guslem 2 ea" Comece cam [S}(ak, + aS) ~ sa’ wenconize 0 ‘alors Ati ima sore quand Glu” esa protonado e Asp do ests proton, (a) Fatordeincremento 196; ¥,~ 60 uae fatordeincremento 1048 (8) Quando a = 20, eu devi paras ita que 0K aumenta peru tor de 2. Quand ~ 30, abun da cure (0) di ‘ul porum ister de. Qaundoa = 20a" ~ $0, a cur aumenta tha da curva ane anibos a e "= 1, esd am dele no, No tanto atsnota mene, porque, deckin por um ator ded. (€) (Quando 20, ainteserginem.=aedesoea paras dela Quando a (a) Ne eran do tipo slvgern, o substato 6 santo na oso por sums Tiacaodehirogénio uma iteragio de diol nic ete a ei nterlearregaa da Arg carbon pol do prayato Durante Ss atdice cade ater da Arg” tabem etd ead de a tigi da carbon polarzda, Na mutant, a Hgagio se re «apenas ‘uma ligagio de hrogt, «gas ao subtato € als rata esa Tunago srcca d etd de transigao se pede, ea atvidade atica reduzda.(B) Una ver que Lys erg em quase oes tamanho © ‘ana carga priv sia, les pratt em popes serseltants, Alf dato, caro pewsto 2 liga Ae” por ura teragi sinc (provareenve), una mtd de Arg pats Ly er fete pogueno sobre again do substat, (e) 0 amano “read Sind shi grg pontivmentvarrgae de resine de Arg como oxigénir negativaentecaregados do private fata da itera (et de igo de rogéni de polo rico combat. Quando 4 lige ests presente, smente ina dest ners & pose, edu basin fra daineraio 0 posanarento do substrata € oes preciso. (@) Tle nterage Pirorobeamente como ane do NADEL Esse {ipo deinteragsn nso € pose om ale atria da in (e) Aestratra xt stead a segue (0) enzina mutate rejeta oprwrato porque o grupo met hiro {obico do sustato ma rd interagis como grupo guanidino altamente ric da Arg A mutate oe gaa oxanactao em wtede dat Intergdes inca fortes entre wcadela literal da Arg” 0 grupo cat bon do oxaloacetate (g)Apoteina deve sr fexivelesucente pats seonodaro sect de volume da cadea net eo subset tain are RESPOSTAS RESUMIDAS AOS PROBLEMAS 1205, Capitulo 1. Com azedusio do origin da carbonium grape hola, cae ‘erste gules em (el ¢ C3 6 mesma; 3 lela de gcerol ne 2, Eplmero dferem na configuragio de epenas ns entbons. (4) 2 throse (62), ogcose (C3), -glose (0-4 (B) ose (C2), 0 “falctose (C5), aloe (C4) (€) marbinase (0-2), lose (C3) 3. Armagio de oruzona deste consguragso do 02, de moto qu a Sldosesiferertes apenas na configuracio de C-2orginam o mesmo Serisado, cam o mesmo porte de sie. 4. Para conseteras.gtase em psglooe, quea-se aga entre C1 ea hueoula do C-5 (ver Fgura 7.8) Para converter o-gcose femo-manote, quebrise tatoo ligagio de—i quant » de —O%1 em (C2. A comversio entze as conformagoes em “eadeia”nio requer 0 rmpimento de igaen, ees 6a datingan eral entre coigiaso 5, Nio:a Beoe ea galactose fer em Co {6 (a) Amboe so piierae de gene, porém eferem quanto 3 hes (he ghecises (BI->4) ra celuazee (alot) no ghengero.(b) Am [as do nexaes, prema gleuseé ura alirhexove ea Rulez € ua ‘etoexose. (6) Ambas sho dusacarideos, mas mates contr diss amidades de ghcose igadae (alo); a sacarose contém oicose © ‘frutos ligndas(ates36). 1 HoH 0, WAL H on A, HO ten, Hoon 0, Vu yp sear onan AP sedstor HOR | Urn horace 6 ormad quando una aldose o cease se condensa ‘ons ut leo, um gicoriden¢ forado quando ums heracetal se ‘conden comm um doo re Fgura 7-8). 9. A frutate fora tana estat eieliea da piranaee quanto ad anos. 0 aunent da temperatura desta 9 eguliro ma reg da ‘anos, forma renos dace 10. .\taxa de mstarotagio 6 lt 0 ein, de maneirs ae, conor to sens canseme a Paeghcote, rate ae gicone € converts forma Be, a0 ral toa a cose oxida, A gheoze-oxdae ¢ expe ‘ies para glecee eo detects outros agdetesredutones (como 4 acter), que eager como zeagente de Feng. 11, (a) A media da variagio da rtagso pica a ong do tempo (B) A tag dpica da mustura& negative (teria) em rela agels da gue de sueaose e) —2.0 12, Prepare uma pasta Fuida de snares eva para recheo, aicone ‘uma pequena quantidade dle sorarate (invertase) imedatamente ‘tra eam chocolate, 18, A sacarae no tem enum catbonoanoménico lie pat passa por ustarotao, a cH, Var ou HO on on HOH HO 1 Hoon Sim, Si 1206 16. 16. v. 5 2s. 2. a RESPOSTAS RESUMIDAS AOS PROBLEMAS Neacatirp--gheotarina ager redutor «seu C4 pode ser ox ‘dado (ver p. 282). ngconato mio 6 um aga reduore 3 C-L36 {638 no estado de oxiagdo de um écido earboxtico, GeN(alevla) Utero um agar redtor © of carbonaearomeércse de ambos ot ronortactideos ext envolidos na ligne aia ‘Os humaroecarecem de cellae no interno endo conseguem de sada cellse ‘Acelulne atv conse er unidades de ghente gad pr gare ‘lcosiieas (BI), 8 quai forgam a eadela do poliero a ssurar “uma conlormage estena. As series poralelas dssascadelas etn ae formar ignes de droge inermolecsars,agregando-as fm frat longa, resutertese insoivei 1 gleogenio camsite em Unidas de gicose unas por gages gcosteas (a1), 0 que leas curvaturs na cadelseunpede formagio de hes longus ‘Ald isso, 0 gogénis€extemamenteramubtadoe, 4 que mutes fos grupos hitroxla esta exposto ga, altamente htt © sealapersana gua ‘Acelulot un material estrutural em plants, consistent corn toga lateral ean va insoles, 0 geogtnio€ uma lott de tnmarenamesto de eombuietiel em armas, Graal de gcogenio slamente hidatace, com sine mista extremes no estor, ‘so rapidamente hidrlsaos pel geogéni.fosfordase paraa bers (fo de gheuselfosato ‘Aclulse 6 algumas vezs mais extersa,assumindo ua conforma se estenida,enquanto a alos tem esta heicoial 5.000 residue Ls ( modelo rm eoera basa do dsacarten na Figura 7-18 nto roma interagies eaters, pork, um move de lume atimico fpresentando oe Stones com seus taushos tle essa exper bipans frees impedimertos estrios no confzrero ~170, “170, fe qune nso eso preseiee no eontrmern 3,0 ‘A cagat negative do slat de condi repens una de outst € frgam a melécua a urea conformesio estendid. A polanidade da smoléela tv muitasmolfcuas de gu, sumentado ovoune mole ‘ular No aide desdatad, cada carga nega contabalaneada Residioe de aminoeldos postivanentecarregados 2 iguiatn soe _rapos da hepaina caregaos com alta carga negative. Na vera, Tes de Ly da snitrombin It neragem com a heparin (to sequéncias poste, 146 lgugdespassvss 6 possbildadee ‘estexcoquien, mando um total de 73.724 permntagies! Cadeine do lgssecrieos: lereforese | e Olgoesacarieos, pois suas subunidades podem ser combinalas de rat manera iferenes do que ae eubunkdadr deans dot Slgppeptear Cada grup hiroxia pode parsipa as gages gic asics, eu configuacao deena gag Geass pode et 204. ( patmero pode er bnew ou rartendo (4) Residuoe em pontoe de raifcago gram 23--0-metilgicose; fr eidune no rama geram 2,3 tr-O-metginae (8) 373% Codes de residuos de n-gcose ligades (1-48) com ramicagses (2) esporsicas, com aproximadamente ua ramiieacio a cata restive (4) 01 testes exvolvern a tentative da dsolugio de apenas parte ds smote em derentessiventes eee a andive doe mates soe ‘ioe er cselsidoe pre waar ea comiponigie ere. (b) Pars. ‘ma ebelaneia pr, ae ne mle sn al alge ao heros spreventré a mesma composiio da rao ni deri, Una subeinela tmpura uma mitra de male de um componente ‘Quo tad com ur solvent epecivo, ur ds conganents pode Aeolverse mae, dean ai do outro componente par tae, Como reelado, 8 aes dsselrdas endo dsslidas apresntan com sige fees (e) Um ensinqaratvopemite que oe pera: Ares estej segregate ea pte poe degrate (6. Ao se determina estutura de uma muted, nportante que ‘ancetr sb ane sea conta sms por molecule intsctas (bo degraadas). Se a aos ester contained com reattal de- fan, oF resladosereazais conve possvelmente eran 19 Interprelaveis Um enai qualita detetara prerenga de alfvie Ae, mesmo que a amostaexivesse sigfealvaente degrada @) Reaultades 12, Orertado 1 conser comma estat conbecs po saigeno spo B tem ts anolGclas de galacone, enquao ot for Ae 0 tem apenat doi eeGuoe cas, O ert 2 tab € nsistente, pols pn Atom doi aminoagieares (Nescaigalctaae rina eAaelgheaeamina), enguant os por 8 06m apense ue (Qrecetglenarins) 0 estado 3 nde &consitente cor a ertrtica forbes pats 0 Spo A, a ani plcruminagalacosana€ LL pate tipo la6 10.(e) As amestasestavam provaveiment pura lapatilente degrada Os pares dois resiladosestarar cor Telos posivesmerte porque o mtr era mete semana portant, no to serail a nprecues ra osagere. 0 ere rou ado ¢ mas quantativ e pur iso, proravelmene dere dos aloes prewsos, devi aamestas impure ou degadadss. (1) Bxogceide- fe Se forse endoghcosidase um des protas desta ao sobre oar {igen 0 aera glean, Neacegiseaina a Nacsa pelo memes um dessesagdcates sei capt de init «degra. Dado ques enama no €ubida po menu dersesagdctes, ela deve ter ua exopicoidace, eriovendo somventeo a Yer da oe Alea 0 agcar terminal do antigen 0 ¢ a feos, qual caresponde porta, a ico agdcar que poder ini degrada do sles 10 (@) Aexoglcosare remove N-acetialactosunina do anigeno A fa glactve do antigen B Como «fucose nio € produto denenhura Aste reagoes, ano impede a veopio deass agentes, ase fala esas ne mais Serio atignos Au Bates. Brteante os prone deveram gratin spire angen O, pie grado para Ia fueate. (h) Todos reautae si eateries com a figura 0-15, (hy oPucose ex gadactne, que protegerann corsa deprdagio, no «sco presentes em nen do atigenos. 2) 0 agaea ermal do snsigeno A ¢Neacetigaaceamina « see 60 ico agica apas de protege esse angen da degrataca, (3 0 ageaetermiral do alige- no B és galactare, Grice agdcarcapas de pteger esse angen apitules 1 Next 2. @)GCGCAATATTTTGAGAAATATTECGCC, « eontéa um palit komo. A cadeaindidual pode fonmar estates de grap as has cadelas poder formar uma esraturacrucoere 8. 94x10" g 4 wwe. 5. Ao de RNA ets na coniormag A: a hice de DNA est geal 8. NoDNA de evcaots, sproximadamente 5% dos restos de estéo retiaos. A Stilctosia pode ser deeaminadaesportanearente para formar nia; o par GT resultant € um dos pateaents t= 7. Maisto. 5 Sem base, © ane de ribore poe er aber pas gear frm ale Asics rao clea. ano e+ perda de iteraes de emphareno fe bast, pders cone signeativanente para a exile do esqueeto de DNA 8. cucecatacaceecca 10. 0 erypiamento debates em deios nucleo tende «radu 4 ab- sergio de uz UV. A desnaturagto envolve peda de empihaments de ‘bear esmento de sbeorio da UV. 11. 035 mga 2 i HOGI, 0. on ay - Woy cM 1 » ‘i LoL ot Ay oo HO OH HN i On Devesiribese Goanine Fertte 1s. 1 1. 1. vv. 4s. 1s. ‘Soluilidades:fotato > desoxiibose > guanina. Os grupos festa aitamonte polars eas porges deagdcar estao na pate eaten da belice dupa expostes gua, as bases hibobics esto no interior dabeice Se ACTP for om, quanta meio residue de fr encontrado ro melde ser asonado dUCTP, ea polmer2ago sera itera da, Smet sna bands serdvaiada no gelde sequencer, ltrtoroee G)P—eaccauuECGs)—ott (G)P-ocaccaLuas oH ()P—AcaccavuE)—on (G)P—GcaccaUis')—o8 (G@)P—acaccacs"}—oHt (GS)P—ecaecs') on GyPacac() oH (G)P—Geaery—on (@)P-L0 oH ‘con ricloeeoe 5 orto, a) A dgua participa da maori das reagdes blige, inclulndo 8 que causa mutaoes. 0 bulxo canted de 4gua not endspo to Yedus a atvdade de esi cautadoras de mages © 4 tans fe reagoes mio erzimsticas de depurinagao{reagoes de hese) {b) Aur CV induza formar de eieros de pimiina cicobtro, (Comp subtle ¢ um orgie Ho sol, of esporoe poder Pars ‘rupert do solo ou pats oar, onde poder sje s b expoigia rolangad os ries UV. DBE ¢ um grupo bloqueador que impede a reacio da kate que ot (x) Grenada para de. ase ex aca exremiade 86a ade rn na outta extemdade 6" € a cdna (b) Oriental para a ‘qurda (e) Se ran conangae ver a extrutastaimensionalment, (a) Nio 6 ct Boss dados pas amostasdierntes do mesmo o farimo demonstra varagoessignfcalas eo endsmento munca 100%. Os mimeros pata C eT tém musto mais ensisténcia do que ela de que ameta do rasmo orga (em mest compo ‘io. Mas mettio cm valores menoe consatentes pate Ae Gy) 4 {six de valores para diferentes tecidoe se sobrepde abstain te; (2) a diverges entre eferentes peparagses do mem trio (aptoximatamente as memma onze amarza le direes ecko ¢ (G) em smostas para as gua venient € ao, os nUmers 30 sais conaistentes(B) Essa tcrica no seria sensiel 0 suficente para detectar uma dverenga entre céuas norms ecancergenss (Cancer 6 causa por mulafoes, mas esa lerages no DNA = po RESPOSTAS RESUMIDAS AOS PROBLEMAS 1207 ‘or pares de bes em rio bes ~eeriam muito peguenae pars seve detetatiae por esas ener. (e) x teagan AG 0 TC va ‘Ham musto ence dierent espéies Por exempl, na bctéia Sor ‘atin warcoscens, amb erates #0 de, rscando gue DNA 6 prnepalmerte competo por Ge Na Haemephitus influenza, Iente Ae. (4) A conchtio om ts exigencia: A~ Tra tabela mostra una ratio AT muito prima a lem todos ae cates. Cera aber AG e BCG ~ C:Novamente, a rasio GC € muto préxima Te oueas rides vara amplamente, (A 1-G) ~ (T+ (): Buea € 4 sete puriapirmilia, «sal taba muito pesxima 22 Ce) [As ages ferents do “cere” reprezetam dfrentes regis to DNA do germe de tngo. Se 0 DNA fosee uma sequénciarepetiva rmonctona,«compsgso de bates de todas as Yegises sera mesa ‘Una ves que regis diferentes da cere tem sequencin ierentes, a sequinciade DNA deve ser mai corplera Gapitulos 1 @) 5) @ 6) 6 6 oD o> ro 69 6 6 @ wo 6 () Método 1: liv 0 DNA. comm oRL coro em (a). Nesse posto, "uate-seoDNA camo em () ou (@, endo lgar wa gue de NA, “Entco com sequin de recomecimento da ein Bam ence suas exeemdades cogas resltantes. Méredo 2 (mais ecient): ‘Snttzar um rogmento de DNA com» esr (AArToaATCCE) @OCTAGETTANG se fragmento seliga de modo ecinte a extrerdadescoesvas ge zadas pea clvagem com Ecol, vealzaria a trod de um so Ge Bay, mas nao regenerarao sto de BecRL (1) Os quat9 fag mento (gendo N= qualquer rucestiden), na ordem de dseassio do robes, io GYAATTENNNNCTECAG) (s)GNNNNGE") GS) AATTONNNNGTICAGS) (GyaNNANCE'y GAATTONNANCTOCAG') (JENNNNGGS') (S)AATIGNRNNGTECAG®) (GCNNNNC 2. 0 DNA do ago A pode 2erempucotado em particla neers de {gos sornente eo eu tantanho elivercompreenid ene 40,000 © 53.000 pares de bases de comprierto, Ua Yes gue vetoes bac {enitagos gerumente tan aia de 80.000 pare de bases (etn duat partes), ele nko srs erspacotido em partic de ago amen que ‘le contenba um fragmento de DNA de comprnent adequado ise ido (20.000 25 00 pares de bases) 3, a) Plasmas nos quis opasmien original yBR322foisegenerado sem neers de fragment de INA exigeno. Esse welotes posse resistencia a ampicina. Dune ou mois melecaas de PBRIZ2 tribe deri ser ign juntas cms ou sem anserso de DNA exdgene, {() Os clones nae caaleae Le 2 um fragmento de DNR needa em derenteseintagées. 0 clone na canaeta 3 tem dois fragmentos {4eDNA, ips de ormatal que as exomidades proximai de EroR! ‘nao mide (paatte---09 (G)e---6)) © GoaarTo~ 5a) e 6) Ne. eo 6, © ere: noac. arcs) 1208 a. RESPOSTAS RESUMIDAS AOS PROBLEMAS (@) GaaaaTecacertaragcaTa(a’) (@)ACGTOTTTCAGGOGCAATATCOGTACTTAAG') O seu teste neceastarla de cigonuceutidens nicares (primers) de DNA, una DNA-palmerae temoes:éel, descxibontcecse- ‘os tfostatadese uma mguna de POR ermocilader). Os cigar tleotdes icndores sto deserhaos para amplifier um segment fe DNA eompreendendo srepeticin CAG. Ait de DNA mostra ta colfeadora, rlentada de 8-0" da eaquerda para ade, O nciador que se ga ao DNA & esguenda da repetica €iertaco ara qualquer sequtnci de 25 nuslotdeos mosteada aris bet ‘uerda da repeizo CAG. O nica que se a a lado dreo deve ercomplamontar eantiparaele 4 sequéncn de 28 rceotaeas 3 a repericio CAG sea ampliicado por PCR, eo seutamanho sera de- {eitado por comparacio com mayeadores de peso melecuar opis tletoreee 0 amano do DNA rela 0 mmero de teneigoes (CA, formecendo um ese sings para dagnésti da doer Detenharoigonucleotdeusinleladores para PCR complerentares atu osegmenta de DNA elminado, rae o gual decionana«aintese ‘Se DNA distante nada outa, Nenhum proto de PCR sera ger a menos que as extremidages do segmentoeiinado etearunidas para riarum elo ‘Alan expessandoaluaferase dovagalume dever apr alucle- ‘ana 0 substrato da luciferase, antes de poder "bar (embor fe amet). A planta expressando a protein Muorescente verde rina semneceasitr de rerum outs eompost Iniciar 1: CCTCGAGTCAATCGATGCTG Iniindor2: CGOGCACKTCAGACGARCCA Recorde que todas as sequéncias de DNA sio sempre exerts no sentido para 3 da esquerda para a deta; que a8 us ae de “uma msieula de DNA sio antiparaeas; «que ambos os rciadores {ie BCR deve di ae sequtneae rinse ora que ae ox ‘remidades 3 seam orientadat para 0 segmento a ser amplifeado [Nolaboratno, escrever uma sequérca na osertago eds em uh {ormulino de pedo de un cignuelesideo mead ito pode a1 S Ae 1 2 ——. ——_ -—_»——_ rs Fr ‘decade stcarpo para cada proteinaalvo €imprtcstl A marcato ‘dea prepara de aticonpo pars que gue a tod os aiconpes ‘ae ama else em patislar permite que a mesma preparacio poten {srr om moe experimented mnofaoreecénca erence [Bxpreie protein na nhager 1 de levedura como protelna de ‘ust com um dos damios de Galdp~por exemplo, o damn de ligagio ao DNA. Usando a inhager 2 de lvedura, aga una bibio~ ‘tecara qual todas as potenas do fargo sejam expeestas como po ‘inate fsa com onominio de interagso Galsp Cruse hiitees dhalinhagem 1 com a lnhager 2 « procure as colina coloidat pela expresio do gene repérter Hssus colinasgeralmertesugem de cella que contem uma protetna de fuss que erage com sua protenaalo, (Cob aanchad,sonar sluio contend Pata, wraar lar LAT 267 SAT 400 ‘Cobras manchas 24, acinar solugio contendo G atvade ira dare evar ¢ 2Gr 1a 3ATG 4c Ccobrirs mancha 3, adconarslugSo contend Calva, fra © lever LARGO 26R0 3Ane 4a08 Cobra manchas 1,3 4 aicionat solo contendo Catia, fora olarat LARGO 26rec 3anG 4600 Cobras manchas 1 02, adleknatsluso contend ative, lac dat elas Lapee 2¢Tce 2atee «ecee 18, Os icadores podem ser usados para sondar bibiotecas contend ‘lones genimioe Ings pare enisca ae extremes dos cons roximos, Se os contigs que fangueiam os esprosestverem su entemerte préaios, os nkidores pole seus ea PCR ats araliicrcietamente o DNA de imeferécia que sepatso& contigs, que psi entao ser clonados e sequencinds. 14. ATSAAGWDEWBGGKVUII-DEKLONRGALLELDIGAY 15. Amesma doenca pode ser causada yor detest em do ou mats ge- res, que estzo em cromessomosciferente 16. (a) As soigdes de DNA sb alarenievsearas porque conden fonjunto de maléeulas ito grandes © emarazhadus em slugs0. DMoléeulas pequenas tender Ser menos emaanhds eorsa uma falugio mends vatoes, desea forma, uma amino de vtecsidae {ke correeporde +m encurtamente do polimero eam 0 dwcgheeral> racer 20, Do eluido em prize ugar ao elude em ihimo lugar: pabeitato de coestecletraeigcerl colesterol ev-etraecano osttieotna ‘ fsitetanolamina: eaingomiensfowitetina e palma, 21, (a) Papa uma cromatograia (BLS, ou TLC em sca ge) com o8 com ponentes de hrolisades cides e compare os resliados com pads fonheeidos. Sidroisado de afzelii eeingorina, Sees ‘or, fost, elina oeat; hdraliado de cerebrosidee goin, sedos gratos, agicares, mas sem fstto. (b) A deze lena forte da estngametna ger esngosinsfosttidcolia gera {iverel Detect os components do hiroisado rw eromatogramat Ae camara delgadacomparando-os cam paies ou por Sta Fao ‘pees quanto ou Hesrareete is copesa em vite at exe ridades dae protelasinseria, que se projtam) do ques beara “ua O modelo ¢ mantdo somente se ura quntidade substancil de prota se projet da ica, (€) Modelo A: cbseuzo 8 dil oreatoresltado com este modelo. Se a protenasextiolgadas 3 membrana porinteragiesneas,o esl pedi qu elas con tila proporezo de aminoseio caregados, a0 cantata do gue ft users, Tarbes, una Ye que arama proeica deve se lo fina [er (by ndo deve ter muito espayo para um ncleo prteica Indofeaco, deforma que oF reduce heofeicesetariam expos tor an tlvente Modolo 8: marti, As prtein Ym una mitra te esos hidrotGbicoe (que lntragem com or ipecs) e de rea. ‘due carregads (que interaern comm gia). Medel Cant, At proteina tn uma mistare de restos httSoics (ancoradoe na membrana} ede resus carregaos (que interagem com R02) {€) Modoto A obscura 8 ail eonearo esta com este mo Aid, que pres uma proporgo exata cle 2. 0 pose arr he de Sleangar sob condigdes de pesesotaologieacente relevartes Mo Golo nets umn ners otto. Ease modelo nio faz predigoes sobre + {uartidade de ipideos na membrana Medeio ©: mantido.Aigume res de supers sa membrane pans por prota, de ora {que a proporgbo deve ser menos de 2,0, confrme fi obeerva fob Condigies sologeamente ras tlevates, (a) Modsis A: cbeci. ‘O modelo pred proteus em confrmacioestendida endo goby, portato mado somente ge for ecto que at proteus posiconndas ‘a supericeineiuam segrentoshelioidais. Modslo manto. 0 ‘modelo pris prinipslmenteprolenas globule (conten alge egneniesheleodale) Modelo C:marliso. O madelo pred prin CGpalmente protenas globulares. (F) Modal A: oscuro. 2 grupos pales fosfrlumina esta protegides pla camuda protic, mas of {osflpideossomenteetario completamente protege da fscps ero arprosinae coset naire a rupee Modelo B: man tho. A atria dos grupos poles ell seeaie a fsfoline, Modelo (©: mantido, Todos ot grupos polaresestsoaceesiel fosflpace (@) Mods Arnio mania. As proteinas esto talent acessves 2 digesto por tpsina, epratcamerte todas strerae mip ir 1s, sem seqenos hitrofobices protegos. Modslo nao marti Pratcaerte tar ae proterae eran ma bam © arenes 3 ‘psig. Modelo marlid. Os segments de prottra que penetra fou que straversam a eamada eto protegides da tpn: aqules fexpostos na supertice sera haoisudoe. Ae poayies testes § tnpsina tem ata proporso de resis hidotebicos. Capitulo 12 1. X@cAMP, sua snes €estimclada pela adenatna, {ad Aceneitugago seinentasadenil-cilase (aqua eta a or ‘magia de cAMP) na Sragio patculads. (b) 0 cANP adilonado es {ula «gcogénioosforate. (¢) 0 ANP 6 ermoestivel ele pode sr prepatado peo tatament do ATP cor hisxide de bio 2. so contrévi do cAMP, o dibutii-cAMP ateavesea prostameste a smenbrana plarties. 2, (a) Els eleva cAMP. (b) 0 cAMP rogula a permesbiae do Ne! (©) Areposiio de fuos corpora e eeesitos pros 4. (a) A muragio toma R meapa dese ga eiabieC, de mode que © std constantemente ata (b) Arutas impede que cAMP se gue [ER dean Cid pla Lasso 4 ‘dnquls e bronguile. Camo ox receptoesfadrenérgioe contro lama its outros process, eve smacespresentaia ees co terns indesjiveis Pata mnimizios, procure um agonist epectico tats o bso so eeepores Beasentnpcar enolase no mie 6, Degrudacio do hormio; hides do GTP ugado a a protena G Aegradagae, metabolism ou soquests do sogunvo mensage; des sentbiizagio do receptor, remoyio do recepor da specie eta 7. Funane CFP atresia eYFP ao domino etophasmsticy do secep tor fradzentygice ou vice-versa, Br quslqer tn doe eas, dune cm 453 nme observe tater 478 quarto em 527 nm. Sea nterasio corer, ntensidade da ux emia ini em 476 rm ame {irsem 527 nm quando satenalina fr aiconada sels expre sand ts proteus fusionaas. e's interagao no ccoeet, tem rimento de onds da ix emia peranecers em 476 nm. Alguras ‘ates para posi alas no experimento: as proeinasfusionadas {0 esto gatas ou so por algun motivo inepazes dentergit (2) ri to taneportalae ar sue Inaisagaee norma, 04 (3) no #50 eaves rene egraacsnproteaticn 4. A-varpreesine atus por meio ds eevagbo ds (Cot) eosches pars 1 a. stvando a potenaeinaee ©. A jegen de BOTA blogstn = 10. a. 2. as M4. 1s 16, yy. 1. 20, RESPOSTAS RESUMIDAS AOS PROBLEMAS 1211 ss30 da vasopressin, porn no deve afta a repo ao gues, (Go lia cA, en0 Ca", emo segundo mensagei -Aamplicagso éozesuado da atiagso de muita molécula de um ‘atador pot a aie lea de uy pitt caso sa do, emuma cascata de anplicagio gue enoive, na ort, receptor de ulna IRS, Ra, MEK, BRK, « BRK ative um ftor de tar ‘0,0 qual esturuaa singe de BNA ‘Umamstagio em ras que natives a atiidade TPSses da Ras ci rama pein que, uma ver iva pla gags de GTP, ontna ‘as emi, por meio da Raina de repost inna Propriedades compartithadas entre Ras + Gata gam ata (OUP qusato GTP, io aivadas por QTD, ivan Una enaima Jane ‘quedo so stiaaee tem stidade GTPAseaintinaece qu a des ga apse un esto perlodo de ativagdo, Diferengas snare Ras » es € uma proteus © pequens, monomers, G,€ heterotrimeric Digorongae punctate snire G, 2 0, Gare a adeni-cielaee, Oy inbes. {Cinase (ator entre parénteses) PRA (cAMP), PRG (6GMP), PRC (C3, DAG), Cx" !eatcenase (Ce Cab), cine dependente de ins (Gila), prleina Tyreinaee Co igante do receptor, camo 3 insulin), MAPK (Raf) eglicogtro-osiorase-iase (PRA). 6, permanece a forma ativada quando o aogo no hirosivel ert igado 0 anslogo, portato, prolongs o eft ds adzenlina na cht neta (a) Dil a resins cromatogrfia igada 3 acbungarotoxina para riesgo pr ainda (ver Figura Sle) do ACHR. Extras a€ protetnas dos drgaossitricos e passe a rstura pela cluna com fograliea 0 ACHR lige slelivamente 5 ena. Hus 9 ACHR om sum solu que enaquers eva interacic com a uctungartoxina. (8) Uae gag de [achurgarooxina come ensatoquantialivo pata ACHR durante» purteacao por divers tcnias, A cada ea testo ACHR pela dosgern da png de [>] bungaotoxna dt tena da amos Apetfesiue a puree para amor aividade ‘apes de ACHR (cuntageatnn de ["T}rbungastoria por mg 4e protein) no mate Sa (a) Nao, Se 3¥, fosse determinate yea permesbldade (principal sente) 20K’, 2 equagao de Nevrst prea ua Ve ~80 mi, 330 de ~85 nV corm observa, de maiza que alg wea outa conan ‘ia contra para, (8) 0 fon lorets ¢provreimente 9 deter ratte de Vs 0B. prio € 34 mV (a) AV, daverbrana do acto via de ~60 mV para ~20 i ta "a merbvana€sespoarzda,(H) Oelesto do KCI deperde do a soe Ca” a partido meso exeacelular A tspenpolarzapi remut na fvbamerto dos canals cde Ca" depen ene ce vottager.na regio pré-sndptca do baronete Ozeslante Aeertecino ma [Ca], manta berapio de un neurotansmiseor Inbitrio que suprine atividade do préximo neurinio do eteuito ‘ssa, Quando essa inbigo €removida em resposta aun estilo Juminorn, oer trnane ative onto do cerebro 0 excites (a) A mutacio impeda o in uno de Na" ¢ Ca” par dentro dat tule em respost lu 0s cones falharam esa ao lzebro 4 detecgo da us Coo oubastanetes no sioaetads, os inviduas Seria capars de energat, as nio team avis em cares. (b) A ‘utasioimpediia «elute de Ko que levara 3 despoanizagio de rombrana das cols Be iberacao canstitutiv de mena 0 san ih. (6) 0 ATP ¢respnesve pe fochamento dese canal. de ane "que os caaispermaneceriamaberos,impedino a despolarng20 damembrana da oils 6 ea Bberapio de insula, Pessoas com a doenga de Oguehi poderiamn apeesentar deft na ovkpainaechase ova aestina, (os bastonetesndo mats mostrariam qulguer vanagio no poten de membrana em respots & ux, Ete expres ft raid. A stumiragio de tao atvon PDE, porém a enaima ni consegu e ‘dui sgncstivaentsonive de cGMP, que permaneces mito tama do necesirn para matter os canis idracosaberes.Portart, ‘undo tem eft sobre o potencal de merctrana 1212 RESPOSTAS RESUMIDAS AOS PROBLEMAS 21. (a) Com s exporigso a0 calor, o# canals TREVI se bre, caurane fp um inane de Na" eC” para deseo do neuro sensorial eso Aespolrzao neutino,stando um potential de ago. Quando 9 potencial de agg atinge os termitas do axdnve, 0 newotansrssor { iberado,smalzando a0 sistema nervien a sensgao de caer () ‘Acapssicinamimetizaoefeir do eae por men ds aber de “TRV em tina temperatura, leva uma ales senvagio de ca lor O BG, extremamert balto indica que eto quanta mule topesuens de capeicne trio eeitorsensoratedrstices,(€) Et ‘utkos tives, o mentol sis o canal TRPMS, evan &seneio de frescor, em ator rivet, arbor TRPMS ¢ TRPV? aire, evan 22, (a) Essus utaccs podeiam lovarhativaguo permanente do recep- tor pata PGE, evant 4 dso colar devel a0 desea ‘mento de tar €B) 0 gene viral pode eeiear ua forma cons ‘iutiamente aia do reeptor,catsand a conatante sinalizngs0 paras aes celular, porto, odesenvolvamerto de taror (@) ‘otelna ELA pode gare «PRD pe gag de BRE de todo ‘ue BAP ests constanterenve aia as elas ividem-se cont Tavelente. () As ceils puimenares io respond neralen'e 2 POE, pois ni expressam o receptor para PGB, Mutapins que r= sniflem no receptor de PGE, conttuvamente ativan aetna clue putonares 28, Uin gene supteeor tumoral coca uma protlna gue testing 3 de ‘sao celular Una forma matante da proteins fatha na supresso da Aivsio cour mas se um dos alls cdiie uma protetna nore 2 ung eotinaars normal Lim oncogene normal cies uma = {einareguladora qu promave» dio celular, mas apenas uaedo 1m stazadar proprado (atx de crescmeto) exer presente A versio mutante do produto do oncogene cnstatomen’e envi stat tara cei, eat aloe de eesrnin esas presente on. 24. Bm ums enga que desenvove maltipoe tamores em ambos of olhos cada cela da retina tem uma dpa deetuoes do gene Bb no romenta do natcimenta, Cedo na vida da erlang, cveress cue Independenoes soieram uma sg mtagio, que daniicou allo Rb coerto, postin eta Urns eran ie desenls m Snie amor tem. no memento do nascimento, dae copie corretas sp gene Rb er cara cella a tags de ambos orale de ua ‘medina fila (extvemamente at) eausou um Uno tuo 25, Dus cule que exprestam o menno veceptoe de supertiie podem spresentardfererts conjuntos de protenasavo para a fosforagso 26, (4) O modelo com base nas cule pred que Werenesreceptoree cstio presents em dierentes cuss. (b) Esse experunento analsa ‘inependncia das deretes sensegdes do paladar. Meso que o¢ "oceptotes para doce eeu mam esejaryausetes, a8 ous Ses {08 do palada dos armas esti normais; portant, seneado de {Bore agradivels edesagradivels independents (¢) Sim, Aperda {ant das subunidades TIRL quanto das TURS nla a sensacio do ‘soe uaz. (@) Amos ot mandelos. Stn qualquer un dos modes a remario de um receptor eliminaca«sensgio daguele sor deter ‘nado e) Sim A pends tanto dag extnicades TIR2 quarto TTR la, quate completamente seneacso do sabor does completa ‘Sinnagio de bor doce requcr a dele daca aubanidades. [Bm concentragdes de sacarsee mult ase, eceptores TIR2 e, em ‘menor extent, TLR3, a Sorta de homodimers, podem devectar © ‘sabar doce (g) 0s resto 0 consstntes coe qualquer um doe rovlo, que fralecem st conchisiee doe pagans A inerae {0 com o igante pode ser completamente geparaa da geneagao do Daladar Se oligante para oeeceptor preserte nat “eluas do 2abor oce" gar uma meu os canting selecopatio aque ole fda caro composto dace Capitulo 13 1. Considerar o embido de pinto como o sistem; us nutientes, a casca do ovo e 0 mundo exterior so o melo ambiente. A tase ao. an 12. 15 16. formago de uma tinea cla om tum pinto eis draticamente & fntropia do itera Inalmente, az partes do vo do lo de ora ‘demise (oanbent) conten noleeulas corsplense de cmbus- tive (ondio de babxaenteopa). Durante a neubasée,algumas dessas moléculas complexas sho convertdas em uma grande quat~ tide de moléeniar de C0, © (alta enlenpia) Esse aiments ‘i enlgopia do ambiente maior do que reducao da eropia do pinto (o sisters) (4) ~ 48 elma (b) 7,56 kde () —15,7 i. (a) 252 (6) 608 @) 030. Ki=2: 86" = 78 Imol, ~ Si ee (2) =1.88 imo! (H) 4.4 rma (€) Bim certa temperatura, 0 ae Tor de SG" par qualquer reas ¢ fa ¢definido para corgi adic (as Iitore-Ploslato geaseasoeato a 1). Er ene Atapartida, 46 ¢ uma varvel qu poe ser ealeuala pas qualquer comnts de concensraies de reagent e produto Ken Lado. Menos. A equige total da hire de ATP pode ser serelhante & ASP +-HL0-+ ADP™ + HDDS" + (so € somente uma prea ‘macio,poraue as expéies ionizadas mostradas ag sho as rina Inatno ar ica formas preentes). So once pasa (ito [ATP) ~ {ADP} ~ [PJ ~ 1) concertragso da gus €55 © € 0 fe altera durante a zeagSo. Una Yea que #80 produdes ors Ba eagd,emvuta ("| mata (9H 9.0), o eqn se desloe para a esquerd,e merce energie ¢ ered 10. = 2 3-20] 8 3 a0 AAG da hese do ATP é reas bas quando (ATPY[ADP} for baixa (<1) doque quando (ATPI(ADP] orate A enerpadispane pare ‘colle a partir de urea dada (ATP 6 ais Daixa quia relapao TATPMADP] cate ata quand a reag30 aumenta (4) 2.85 107A hone sont) = 89 10" no. (0) 4 sea no € uma eiapa acetal, porque a solbiiade mira a co € reno de TM (@) 837 (QG" — —16,7 kok one) = 412% 107s ee. (4) No, bso requereria ura cncenteago de to ala que oti defststo de citionsdivalentespresiptenars. Ce) Peatransferdncta deta do grupo osfor do ATP pats ioe, 0 po- lene cde transferrin do grupo fosfor Cerna” ou "presio") Ado ATP &utzao sem gerar alas concenragsee de intermedisrioe [pate een dest rnsferéncia naturamente cae er (a) — 125 eine () ~ 146 tn (a) 3 20° by 58,7 (€) T4210" s8;7 om A tsomerizagio desocao grupo carbon do C1 para o C2, estabe- lecardo a queda da igaqao earkono-earbono entre C-3 © Got Sem seomerieao, + quebra da lgaqao ocorreaentze o2 oC, com a {erage de um composto de dts carbonos em de quite ¥. 4s. w. 20, 2 2. 26 27 2. CO mecanisme 60 mesmo daguse da reac da sleooldesdrogerave (verPigura 1414), (pret psto ¢ overs de uma condensagio aie (ver mec sso da aldolase, Figure 168) 0 seguro paseo € una canvenseio lds (er gus 19), (a) 46 ei} Cb) 48g 685 (€) 0 ATP & simon quando neces trio, sendo enti quebrado em ADP e Ps ua concentagio & man (ser um estado eatacinito, (sisters do ATP ess em ett etacionrin dninseo {ATP} per rmanece constante pore ataxa de seu consumo gual taxa dese fSntese.O conan le ATP exe ailersen do grep oars ter ‘inal (9); sinese die ATP a partic de ADP ervovereposgao desse ‘rape fotos, Por, 0 fost ternal pasa por uma repoteso pa. im contepari, a reposigi do fufato central (B) tla ‘nent eta (a) 1,7 imo! (W) A proostrase inorgnicactalisa a hide do roost econduzareago no snto da sites de actl-C0, (a) NAD INADH (8) Parwatoactato (€) Formagio de leat (4) 28, nal (e) 383 10" (a) LAV (b) ~ 220 imal Ce) ~4 (a) ~ 0588 @) ~ 9520 (@) — 029% ‘Em ordem de sznento de endaea ,(, (0), (0. we (a) O cata de male Yaa eneepa€ de maa entropla corre quando concentragio do eorante € a mesina nas dae elias Se {ana unguo tip fend do tipo “ane de pee” pee o tans porte uniirecons, um mor quantidade decorate ib pars ool odendeeitoe menos pate o atc. Bese é ues emai alta fener ede ais Hana entopia do que o esta de puta, volando {segunda et da ermovinama. 0 moselo propos por Robinson ¢ Coaboradoresreque ua redutdo expontinea mnpessivel da eno bla Br tenes de energi,o modelo real tna Yara espont ‘ea stad ce mas batts energia pata ude raat energa ses Short de energia~ de novo, termodamicamente impose. (B) [As mléculs, ao contzdia dos pees, no exbers comportamento Givecionat, eas se ver ae wea por mavento bownnd. A igus resulta em um morentowftive de receeuas de una re {to de concentraao mais alta para uma regio de concenras30 mais {nica simplemente porgse & mast provavel que uma molésls que fentej no lado mae concenrao ete no canal le ee. Veja it ‘omo ums vi com ela imtante de vloeidade extrem {rea do canal. Aextreidade ras eta iia slociade com a ual moléulas atravestam porque o movieatoalestdno € menos ‘Hloguado para move-es através do det menor. A extend Sple do canal nae tua cco um unl para as moles, embors 0 fagaparos pears, porque as matcuss no so "corprias” ples Indos do furl eteito amo os pees 0 #30. 4 extremidadeesreta lita a veloc do movment igalmente em ambos eno (Quand concentrates er amor o lao en igulare eat de em abo or serio albert, eno haves vara na ‘incentragio, (e) Os peaes exer comportamento nda aleatri, Sstando suas apes em resposta a0 mci amlent, O8 pees que entrar na abestra larga do canal tender ase rover para adarte, porque seu comportamento indus 0 movimento adante, eels se agomeram’ A eeida que se mover pelo canal eset. tel para os pete enzar na alberta lnga, mae ees nio sama da aerate {io facimente poraue é menos provivel qu enema abertua es trea (A) Bxistem malar explicages poses, alumas dat Quae foram propottas pelos ator dae cata que xara o artigo. Ach ‘eo dug. 1) Ocorante se liga a wna moléoula no oliedandré ita Aligagio remove eletvamente ocotante do solvent, de ose (ue ele nso "conta" coms slut pas as carsideragos tear ‘i, embers permanesavsiel so mucrospiode duorertnci, (2) 0 Conanteo soquestrade om wna organelasuberkular do lie Unita, sendo Bombeudo ateamente 3 sts deATP 08 strato por utr molecula desesorganela RESPOSTAS RESUMIDAS AOS PROBLEMAS 1213. Capitulo 14 1, Equagio reputante: Oicose + 2ATP + 2 gheerldeto-Dosisto + 2a? + ait AG" = 2) imo, 2. Ravage renutante-2 gleeraesdo-ostto + 4ADP + 2,92 be tuto = 2NAD" 4G" =~ 114 ln 3, GLTTE (e GUT éercontrao no Meadow est sempre presente ra membrana plarmsea doe hepatseitoe GLUTS ets sempre presente ‘ma retsbranapatntin de doterminada cn do cerebro, GLUT ‘horaientesegurstrado er Vesicuas nas edie scutes edo {eeldo adipose se nrodus na methane plasmdtiessomente ex espsta sulin. Assim, o iad o cerebro poder capargeose Ao sang intependenteceno do nivel de nsdn, aso sed © f tei apnan a capa somente qastlo oe nied de iain vo evan em espa gieose sanguinea alls. (CH CHO + NADH + 1" == CH,CHOH + NADY = S60! (a) "CH,CHOH Co (."Cjteare ou f4!"Cglease A fomtagao hers energia, uma parte 6 conservada na forma de 'ATP, mas ua grande quatidade 6 disipada como calor Se 0 con ‘eso fermentation rae for resirado, stemperatara tora as ¢ Pullen para maar os mierrguiees {8 Grios de ao igo contém amido un poinero de glicoee Os mi forgnismos degratno amido em icon, glcoee em pavato wa {edie pirualo em leita ~ porque o proceso se realiza naa Fercinde 0, (ous, € ma fermertarao) Se oO, ecter present, ¢ Dura sets ordado ascetic eno a CO, 140. Certa quant ‘ade de acetl-CoA, conto, ars também hdrolsda ci actica {vinagte) ra presenga de oxigen 1. Rete experimen demons «reverse ds rea ds al dolige, 0 Go do gerade 2fogtate ¢ equvalete ao Oot da fo ‘osenlSufontato (Wer Fgura 16-7) gieraldeldostotsto ell deve ser area m9 C-. © 63 da dskatonicetonuntstte se tea area pela regio da zoteefalo-szomwerse, gers free irtita mares m0 C3 10, io. Nio héproducie de ATP em condgdes anuersia; x produgio sera de ATP ser leveente reds LL, Nio. A lactatondesirogenase € requerida para a reposisio de [NAD" a partido NADI ormaio durante a oxdaqa0 do gceraide 12, A rranstormagio de pcos em lactatoacaze quando os mibitos es ‘Ho cam Bass oxgéno, isto propeciona ure de grat ATP sob candies ce deiizneia de 0, A gliense nao ¢gasta porque oats “o pote ser oxida a pirat; este &oxiao em reagineaerae ‘rganismo uma mor capadade de adaplagio ao seu ambiente 418, Elaremove rapidamente 0 1 -bioefoghiceras em urna etapa subse qoene fore) clairada pla fonfogierato-cinare. 1A, (a) 0 produto € Sosfopicerte (b) Nio hé sites resltante de ATP enn candies unaerdblas na presenga de arsenate 1B. (4) Afermentags do etarol equer 2 ee P,por mol de gos. 6) O claro] €o proto redid forma durante a reoidago do ‘etanol Sino pirwato deve see convertido em etara para s produgso de ue supriento continuo de NAD" para oxdagio do glcerade ‘do-fossto, A frutace] -iontate se acuul, eat forma come ‘um iterrero na gcse. e) 0 arsenata subs oP, 760;30 fi pleerldedo-Sfoist-desdrogerave «forma im aclsteenat, tras oSosogceatocortinua ra a 16, A nocina da deta €usada pata setizar NAD". As omiagbes eft fas pelo NAD’ so pare de procesos cen, tendo 0 NAD" como area de elétrone (agente redtor, uma keds de NAD" xis ‘mutts mihares de molécuat de gcos,e asim a neceasidade da ‘tami precursors (aia) ea eta €relatvaerte pequena AT. Dishidrosseetonafosato + NADH + 10 —+ ghverobforiato + NAD" eal por ma desisrogensae) i= 149 x0 1214 RESPOSTAS RESUMIDAS AOS PROBLEMAS 1B. Defciéncia de gatactocsnase galactose (menos téxes); UDP 9 case defictincia de uri galactose 1 fora: galetoe-Loslto (als ne), 19, As protenas sho degradadas a aminoécios wise nagiconeogé- 20. (a) Na eago da prueare-earboutne, “C0, € adiconado ao power 1 mata PEP-catborcnase remove o mes CO, na eps eRe, ‘Assn, o “Cn €icorpornde (icamente) a cose. 00 on on, oH, fo — feo toro sdoo- sdoo- 600 LMcrPinwato Onsloeelato —-Fofenolpreato ‘CH,OPO}- ton Gxt.070%- Guion MG-opo}- ton 4 —oPoF- é «doo- udoo- 1,3-Bitosfolicerato | Fosfoglicersto 2-Foafogicersto GrOPOr H-C—OH GHLOPOS- = wotong prot 7 nosel—bon Ak Frutose 1.6-bifoafato 21, Quatro equvalentes de ATP por maléeua de gcoee 22, A glconeogénese seria amenteendergica «seria mposivel re [dar gconeogenese ea gieslisesepraarente ‘Ac@ul "pasta" 1 ATP © GTP para converter plruato em PEP (@), (0), (so cries; (2) «(em so. 25. O coneuo de seoo forcaacompetici pot NAD” entre o metab rio do eanol es giconeogtneveO problema & una cmbinagio de fuerelioextenvantee falta de eno, pague seta altura o nivel ‘de Bose no sangue i € bab. 26. (4) O aumento pido dagelite;o aumento do pirueats edo NADI resulta er aumento do acta, (b) 0 lactate € transforma em ge foe a iruvto esse puoceao mals lento, ge «forma ao do pruvta 6 imtada pea dspondiidae de NAD", eglibio da LOH E tavoréel ao lactato, a conversa do prusat em gcose necesita fe ener (@) 0 earn da eagsn da DIT 6 ators! forma delactat, Be 2 0 a1 lactate 6 transformado em dlicore no fda pela giconeogénest (Ger Rgurss 118, LLI7), Um deeto ra PRPase-impedina + en- ‘Wada do lactato na ta gcuneogénica nos hepatéetos,cusande ae mule de acto no sangue (0 succinao ¢ tansormado em oxaloacelato, 0 gua passa para oc tole ¢ convert em PEP pela PEP-carboricnase. Duis mols de PEP eo requeadn para pugs de um mol de gente pela ota eteada ma gus 1417 Seat va catabilics enables do metals da ghcote etveema porando snaitanearcete,ocorte cco fal de ATP, com corsa ters de reago no tert verso pela ago das masse (ver Eguagdo 13-0 sum afetar outs reagesmetabalcas que envolen & sostto como subsrato ou produto ~cmo as as de sintese de icleteoe (GE provivel que a tolerineia a0 etanolenvava must male ge= nes sue cazo a engenharia gendeasgleeia um projet mie {to mais complicado (b) A varsbinosessomerace (4 eruima are) converte aldase em cetose ao river o grupo carbon de agacat ro fosordao do C- para o C2. Nao 6 eiseutidanenhuma enzima anoga neste capt toda ag ens deserts cata sobre agdearesfosfonidos, Uma esina que execta ta transforms {Go sila com agiearesfosforados € a fostoexoseisomerase. A Eribulocinase Craft) fosfora um agdear no 6 pea transtertn- th da fofato 7 do ATP Multas dessa eoagbes eri deserts neste fapltua,Iculndo a reago da hexocnase. A Lribulose-5ositan ‘epinetase (ora) toca os grupos He —OH no carbono gual de Um ager Neste capitulo nao est descritanenkuma reapao sala, snag est no Capito 20 (wer Figura 20-13). (e) As tes enzas| ‘ara converte arahinnse om xiuloe-Sfoeato pela engine vs Arabinoee HEBER, alae SADE Lore fof SESE, culoge-Sostato (A) A arabinose 6 conversida em lub se Sonat come em (€), al entra na via mostada na Figure 1 25; produto gheest-Efosate€ eto fermentado« eanal e CO, (e) Bmaléculae de sevinone + 6 olécuae de ATP aio converses fm 6 moléclas de nsloee-bfststn, que almertam am moet fa na Figura 1423 para gerar 5 moléculas de gcoret-osfate, © ‘aia uma dela 6 ferment pars grat ATP (eae entrar como lcosesfostato nao emo gheoae) ~ 16 ATP no total. De pon a Ponta experanse a geraqio de 15 ATP ~ 6 ATP ~ 6 ATP a partie de B moldeuls de avabinase. Os outvos produto #3010 moldeuas de etanole 10 malteulas de 00, (£) Dada a geragso de ATP mai baa, pars um crescmento (st, ispanbiidade de ATP) equivalen-e Aqueleobtdo sem os genes aiclonados,o Z mobiis modiscad deve fermentar ait arabinose, «deers forma ele produ mais eae ‘ol C2) Una mancen de permits de ose vein nto de [gees ara das enaimas Uma sndioga da ena araD que covers “ose em rsse pela roca de —He-—OH no C.3, eum anoga da fama a7aB que losforla a bose no C5, A rboe-Slostto esi {ante supa as exstente Capitulo 15 1 (4) 0.0285 (b) 308 (2) Nio. 9 é ato mais bao do que Ky sae ado que azeagio da PFK-1 ext lange de equlbric ras eas e880 Feaplo ¢ mas lent do que + eas posterior a goalie 0 Saxo pela ‘a oes € baieaente determina pela athlade da PPK (a) 14 107 (H) A concentagio fsiligi (0.023 ma € 16.000 vues a concenraso no eqs; eat ago no alana 0 egule Igo na cua Mua eagoes nto etao en equi a cll Na austria de 0, ATP necessvio € produado peo metabotism rarrbio da gene (ements ttn, Lima ve a oxi teria da geore prs mito male ATP do que afermentacio,€ necesine menos geass para produ mezma guns de ATP 4. (a) Basten doi soe de igasS0 para ATP um so ctalteo eum slo de eguiagic A Lgao do ATP 20 ito de regula nea PEK. 1 pela redugto da Vg, ou pelo sumento do pats o ATP no #80 ‘italic, (b) 0 fue lcoltce &reduxde quand hs sbundincia de [ATP (6) 0 gro nda qu osmento ds ADP] spre cig pelo ACP Uma vex que a quantdate de nicleaidecs de aerina ¢ fazoaelmente conslante,« tonrumo le ATP leva rn aumento 2 [ADP] Os dadan masra que a atividade da PP&-1 pode serregulada pela roporgse[ATEIIADD) 5. 0 grapo foto da glone-orat ets completamente nize em pl, dando 4 moléula ura carga total negation Uma vex que a8 ‘menbranas suo geramerte umperieivels ales eletrcamente ‘artegadas,« ghtone-b-oesto ni consegue past da correte su ines pats as cua, orien, no entra wa gcotics «gens ATP Gisse 6 0 motivo pelo qual a gicose, uma vex foforiada,r30 consegie earapar da clu) 6. a) No sscul: a epradaso do hicogenioforece energa (ATP) wis gle. A ghoogénioostorage eatalies 4 conversi do lice {ino armazenado em glcose--fowato,qve€ eomvertida em co essen, nleredirin a gesien Durante aoa nena, 0 trasculoesguceticerequer grande quantiade de glease-4.fxfto, [No fgndo: a degeadacso do gcogtsio martém urn nivel sngulaeo ‘onstante de gcose entre as etsses (a glase-Hosato € conver {ada em gzose re). (b) No trabalho muscular ato,» necesiade tie fuxn de ATP é mse ts ea gcoe-Isfoiata dw ser pola 7. (a) [Pflghcose-t osteo] = 3.371 W), Ce) 0 valor desea proporsio ra eta © 100:1) india que a [icose-Losfato} est bem abaixo fo nivel de equi. geae-L-foriato€remida (para ona ns ‘lee com velocidad must mae do gue sua vote de ro ‘lugs (pea reagio da gheogéniotosforlase), de modo que 0 Zuxo retablico€ do gloogéni para gheose-L-oslata. A reagao da geo fnio-fortorase 6, provavelmente a etapa zopuadora na degragao fo dicotinin 8. Ga) aumena(W) dimina () aumests 9, Repouso alla (ATP, bai (ANPI;[acot-CoAe een} interme: ira. Cori: [NTP nermeia:at [AMPI baa facet] @ [eitato}- 0 fuxo de ghcoe pela ghesise uesta durante a eorida aera pore (1) « bio do ATP pela leogtno-esorlase © Dela PFKCI pacaeateabranidads, (2) 0 AMP este aba ot ‘nats, ¢ (9) of nis banoe de cto de seatieCoA abrandimn eur estos inibidoresrespectvament sobre a PPK «sobre api 10, © péssuroigratni eonta con uma oxdago de gordursaamerte ‘cient, enn vo cdo rstabelenaanaerin da coe wtdaado pela ovo eatreder. © pastaro reserva o geogénio de seus miscalos pata curtar-explsies" de enegia ante suacées de mergenei AL, Caso. (8); Cas B. (6) @); Caso C. (A) (4); Caso D. (8 (8) 12, (a) (1) Tei adipose sinter maint de Sides graxor; 2) Ma ‘il; glee, antese mais lente de dcldos graros © de gheogénl; (G) Masao: ghelee rate raid geoneogenes,sntse mal eta de deidosgrazose da ghcogéni, va da pentose-fosato malts 4a. (b) (1) Tecido niporo e (3) tgado sinvese de dei grazer ‘ai lent pra sala de invtinareulta na nativagio es ae “CoAwatbowiate a primeira emgina daa A istese de ghengenio 6 ‘nbida pea fosorlao dependent de AMP cio (e consequente stovagho) da gcogéniosintase. (2) Museulo: a ghesie est mais Jenta porque 0 GLUT est nati, iin «capt da lice (3) Pgndo-a gedie est mas lenta porque o complex bifurconal PPKAIPBPate est em sua forma com = PPag~2 lia reddy ltrstoze.26iosato),o que stimula aloteicamente a fosfotrto ‘inane eid a FBPase1 ao tar responsive pela esti ‘iodo plconeogtnese 1B, (a) elevate (b) elevator, () slevatos. AA, (4) APKA nio poe sr ative em tespots so glucagon ou ae pai, ea lcogiosfosfonlae nso 6 aruda, (b) PPD permanece 4s. 16. vy. RESPOSTAS RESUMIDAS AOS PROBLEMAS 1215, tivo permit a deseeforagso da ghengénisintare (aiando-s) fa ghengSricosonare (bina). Ce) foeforiate permanere {orf (tira), aumentando drgradagso do ghcogénio A ‘ieoneagenece nao ote sr estima quando or nivel de gore "angus forer bat, leva am nivel grees perigorsmenta ‘A queda na glcate sanguinea desencadelaUberacio de ghucagon pelo pincrent. No figado,o otmdnlo ative gleogéno-oworlase pels estimulagio de sua fosiorlagso dependente de AMP cco @ frtinula a geoneogénese pea educto da tore 6-borso, ‘Stoulndo, dese nds « FAPate (a) Capacidade de mobizagio do glcogtni redid, gicose son ulnes mas bana entre as efeiges. (b) Capac eduava de ba Jaros rves de cose sanguinea apis uma elie en em carbo Aratos ease sanguinea evade) Fratese2 6 iesato (F2SBP) edtda ro liad, o que esi ghessee ibe a gconcogtnese (a) FuDRP redusd,o que bea plese esl» glconeoge nese (@) Capagio de dcdoe gros ede gicoge aumento, avento 4a oxidase de ambos. (1) Conversio do pirsrato em acei-C98 a rentada ste de eos grstnesurentads (2) Dado que cada partials contém cere de 65.000 resis de icore, a concentracsoequivalete fe ghee livre geri 55.000 % tieo serio para a eu! (Os Nuidas corporas tem uma cerca Ge substancialerte mais bana). (b) Quanto menor o nimero de TanfcagSes, menor o ndinero de extremndades livres depanivets patna agio da glagéniofoforase, menor a taxa de Iberagio de {icose. Sem raruleaies, haverlasomente um ato pata astuses0 Ga ean. (€) A card externa da particula estaria ut chet de Tealduoe de glicone para ques enainatvese acess a Meacies Para Didrols.age Uberar glove. (4) O ndmero de cadet dupas erm ‘da camadheucensv:acaada 1 term uma caela (2) artada 2 tem dus (2), camada 3 tem qua (2), e asim por dart, ‘Asin, para catoadas, o ndmero de eadeis na eatnada tale ex terms, 0, 627" (e) O nimero total de eadeas 24 2142 mT gh] cada cadets contd g,moléeuas de gcse, de modo que o numero total de meulas de gave, Gy 9,2 2). A Bleogene-osforiase poe lbevar todos os veviduos de pcose de tua eadelade compnmento 9, menos gusto, Por isso, para cada ‘dela na camada externa, a enatua pode lbear (9, ~ 4) moléculas Ge gcose. Dado que exstem 2" cadeias na earada externa, 0 pumero de woléeulas de gcose que «exaina pode iberat, Oj & (G.— 9127) (4) 0 Vou dena cera ier Nese eso, ‘sespennur dea cata vee ome de camadas 04 (0,12 9, Vimy’ (129, + 0:35)" mn Ch) Vore pode rottatsgebricamente que alr de que maxiiaa indepen Gente des Escothendo + 6 4 58 4 @ 8 BP 4 # Bo ow 4% oo 4 6 ms 4 moe 4 7 BO 4009 % oT 40098 0 oT 4 4m #8 ow ‘valor otimo deg (sto €, no fmm) 618. Nanaturts 9, varia de 124 14,oquecomesponde avalores demo prisms ao timo Se voce escolar outo valor pata, o mers gers ifrents, mas 0 9 oto ainda sees 13. 1216 RESPOSTAS RESUMIDAS AOS PROBLEMAS apitule 16 1 o ‘AceulCoA + oxaloacetate + 1,0 esto + Cab, © Aconitase [isto ieoetete (© Sroitrats desisrogenase Inpatato NAD" acetogutarato #0, + NADEL © eCotoglutarato-iosidvogenase: Catgiutanato +NAD™ + CoA aucelneO0A + CO, + NADH © Sucrini.Cadcsintsage Succs0on + R,+ GDP —euccnato + CoA + GTP (© Succinatodesidrogenase Sucinslo + FAD» fumarato + EADI, 8 Funarase Pamurata + 10+ alato OWatotodeniaropenase Malte + NAD" + oxalosetsto + NADH + H (2), (©) @ Cod, condensago; @ nenhum,ssomerizagso; © NAD", destatbortigio endative, @ NAD", CoA profosfato de tana, descarboulagio data; @ CoA, fsfrdagto no nlvel do suber ‘@ FAD, exidagdo, @ neni, Hdrstagbo, © NAD" oxida (4) AceieCok + SNAD' + FAD + GOP + P, + 211,.0-» 200, + CoA 2NADHE+ EADHL, + GEP 6280" ‘cose + 4ADP +P, + 1ONAD" + 2FAD-+ ATP + 1ONADHT + 2FADHL, + 600, (0) Oxtdagio; retanel + formalde + [FH (6) Oxagio, formaldeo format + [IH (@) Redugio, 20, + tt] -vsormato +18" (A) Redusio erate +P + GH + cero + 0. (©) oxtdacio, her -> db ldvntacetona + (HH) (9 oxida, 29,0 + ttueno—+berasato +E + 3[B8, () Oster sccinato fumarate + (1) (0) oxiacio, pswato + HL0—>acetato = 00, + BH, ‘A pars das fers ett, ¢ posse observar que araio HC dee carbonos gals do dco hexaroie (1118) maior de que aguela ds gleaee (16) 0 chlo heranceo mas reaundoe gers mals ene ‘Ba am a cmplets eambustio a C0, 1,0 (4) Ova; ano] + NAD" agetaieido + NADAL +H (b) Reid; 1 22sosfogcerate NADI 3° lverldeldin-oeato + NAD* + HPO? () nates: pruato = H+ aetna + C0, {@) Oxadado;pisvato | NAD" —acetto + CO, + NADH HY (e) Reddo oxaiseetsto + NADI + Hs mala + NAD (O tnanerade acetoacetate +11" acetona +0, TPP anelanseo se uiciona ao carbon ado pirwetoe ertio es ‘uti earhnin rsaantestuado com esemdoate de elétoons ‘eso epoca oxida pirat ro nivel da acetal (aet-COA) eh ‘ao acelatoa forma tier Cok Hava aes forma ister ADroxie o ido peo. NAD": oda o FAD. ‘falta de TPP nib s piravato-desirogenaesopruvso se acum, Deteatboxilagio oxidative; NAD" ou NADP"; ecetoghitaratoded- drogerae. (consumo de oxignio 6 sm mes da ativdade do doe priele ros estigis ea resptaio celular: hess cielo do seo eric. A iio de cxaloucetato otal extimula occ do ida etic, portance, erimua a eaprasio,O oxaloacetate o malt acto ‘es desempenhar tung cata, pos S80 regenerados na tina paste do clo do eid eco vo. n. 12, ut. as. v. a. 2 Pn 2. (2) 58 « 107) LL x 107% (@) 28 moles ADP (os ODP), P, CoA-SH, TPP, NAD"; nd énecessro adicionar Sei ipoieo, 0 qual ets rovalertemente lgado a enim que 9 ‘tia ‘Os neletieos de Aina, FMI ¢ EAD no svi snteteado, Como ‘FAD énecessivio pata o cco do aco ico, deficénia deve ranateadament nis oil, ‘oxaloscetato pode ser desvao prea sstese de spats oy para a gconeogenese. 0 oxalacetato ¢ reposto peas eeagoesaraplere- lias catasadas pela PEP-carboicnase, PRP-carboxase,erzima rsa ou piraatnrarbosace (ee Figura 16-16), (0 grupo fostato tezanal do GTP pode ser tanserdo a0 ADP por meio de uma reac catasaa pla mucleosieo-ostato-enase, om fonsanve de eqn igual 10-GTP + ADP» GDP ~ ATP. (4) “O0C—CHt,—Cit,—COO™ (eueeinat). (0 malonato & urn ‘nitidor competitio da sucsinatoneaidrogenase, (€) Um Boqlo do ciclo do deo ctyico interrompe scessvamente, a frmagso de NADH, atranseréncia de eetrons ea respira. (@) Um grande ex- eed senate (estat) supers nibigi competi, (a) Adicne|"Cjgcose unitumemente marcadae verti ibe sd0de'"CO, (b)Tqualmente distibuldo entre 0260-3 no oxaloace- tate; um ncmaro innit O oxaloacetate se equa como succinate, no qual C-1 © C-4 sho quialentes.Oauaiacetatodervade do suciaata€ marcato em. C-1 (0s, eo EP derivado dees onaloaceteta ees mateo no C-l, oe ‘corgem ane («Ct da lions (A) C1.) C4.) C8 (A) C2 (grapomel) (ICA DE: -ualmente distibuldo entre C2 ¢ C= Avamina énecesscia para srtee de TPR, um grupo proséico dos ‘amples ta prurato-desdrogenare eaecatogltartowiesirogenae $e. Una deficlncl de tala red a ativiade destescomplexos atndtioose cae ocbuervad acti ds recutstes No, Para cada dois caroonos que entram na forma de acetato dois Asia aero na forma de CO, portant, no hs xseae i de btaoacetate, A site gua de oxaloacetato oore pela descatbo- _xlago do plruate eng anaplerdtcn, Si, cieln do Sido tio seria iii. 0 oxaloaetao ets pee tents em eancertragées ratvumerte bras na rtect, 6 Femogso para a gconeoganeve tenders dsloca 0 equi da ‘read daetatoratase no sentido do oxaloacetate, (2) Inibicio da acontase. (W) Fucrcitrato;eompete com o citrate; porum grande excess de tat, (e) Cirao e huroctat sn inbi- fotes da PPICL. () Todos os procesos catabiosnecezence para {yrodujio de ATP estzo Moqueatoe tics (cose + 2P, = 2ADP 4 2NAD" + 2pirmto + 2A7P + ANADH + 2H + 28,0, eogi da pirwate-carboilas; 2Pruvato +260, + 2ATP + 21,0 ‘onalsceato +2ADP +20, +480 Reap da malate desisrozenase Omaloscetsta + 2NADH + 240" + 2imalto + 2NAD’ Isso recil ae eoensimas de nicotinamida sn onder ansesbie resco geal Ghcose +200,» 2:emalato +4" "sso produ quatro H" por glitose,sumentandoaacidese, portato, o saboradstingente do vito. Reagio enutante:2Piuvato | AIP ¢ 2NAD* + HO—> scetoguturno + 00, + ADP +B, 2NADH + 3 ‘cielo participa dle processor ealablcn e anabslcos Por exer, fe gers ATP pels oxacan de substrata arb formees pees furtures para aintse de amiosesdos (er Figura 18-18). @ 26. 2, 23, 28, a. a2, as. 4. 4, 2%, (2) emir (8) suena. (€) iin (2) 0 citzato& produndo pela aco da ctato-antase sobre oxale tata eacetI-CaA A ctratosinase pode ser uada para scese {guide de cizto quando C) existe um inf continuo de oxox festa cetsCoA novoe@ (2) a antere de eos eats ma, ome emu eso vm ba nie de FA neat rear Fe portato um lo pore em Fe" estetgeasnteve da scotase (by Saeaoee + HO» cote + store Gleoee +29, + 2ADP + 2NADT > 2pinuvato + 2ATP + 2NADE + 2H + 2840, Frutoge +P, + 28DP + 2NAD' > 2 pirwato +2 ATP + 2NADIL-+ 24" + 210 2Pauvsto + 2NAD' + 200A ‘Lacei-CoA + 2NADH + 24° + 200, 2 Piraato +200, + 2A1P + 28,0-+ ‘oxaloacetate + 2ADP 4 29, +a 2 Ace-CaA +2 oaloscstata + 21,0. tate + 2008 Areatio ger é Sacatose 11,0 + 29, + 2ADP + QNAD' + Sesto + 2ATP + NADH + 1030" (©) A reagso gera cansome NAD". Camo 9 conte clue desea ‘ena oxida €initado, ela deve ser recielada pela adel tran pottadoa deeftons como eoneuro de 0, Conaequentemerte,« ‘orersio global de sacarose a cio treo €um process archi @ eque oigtio molecular ‘Asuctnl-CoA € um ermero do cel da ida eco seus rule sbulza ute redzido 0 longo do clo, demardando ne ‘nada redida do acei-CaA par dente do Glo. Actuate, por tein da regula ds a ods principal a eli reg 0 $upmento de NADH, porta, oxo de etna do NADH pars (O estabetsme de idee sraxs eles a fcet-CoAl, 0 que eins = piraatowarbonare 0 reullanie aumento na [otanaclat] ee ‘lao contumo de aeti acc AMP + PP, AGLAMP + CoA->ac-CoA + AMP 1218 2. a “ 16. wy. RESPOSTAS RESUMIDAS AOS PROBLEMAS (b) Itrstig reversed de PP, 2 3P pela piofotstase inrginics elu. cig Aldodecanll-Can 6 converte em cis dodecanl-C0A ¢,& segus, em B-idtoxidoecanoiCod uate acetl.Cah eI proplontaa, ‘Sim, Una pate do to ¢ remonida do panatto durante a eases Ae desidrogenasao da G-oniagio, 0 tetio removito aparece como Sguatcvas Os rupos aci- gros condeneados cons CoA no tol sto primeira ‘wanstesids poe «carina, com ibeapio de CoA, e entio trans races par mioctnsi nde sso rover coven om 2 Goh Or reseratria itiose mitocondras de CoA #0, dessa ‘co no entea na mitocindl (2) No pombo,predomina a f-oxdas, nosh, predominaagics- Ise anaerdbia do gcogtrio.(B) A muscuatura do orb consome mals O, (e) A gundurs cont ras enenga por grata do uso ogo. Adm isso degradagso anatrobia do ghcogéni ¢ Lmitada pels tolerincis do seco a lactate formado, Ass, 0 pombe, Que ancina com o metabolism exidatsvo das gordurs,¢ 0 voador de Jong nts (Bara onsite aroulasora de ae reap= ‘0 malond-CoA no iba ai ett dos Gidosgraxos na ie toctnaifiae na roxdacao, deforma guo poesia serum ciclo ft ae sinesesimllnea de Seis graxor no ciloel © degracasso na (@) Acntiada de dcios graxos na utocSntn, mediada yea care tina, etapa limiante da veloc na oxida, A deine de carnitina rer a oxida dos dds graxos; a ago de carina uments tata. (B) Tosoraurentam neresidae metabea a Suilaco dos scilo gra” (@) A deine de earrtiva podera ser esultado de uma defiséncia do seu precursor, ise, 3 de wn, ‘ele env ums dat ens da bneitece de cretins ‘A oxidagio das goriaraslibers gua retabica; 1.4L de gua por kg de eepaimstlgicera(gnorar a pequena conebuso do gceol para a masa total) ‘As bacérse podem ser ueaae para aida completamente of hiro tarbonetos em 0, 8,0, Contude, pode sor diel conseguir cntato tire o hidrocarboneloee a ena baceranas,Nutintesbae- terianos como o nitogéniae foro poder eer initantese mbit 0 (A), 196 ed fentaetic (4) Pat ‘Uma veaqueoeserstni de CoA mitocondal ¢peauenn, ess deve serrovithda a pats deseeti-Con vas formagin de corps covini= fn. eso permite funconamnte da vs da Boosdagso, neers para produgio de enerpia (4) A gcose gers piraato vs gcse, « o pinata 6 principal one de oxaloacetato Sem gicose na deta, a [oxabaceato] oa, ¢ o cielo do Sido eric rede a vloctasle (hb) De sme impa Dara ceo do Sido ezco« precurtores de gusty earbunos para iconcogtnese, Para eid heptanoic de cada impr, f-oxdagio prs propio- Um material de putida pare a geoneogenese Os Seow geanan de «aces pa aio marten a glconeogtnes, porque so completamente nada a aetleCon ‘A fonda eo anluroleato forma funraceti-CoA, que entra 30 tela do sede efi produ Auortato, patente inbidor du acon tase. Anbigi desu enaima paras ciclo do seo cuico. Sem os tctvalente redtores do ice do deo efi, osama onde tiv (intese de ATP) rea, Ser por Ala: blogula«f-oxsagso na mitcinda. Ser por Asp blo sue sintese dos ses gras, stil» oduct, a. a 26 2 Blade. CaA sree A reaps ao gcagon 0 arrnatna seria prolongs, povoeando tale mobiiagio de cos grax nos adip6cioe, ‘A eu-PAD, por ter um potenca padvio de reducso mais postive, € ‘um acepor de elatrons melhor do que o NAD’, e reac conte ‘iano sentido oxida do aisConegraxo, Esse eqs mae fax rel ble como gata de | ATP. aumente 18 ATP podua or cada PADI, oxidado na cadeis espana (2.5 por NADH Nove wos dei aqui, deo graxo satura com 20 carho- ros gra 10 moléculae de aeetlsCoA ar cus imas forme na Ver Figura 17-12 Formas 5-"C}oucc-CoA, que produ oxaloace- tatomareadona C2er0 0, Feldo thinica~» ded pistinico > propio: CoA + +» suec- ‘ACoA —succnato > furatato > Mato, Todos ot carbone do rialsto geriam marca, mae Cl ¢ C-l teria eomente stad da rmarcagae doC20 C3, ‘hides de ATP nas reagins elutes que veguerem energicapta gua na seagso ATP + H,0—> ADP + P, ass, no estad estaconde no, non predusiovesutante de #0 ‘Ametimaloniscademutate reqeroeoftor que contém eta foe rma a parsieda arin ‘A pena de mass 6 de quate 0.66 kg por ea, ou quase 140 kg em 7 reset cone pe fer evtada pela degrada de protlnas cor Doris nie errecii para suprirorexquletos de arindseidor para [Blconeogsrese (4) ido gros so conmerios em se dervadoe ai-co8 por frsimae do copa; oF akC0k 30 enti imports pats ric AoeSndra oxida Dado qu om peaghsadore szara mone tia lnladas, les iveram de usa divs CoA. Cb) O etteare- ‘CoA fo rapsamentecorwertido em nove moléeuae de acellLCo8 pela ia da rods. Todos os intermedstios raga repidaren- te, e neahm dees fs detect em nies sgifeatvee (e) Dois tiene Cada cielo remove dos slomor decaroone, assim dois los foriertem um dei gra de 18 earbonos em um le 19 enone ras 2acetl-CoA (4) OK, é male alto pura olsimero ras do gue pasa oets de forma que éecesérs mace concerracae do she Frans para a mesma taxa de degrada. Grosso modo, oismeero trans te hes tao bem quanto oes, provaveimente pore de tetera lgagao do substrate benaima, Ce) O substrate da LCADi VLCAD é fort de mateta dierent, depended do substato ce panicular io ¢esporado par a apa mutante da veloeidade de ‘uma wis, (2) Os parsmetro cineboe mera quo ximero tras € tim sbettato mae pobre para LCAD do que oes, mas existe Uma ‘Aferenga pequna Paras VLCAD, Por sr un substrata mals pobre, © labmero rans ge acurula eu rives mais alles doque oct.) Una ‘a pessiel est masteada a sequ(adicando “entro"e"ore" ao toons) laidl-ersition art ers) “fers! slhidei-eratinn zine, aida ta one (dente) (dentro) StranstetradecnsibCeA tn, Strand tateadecncicn 8, “dentro ‘destr) Siransdcidettadecansico fers) (i) 8 corto medida que as gordnas trans sho degradadas com mers efieiéncla do que as cis e, ass, as gorduas (vans poder “vanst"parafora da mlootndnia Nan correo dant qe a onze rane no sia degredadas plas clas; eso 30, asa ua veloc he mai bata do que ae gordurae ci Copitao18 ° @ “ooc—cr.—lco0- maleate i ~000—CH,—CH,-C—COOecaagiarto i © cn,—b-co0- Prwate 3 2. ste € um ensaio que uz veagses acpladas. O produto dale ta tansaminago (pruvato)€sapidamenteconsumido na “reagao sndicador” subsequent, cals pea actato-desirogenaee, ue ‘onsome NADI Asim, 3 weloefae de desaparecimento do NADIE tndlcadoa émontorada pla dbseragio do decrércima na absorb. ‘lado NADH a 540 uy, core um espectrfotametz. 3. nina glutamina desemperdam paps espeiais no transporte de {rapes amino do masculo ede cures tocas nao hepstices, respect amente, pars ogado 44 Nio. mitrogéni da alanina pose sr tanserdo par o oxaloacetate, por transaminasso pata format aspartat, 5. 18 roe de ATP por mal de lctato 1 mals de AI por mal de alan a, quando €inchlda a remota do itogtuo. {6 (2) 0 jm reson em bao nee sangtinene de acoee. A a fhleagiosubsequente da deta experimental levou «um espido eats. boli de arunodcite gcogenes. (B) A derarunajio oxativa ‘sagou um aumento noe nfvels de NHL, «suena de agin (mn tnlermedi do il da urea) imped a conversio de NE,em rca ‘Nargiinanio¢sntelizada no gato em quantiles suftientes pata {lalaer at necessidads impostas pel eteese do experimen Invosugere que agia tea um amunosldo essential a des do so, (e) Ace € convert em angina peo cil de 7. 1,0 + phtamato + NAD" > weotoglstarato + NIE? ~ NADIC+ I NH! + BATP + 1,0 + 00, >carbutnleontsta + 2ADP +, + aH CCarbamoionato + omitina» ctrina +P, + (Ctra + separtato + ATP arginin-eucinato + AMP +P, +H Arginuneesccnato again + Sarat Fumarato + #0 matt Molto ~ NAD" -+oxalouceato-+ NADIE +10" COnaoacetata + gutamato + asprtal ~ a-etogharato Argiuna + HO—>utela + ortina 2 Glutanato CO, ¢ 4,0 4 2NAD™ 4 SAP > ‘Revcetogtatst + 2NADH + TH ueia + 2ADP + AMP+PR = aPC) eages aionais que devem ser considera AMP + ATP-—+240P @ (0, +81 + 2NADHL+ 6ADP + 6P,-—+2NAD" + HATP + 4,0 @) 06 PR-w2P, 1 o Somando-se a8 equagoes (Da (8) 2.Glutanao + C0, © 0, + 24DP 62%.» 2oesetlutatata | ues | 38,0 1 24TP 8. © segusno grupo amino intron na moléels ca uta € ane {eri a partido aspartto, que € gerado durante a traneaminagsn do ghtamato pars oxaloacetato, eng ctaluada ela sepatto “ainotvansfetae. Aprouimadamentemetade de todos» grupos Sano exeretados na forma de ea deve passr pa Yasuo da tf “ato-msinotanaerse,tonnand eet aminotranaersees ma tvs ese nsimae RESPOSTAS RESUMIDAS AOS PROBLEMAS 1219. 9. (a) Us pessoa em uma deta entero apenas protelnas deve ise amineidos emo principal fnte de eombistive mabe ‘Una vezque ometsbolimo dor andnoeldesrequr qu a grapo sr no ej temovid, por fm gerado wea, prcesso consame qua tidadesanormalente grandes deus paradise excretar2urela rarina. Alm ety, eetait eonlior na “protaina ids” ever {er duos com gia eexeetadce Se apes cia de ga poe tine no ertiverequllbvads por uma Ingest euiente de agus, resultado ser peda gud da gan compo (b) Ao se consderar os benetcosnutricinais das protenas, deve “ee term meres quantidade tal de ainasides ners pes 2 setere protec, ea dstebaico de amunoseidos nas protelnas de “eta A gelstina cont uma dsbulgo de amurodeos ade fo porta de visa rutiional. Como grandes quartidades de gelatine ‘so ingeriaa © 9 exreeto do anne 6 atablzado, € posse {gee eapacae do elo da urea ja excedia evan 3 oxide poraminis. ao ada mals complica pea desidrtarSo que pode {esular da exergio de grandes quattiades de rea Lina combine ‘dense dois stores pode evar ao coma emote 10, Lisnasessna AL, (a) Fendolannuchidronase; eta com batzo contd defen 18. (b) Ata normal pata orrtabobsmo da feral via hiro Jaco, prodursvio vem, e4Moqueala 2 eialanna se acca (©) Alersianina 6 transom rm eipruvato por trancaminago seguir, em felacato por redo, A reago de transminagso presenta ua constante de equllbio de 10, fenlpeuvato €or ‘ado em quaridades ignicativas quanto afenalanina se acura (a) Bm virtue da deine ma produ de tions, precareara da sean, opigmento notmaimente presente n abel 12, 0 catabolsme des exqueletascarborados da van, da mationna € 4a boleucina ests prejudicado em vrude da auséncia de urge da rotiasiori-CoA-rtase (enazna que wa vamina como eo frsima), Orfeo frogs da yor deta eraima eat descrie re Tibels 18.20 Quacto 1&2 13, A deta vegana apreserta cartnea de tana B,,evando a um au mento de homoriseina ¢ rrtinainatn (retin deficit na relionina-tntaze e na mtiimalonatosmulase, respectivamerte) em Inve queadotam ee deta por wri anoe Na eta laetovege ‘etna o# itil fomecer cet quatidade detain 8 14, As formas genéticas de anemia pericosagealmerte surgom como resulta e dees nat vas responses por mediar a abeoro de ‘amin Ba data (Wer Quadro 17-2), Una ves que suplemsentar Aiettiosnio sao absoridos plo intestino, ext conde 0 tr ‘ads pels admanstragd iravenota de supinentas de 8, 15. Omecaniann 6 dénion aque serinsashratate (ver Bgar 1 203), exceto pelo fto de gue grupo mei adconal de treorina € tanto, produsindoc-cetabutieto en vex de puri 16. (@) YNH,—CO—" NHL, (b) ~00"c—cHt,—cH,—4C00- a (©) RNE—C—"NE, I (a) R-NE—C—"NH, om, -00%0——cH,—"c00- H 1220 RESPOSTAS RESUMIDAS AOS PROBLEMAS 27, (4) aceasta 25 sy 2519s y 9 1% seotcon + propionl-CoA.(b) Passe @ transarinsfdo, sm reagio alogs PLP; @ desearboxlgio oxidatis, anlogs 3 renga da pirate xiogerate, NAD, TPP, ipo, FAD; @ odaga,andngs 4 eagso ta succnatodesifogenate, PAD; © Riratgio,andlogs A reagio dt. fumarase sem coatores, @ oxida, andlogs rag da aloe szogerate, NAD"; @ tiie (rego ever da condensasso sds a), andlogs 4 eapaodatilse, Co 18, Ur mecanisme proviel er: Le a Glicina -o00 Fi Ue -000-4—i u NH, mys Sen CP Ta. ey cay Be © formaldetdo produsido (ICHO) no sngunda pass reage rapidax mente com tetracisrfssto no aio atvn a ensima, produto NN setdenstetra-bdrfolat (er Figura 1817) 19, (a) Tansaminasio, em analogias; PLP. (b) Descatbosagiooxidae tia; analogs 3 descarboxigin oid do prurto em aeti-C0A, anterormente 3 sua entrada no ciclo do cio tie, 3 descariee ‘lacie do qveetoglutrato em sucenl.CaA no elo do edo eto; [NAD , FAD hpoato e TPP (e) Desstogenacio (oxapio)andogs ‘esidogenagio do succto em fumarase ciclo do seid csc € Ae ac-CoX em erica na oxidagio; FAD. (@) Carboragao; sem analogiat no ilo Sein eticn ou na Beoidago, ATP e bitin ( Htatago, andlga i hiratagio do timarato em malt no cielo do sci cco ede enol-Coa em 3-hidroxac-CoA na roxas ‘sem cofstores, (2) Reag lia revere analogs b eassorevetss, A erato-stase no cco do deo eles, em cotres. 20, (4) Learns; salina jolewsina (b) Cistena (provid a parti da ting), Se actin for desrarbonlada, comma modtrado ma Figura 18-8, produ LN”—CH,—CH SH, que pode verona, protic indo tau, (€) 0 sangue catido em Jano de 1957 meses ives seiativamente eleva de elena, lesa, etionina evi ‘nna araars em snnte de 1987 mostra nei signifeativamente iments dessa, een, turin vali. (A) To pe tienes apresentavan ves aoe de oleucla,lelna eval, ato ro sangue quanto mu urb,sugevovic ura defcidnca wa degrada esses arunoscidos Uma vez que urinate ontinha nies ee ‘rans dos aeretosedoscnmesponeatee a errr is ansnncio, 0 Dogueio ra wa deve ceorrer apse a desainatso, mas antenormene 4 desidogenagio (come mostad na Fgura 18-28, (@) O modelo ‘io expla o rivets elevados de retionina no sangue de tauina ‘hw ua, Osves eleva ce auzina alex ccortan devido mate Ae celles rervorae durante o etip final da doenga. A rato para be nves eleva de metonina no sang, no entan, nso & clas 2 vn de degrada da mettanina nao est liga com sdegradago tos aminoeidon de cadela ramen. O aumento da ston fo dena serum feito secanciio do aumento de outros sasnaidoe Important consderarmos que as amcstra de nex de 1957 era ‘e'sm indian que esata morren, de modo qve nao & atone ‘is compara de reat ee testes de tangle «uri arm am Individuosaudve. () A normagioa segue €necessct (e fl por se obtda por outros peoqusadores) (1) A atadae da deidoge- nase est slncatsvarenteredua ou ausnte em ndvius 2am 2 loenga do aarope de horde. 2) A doenga head como defo tanum ico gene (3) O defo score emum gan que coifea tod tu parte da deidrogenase (4) O defeto genta leva 3 produgio de Capitulo 19 A. Royo (1): (4, (4) NADH; Q), () BAEMN, (6) NAD NADH € PUNEMN, Reap 2 (a), () BPMN (), (6) P= (©) BEMNTMNE Pe Fee eoj0 (3). (0), (0 Fe, ), (0) Q; (2) Fe""Fe"*e WOH, 2. Aca lateral oma wiquinona solved em pies © permite sua ‘Afiso na membrana emits 1, Poa erenga no potercial padre de redug (A5) para ead par ‘de meiereacin, pete clear AG" A ong do raeinaln pelo FAD 6 favoreida pela varagSo de energi wre negatva (A ~ =27hulad Aoxidago plo NAD” equer uma grande varagio de erga ve postive QO" = 58 Wal). 4. (a) Todor or eareadores esto redux; CN” Bogue a redugso| 5 0, calalisada peta Gocrome-onidae,(b) Todos 0 crreadares ti yehndoe, a aunénca de Oy on earendonesreduidos no #0 ‘eoxsados.(€) Todas o# carreadores eso oxdadon (2) Os are ‘coves irc eto me redundes, os catrenores fins esto is ‘aor 5. (a) Ainiigso da NADHsidrogenate pea rotenona re a elo dade do xo de eletrons pela cadeiarexprtona, 0 que, por sua Ver, rez tana de produc de ATP. Se eta taxa recat fr capa de super as necesittes do organism por ATP, ele morers. (b) A detinomicna Ante fortemente a oil da coer Qa aa Fespistona,redusindo « veiesace de tansferénca de stons © lesando ts consequence desesas er (2). (e) Una ver que a= Ainomicin A bloguea todo o uo de eletons pats o oxigen, ela € ‘um veneno mais patente do que arotenona, «qual bloqueiao fare de ‘eons apart do NADIE, mae nie do PADI, 46. (a) Avelocidade de trnsterénci de tone neces pat pte & demands de ATP auenta, er soa relaio P/O iin. (B) Uma ita concentragao do desacoplador redux relagio P/O para quase Ser. A ela PO imine ¢neeeeesn oxida mass combust pata gerara mesma quantiade de ATP 0 calor eXtra iberado poe nts onagio eleva a teriperstra conporal (e) A atidade aurea