Você está na página 1de 479

00Buckingham (F)-FM 2/14/07 1:09 PM Page i

MOLECULAR
DIAGNOSTICS
Fundamentals, Methods, & Clinical Applications
00Buckingham (F)-FM 2/14/07 1:09 PM Page ii
00Buckingham (F)-FM 2/14/07 1:09 PM Page iii

MOLECULAR
DIAGNOSTICS
Fundamentals, Methods, & Clinical Applications

Lela Buckingham, PhD, CLSpMB, CLDir(NCA)


Assistant Director, Molecular Diagnostics
Department of Pathology
Rush Medical Laboratories
Rush University Medical Center
Chicago, Illinois

Maribeth L. Flaws, PhD, SM(ASCP)SI


Associate Chairman and Associate Professor
Department of Clinical Laboratory Sciences
Rush University Medical Center
Chicago, Illinois
00Buckingham (F)-FM 2/14/07 1:09 PM Page iv

F.A. Davis Company


1915 Arch Street
Philadelphia, PA 19103
www.fadavis.com

Copyright 2007 by F. A. Davis Company


All rights reserved. This product is protected by copyright. No part of it may be
reproduced, stored in a retrieval system, or transmitted in any form or by any
means, electronic, mechanical, photocopying, recording, or otherwise, without
written permission from the publisher.
Printed in the United States of America
Last digit indicates print number: 10 9 8 7 6 5 4 3 2 1

Acquisitions Editor: Christa Fratantoro


Manager of Content Development: Deborah Thorp
Developmental Editor: Marla Sussman
Manager of Art & Design: Carolyn OBrien

As new scientific information becomes available through basic and clinical


research, recommended treatments and drug therapies undergo changes. The
author(s) and publisher have done everything possible to make this book accurate,
up to date, and in accord with accepted standards at the time of publication. The
author(s), editors, and publisher are not responsible for errors or omissions or for
consequences from application of the book, and make no warranty, expressed or
implied, in regard to the contents of the book. Any practice described in this book
should be applied by the reader in accordance with professional standards of care
used in regard to the unique circumstances that may apply in each situation. The
reader is advised always to check product information (package inserts) for
changes and new information regarding dose and contraindications before admin-
istering any drug. Caution is especially urged when using new or infrequently
ordered drugs.

Library of Congress Cataloging-in-Publication Data


Buckingham, Lela.
Molecular diagnostics : fundamentals, methods, and clinical applications /
Lela Buckingham, Maribeth Flaws.
p. ; cm.
Includes bibliographical references and index.
ISBN-13: 978-0-8036-1659-2 (hardcover : alk. paper)
ISBN-10: 0-8036-1659-7 (hardcover : alk. paper)
1. Molecular diagnosis. I. Flaws, Maribeth. II. Title.
[DNLM: 1. Molecular Diagnostic Techniquesmethods. 2. Nucleic
Acidsanalysis. QU 58 B923m 2007]
RB43.7.B83 2007
616.9041dc22 2006038487

Authorization to photocopy items for internal or personal use, or the internal or


personal use of specific clients, is granted by F. A. Davis Company for users reg-
istered with the Copyright Clearance Center (CCC) Transactional Reporting
Service, provided that the fee of $.10 per copy is paid directly to CCC, 222
Rosewood Drive, Danvers, MA 01923. For those organizations that have been
granted a photocopy license by CCC, a separate system of payment has been
arranged. The fee code for users of the Transactional Reporting Service is: 8036-
1659/07 0 ! $.10.
00Buckingham (F)-FM 2/14/07 1:09 PM Page v

DEDICATION
To Zachary
LB
This textbook is especially dedicated to my parents Maureen
and Edward Laude, my husband John, and our daughters
Emily, Michelle, and Kristen. To my family, friends, teach-
ers, students, and colleagues, I am forever grateful for your
guidance, support, and encouragement.
MLF

v
00Buckingham (F)-FM 2/14/07 1:09 PM Page vi
00Buckingham (F)-FM 2/14/07 1:09 PM Page vii

PREFACE
Molecular Technology has been implemented into diagnos-
tic testing in a relatively short period. Programs that educate
clinical laboratory professionals have had to incorporate
molecular-based diagnostic testing into their curricula just
as rapidly despite a lack of formal resources. This textbook
was written to address these concerns.
The primary audience for this text is students enrolled
in Clinical Laboratory Science/Medical Technology pro-
grams at all levels. The textbook explains the principles of
molecular-based tests that are used for diagnostic purposes.
Examples of applications of molecular-based assays are
included in the text as well as case studies that illustrate the
use and interpretation of these assays in patient care.
This textbook is also appropriate for students in other
health-related disciplines who have to understand the pur-
pose, principle, and interpretation of molecular-based diag-
nostic tests that they will be ordering and assessing for their
patients.
Students who are first learning about molecular-based
assays will find this text useful for explaining the principles.
Practitioners who are performing and interpreting these
assays can use this text as a resource for reference and
trouble-shooting and to drive the implementation of addi-
tional molecular-based assays in their laboratory.
For educators who adopt this text for a course, we
have developed an Instructors Resource package. These

vii
00Buckingham (F)-FM 2/14/07 1:09 PM Page viii

viii Preface

resources, which include a Brownstone test generator, image


bank, and PowerPoint presentation, are available on CD-
ROM and on DavisPlus at http://davisplus.fadavis.com.
Educators should contact their F.A. Davis Sales Represen-
tative to obtain access to the Instructors Resources.

Lela Buckingham, PhD, CLSpMB, CLDir(NCA)


Maribeth L. Flaws, PhD, SM(ASCP)SI
00Buckingham (F)-FM 2/14/07 1:09 PM Page ix

REVIEWERS
Roxanne Alter, MS, MT(ASCP) Huey-Jen Lin, MT(ASCP), Phyllis Pacifico, EdD, MT(ASCP)
Assistant Professor CLSpMB(NCA) Program Director
Clinical Laboratory Science Assistant Professor Clinical Laboratory Science
University of Nebraska Medical Medical Technology Wright State University
Center Ohio State University Dayton, Ohio
Omaha, Nebraska Columbus, Ohio
Robert D. Robison, PhD,
Theola N. Copeland, MS, Mary E. Miele, PhD, CLS(NCA), MT(ASCP)
MT(ASCP) MT(ASCP), RM(NRM) Professor and Program Director
Assistant Professor Associate Professor Medical Technology/Biology
Medical Technology Medical Technology Austin Peay State University
Tennessee State University University of Delaware Clarksville, Tennessee
Nashville, Tennessee Newark, Delaware
Timothy S. Uphoff, PhD,
Audrey E. Hentzen, PhD Teresa S. Nadder, PhD, MT(ASCP)
Director CLS(NCA), MT(ASCP) Clinical Chemistry and Molecular
Medical Laboratory Technology Associate Professor/Assistant Genetic Fellow
Casper College Chairman Mayo Clinic
Casper, Wyoming Clinical Laboratory Sciences Rochester, Minnesota
Virginia Commonwealth University
Lynn R. Ingram, MS, CLS(NCA) Jo Ann Wilson, PhD, MT(ASCP),
Richmond, Virginia
Associate Professor CLDir(NCA), BCLD
Clinical Laboratory Sciences Susan M. Orton, PhD, MS, Professor and Department Chair
University of Tennessee Health MT(ASCP) Environmental Health, Molecular
Science Center Assistant Professor and Clinical Sciences
Memphis, Tennessee Clinical Laboratory Sciences Florida Gulf Coast University
University of North Carolina Fort Myers, Florida
Mary Ellen Koenn, MS,
Chapel Hill, North Carolina
CLS(NCA), MT(ASCP)
Associate Professor
Medical Technology
West Virginia University
Morgantown, West Virginia

ix
00Buckingham (F)-FM 2/14/07 1:09 PM Page x
00Buckingham (F)-FM 2/14/07 1:09 PM Page xi

ACKNOWLEDGMENTS
We would like to acknowledge the hard work of all of the
people at F.A. Davis who helped get this book from the idea
stage to hard copy, especially the Acquisitions Editor,
Health Professions, Christa A. Fratantoro; Elizabeth
Zygarewicz, Developmental Associate; Elizabeth Morales,
the artist who made the drawings come to life; Deborah
Thorp, Sam Rondinelli, and everyone else at F.A. Davis
who was involved in this project.
We would also like to thank all of the reviewers who
gave their time to read and comment on the chapters as they
were being developed, and especially the students at Rush
University in Chicago, Illinois, who literally begged for a
textbook in this subject.

xi
00Buckingham (F)-FM 2/14/07 1:09 PM Page xii
00Buckingham (F)-FM 2/14/07 1:09 PM Page xiii

CONTENTS

SECTION I 1
Chapter 2 27
Fundamentals of Nucleic RNA
Acid Biochemistry: Lela Buckingham

An Overview TRANSCRIPTION
TYPES/STRUCTURES
28
29
Ribosomal RNA 30
Chapter 1 1 Messenger RNA 30
DNA Small Nuclear RNA 34
Lela Buckingham Small Interfering RNA 34
DNA 2 Transfer RNA 34
DNA STRUCTURE 2 Micro RNAs 35
Nucleotides 3 Other Small RNAs 36
Nucleic Acid 6 RNA POLYMERASES 36
DNA REPLICATION 7 OTHER RNA-METABOLIZING ENZYMES 37
Polymerases 8 Ribonucleases 37
ENZYMES THAT METABOLIZE DNA 12 RNA Helicases 38
Restriction Enzymes 12 REGULATION OF TRANSCRIPTION 38
DNA Ligase 14 Epigenetics 42
Other DNA Metabolizing Enzymes 14
RECOMBINATION IN SEXUALLY REPRODUCING Chapter 3 48
ORGANISMS 17 Proteins
RECOMBINATION IN ASEXUAL REPRODUCTION 18 Lela Buckingham
Conjugation 19 AMINO ACIDS 49
Transduction 20 GENES AND THE GENETIC CODE 54
Transformation 21 The Genetic Code 55
PLASMIDS 22

xiii
00Buckingham (F)-FM 2/14/07 1:09 PM Page xiv

xiv Contents

TRANSLATION 57 Chapter 6 94
Amino Acid Charging 57
Protein Synthesis 57 Analysis and Characterization
of Nucleic Acids and Proteins
Lela Buckingham
SECTION II 65 RESTRICTION ENZYME MAPPING 95
Common Techniques HYBRIDIZATION TECHNOLOGIES
Southern Blots
96
96
in Molecular Biology Northern Blots 101
Western Blots 102
Chapter 4 65 PROBES 103
DNA Probes 103
Nucleic Acid Extraction Methods RNA Probes 103
Lela Buckingham Other Nucleic Acid Probe Types 104
ISOLATION OF DNA 66 Protein Probes 104
Preparing the Sample 66 Probe Labeling 105
Organic Isolation Methods 67 Nucleic Acid Probe Design 106
Inorganic Isolation Methods 68 HYBRIDIZATION CONDITIONS, STRINGENCY 107
Solid-Phase Isolation 69 DETECTION SYSTEMS 109
Crude Lysis 71 INTERPRETATION OF RESULTS 111
Isolation of Mitochondrial DNA 71 ARRAY-BASED HYBRIDIZATION 112
ISOLATION OF RNA 72 Dot/Slot Blots 112
Total RNA 72 Genomic Array Technology 113
Extraction of Total RNA 72 SOLUTION HYBRIDIZATION 117
Isolation of polyA (messenger) RNA 74
MEASUREMENT OF NUCLEIC ACID QUALITY Chapter 7 121
AND QUANTITY 75 Nucleic Acid Amplification
Electrophoresis 75 Lela Buckingham and Maribeth L. Flaws
Spectrophotometry 76 TARGET AMPLIFICATION 122
Fluorometry 77 Polymerase Chain Reaction 122
Transcription-Based Amplification Systems 142
Chapter 5 80 PROBE AMPLIFICATION 144
Resolution and Detection Ligase Chain Reaction
Strand Displacement Amplification
144
144
of Nucleic Acids Q! Replicase 145
Lela Buckingham SIGNAL AMPLIFICATION 147
ELECTROPHORESIS 81 Branched DNA Amplification 147
GEL SYSTEMS 81 Hybrid Capture Assays 148
Agarose Gels 81 Cleavage-Based Amplification 148
Polyacrylamide Gels 84 Cycling Probe 149
Capillary Electrophoresis 85
BUFFER SYSTEMS 86 Chapter 8 155
Buffer Additives 88
ELECTROPHORESIS EQUIPMENT 88
Chromosomal Structure and
GEL LOADING 90 Chromosomal Mutations
DETECTION SYSTEMS 91 Lela Buckingham
Nucleic AcidSpecific Dyes 91 CHROMOSOMAL STRUCTURE AND ANALYSIS 157
Silver Stain 92 Chromosomal Compaction and Histones 157
00Buckingham (F)-FM 2/14/07 1:09 PM Page xv

Contents xv

Chromosomal Morphology 159 Gender Identification 234


Visualizing Chromosomes 159 Analysis of Test Results 235
DETECTION OF GENOME AND CHROMOSOMAL Y-STR 241
MUTATIONS 161 Matching with Y-STRs 242
Karyotyping 161 ENGRAFTMENT TESTING USING DNA
Fluorescence In Situ Hybridization 166 POLYMORPHISMS 245
LINKAGE ANALYSIS 249
Chapter 9 173 QUALITY ASSURANCE OF TISSUE SECTIONS
Gene Mutations USING STR
SINGLE NUCLEOTIDE POLYMORPHISMS
251
252
Lela Buckingham
The Human Haplotype (Hap Map) Mapping Project 252
TYPES OF GENE MUTATIONS 174
MITOCHONDRIAL DNA POLYMORPHISMS 253
DETECTION OF GENE MUTATIONS 174
Hybridization-Based Methods 175
Chapter 12 263
Sequencing (Polymerization)-Based Methods 185
Cleavage Methods 189 Detection and Identification
Other Methods
GENE MUTATION NOMENCLATURE
193
194
of Microorganisms
Maribeth L. Flaws and Lela Buckingham
SPECIMEN COLLECTION 264
Chapter 10 203 SAMPLE PREPARATION 266
DNA Sequencing QUALITY CONTROL 266
Lela Buckingham BACTERIAL TARGETS OF MOLECULAR-BASED TESTS 268
DIRECT SEQUENCING 204 Selection of Sequence Targets for Detection
Manual Sequencing 204 of Microorganisms 268
Automated Fluorescent Sequencing 210 Molecular Detection of Bacteria 269
PYROSEQUENCING 214 Respiratory Tract Pathogens 270
BISULFITE DNA SEQUENCING 216 Urogenital Tract Pathogens 276
BIOINFORMATICS 218 ANTIMICROBIAL AGENTS 280
THE HUMAN GENOME PROJECT 219 Resistance to Antimicrobial Agents 280
Molecular Detection of Resistance 282
MOLECULAR EPIDEMIOLOGY 284
SECTION III 225 Molecular Strain Typing Methods for

Techniques in the Epidemiological Studies


Comparison of Typing Methods
284
289
Clinical Lab VIRUSES 291
Human Immunodeficiency Virus 292
Chapter 11 225 Hepatitis C Virus 298
Summary 299
DNA Polymorphisms and FUNGI 299
Human Identification PARASITES 300
Lela Buckingham
TYPES OF POLYMORPHISMS 226 Chapter 13 310
RFLP TYPING
Genetic Mapping With RFLPs
226
228
Molecular Detection
RFLP and Parentage Testing 229 of Inherited Diseases
Human Identification Using RFLP 229 Lela Buckingham
STR TYPING BY PCR 231 THE MOLECULAR BASIS OF INHERITED DISEASES 311
STR Nomenclature 232 CHROMOSOMAL ABNORMALITIES 311
00Buckingham (F)-FM 2/14/07 1:09 PM Page xvi

xvi Contents

PATTERNS OF INHERITANCE IN SINGLE-GENE HLA POLYMORPHISMS 379


DISORDERS 312 HLA Nomenclature 380
MOLECULAR BASIS OF SINGLE-GENE DISORDERS 314 MOLECULAR ANALYSIS OF THE MHC 384
Lysosomal Storage Diseases 315 Serological Analysis 384
MOLECULAR DIAGNOSIS OF SINGLE-GENE DNA-Based Typing 388
DISORDERS 316 Combining Typing Results 392
Factor V Leiden 316 HLA Test Discrepancies 393
Hemochromatosis 317 Coordination of HLA Test Methods 393
Cystic Fibrosis 318 ADDITIONAL RECOGNITION FACTORS 393
Cytochrome P-450 319 Minor Histocompatibility Antigens 393
Nonconventional MHC Antigens 393
SINGLE-GENE DISORDERS WITH NONCLASSICAL
Killer Cell Immunoglobulin-like Receptors 394
PATTERNS OF INHERITANCE 319
MHC DISEASE ASSOCIATION 394
Mutations in Mitochondrial Genes 319
SUMMARY OF LABORATORY TESTING 395
Trinucleotide Repeat Expansion Disorders 322
Genomic Imprinting 325 Chapter 16 403
Multifactorial Inheritance 326
LIMITATIONS TO MOLECULAR TESTING 326 Quality Assurance and
Quality Control in the
Chapter 14 332 Molecular Laboratory
Molecular Oncology Lela Buckingham
Lela Buckingham SPECIMEN HANDLING 404
CLASSIFICATION OF NEOPLASMS 333 Collection Tubes for Molecular Testing 405
MOLECULAR BASIS OF CANCER 333 Precautions 406
ANALYTICAL TARGETS OF MOLECULAR TESTING 334 Holding and Storage Requirements 407
Gene and Chromosomal Mutations in Solid Tumors 335 TEST PERFORMANCE 409
Microsatellite Instability 343 Controls 412
Loss of Heterozygosity 346 Quality Assurance 412
GENE REARRANGEMENTS IN LEUKEMIA INSTRUMENT MAINTENANCE 413
AND LYMPHOMA 346 Calibrations 416
V(D)J Recombination 347 REAGENTS 417
Detection of Clonality 350 Chemical Safety 418
Translocations in Hematological Malignancies 356 Proficiency Testing 419
DOCUMENTATION OF TEST RESULTS 420
Gene Sequencing Results 421
Chapter 15 376 Reporting Results 421
DNA-Based Tissue Typing Appendix 427
Lela Buckingham
THE MHC LOCUS 377 Index 441
01Buckingham (F)-01 2/6/07 12:23 PM Page 1

SECTION 1

Fundamentals of Nucleic Acid


Biochemistry: An Overview

Chapter 1 Lela Buckingham

DNA

OUTLINE OBJECTIVES
DNA Diagram the structure of nitrogen bases, nucleosides,
DNA STRUCTURE and nucleotides.
Nucleotides Describe the nucleic acid structure as a polymer
Nucleic Acid
of nucleotides.
DNA REPLICATION
Polymerases Demonstrate how deoxyribonucleic acid (DNA) is repli-
cated such that the order or sequence of nucleotides is
ENZYMES THAT METABOLIZE DNA
Restriction Enzymes
maintained (semiconservative replication).
DNA Ligase Explain the reaction catalyzed by DNA polymerase that
Other DNA Metabolizing Enzymes results in the phosphodiester backbone of the DNA chain.
RECOMBINATION IN SEXUALLY Note how the replicative process results in the antiparallel
REPRODUCING ORGANISMS nature of complementary strands of DNA.
RECOMBINATION IN ASEXUAL
List the enzymes that modify DNA, and state their
REPRODUCTION
Conjugation
specific functions.
Transduction Illustrate three ways in which DNA can be transferred
Transformation between bacterial cells.
PLASMIDS Define recombination, and sketch how new combinations
of genes are generated in sexual and asexual reproduction.

1
01Buckingham (F)-01 2/6/07 12:23 PM Page 2

2 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

When James Watson coined the term molecular biol-


ogy,1 he was referring to the biology of deoxyribonu-
cleic acid (DNA). Of course, there are other molecules in
Historical Highlights
nature. The term, however, is still used to describe the Johann Friedrich Miescher is credited with the dis-
study of nucleic acids. In the clinical molecular labora- covery of DNA in 1869.2 Miescher had isolated
tory, molecular techniques are designed for the handling white blood cells from seepage collected from dis-
and analysis of the nucleic acids, DNA and ribonucleic carded surgical bandages. He found that he could
acid (RNA). Protein analysis and that of carbohydrates extract a viscous substance from these cells.
and other molecular species remain, for the most part, the Miescher also observed that most of the nonnuclear
domain of clinical chemistry. Molecular techniques are, cell components could be lysed away with dilute
however, being incorporated into other testing venues hydrochloric acid, leaving the nuclei intact.
such as cell surface protein analysis, in situ histology, and Addition of extract of pig stomach (a source of
tissue typing. The molecular biology laboratory, there- pepsin to dissolve away contaminating proteins)
fore, may be a separate entity or part of an existing resulted in a somewhat shrunken but clean prepara-
molecular diagnostics or molecular pathology unit. tion of nuclei. Extraction of these with alkali yielded
Nucleic acids offer several characteristics that support the same substance isolated from the intact cells. It
their use for clinical purposes. Highly specific analyses precipitated upon the addition of acid and redis-
can be carried out through hybridization and amplification solved in alkali. Chemical analysis of this substance
techniques without requirement for extensive physical or demonstrated that it was 14% nitrogen and 2.5%
chemical selection of target molecules or organisms. This phosphorus, different from any then known group of
sensitivity allows specific and rapid analysis from limiting biochemicals. He named the substance nuclein.
specimens. Furthermore, information carried in the (Analytical data indicate that less than 30% of
sequence of the nucleotides that make up the DNA macro- Mieschers first nuclein preparation was actually
molecule is the basis for normal and pathological traits DNA.) He later isolated a similar viscous material
from microorganisms to humans and, as such, provides a from salmon sperm and noted: If one wants to
valuable means of predictive analysis. Effective preven- assume that a single substanceis the specific
tion and treatment of disease will result from the analysis cause of fertilization, then one should undoubtedly
of these sequences in the clinical laboratory. first of all think of nuclein.

DNA
DNA is a macromolecule of carbon, nitrogen, oxygen, his work on the nucleus in 1882 admitted that the biolog-
phosphorous, and hydrogen atoms. It is assembled in ical significance of the substance was unknown. We now
units or nucleotides that are composed of a phosphory- know that the purpose of DNA, contained in the nucleus
lated ribose sugar and a nitrogen base. There are four of the cell, is to store information. The information in the
nitrogen bases that make up the majority of DNA found DNA storage system is based on the order or sequence of
in all organisms in nature. These are adenine, cytosine, nucleotides in the nucleic acid polymer. Just as computer
guanine, and thymine. Nitrogen bases are attached to a information storage is based on sequences of 0 and 1,
deoxyribose sugar, which forms a polymer with the biological information is based on sequences of A, C, G,
deoxyribose sugars of other nucleotides through a phos- and T. These four building blocks (with a few modifica-
phodiester bond. Linear assembly of the nucleotides tions) account for all of the biological diversity that
makes up one strand of DNA. Two strands of DNA com- makes up life on Earth.
prise the DNA double helix.
In 1871, Miescher published a paper on nuclein, the
viscous substance extracted from cell nuclei. In his writ-
DNA Structure
ings, he made no mention of the function of nuclein. The double helical structure of DNA (Fig. 1-1) was first
Walther Flemming, a leading cell biologist, describing described by James Watson and Francis Crick. Their
01Buckingham (F)-01 2/6/07 12:23 PM Page 3

DNA Chapter 1 3

(A) Nitrogen bases


3 5
C C G C C G C
G T A G
DNA A A G A
A A
double helix C C T T C
G G C G
C C
5 G C A T G
3
C
T T G C G T

Sugar-phosphate backbone

Hydrogen bond H
H
N H O N
CH3 O H N N CH
CH HC C C C
C C C C
G N
N HC C N H N C
HC T N H N A C
N C C N
N C HC N
O H NH
O

(B) Thymine Adenine Cytosine Guanine


Figure 1-1 (A) The double helix. The phosphodiester backbones of the two nucleic acid chains form the
helix. Nitrogen bases are oriented toward the center where they hydrogen-bond with homologous bases to
stabilize the structure. (B) Two hydrogen bonds form between adenine and thymine. Three hydrogen bonds
form between guanine and cytosine.

molecular model was founded on previous observa- or a nucleotide. For example, adenosine with one phos-
tions of the chemical nature of DNA and physical evi- phate is adenosine monophosphate (AMP). Adenosine
dence including diffraction analyses performed by with three phosphates is adenosine triphosphate (ATP).
Rosalind Franklin.3 The helical structure of DNA results Nucleotides can be converted to nucleosides by hydroly-
from the physicochemical demands of the linear array of sis. The five-carbon sugar of DNA is deoxyribose, which
nucleotides. Both the specific sequence (order) of is ribose with the number two carbon of deoxyribose
nucleotides in the strand as well as the surrounding linked to a hydrogen atom rather than a hydroxyl group
chemical microenvironment can affect the nature of the (see Fig. 1-2). The hydroxyl group on the third carbon is
DNA helix. important for forming the phosphodiester bond that is the
backbone of the DNA strand.
Nitrogen bases are planar carbon-nitrogen ring
Nucleotides
structures. The four common nitrogen bases in DNA are
The four nucleotide building blocks of DNA are mole- adenine, guanine, cytosine, and thymine. Amine and
cules of about 700 kd. Each nucleotide consists of a five- ketone substitutions around the ring as well as the single
carbon sugar, the first carbon of which is covalently or double bonds within the ring distinguish the four bases
joined to a nitrogen base and the fifth carbon to a triphos- that comprise the majority of DNA (Fig. 1-3). Nitrogen
phate moiety (Fig. 1-2). A nitrogen base bound to an bases with a single ring (thymine, cytosine) are pyrim-
unphosphorylated sugar is a nucleoside. Adenosine (A), idines. Bases with a double ring (guanine, adenine) are
guanosine (G), cytidine (C), and thymidine (T) are purines.
nucleosides. If the ribose sugar is phosphorylated, the Numbering of the positions in the nucleotide molecule
molecule is a nucleoside mono-, di-, or triphophosphate starts with the ring positions of the nitrogen base, desig-
01Buckingham (F)-01 2/6/07 12:23 PM Page 4

4 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

O
Advanced Concepts Phosphate N C
group OR Guanine
The double helix first described by Watson and Crick HC C NH
is DNA in its hydrated form (B-form) and is the stan- O P O
N C C
dard form of DNA.4 It has 10.5 steps or pairs of O O N NH2
nucleotides (bp) per turn. Dehydrated DNA takes the 1
A-form with about 11 bp per turn and the center of H2C CH CH
5 Ribose
symmetry along the outside of the helix rather than HC CH2
down the middle as it is in the B-form. Both A- and
B-form DNA are right-handed helices. Stress and OH
torsion can throw the double helix into a Z-form. Z- dGMP
DNA is a left-handed helix with 12 bp per turn and Figure 1-2 The nucleotide deoxyguanosine 5! phosphate
or guanosine monophosphate (dGMP). It is composed of
altered geometry of the sugar-base bonds. Z-DNA
deoxyribose covalently bound at its number 1 carbon to the
has been observed in areas of chromosomes where nitrogen base, guanine, and at its number 5 carbon to a
the DNA is under torsional stress from unwinding phosphate group. The molecule without the phosphate
for transcription or other metabolic functions. group is the nucleoside, deoxyguanosine.
Watson-Crick base pairing (purine:pyrimidine
hydrogen bonding) is not limited to the ribofuranosyl
nucleic acids, those found in our genetic system. of the nucleotides is maintained. As DNA is polymerized,
Natural nucleic acid alternatives can also display the each nucleotide to be added to the new DNA strand
basic chemical properties of RNA and DNA. hydrogen bonds with the complementary nucleotide on
Theoretical studies have addressed such chemical the parental strand (A:T, G:C). In this way the parental
alternatives to DNA and RNA components. An DNA strand can be replicated without loss of the
example is the pentopyranosyl-(2!4!) oligonu- nucleotide order. Base pairs (bp) other than A:T and G:C
cleotide system that exhibits stronger and more or mismatches, e.g., A:C, G:T, can distort the DNA helix
selective base pairing than DNA or RNA.5 Study of and disrupt the maintenance of sequence information.
nucleic acid alternatives has practical applications.
For example, protein nucleic acids, which have a car- Substituted Nucleotides
bon nitrogen peptide backbone replacing the sugar Modifications of the nucleotide structure are found
phosphate backbone,6,7 can be used in the laboratory throughout nature. Methylations, deaminations, additions,
as alternatives to DNA and RNA hybridization substitutions, and other chemical modifications generate
probes.8 They are also potential enzyme-resistant nucleotides with new properties. Changes such as methy-
alternatives to RNA in antisense RNA therapies.9 lation of nitrogen bases have biological consequences for
gene function and are intended in nature. Changes can

nated C or N 1, 2, 3, etc. The carbons of the ribose sugar


are numbered 1! to 5!, distinguishing the sugar ring posi-
tions from those of the nitrogen base rings (Fig. 1-4).
Advanced Concepts
The nitrogen base components of the nucleotides form In addition to the four commonly occurring nucleo-
hydrogen bonds with each other in a specific way. tide bases, modified bases are also often found in
Guanine forms three hydrogen bonds with cytosine. nature. Base modifications have significant affects
Adenine forms two hydrogen bonds with thymine (see on phenotype. Some modified bases result from
Fig. 1-1B). Hydrogen bonds between nucleotides are the damage to DNA; others are naturally modified for
key to the specificity of all nucleic acidbased tests used specific functions or to affect gene expression, as
in the molecular laboratory. Specific hydrogen bond for- will be discussed in later sections.
mation is also how the information held in the linear order
01Buckingham (F)-01 2/6/07 12:23 PM Page 5

DNA Chapter 1 5

PURINES

O NH2

Guanine N C Adenine N C
OR OR
HC C NH HC C N
O P O O P O
N C C N C HC
O O N NH2 O O N

H2 C CH CH2 H 2C CH CH2

HC CH2 HC CH2

OH OH
dGMP dAMP

PYRIMIDINES
NH2 O

Cytosine C Thymine C
HC N H 3C C NH
OR OR

O P O HC C O O P O HC C O
N N
O O O O

H2 C CH CH H 2C CH CH

HC CH2 HC CH2
OH OH

dCMP dTMP
Figure 1-3 Nucleotides, deoxyguanosine monophosphate (dGMP), deoxyadenosine
monophosphate (dAMP), deoxythymidine monophosphate (dTMP), and deoxycytidine
monophosphate (dCMP), differ by the attached nitrogen bases. The nitrogen bases, guanine and
adenine, have purine ring structures. Thymine and cytosine have pyrimidine ring structures. Uracil,
the nucleotide base that replaces thymine in RNA, has the purine ring structure of thymine minus
the methyl group and hydrogen bonds with adenine.

O
also be brought about by environmental insults such as
7 6
chemicals or radiation. These changes can affect gene
OR 8 N 5 C 1 function as well, resulting in undesirable effects such as
HC C NH
O P O
cancer.
9 N C C2
O O 4 N NH2
3
H2 C
5
CH
4
CH
1 Advanced Concepts
Modified nucleotides are used in bacteria and
HC CH2
3 2
OH viruses as a primitive immune system that allows
Figure 1-4 Carbon position numbering of a nucleotide them to distinguish their own DNA from that of
monophosphate. The base carbons are numbered 1
host or invaders (restriction modification [rm] sys-
through 9. The sugar carbons are numbered 1! to 5!.
The phosphate group on the 5! carbon and the hydroxyl
tem). Recognizing its own modifications, the host
group on the 3! carbon form phosphodiester bonds can target unmodified DNA for degradation.
between bases.
01Buckingham (F)-01 2/6/07 12:23 PM Page 6

6 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Due to their specific effects on enzymes that metabo- Growing strand


lize DNA, modified nucleosides have been used effec-
tively for clinical applications (Fig. 1-5). The anticancer
drugs, 5-bromouridine (5BrdU) and cytosine arabinoside O P O
(cytarabine, ara-C), are modified thymidine and cytosine O
template strand
nucleosides, respectively. Azidothymidine (Retrovir,
H2 C O
AZT), cytosine, 2!,3!-dideoxy-2!-fluoro (ddC), and 2!,3!- A T
dideoxyinosine (Videx, ddI), drugs used to treat patients CH CH2
with human immunodeficiency virus (HIV) infections,
HC CH2
are modifications of thymidine and cytosine and a precur-
sor of adenine, respectively. An analog of guanosine, 2- O

amino-1,9-dihydro-9-[(2-hydroxyethoxy)methyl]-6H-pur O P O
in-6-one (Acyclovir, Zovirax), is a drug used to combat
O
herpes simplex virus and varicella-zoster virus.
H2C O
In the laboratory, nucleosides can be modified for pur- G C
poses of labeling or detection of DNA molecules, se- CH CH2
quencing, and other applications. The techniques used for
HC CH2
these procedures will be discussed in later chapters.
OH
Phosphodiester
Nucleic Acid linkage

Nucleic acid is a macromolecule made of nucleotides


O O O
bound together by the phosphate and hydroxyl groups on
their sugars. A nucleic acid chain grows by the attach- O P O P O P O
ment of the 5! phosphate group of an incoming nucleotide O O O C G
to the 3! hydroxyl group of the last nucleotide on the
growing chain (Fig. 1-6). Addition of nucleotides in this H2C O
Pyrophosphate
CH CH

Nitrogen base Nitrogen base HC CH2


OH
HOCH2 O HOCH2 O
C C C C Incoming nucleotide
C C C C Figure 1-6 DNA replication is a template guided polymer-
OH ization catalyzed by DNA polymerase.

Deoxynucleoside Dideoxynucleoside

way gives the DNA chain a polarity; that is, it has a 5!


phosphate end and a 3! hydroxyl end. We refer to DNA as
HOCH2 O T HOCH2 O G oriented in a 5! to 3! direction, and the linear sequence
C C C C
of the nucleotides, by convention, is read in that order.
DNA found in nature is mostly double-stranded. Two
C C C C
strands exist in opposite 5! to 3!/3! to 5! orientation held
N3 OH
together by the hydrogen bonds between their respective
Azidothymidine Acyclovir bases (A with T and G with C). The bases are positioned
(AZT)
such that the sugar-phosphate chain that connects them
Figure 1-5 Substituted nucleosides used in the clinic and (sugar-phosphate backbone) is oriented in a spiral or
the laboratory. helix around the nitrogen bases (see Fig. 1-1).
01Buckingham (F)-01 2/6/07 12:23 PM Page 7

DNA Chapter 1 7

Advanced Concepts 5 3
OH
The sugar-phosphate backbones of the helix are
arranged in specific distances from one another in
A T
the double helix (see Fig. 1-1). The two regions of
the helix formed by the backbones are called the
major groove and minor groove. The major and
minor grooves are sites of interaction with the many
proteins that bind to specific nucleotide sequences
in DNA (binding or recognition sites). The double G C
helix can also be penetrated by intercalating
agents, molecules that slide transversely into the
center of the helix. Denaturing agents such as for-
mamide and urea displace the hydrogen bonds and
separate the two strands of the helix.
C G
3 5
The DNA double helix represents two versions of the
information stored in the form of the order or sequence of HO
the nucleotides on each chain. The sequences of the two
strands that form the double helix are complementary,
not identical (Fig. 1-7). They are in antiparallel orienta- Figure 1-8 DNA synthesis proceeds from the 5! phos-
tion with the 5! end of one strand at the 3! end of the other phate group to the 3! hydroxyl group. The template
(Fig. 1-8). Identical sequences will not hybridize with strand is copied in the opposite (3! to 5!) direction. The
each other. In later sections we will appreciate the impor- new double helix consists of the template strand and
the new daughter strand oriented in opposite directions
tance of this when designing hybridization and amplifica- from one another.
tion assays.

DNA Replication As Watson and Crick predicted, semiconservative


replication is the key to maintaining the sequence of the
DNA has an antiparallel orientation because of the way it nucleotides in DNA through new generations. Every cell
is synthesized. As DNA synthesis proceeds in the 5! to 3! in a multicellular organism or in a clonal population of
direction, DNA polymerase, the enzyme responsible for unicellular organisms carries the same genetic informa-
polymerizing the nucleotides, uses a guide, or template, tion. It is important that this information, in the form of
to determine which nucleotides to add. The enzyme reads the DNA sequence, be transferred faithfully at every cell
the template in the 3! to 5! direction. The resulting dou- division. The replication apparatus is designed to copy
ble strand, then, will have a parent strand in one orienta- the DNA strands in an orderly way with minimal errors
tion and a newly synthesized strand oriented in the before each cell division.
opposite orientation. The order of nucleotides is maintained because each
strand of the parent double helix is the template for a
newly replicated strand. In the process of replication,
PO 5 G T A G C T C G C T G A T 3 OH DNA is first unwound from the duplex so that each sin-
HO 3 C A T C G A G C G A C T A 5 OP gle strand may serve as a template for the order of addi-
Figure 1-7 Homologous sequences are not identical and tion of nucleotides to the new strand (see Fig. 1-6). The
are oriented in opposite directions. new strand is elongated by hydrogen bonding of the
01Buckingham (F)-01 2/6/07 12:23 PM Page 8

8 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Historical Highlights Historical Highlights


Before the double helix was determined, Erwin A few years after solution of the double helix, the
Chargaff10 made the observation that the amount mechanism of semiconservative replication was
of adenine in DNA corresponded to the amount of demonstrated by Matthew Meselson and Franklin
thymine and the amount of cytosine to the amount of Stahl,11 using the technique of equilibrium density
guanine. Upon the description of the double helix, centrifugation on a cesium gradient. They prepared
Watson proposed that the steps in the ladder of the heavy DNA by growing bacteria in a medium
double helix were pairs of bases, thymine with ade- containing the nitrogen isotope 15N. After shifting
nine and guanine with cytosine. Watson and Crick, the bacteria into a medium of normal nitrogen (14N),
upon publication of their work, suggested that this they could separate the hybrid 14N:15N DNA mole-
arrangement was the basis for a copying mechanism. cules synthesized as the bacteria replicated. These
The complementary strands could separate and serve molecules were of intermediate density to the ones
as guides of templates for producing like strands. from bacteria grown only in 14N or 15N. They could
differentiate true semiconservative replication from
dispersive replication by demonstrating that
approximately half of the DNA double helices from
proper incoming nucleotide to the nitrogen base on the next generation grown in normal nitrogen
the template strand and then a nucleophilic attack of the were14N:15N and half were 14N:14N.
deoxyribose 3! hydroxyl oxygen on a phosphorous atom
of the phosphate group on the hydrogen-bonded
nucleotide triphosphate. Orthophosphate is released with
the formation of a phosphodiester bond between the not copied in the same way. The replication apparatus
new nucleotide and the last nucleotide of the growing jumps ahead a short distance (~1000 bases) on the 5! to 3!
chain. The duplicated helix will ultimately consist of one strand and then copies backward toward the replication
template strand and one new strand. fork, while DNA replication proceeds in a continuous
DNA replication proceeds through the DNA duplex manner on the 3! to 5! strand, or the leading strand. The
with both strands of DNA replicating in a single pass. 5! to 3! strand copied in a discontinuous manner is the
DNA undergoing active replication can be observed by lagging strand13 (Fig. 1-9).
electron microscopy as a forked structure, or replication Another requirement for DNA synthesis is the avail-
fork. Note, however, that the antiparallel nature of duplex ability of the deoxyribose 3! hydroxyl oxygen for chain
DNA and the requirement for the DNA synthesis appara- growth. This means that DNA cannot be synthesized de
tus to read the template strand in a 3! to 5! direction are novo. A preceding base must be present to provide the
not consistent with copying of both strands simultane- hydroxyl group. This base is provided by another enzyme
ously in the same direction. The question arises as to how component of the replication apparatus, primase.
one of the strands of the duplex can be copied in the same Primase is a ribonucleic acid (RNA) synthesizing enzyme
direction as its complementary strand that runs antiparal- that lays down short (611 bp) RNA primers required for
lel to it. This problem was addressed in 1968 by Okazaki priming DNA synthesis. Primase must work repeatedly
and Okazaki12 studying DNA replication in Escherichia on the lagging strand to prime synthesis of each Okazaki
coli. In their experiments, small pieces of DNA, about fragment.
1000 bases in length, could be observed by density gradi-
ent centrifugation in actively replicating DNA. The frag-
Polymerases
ments chased into larger pieces with time, showing that
they were covalently linked together shortly after synthe- The first purified enzyme shown to catalyze DNA repli-
sis. These small fragments, or Okazaki fragments, were cation in prokaryotes was designated DNA polymerase I
the key to explaining how both strands were copied at the (pol I). DNA polymerases II (pol II) and III were later
replication fork. The two strands of the parent helix are characterized, and it was discovered that DNA poly-
01Buckingham (F)-01 2/6/07 12:23 PM Page 9

DNA Chapter 1 9

DNA
polymerase
3

5 5
Figure 1-9 Simultaneous replica- Leading strand 3
tion of both strands of the double Lagging strand 5 3
helix. Both strands are read in the 3
3! to 5! direction. The lagging Replication fork
strand is read discontinuously, with 5
the polymerase skipping ahead Okazaki fragments
and reading back toward the repli-
cation fork on the lagging strand. Overall direction of replication

merase III (pol III) was the main polymerizing enzyme studies. In in vitro studies where the enzymes were first
during bacterial replication (Table 1.1). The other two described, pol II and pol III activity was less than 5% of
polymerases were responsible for repair of gaps and dis- that of pol I. In vivo, pol III functions as a multisubunit
continuities in previously synthesized DNA. It not sur- holoenzyme. The holoenzyme works along with a larger
prising that pol I was preferentially purified in those early assembly of proteins required for priming, initiation, reg-
ulation, and termination of the replication process (Fig.
1-10). Two of the 10 subunits of the holoenzyme are cat-
alytic DNA polymerizing enzymes, one for leading and
Advanced Concepts one for lagging strand synthesis.14
Most DNA polymerase functions include, in addition
The DNA replication complex (replisome) contains
to polymerization, pyrophosphorolysis and pyrophos-
all the necessary proteins for the several activities
involved in faithful replication of double-stranded
DNA. Helicase activity in the replisome unwinds
and untangles the DNA for replication. Primase,
either as a separate protein or in a primase-helicase
Historical Highlights
polyprotein in the replisome, synthesizes short At a conference on the chemical basis of heredity
(11"1 bases) RNA sequences to prime DNA syn- held at Johns Hopkins University in June 1956,
thesis. Primase activity is required throughout the Arthur Kornberg, I. Robert Lehman, and Maurice J.
replication process to prime the discontinuous syn- Bessman reported on an extract of E. coli that could
thesis on the lagging DNA strand. The E. coli pri- polymerize nucleotides into DNA.13 It was noted
mase, DnaG, transcribes 20003000 RNA primers at that the reaction required preformed DNA and all
a rate of 1 per second in the replication of the E. coli four nucleotides along with the bacterial protein
genome. Separate polymerase proteins add incoming extract. Any source of preformed DNA would work,
nucleotides to the growing DNA strands of the repli- bacterial, viral, or animal. At the time it was difficult
cation fork. The details of synthesis of the lagging to determine whether the new DNA was a copy of
strand are not yet clear, although recent evidence the input molecule or an extension of it. During the
suggests discontinuous replication proceeds by a next 3 years, Julius Adler, Sylvy Kornberg, and
ratcheting mechanism, with replisome molecules Steven B. Zimmerman showed that the new DNA
pulling the lagging strand in for priming and copy- had the same A-T to G-C base pair ratio as the input
ing. Once DNA is primed and synthesized, Rnase H, DNA, and was indeed a copy of it. This ratio was
an enzyme that hydrolyzes RNA from a complemen- not affected by the proportion of free nucleotides
tary DNA strand, removes the primer RNA from the added to the initial reaction, confirming that the
short RNA-DNA hybrid, and the resulting gap is input or template DNA determined the sequence of
filled by another DNA polymerase, pol I. the nucleotides on the newly synthesized DNA.
01Buckingham (F)-01 2/6/07 12:23 PM Page 10

10 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Table 1.1 Examples of Polymerases Classified by Sequence Homology


Family Polymerase Source Activity
A Pol I E. coli Recombination, repair, replication
A T5 pol, T7 pol T5, T7 bacteriophage Replication
A Pol ! Mitochondria Replication
B Pol II E. coli Repair
B Archael P. furiosus Replication, repair
B "29 pol, T4 pol "29, T4 bacteriophage Replication
B Pol#, Pol$, Pol% Eukaryotes Repair
B Viral pols Various viruses Repair
C Pol III core E. coli Replication
C dnaE, dnaEBS B. subtilis Replication
X Pol & Eukaryotes Repair, replication
? Pol ', Pol Eukaryotes Bypass replication
? Pol ( Eukaryotes Bypass replication, cohesion
? Pol IV, Pol V E. coli Bypass replication
? Rev1, Rad30 S. cerevisiae Bypass replication
? Rad 6, Pol ) S. cerevisiae uv-induced repair

Leading strand DNA


polymerase

5 Single-strand
binding proteins
3 5
Lagging strand Figure 1-10 DNA polymerase activity
Helicase
involves more than one protein molecule.
5 3
Several cofactors and accessory proteins
are required to unwind the template helix
3
(green), prime synthesis with RNA primers
Primase (gray), and protect the lagging strand
RNA primer (dark gray).

phate exchange, the latter two activities being a reversal


Advanced Concepts of the polymerization process. DNA polymerase enzymes
thus have the capacity to synthesize DNA in a 5* to 3*
Genome sequencing has revealed that the organiza- direction and degrade DNA in both a 5* to 3* and 3* to 5*
tion of the proteins in and associated with the direction (Fig 1-11). The catalytic domain of E. coli DNA
holoenzyme is similar in bacteria of the Bacillus/ pol I can be broken into two fragments, separating the
Clostridium group and in the unrelated thermophile, two functions, a large fragment carrying the polymerase
Thermotoga maritima.14 The conserved nature of the activity and a small fragment carrying the exonuclease
polymerase complex suggests a limited range of pos- activity. The large fragment without the exonuclease
sible structures with polymerase activity. It also ex- activity (Klenow fragment) has been used extensively in
plains how a bacterial polymerase can replicate DNA the laboratory for in vitro DNA synthesis.
from diverse sources. This is important in the labora- One purpose of the exonuclease function in the vari-
tory where prokaryote polymerases are used exten- ous DNA polymerases is to protect the sequence of
sively to copy DNA from many different sources. nucleotides, which must be faithfully copied. Copying
errors will result in base changes or mutations in the
01Buckingham (F)-01 2/6/07 12:23 PM Page 11

DNA Chapter 1 11

3 3
G G
C C
T T
A A
T T
5 5
35 exonuclease
T T C
A A
3 C 3
A A
T T
A A
G G
Figure 1-11 DNA polymerase C C
5 5
can remove misincorporated Mispair (AC) at 3 end of Mispaired base (C) removed
bases during replication using its growing DNA strand by exonuclease. DNA polymerase
3! to 5! exonuclease activity. tries a second time.

DNA. The 3! to 5! exonuclease function is required to tance until the polymerase is dislodged. The nick can
assure that replication begins or continues with a cor- then be reclosed by DNA ligase, an enzyme that forms
rectly base-paired nucleotide. The enzyme will remove a phosphodiester bonds between existing DNA strands.
mismatch (for example, A opposite C instead of T on the Nick translation is often used in vitro as a method to
template) in the primer sequence before beginning poly- introduce labeled nucleotides into DNA molecules. The
merization. During DNA synthesis, this exonuclease resulting labeled products are used for DNA detection in
function gives the enzyme the capacity to proofread hybridization analyses.
newly synthesized DNA; that is, to remove a misincorpo- Another type of DNA polymerase, terminal trans-
rated nucleotide by breaking the phosphodiester bond ferase, can synthesize polynucleotide chains de novo
and replace it with the correct one. without a template. This enzyme will add nucleotides to
During DNA replication, E. coli DNA pol III can syn- the end of a DNA strand in the absence of hydrogen base
thesize and degrade DNA simultaneously. At a nick, or pairing with a template. The initial synthesis of a large
discontinuity, in one strand of a DNA duplex, the enzyme dA-dT polymer by terminal transferase was a significant
can add nucleotides at the 3! end of the nick while event in the history of DNA polymerase studies.15
removing nucleotides ahead of it with its 5! to 3! exonu- Terminal transferase is used in the laboratory to generate
clease function (Fig. 1-12). This concurrent synthesis and 3!-labeled DNA species.
hydrolysis then move the nick in one strand of the DNA
forward in an activity called nick translation. The poly-
merization and hydrolysis will proceed for a short dis-
Advanced Concepts
After replication, distortions in the DNA duplex
Advanced Concepts caused by mismatched or aberrantly modified bases
are removed by the 5! to 3! exonuclease function of
Like prokaryotes, eukaryotic cells contain multiple repair polymerases such as DNA pol I. This activ-
polymerase activities. Two polymerase protein com- ity degrades duplex DNA from the 5! end and can
plexes, designated " and #, are found in the nucleus also cleave diester bonds several bases from the end
and one, $, in the mitochondria. The three poly- of the chain. It is important for removing lesions in
merases resemble prokaryotic enzymes, except they the DNA duplex such as thymine or pyrimidine
have less demonstrable exonuclease activity. A dimers, boxy structures formed between adjacent
fourth polymerase, %, originally isolated from bone thymines or cytosines and thymines on the same
marrow, has 3! to 5! exonuclease activity. Poly- DNA strand that are induced by exposure of DNA to
merase ", the most active, is identified with chro- ultraviolet light. If these structures are not removed,
mosome replication, and # and % are associated with they can disrupt subsequent transcription and repli-
DNA repair. cation of the DNA strand.
01Buckingham (F)-01 2/6/07 12:23 PM Page 12

12 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

5 3 of these enzymes is contained in a monomeric or single


3 5 protein. Chemical manipulation of the amino acid struc-
ture of these enzymes produces polymerases with char-
Nick
5 3 5 3
acteristics that are useful in the laboratory. These include
3 5 altered processivity (staying with the template longer to
make longer products), fidelity (faithful copying of the
5 to 3 synthesis
DNA poymerase template), and substrate specificity (affinity for altered
5 3 nucleotides).19
3 5

DNA ligase
Enzymes That Metabolize DNA
Newly synthesized DNA
5 3 Once DNA is polymerized, it is not static. The informa-
3 5 tion stored in the DNA must be tapped selectively to
make RNA and, at the same time, protected from muta-
Closed nick
tion. In addition, an important aspect of reproduction is
5 3
3 5 mixing of sequence information to generate genetic
Figure 1-12 Nick translation of DNA. DNA polymerase diversity (hybrid vigor) in the offspring, which requires
extends the 3! end of a nick in double-stranded DNA with cutting and reassembly of the DNA strands in advance of
newly synthesized strand (gray) while digesting the original cell division and gamete formation. A host of enzymes
strand from the 5! end. After polymerization, the nick is performs these and other functions during various stages
closed by DNA ligase.
of the cell cycle. Some of these enzymes, including DNA
polymerase, have been isolated for in vitro manipulation
DNA polymerases play a central role in modern of DNA in the laboratory. They are key tools of recombi-
biotechnology. Cloning as well as some amplification and nant DNA technology, the basis for commonly used
sequencing technologies all require DNA polymerase molecular techniques.
activity. The prerequisite for specific polymerase charac-
teristics has stimulated the search for new polymerases
Restriction Enzymes
and the engineering of available polymerase enzymes.
Polymerases from various sources were classified into Genetic engineering was stimulated by the discovery of
families (A, B, C, X) based on sequence structure.16,17 deoxyriboendonucleases, or endonucleases. Endonucle-
Short summary is shown in Table 1.1. Other classifica- ases break the sugar phosphate backbone of DNA at
tions are based on similarities in protein structure. internal sites.
Polymerases in the A and B family are most useful for Restriction enzymes are endonucleases that recognize
biotechnological engineering, as the polymerase activity specific base sequences and break or restrict the DNA

Advanced Concepts Advanced Concepts


Polymerases replicate DNA under different cellular These enzymes are of several types. Some prefer sin-
conditions as shown in Table 1.1. A large part of gle-stranded and some prefer double-stranded DNA.
DNA synthesis activity in the cell occurs after repli- Repair endonucleases function at areas of distortion
cation of the cellular DNA is complete. New infor- in the DNA duplex such as baseless (apurinic or
mation as to the nature of these enzymes indicates apyrimidic) sites on the DNA backbone, thymine
that polymerases can participate in cohesion (hold- dimers, or mismatched bases. As the chemical struc-
ing together) of sister chromatids to assure proper ture of DNA is the same in all organisms, most
recombination and segregation of chromosomes.18 enzymes are active on DNA from diverse sources.
01Buckingham (F)-01 2/6/07 12:23 PM Page 13

DNA Chapter 1 13

polymer at the sugar-phosphate backbone. These enzymes


were originally isolated from bacteria where they function
as part of a primitive defense system to cleave foreign
Advanced Concepts
DNA entering the bacterial cell. The ability of the cell to Restriction enzyme recognition sequences in the
recognize foreign DNA depended on both DNA sequence DNA are generally areas of bilateral rotational sym-
recognition and methylation. metry around an axis perpendicular to the DNA
Restriction enzymes are named for the organism from helix. The enzymes bind to the recognition site,
which they were isolated. For example, BamHI was iso- which is usually 48 bp in length, as dimers to form
lated from Bacillus amyloliquefaciens H, HindIII from a complex with twofold symmetry. The enzymes
Haemophilus influenzae Rd, SmaI from Serratia then cleave the DNA backbone at sites symmetri-
marcescens Sbb and so forth. cally located around the same twofold axis.
Restriction endonucleases have been classified into
three types. Type I restriction enzymes have both nucle-
ase and methylase activity in a single enzyme. They bind
palindromic in nature; that is, they read the same 5! to 3!
to host-specific DNA sites of 46 bp separated by 68 bp
on both strands of the DNA (Fig. 1-13), referred to as
and containing methylated adenines. The site of cleavage
bilateral symmetry. Type II restriction enzymes cleave
of the DNA substrate can be over 1000 bp from this bind-
the DNA directly at their binding site, producing frag-
ing site. An example of a type I enzyme is EcoK from E.
ments of predictable size.
coli K 12. It recognizes the site:
Type II restriction enzymes have been found in almost
5! - A C N N N N N N G T G C all prokaryotes, but none, to date, have been found in
T G N N N N N N C A C G - 5! eukaryotes. The specificity of their action and the hun-
where N represents nonspecific nucleotides and the dreds of enzymes available that recognize numerous sites
adenine residues (A) are methylated. are key factors in the ability to perform DNA recombina-
Type III restriction enzymes resemble type I tion in vitro. Cutting DNA at specific sequences is the
enzymes in their ability to both methylate and restrict basis of many procedures in molecular technology,
(cut) DNA. Like type I, they are complex enzymes with including mapping, cloning, genetic engineering, and
two subunits. Recognition sites for these enzymes are mutation analysis. Restriction enzymes are frequently
asymmetrical, and the cleavage of the substrate DNA used in the clinical laboratory, for example, in the analy-
occurs 2426 bp from the site to the 3! side. An example sis of gene rearrangements and in mutation detection.
of a type III enzyme is HinfIII from H. influenzae. It rec- Although all type II restriction enzymes work with
ognizes the site: bilateral symmetry, their patterns of double-stranded
5! - C G A A T breaks differ (see Fig. 1-13). Some enzymes cut the
G C T T A - 5! duplex with a staggered separation at the recognition
where the adenine methylation occurs on only one site, leaving 24 base single-strand overhangs at the
strand. ends of the DNA. The single-strand ends can hybridize
Type II restriction enzymes are those used most fre- with complementary ends on other DNA fragments,
quently in the laboratory. These enzymes do not have directing the efficient joining of cut ends. Because of
inherent methylation activity in the same molecule as the their ability to form hydrogen bonds with complementary
nuclease activity. They bind as simple dimers to their overhangs, these cuts are said to produce sticky ends
symmetrical DNA recognition sites. These sites are at the cut site. Another mode of cutting separates the

Figure 1-13 Restriction enzymes recognize 5 G A A T T C 3 5 C C C G G G 3 5 C T G C A G 3


symmetrical DNA sequences and cut the sugar DNA
3 C T T A A G 5 3 G G G C C C 5 3 G A C G T C 5
phosphate background in different ways.
Exposed single-stranded ends are sticky ends
that can hybridize with complementary over- Eco RI SmaI PstI
hangs. 5 overhang blunt 3 overhang
01Buckingham (F)-01 2/6/07 12:23 PM Page 14

14 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Advanced Concepts Advanced Concepts


The advantage of blunt ends for in vitro recombina- DNA ligase can join both DNA and RNA ends.
tion is that blunt ends formed by different enzymes RNA ligase, first found in phage T4infected bacte-
can be joined, regardless of the recognition site. ria, has the same activity. DNA ligases are more effi-
This is not true for sticky ends, which must have cient in joining DNA ends and have been found in a
matching overhangs. Sticky ends can be converted wide variety of bacteria. The ability to convert open
to blunt ends using DNA polymerase to extend the or nicked circles of DNA to closed circles, to protect
recessed strand in a sticky end, using the nucleotides free DNA ends, to extend DNA into an overhanging
of the overhang as a template or by using a single template, and to recover transformation-capable
strand exonuclease to remove the overhanging DNA after nicking are all activities of DNA ligase
nucleotides. Synthetic short DNA fragments with that led to its discovery and isolation.
one blunt end and one sticky end (adaptors) can be
used to convert blunt ends to specific sticky ends.

they will not work on closed circular DNA. These en-


zymes are used, under controlled conditions, to manipu-
DNA duplex at the same place on both strands, leaving late DNA in vitro,23 for instance to make stepwise
flush, or blunt, ends. These ends can be rejoined as well, deletions in linearized DNA or to modify DNA ends after
although not as efficiently as sticky ends. cutting with restriction enzymes. Exonucleases have dif-
Restriction enzymes can be used for mapping a DNA ferent substrate requirements and will therefore degrade
fragment, as will be described in later sections. The col- specific types of DNA ends.
lection of fragments generated by digestion of a given Exonuclease I from E. coli degrades single-stranded
DNA fragment, e.g., a region of a human chromosome, DNA from the 3! hydroxyl end, producing mononu-
with several restriction enzymes will be unique to that cleotides. Its activity is optimal on long single-stranded
DNA. This is the basis for forensic identification and ends, slowing significantly as it approaches a double-
paternity testing using restriction fragment analysis of stranded region.
human DNA. Exonuclease III from E. coli removes 5! mononu-
cleotides from the 3! end of double-stranded DNA in the
DNA Ligase presence of Mg2" and Mn2". It also has some endonu-
clease activity, cutting DNA at apurinic sites. Exo III
DNA ligase catalyzes the formation of a phosphodiester
removes nucleotides from blunt ends, recessed ends, and
bond between adjacent 3!-hydroxyl and 5!-phosphoryl
nicks, but will not digest 3! overhangs. Exo III has been
nucleotide ends. Its existence was predicted by the obser-
used in the research setting to create nested deletions in
vation of replication, recombination, and repair activities
double-stranded DNA or to produce single-stranded
in vivo. These operations require reunion of the DNA
DNA for dideoxy sequencing.
backbone after discontinuous replication on the lagging
Exonuclease VII from E. coli digests single-stranded
strand, strand exchange, or repair synthesis. In 1967,
DNA from either the 5! phosphate or 3! hydroxyl end. It
DNA ligase was discovered in five different laborato-
is one of the few enzymes with 5! exonuclease activity.
ries.20 The isolated enzyme could catalyze end to end
Exo VII can be employed to remove long single strands
cleavage of separated strands of DNA.
protruding from double-stranded DNA.
Nuclease Bal31 from Alteromonas espejiani can
Other DNA Metabolizing Enzymes
degrade single- and double-stranded DNA from both
Other Nucleases ends. Because its activity at 20oC is slow enough to con-
In contrast to endonucleases, exonucleases degrade DNA trol with good resolution, it has been used extensively in
from free 3! hydroxyl or 5! phosphate ends. Consequently, research applications to make nested deletions in DNA.
01Buckingham (F)-01 2/6/07 12:23 PM Page 15

DNA Chapter 1 15

S1 nuclease from Aspergillus oryzae is another single-


Historical Highlights strandspecific nuclease. It hydrolyzes single-stranded
DNA or RNA into 5! mononucleotides. It also has
The initial analysis of the joining reaction was per- endonuclease capability to hydrolyze single-stranded
formed with physically fractured DNA helices that regions such as gaps and loops in duplex DNA. It was
had no homology at their ends. The joining reaction used extensively in early RNAse protection assays of
required the chance positioning of two adjacent ends gene expression. It is also used for nuclease mapping
and was, therefore, not very efficient. A better sub- techniques.24
strate for the enzyme would be ends that could be recBC nuclease from E. coli is an ATP-dependent sin-
held together before ligation, i.e., by hydrogen bonds gle- and double-stranded DNA nuclease. Although it has
between single strands. H. Gobind Khorana showed no activity at nicks (short single-strand gaps) in the DNA,
that short synthetic segments of DNA with single- it digests DNA from either the 3! hydroxyl or the 5! phos-
strand complementary overhangs joined into larger phate ends. It has some endonuclease activity on duplex
fragments efficiently.21Several investigators ob- DNA, generating short fragments, or oligonucleotides.
served the increased efficiency of joining of ends of Micrococcal nuclease digests single- and double-
DNA molecules from certain bacterial viruses. These stranded DNA and RNA at AT- or AU-rich regions.
ends have naturally occurring single-stranded over- Although this enzyme can digest duplex DNA, it prefers
hangs. It was also observed that treatment of DNA single-stranded substrates. It is used in the laboratory to
ends with terminal transferase to add short runs of remove nucleic acid from crude extracts and also for
As to one fragment and Ts to another increased the analysis of chromatin structure.25
efficiency of joining ends of any two treated frag- Deoxyribonuclease I (DNAse I) from bovine pan-
ments. Although not yet available when ligase activ- creas digests single-and double-stranded DNA at pyrim-
ity was being studied, it was subsequently observed idines to oligodeoxyribonucleotides; so, technically, it is
that the single-strand overhangs left by some restric- an endonuclease. It is used in both research and clinical
tion enzymes were better substrates for DNA ligase laboratories to remove DNA from RNA preparations.
than blunt ends due to hydrogen bonding of the com- DNAse I has also been used to detect exposed regions of
plementary single-stranded bases. DNA in DNA protein binding experiments.
DNA pol I from E. coli has exonuclease activity.
5 T C G A C T G C T A T 3
DNA
3 A G C T G A C G A T A 5
Formerly called exonuclease II, this activity is responsi-
ble for the proofreading function of the polymerase.
5 T C A T G C C C A C T A T G 3 As nucleases are natural components of cellular
3 A G T A C G G C C G A T A C 5 lysates, it is important to eliminate or inactivate them
when preparing nucleic acid specimens for clinical
5 G C A A T C A A A A A G T G C C 3 analysis. Most DNA isolation procedures are designed to
3 C G T T A G T T T T T C A C G G 5
minimize both endonuclease and exonuclease activity
Substrates for DNA ligase are broken double helices. during DNA isolation. Purified DNA is often stored in TE
Blunt ends (top) or noncomplementary overhangs (center) buffer (10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA) to
are joined less efficiently than complementary overhangs
(bottom). Also note the complementary overhangs in
chelate cations required by nucleases for activity.
Figure 1-13.
Helicases
DNA in bacteria and eukaryotes does not exist as the
relaxed double helix as shown in Figure 1-1 but as a series
Mung bean nuclease from Mung bean sprouts digests of highly organized loops and coils. Release of DNA for
single-stranded DNA and RNA. Because it leaves double- transcription, replication, and recombination without tan-
stranded regions intact, it is used to remove overhangs gling is brought about through cutting and reclosing of
from restriction fragments to produce blunt ends for the DNA sugar-phosphate backbone. These functions are
cloning. carried out by a series of enzymes called helicases.
01Buckingham (F)-01 2/6/07 12:23 PM Page 16

16 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

As described with restriction endonucleases, the DNA


double helix can be broken apart by the separation of
the sugar phosphate backbones in both strands, a double-
Advanced Concepts
strand break. When only one backbone is broken (a Both DNA and RNA helicases have been identified
single-strand break or nick), the broken ends are free to in molds, worms, and plants.2831 These enzymes
rotate around the intact strand. These ends can be digested may function in establishment of local chromosome
by exonuclease activity or extended using the intact architecture as well as regulation of transcription.
strand as a template (nick translation, as described above).
The nicking and reclosing of DNA by helicases relieve
topological stress in highly compacted, or supertwisted,
strands. Most prokaryotic DNA is methylated, or hemi-
DNA as required; for example, in advance of DNA repli-
methylated (methylated on one strand of the double helix
cation or transcription. Helicases are of two types: topoi-
and not the other), as a means to differentiate host DNA
somerases and gyrases. Topoisomerases interconvert
from nonhost and to provide resistance to restriction
topological isomers or relax supertwisted DNA. Gyrases
enzymes. Unlike prokaryotic DNA, eukaryotic DNA is
(type II topoisomerases) untangle DNA through double-
methylated in specific regions. In eukaryotes, DNA bind-
strand breaks. They also separate linked rings of DNA
ing proteins may limit accessibility or guide methyltrans-
(concatamers).
ferases to specific regions of the DNA.
Topoisomerases in eukaryotes have activity similar to
There are two main types of methyltransferases.
that in bacteria but with different mechanisms of cutting
Maintenance methyltransferases work throughout the
and binding to the released ends of the DNA. Because of
life of the cell and methylate hemimethylated DNA. In
their importance in cell replication, topoisomerases are
contrast, de novo methyltransferases work only during
the targets for several anticancer drugs, such as camp-
embryonic development and may be responsible for the
tothecin, the epipodophyllotoxins VP-16 and VM-26,
specific methylation patterns in differentiated cells.
amsacrine, and the intercalating anthracycline derivatives
doxorubicin and mitoxantrone. These topoisomerase
inhibitors bring about cell death by interfering with the
breaking and joining activities of the enzymes, in some
cases trapping unfinished and broken intermediates.
Advanced Concepts
Cytosine methyltransferases are key factors in ver-
Methyltransferases tebrate development and gene expression. These
DNA methyltransferases catalyze the addition of methyl enzymes catalyze the transfer of an activated methyl
groups to nitrogen bases, usually cytosine in DNA group from S-adenosyl methionine to the 5 position
of the cytosine ring (producing 5-methyl cytosine).
Methylation marks DNA for recognition by or resist-
ance to enzymes such as nucleases or architectural
Advanced Concepts proteins in higher eukaryotes. Methylation is the
source of imprinting of DNA, a system that pro-
Enzymatic interconversion of DNA forms was first vides a predetermined program of gene expression
studied in vitro by observing the action of two E. during development. A specific methyl transferase,
coli enzymes, topoisomerase I26 and gyrase27 on cir- Dmnt1, prefers hemimethylated DNA, indicating a
cular plasmids. Topo I can relax supercoils in circu- mechanism for keeping methylation patterns in the
lar plasmid DNA by nicking one strand of the genome.32 Defects in methylation have been
double helix. Gyrase, also called topoisomerase II, observed in cancer cells, 33 some disease states,34 and
can introduce coiling by cutting both strands of the clones.35 To date, three DNA cytosine methyltrans-
helix, passing another part of the duplex through ferases have been cloned, DNMT1, DNMT3a, and
and religating the cut strand. DNMT3b.36,37
01Buckingham (F)-01 2/6/07 12:23 PM Page 17

DNA Chapter 1 17

Recombination in Sexually molecular process of crossing over or physical exchange


between molecules. A recombinant molecule or organism
Reproducing Organisms is one that holds a new combination of DNA sequences
Recombination is the mixture and assembly of new Based on Mendels laws, each generation of sexually
genetic combinations. Recombination occurs through the reproducing organisms is a new combination of the

Historical Highlights
Early studies of recombination were done with progeny. These observations had been made before,
whole organisms. Mendels analysis of peas (Pisum but by making quantitative predictions of the proba-
species)38 established the general rules of recombi- bility of phenotypes Mendel proposed that traits are
nation in sexually reproducing organisms. Mendel inherited in a particulate manner, rather than blend-
could infer the molecular exchange events that ing as was previously thought.
occurred in the plants by observing the phenotype of
What Mendel saw: What Mendel inferred:
phenotypes genotypes

RRGG x rrgg

Round Wrinkled
gray white
rg rg rg rg
Gamete production
and fertilization RG RGrg RGrg RGrg RGrg

RG RGrg RGrg RGrg RGrg


All round and gray
RG RGrg RGrg RGrg RGrg
Self-pollinization
and fertilization
RG RGrg RGrg RGrg RGrg

All RrGg

315 108 101 32


RrGg x RrGg
round round wrinkled wrinkled
gray white gray white

RG Rg rG rg

RG RRGG RRGg RrGG RrGg

Rg RRGg RRgg RrGg Rrgg

rG RrGG RrGg rrGG rrGg


Mendelian genetics showed that traits
are inherited as unit characteristics. The
probability of inheriting a given trait can rg RrGg Rrgg rrGg rrgg
then be calculated from the traits of the
parents. (R-round, r-wrinkled, G-gray, g- Genotypic ratio:
white) 1:1:2:2:4:2:2:1:1
01Buckingham (F)-01 2/6/07 12:23 PM Page 18

18 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

of each the recombined parental chromosomes. Finally,


the gamete will merge with a gamete from the other par-
ent carrying its own set of recombined chromosomes.
The resulting offspring will contain a new set or recom-
bination of genes of the parents. The nature of this
Genetic recombination by crossing over Recombinant recombination is manifested in the combinations of
chromosomes inherited traits of subsequent generations.
Figure 1-14 Generation of genetic diversity by crossing Recombinant DNA technology is a controlled mixing
over of homologous chromosomes. of genes. Rather than relying on natural mixing of whole
genomes, single genes can be altered, replaced, deleted,
or moved into new genomes. This directed diversity can
parental genomes. The mixing of genes generates genetic produce organisms with predictable traits, as natural
diversity, increasing the opportunity for more robust and purebreds, but with single gene differences. The ability to
well-adapted offspring. The beneficial effect of natural manipulate single traits has implications not only in the
recombination is observed in heteresis, or hybrid vigor, laboratory but also in treatment and prevention of dis-
observed in genetically mixed or hybrid individuals com- ease; for example, through gene therapy.
pared with purebred organisms.
Sexually reproducing organisms mix genes in three
ways. First, at the beginning of meiosis, duplicated Recombination in
homologous chromosomes line up and recombine by
crossing over or breakage and reunion of the four DNA
Asexual Reproduction
duplexes (Fig. 1-14). This generates newly recombined Movement and manipulation of genes in the laboratory
duplexes with genes from each of the homologs. Then, began with observations of natural recombination in
these recombined duplexes are randomly assorted into asexually reproducing bacteria. Genetic information
gametes (Fig. 1-15), so that each gamete contains one set in asexually reproducing organisms can be recombined in

Homologous
chromosomes

Recombined
chromosomes

Gametes
Figure 1-15 Recombined chromosomes are randomly assorted into gametes. Twenty-two other
chromosomes will be randomly assorted into the four gametes, giving each one a new collection
of recombined chromosomes.
01Buckingham (F)-01 2/6/07 12:23 PM Page 19

DNA Chapter 1 19

Sexual reproduction Asexual reproduction

Donor cell Recipient cell


Gametes

Chromosome
Conjugation,
Zygote transduction, or
transformation

Duplicated
chromosomes,
recombination

Transformed
(recombinant) cell

Figure 1-16 Recombination in sexual (left) and asexual (right) reproduction.

three ways: conjugation, transduction, and transforma-


tion (Fig. 1-16).

Conjugation
Bacteria that participate in conjugation are of two types,
or sexes, termed F! and F-. For conjugation to occur, F-
and F! cells must be in contact with each other. F
Requirement for contact can be demonstrated by physi- F+
cally separating F! and F- cells. If this is done, mating
does not occur (Fig. 1-17). Microscopically, a filamentous
bridge is observed between mating bacteria. Further work
by J. Lederberg and William Hayes demonstrated polar-
ity in the conjugation process; that is, genetic information
could move from F! to F- bacteria but not from F- to F!
bacteria. The explanation for this was soon discovered.
The F! bacteria had a fertility factor that not only car-
Filter impermeable
ried the information from one cell to another but also was
to bacteria
responsible for establishing the physical connection
Figure 1-17 Conjugating cells must be in physical contact
between the mating bacteria. The fertility factor was with each other (top) for successful transfer of the F! pheno-
transferred from F! to F- bacteria in the mating process, type. If cells are separated by a membrane (bottom), F-
so that afterward the F- bacteria became F! (Fig. 1-18). bacteria do not become F!.
01Buckingham (F)-01 2/6/07 12:23 PM Page 20

20 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

F Chromosome
Historical Highlights
Historically, recombination was studied through
controlled mating and propagation of organisms.
George Beadle39 and others confirmed the connec-
tion between the units of heredity and physical phe- Loss Conjugation
notype using molds (Neurospera crassa), bacteria, F+
and viruses. Joshua Lederberg and Edward L.
Tatum40 demonstrated that bacteria mate and
exchange genetic information to produce recombi-
nant offspring. Lederberg and Tatum proved that
genetic exchange between organisms was not
Detachment Integration
restricted to the sexually reproducing molds. These
early studies first demonstrated the existence of Hfr F
recombination in E. coli.

E. coli Abnormal
detachment
met + bio +
thr leu Figure 1-18 Fertility (the ability to donate genetic informa-
tion) is controlled by the F factor (green). The F factor can
Requires threonine exist by itself or be integrated into the host chromosome
and leucine for growth thr + leu + (large black circle).
met + bio +

met bio factor remains in the F! bacteria, and the other is intro-
thr + leu + duced into the F- bacteria. After mating, both bacteria are
F!. The F factor may be lost or cured during normal cell
Requires methionine division, turning an F! bacteria back to the F" state.
and biotin for growth
The F factor can also insert itself into the host chro-
No growth on Growth on mosome through a crossover or recombination event.
minimal medium minimal medium
(auxotrophic) (prototrophic)
Embedded in the chromosome, the F factor maintains its
ability to direct mating and can carry part or all of the
Transfer of genetic information by conjugation can be host chromosome with it across the mating bridge into
demonstrated using double mutants. Bacteria with double
mutations that required exogenous methionine and biotin
the F- bacteria. Strains with chromosomally embedded F
(met and bio) or threonine and leucine (thr and leu) can- factors are called Hfr bacteria, for high frequency of
not grow on a medium without addition of these nutrients recombination. The embedded F factor in these rarely
(minimal medium). When these strains are mixed together, occurring strains pulls host chromosomal information
however, growth occurs. The resulting bacteria have into recipient bacteria where another recombination
acquired the normal genes (!) through transfer or conju-
gation.
event can insert that information into the recipient chro-
mosome, forming a recombinant or new combination of
genes of the Hfr and F- bacteria. Hfr bacteria were used
in the first mapping studies.
The F factor was subsequently shown to be an extra-
chromosomal circle of double-stranded DNA carrying the
Transduction
genes coding for construction of the mating bridge. Genes
carried on the F factor are transferred across the bridge In the early 1960s, Francois Jacob and Elie Wollman41
and simultaneously replicated, so that one copy of the F studied the transmission of units of heredity carried by
01Buckingham (F)-01 2/6/07 12:23 PM Page 21

DNA Chapter 1 21

viruses from one bacterium to another (transduction).


Just as animal and plant viruses infect eukaryotic cells, Coat
bacterial viruses, or bacteriophages, infect bacterial
cells. The structure of bacteriophage T4 is one example Head

of the specialized protein coats that enable these viruses


DNA
to insert their DNA through the cell wall into the bacter-
ial cell (Fig. 1-19). Alfred Hershey and Martha Chase
Collar
confirmed that the DNA of a bacterial virus was the car-
rier of its genetic determination in the transduction
process.42 Hershey and Chase used 35S to label the viral Helical sheath
protein and 32P to label the viral DNA. The experiment
showed that viral protein remained outside of the cell
while viral DNA entered the cell. Furthermore, 32P-
labeled DNA could be detected in new viruses generated
in the transduction process (Fig. 1-20). Methods soon
Base plate Tail fibers
developed using bacteriophages to move genetic infor-
mation between bacteria by growing the phage on one Figure 1-19 Bacteriophage T4 infects specific strains of E.
strain of bacteria and then infecting a second strain with coli. It has specialized structures. The tail fibers find the bacter-
those viruses. Transduction is also useful in determining ial surface and allow contact of the tail plate and injection of
the DNA in the viral head through the sheath into the bac-
gene order. Seymour Benzer used transduction of the T4 terium.
bacterial virus to fine-map genes.43
were not. If he first killed the smooth-type bacteria by
Transformation
boiling, virulence was lost, and they were no longer lethal
Although conjugation and transduction were the methods to mice. Surprisingly, when he mixed killed smooth-type
for the initial study of the connection between DNA and and live rough-type bacteria, virulence returned.
phenotype, transformation, which had first been Furthermore, he could recover live smooth-type bacteria
observed in 1928 by Frederick Griffith,44 is the basis for from the dead mice. He concluded that something from
modern-day recombinant techniques. Griffith was inves- the dead smooth-type bacteria had transformed the
tigating virulence in Diplococcus (now known as rough-type bacteria into smooth-type.
Streptococcus) pneumoniae. He had two strains of the What Griffith had observed was the transfer of DNA
bacteria: one with a rough colony type that was avirulent from one organism to another without the protection of a
and one with a smooth colony type that was virulent. conjugative bridge or a viral coat. Fifteen years later,
Griffith intended to use these strains to develop a protec- Oswald T. Avery, Colin MacLeod, and M.J. McCarty
tive vaccine (Fig. 1-21). He knew that the live smooth- identified the transforming material as DNA.45,46 They
type bacteria were lethal in mice, and the live rough-type prepared boiled virulent bacterial cell lysates and sequen-

35S 32P
(protein coat) (DNA)

Figure 1-20 Radioactive (green)


Host
protein does not enter the host cell
cell
during transduction (left). Radioactive
DNA, however, does enter (right) and
is passed to subsequent generations
of viruses.
01Buckingham (F)-01 2/6/07 12:23 PM Page 22

22 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Rough type (avirulent) Cell lysate

Mouse lives Transformation

Smooth type (virulent)


Mouse dies
+ proteinase Transformation

Heat-killed smooth type


Mouse lives
+ RNase Transformation

Heat-killed smooth type


plus rough type Mouse dies

Figure 1-21 The transforming factor discovered by Griffith


was responsible for changing the phenotype of the avirulent + DNase Transformation
rough type bacteria to that of the virulent smooth type.

Figure 1-22 Avery, MacLeod, and McCarty showed that


destruction of protein or RNA in the cell lysate did not affect
tially treated them with recently discovered enzymes
the transforming factor. Only destruction of DNA prevented
(Fig. 1-22). Protease and ribonuclease treatment, which transformation.
degraded protein and RNA, respectively, did not affect
the transformation phenomenon that Griffith had demon-
strated earlier. Treatment with deoxyribonuclease, which
degrades DNA, however, prevented transformation. They Plasmids
concluded that the transforming factor that Griffith
had first proposed was DNA. The transduction experi- DNA helices can assume both linear and circular forms.
ment of Alfred Hershey and Martha Chase also con- Most bacterial chromosomes are in circular form.
firmed their findings that DNA carried genetic traits. Chromosomes in higher organisms, such as fungi, plants,
and animals, are mostly linear. The ends of linear chro-
mosomes are protected by specialized structures called
telomeres. A cell can contain, in addition to its own chro-
Advanced Concepts mosome complement, extrachromosomal entities, or
plasmids (Fig. 1-23). Most plasmids are double-stranded
Investigators performing early transformation stud- circles, 2000100,000 bp (2100 kilobase pairs) in size.
ies observed the transfer of broken chromosomal Just as chromosomes do, plasmids carry genetic informa-
DNA from one population of bacterial cells to tion. Due to their size and effect on the host cell, plas-
another. Naked DNA transferred in this way, how- mids can carry only a limited amount of information. The
ever, is a very inefficient source for transformation. plasmid DNA duplex is compacted, or supercoiled.
Unprotected DNA is subject to physical shearing as Breaking one strand of the plasmid duplex, or nicking,
well as chemical degradation from naturally occur- will relax the supercoil (Fig. 1-24), whereas breaking
ring nucleases, especially on the broken ends of the both strands will linearize the plasmid. Different physical
DNA molecules. Natural transformations are much states of the plasmid DNA can be resolved by distinct
more efficient, because the transforming DNA is in migration characteristics during gel electrophoresis.
circular form. Plasmids were discovered to be the source of resistant
phenotypes in multidrug-resistant bacteria.47 The demon-
01Buckingham (F)-01 2/6/07 12:23 PM Page 23

DNA Chapter 1 23

Circular plasmids fer factors (RTF), or R factors. R factors carry resistance


(several thousand Main circular chromosome to common antibiotics such as chloramphenicol, tetracy-
base pairs each) (4 million base pairs) cline, ampicillin, and streptomycin. Another class of
plasmid, colicinogenic factors, carries resistance to bac-
teriocins, toxic proteins manufactured by bacteria.
Plasmids can replicate in the host cell but cannot survive
outside of the cell as viruses do. The acquisition of the
resistance genes from host chromosomes of unknown
bacteria is the presumed origin of these resistance fac-
Antibiotic-resistance tors.49 Drug-resistance genes are commonly gained and
genes lost from episomes in a bacterial population. Simultane-
ous introduction of R factors into a single cell can result
in recombination between them, producing a new, recom-
Mobile binant plasmid with a new combination of resistance
plasmid
genes.
Plasmids were initially classified into two general
Genes necessary for types: large plasmids and small plasmids. Large plas-
DNA transfer
mids include the F factor and some of the R plasmids.
Figure 1-23 Plasmids are small extrachromosomal DNA Large plasmids carry genes for their own transfer and
duplexes that can carry genetic information. propagation and are self-transmissible. Large plasmids
occur in small numbers, one or two copies per chromo-
some equivalent. Small plasmids are more numerous in
stration that multiple drug resistance in bacteria can be the cell, about 20 copies per chromosomal equivalent;
eliminated by treatment with acridine dyes48 was the first however, they do not carry genes directing their mainte-
indication of the episomal (plasmid) nature of the resist- nance. They rely on high numbers for distribution into
ance factor, similar to the F factor in conjugation. The daughter cells at cell division or uptake by host cells in
plasmids, which carry genes for inactivation or circum- transformation.
vention of antibiotic action, were called resistance trans- Compared with fragments of DNA, plasmids are more
efficient vehicles for the transfer of genes from one cell
to another. Upon cell lysis, supercoiled plasmids can
Locally denatured enter other cells more efficiently. Plasmids have been
base pairs used extensively in recombinant DNA technology to
introduce specific traits. By manipulation of the plasmid
DNA in vitro, specific genes can be introduced into cells

Gyrase + ATP

Advanced Concepts
Topoisomerase
The circular nature of R factors was demonstrated by
buoyant density centrifugation.50 Plasmid DNA has
a density higher than that of the host chromosome
and can be isolated from separate, or satellite, bands
in the gradient. Examination of the fractions of the
higher density DNA revealed small circular species.
Relaxed circle Supercoiled DNA These circles were absent from drug-sensitive
Figure 1-24 Supercoiled plasmids can be relaxed by nick- bacteria.
ing (left) or by local unwinding of the double helix (right).
01Buckingham (F)-01 2/6/07 12:23 PM Page 24

24 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

a. How many HpaII sites are present in this


Advanced Concepts plasmid?
b. What are the distances between each site?
Plasmids are found not only in bacteria but in mul- c. What is the size of the plasmid?
ticellular plants and animals as well. Some viruses, d. Draw a picture of the plasmid with the Hpa
such as the single-stranded DNA virus M13, have a II sites.
transient plasmid phase in their life cycle. A second cut of the plasmid with BamH1 yields two
Laboratory techniques requiring single-stranded pieces, 80 and x bp.
versions of specific DNA sequences have been e. How many BamH1 sites are in the plasmid?
based on the manipulation of the plasmid (duplex f. What is x in base pairs (bp)?
circle) phase of these viruses and isolation of the
single-stranded recombinant single-stranded circles 2. How would you determine where the BamH1 sites are
from the virus. This technology was used in meth- in relation to the HpaII sites?
ods devised to determine the order or sequence of
nucleotides in the DNA chain. 3. The plasmid has one EcoR1 site into which you want
to clone a blunt-ended fragment. What type of enzyme
could turn an EcoR1 sticky end into a blunt end?

to produce new phenotypes or recombinant organisms. Recombination and DNA Transfer


The ability to express genetic traits from plasmids makes
1. Compare how DNA moves from cell to cell by a) con-
it possible to manipulate phenotype in specific ways. As
jugation, b) transduction, and c) transformation.
will be described in later chapters, plasmids play a key
role in the development of procedures used in molecular
analysis.
References
1. Watson J. Molecular Biology of the Gene: New
York: W.A. Benjamin, Inc., 1965.
2. Mirsky AE. The discovery of DNA. Scientific
American 1968;218(6):78.
STUDY QUESTIONS
3. Crick F, Watson J. DNA structure. Nature
1953;171:737.
DNA Structure and Function
4. Watson J, Hopkins N, Roberts J, et al. The Molecular
1. What is the function of DNA in the cell? Biology of the Gene, 4th ed. Redwood City, CA:
Benjamin/Cummings, 1987.
2. Compare the structure of the nitrogen bases. How do
5. Eschenmoser A. Chemical etiology of nucleic acid
purines and pyrimidines differ?
structure. Science 1999;284:211824.
3. Write the complementary sequence to the following: 6. Egholm M, Buchardt O, Christensen L, et al. PNA
5!AGGTCACGTCTAGCTAGCTAGA3! hybridizes to complementary oligonucleotides obey-
ing the Watson-Crick hydrogen-binding rules. Nature
4. Which of the ribose carbons participate in the phos-
1993;365:566658.
phodiester bond?
7. Demidev VV, Yavnilovich MV, Belotserkovskii
5. Which of the ribose carbons carries the nitrogen base? BP, et al. Kinetics and mechanism of polyamide
(peptide) nucleic acid binding to duplex DNA.
6. Why does DNA polymerase require a primer?
Proceedings of the National Academy of Sciences
1995;92:263741.
Restriction Enzyme Analysis
8. Ray A, Norden B. Peptide nucleic acid (PNA):
1. A plasmid was digested with the enzyme, HpaII. On Its medical and biotechnical applications and prom-
agarose gel electrophoresis, you observe three bands, ise for the future. FASEB Journal 2000;14 (9):
100, 230, and 500 bp. 104160.
01Buckingham (F)-01 2/6/07 12:23 PM Page 25

DNA Chapter 1 25

9. Dean D. Peptide nucleic acids: Versatile tools for cleotide templates. Proceedings of the National
gene therapy strategies. Advanced Drug Delivery Academy of Sciences 1970;67(1):6873.
Reviews 2000;44(2-3):8195. 23. Lehman IR. The Enzymes, vol. 4. New York:
10. Chargaff E. Chemical specificity of nucleic acids Academic Press, 1971.
and mechanisms of their enzymatic degradation. 24. Berk AJ, Sharp PA. Sizing and mapping of early
Experimentia 1950;6:2019. adenovirus mRNAs by gel electrophoresis of S1
11. Meselson M, Stahl FW. The replication of DNA in endonuclease-digested hybrids. Cell 1977;12(3):
Escherichia coli. Proceedings of the National 72132.
Academy of Sciences 1958;44:67182. 25. Kornberg RD. Structure of chromatin. Annual
12. Okazaki R, Okazaki T, Sakabe K, et al. In vivo Review of Biochemistry 1977;46:93154.
mechanism of DNA chain growth. Cold Spring 26. Wang J. Interaction between DNA and an
Harbor Symposium on Quantitative Biology Escherichia coli protein omega. Journal of
1968;33:12944. Molecular Biology 1971;55(3):52333.
13. Kornberg A. The synthesis of DNA. Scientific 27. Gellert M, Mizuuchi K, O!Dea MH, et al. DNA
American 1968. gyrase: An enzyme that introduces superhelical
14. Dervyn E, Suski C, Daniel R, et al. Two essential turns into DNA. Proceedings of the National
DNA polymerases at the bacterial replication fork. Academy of Sciences 1976;73(11):387276.
Science 2001;294:171619. 28. Matzke MA, Matzke AJM, Pruss G, et al. RNA-
15. Schachman HK, Adler J, Radding CM, et al. based silencing strategies in plants. Current
Enzymatic synthesis of deoxyribonucleic acid. VII. Opinions in Genetic Development 2001;11
Synthesis of a polymer of deoxyadenylate and (2):22127.
deoxythymidylate. Journal of Biological Chemistry 29. Vance V, Vaucheret H. RNA silencing in plants:
1960;235:324249. Defense and counterdefense. Science 2001;292
16. Ito J, Braithwaite DK. Compilation and alignment (5525):227780.
of DNA polymerase sequences. Nucleic Acids 30. Cogoni C, Macino G. Post-transcriptional gene
Research 1991;19(15):404557. silencing across kingdoms. Current Opinions in
17. Braithwaite DK, Ito J. Complication, alignment, Genetic Development 2000;10(6):63843.
and phylogenetic relationships of DNA poly- 31. Plasterk R, Ketting R. The silence of the genes.
merases. Nucleic Acids Research 1993;21: Current Opinions in Genetic Development 2000;
787802. 10(5):56267.
18. Wang Z, Castano IB, De Las Penas A, et al. Pol K: 32. Reik W, Dean W, Walter J. Epigenetic reprogram-
A DNA polymerase required for sister chromatid ming in mammalian development. Science 2001;
cohesion. Science 2000;289:77479. 293:108993.
19. Hamilton SC, Farchaus JW, Davis MC. DNA 33. Esteller M, Corn PG, Baylin SB, et al. A gene
polymerases as engines for biotechnology. hypermethylation profile of human cancer. Cancer
BioTechniques 2001;31(2):37083. Research 2001;61:322529.
20. Lehman IR. DNA ligase: Structure, mechanism, 34. Jones P, Takai D. The role of DNA methylation
and function. Science 1974;186(4166):79097. in mammalian epigenetics. Science 2001;293:
21. Sgaramella V, Van de Sande JH, Khorana HG. 106870.
Studies on polynucleotides, C: A novel joining 35. Kang Y, Koo DB, Park JS, et al. Aberrant methyla-
reaction catalyzed by the T4-polynucleotide ligase. tion of donor genome in cloned bovine embryos.
Proceedings of the National Academy of Sciences Nature Genetics 2001;28(2):17377.
1971;67(3):146875. 36. Bestor T, Laudano A, Mattaliano R, et al. CpG
22. Kleppe K, Van de Sande JH, Khorana HG. Poly- islands in vertebrate genomes. Journal of Molecular
nucleotide ligasecatalyzed joining of deoxyribo- Biology 1987;196(2):26182.
oligonucleotides on ribopolynucleotide templates 37. Okano M, Xie S, Li E. Cloning and characteriza-
and of ribo-oligonucleotides on deoxyribopolynu- tion of a family of novel mammalian DNA (cyto-
01Buckingham (F)-01 2/6/07 12:23 PM Page 26

26 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

sine-5) methyltransferases. Nature Genetics formation of pneumococcal types. I. Induction of


1998;19(3):21920. transformation by a DNA fraction isolated from
38. Mendel G . Versuche ber Pflanzen-Hybriden pneumococcal type III. Journal of Experimental
(1865), In Peters JA, ed. Classic papers in genetics. Medicine 1944;79:13758.
vol. iv. Englewood Cliffs, NJ: Prentice-Hall:1959. 46. Hotchkiss RD: The genetic chemistry of the pneu-
39. Beadle GW. Genes and the chemistry of organism. mococcal transformations The Harvey Lectures
American Scientist 1946;34:3153. 1955;49:12444.
40. Lederberg J, Tatum, EL. Sex in bacteria: Genetic 47. Clowes R. The molecule of infectious drug resist-
studies, 19451952. Science 1953;118(3059): ance. Scientific American 1973;228(4): 1927.
16975. 48. Watanabe T, Fukasawa T. Episome-mediated
41. Jacob F, Wollman E. Viruses and genes. Scientific transfer of drug resistance in Enterobacteri-
American 1961. aceae. II. Elimination of resistance factors
42. Hershey AD, Chase M. Independent function of with acridine dyes. Journal of Bacteriology
viral protein and nucleic acid in growth of bacterio- 1961;81:67983.
phage. Journal of General Physiology 1952;26: 49. Watanabe T. Episome-mediated transfer of drug
3656. resistance in Enterobacteriaceae. VI. High fre-
43. Benzer S. The fine structure of the gene. Scientific quency resistance transfer system in E. coli.
American 1962;206(1):7084. Journal of Bacteriology 1963;85:78894.
44. Griffith F. Significance of pneumococcal types. 50. Moller JK, Bak AL, Christiansen G, et al.
Journal of Hygiene 1928;27:11359. Extrachromosomal DNA in R factor harboring
45. Avery O, MacLeod CM, McCarty M. Studies on Enterobacteriaceae. Journal of Bacteriology
the chemical nature of the substance-inducing trans- 1976;125:398403.
02Buckingham (F)-02 2/6/07 12:28 PM Page 27

Chapter 2 Lela Buckingham

RNA

OUTLINE OBJECTIVES
TRANSCRIPTION Compare and contrast the structure of RNA
TYPES/STRUCTURES with that of DNA.
Ribosomal RNA List and compare the different types of RNA.
Messenger RNA
Small Nuclear RNA Describe the cellular processing of messenger RNA.
Small Interfering RNA List several types of RNA polymerases, their substrates
Transfer RNA and products.
Micro RNAs
Other Small RNAs Recognize the reactions catalyzed by ribonucleases and
RNA helicases and their roles in RNA metabolism.
RNA POLYMERASES
OTHER RNA-METABOLIZING ENZYMES Describe how ribonucleotides are polymerized into RNA
Ribonucleases (transcription) and the relation of the sequence of the
RNA Helicases RNA transcript to the DNA sequence of its gene.
REGULATION OF TRANSCRIPTION Describe gene regulation using the Lac operon as
Epigenetics an example.
Define epigenetics and list examples of epigenetic
phenomena.

27
02Buckingham (F)-02 2/6/07 12:28 PM Page 28

28 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

O O

C C
H3C C NH HC NH
OR OR

O P O HC C O O P O HC C O
N N
O O O O

H2C CH CH H2C CH CH
Figure 2-1 Uracil (U), the nucleotide
HC CH2 HC CH
base that replaces thymine in RNA, has
OH OH OH the purine ring structure of thymine (dT)
minus the methyl group. Uracil forms
dT U hydrogen bonds with adenine.

Ribonucleic acid (RNA) is a polymer of nucleotides sim- Transcription


ilar to DNA. It differs from DNA in the sugar moieties,
having ribose instead of deoxyribose and, in one nitrogen DNA can only store information. In order for this infor-
base component, having uracil instead of thymine mation to be utilized, it must be transcribed and then
(thymine is 5-methyl uracil; Fig. 2-1). Furthermore, RNA translated into protein, a process called gene expression.
is synthesized as a single strand rather than as a double A specific type of RNA, messenger RNA (mRNA), car-
helix. Although RNA strands do not have complementary ries the information in DNA to the ribosomes where it is
partner strands, they are not completely single-stranded. translated into protein.
Through internal homologies, RNA species fold and loop Transcription is the copying of one strand of DNA
upon themselves to take on as much of a double-stranded into RNA by a process similar to that of DNA replication.
character as possible. RNA can also pair with comple- This activity occurs mostly in interphase nuclei.
mentary single strands of DNA or RNA and form a dou- Evidence1 suggests that transcription takes place at dis-
ble helix. creet stations of the nucleus into which the DNA mole-
There are several types of RNAs found in the cell. cules move. One of these sites, the nucleolus, is the
Ribosomal RNA, messenger RNA, transfer RNA, and location of ribosomal RNA synthesis.
small nuclear RNAs have distinct cellular functions. The polymerization of RNA from a DNA template is
RNA is copied, or transcribed, from DNA. catalyzed by RNA polymerase. After binding to its start
site in DNA, a specific sequence of bases called the pro-
moter, RNA polymerase and its supporting accessory
proteins synthesize RNA using the base sequence of one
Advanced Concepts strand of the double helix (the antisense strand) as a

Evolutionary theory places RNA as the original


genetic material from which DNA has evolved. In
most organisms, RNA is an intermediate between
the storage system of DNA and the proteins respon-
Advanced Concepts
sible for phenotype. One family of RNA viruses, the DNA must be released locally from histones and the
retroviruses, which include leukemia viruses and helix unwound in order for transcription to occur.
the human immunodeficiency virus, have RNA These processes involve the participation of numer-
genomes and, in order to replicate using host cell ous factors, including DNA binding proteins, tran-
machinery, must first make a DNA copy of their scription factors, histone modification enzymes, and
genome by reverse transcription. RNA polymerase.
02Buckingham (F)-02 2/6/07 12:28 PM Page 29

RNA Chapter 2 29

(A)
RNA
mRNA polymerase

DNA 3 5
5 3

Direction of transcription
(B)

mRNA
RNA
A C G
U G polymerase
5 C
U
G DNA template
A 5
A
G T G A C A A G T A C C G T A G C T A

A C U G U U C A U G G C A U C
T T
3 3
DNA A
5 A
C A C T G T T C A T G G C A T C G

DNA complement of template


Figure 2-2 RNA polymerase uses one strand of the double helix (the antisense strand) as a template
for synthesis of RNA. About 10 base pairs of DNA are unwound or opened to allow the polymerase to
work.

guide (Fig. 2-2). The sense strand of the DNA template There is no consensus sequence in DNA that specifies
has a sequence identical to that of the RNA product termination of transcription. This might be explained by
(except for the U for T substitution in RNA), but it does recent descriptions of termination by specific exonucle-
not serve as the template for the RNA. ase activity.2 As the polymerase proceeds past the polyA
Compared with sites of initiation of DNA replication, site, the nascent mRNA is released by an endonuclease
there are many more sites for initiation of transcription associated with the carboxy terminal end of the poly-
(RNA synthesis) in both prokaryotes and eukaryotes. merase. RNA synthesized beyond the site trails out of the
There are also many more molecules of RNA polymerase RNA polymerase and is bound by another exonuclease
than DNA polymerase in the cell. RNA polymerases that begins to degrade the RNA 5! to 3! toward the RNA
work more slowly than DNA polymerases (50100 polymerase. When the exonuclease catches up with the
bases/sec for RNA synthesis vs. 1000 bases/sec for DNA polymerase, transcription stops.
replication) and with less fidelity. Gene expression is the fundamental process for cell
Unlike DNA synthesis, RNA synthesis does not regulation, differentiation, and development. Signal
require a primer. Upon initiation of RNA synthesis, the transduction pathways that are the targets of several ther-
first ribonucleoside triphosphate retains all of its phos- apeutic strategies funnel internal and external signals to
phate groups as the RNA is polymerized in the 5! to 3! the nucleus where transcription factors bind to specific
direction. Subsequent ribonucleoside triphosphates retain sequences in DNA and initiate or turn off transcription.
only the alpha phosphate, the one closest to the ribose
sugar. The other two phosphate groups are released as
orthophosphate during the synthesis reaction.
Types/Structures
RNA synthesis proceeds along the DNA template until There are several types of RNAs found in the cell. Ribo-
the polyadenylation signal is encountered. At this point somal RNA, mRNA, transfer RNA, and small nuclear
the process of termination of transcription is activated. RNAs have distinct cellular functions.
02Buckingham (F)-02 2/6/07 12:28 PM Page 30

30 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Prokaryotic ribosome Eukaryotic ribosome

Large subunit Large subunit


23S rRNA 28S rRNA

5S rRNA 5S rRNA

50S 5.8S rRNA 60S

L1L31

L1L50
70S 80S
Small subunit
16S rRNA Small subunit
18S rRNA
30S
40S
S1S21
S1S32

Figure 2-3 Prokaryote and eukaryote ribosomal subunits are of similar structure but different size.
Ribosomal RNAs (left) are assembled with 52 or 82 ribosomal proteins (center) to make the subunits
that will form the complete ribosome in association with mRNA.

Ribosomal RNA mosome. In prokaryotes, mRNA is synthesized even as it


is being translated into protein. Prokaryotic mRNA is
The largest component of cellular RNA is ribosomal sometimes polycistronic; that is, coding for more than
RNA (rRNA), comprising 80%-90% of the total cellular one protein on the same mRNA. Eukaryotic mRNA, in
RNA. The various types of ribosomal RNAs are named contrast, is monocistronic, having only one protein per
for their sedimentation coefficient (S) in density gradi- mRNA. Eukaryotes can, however, produce different pro-
ent centrifugation.3 rRNA is an important structural and teins from the same DNA sequences by starting the RNA
functional part of the ribosomes, cellular organelles synthesis in different places or by processing the mRNA
where proteins are synthesized (Fig. 2-3). differently. In eukaryotes, copying of RNA from DNA
In prokaryotes, there are three rRNA species, the 16S and protein synthesis from the RNA are separated by the
found in the ribosome small subunit, and the 23S and 5S, nuclear membrane barrier. Eukaryotic mRNA undergoes
found in the ribosome large subunit, all synthesized from a series of post-transcriptional processing events
the same gene. In eukaryotes, rRNA is synthesized from before it is translated into protein (Fig. 2-4).
highly repeated gene clusters. Eukaryotic rRNA is copied
from DNA as a single 45S precursor RNA (preribosomal
RNA) that is subsequently processed into 18S of the ribo-
some small subunit and 5.8S and 28S species of the large
subunit. Another rRNA species, 5S, found in the large Advanced Concepts
ribosome subunit in eukaryotes, is synthesized separately.
The secondary structure of rRNA is important for
the integrity and function of the ribosome. Not only
Messenger RNA
is it important for ribosomal structure, it is also
Messenger RNA (mRNA) is the initial connection be- involved in the correct positioning of the ribosome
tween the information stored in DNA and the translation on the mRNA and with the transfer RNA during
apparatus that will ultimately produce the protein prod- protein synthesis.50, 51
ucts responsible for the phenotype dictated by the chro-
02Buckingham (F)-02 2/6/07 12:28 PM Page 31

RNA Chapter 2 31

Promoter Exon 1 Intron 1 Exon 2 Intron 2 Exon 3


5 3
3 5
DNA

Transcription

Pre-mRNA 5 3
Figure 2-4 DNA (top) and heteronuclear
Processing
RNA (middle) contain intervening (intron) and
expressed (exon) sequences. The introns are
removed and the mature RNA is capped and mRNA 7 Me G AAAAA
polyadenylated during processing (bottom). 5 3

The amount of a particular mRNA in a cell is related


to the requirement for its final product. Some messages
are transcribed constantly and are relatively abundant Historical Highlights
in the cell (constitutive transcription), whereas others A DNA copy (complementary DNA, copy DNA
are transcribed only at certain times during the cell cycle [cDNA]) of mature mRNA can be made by reverse
or under particular conditions (inducible, or regula- transcription of mRNA (synthesis of DNA from
tory, transcription). Even the most abundantly trans- the mRNA template). Compared with the original
cribed mRNAs are much less plentiful in the cell than gene on the chromosome, the cDNA version of
rRNA. eukaryotic genes is smaller than the chromosomal
version. Restriction enzyme mapping can be used
Messenger RNA Processing
to confirm that this is not due to premature termina-
Polyadenylation tion of the genomic transcript. The entire functional
Study of mRNA in eukaryotes was facilitated by the gene is present in the shorter sequence because
discovery that most messengers carry a sequence of cDNA versions of eukaryotic genes can be
polyadenylic acid at the 3! terminus, the poly(A) tail. expressed (transcribed and translated) into complete
The run of adenines was first discovered by hydrogen proteins.8 The larger chromosomal version of the
bonding of mRNA to polydeoxythymine on poly(dT) cel- gene must, therefore, have extra sequences, and
lulose.4 Polyuridine or polythymine residues covalently these sequences must be inserted between the
attached to cellulose or sepharose substrates are often protein coding sequences. Direct location and size
used to specifically isolate mRNA in the laboratory. of these intervening sequences were first demon-
The poly(A) tail is not coded in genomic DNA. It is strated by electron microscopy of hybrids between
added to the RNA after synthesis of the pre-mRNA. A mRNA and cDNA69 using the method of R loop
protein complex recognizes the RNA sequence, mapping developed by White and Hogness.70 In
AAUAAA, and cleaves the RNA chain 1130 bases 3! to these experiments, mRNA and duplex genomic
that site. The enzyme that cuts pre-mRNA in advance of DNA were incubated together at elevated tempera-
polyadenylation has not been identified. Recent studies tures in a high concentration of formamide. Under
suggest that a component of the protein complex related these conditions, the more stable RNA-DNA
to the system that is responsible for removing the 3! hybrids are favored over the DNA duplexes. The
extension from pre-transfer RNAs may also be involved resulting structures released loops of unpaired DNA
in generation of the 3! ends on mRNA.5,6 The enzyme (introns) that could be measured. The DNA
polyadenylate polymerase is responsible for adding the duplexed with RNA corresponded to the coding
adenines to the end of the transcript. A run of up to 200 sequences (exons).
nucleotides of poly(A) is typically found on mRNA in
mammalian cells.
02Buckingham (F)-02 2/6/07 12:28 PM Page 32

32 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Advanced Concepts Advanced Concepts


About 30% of the mRNAs, notably histone mRNAs, Caps are present on all eukaryotic mRNA bound for
are not polyadenylated.52 The function of the translation, except for some mRNA transcribed from
poly(A) tail, or functional differences between mitochondrial DNA. Capping occurs after initiation
poly(A)" and poly(A)- mRNA, is not clear. The of transcription, catalyzed by the enzyme guany-
polyA tail may be involved in movement of the lyl transferase. This enzyme links a guanosine
mRNA from the nucleus to the cytoplasm, associa- monophosphate provided by guanosine triphosphate
tion with other cell components, maintenance of sec- to the 5! phosphate terminus of the RNA with the
ondary structure, or proper stability of the message. release of pyrophosphate. In some viruses, guano-
sine diphosphate provides the guanidine residue,
and monophosphate is released. Caps of mRNA are
recognized by ribosomes just before translation.53
Capping
Eukaryotic mRNA is blocked at the 5! terminus by an
unusual 5!-5! pyrophosphate bridge to a methylated
guanosine.7 The structure is called a cap. The cap is a
5!-5! pyrophosphate linkage of 7-methyl guanosine to
either 2! O-methyl guanine or 2! O-methyl adenine of the
Advanced Concepts
mRNA, There are four types of introns, group I, group II,
7-methylG5!ppp 5! G or A 2!O-methyl pNpNpNp
nuclear, and tRNA, depending on the mechanism
where p represents a phosphate group, N represents of their removal from hnRNA. Group I introns are
any nucleotide. found in nuclear, mitochondrial, and chloroplast
The cap confers a protective function as well as serves genes. Group II introns are found in mitochondrial
as a recognition signal for the translational apparatus. and chloroplast genes. Group I introns require a
Caps differ with respect to the methylation of the end guanosine triphosphate molecule to make a nucle-
nucleotide of the mRNA. In some cases, 2!O-methylation ophilic attack on the 5! phosphate of the 5! end of
occurs not only on the first but also on the second the intron. This leaves a 3! OH at the end of the 5!
nucleotide from the cap. Other caps methylate the first exon (splice donor site), which attacks the 5! end of
three nucleotides of the RNA molecule. the next exon (splice acceptor site), forming a new
phosphodiester bond and releasing the intervening
Splicing sequence. Group II introns are removed in a similar
Prokaryotic structural genes contain uninterrupted reaction initiated by the 2! OH of an adenosine
lengths of open reading frame, sequences that code for within the intron attacking the 5! phosphate at the
amino acids. In contrast, eukaryotic coding regions are splice donor site. When the 3! OH of the splice
interrupted with long stretches of noncoding DNA donor site bonds with the splice acceptor site of the
sequences called introns. Newly transcribed mRNA, het- next exon, the intervening sequence is released as a
eronuclear RNA (hnRNA), is much larger than mature lariat structure (see Fig. 2-4). This lariat contains an
mRNA because it still contains the intervening sequences. unusual 2!, 3!, and 5! triply-linked nucleotide, the
Labeling studies demonstrated that the hnRNA is capped presence of which proved the mechanism. Removal
and tailed and that these modifications survive the transi- of nuclear introns occurs by the same transesterifi-
tion from hnRNA to mRNA, which is simply a process of cation mechanism, except this reaction is catalyzed
removing the intervening sequences from the hnRNA. by specialized RNA-protein complexes (small
Introns are removed from hnRNA by splicing (Fig. nucleoprotein particles). These complexes contain
2-5). The remaining sequences that code for the protein the small nuclear RNAs U1, U2, U4, U5, and U6.
product are exons.
02Buckingham (F)-02 2/6/07 12:28 PM Page 33

RNA Chapter 2 33

Exon Intron Exon


5 AG GUAAGU UAUAC NCAG G 3

U G A AU G GA 5

UAUAC NCAG G 3

UG
A 5 AG 3
Figure 2-5 RNA splicing at the 5! splice site (AGGUAAGU), A
branch (UAUAC), and 3! splice site (NCAGG) consensus U
sequences. The intron (light gray) is removed through a trans- G
esterification reaction involving a guanine nucleotide UAUAC N C A G 3 5 G 3
of the 5! site and an adenine in the branch sequence. Discarded intron
The product of this reaction is the discarded intron in a
lariat structure. Another transesterification reaction connects
the exons. 5 AG G 3

Although removal of all nuclear introns requires pro- The branch point sequence YNCURAC is variable in
tein catalysts, some introns are removed without the par- mammals but almost invariant in the yeast Saccharomyces
ticipation of protein factors in a self-splicing reaction. cervisiae (UACUAAC).
The discovery of self-splicing was the first demonstration Splicing may be important for timing of translation of
that RNA could act as an enzyme. mRNA in the cytoplasm, although it is not necessarily
Inspection of splice junctions from several organisms required as cloned genes synthesized in vitro without
and genes has demonstrated the following consensus introns are expressed in eukaryotic cells. Introns may have
sequences for the donor and acceptor splice junctions of evolved as a means of increasing recombination frequency
group I, II, and nuclear introns8: within genes as well as between genes.8 The discontinu-
A G // G U A A G U (intron) YNCURAC YN N C A G // G ous nature of eukaryotic genes may also protect the cod-
splice branch point splice ing regions from genetic damage by toxins or radiation.
donor site sequence acceptor site Alternative splicing can modify products of genes by
alternate insertion of different exons. For example, the
production of calcitonin in the thyroid or calcitonin gene-
related peptide in the brain depends on the exons included
Advanced Concepts in the mature mRNA in these tissues.9 Alternative splic-
ing has been found in about 40 different genes.
The splicing of transfer RNA (tRNA) transcripts Abnormalities in the splicing process are responsible
involves breakage and reunion of the RNA chain. for several disease states. Some "-thalassemias result
Endonucleases cleave the tRNA precisely at the from mutations in splice recognition sequences of the "-
intron ends. The resulting tRNA ends, a 2!, 3! cyclic globin genes. Certain autoimmune conditions result from
phosphate and a 5! OH, are then ligated in a com- production of antibodies to RNA protein complexes.
plex reaction that requires ATP, followed by further Auto-antibodies against U1 RNA, one of the small
base modification in some tRNAs. nuclear RNAs required for splicing, are associated with
systemic lupus erythematosus.
02Buckingham (F)-02 2/6/07 12:28 PM Page 34

34 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Small Nuclear RNA Small Interfering RNA


Another type of cellular RNA is the small nuclear RNA Small interfering RNAs (siRNA) are the functional
(snRNA), which functions in splicing (removal of introns intermediates of RNA interference (RNAi, discussed
from freshly transcribed RNA) in eukaryotes. Small later in this chapter), a defense in eukaryotic cells against
nuclear RNA stays in the nucleus after its transcription viral invasion. In a process that is not yet completely
by RNA polymerase I or III. Small nuclear RNAs from understood, double-stranded RNA (dsRNA) species are
eukaryotic cells sediment in a range of 6-8S. Small believed to originate from transcription of inverted repeats
nuclear RNAs isolated from hepatoma and cervical car- or by the activity of cellular or viral RNA-directed RNA
cinoma cell lines are summarized in Table 2.1. polymerases.13 Biochemical analysis of RNA interference
Small nuclear RNAs serve mostly a structural role has revealed that these 2122 nucleotide dsRNAs, also
in the processing of mRNA. Several of a family of pro- called small intermediate RNAs, are derived from suc-
teins (Sm proteins) assemble into a (60A ! by 30-40A!) cessive cleavage of dsRNAs 500 or more nucleotide base
doughnut-shaped complex that interacts with the U-rich pairs in length.14 The ribonuclease III enzyme, dicer, is
regions of poly (U) RNAs.10,11 responsible for the generation of siRNA and another small
U1 RNA is complementary to sequences at the splice RNA, micro RNA (see below), from dsRNA precursors.15
donor site, and its binding distinguishes the sequence GU
in the splice site from other GU sequences in the RNA.
Transfer RNA
U2 RNA recognizes the splice acceptor site. In lower
eukaryotes, another protein, splicing factor 1,12 binds to Translation of information from nucleic acid to protein
the branch point sequence, initiating further protein requires reading of the mRNA by ribosomes, using adap-
assembly and association of U4, U5, and U6, with the tor molecules or transfer RNA (tRNA). Transfer RNAs
looped RNA forming a complex called the splicesosome are relatively short single-stranded polynucleotides of
in which the transesterification reaction linking the exons 7393 bases in length, MW 2431,000. There is at least
together takes place. one tRNA for each amino acid.

Table 2.1 Small Nuclear RNA Isolated From


HeLa Cervical Carcinoma and
Advanced Concepts
Novikoff Hepatoma Cells8 The first demonstration of directed RNAi in the lab-
Species Approximate oratory occurred in the experiments of Fire et al.
Species (HeLa) (Novikoff) Length (Bases) with C. elegans.45 These investigators injected
dsRNA into worms and observed dramatic inhibition
SnA U5 180
of the genes that generated the RNA. Since then,
SnB 210
siRNAs have been introduced into plants and ani-
SnC U2 196
mals, including human cells growing in culture.
SnD U1B 171
Injection of long dsRNA kills human cells, but gene
SnE/ScE (5.8S rRNA) 5.8S
silencing can be achieved by introduction of the
SnF U1A 125
siRNAs or plasmids coding for the dsRNA. Libraries
SnG/ScG (5S rRNA) 5S I and II
of siRNAs or DNA plasmids encoding them have
SnG 5S III 120
been made that are complementary to over 8000 of
SnH 4.5S I, II and III 96
the approximately 35,000 human genes.54 These
SnI (tRNA)
genetic tools have potential applications not only in
SnK 260
identifying genes involved in disease but also as
SnP 130
treatment for some of these diseases, particularly
ScL (viral 7S) 260
cancer where overexpression or abnormal expression
ScM 180
of specific genes is part of the tumor phenotype.55,56
ScD 180
02Buckingham (F)-02 2/6/07 12:28 PM Page 35

RNA Chapter 2 35

Advanced Concepts Advanced Concepts


Mitochondria contain distinct, somewhat smaller The tRNA genes contain 1420 extra nucleotides in
tRNAs.57 the sequences coding for the anticodon loop that are
transcribed into the tRNA. Enzymes that recognize
other tRNA modifications remove these sequences
(introns) by a cleavage-ligation process. Intron
Eight or more of the nucleotide bases in all tRNAs removal, addition of CCA to the 3! end, and nucleo-
are modified, usually methylated, after the tRNA synthe- tide modifications all occur following tRNA tran-
sis. Most tRNAs have a guanylic residue at the 5! end scription. Enzymatic activities responsible for intron
and the sequence C-C-A at the 3! end. With maximum removal and addition of CCA may also contribute to
intrastrand hybridization, tRNAs take on a cruciform intron removal and polyA addition to mRNA.
structure of double-stranded stems and single-stranded
loops (Fig. 2-6). Transfer RNAs with longer sequences
have an additional loop. The sequence C-C-A is found at
the 3! acceptor end of the tRNA. This is where the amino tional level of hydrogen bonding between the D loop
acid will be covalently attached to the tRNA. A seven- and the T"C loop to form a #-shaped structure (see
base loop (the T"C loop, where " stands for the modi- Fig. 2-6).
fied nucleotide pseudouridine) contains the sequence
5!-T"CG-3!. The variable loop is larger in longer
Micro RNAs
tRNAs. Another seven-base loop (the anticodon loop)
contains the three-base pair anticodon that is comple- Micro RNAs (miRNA) are tiny regulatory RNAs, 21-25
mentary to the mRNA codon of its cognate amino acid. nt in length, derived from endogenous RNA hairpin
An 8-12base loop (D loop) is relatively rich in dihy- structures (RNA folded into double-stranded states
drouridine, another modified nucleotide. X-ray diffrac- through intrastrand hydrogen bonds). Micro RNAs were
tion studies of pure crystalline tRNA reveal that the discovered in the worm Caenorhabditis elegans. Two 22-
cruciform secondary structure of tRNA takes on an addi- nt RNAs were shown to contribute to temporal progres-

3 Amino acid
A O H
C CCA terminus
C C N2H
C Acceptor end
O R
5 A 3
G C 5
G C
G U Acceptor arm Acceptor arm
C G
G C
D loop U U TyCC loop TyCC loop
G C U
U A G G C C U A
D G A mG G
C U G C G
U C C G G T C
G C D stem
G D A G C G C mG D
2
C G A G D loop
G
U A
Anticodon stem Variable loop
Figure 2-6 Alanine tRNA is an C G
Anticodon loop C G
example of the general structure G
C
of tRNA, which is often depicted U
in a cruciform structure (left). The U m1
C Anticodon loop
inverted L (right) is more accurate G
of the structure formed by
Anticodon Anticodon
intrastrand hydrogen bonding.
02Buckingham (F)-02 2/6/07 12:28 PM Page 36

36 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

RNA Polymerases
Historical Highlights
Table 2.2

Enzyme Template Product


In 1964 Robert Holley and colleagues at Cornell
E. coli RNA polymerase II DNA mRNA
University solved the first tRNA sequence. The
RNA polymerase I DNA rRNA
sequence was that of alanine tRNA of yeast.71 Yeast
RNA polymerase II DNA mRNA
tRNAala is 76 bases long; 10 of these bases are
RNA polymerase III DNA tRNA, snRNA
modified.
Mitochondrial RNA polymerase DNA mRNA
Mammalian DNA polymerase ! DNA primers
HCV RNA polymerase RNA Viral genome
Dengue virus RNA polymerase RNA Viral genome
sion of cell fates by triggering down regulation of target PolyA polymerase None PolyA tails
mRNAs.16-18 These RNA species were called small tem-
poral RNA (stRNA).
Like siRNAs, these evolutionarily conserved RNAs
are involved in control of gene expression. Unlike RNA Polymerases
siRNAs that destroy mRNA, miRNAs pair with partially
complementary sequences in mRNAs and inhibit transla- RNA synthesis is catalyzed by RNA polymerase
tion. So far, over 100 miRNAs have been identified in enzymes (Table 2.2). One multi-subunit prokaryotic
eukaryotic cells and viruses.19-22 Bacteria have genes that enzyme is responsible for the synthesis of all types of
resemble miRNA precursors; however, the full miRNA RNA in the prokaryotic cell. Eukaryotes have three dif-
system has not been demonstrated in bacteria. The true ferent RNA polymerase enzymes. DNA-dependent RNA
number of these RNAs may amount to thousands per polymerases require a DNA template. RNA-dependent
genome. RNA polymerases require an RNA template.
Micro RNAs perform diverse functions in eukaryotic In prokaryotes, all types of RNA are synthesized by a
cells affecting gene expression, cell development, and de- single RNA polymerase. Bacterial RNA polymerase con-
fense. Because production of miRNAs is strictly regulated sists of five subunits, two ! and one of each ", " and #27
as to time or stage of cell development, finding them is a (Fig. 2-7).
technical challenge. Many of these species are only pres-
ent in virally infected cells or after introduction of foreign
nucleic acid by transformation.20 Novel approaches will
be required for discovery of rare miRNAs expressed in

specific cell types at specific times. Core enzyme (,2,,)

Other Small RNAs



Since the late 1990s a growing variety of small RNAs

(sRNA) have been described in prokaryotes and eukary- Holoenzyme (,2,,,)
otes, including tiny noncoding RNAs (tncRNA, 20-22
b),23 small modulatory RNA (smRNA, 21-23b),24 small
nucleolar RNAs (snoRNA),25 tmRNA26 and others. In
addition to RNA synthesis and processing, these mole- Rho termination factor ()
cules influence numerous cellular processes, including
plasmid replication, bacteriophage development, chro- Figure 2-7 Prokaryotic RNA polymerase is made up of
separate proteins. The four subunits that make up the core
mosome structure, and development. These small enzyme have the capacity to synthesize RNA. The sigma
untranslated RNA molecules have been termed sRNAs in cofactor aids in accurate initiation of RNA synthesis. The
bacteria and noncoding RNAs (ncRNAs) in eukaryotes. rho cofactor aids in termination of RNA synthesis.
02Buckingham (F)-02 2/6/07 12:28 PM Page 37

RNA Chapter 2 37

Cellular Location and Activity of


Advanced Concepts
Table 2.3
RNA pol I, II, and III in Eukaryotes
Type Location Products !-Amanitin The most well-studied eukaryotic RNA polymerase
I Nucleolus 18s, 5.8s, Insensitive II is from the yeast Saccharomyces cervisiae. It is a
28s rRNA 0.4 megadalton complex of 12 subunits. The yeast
II Nucleus mRNA, snRNA Inhibited enzyme works in conjunction with a large complex
III Nucleus tRNA, 5s rRNA Inhibited by high of proteins required for promoter recognition and
concentration melting, transcription initiation, elongation and ter-
mination, and transcript processing (splicing, cap-
ping, and polyadenylation).
Burgess et al.28 showed that the !2,"," core enzyme
retained the catalytic activity of the !2,","# complete,
or holoenzyme, suggesting that the sigma factor played The differential drug sensitivity, cellular location, and
no role in RNA elongation. In fact, the sigma factor is ionic requirements of the three eukaryotic RNA poly-
released at RNA initiation. The role of sigma factor is to merases were used to assign the polymerases to the type
guide the complete enzyme to the proper site of initiation of RNA they synthesize. Pol I synthesizes rRNA (except
on the DNA. 5S rRNA). Pol II synthesizes mRNAs and snRNAs. Pol
In eukaryotes, there are three multisubunit nuclear III synthesizes tRNAs, 5S rRNA, and some snRNAs. Pol
DNA-dependent RNA polymerases, RNA polymerase I, II (also called RNA polymerase b [Rpb]) is the central
II, and III (Table 2.3). A single subunit mitochondrial transcribing enzyme of mRNA in eukaryotes.
RNA polymerase, imported to organelles, is also encoded RNA viruses carry their own RNA-dependent RNA
in the nucleus. The three RNA polymerases in eukaryotic polymerases. Hepatitis C virus and Dengue virus carry
cells were first distinguished by their locations in the this type of polymerase to replicate their RNA genomes.
cell. RNA polymerase I (pol I) is found in the nucleolus. RNA-dependent RNA polymerase activity has also been
RNA polymerase II (pol II) is found in the nucleus. found in lower eukaryotes.29 The purpose of these
RNA polymerase III (pol III), one of the first nucleic enzymes in cells may be associated with RNAi and gene
acid polymerases discovered, is also found in the nucleus silencing.
(and sometimes the cytoplasm). PolyA polymerase is a template-independent RNA
polymerase. This enzyme adds adenine nucleotides to the
3$ end of mRNA.30 The resulting polyA tail is important
for mRNA stability and translation into protein (see
Advanced Concepts below).
The three polymerases were also distinguished
by their differential sensitivity to the toxin !- Other RNA-Metabolizing
amanitin.58-60 This toxin is a bicyclic octapeptide Enzymes
isolated from the poisonous mushroom Amanita
Ribonucleases
phalloides. Pol II is sensitive to relatively low
amounts of this toxin. Pol III is sensitive to inter- Ribonucleases degrade RNA in a manner similar to the
mediate levels, and pol I is resistant. This toxin degradation of DNA by deoxyribonucleases (Table 2.4).
has been invaluable in the research setting to deter- An endoribonuclease, cleavage and polyadenylation spe-
mine which polymerase activity is responsible for cific factor (CPSF) is required for proper termination of
synthesis of newly discovered types of RNA and RNA synthesis.32,33 Along with RNA polymerase II sub-
to dissect the biochemical properties of the poly- units and other proteins, this enzyme cuts the nascent
merases.61-63 RNA transcript before addition of the polyA tail by
polyA polymerase.
02Buckingham (F)-02 2/6/07 12:28 PM Page 38

38 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Advanced Concepts Advanced Concepts


With advances in crystallography, the molecular There are two major groups of RNA helicases
mechanisms of RNA synthesis are being revealed. defined by the amino acid sequence of their con-
During transcription, DNA enters a positively served regions. DEAD-box helicases (asp-glu-ala-
charged cleft between the two largest subunits of the asp) are typified by the yeast translation initiation
RNA polymerase. At the floor of the cleft is the factor e1F4A, which unwinds messenger RNA at
active site of the enzyme to which nucleotides are the 5! untranslated end for proper binding of the
funneled through a pore in the cleft beneath the small ribosomal subunit. DEAD-box proteins are
active site (pore 1). In the active site, the DNA not strong helicases and may be referred to as
strands are separated, and the RNA chain is elon- unwindases or RNA chaparones.66 The DEAH-
gated driven by cleavage of phosphates from each box helicases (asp-glu-ala-his) (DExDH-box heli-
incoming ribonucleoside triphosphate. The resulting cases) resemble DNA helicases. They act on mRNA
DNA-RNA hybrid moves out of the active site and snRNA during splicing. They may also be
nearly perpendicular to the DNA coming into the required for ribosome biosynthesis. In addition to
cleft. After reaching a length of 10 bases, the newly RNA unwinding, protein dissociation, splicing, and
synthesized RNA dissociates from the hybrid and translation, RNA helicases also participate in RNA
leaves the complex through an exit channel. Three turnover and chromatin remodeling.
protein loops, rudder, lid, and zipper, are
involved in hybrid dissolution and exit of the RNA
product.64,65
Another activity of these enzymes is in the removal of
proteins from RNA-protein complexes.
RNA Helicases
RNA helicases catalyze the unwinding of double-
Regulation of Transcription
stranded RNA. RNA synthesis and processing require the Gene expression is a key determinant of phenotype. The
activity of helicases. These enzymes have been charac- sequences and factors controlling when and how much
terized in prokaryotic and eukaryotic organisms. Some protein is synthesized are equally as important as the
RNA helicases work exclusively on RNA. Others can DNA sequences encoding the amino acid makeup of a
work on DNA:RNA heteroduplexes and DNA substrates. protein. Early studies aimed at the characterization of

Table 2.4 RNases Used in Laboratory Procedures49


Enzyme Source Type Substrate
RNAse A Bovine Endoribonuclease Single-stranded RNA 3! to pyrimidine residues
RNAse T1 Aspergillus Endoribonuclease 3! Phosphate groups of guanines
RNAse H E. coli Exoribonuclease RNA hybridized to DNA
RNAse CL3 Gallus Endoribonuclease RNA next to cytidylic acid
Cereus RNAse Physarum Endoribonuclease Cytosine and uracil residues in RNA
RNAse Phy M Physarum Endoribonuclease Uracil, adenine, and guanine residues in RNA
RNAse U2 Ustilago Endoribonuclease 3! Phosphodiester bonds next to purines
RNAse T2 Aspergillus Endoribonuclease All phosphodiester bonds, preferably next to adenines
S1 nuclease Aspergillus Exoribonuclease RNA or single-stranded DNA
Mung bean nuclease Mung bean sprouts Exoribonuclease RNA or single-stranded DNA
RNAse Phy I Physarum Exoribonuclease Guanine, adenine, or uracil residues in RNA
02Buckingham (F)-02 2/6/07 12:28 PM Page 39

RNA Chapter 2 39

gene structure were confounded by phenotypes that cis element


resulted from aberrations in gene expression rather than 5 3
in protein structural alterations. 3 5
Gene expression is tightly regulated throughout the life DNA
Trans
of a cell. Because gene products often function together factor
to bring about a specific cellular response, specific com-
binations of proteins in stoichiometric balance are crucial
for cell differentiation and development. Protein avail-
ability and function are controlled at the levels of tran-
scription, translation, and protein modification and 5 3
stability. The most immediate and well-studied level of 3 5
control of gene expression is transcription initiation. Figure 2-8 cis factors or cis elements (top) are DNA
Molecular technology has led to an extensive study of sequences recognized by transcription factors, or trans
factors, or DNA binding proteins (bottom).
transcription initiation, so a large amount of information
on gene expression refers to this level of transcription.
Two types of factors are responsible for regulation of
RNA synthesis: cis factors and trans factors (Fig. 2-8). such as bacteria and viruses, operons bring about coordi-
cis factors are DNA sequences that mark places on the nate expression of proteins required at the same time; for
DNA involved in the initiation and control of RNA syn- example, the enzymes of a metabolic pathway. The lac-
thesis. Trans factors are proteins that bind to the cis tose operon contains three structural genes, LacZ, LacY,
sequences and direct the assembly of transcription com- and LacA, which are all required for the metabolism of
plexes at the proper gene. In order for transcription to lactose. The LacZ gene product, !-galactosidase,
occur, several proteins must assemble at the genes tran- hydrolyzes lactose into glucose and galactose. The LacY
scription initiation site including specific and general gene product, lactose permease, transports lactose into the
transcription factors and the RNA polymerase complex. cell. The LacA gene product, thiogalactoside transacety-
An operon is a series of structural genes transcribed lase, transacetylates galactosides. The LacI gene, which
together on one mRNA and subsequently separated into encodes a protein repressor and the repressors binding
individual proteins. In organisms with small genomes site in the DNA just 5" to the start of the operon, is respon-
sible for the regulated expression of the operon. When E.
coli is growing on glucose as a carbon source, the lactose-
metabolizing enzymes are not required, and this operon is
Historical Highlights minimally expressed. Within 23 minutes after shifting
the organism to a lactose-containing medium, the expres-
The production of particular proteins in media con- sion of these enzymes is increased a thousandfold.
taining specific substrates was observed early in the Fig. 2-9 shows a map of the lac operon. The three
last century, a phenomenon termed enzyme adapta- structural genes of the operon are preceded by the pro-
tion. It was later called induction, and detailed moter, where RNA polymerase binds to the DNA to start
analysis of the lactose operon was the first descrip- transcription and the cis regulatory element, the opera-
tion of an inducible gene expression at the molecu- tor, where the regulatory repressor protein binds. The
lar level. The effect of gene expression on sequences coding for the repressor protein are located
phenotype was initially demonstrated by Monod just 5" to the operon. In the absence of lactose, the repres-
and Cozen-Bazire in 1953 when they showed that sor protein binds to the operator sequence and prevents
synthesis of tryptophane in Aerobacter was inhib- transcription of the operon. When lactose is present, it
ited by tryptophane.72 Jacob and Monod subse- binds to the repressor protein and changes its conforma-
quently introduced the concept of two types of tion and lowers its affinity to bind the operator sequence.
genes, structural and regulatory in an inducible sys- This results in expression of the operon (Fig. 2-10). Jacob
tem, the lactose operon in E. coli.73 and Monod deduced these details through analysis of a
series of mutants. Since their work, numerous regulatory
02Buckingham (F)-02 2/6/07 12:28 PM Page 40

40 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Regulator gene P O lacZ lacY lacA


5 3
3 5
DNA

Figure 2-9 General structure of the lac operon. The regulator or repressor gene codes for the
repressor protein trans factor that binds to the operator.

systems have been described in prokaryotes and eukary- Another mechanism of control in bacteria is attenua-
otes, all using the same basic idea of combinations of cis tion. This type of regulation works through formation of
and trans factors. stems and loops in the RNA transcript by intrastrand
Other operons are controlled in a similar manner by hydrogen bonding. These secondary structures allow or
the binding of regulatory trans factors to cis sequences prevent transcription, for instance by exposing or seques-
preceding the structural genes (Fig. 2-11). A different tering ribosome binding sites at the beginning of the tran-
type of negative control is that found in the arg operon script.
where a corepressor must bind to a repressor in order to The general arrangement of cis factors on DNA is
turn off transcription (enzyme repression). Compare this shown in Fig. 2-12. These sequences are usually 420
with the inducer that prevents the repressor from binding bp in length. Some are inverted repeats with the capacity
the operator to turn on expression of the lac operon to form a cruciform structure in the DNA duplex recog-
(enzyme induction). The mal operon is an example of nizable by specific proteins. Prokaryotic regulatory
positive control where an activator binds with RNA sequences are found within close proximity of the gene.
polymerase to turn on transcription. Eukaryotic genes have both proximal and distal regula-

(A)
Repressor RNA
polymerase

5 3
3 5
DNA Regulator P O lacZ lacY lacA
gene

(B)
Inducer
(lactose)

Figure 2-10 Two states of the


lac operon. (A) The repressor pro-
tein (R) binds to the operator cis
5 3 element (O) preventing transcrip-
3 5 tion of the operon from the pro-
DNA Regulator P O lacZ lacY lacA moter (P). (B) In the presence of
gene the inducer lactose, the inducer
binds to the repressor, changing its
Transcription conformation, decreasing its affin-
ity for the operator, allowing tran-
mRNA scription to occur.
02Buckingham (F)-02 2/6/07 12:28 PM Page 41

RNA Chapter 2 41

(A)
Inducer
Repressor

5 3
3 5
P O

Transcription

mRNA

(B)
Corepressor
Repressor

5 3
3 5
P O

(C)
Activator

5 3
3 5
P O
Figure 2-11 Modes of regulation in prokary-
otes include induction as found in the lac operon Transcription
(A), repression as found in the arg operon (B),
and activation as in the mal operon (C). mRNA

Prokaryotes
Proximal elements Structural gene

5 3
Figure 2-12 cis regulatory elements in
3 5
prokaryotes are located close to the struc-
Promoter
tural genes they control in the vicinity of
the promoter. In eukaryotes, distal ele-
Eukaryotes
ments can be located thousands of base
pairs away from the genes they control. Distal elements Proximal elements Structural gene
Proximal elements can be located in or
around the genes they control. Elements 5 3
may also be located behind their target 3 5
genes. Promoter
02Buckingham (F)-02 2/6/07 12:28 PM Page 42

42 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Coactivator

Advanced Concepts (histone acetyl


transferase)

Unlike prokaryotes, eukaryotes do not have oper-


ons. Coordinately expressed genes can be scattered Activator
in several locations. Synchronous expression is
brought about in eukaryotes by combinatorial con- DNA
trol. Genes that are expressed in a similar pattern
share similar cis elements so that they respond Nucleosome
Regulatory region

simultaneously to specific combinations of control-


TFIID
ling trans factors. (TATA binding
Regulatory region protein)

tory elements. Distal eukaryotic elements can be located Enhancer Promoter


thousands of base pairs away from the genes they control. 5 TATAT 3
Enhancers and silencers are examples of distal regula- 3 ATATA 5
DNA
tory elements that respectively stimulate or dampen Regulator
protein
expression of distant genes. Activator protein Other basal
factors
TFIID
Epigenetics 5 TATAT 3
3 ATATA 5
Histone Modification RNA
Gene activity (transcription) can be altered in ways other polymerase II
than by cis elements and transcription factors. Histone
modification, DNA methylation, and gene silencing by
double-stranded or antisense RNA regulate gene expres- TFIID

sion. These types of gene regulation are called epigenetic 5 3


regulation. 3 5

Chromatin is nuclear DNA that is compacted onto


nucleosomes. A nucleosome is about 150 bases of DNA
wrapped around a complex of eight histone proteins, two
each of H2A, H2B, H3, and H4. Histones are not only
structural proteins but can also regulate access of trans TFIID
factors and RNA polymerase to the DNA helix. 3
Modification of histone proteins affects the activity of 5
chromatin-associated proteins and transcription factors
that increase or decrease gene expression. Through these Figure 2-13 Interaction of transcription factors and nucleo-
protein interactions, chromatin can move between tran- some acetylation at the regulatory region of a gene (top)
scriptionally active and transcriptionally silent states. induce assembly of protein factors and RNA polymerase at
Different types of DNA modifications, including methy- the promoter (bottom).
lation, phosphorylation, ubiquitination, and acetylation,
establish a complex system of control. These modifica-
tions create a docking surface that forms an environment The involvement of histone modification with gene
for interaction with other chromatin binding factors and, expression has led to the study of aberrations in these
ultimately, regulatory proteins (Fig. 2-13).34 A collection modifications in disease states such as viral infections
of such architectural and regulatory proteins assembled and neoplastic cells. Thus, analysis of histone states may
on an enhancer element has been termed an enhanceo- be another target for diagnostic, prognostic, and thera-
some.35 peutic applications.
02Buckingham (F)-02 2/6/07 12:28 PM Page 43

RNA Chapter 2 43

DNA Modification
Advanced Concepts DNA methylation is another type of epigenetic regulation
of gene expression in eukaryotes and prokaryotes. In ver-
One theory holds that pre-existing and gene-specific tebrates, methylation occurs in cytosine-guaninerich
histone modifications constitute a histone code that sequences in the DNA (CpG islands) (Fig. 2-14). CpG
extends the information potential of the genetic islands were initially defined as regions !200 bp in
code.67 Accordingly, euchromatin, which is tran- length with an observed/expected ratio of the occurrence
scriptionally active, has more acetylated histones of CpG !0.6.36 This definition may be modified to a
and less methylated histones than transcriptionally more selective GC content to exclude unrelated regions
silent heterochromatin made up of more condensed of naturally high GC content.37 CpG islands are found
nucleosome fibers. Although methylated histones around the first exons, promoter regions, and sometimes
can activate transcription by recruiting histone acety- toward the 3" ends of genes. Aberrant DNA methylation
lases, establishment of localized areas of histone at these sites is a source of dysregulation of genes in dis-
methylation can also prevent transcription by recruit- ease states. Methylation of cytosine residues in the pro-
ing proteins for heterochromatin formation and is moter regions of tumor suppressor genes is a mechanism
one form of gene or transcriptional silencing.68 of inactivation of these genes in cancer.38 Methods to
Transcriptional silencing is responsible for inactiva- analyze promoter methylation have been developed.39,40
tion of the human X chromosome in female embryo Methylation of DNA is the main mechanism of
development and position effects, the silencing of genomic imprinting, the gamete-specific silencing of
genes when placed in heterochromatic areas. genes.41,42 Imprinting maintains the balanced expression
Nucleosome
of genes in growth and embryonic development by selec-
Active tive methylation of homologous genes. This controlled
DNA
methylation occurs during gametogenesis and is different
in male and female gametes. A convenient illustration of
Acetylation imprinting is the comparison of mules and hinnies. A
mule (progeny of a female horse and male donkey) has a
distinct phenotype from that of a hinny (progeny of a
male horse and a female donkey). The difference is due
Inactive
to distinct imprinting of genes inherited through the egg
versus those inherited through the sperm. Genetic dis-
Deacetylation eases in humans, Angelmans syndrome and Prader-Willi
syndrome, are clinically distinct conditions that result
from the same genetic defect on chromosome 15. The
phenotypic differences depend on whether the genetic
Silenced
lesion involves the maternally or paternally inherited
chromosome. Imprinting may be partly responsible for
Methylation abnormal development and phenotypic characteristics of

Methylation
DNA cytosine
GGAGGAGCGCGCGGCGGCGGCCAGAGA
Stably
silenced
AAAGCCGCAGCGGCGCGCGCGCACCCGGA

CAGCCGGCGGAGGCGGG
Deacetylation and methylation of histones can establish Figure 2-14 CpG islands are sequences of DNA rich in the
silenced regions of DNA. C-G dinucleotides. These structures have no specific sequence
other than a higher than expected occurrence of CpG.
02Buckingham (F)-02 2/6/07 12:28 PM Page 44

44 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

cloned animals as the process of cloning by nuclear trans-


fer bypasses gametogenesis.43,44 Advanced Concepts
RNAi RNA interference has been utilized as a method to
Another phenomenon that affects transcription is RNAi. specifically inactivate genes in the research labora-
First discovered in the worm Caenorhabditis elegans in tory. Preferable to gene deletions or knock-out
1993,16,18,45 RNAi is mediated siRNAs.46 The siRNAs methods that take months to inactivate a single gene,
and other proteins assemble into an enzyme complex, RNAi can specifically inactivate several genes in a
called the RNA induced silencing complex (RISC) (Fig. few days.
2-15). The RISC uses the associated siRNA to bind and Initially, this method did not work well in mam-
degrade mRNA with sequences complementary to the malian cells, due to a cellular response elicited by
siRNA. In this way translation of specific genes can be introduction of long dsRNAs that turns off multiple
inhibited. siRNAs may also guide methylases to homolo- genes and promotes cell suicide. Studies with
gous sequences on the chromosome, either through direct shorter dsRNAs, however, have been demonstrated
interaction with the methylating enzymes or by hybridiz- to work in mammalian cell cultures 31. This type of
ing to specific sequences in the target genes, forming a specific gene control in vitro may lead to control cell
bulge in the DNA molecule that attracts methylases. cultures or transcriptional states useful in the clinical
laboratory setting as well as the research laboratory.

Trigger dsRNA

RNAi, however is not always required for DNA methyla-


Dicer
tion.47 Alternatively, siRNAs may bind to specific
sequences in already transcribed homologous RNA, tar-
geting them for degradation into more siRNAs.
siRNA RNAi can also control gene expression during devel-
opment. There are more than 200 regulatory RNAis in
humans. Mice without RNAi function do not survive
long into gestation, emphasizing a key role of this mech-
RISC anism in embryogenesis.
Because of the high specificity of siRNAs, RNAi
5 cap has also been proposed as a manner of gene and viral
therapy.48 Silencing has been targeted to growth-activat-
Target mRNA ing genes such as the vascular endothelial growth factor
in tumor cells. Small interfering RNA silencing may also
be aimed at HIV and influenza viruses. As with other
RISC gene therapy methods, stability and delivery of the thera-
peutic siRNAs are major challenges.

Direct cleavage
STUDY QUESTIONS

RNA Secondary Structure

1. Draw the secondary structure of the following RNA.


Figure 2-15 Trigger double-stranded RNA is cleaved into
siRNAs that become part of the RISC. Led by the complemen- The complementary sequences (inverted repeat) are
tary siRNA sequences, RISC binds to the target RNA and underlined.
begins RNA cleavage.13 5!CAUGUUCAGCUCAUGUGAACGCU 3!
02Buckingham (F)-02 2/6/07 12:28 PM Page 45

RNA Chapter 2 45

2. Underline the rest of the two inverted repeats in by Ehrlich ascites cells. Journal of Biological
the following RNA, then draw the secondary struc- Chemistry 1969;244:131424.
ture. 5. Wickens M, Gonzalez TN. Knives, accomplices and
5!CUGAACUUCAGUCAAGCAUGCACU- RNA. Science 2004;306:1299300.
GAUGCUU 3! 6. Paushkin S, Patel M, Furia BS, et al. Identification
of a human endonuclease complex reveals a link
The Lac Operon between tRNA splicing and pre-mRNA 3!-end
formation. Cell 2004;117:31121.
1. Using the depiction of the lac operon in Figures
7. Perry RP, Kelly DE. Existence of methylated
2-9 and 2-10, indicate whether gene expression
mRNA in mouse L cells. Cell 1974;1:3742.
(transcription) would be on or off under the following
8. Lewin BM. Gene Expression 2: Eucaryotic
conditions:
Chromosomes, 2nd ed. New York: John Wiley
(P = promoter; O = operator; R = repressor)
& Sons, 1980.
a. P" O" R", no inducer present - OFF
9. Amara SG, Jonas V, Rosenfield MG, et al.
b. P" O" R", inducer present - ON
Alternative RNA processing in calcitonin gene
c. P- O" R", no inducer present -
expression generates mRNA encoding different
d. P- O" R", inducer present -
polypeptide products. Nature 1982;298:24044.
e. P" O- R", no inducer present -
10. Toro I, Thore S, Mayer C, et al. RNA binding in an
f. P" O- R", inducer present -
Sm core domain: X-ray structure and functional
g. P" O" R-, no inducer present -
analysis of an archaeal Sm protein complex. EMBO
h. P" O" R-, inducer present -
Journal 2001;20(9):2293303.
i. P- O- R", no inducer present -
11. Mura C, Cascio D, Sawaya MR, et al. The crystal
j. P- O- R", inducer present -
structure of a heptameric archaeal Sm protein:
k. P- O" R-, no inducer present -
Implications for the eukaryotic snRNP core.
l. P- O" R-, inducer present -
Proceedings of the National Academy of Sciences
m. P" O- R-, no inducer present -
2001;98(10):553237.
n. P" O- R-, inducer present -
12. Liu Z, Luyten I, Bottomley MJ, et al. Structural
o. P- O- R-, no inducer present -
basis for recognition of the intron branch site RNA
p. P- O- R-, inducer present -
by splicing factor 1. Science 2001;294:1098101.
13. Adams A. RNAi inches toward the clinic. The
Epigenetics Scientist 2004;March 29, 2004:3235.
1. Indicate whether the following events would increase 14. Hamilton A, Baulcombe D. A species of small anti-
or decrease expression of a gene: sense RNA in posttranscriptional gene silencing in
a. Methylation of cytosine bases 5! to the gene plants. Science 1999;286(5441):95052.
b. Histone acetylation close to the gene 15. Knight S, Bass BL. A role for the RNase III
c. siRNAs complementary to the gene transcript enzyme DCR-1 in RNA interference and germ line
development in Caenorhabditis elegans. Science
2001;293(5538):226971.
References 16. Lee R, Feinbaum RL, Ambros V. The C. elegans
1. Lamond A, Earnshaw WC. Structure and function in heterochronic gene lin-4 encodes small RNAs with
the nucleus. Science 1998;280:54753. antisense complementarity to lin-14. Cell 1993;
2. Tollervey D. Termination by torpedo. Nature 2004; 75(5):84354.
432:45657. 17. Reinhart B, Slack FJ, Basson M, et al. The 21-
3. Weinberg RA, Penman S. Processing of 45S nucleo- nucleotide let-7 RNA regulates developmental tim-
lar RNA. Journal of Molecular Biology 1970;47: ing in Caenorhabditis elegans. Nature 2000;403
16978. (6772):901906.
4. Edmonds M, Caramela MG. The isolation and char- 18. Wightman HI, Ruvkun G. Posttranscriptional regu-
acterization of AMP-rich polynucleotide synthesized lation of the heterochronic gene lin-14 by lin-4
02Buckingham (F)-02 2/6/07 12:28 PM Page 46

46 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

mediates temporal pattern formation in C. elegans. 32. Ryan K, Calvo O, Manley JL. Evidence that
Cell 1993;75(5):85562. polyadenylation factor CPSF-73 is the mRNA 3!
19. Lagos-Quintana M, Rauhut R, Lendeckel W, et al. processing endonuclease. RNA 2004;10(4):56573.
Indentification of novel genes coding for small 33. Dantonel J, Murthy KG, Manley JL, et al. Trans-
expressed RNAs. Science 2001;294:85358. cription factor TFIID recruits factor CPSF for for-
20. Lau NC, Lim LP, Weinstein, EG, et al. An abundant mation of 3! end of mRNA. Nature 1997;389
class of tiny RNAs with probable regulatory roles (6649):399402.
in Caenorhabditis elegans. Science 2001;294: 34. Berger SL. The histone modification circus. Science
85862. 2001;292:6465.
21. Lee RC, Ambros V. An extensive class of small 35. Munshi NT, Agalioti S, Lomvardas M, et al.
RNAs in Caenorhabditis elegans. Science 2001; Coordination of a transcriptional switch by
294:86264. HMGI(Y) acetylation. Science 2001;293:113336.
22. Pfeffer ZM, Grasser FA, Chien M, et al. Identifica- 36. Gardiner-Garden M, Frommer M. CpG islands in
tion of virus-encoded microRNAs. Science 2004; vertebrate genomes. Journal of Molecular Biology
304:73436. 1987;196(2):26182.
23. Ambros V, Lee RC , Lavanway A, et al. 37. Jones D. The role of DNA methylation in mam-
MicroRNAs and other tiny endogenous RNAs in malian epigenetics. Science 2001;293(5532):
C. elegans. Current Biology 2003;13:80718. 106870.
24. Kuwabara T, Hsieh J, Nakashima K, et al. A small 38. Jones PAaL, P. W. Cancer epigenetics comes of
modulatory dsRNA specifies the fate of adult neural age. Nature Genetics 1999;21:16367.
stem cells. Cell 2004;116:77993. 39. Lehmann UB, Hasemeier R, Kreipe H. Quantitative
25. Eliceiri G. Small nucleolar RNAs. Cellular and analysis of promoter hypermethylation in laser-
Molecular Life Sciences 1999;56(1-2):2231. microdissected archival specimens. Laboratory
26. Sunohara T, Jojima K, Yamamoto Y, et al. Nascent- Investigation 2001;81(4):63537.
peptide-mediated ribosome stalling at a stop codon 40. Gonzalgo ML, Bender CM, You EH, et al. Low
induces mRNA cleavage resulting in nonstop frequency of p16/CDKN2A methylation in sporadic
mRNA that is recognized by tmRNA. RNA 2004; melanoma: Comparative approaches for methyla-
10(3):37886. tion analysis of primary tumors. Cancer Research
27. Travers A, Burgess RR. Cyclic reuse of the RNA 1997;57:533647.
polymerase sigma factor. Nature 1969;222: 41. Li E, Beard C, Forster AC, et al. DNA methylation,
53740. genomic imprinting, and mammalian development.
28. Burgess R, Travers AA, Dunn JJ, et al. Factor-stim- Cold Spring Harbor Symposium on Quantitative
ulating transcription by RNA polymerase. Nature Biology 1993;58:297305.
1969;221:4347. 42. Gold J, Pedersen RA. Mechanisms of genomic
29. Dalmay T, Hamilton A, Rudd S, et al. An RNA- imprinting in mammals. Current Topics in Deve-
dependent RNA polymerase gene in Arabidopsis is lopmental Biology 1994;29:22747.
required for posttranscriptional gene silencing 43. Solter D. Lambing by nuclear transfer. Nature
mediated by a transgene but not by a virus. Cell 1996;380(6569):2425.
2000;101(5):54353. 44. Yang L, Chavatte-Palmer P, Kubota C, et al.
30. Dickson K, Thompson SR, Gray NK, et al. Poly Expression of imprinted genes is aberrant in
(A) polymerase and the regulation of cytoplasmic deceased newborn cloned calves and relatively
polyadenylation. Journal of Biological Chemistry normal in surviving adult clones. Molecular
2001;276(45):4181016. Reproduction and Development 2005.
31. Tuschl T, Weber K. Duplexes of 21-nucleotide 45. Fire A, Xu S, Montgomery MK, et al. Potent and
RNAs mediate RNA interference in cultured specific genetic interference by double-stranded
mammalian cells. Nature 2001;411(6836): RNA in Caenorhabditis elegans. Nature 1998;391
49498. (6669):80611.
02Buckingham (F)-02 2/6/07 12:28 PM Page 47

RNA Chapter 2 47

46. Matzke M, Kooter JM. RNA: Guiding gene silenc- 60. Lindell TJ, Weinber F, Morris PW, et al. Specific
ing. Science 2001;293:108083. inhibition of nuclear RNA polymerase by amanitin.
47. Freitag M, Lee DW, Kothe GO, et al. DNA methy- Science 1970;170:44748.
lation is independent of RNA interference in 61. Lee Y, Kim M, Han J, et al. MicroRNA genes are
Neurospora. Science 2004;304:1939. transcribed by RNA polymerase II. EMBO Journal
48. Wall N, Shi Y. Small RNA: Can RNA interference 2004;23(20):405160.
be exploited for therapy? Lancet 62. Bird G, Zorio DA, Bentley DL. RNA polymerase II
2003;362:1401403. carboxy-terminal domain phosphorylation is
49. Perbal B. A Practical Guide to Molecular Cloning, required for cotranscriptional pre-mRNA splicing
2nd ed. New York: John Wiley & Sons, 1988. and 3!-end formation. Molecular and Cellular
50. Yusupov M, Yusupova GZH, Baucom A, et al. Biology 2004;24(20):896369.
Crystal structure of the ribosome at 5.5A resolution. 63. Gong X, Nedialkov YA, Burton ZF. Alpha-amanitin
Science 2001;292:88396. blocks translocation by human RNA polymerase
51. Ogle JM, Brodersen DE, Clemons WM Jr.et al. II. Journal of Biological Chemistry 2004;279(26):
Recognition of cognate transfer RNA by the 30S 2742227.
ribosomal subunit. Science 2001;292:897902. 64. Cramer P, Bushnell DA, Kornberg R. Structural
52. Milcarek CR. The metabolism of a poly(A) basis of transcription: RNA polymerase II at
minus mRNA fraction in HeLa cells. Cell 2.8 angstrom resolution. Science 2001;292:
1974;3:110. 186376.
53. Both GW, Furuichi Y, Muthukrishman S, et al. 65. Gnatt AL, Cramer P, Fu J, et al. Structural basis of
Effect of 5! terminal structure and base composi- transcription: An RNA polymerase II elongation
tion on polyribonucleotide binding to ribosomes. complex. Science 2001;292:187681.
Journal of Molecular Biology 1975;104:63758. 66. Linder P. The life of RNA with proteins. Science
54. Novina C, Sharp PA. The RNAi revolution. Nature 2004;304:69495.
2004;430:16164. 67. Jenuwein T. Translating the histone code. Science
55. Sum E, Segara D, Duscio B, et al. Overexpression 2001;293:107479.
of LMO4 induces mammary hyperplasia, promotes 68. Bird A. Methylation talk between histones and
cell invasion, and is a predictor of poor outcome in DNA. Science 2001;294:211315.
breast cancer. Proceedings of the National Academy 69. Tilghman SM, Tiemeier DC, Seidman JG, et al.
of Sciences 2005. Intervening sequence of DNA identified in the
56. Calderon A, Lavergne JA. RNA interference: structural portion of a mouse #-globin gene.
A novel and physiologic mechanism of gene Proceedings of the National Academy of Sciences
silencing with great therapeutic potential. 1978;75:72529.
Puerto Rico Health Sciences Journal 2005; 70. White R, Hogness DS. R loop mapping of the 18S
24(1):2733. and 28S sequences in the long and short repeating
57. Lehninger A. Principles of Biochemistry. New units of D. melanogaster rDNA. Cell 1977;10:
York: Worth Publishers, 1982. 17792.
58. Roeder R, Rutter WJ. Specific nucleolar and 71. Holley RW. The nucleotide sequence of a nucleic
nucleoplasmic RNA polymerases. Proceedings acid. San Francisco: Freeman, 1968.
of the National Academy of Sciences 1970;65: 72. Monod J, Cozen-Bizare G. L!effect d!inhibition
67582. specifique dans la biosynthese de la tryptophane-
59. Jacob ST, Sajdel EM, Munro HN. Different desmase chez Aerobacter aerogenes. Comptes
responses of soluble whole nuclear RNA poly- Rendus de l!Academie des Sciences 1953;236:
merase and soluble nucleolar RNA polymerase at 53032.
divalent cations and to inhibition by "-amanitin. 73. Jacob F, Monod J. Genetic regulatory mechanisms
Biochemical Biophysical Research Communications in the synthesis of proteins. Journal of Molecular
1970;38:76570. Biology 1961;3:31856.
03Buckingham (F)-03 2/6/07 12:20 PM Page 48

Chapter 3 Lela Buckingham

Proteins

OUTLINE OBJECTIVES
AMINO ACIDS Describe the structure and chemical nature of the 20
GENES AND THE GENETIC CODE amino acids.
The Genetic Code Show how the chemistry of the amino acids affects the
TRANSLATION chemical characteristics and functions of proteins.
Amino Acid Charging
Protein Synthesis Define primary, secondary, tertiary, and quaternary
structure of protein organization.
Give the definition of a gene.
Recount how the genetic code was solved.
Describe how amino acids are polymerized into proteins,
using RNA as a guide (translation).

48
03Buckingham (F)-03 2/6/07 12:20 PM Page 49

Proteins Chapter 3 49

Proteins are the products of transcription and translation


Table 3.1 Classification of Amino Acids Based
of the nucleic acids. Even though nucleic acids are most on Polarity of Their Side Chains
often the focus of molecular analysis, the ultimate effect
Classification Amino Acid Abbreviations
of the information stored and delivered by the nucleic
acid is manifested in proteins. Analysis of the amount Nonpolar Alanine Ala, A
and mutational status of specific proteins has long been Isoleucine Ile, I
performed in situ using immunohistochemistry, on live Leucine Leu, L
cells using flow cytometry, and on isolated proteins by Methionine Met, M
Western blots. More recently, global protein analysis by Phenylalanine Phe, F
mass spectrometry (proteomics) has been applied to clin- Tryptophan Trp, W
ical work on a research basis. Even if proteins are not Valine Val, V
being tested directly, they manifest the phenotype Polar Asparagine Asn, N
directed by the nucleic acid information. In order to inter- Cysteine Cys, C
pret results of nucleic acid analysis accurately, therefore, Glutamine Gln, Q
it is important to understand the movement of genetic Glycine Gly, G
information from DNA to protein as dictated by the Proline Pro, P
genetic code. Serine Ser, S
Threonine Thr, T
Tyrosine Tyr, Y
Amino Acids Negatively charged Aspartic acid Asp, D
Proteins are polymers of amino acids. Each amino acid (acidic) Glutamic acid Glu, E
has characteristic biochemical properties determined by Positively charged Arginine Arg. R
the nature of its amino acid side chain (Fig. 3-1). Amino (basic) Histidine His, H
acids are grouped according to their polarity (tendency Lysine Lys, K
to interact with water at pH 7) as follows: nonpolar,
uncharged polar, negatively-charged polar, and positively-
charged polar (Table 3.1). thetic precursor (Table 3.2). Histidine has a unique syn-
The properties of amino acids that make up a protein thetic pathway using metabolites common with purine
determine the shape and biochemical nature of the pro- nucleotide biosynthesis, which affords connection of
tein, such as highly charged, hydrophilic, or hydropho- amino acid synthesis with nucleotide synthesis.
bic. A single protein can have separate domains with At pH 7, most of the carboxyl groups of the amino
different properties. For example, transmembrane pro- acids are ionized, and the amino groups are not. The ion-
teins might have several stretches of hydrophobic amino ization can switch between the amino and carboxyl
acids that will sit in the lipid membrane of the cell; they groups, making the amino acids zwitterions at physio-
might also have hydrophilic or charged extracellular logical pH (Fig. 3-3). At a specific pH, amino acids will
domains (Fig. 3-2). become completely positively or negatively charged.
Amino acids are synthesized in vivo by stereospecific These are the pK values. At the pH where an amino acid
enzymes so that naturally occurring proteins are made of is neutral, its positive and negative charges are in balance.
amino acids of L-stereochemistry. The central asymmet- This is the pI value. Each amino acid will have its char-
ric carbon atom is attached to a carboxyl group, an amino acteristic pI. The pI of a peptide or protein is determined
group, a hydrogen atom, and the side chain. Proline dif- by the ionization state (positive and negative charges) of
fers somewhat from the rest of the amino acids in that its the side chains of its constituent amino acids.
side chain is cyclic, the amino group attached to the end The amino and carboxyl terminal groups of the amino
carbon of the side chain making a five-carbon ring (see acids are joined in a carbon-carbon-nitrogen (-C-C-N-)
Fig. 3-1). substituted amide linkage (peptide bond) to form the
Amino acids are also classified by their biosynthetic protein backbone (Fig. 3-4). Two amino acids joined
origins or similar structures based on a common biosyn- together by a peptide bond make a dipeptide. Peptides
03Buckingham (F)-03 2/6/07 12:20 PM Page 50

Charged R groups
H H H H H
+ + +
H3N
+
C COO H3N
+
C COO H3N C COO H3N C COO H3N C COO

CH2 CH2 CH2 CH2 CH2


+
CH2 CH2 COO CH2 C NH

CH2 CH
CH2 COO
HC NH
NH
CH2
+
+NH C NH2
3
NH2

Lysine Arginine Aspartic acid Glutamic acid Histidine


(Lys) (Arg) (Asp) (Glu) (His)

Polar R groups

H H H H H H
+ + + + +
H3N C COO H3N C COO H3N C COO H3N C COO +
H3N C COO H2N C COO

CH2OH H C OH CH2 CH2 CH2 H2C CH2


CH3 SH C CH2 CH2

H2N O C
H2N O

Serine Threonine Cysteine Asparagine Glutamine Proline


(Ser) (Thr) (Cys) (Asn) (Gln) (Pro)

Nonpolar R groups
H H H H H H
+ + + +
H3N C COO H3N C COO H3N C COO H3N C COO H3N
+
C COO H3N
+
C COO

H CH3 CH CH2 CH2 H C CH3


H3C CH3 CH2 CH CH2
S H3C CH3 CH3
CH3
Glycine Alanine Valine Methionine Leucine Isoleucine
(Gly) (Ala) (Val) (Met) (Leu) (Ile)

Aromatic R groups
H H H
+ + +
H3N C COO H3N C COO H3N C COO

CH2 CH2 CH2

C CH
NH

OH

Phenylalanine Tyrosine Tryptophan


(Phe) (Tyr) (Trp)

Figure 3-1 Structures of the 20 amino acids. The side chains are grouped according to their chemical characteristics.

50
03Buckingham (F)-03 2/6/07 12:20 PM Page 51

Proteins Chapter 3 51

Outside of cell Table 3.2 Amino Acid Biosynthetic Groups


Biosynthetic Group Precursor Amino Acids
Extracellular domains "-Ketoglutarate group "-Ketoglutarate Gln, Q
Glu, E
Cell membrane Pro, P
Arg. R
Pyruvate group Pyruvate Ala, A
Val, V
Leu, L
Oxalate group Oxalacetic acid Asp, D
Asn, N
Intracellular domains Lys, Q
Transmembrane domains
Ile, I
Inside of cell
Thr, T
Met, M
Figure 3-2 Transmembrane proteins have hydrophobic Serine group 3-Phosphoglycerate Gly, G
transmembrane domains and hydrophilic domains exposed
Ser, S
to the intracellular and extracellular spaces. The biochemical
nature of these domains results from their distinct amino acid
Cys, C
compositions. Aromatic group Chorismate Phe, F
Trp, W
Tyr, Y
with additional units are tri-, tetra-, pentapeptides, and so (Unique biosynthesis) His, H
forth, depending on how many units are attached to each
other. At one end of the peptide will be an amino group
(the amino terminal or NH2 end), and at the opposite that will ultimately bring about the genetically coded
terminus of the peptide will be a carboxyl group (the car- phenotype.
boxy terminal or COOH end). Like the 5! to 3! direction The collection of proteins produced by a genome is a
of nucleic acids, peptide chains grow from the amino to proteome. The proteome of humans is larger than the
the carboxy terminus. genome, possibly 10 times its size.1 This is because a sin-
Proteins are polypeptides that can reach sizes of more gle gene can give rise to more than one protein through
than a thousand amino acids in length. Proteins constitute alternate splicing and other post-transcriptional/post-
the most abundant macromolecules in cells. The infor- translational modifications.
mation stored in the sequence of nucleotides in DNA is The sequence of amino acids in a protein determines
transcribed and translated into an amino acid sequence the nature and activity of that protein. This sequence is
the primary structure of the protein and is read by con-
vention from the amino terminal end to the carboxy ter-
minal end. Minor changes in the primary structure can
Advanced Concepts alter the activity of proteins dramatically. The single
An unusual 21st amino acid, selenocysteine, is a amino acid substitution that produces hemoglobin S in
component of selenoproteins such as glutathione
peroxidase and formate dehydrogenase. There are O O O
25 known mammalian selenoproteins. Selenocys- R pK1 R pK2 R
teine is cysteine with the sulfur atom replaced by OH O O
selenium.31 Selenocysteine is coded by a predefined +
NH3 +
NH3 NH2
UGA codon that inserts selenocysteine instead of a Figure 3-3 An amino acid is positively charged at pK1 and
termination signal. negatively charged at pK2. At the pH where the positive and
negative charges balance (pI), the molecule is neutral.
03Buckingham (F)-03 2/6/07 12:20 PM Page 52

52 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Advanced Concepts Historical Highlights


Peptides can have biological activity. Hormones The primary sequence of proteins can be determined
such as insulin, glucagons, corticotropin, oxytocin, by a method first described in the report of the
bradykinin, and thyrotropin are examples of pep- amino acid sequence of insulin by Fred Sanger.38,39
tides (9-40 amino acids long) with strong biological This procedure was carried out in six steps. First, the
activity. Several antibiotics such as penicillin and protein was dissociated to amino acids. The dissoci-
streptomycin are also peptides. ation products were separated by ion exchange chro-
matography in order to determine the type and
amount of each amino acid. Second, the amino ter-
sickle cell anemia is a well-known example. Replacement minal and carboxy terminal amino acids were deter-
of a soluble glutamine residue with a hydrophobic valine mined by labeling with 1-fluoro-2,4-dinitrobenzene
at the sixth residue changes the nature of the protein so and digestion with carboxypeptidase, respectively.
that it packs aberrantly in corpuscles and drastically alters The complete protein was then fragmented selec-
cell shape. Minor changes in primary structure can have tively at lysines and arginines with trypsin to 1015
such drastic effects because the amino acids must often amino acid peptides. Fourth, Edmund degradation
cooperate with one another to bring about protein struc- with phenylisothiocyanate and dilute acid labeled
ture and function. and removed the amino terminal residue. This was
repeated on the same peptide until all the amino
acids were identified. Fifth, after another selected
Amino acid 1 Amino acid 2 cleavage of the original protein using cyanogen bro-
H O
mide, chymotrypsin, or pepsin and identification of
H R1 the peptides by chromatography, the peptides were
+ C O + N C H again sequenced using the Edmund degradation.
H3N C H H C O
H R2 Sixth, the complete amino acid sequence could be
O assembled by identification of overlapping regions.
H2O

H R1 Interactions between amino acid side chains fold a


H O
+ C protein into predictable configurations. These include
H3N C N C H ordered beta or beta-pleated sheets and less ordered
C O
O H R2 alpha helices or random coils. The alpha helix and beta
sheet structures in proteins (Fig. 3-5) were first described
Peptide bond
by Linus Pauling and Robert Corey in 1951.2-5 This level
+ amino acid 3

H2O Advanced Concepts


Protein sequence can be inferred from DNA
H R1 H O H R3 sequence, although the degeneracy of the genetic
+ C C O code will result in several possible protein sequences
H3N C N C N C H
C for a given DNA sequence. Many databases are
O H R2 H O available on the frequency of codon usage in various
Figure 3-4 The peptide bond is a covalent linkage of the
organisms.32-34 These can be used to predict the cor-
carboxyl C of one amino acid with the amino N of the next rect amino acid sequence.
amino acid. One molecule of water is released in the reaction.
03Buckingham (F)-03 2/6/07 12:20 PM Page 53

Proteins Chapter 3 53

of organization is the secondary structure of the protein. The secondary structures of proteins are further folded
Some proteins, especially structural proteins, consist and arranged into a tertiary structure. Tertiary structure
almost entirely of alpha helices or beta sheets. Globular is important for protein function. If a protein loses its ter-
proteins have varying amounts of alpha helix and beta tiary structure, it is denatured. Mutations in DNA that
sheets. substitute different amino acids in the primary structure

Advanced Concepts
Specialized secondary structures can identify func- tion such that the leucine side chains radiate out-
tions of proteins. Zinc finger motifs are domains wardly to facilitate association with other peptides
frequently found in proteins that bind to DNA. of similar structure. Because other amino acids
These structures consist of two beta sheets followed besides leucine can participate in this interaction,
by an alpha helix with a stabilizing zinc atom. There the term basic zipper, or bZip, has been used to
are three types of zinc fingers, depending on the describe this type of protein structure. Another sim-
arrangement of cysteine residues in the protein ilar structure found in transcriptional regulators is
sequence. Another example of specialized second- the helix loop helix.36 This motif consists of basic
ary structure is the leucine zipper, also found in amino acids that bind consensus DNA sequences
transcription factors.35 This conserved sequence has (CANNTG) of target genes. This structure is some-
a leucine or other hydrophobic residue at each sev- times confused with the helix turn helix. The helix
enth position for approximately 30 amino acids. The turn helix is two alpha helices connected by a short
sequence is arranged in an alpha helical conforma- sequence of amino acids. This structure can easily
fit into the major groove of DNA.
His
HOOC

+ Cys
Zn2

Cys
His

H2N

3-1 Zinc finger motif of the Sp1 protein, a eukaryotic tran-


scription regulator. The side chains of histidine (H) and cys- 3-2 The lambda repressor, a transcription factor of the
teine (C), part of the zinc finger amino acid sequence, bacteriophage lambda, has a helix turn helix motif. One
C-X 2-4-C-X3-F-X5-L-X2-H-X3-H (~23 amino acids), bind a Zn of each of the helices fits into the major groove of the
atom in the active protein. Sp1 binds DNA in the regulatory DNA. Lambda repressor prevents transcription of genes
region of genes. Note: For single-letter amino acid code, necessary for active growth of the bacteriophage lead-
see Figure 3-7. X in this consensus denotes any amino acid. ing to host cell lysis.
03Buckingham (F)-03 2/6/07 12:20 PM Page 54

54 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

prosthetic group. Examples of conjugated proteins are


those covalently attached to lipids (lipoproteins), e.g.,
low density lipoproteins; sugars (glycoproteins), e.g.,
mucin in saliva; and metal atoms (metalloproteins),
e.g., ferritin. One of the most familiar examples of a con-
jugated protein is hemoglobin. Hemoglobin is a tetramer
with four Fe2!-containing heme groups, one covalently
attached to each monomer.

Genes and the Genetic Code


A gene is defined as the ordered sequence of nucleotides
(A) Helix (B) Pleated sheet
on a chromosome that encodes a specific functional prod-
Figure 3-5 Secondary structure of proteins includes the uct. A gene is the fundamental physical and functional
alpha helix (A) and the beta pleated sheet (B). The ribbon- unit of inheritance. The physical definition of a gene was
like structures in the pictures are composed of chains of
complicated in early texts because of the methods used to
amino acids hydrogen-bonded through their side chains.
define units of genetic inheritance. Genes were first stud-
ied by tracking mutations that took away their function.
can also alter tertiary structure. Denatured or improperly A gene was considered that part of the chromosome
folded proteins are not functional. Proteins are also dena- responsible for the function affected by mutation. Genes
tured by heat, e.g., the albumin in egg white, or by con- were not delineated well in terms of their physical size
formations forced on innocuous peptides by infectious but were mapped relative to each other based on the fre-
prions. Aggregations of prion-induced aberrantly folded quency of recombination between them.
proteins cause transmissible spongiform encephalo- In the early 1960s, Seymour Benzer6,7 used the T4 bac-
pathies such as Creutzfeldt-Jakob disease and bovine teriophage to investigate the gene more closely. By mix-
spongiform encephalitis (mad cow disease). ing phage with several different phenotypes, he could
As previously mentioned, proteins often associate with observe the complementation of one mutant for another.
other proteins in order to function. Two proteins bound Benzer could distinguish mutations that could comple-
together to function form a dimer, three a trimer, four a ment each other, even though they affected the same phe-
tetramer, and so forth. Proteins that work together in this notype and mapped to the same locus. He determined
way are called oligomers, each component protein being that these were mutations in different places within the
a monomer. This is the quaternary structure of pro- same gene. He organized many mutants into a series of
teins. The combinatorial nature of protein function may sites along the linear array of the phage chromosome so
account for genetic complexity of higher organisms with- that he could structurally define the gene as a continuous
out concurrent increase in gene number. linear span of genetic material.
Proteins are classified according to function as We know now that a gene contains not only structural
enzymes and transport, storage, motility, structural, sequences that code for an amino acid sequence but also
defense, or regulatory proteins. Enzymes and transport, regulatory sequences that are important for the regu-
defense, and regulatory proteins are usually globular in lated expression of the gene (Fig. 3-6). Cells expend
nature, making them soluble and allowing them to diffuse much energy to coordinate protein synthesis so that the
freely across membranes. Structural and motility pro- proper proteins are available at specific times and in spe-
teins, such as myosin, collagen, and keratin, are fibrous cific amounts. Loss of this controlled expression will
and insoluble. result in an abnormal phenotype, even though there may
In contrast to simple proteins that have no other com- be no mutation in the structural sequence of the gene.
ponents except amino acids, conjugated proteins do Lack of appreciation for the importance of proximal and
have components other than amino acids. The nonprotein distal regulatory sequences was another source of confu-
component of a conjugated protein is the nonprotein sion in early efforts to define a gene. Regulatory effects
03Buckingham (F)-03 2/6/07 12:20 PM Page 55

Proteins Chapter 3 55

Regulatory Structural Regulatory Early on, scientists had surmised the triplet nature of
sequence Promoter sequence sequence the code based on mathematical considerations. It was
5 PO OH 3
3 HO
reasoned that the smallest set of 4 possible letters that
OP 5
DNA would yield enough unique groups to denote 20 different
amino acids was 3. A 1-nucleotide code could only
Figure 3-6 A gene contains not only structural (coding) account for 4 different amino acids, whereas a 2-
sequences but also sequences important for regulated tran- nucleotide code would yield just 16 different possibilities.
scription of the gene. These include the promoter, where
RNA polymerase binds to begin transcription, and regulatory
A 3-nucleotide code would give 64 different possibilities,
regions, where transcription factors and other regulatory enough to account for all 20 amino acids.
factors bind to stimulate or inhibit transcription by RNA The next challenge was to decipher the triplet code and
polymerase. to prove its function. The simplest way to prove the code
would have been to determine the sequence of
nucleotides in a stretch of DNA coding for a protein and
and the interaction between proteins still challenge inter-
compare it with the protein sequence. In the early 1960s,
pretation of genetic analyses in the clinical laboratory.
protein sequencing was possible, but only limited DNA
sequencing was available. Marshall Nirenberg made the
The Genetic Code initial attempts at the code by using short synthetic DNA
sequences to support protein synthesis in a cell-free
The nature of a gene was further clarified with the deci-
extract of Escherichia coli. In each of 20 tubes he mixed
phering of the genetic code by Francis Crick, Marshall
a different radioactive amino acid, cell lysate from E.
Nirenberg, Philip Leder, Gobind Khorana, and Sydney
coli, and an RNA template. In the first definitive experi-
Brenner.8-10 The genetic code is not information in itself
ment, the input template was a polymer of uracil, UUU-
but is a dictionary to translate the four-nucleotide se-
UUUU. If the input template supported synthesis of
quence information in DNA to the 20amino acid
protein, the radioactive amino acid would be incorpo-
sequence information in proteins.
rated into the protein and the radioactivity detected in a
precipitable protein extract from the mixture. On May 27,
1961, Nirenberg measured radioactive protein levels
Historical Highlights from all but 1 of the 20 vials at around 70 counts/mg. The
vial containing phenylalanine yielded protein of 38,000
The interesting history of the breaking of the genetic counts/mg. After the first demonstration of success of this
code began with a competitive scramble. A physicist strategy, other templates were tested. Each synthetic
and astronomer, George Gamow, organized a group nucleic acid incorporated different amino acids, based on
of scientists to concentrate on the problem. They the composition of bases in the RNA sequence. Codes for
called themselves the RNA Tie Club. Each of the 20 phenylalanine (UUU), proline (CCC), lysine (AAA), and
members wore a tie emblazoned with a depiction of glycine (GGG) were soon deduced from the translation
RNA and a pin depicting a different amino acid. The of nucleic acids synthesized from a single nucleotide
club members were William Astbury, Oswald Avery, population. More of the code was indirectly deduced
Sir William Laurence Bragg, Erwin Chargaff, using mixtures of nucleotides at different proportions.
Martha Chase, Robert Corey, Francis Crick, Max For instance, an RNA molecule synthesized from a 2:1
Delbruck, Jerry Donohue, Rosalind Franklin, Bruce mixture of U and C polymerized mostly phenylalanine
Fraser, Sven Furgerg, Alfred Hershey, Linus Pauling, and leucine into protein. Similar tests with other
Peter Pauling, Max Perutz, J.T. Randall, Verner nucleotide mixtures resulted in distinct amino acid incor-
Schomaker, Alexander R. Todd, James Watson, and porations. Although each RNA molecule in these tests
Maurice Wilkins. This group met regularly during was of known composition of nucleotides, the exact order
the 1950s but did not exclusively break the genetic of nucleotides in the triplet was not known.
code. Nirenberg and Leder used another technique to get at
the basic structure of the code. They observed binding of
03Buckingham (F)-03 2/6/07 12:20 PM Page 56

56 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

specific amino acids to RNA triplets in ribosome-tRNA Triplets coding for the same amino acid are similar,
mixtures. By noting which triplet/amino acid combina- mostly differing only in the third base of the triplet. Crick
tion resulted in binding of the amino acid to ribosomes, first referred to this as wobble in the third position.11
they were able to assign 50 of the 64 triplets to specific Wobble is also used to describe movement of the base in
amino acids. the third position of the triplet to form novel pairing
Meanwhile, Gobind Khorana had developed a system between the carrier tRNA and the mRNA template dur-
to synthesize longer polymers of known nucleotide ing protein translation. Recent investigations have
sequence. With polynucleotides of repeated sequence, he revealed that wobble may affect the severity of disease
could predict and then observe the peptides that would phenotype.12
come from the known sequence. For example, a polymer All amino acids except leucine, serine, and arginine
consisting of two bases such as ...UCUCUCUCUCU- are selected by the first two letters of the genetic code.
CUC... was expected to code for a peptide of two differ- The first two letters, however, do not always specify
ent amino acids, one coded for by UCU and one by CUC. unique amino acids. For example, CA starts the code for
This polymer yielded a peptide with the sequence ...Ser- both histidine and glutamine. Three codons, UAG, UAA,
Leu-Ser-Leu.... This experiment did not tell which triplet and UGA, that terminate protein synthesis are termed
coded for which amino acid, but combined with the nonsense codons. UAG, UAA, and UGA were named
results from Nirenberg and Leder, the UCU was assigned amber, ocher, and opal, respectively, when they were
to serine and CUC to leucine. first defined in bacterial viruses.
By 1965, all 64 triplets, or codons, were assigned to The characteristics of the genetic code have conse-
amino acids (Fig. 3-7). Once the code was confirmed, quences for molecular analysis. Mutations or changes in
specific characteristics of it were apparent. The code is the DNA sequence will have different effects on pheno-
redundant, so that all but two amino acids (methionine type depending on the resultant changes in the amino
and tryptophan) are coded for by more than one codon. acid sequence. Accordingly, mutations range from silent

Second position of codon


U C A G
UUU UAU UGU U
UCU Tyrosine
UUC Phenylalanine UCC UAC UGC Cysteine C
U Serine
UUA UCA UAA Ter (end) UGA Ter (end) A
Leucine UCG
UUG UAG Ter (end) UGG Tryptophan G

CAU U
CUU CCU Histidine CGU
CUC CCC CAC CGC C
C Leucine Proline Arginine
CUA CCA CGA Third position
First position

CAA A
CUG CCG CAG Glutamine CGG
G
AUU AAU AGU U
ACU Serine
AUC Isoleucine ACC AAC Asparagine AGC C
A AUA Threonine
ACA AAA AGA A
AUG Methionine ACG AAG Lysine AGG Arginine G
GAU Aspartic U
GUU GCU GGU
GUC GCC GAC acid GGC C
G Valine Alanine Glycine
GUA GCA GAA Glutamic GGA A
GUG GCG GAG GGG
acid G

Figure 3-7 The genetic code. Codons are read as the nucleotide in the left column, then the
row at the top, and then the right column. Note how there are up to six codons for a single amino
acid. Only methionine and tryptophan have a single codon. Note also the three termination
codons (ter), TAA, TAG, and TGA.
03Buckingham (F)-03 2/6/07 12:20 PM Page 57

Proteins Chapter 3 57

into proteins. Through the genetic code, specific nucleic


Advanced Concepts acid sequence is translated to amino acid sequence and,
ultimately, to phenotype.
The UGA codon also codes for selenocysteine. Protein synthesis starts with activation of the amino
Selenoproteins have UGA codons in the middle of acids by covalent attachment to tRNA, or tRNA charg-
their coding regions. In the absence of selenium, ing, a reaction catalyzed by 20 aminoacyl tRNA syn-
protein synthesis stops prematurely in these genes. thetases. The Mg!!-dependent charging reaction was
first described by Hoagland and Zamecnik, who observed
that amino acids incubated with ATP and the cytosol frac-
to drastic in terms of their effects on phenotype. This will tion of liver cells became attached to heat-soluble RNA
be discussed in more detail in later chapters. (tRNA).15 The reaction takes place in two steps. First, the
An interesting observation about the genetic code is amino acid is activated by addition of AMP:
that, with limited exceptions, the repertoire of amino amino acid ! ATP aminoacyl-AMP ! PPi
acids is limited to 20 in all organisms, regardless of grow- Second, the activated amino acid is joined to the tRNA:
ing environments. Thermophilic and cryophilic organ- aminoacyl-AMP ! tRNA
isms adapt to growth at 100oC and freezing temperatures, aminoacyl-tRNA ! AMP
respectively, not by using structurally different amino The product of the reaction is an ester bond between
acids but by varying the combinations of the naturally the 3" hydroxyl of the terminal adenine of the tRNA and
occurring amino acids. As will be discussed in the next the carboxyl group of the amino acid.
section, cells have strict control and editing systems to There are 20 amino acyl tRNA synthetases, one for
protect the genetic code and avoid incorporation of unnat- each amino acid. Designated into two class I and class II
ural amino acids into proteins. Recent studies have shown synthetases, these enzymes interact with the minor or
that it is possible to manipulate the genetic code to incor- major groove of the tRNA acceptor arm, respectively.
porate modified amino acids.13,14 The ability to introduce Both classes also recognize tRNAs by their anticodon
chemically or physically reactive sites into proteins in sequences and amino acids by their side chains. Only the
vivo has significant implications in biotechnology. appropriate tRNA and amino acid will fit into its cognate
synthetase (Fig. 3-8). An errant amino acid bound to the
Translation wrong synthetase will dissociate rapidly before any con-
formation changes and charging can occur. In another
Amino Acid Charging level of editing, mischarged aminoacylated tRNAs are
After transcription of the sequence information in DNA hydrolyzed at the point of release from the enzyme. The
to RNA, the transcribed sequence must be transferred fidelity of this system is such that mischarging is 103106
less efficient than correct charging.16

Protein Synthesis
Advanced Concepts Translation takes place on ribosomes, small ribonucleo-
According to evolutionary theory, the genetic code protein particles first observed by electron microscopy of
has evolved over millions of years of selection. An animal cells. In the early 1950s, Zamecnik demonstrated
interesting analysis was done to compare the natural by pulse labeling that these particles were the site of pro-
genetic code shared by all living organisms with tein synthesis in bacteria.17 There are about 20,000 ribo-
millions of other possible triplet codes (4 nucleo- somes in an E. coli cell, making up almost 25% of the
tides coding for 20 amino acids) generated by com- cells dry weight. Ribosomal structure is similar in
puter.37 The results showed that the natural code was prokaryotes and eukaryotes (see Fig. 2-3). In prokary-
significantly more resistant to damaging changes otes, 70S ribosomes are assembled from a 30S small sub-
(mutations in the DNA sequence) compared with unit and a 50S large subunit, in association with mRNA
the other possible codes. and initiating factors (S stands for sedimentation units in
density gradient centrifugation, a method used to deter-
03Buckingham (F)-03 2/6/07 12:20 PM Page 58

58 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

somes are slightly larger (80S) and more complex with a


Advanced Concepts 40S small subunit (1.3 million daltons) and a 60S subunit
(2.7 million daltons). The 40S subunit is made up of an
Once the amino acid is esterified to the tRNA, it 18S rRNA and about 30 ribosomal proteins. The 60S
makes no difference in specificity of its addition to subunit contains a 5S rRNA, a 5.8S rRNA, a 28S rRNA,
the protein. The fidelity of translation is now deter- and about 40 ribosomal proteins.
mined by the anticodon (complementary three bases Protein synthesis in the ribosome almost always starts
to the amino acid codon) of the tRNA as an adaptor with the amino acid methionine in eukaryotes and N-
between mRNA and the growing protein. This asso- formylmethionine in bacteria, mitochondria, and chloro-
ciation has been exploited by attaching amino acids plasts. Initiating factors that participate in the formation
synthetically to selected tRNAs. If amino acids of the ribosome complex differentiate the initiating
attached are to tRNAs carrying anticodons to UAG, methionyl tRNAs from those that add methionine inter-
UAAm or UGA, the peptide chain will continue to nally to the protein.
grow instead of terminating at the stop codon. These In protein translation, the small ribosomal subunit first
tRNAs are called suppressor tRNAs as they can binds to initiation factor 3 (IF-3) and then to specific
suppress point mutations that generate stop codons sequences near the 5! end of the mRNA, the ribosomal
within a protein coding sequence. binding site. This guides the AUG codon (the start
codon) to the proper place in the ribosomal subunit.
Another initiation factor, IF-2 bound to GTP and the ini-
tiating tRNAMet or tRNAfMet, then joins the complex
mine sizes of proteins and protein complexes). The 30S
(Fig. 3-9). The large ribosomal subunit then associates
subunit (1 million daltons) is composed of a 16S riboso-
coordinate with the hydrolysis of GTP and release of
mal RNA (rRNA) and 21 ribosomal proteins. The 50S
GDP and phosphate, IF-2 and IF-3. The resulting func-
subunit (1.8 million daltons) is composed of a 5S rRNA,
tional 70S or 80S ribosome is the initiation complex. In
a 23S rRNA, and 34 ribosomal proteins. Eukaryotic ribo-
this complex, the tRNAMet or tRNAfMet is situated in the
peptidyl site (P site) of the functional ribosome. tRNAMet
or tRNAfMet can only bind to the P site in the ribosome,
which is formed in combination by both ribosomal sub-
Amino acyl-tRNA synthetase
units. In contrast, all other tRNAs bind to an adjacent
site, the aminoacyl site (A site) of the ribosome.
tRNA
Synthesis proceeds in the elongation step where the
Ile
Val tRNA carrying the next amino acid binds to the A site of
the ribosome in a complex with elongation factor Tu (EF-
Tu) and GTP (Fig. 3-10). The fit of the incoming tRNA
takes place by recognition and then proofreading of the
Gln codon-anticodon base pairing. Hydrolysis of GTP by EF-
Phe Tu occurs between these two steps.18 The EF-Tu-GDP is
released, and the EF-Tu-GTP is regenerated by another
elongation factor, EF-Ts. Although these interactions
ensure the accurate paring of the first two codon posi-
Thr tions, the pairing at the third position is not as stringent,
which accounts for the wobble in the genetic code.19
The first peptide bond is formed between the amino
acids in the A and P sites by transfer of the N-formylme-
Figure 3-8 Five amino acyl tRNA synthetases. Each
enzyme is unique for a tRNA (shown in green) and its match- thionyl group to the amino group of the second amino
ing amino acid. The specificity of these enzymes is key to the acid, leaving a dipeptidyl-tRNA in the A site. This step is
fidelity of translation. catalyzed by an enzymatic activity in the large subunit,
03Buckingham (F)-03 2/6/07 12:20 PM Page 59

Proteins Chapter 3 59

Amino
acid

Ribosomal subunits
tRNA

5
mRNA 3
Components

Initiation

Recycling

5 Amino acid
3
tRNA

Elongation
Polypeptide Termination

5 5
3 3

Polypeptides More ribosomes


First ribosome attach to the 5
reaches termination end of mRNA
codon

5 3
Polyribosomal complex

Figure 3-9 Assembly of the small ribosome subunit with mRNA and then the large ribosomal subunit and charged tRNA initi-
ates RNA synthesis (initiation). Binding of charged tRNAs and formation of the peptide bond produce the growing polypeptide
(elongation). Several ribosomes can simultaneously read a single mRNA (polyribosome complex). When the complex encoun-
ters a nonsense codon, protein synthesis stops (termination), and the components are recycled.

peptidyl transferase. This activity might be mediated the A site to the P site with the release of the empty
entirely through RNA, as no proteins are in the vicinity tRNA from a third position, the E site, of the ribosome.
of the active site of the ribosome where the peptide bond This movement (translocation) of tRNAs across a dis-
formation occurs.20 After formation of the peptide bond, tance of 20 angstroms from the A to the P site and 28
the ribosome moves, shifting the dipeptidyl-tRNA from angstroms from the P to the E site requires elongation
03Buckingham (F)-03 2/6/07 12:20 PM Page 60

60 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

Growing peptide
Amino
tRNA acid

Ribosome
P site
A A C
G A site
A G
A UG P site A site
C CG AU C C U A C U UGU U C CG A GU
5 3
mRNA
Ribosome

Translocation A2451

:
Peptide O H R
:N O
O
H O
A UG A A C tRNA
C CG AU C C U A C U UGU U C CG A GU tRNA
P site
5 3 A site

O R
Peptide
O
H N
O H O

tRNA tRNA
A A G
Figure 3-11 Protein synthesis (translation) as it takes place
G
A U in the ribosome. The peptide bond is formed in an area
between the large and small subunits of the ribosome. The
A A C ribozyme theory holds that the ribosome is an enzyme that
C CG AU C C U A C U UGU U C CG A GU
functions through RNA and not protein. The close proximity
5 3
of only RNA to this site is evidence for the ribozyme theory.

Figure 3-10 Incoming charged tRNAs bind to the A site of


the ribosome, guided by matching codon-anticodon pairing. During translation, the growing polypeptide begins to
After formation of the peptide bond between the incoming fold into its mature conformation. This process is assisted
amino acid and the growing peptide, the ribosome moves to
the next codon in the mRNA, translocating the peptide to the
by molecular chaperones.22 These specialized proteins
P site and creating another A site for the next tRNA. bind to the large ribosomal subunit, forming a hydropho-
bic pocket that holds the emerging polypeptide (Fig.
3-12). Chaperones apparently protect the hydrophobic
factor EF-G. As the ribosomal complex moves along the regions of unfinished polypeptides until they can be
mRNA, the growing peptide chain is always attached to safely associated inside the protein. In the absence of this
the incoming amino acid. Two GTPs are hydrolyzed to activity, unfinished proteins might bind to each other and
GDP with the addition of each amino acid. This energy- form nonfunctional aggregates. The DnaK protein of E.
dependent translocation occurs with shifting and rotation coli can also act as a chaperone by binding to the
of ribosomal subunits (Fig. 3-11).21 hydrophobic regions of the emerging polypeptide.23
03Buckingham (F)-03 2/6/07 12:20 PM Page 61

Proteins Chapter 3 61

Ribosome
3 3 3
5 5 5
mRNA

Growing polypeptide
Chaperone

Folded
peptide

Figure 3-12 Molecular chaperones catch the growing peptide as it emerges from the active site. The pep-
tide goes through stages of holding (left), folding (center), and release (right). When the protein is completely
synthesized and released from the ribosome, it should be in its folded state. This protects the nascent (grow-
ing) peptide from harmful interactions with other proteins in the cell before it has had an opportunity to form
its protective and active tertiary structure.

Termination of the amino acid chain is signaled by one may not occur in the nuclei of lower eukaryotes.28 As in
of the three nonsense, or termination, codons, UAA, procaryotes, nuclear translation may require concurrent
UAG, or UGA, which are not charged with an amino transcription.29,30
acid. When the ribosome encounters a termination codon,
termination, or release factors (R1, R2, and S in E. coli),
causes hydrolysis of the finished polypeptide from the
final tRNA, release of that tRNA from the ribosome, and
STUDY QUESTIONS
dissociation of the large and small ribosomal subunits. In
eukaryotes, termination codonmediated binding of 1. Indicate whether the following peptides are hydro-
polypeptide chain release factors (eRF1 and eRF3) trig- philic or hydrophobic.
ger hydrolysis of peptidyl-tRNA at the ribosomal pep- a. MLWILSS
tidyl transferase center.24,25 b. VAIKVLIL
E. coli can synthesize a 300400 amino acid protein in c. CSKEGCPN
1020 seconds. Because the protein takes on its second- d. SSIQKNET
ary structure as it is being synthesized, it already has its e. YAQKFQGRT
final conformation when it is released from the ribosome. f. AAPLIWWA
In bacteria, translation and transcription occur simulta- g. SLKSSTGGQ
neously. In nucleated cells, the majority of translation
occurs in the cytoplasm. Several lines of evidence, how- 2. Is the following peptide positively or negatively
ever, suggest that translation might also occur in the charged at neutral pH?
nucleus. One line of evidence is that nuclei contain fac- GWWMNKCHAGHLNGVYYQGGTY
tors required for translation.26,27 Furthermore, isolated
nuclei can aminoacylate tRNAs and incorporate amino 3. Consider an RNA template made from a 2:1 mixture
acids into proteins. Another support for nuclear transla- of C:A. What would be the three amino acids most
tion is that nonsense-mediated decay (NMD), degrada- frequently incorporated into protein?
tion of messenger RNAs with premature termination
codons, was proposed to occur in mammalian nuclei. 4. What is the peptide sequence encoded in
Further investigations, however, have shown that NMD AUAUAUAUAUAUAUA?
03Buckingham (F)-03 2/6/07 12:20 PM Page 62

62 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview

5. Write the anticodons 5! to 3! of the following amino 10. Jones D, Nishimura S, Khorana HG. Studies on
acids: polynucleotides, LVI: Further synthesis, in vitro, of
a. L copolypeptides containing two amino acids in alter-
b. T nating sequence dependent upon DNA-like poly-
c. M mers containing two nucleotides in alternating
d. H sequence. Journal of Molecular Biology 1966;
e. R 16(2):45472.
f. I 11. Crick FHC. Codon-anticodon pairing: The wobble
hypothesis. Journal of Molecular Biology 1966;
6. A protein contains the sequence LGEKKW- 19:54855.
CLRVNPKGLDESKDYLSLKSKYLLL. What is the 12. Kirino Y, Goto Y, Campos Y, et al. Specific correla-
likely function of this protein? (Note: see Box A3-4.) tion between the wobble modification deficiency
7. A histone-like protein contains the sequence: in mutant tRNAs and the clinical features of a
PKKGSKKAVTKVQKKDGKKRKRSRK. What cha- human mitochondrial disease. Proceedings of the
racteristic of this sequence makes it likely to associate National Academy of Sciences 2005;102(20):
with DNA? (Note: see the Box on p. 53.) 712732.
13. Wang L, Brock A, Herberich B et al. Expanding the
References genetic code of Escherichia coli. Science 2001;292:
1. Fields S. Proteomics in genomeland. Science 498500.
2001;291:122124. 14. Doring V, Mootz HD, Nangle LA, et al. Enlarging
2. Pauling L, Corey RB. The structure of proteins; two the amino acid set of Escherichia coli by infiltration
hydrogen-bonded helical configurations of the of the valine coding pathway. Science 2001;292:
polypeptide chain. Proceedings of the National 501504.
Academy of Sciences 1951;205(4):20511. 15. Hoagland MB, Keller EB, Zamecnik PC. Enzymatic
3. Pauling L, Corey RB. The pleated sheet, a new layer carboxyl activation of amino acids. Journal of
configuration of polypeptide chains. Proceedings Biological Chemistry 1956;218:34558.
of the National Academy of Sciences 1951;37(5): 16. Szymansk M, Deniziak M, Barciszewski J. The new
25156. aspects of aminoacyl-tRNA synthetases. Acta
4. Pauling L, Corey RB. The structure of synthetic Biochimica Polonica 2000;47(3):82134.
polypeptides. Proceedings of the National Academy 17. Zamecnik PC. An historical account of protein syn-
of Sciences 1951;37(5):24150. thesis with current overtone: A personalized view.
5. Pauling L, Corey RB. Atomic coordinates and struc- Cold Spring Harbor Symposium on Quantitative
ture factors for two helical configurations of Biology 1969;34:116.
polypeptide chains. Proceedings of the National 18. Ruusala T, Ehrenberg M, Kurland CG. Is there
Academy of Sciences 1951;37(5):23540. proofreading during polypeptide synthesis? EMBO
6. Benzer S. On the topography of genetic fine struc- Journal 1982;1(6):74145.
ture. Proceedings of the National Academy of 19. Ogle JM, Brodersen DE, Clemons WM Jr, et al.
Sciences 1961;47(3):40315. Recognition of cognate transfer RNA by the 30S
7. Benzer S. The fine structure of the gene. Scientific ribosomal subunit. Science 2001;292:897902.
American 1962;206(1):7084. 20. Steitz T, Moore PB. RNA, the first macromolecular
8. Crick F, Barnett, L, Brenner, S, et al. General nature catalyst: The ribosome is a ribozyme. Trends in
of the genetic code for proteins. Nature 1961;192 Biochemical Sciences 2003;28(8):41118.
(4809):122732. 21. Yusupov M, Yusupova GZ, Baucom A, et al. Crystal
9. Nirenberg M, Leder, P, Bernfield, M, et al. RNA structure of the ribosome at 5.5A resolution. Science
code words and protein synthesis, VII: On the 2001;292:88396.
general nature of the RNA code. Proceedings of the 22. Horwich A. Sight at the end of the tunnel. Nature
National Academy of Sciences 1965;53(5):116168. 2004;431:52022.
03Buckingham (F)-03 2/6/07 12:20 PM Page 63

Proteins Chapter 3 63

23. Deuerling E, Schulze-Specking A, Tomoyasu, T, 31. Schomburg L, Schweizer U, Kahrle J. Selenium


et al. Trigger factor and DnaK cooperate in folding and selenoproteins in mammals: Extraordinary,
of newly synthesized proteins. Nature 1999;400: essential, enigmatic. Cellular and Molecular Life
69396. Science 2004;61(16):198895.
24. Zhouravleva G, Frolova L, Le Goff X, et al. Termi- 32. Carbone F, Zinovyev A, Kepes F. Codon adaptation
nation of translation in eukaryotes is governed by index as a measure of dominating codon bias.
two interacting polypeptide chain release factors, Bioinformatics 2003;19(16):200515.
eRF1 and eRF3. EMBO Journal 1995;14(16): 33. Ma J, Zhou T, Gu W, et al. Cluster analysis of
406572. the codon use frequency of MHC genes from differ-
25. Frolova L, Merkulova TI, Kisselev LL. Transla- ent species. Biosystems 2002;65(2-3):199207.
tion termination in eukaryotes: Polypeptide 34. Van Den Bussche RA, Hansen EW. Characteriza-
release factor eRF1 is composed of functionally tion and phylogenetic utility of the mammalian
and structurally distinct domains. RNA 2000; protamine p1 gene. Molecular and Phylogenetic
6(3):38190. Evolution 2002;22(3):33341.
26. Gunasekera N, Lee SW , Kim S , et al. Nuclear 35. Landschulz W, Johnson PF, McKnight SL. The
localization of aminoacyl-tRNA synthetases using leucine zipper: A hypothetical structure common
single-cell capillary electrophoresis laser-induced to a new class of DNA binding proteins. Science
fluorescence analysis. Analytical Chemistry 2004; 1988;240(4860):175964.
76(16):474146. 36. Ferre-DAmare A, Prendergast GC, Ziff EB, et al.
27. Brogna S, Sato TA, Rosbash M. Ribosome compo- Recognition by Max of its cognate DNA through
nents are associated with sites of transcription. a dimeric b/HLH/Z domain. Nature 1993;363
Molecular Cell 2002;10(4):93104. (6424):3845.
28. Kuperwasser N, Brogna S, Dower K, et al. 37. Vogel G. Tracking the history of the genetic code.
Nonsense-mediated decay does not occur within the Science 1998;281:32931.
yeast nucleus. RNA 2004;10(2):190715. 38. Sanger F, Tuppy H. The amino-acid sequence in the
29. Iborra FJ, Jackson DA, Cook PR. Coupled tran- phenylalanyl chain of insulin. II: The investigation
scription and translation within nuclei of mam- of peptides from enzymic hydrolysates. Biochemical
malian cells. Science 2001;293:113942. Journal 1951;49(4):48190.
30. Sommer P, Nehrbass U. Quality control of messen- 39. Sanger F, Tuppy H. The amino-acid sequence in
ger ribonucleoprotein particles in the nucleus and the phenylalanyl chain of insulin. I. The identifica-
at the pore. Current Opinions in Cell Biology 2005; tion of lower peptides from partial hydrolysates.
17(3):294301. Biochemical Journal 1951; 49(4):46381.
03Buckingham (F)-03 2/6/07 12:20 PM Page 64
04Buckingham (F)-04 2/6/07 5:53 PM Page 65

SECTION 2

Common Techniques
in Molecular Biology

Chapter 4 Lela Buckingham

Nucleic Acid
Extraction Methods

OUTLINE OBJECTIVES
ISOLATION OF DNA Compare and contrast organic, inorganic, and solid-phase
Preparing the Sample approaches for isolating cellular and mitochondrial DNA.
Organic Isolation Methods
Inorganic Isolation Methods Note the chemical conditions in which DNA precipitates
Solid-Phase Isolation and goes into solution.
Crude Lysis Compare and contrast organic and solid-phase approaches
Isolation of Mitochondrial DNA for isolating total RNA.
ISOLATION OF RNA
Distinguish between the isolation of total RNA with that
Total RNA
of messenger RNA.
Extraction of Total RNA
Isolation of polyA (messenger) RNA Describe the gel-based, spectrophotometric, and fluoro-
MEASUREMENT OF NUCLEIC ACID metric methods used to determine the quantity and quality
QUALITY AND QUANTITY of DNA and RNA preparations.
Electrophoresis Calculate the concentration and yield of DNA and RNA
Spectrophotometry from a given nucleic acid preparation.
Fluorometry

65
04Buckingham (F)-04 2/6/07 5:53 PM Page 66

66 Section 2 Common Techniques in Molecular Biology

The purpose of extraction is to release the nucleic acid (Table 4.1). The initial steps in nucleic acid isolation
from the cell for use in subsequent procedures. Ideally, depends on the nature of the starting material.
the target nucleic acid should be free of contamination
with protein, carbohydrate, lipids, or other nucleic acid, Nucleated Cells in Suspension
i.e., DNA free of RNA or RNA free of DNA. The initial Depending on the type of clinical sample that is sent for
release of the cellular material is achieved by breaking analysis, the specimen may have to be pretreated to make
the cell and nuclear membranes (cell lysis). Lysis must nucleated cells available from which the nucleic acid will
take place in conditions that will not damage the nucleic be extracted. For instance, white blood cells (WBCs)
acid. Following lysis, the target material is purified, and must be isolated from blood or bone marrow specimens.
then the concentration and purity of the sample can be This is done by either differential density gradient cen-
determined. trifugation or differential lysis. For differential density
gradient centrifugation, whole blood or bone marrow
mixed with isotonic saline is overlaid with Ficoll.
Isolation of DNA Ficoll is a highly branched sucrose polymer that does
Although Miescher first isolated DNA from human cells not penetrate biological membranes. Upon centrifuga-
in 1869,1 the initial routine laboratory procedures for tion, the mononuclear WBCs (the desired cells for isola-
DNA isolation were developed from density gradient tion of nucleic acid) settle into a layer in the Ficoll
centrifugation strategies. Meselson and Stahl used such a gradient that is below the less dense plasma components
method in 1958 to demonstrate semiconservative replica- and above the polymorphonuclear cells and red blood
tion of DNA.2 Later procedures made use of the differ- cells (RBCs). The layer containing the mononuclear cells
ences in solubility of large chromosomal DNA, plasmids, is removed from the tube and washed by at least two
and proteins in alkaline buffers. Large (!50 kbp) chro- rounds of resuspension and centrifugation in saline before
mosomal DNA and proteins cannot renature properly proceeding with the nucleic acid isolation procedure.
when neutralized in acetate at low pH after alkaline treat- Another method used to isolate nucleated cells takes
ment, forming large aggregates instead. As a result, they advantage of the differences in the osmotic fragility of
precipitate out of solution. The relatively small plasmids RBCs and WBCs. Incubation of whole blood or bone
return to their supercoiled state and stay in solution. marrow in hypotonic buffer or water will result in the
Alkaline lysis procedures were used extensively for lysis of the RBCs before the WBCs. The WBCs are then
extraction of 150kb plasmid DNA from bacteria dur- pelleted by centrifugation, leaving the empty RBC mem-
ing the early days of recombinant DNA technology. branes (ghosts) and hemoglobin, respectively, in suspen-
sion and solution.
Preparing the Sample
Tissue Samples
Nucleic acid is routinely isolated from human, fungal,
Fresh or frozen tissue samples must be dissociated before
bacterial, and viral sources in the clinical laboratory
DNA isolation procedures can be started. Grinding the
frozen tissue in liquid nitrogen, homogenizing the tissue,
or simply mincing the tissue using a scalpel can disrupt
Advanced Concepts whole tissue samples. Fixed embedded tissue has to be
deparaffinized by soaking in xylene (a mixture of three
In surveying the literature, especially early refer- isomers of dimethylbenzene). Less toxic xylene substi-
ences, the starting material for DNA extraction had tutes, such as Histosolve, Anatech Pro-Par, or ParaClear,
to be noted because that determined which extrac- are also often used for this purpose. After xylene treat-
tion procedure was used. Extraction procedures are ment, the tissue is usually rehydrated by soaking it in
often modified to optimize the yield of specific decreasing concentrations of ethanol.
products. A procedure designed to yield plasmid
DNA does not efficiently isolate chromosomal DNA Microorganisms
and vice versa. Some bacteria and fungi have tough cell walls that must
be broken to allow the release of nucleic acid. Several
04Buckingham (F)-04 2/6/07 5:53 PM Page 67

Nucleic Acid Extraction Methods Chapter 4 67

Table 4.1 Yield of DNA from Different Specimen Sources1118


Specimen Expected Yield*
Specimens adequate for analysis
without DNA amplification
Blood (1 mL, 3.510 ! 106 WBCs/mL) 2050 "g
Buffy coat (1 mL whole blood) 50200 "g
Bone marrow (1 mL) 100500 "g
Cultured cells (107 cells) 3070 "g
Solid tissue (1 mg) 110 "g
Lavage fluids (10 mL) 2250 "g
Mitochondria (10-mg tissue, 107 cells) 110 "g
Plasmid DNA, bacterial culture, (100-mL overnight culture) 350 "g1 mg
Bacterial culture (0.5 mL, 0.7 absorbance units) 1035 "g
Feces (1 mg; bacteria, fungi) 2228 "g
Specimens adequate for analysis
with DNA amplification
Serum, plasma, cerebrospinal fluid (0.5 mL) 0.33 "g
Dried blood (0.5-1cm diameter spot) 0.040.7 "g
Saliva (1 mL) 515 "g
Buccal cells (1 mg) 110 "g
Bone, teeth (500 mg) 3050 "g
Hair follicles# 0.10.2 "g
Fixed tissue** (5-10 ! 10micron sections) 650 "g
Feces (animal cells, 1 mg) 2100 pg
*Yields are based on optimal conditions. Assays will vary in yield and purity of sample DNA.
DNA yield will vary with WBC count.
DNA yield will depend on type and condition of tissue.
Different bacterial types and fungi will yield more or less DNA.
DNA yield will depend on degree of cellularity.
Dried blood yield from paper is less than from textiles.
#Mitochrondrial DNA is attainable from hair shafts.
**Isolation of DNA from fixed tissue is affected by the type of fixative used and the age and the preliminary handling of the original specimen.

Cells in fecal specimens are subjected to digestion and degradation.

enzyme products, e.g., lyzozyme or zymolyase, that that can be immediately precipitated with alcohol (see
digest cell wall polymers are commercially available. below). DNA extracted with NaOH or boiling procedures
Alternatively, cell walls can be broken mechanically by is denatured (single-stranded) and may not be suitable for
grinding or by vigorously mixing with glass beads. methods such as restriction enzyme analysis that require
Gentler enzymatic methods are less likely to damage double-stranded DNA. The advantage of these types of
chromosomal DNA and thus are preferred for methods extraction is their speed and simplicity. Amplification
involving larger chromosomal targets as opposed to plas- methods will work with this type of DNA isolation.
mid DNA.
Treatment with detergent (1% sodium dodecyl sulfate)
Organic Isolation Methods
and strong base (0.2 M NaOH) in the presence of Tris
base, ethylenediaminetetraacetic acid (EDTA), and glu- After release of DNA from the cell, further purification
cose can also break bacterial cell walls. requires removal of contaminating proteins, lipids, car-
Boiling in 8% sucrose, 8% Triton X-100 detergent, Tris bohydrates, and cell debris. This is accomplished using a
buffer, and EDTA after lysozyme treatment releases DNA combination of high salt, low pH, and an organic mix-
04Buckingham (F)-04 2/6/07 5:53 PM Page 68

68 Section 2 Common Techniques in Molecular Biology

DNA in DNA
aqueous precipitation
solution (ethanol)
Lysis Acidification Extraction
(NaOH, SDS) (acetic acid, (phenol,
salt) chloroform)
Cells in
suspension
Lysed cells
Cell debris

DNA

Figure 4-1 General scheme of organic DNA isolation.

ture of phenol and chloroform. The combination readily Inorganic Isolation Methods
dissolves hydrophobic contaminants such as lipids and
lipoproteins, collects cell debris, and strips away most Safety concerns in the clinical laboratory make the use of
DNA-associated proteins (Fig. 4-1). Isolation of small caustic reagents such as phenol undesirable. Methods of
amounts of DNA from challenging samples such as fungi DNA isolation that do not require phenol extraction have,
can be facilitated by pretreatment with cetyltrimethylam-
monium bromide, a cationic detergent that efficiently sep-
arates DNA from polysaccharide contamination. To avoid
RNA contamination, RNAse, an enzyme that degrades
Advanced Concepts
RNA, can be added at this point. Alternatively, RNAse Ethanol and isopropanol are used for molecular
may also be added to the resuspended DNA at the end of applications. The ethanol is one of the general use
the procedure. formulas, reagent grade. Reagent-grade alcohol
When phenol and chloroform are added to the (90.25% ethanol, 4.75% methanol, 5% isopropanol)
hydrophilic cleared cell lysate, a biphasic emulsion is denatured; that is, the ethanol is mixed with other
forms. Centrifugation will settle the hydrophobic layer components because pure 100% ethanol cannot be
on the bottom, with the hydrophilic layer on top. Lipids distilled. The isopropanol used is undenatured, or
and other hydrophobic components will dissolve in the pure, as it is composed of 99% isopropanol and 1%
lower hydrophobic phase. DNA will dissolve in the upper water with no other components.
aqueous phase. Amphiphilic components, which have The choice of which alcohol to use depends on
both hydrophobic and hydrophilic properties as well as the starting material, the size and amount of DNA
cell debris, will collect as a white precipitate at the inter- to be isolated, and the design of the method.
face between the two layers. Isopropanol is less volatile than ethanol and precip-
The upper phase containing the DNA is collected, and itates DNA at room temperature. Precipitation at
the DNA is then precipitated using ethanol or iso- room temperature reduces coprecipitation of salt.
propanol in a high concentration of salt (ammonium, Also, compared with ethanol, less isopropanol is
potassium or sodium acetate, or lithium or sodium chlo- added for precipitation; therefore, isopropanol can
ride). The ethyl or isopropyl alcohol is added to the upper be more practical for large-volume samples. For low
phase solution at 2:1 or 1:1 ratios, respectively, and the concentrations of DNA, longer precipitation times
DNA forms a solid precipitate. at freezer temperatures may be required to maxi-
The DNA precipitate is collected by centrifuga- mize the amount of DNA that is recovered. An
tion. Excess salt is removed by rinsing the pellet in important consideration to precipitating the DNA at
70% ethanol, centrifuging and discarding the ethanol freezer temperatures is that the increased viscosity
supernatant, and then dissolving the DNA pellet in rehy- of the alcohol at low temperatures will require
dration buffer, usually 10 mM Tris, 1 mM EDTA (TE), or longer centrifugation times to pellet the DNA.
water.
04Buckingham (F)-04 2/6/07 5:53 PM Page 69

Nucleic Acid Extraction Methods Chapter 4 69

Advanced Concepts Advanced Concepts


Sometimes, DNA preparations are intended for Precipitation of the DNA excludes hydrophilic pro-
long-term storage. The presence of the chelating teins, carbohydrates, and other residual contami-
agent EDTA protects the DNA from damage by nants still present after protein extraction. In
DNAses present in the environment. EDTA is a addition, the concentration of the DNA can be con-
component of TE buffer (10 mM Tris, 1 mM EDTA) trolled by adjusting the buffer or water volume used
and other resuspension buffers. The EDTA will also for resuspension of the pellet.
inhibit enzyme activity when the DNA is used in
various procedures such as restriction enzyme
digestion or polymerase chain reaction (PCR). One
must be careful not to dilute the DNA too far so that Solid-Phase Isolation
large volumes (e.g., more than 10% of a reaction
volume) of the DNA-EDTA solution are required. More rapid and comparably effective DNA extraction can
When DNA yield is low, as is the case with some be performed using solid matrices to bind and wash the
clinical samples, it is better to dissolve it in water. DNA. Silica-based products were shown to effectively
More of this can be used in subsequent procedures bind DNA in high salt conditions.3 Many variations on
without adding excess amounts of EDTA. Because this procedure have been developed, including use of
the entire sample will be used for analysis, protec- diatomaceous earth as a source of silica particles.4 More
tion on storage is not a concern. modern systems can be purchased with solid matrices in
the form of columns or beads. Columns come in various
sizes, depending on the amount of DNA to be isolated.
Columns used in the clinical laboratory are usually small
therefore, been developed and are used in many laborato- spin columns that fit inside microcentrifuge tubes.
ries. Initially, these methods did not provide the efficient These columns are commonly used to isolate viral and
recovery of clean DNA achieved with phenol extraction; bacterial DNA from serum, plasma, or cerebrospinal
however, newer methods have proven to produce high- fluid. They are also used routinely for isolation of cellular
quality DNA preparations in good yields. DNA in genetics and oncology. Preparation of samples
Inorganic DNA extraction is sometimes called salt- for isolation of DNA on solid-phase media starts with cell
ing out (Fig. 4-2). It makes use of low pH and high salt lysis and release of nucleic acids, similar to organic and
conditions to selectively precipitate proteins, leaving the inorganic procedures (Fig. 4-3). Specific buffers are used
DNA in solution. The DNA can then be precipitated as to lyse bacterial, fungal, or animal cells. Buffer systems
described above using isopropanol pelleted and resus- designed for specific applications (e.g., bacterial cell lysis
pended in TE buffer or water. or human cell lysis) are commercially available.

DNA in DNA
aqueous precipitation
solution (isopropanol)
Lysis Protein
(Tris, EDTA, precipitation
SDS) (sodium
Cells in
acetate)
suspension
Lysed cells

Cell debris

Figure 4-2 Inorganic DNA


isolation. DNA
04Buckingham (F)-04 2/6/07 5:53 PM Page 70

70 Section 2 Common Techniques in Molecular Biology

Advanced Concepts Advanced Concepts


Alkaline lysis can be used to specifically select for Solid matrices conjugated to specific sequences of
plasmid DNA because chromosomal DNA will not nucleic acid can also be used to select for DNA con-
renature properly upon neutralization and precipitate. taining complementary sequences by hybridization.
The denatured chromosomal DNA and protein can After removal of noncomplementary sequences, the
be removed by centrifugation before the supernatant DNA can be eluted by heating the matrix or by
containing plasmid DNA is applied to the column. breaking the hydrogen bonds chemically.

For solid-phase separation, the cell lysate is applied to Solid-phase isolation is the methodology employed for
a column in high salt buffer, and the DNA in solution several robotic DNA isolation systems such as Roche
adsorbs to the solid matrix. After the immobilized DNA MagnaPure and Qiagen BioRobot, which use magnetized
is washed with buffer, the DNA is eluted in a specific vol- glass beads or membranes to bind DNA. These systems
ume of water, TE, or other low salt buffer. The washing are finding increased use in clinical laboratories for auto-
solutions and the eluant can be drawn through the column mated isolation of DNA from blood, tissue, bone marrow,
by gravity, vacuum, or centrifugal force. DNA absorbed plasma, and other body fluids. A measured amount of
to magnetic beads is washed by suspension of the beads sample, e.g., 200400 !L of whole blood or 1050 mg of
in buffer and collection of the beads using a magnet tissue, in sample tubes is placed into the instrument along
applied to the outside of the tube while the buffer is aspi- with cartridges or racks of tubes containing the reagents
rated or poured off. The DNA IQ system (Promega) uses used for isolation. Reagents are formulated in sets
a magnetic resin that holds a specific amount of DNA depending on the type and amount of starting material.
(100 ng). When the DNA is eluted in 100 !L, the DNA The instrument is then programmed to lyse the cells and
concentration is known, 1 ng/!L, and ready for analysis. isolate and elute the DNA automatically.

DNA in
aqueous
solution
DNA adsorption
Lysis Acidification (low pH)
(supplied (supplied
reagents) reagents)
Cells in
suspension
Lysed cells

Cell debris
Wash DNA Elute DNA
(supplied (low salt)
buffer)

DNA

Figure 4-3 Isolation of DNA on solid media.


04Buckingham (F)-04 2/6/07 5:53 PM Page 71

Nucleic Acid Extraction Methods Chapter 4 71

Crude Lysis (A) (B)


Deparaffinize
Although high-quality DNA preparations are tantamount Tissue embedded
in paraffin
(xylene, ethanol
Tumor cells wash)
to successful procedures, there are circumstances that
either preclude or prohibit extensive DNA purification. ~20 micron
These include screening large numbers of samples by sections
simple methods (e.g., electrophoresis with or without re-
Paraffin
striction enzyme digestion and some amplification proce-
dures), isolation of DNA from limited amounts of starting Digest
(proteinase K,
material, and isolation of DNA from challenging samples Tris buffer)
such as fixed, paraffin-embedded tissues. In these cases,
simple lysis of cellular material in the sample will yield
sufficiently useful DNA for amplification procedures. Microdissection

Figure 4-4 Crude extraction of DNA from fixed paraffin-


embedded tissue. Selected regions of tissue are scraped
Proteolytic Lysis of Fixed Material
from slides (A) and extracted (B).
Simple screening methods are mostly used for research
purposes in which large numbers of samples must be
processed. This is usually not done in the clinical labora- lyzed by boiling. After centrifugation of the suspension,
tory. In contrast, the analysis of paraffin samples is fre- DNA in the supernatant is cooled and may be further
quently performed in the clinical laboratory. Fixed tissue extracted with chloroform before use in amplification
is more conveniently accessed in the laboratory and may procedures. This method is most commonly used in
sometimes be the only source of patient material. Thin forensic applications but may also be useful for purifica-
sections are usually used for analysis, although sectioning tion of DNA from clinical samples and fixed, paraffin-
is not necessary with very small samples such as needle embedded specimens.7,8
biopsies. Paraffin-embedded specimens must be dewaxed
with xylene or other agents and then rehydrated before Other Rapid Extraction Methods
nucleic acid isolation. For some tests, such as somatic With the advent of PCR, new and faster methods for
mutation analyses, a separate stained serial section can be DNA isolation have been developed. The minimal sam-
examined microscopically to identify tumor cells. The ple requirements of amplification procedures allow for
identifiable areas of tumor can then be isolated directly the use of material previously not utilizable for analysis.
from the slide by simple scraping in buffer (microdissec- Rapid lysis methods (produced by Sigma or Epicentre
tion) or laser capture (Fig. 4-4) and deposited into micro- Technologies) and DNA extraction/storage cards (pro-
centrifuge tubes. duced by Whatman) provide sufficiently clean DNA that
Before lysis, cells may be washed by suspension and can be used for amplification.
centrifugation in saline or other isotonic buffer. Reagents
used for cell lysis depend on the subsequent use of the
DNA. For simple screens, cells can be lysed in detergents Isolation of Mitochondrial DNA
such as SDS or Triton. For use in PCR amplification (see There are two approaches to the isolation of mitochon-
Chapter 7), cells may be lysed in a mixture of Tris buffer drial DNA from eukaryotic cells. One method is to first
and proteinase K. The proteinase K will digest proteins in isolate the mitochondria by centrifugation. After cell
the sample, lysing the cells and inactivating other preparations are homogenized by grinding on ice, the
enzymes. The released DNA can be used directly in the homogenate is centrifuged at low speed (7002600 ! g)
amplification reaction. to pellet intact cells, nuclei, and cell debris. The mito-
chondria can be pelleted from the supernatant in a second
Extraction With Chelating Resin high-speed centrifugation (10,00016,000 ! g). The
Chelex is a cation-chelating resin that can be used for mitochondria can be lysed with detergent and the lysate
simple extraction of DNA.5,6 A suspension of 10% chelex treated with proteinase to remove protein contaminants.
resin beads is mixed with specimen, and the cells are Mitochondrial DNA can then be precipitated with cold
04Buckingham (F)-04 2/6/07 5:53 PM Page 72

72 Section 2 Common Techniques in Molecular Biology

Advanced Concepts Advanced Concepts


When homogenizing cells for isolation of mito- Several chemical methods have been developed to
chondria, care must be taken not to overgrind the tis- inactivate or eliminate RNAses. Diethyl pyrocar-
sue and dissociate the mitochondrial membranes. bonate (DEPC) can be added to water and buffers
Grinding in alkaline buffers with reducing agents (except for Tris buffer) to inactivate RNAses perma-
such as !-mercaptoethanol will protect the mito- nently. DEPC converts primary and secondary
chondria during the isolation process. A high ionic amines to carbamic acid esters. It can cross-link
strength buffer can also be used to selectively lyse RNAse proteins through intermolecular covalent
the nuclear membranes. bonds, rendering them insoluble. Because of its
effect on amine groups, DEPC will adversely affect
Tris buffers. DEPC will also interact with poly-
styrene and polycarbonate and is not recommended
ethanol and resuspended in water or appropriate buffers for use on these types of materials.
for analysis. Other RNAse inhibitors include vanandyl-ribonu-
The second approach to mitochondrial DNA prepara- cleoside complexes, which bind the active sites of
tion is to isolate total DNA as described above. The the RNAse enzymes, and macaloid clays, which
preparation will contain mitochondrial DNA that can be absorb the RNAse proteins. Ribonuclease inhibitor
analyzed within the total DNA background by hybridiza- proteins can be added directly to RNA preparations.
tion or PCR. These proteins form a stable noncovalent complex
with the RNAses in solution. Some of these interac-
Isolation of RNA tions require reducing conditions; therefore, dithio-
threitol must be added in addition to the inhibitor.
Working with RNA in the laboratory requires strict pre-
cautions to avoid sample RNA degradation. RNA is espe- H2 O O O CH2
C C C C
cially labile due to the ubiquitous presence of RNAses.
These enzymes are small proteins that can renature, even O O
after autoclaving, and become active. Unlike DNAses,
Diethyl pyrocarbonate.
RNAses must be eliminated or inactivated before isola-
tion of RNA. They remain active at a wide range of tem-
peratures (e.g., below -20oC and can renature even after
heating). more detailed discussion of RNA type and structure.) The
It is useful to allocate a separate RNAse-free (RNF) most abundant (80%-90%) RNA in all cells is ribosomal
area of the laboratory for storage of materials and speci- RNA (rRNA). This RNA consists of two components,
men handling. Gloves must always be worn in the RNF large and small, which are visualized by agarose gel elec-
area. Disposables (tubes, tips, etc.) that come in contact trophoresis (see Fig. 4-9). Depending on the cell type and
with the RNA should be kept at this location and never be conditions, the next most abundant RNA fraction (2.5%-
touched by ungloved hands. Articles designated DNAse- 5%) is messenger RNA (mRNA). This mRNA may be
free/RNF by suppliers may be used directly from the detected as a faint background underlying the rRNA
package. Reusable glassware is seldom used for RNA detected by agarose gel electrophoresis. Transfer RNA
work. After cleaning, glassware must be baked for 46 and small nuclear RNAs are also present in the total RNA
hours at 400oC to inactivate the RNAses. sample.

Total RNA Extraction of Total RNA


There are several types of naturally occurring RNA in Preparation of specimen material for RNA extraction dif-
prokaryotes and eukaryotes. (Refer to Chapter 2 for a fers in some respects than for DNA extraction. Reticulo-
04Buckingham (F)-04 2/6/07 5:53 PM Page 73

Nucleic Acid Extraction Methods Chapter 4 73

alcohol (25:24:1) solution efficiently extracts RNA.


Advanced Concepts Chloroform enhances the extraction of the nucleic acid
by denaturing proteins and promoting phase separation.
Specialized collection tubes are available for the Isoamyl alcohol prevents foaming. For RNA, the organic
isolation of RNA from whole blood (e.g., from phase must be acidic (ph 45). The acidity of the organic
Qiagen or Applied Biosystems). These tubes contain phase can be adjusted by overlaying it with buffer of the
proprietary reagents that stabilize the intracellular appropriate pH. In some isolation procedures, DNAse is
RNA for several days at room temperature and added at the lysis step to eliminate contaminating DNA.
longer at refrigerator temperature. The RNA can be Alternatively, RNAse-free DNAse also may be added
isolated on a solid matrix. directly to the isolated RNA at the end of the procedure.
After phase separation, the upper aqueous phase contain-
ing the RNA is removed to a clean tube, and the RNA is
cytes in blood and bone marrow samples are lysed by precipitated by addition of two volumes of ethanol or one
osmosis or separated from WBCs by centrifugation. volume of isopropanol. Glycogen or yeast-transfer RNA
When dissociating tissue, the sample should be kept may be added at this step as a carrier to aid RNA pellet
frozen in liquid nitrogen or immersed in buffer that will formation. The RNA precipitate is then washed in 70%
inactivate intracellular RNAses. This is especially true ethanol and resuspended in RNF buffer or water.
for tissues such as pancreas that contain large amounts of Solid-phase separation of RNA begins with similar
innate RNAses. Bacterial and fungal RNA are also iso- steps as described above for organic extraction. The
lated by chemical lysis or by grinding in liquid nitrogen. strong denaturing buffer conditions must be adjusted
Viral RNA can be isolated directly from serum or other before application of the lysate to the column (Fig. 4-6).
cell-free fluids by means of specially formulated spin In some procedures, ethanol is added at this point. Some
columns or beads. As most total RNA isolation methods systems provide a filter column to remove particulate
cannot distinguish between RNA from microorganisms material before application to the adsorption column. As
and those from host cells, cell-free material should be with DNA columns, commercial reagents are supplied
used for these isolations. with the columns to optimize RNA adsorption and wash-
The cell lysis step for RNA isolation is done in deter- ing on the silica-based matrix.
gent or phenol in the presence of high salt (0.20.5 M The lysate is applied to a column in high-salt
NaCl) or RNAse inhibitors. Guanidine thiocyanate is a chaotropic buffer, and the adsorbed RNA is washed with
strong denaturant of RNAses and can be used instead supplied buffers. DNAse can be added directly to the
of high salt buffers. Strong reducing agents such as 2- adsorbed RNA on the column to remove contaminating
mercaptoethanol can also be added during this step. DNA. Washing solutions and the eluant can be drawn
Once the cells are lysed, proteins can be extracted through the column by gravity, vacuum, or centrifugal
with phenol (Fig. 4-5). Acid phenol:chloroform:isoamyl force. Small columns of silica-based material that fit

RNA in RNA
aqueous precipitation
solution) (ethanol)
Lysis Extraction
(guanidinium (phenol,
isothiocyanate) chloroform)
Cells in
suspension
Lysed cells

Figure 4-5 Organic extraction


of total RNA. RNA
04Buckingham (F)-04 2/6/07 5:53 PM Page 74

74 Section 2 Common Techniques in Molecular Biology

RNA adsorption
Lysis (low pH)
(supplied
reagents)
Cells in
suspension
Lysed cells

Wash RNA Elute RNA


(supplied
buffer)

RNA
Figure 4-6 Isolation of RNA on a solid matrix.

inside microfuge tubes (spin columns) are widely used


for routine nucleic acid isolation from all types of speci- Table 4.2 Yield of RNA From Various
Specimen Sources19-21
mens. The eluted RNA is usually of sufficient concentra-
Specimen Expected
tion and purity for direct use in most applications.
Yield*
Generally, 1 million eukaryotic cells or 1050 mg of
tissue will yield about 10 !g of RNA. The yield of RNA Blood (1 mL, 3.5-10 " 106 110 !g
from biological fluids will depend on the concentration WBCs/mL)
of microorganisms or other target molecules present in Buffy coat (1 mL whole blood) 510 !g
the specimen (Table 4.2). Bone marrow (1 mL) 50200 !g
Cultured cells (107 cells) 50150 !g
Isolation of polyA (messenger) RNA Buccal cells (1 mg) 110 !g
Solid tissue (1 mg) 0.54 !g
As previously stated, approximately 80%90% of total
Fixed tissue (1 mm3) 0.23 !g
RNA is rRNA. Often the RNA required for analysis is
Bacterial culture (0.5 mL, 10100 !g
mRNA, accounting for only about 2.5%5% of the
0.7 absorbance units)
total RNA yield. The majority of mRNA consists of
*Specimen handling especially effects RNA yield. Isolation of polyA RNA
mRNA from highly expressed genes. Rare or single
will result in much lower yields. See text.
copy mRNA is, therefore, a very minor part of the total RNA yield will depend on WBC count.
RNA isolation. To enrich the yield of mRNA, especially RNA yield will depend on type of cells and the conditions of cell
rare transcripts, protocols employing oligomers of culture.
thymine or uracil immobilized on a matrix resin column Liver, spleen, and heart tissues yield more RNA than brain, lung, ovary,
kidney, or thymus tissues.
or beads are often used (Fig. 4-7). The polyT or polyU
Isolation of RNA from fixed tissue is especially affected by the type
oligomers will bind the polyA tail found exclusively on of fixative used and the age and the preliminary handling of the original
mRNA. After washing away residual RNA, polyA RNA specimen.
is eluted by washing the column with warmed, low-salt Different bacterial types and fungi will yield more or less RNA.
04Buckingham (F)-04 2/6/07 5:53 PM Page 75

Nucleic Acid Extraction Methods Chapter 4 75

Measurement of Nucleic
mRNA Acid Quality and Quantity
5 A A A A A A A A A 3
3 T T T T T T T T T 5
Laboratory analysis of nucleic acids produces variable
results, depending on the quality and quantity of input
material. This is an important consideration in the clini-
cal laboratory, as test results must be accurately inter-
Bead or column preted with respect to disease pathology. Consistent
Figure 4-7 Oligo polythymine columns or beads bind the results require that run-to-run variation be minimized.
polyA tail of mRNA. The oligo can be poly uracil. Peptide
Fortunately, measurement of the quality and quantity of
nucleic acid dU or dT can also be used.
DNA and RNA is straightforward.

buffer containing detergent. With this approach, approxi-


Electrophoresis
mately 3040 ng of mRNA can be obtained from 1 !g of
total RNA. DNA and RNA can be analyzed for quality by resolving
There are limitations to the isolation of polyA RNA an aliquot of the isolated sample on an agarose gel (Fig.
using oligo dT or dU. The efficiency of polyA and polyU 4-8; see Chapter 5 for a more detailed discussion of elec-
binding is variable. Secondary structure (intrastrand or trophoresis). Fluorescent dyes such as ethidium bro-
interstrand hydrogen bonds) in the target sample may mide or SybrGreen I bind specifically to DNA and are
compete with binding to the capture oligomer. Also, used to visualize the sample preparation. Ethidium bro-
mRNAs with short polyA tails may not bind efficiently or mide or SybrGreen II can be used to detect RNA. Less
at all. AT-rich DNA fragments might also bind to the col- frequently, silver stain has been used to detect small
umn and not only compete with the desired mRNA target amounts of DNA by visual inspection.
but also contaminate the final eluant. Potential digestion The appearance of DNA on agarose gels depends on
of the oligo-conjugated matrices precludes the use of the type of DNA isolated. A good preparation of plasmid
DNase on the RNA before it is bound to the column. DNA will yield a bright, moderate-mobility single band
Treatment of the eluant with RNase-free DNase is possi- of supercoiled plasmid DNA with minor or no other
ble, but the DNase should be inactivated if the mRNA is bands that represent nicked or broken plasmid (see Fig.
to be used in procedures involving DNA components. 4-8). High-molecular-weight genomic DNA should col-
Furthermore, rRNA can copurify with the polyA RNA. lect as a bright band with low mobility (near the top of
The final purified product, then, is enriched in polyA the gel in Fig. 4-9). A high-quality preparation of RNA
RNA but is not a pure polyA preparation. will yield two distinct bands of rRNA. The integrity of

L N, SC

M SC N/R L Nicked/relaxed
Figure 4-8 After agarose gel elec-
trophoresis, compact supercoiled plasmid
DNA (SC) will travel farther through the gel 23 kb
than nicked plasmid (N), which has single-
strand breaks. Relaxed plasmid DNA (R)
has double-strand breaks and will migrate
according to its size, 23 kb in the drawing
on the left. Linear (L) plasmids migrate Linear
according to the size of the plasmid. A gel 0.6 kb
photo shows a plasmid preparation. Supercoiled
(nicked, N; supercoiled, SC; linear, L;
relaxed, R; molecular weight markers, M)
04Buckingham (F)-04 2/6/07 5:53 PM Page 76

76 Section 2 Common Techniques in Molecular Biology

28S rRNA

18S rRNA

Genomic
DNA

Figure 4-9 Intact ethidium bromidestained human chromosomal DNA (left) and total RNA (right) after
agarose gel electrophoresis. High-quality genomic DNA runs as a tight smear close to the loading wells.
High-quality total RNA appears as two rRNA bands (shown with molecular weight markers, M).

these bands is an indication of the integrity of the other DNA, 40 for RNA). The relationship of concentration to
RNA species present in the same sample. If these bands absorbance is expressed as
are degraded (smeared) or absent, the quality of the RNA A ! "bc
in the sample is deemed unacceptable for use in molecu- where A ! absorbance, " ! molar absorptivity (L/mol-
lar assays. cm), b ! path length (cm), and c ! concentration (mg/L).
When fluorescent dyes are used, DNA and, less accu- The absorbance at this wavelength is thus directly propor-
rately, RNA can be quantitated by comparison of the flu- tional to the concentration of the nucleic acid in the sam-
orescence intensity of the sample aliquot run on the gel ple. Using the absorptivity as a conversion factor from
with that of a known amount of control DNA or RNA optical density to concentration, one optical density unit
loaded on the same gel. Densitometry of the band inten- (or absorbance unit) at 260 nm is equivalent to 50 mg/L
sities gives the most accurate measurement of quantity. (or 50 #g/mL) of DNA and 40 #g/mL of RNA. To deter-
For some procedures, estimation of DNA or RNA quan- mine concentration, multiply the spectrophotometer read-
tity can be made by visual inspection. ing in absorbance units by the appropriate conversion
factor. Phenol absorbs ultraviolet light at 270275 nm,
close to the wavelength of maximum absorption by
Spectrophotometry
nucleic acids. This means that residual phenol from
Nucleic acids absorb light at 260 nm through the adenine organic isolation procedures can increase 260 readings, so
residues. Using the Beer-Lambert Law, concentration can phenol contamination must be avoided when measuring
be determined from the absorptivity constants (50 for concentration at 260 nm.
04Buckingham (F)-04 2/7/07 4:43 PM Page 77

Nucleic Acid Extraction Methods Chapter 4 77

Most DNA and RNA preparations are of sufficient con-


centration to require dilution before spectrophotometry
in order for the reading to fall within the linear reading
Advanced Concepts
range (0.050.800 absorbance units, depending on the Newer models of ultraviolet spectrophotometers
instrument). If the sample has been diluted before read- dedicated to nucleic acid analysis can be pro-
ing, the dilution factor must be included in the calculation grammed to do the calculations described. The oper-
of quantity. Multiply the absorbance reading by the con- ator must enter the type of nucleic acid, the dilution
version factor and the dilution factor to find the concen- factor, and the desired conversion factor. The instru-
tration of nucleic acid. ment will automatically read the sample at both
Example 1. A DNA preparation diluted 1:100 yields wavelengths and do the required calculations, giving
an absorbance reading of 0.200 at 260 nm. To obtain the a reading of concentration in !g/mL and a 260
concentration in !g/mL, multiply: nm/280 nm ratio.
0.200 absorbance units " 50 !g/mL per absorbance
unit " 100 # 1000 !g/mL
The yield of the sample is calculated using the volume analysis are not affected by contaminating RNA, in which
of the preparation. If in the case illustrated above, the case the DNA is still suitable for use. If, however, RNA
DNA was eluted or resuspended in a volume of 0.5 mL, may interfere or react with DNA detection components,
the yield would be: RNase should be used to remove the contaminating RNA.
Because it is difficult to detect contaminating DNA in
1000 !g/mL " 0.5 mL # 500 !g
RNA preparations, RNA should be treated with RNase-
Example 2. An RNA preparation diluted 1:10 yields free DNase where DNA contamination may interfere.
an absorbance reading of 0.500 at 260 nm. The concen-
tration is:
Fluorometry
0.500 absorbance units " 40 !g/mL per absorbance
unit " 10 # 200 !g/mL Fluorometry or fluorescent spectroscopy measures fluo-
rescence related to DNA concentration in association
The yield of the sample is calculated using the volume
with DNA-specific fluorescent dyes. Early methods used
of the preparation. If in the case illustrated above, the
3,5-diaminobenzoic acid 2HCl (DABA).9 This dye com-
DNA was eluted or resuspended in 0.2 mL, the yield
bines with alpha methylene aldehydes (deoxyribose) to
would be:
yield a fluorescent product. It is still used for the detec-
200 !g/mL " 0.2 mL # 40 !g tion of nuclei and as a control for hybridization and spot
Spectrophotometric measurements also indicate the integrity in microarray analyses.
quality of nucleic acid. Protein absorbs light at 280 nm More modern procedures use the DNA-specific dye
through the tryptophane residues. The absorbance of the Hoechst 33258 {2-[2-(4-hydroxyphenyl)-(6-benzimida-
nucleic acid at 260 nm should be 1.62.00 times more zol)]-6-(1-methyl-4-piperazyl)-benzimidazol/.3HCl}.
than the absorbance at 280 nm. If the 260 nm/280 nm This dye combines with adenine-thymine base pairs in
ratio is less than 1.6, the nucleic acid preparation may be the minor groove of the DNA double helix and is thus
contaminated with unacceptable amounts of protein and specific for intact double-stranded DNA. This binding
not of sufficient purity for use. Such a sample can be specificity for A-T residues however, complicates meas-
improved by reprecipitating the nucleic acid or repeating urements of DNA that have unusually high or low GC
the protein removal step of the isolation procedure. It content. A standard measurement is required to determine
should be noted that low pH can affect the 260 nm/280 concentration by fluorometry, and this standard must have
nm ratio. Somewhat alkaline buffers (pH 7.5) are recom- GC content similar to that of the samples being measured.
mended for accurate determination of purity. RNA Calf thymus DNA (GC content # 50%) is often used as a
affords a somewhat higher 260 nm/280 nm ratio, 2.02.3. standard for specimens with unknown DNA GC content.
A DNA preparation with a ratio higher than 2.0 may be Fluorometric determination of DNA concentration using
contaminated with RNA. Some procedures for DNA Hoechst dye is very sensitive (down to 200 ng DNA/mL).
04Buckingham (F)-04 2/6/07 5:53 PM Page 78

78 Section 2 Common Techniques in Molecular Biology

PicoGreen and OliGreen (Molecular Probes, Inc.) are


other DNA-specific dyes that can be used for fluoromet- STUDY QUESTIONS
ric quantitation. Due to brighter fluorescence upon bind-
ing to double-stranded DNA, PicoGreen is more sensitive DNA Quantity/Quality
than Hoechst dye (detection down to 25 pg/mL concen-
trations). Like Hoechst dye, single-stranded DNA and 1. Calculate the DNA concentration in !g/mL from the
RNA do not bind to PicoGreen. OliGreen is designed to following information:
bind to short pieces of single-stranded DNA (oligonu- a. Absorbance reading at 260 nm from a 1:100 dilu-
cleotides). This dye will detect down to 100 pg/mL of tion " 0.307
single-stranded DNA. OliGreen will not fluoresce when b. Absorbance reading at 260 nm from a 1:50 dilu-
bound to double-stranded DNA or RNA. tion " 0.307
RNA may be measured in solution using SybrGreen II c. Absorbance reading at 260 nm from a 1:100 dilu-
RNA gel stain.10 Intensity of SyBrGreen II fluorescence is tion " 0.172
less with polyadenylated RNA than with total RNA by d. Absorbance reading at 260 nm from a 1:100 dilu-
20%26%. The sensitivity of this dye is down to 2 ng/mL. tion " 0.088
SybrGreen II, however, is not specific to RNA and will
bind and fluoresce with double-stranded DNA as well. 2. If the volume of the above DNA solutions was 0.5
Contaminating DNA must, therefore, be removed in order mL, calculate the yield for a.d.
to get an accurate determination of RNA concentration.
Fluorometry measurements require calibration of the 3. Three DNA preparations have the following A260
instrument with a known amount of standard before and A280 readings:
every run. For methods using Hoechst dye, the dye is
diluted to a working concentration of 1 !g/mL in water. Sample OD260 OD280
The dye is then mixed with the sample (usually a dilution 1 0.419 0.230
of the sample). Once the dye and sample solution are 2 0.258 0.225
mixed, fluorescence must be read within 2 hours because
the dye/sample complex is stable only for approximately 3 0.398 0.174
this amount of time. The fluorescence is read in a quartz
cuvette. A programmed fluorometer will read out a con- For each sample, based on the A260/ A280 ratio, is
centration based on the known standard calibration. each preparation suitable for further use? If not,
Absorption and fluorometry readings may not always what is contaminating the DNA?
agree. First, the two detection methods recognize differ-
ent targets. Single nucleotides do not bind to fluorescent RNA Quantity/Quality
dyes, but they can absorb ultraviolet light and affect spec-
trometric readings. Furthermore, absorption measure- 1. Calculate the RNA concentration in !g/mL from the
ments do not distinguish between DNA and RNA, so following information:
contaminating RNA may be factored into the DNA meas- a. Absorbance reading at 260 nm from a 1:100 dilu-
urement. RNA does not enhance fluorescence of the flu- tion " 0.307
orescent dyes and is thus invisible to fluorometric b. Absorbance reading at 260 nm from a 1:50 dilu-
detection. In fact, specific detection of RNA in the pres- tion " 0.307
ence of DNA in solution is not yet possible. The decision c. Absorbance reading at 260 nm from a 1:100 dilu-
which instrument to use is at the discretion of the labora- tion " 0.172
tory. Most laboratories use spectrophotometry because d. Absorbance reading at 260 nm from a 1:100 dilu-
the samples can be read directly without staining or mix- tion " 0.088
ing with dye. For methods that require accurate measure-
ments of low amounts of DNA or RNA (in the 2. If the volume of the above RNA solutions was 0.5 mL,
10100ng/mL range), fluorometry may be preferred. calculate the yield for a.d.
04Buckingham (F)-04 2/6/07 5:53 PM Page 79

Nucleic Acid Extraction Methods Chapter 4 79

3. An RNA preparation has the following absorbance 12. Dani S, Gomes-Ruiz AC, Dani MAC. Evaluation
readings: of a method for high yield purification of largely
A260 ! 0.208 intact mitochondrial DNA from human placentae.
A280 ! 0.096 Genetic and Molecular Research 2003;2(2):
17884.
Is this RNA preparation satisfactory for use? 13. Leal-Klevezas D, Martnez-Vzquez IO, Cuevas-
Hernndez B, et al. Antifreeze solution improves
References DNA recovery by preserving the integrity of
1. Mirsky AE. The discovery of DNA. Scientific pathogen-infected blood and other tissues. Clini-
American 1968;218(6):7888. cal and Diagnostic Laboratory Immunology
2. Meselson M, Stahl FW. The replication of DNA in 2000;7(6):94546.
Escherichia coli. Proceedings of the National 14. ORourke D, Hayes MG, Carlyle SW. Ancient
Academy of Sciences 1958;44:67182. DNA studies in physical anthropology. Annual
3. Vogelstein GD. Preparative and analytical purifica- Review of Anthropology 2000;29:21742.
tion of DNA from agarose. Proceedings of the 15. Shia S-R, Cotea RJ, Wub L, et al. DNA extraction
National Academy of Sciences 1979;76:61519. from archival formalin-fixed, paraffin-embedded
4. Carter MJ., Milton ID. An inexpensive and simple tissue sections based on the antigen retrieval princi-
method for DNA purifications on silica particles. ple: Heating under the influence of pH. Journal
Nucleic Acids Research 1993;21(4):1044. of Histochemistry and Cytochemistry 2002;50:
5. Walsh P, Metzger DA, Higuchi R. Chelex 100 as a 100511.
medium for simple extraction of DNA for PCR- 16. Cao W, Hashibe M, Rao J-Y, et al. Comparison
based typing from forensic material. BioTechniques of methods for DNA extraction from paraffin-
1991;10(4):50613. embedded tissues and buccal cells. Cancer Detec-
6. de Lamballerie X, Zandotti C, Vignoli C, et al. A tion and Prevention 2003;27:397404.
one-step microbial DNA extraction method using 17. Blomeke B, Bennett WP, Harris CC, et al. Serum,
Chelex 100 suitable for gene amplification. plasma and paraffin-embedded tissues as sources
Research in Microbiology (Paris) 1992;143(8): of DNA for studying cancer susceptibility genes.
78590. Carcinogenesis 1997;18:127175.
7. de Lamballerie X, Chapel F, Vignoli C, et al. 18. McOrist A, Jackson M, Bird AR. A comparison of
Improved current methods for amplification of five methods of extraction of bacterial DNA from
DNA from routinely processed liver tissue by PCR. human faecal samples. Journal of Microbiological
Journal of Clinical Pathology 1994;47:46667. Methods 2002;50:13139.
8. Coombs N, Gough AC, Primrose JN. Optimisa- 19. Barbaric D, Dalla-Pozza L, Byrne JA. A reliable
tion of DNA and RNA extraction from archival method for total RNA extraction from frozen
formalin-fixed tissue. Nucleic Acids Research human bone marrow samples taken at diagnosis
1999;27(16):e12. of acute leukaemia. Journal of Clinical Pathology
9. Kissane J, Robins E. The fluorometric measurement 2002;55(11):86567.
of deoxyribonucleic acid in animal tissues with 20. Byers R, Roebuck J, Sakhinia E, et al. PolyA
special reference to the central nervous system. PCR amplification of cDNA from RNA extracted
Journal of Biological Chemistry 1958;233:18488. from formalin-fixed paraffin-embedded tissue.
10. Schmidt D, Ernst JD. A fluorometric assay for the Diagnostic Molecular Pathology 2004;13(3):1
quantification of RNA in solution with nanogram 4450.
sensitivity. Analytical Biochemistry 1995;232: 21. Medeiros M, Sharma VK, Ding R, et al. Optimiza-
14446. tion of RNA yield, purity, and mRNA copy number
11. Aplenc R, Orudjev E, Swoyer J, et al. Differential by treatment of urine cell pellets with RNA later.
bone marrow aspirate DNA yields from commercial Journal of Immunological Methods 2003;279
extraction kits. Leukemia 2002;16(9):186566. (1-2):13542.
05Buckingham (F)-05 2/6/07 12:30 PM Page 80

Chapter 5 Lela Buckingham

Resolution and
Detection of
Nucleic Acids

OUTLINE OBJECTIVES
ELECTROPHORESIS Explain the principle and performance of electrophoresis
GEL SYSTEMS as it applies to nucleic acids.
Agarose Gels Compare and contrast the agarose and polyacrylamide gel
Polyacrylamide Gels polymers commonly used to resolve nucleic acids, and
Capillary Electrophoresis
state the utility of each polymer.
BUFFER SYSTEMS
Buffer Additives Explain the principle and performance of capillary elec-
trophoresis as it is applied to nucleic acid separation.
ELECTROPHORESIS EQUIPMENT
GEL LOADING Give an overview of buffers and buffer additives used in
electrophoretic separation, including the constituents, pur-
DETECTION SYSTEMS
Nucleic AcidSpecific Dyes
pose, and importance.
Silver Stain Describe the general types of equipment used for elec-
trophoresis and how samples are introduced for elec-
trophoretic separation.
Compare and contrast pulse field gel electrophoresis and
regular electrophoresis techniques with regards to method
and applications.
Compare and contrast detection systems used in nucleic
acid applications.

80
05Buckingham (F)-05 2/6/07 12:30 PM Page 81

Resolution and Detection of Nucleic Acids Chapter 5 81

Resolution and detection of nucleic acids are done in sev-


eral ways. Gel and capillary electrophoresis are the most
practical and frequently used methods. DNA can also be
spotted and detected using specific hybridization probes,
as will be described in Chapter 10.

+
Electrophoresis
Electrophoresis is the movement of molecules by an
electric current. This can occur in solution, but it is prac- +
tically done in a matrix to limit migration and contain the
migrating material. Electrophoresis is routinely applied Figure 5-1 Horizontal (left) and vertical (right) gel elec-
to the analysis of proteins and nucleic acids. Each phos- trophoresis. In both formats, sample is introduced into the gel
at the cathode end (small arrows) and migrates with the cur-
phate group on a DNA polymer is ionized, making DNA rent toward the anode.
a negatively charged molecule. Under an electric current,
DNA will migrate toward the positive pole (anode).
When DNA is applied to a macromolecular cage such as Gel Systems
agarose or polyacrylamide, its migration under the pull
of the current is impeded, depending on the size of the Gel matrices provide resistance to the movement of mol-
DNA and the spaces in the gel. Because each nucleotide ecules under the force of the electric current. They pre-
has one negative charge, the charge-to-mass ratio of mol- vent diffusion and reduce convection currents so that the
ecules of different sizes will remain constant. DNA frag- separated molecules form a defined group, or band.
ments will therefore migrate at speeds inversely related The gel can then serve as a support medium for analysis
to their size. Electrophoresis can be performed in tubes, of the separated components. These matrices must be
slab gels, or capillaries. Slab gel electrophoresis can have unaffected by electrophoresis, simple to prepare and
either a horizontal or vertical format (Fig. 5-1). amenable to modification. Agarose and polyacrylamide
are polymers that meet these criteria.

Agarose Gels
Advanced Concepts Agarose is a polysaccharide polymer extracted from sea-
weed. It is a component of agar used in bacterial culture
Double-stranded DNA and RNA are analyzed by
dishes. Agarose is a linear polymer of agarobiose, which
native gel electrophoresis. The relationship between
consists of 1,3-linked-!-D-galactopyranose and 1,4-
size and speed of migration can be improved by sep-
linked 3,6-anhydro-"-L-galactopyranose (Fig. 5-2).
arating single-stranded nucleic acids; however, both
DNA and RNA favor the double-stranded state.
Unpaired, or denatured, DNA and RNA must, O
6 CH2OH
therefore, be analyzed in conditions that prevent the 5 3 2
O
hydrogen bonding between complementary sequen- OH O OH
OH 1
ces. These conditions are maintained through a 4
1 4
6 CH2

combination of formamide mixed with the sample, O


O 2 5 O
urea mixed with the gel, and/or heat-denaturing 3

electrophoresis. OH
Figure 5-2 Agarobiose is the repeating unit of agarose.
05Buckingham (F)-05 2/6/07 12:30 PM Page 82

82 Section 2 Common Techniques in Molecular Biology

Hydrated agarose gels in various concentrations,


buffers, and sizes can be purchased ready for use. Alter-
natively, agarose can be purchased and stored in the labo-
Advanced Concepts
ratory in powdered form. For use, powdered agarose is The physical characteristics of the agarose gel can
suspended in buffer, heated, and poured into a mold. The be modified by altering its polymer length and heli-
concentration of the agarose dictates the size of the spaces cal parameters. Several types of agarose are thus
in the gel and will, therefore, be determined by the size of available for specific applications. The resolving
DNA to be resolved (Table 5.1). Small pieces of DNA properties differ in these preparations as well as the
(50500 bp) are resolved on more concentrated agarose gelling properties. Low-melting agarose is often
gels, e.g., 2%3% (Fig. 5-3). Larger fragments of DNA used for re-isolating resolved fragments from the
(200050,000) are best resolved in lower agarose concen- gel. Other agarose types give better resolution of
trations, e.g., 0.5%1%. Agarose concentrations above larger or smaller fragments. Modern agarose prepa-
5% and below 0.5% are not practical. High-concentration rations are sufficiently pure to avoid problems such
agarose will impede migration, whereas very low concen- as electroendosmosis, a solvent flow toward one of
trations produce a weak gel with limited integrity. the electrodes, usually the cathode (negative), in
opposition to the DNA or RNA migration. This
slows and distorts the migration of the samples,
2% 4% 5%
reducing resolution and smearing the bands.

500 bp
Pulsed Field Gel Electrophoresis
Very large, i.e., 50,000250,000 bp, pieces of DNA can-
500 bp not be resolved efficiently by simple agarose elec-
trophoresis. Even in the lowest concentrations of agarose,
megabase fragments are too severely impeded for correct
resolution (referred to as limiting mobility). Limiting
200 bp

mobility is reached when a DNA molecule can move


200 bp only lengthwise through successive pores of the gel, a
process called reptation.
For genomic-sized DNA molecules, pulses of current
800 bp
applied to the gel in alternating dimensions enhance

500 bp Table 5.1 Choice of Agarose Concentration


for DNA Gels*10
Agarose Concentration (%) Separation Range (size in bp)
50 bp
0.3 500060,000
0.6 100020,000
200 bp 0.8 80010,000
1.0 4008000
50 bp 1.2 3007000
1.5 2004000
2.0 1003000
50 bp *The table shows the range of separation for linear double-stranded DNA
molecules in TAE agarose gels with regular power sources. Note that these
Figure 5-3 Resolution of double-stranded DNA fragments values may be affected if another running buffer is used and if voltage is
on 2%, 4%, and 5% agarose. over 5 V/cm.
05Buckingham (F)-05 2/6/07 12:30 PM Page 83

Resolution and Detection of Nucleic Acids Chapter 5 83

Choice of Polyacrylamide Concentration


Advanced Concepts
Table 5.2
for DNA Gels*10
Acrylamide Concentration (%) Separation Range (size in bp) Field inversion gel electrophoresis (FIGE) is a spe-
3.5 1001000 cial modification of PFGE in which the alternating
5.0 80500 currents are aligned 180! with respect to each other.
8.0 60400 The current pulses must be applied at different
12.0 40200 strength and/or duration so that the DNA will make
20.0 10100 net progress in one dimension. The parameters for
*The indicated figures are referring to gels run in TBE buffer. Voltages this type of separation must be matched to the DNA
over 8 V/cm may affect these values. being separated so that both large and small frag-
ments of the DNA sample have time to reorient
properly. For example, if timing is not sufficient for
migration. This process is called pulsed field gel elec-
reorientation of the large fragments, small fragments
trophoresis (PFGE) (Fig. 5-4). The simplest approach to
will preferentially reorient and move backward and
this method is field inversion gel electrophoresis (FIGE).1
gradually lose distance with respect to the large mol-
FIGE works by alternating the positive and negative elec-
ecules, which will continue forward progress on the
trodes during electrophoresis. In this type of separation,
next pulse cycle. Unlike PFGE that requires special
the DNA goes periodically forward and backward. This
equipment, FIGE can be done in a regular gel appa-
method requires temperature control and a switching
ratus; however, its upper resolution limit is 2
mechanism. Contour-clamped homogeneous electric
megabases compared with 5 megabases for PFGE.
field,2 transverse alternating field electrophoresis,3 and
rotating gel electrophoresis 4,5 are examples of commonly
used pulsed field or transverse angle reorientation elec-
trophoresis. These systems require a special gel box with
a special electrode and gel configuration as well as appro-
priate electronic control for switching the electric fields
FIGE TAFE during electrophoresis. Using PFGE, the large fragments
are resolved, not only by sifting through the spaces in the

polymer but also by their reorientation and the time nec-

essary to realign themselves to move in a second dimen-


+

Above
gel sion, usually an angle of 120! (180! for FIGE) from the
Below original direction of migration.
gel DNA to be resolved by these methods must be pro-
+ + tected from breakage and shearing. Therefore, specimens
are immobilized in an agarose plug before cell lysis.
RGE CHEF Further treatment of the DNA, e.g., with restriction

enzymes, is also performed while the DNA is immobi-

lized in the agarose plug. After treatment, the plug is
inserted directly into the agarose gel for electrophoresis.
+ PFGE instruments are designed to apply current in alter-
nating directions at specific times (called the switch
interval) that are set by the operator. These parameters
+
+ are based on the general size of the fragments to be ana-
lyzed; i.e., a larger fragment will require a longer switch
Figure 5-4 Field inversion gel electrophoresis (FIGE),
interval. PFGE is a slow migration method. Sample runs
contour-clamped homogeneous electric field (CHEF), trans-
verse alternating field electrophoresis (TAFE), and rotating gel will take 24 hours or more.
electrophoresis (RGE) are all examples of pulsed field gel con- Alternating field electrophoresis is used for applica-
figurations. Arrows indicate the migration path of the DNA. tions that require the resolution of chromosome-sized
05Buckingham (F)-05 2/6/07 12:30 PM Page 84

84 Section 2 Common Techniques in Molecular Biology

CH2 CH CH2 CH CH2 CH CH2 CH CH2 CH


Persulfate
C O + C O C O C O C O
TEMED
NH2 NH NH2 NH NH2

Acrylamide CH2 CH2

NH NH2 NH NH2

C O C O C O C O

CH2 CH CH2 CH Figure 5-5 The repeating


CH2 CH CH2 CH
H unit of polyacrylamide is acry-
BIS lamide; bis introduces branches
Polyacrylamide into the polymer.

fragments of DNA such as in bacterial typing for epi-


demiological purposes. Digestion of genomic DNA with
restriction enzymes will yield a band pattern specific to
each type of organism. By comparing band patterns, the
similarity of organisms isolated from various sources can
800 bp
be assessed. This information is especially useful in
determining the epidemiology of infectious diseases,
e.g., identifying whether two biochemically identical iso-
lates have a common source. This will be discussed in
more detail in Chapter 12.

Polyacrylamide Gels
500 bp
Very small DNA fragments and single-stranded DNA are
best resolved on polyacrylamide gels in polyacrylamide
gel electrophoresis (PAGE). Acrylamide, in combination
with the cross-linker methylene bisacrylamide (Fig. 5-5),
polymerizes into a gel that has consistent resolution char-
acteristics (Fig. 5-6).
200 bp

Figure 5-6 Resolution of double-stranded DNA fragments


Advanced Concepts on a 5%, 19:1 acrylamide:bis gel.

Different cross-linkers affect the physical nature of Polyacrylamide was originally used mostly for protein
the acrylamide mesh. Piperazine diacrylate can separation, but it is now routinely applied to nucleic acid
reduce the background staining that may occur analysis. Polyacrylamide gels are used for sequencing
when the gel is stained. N,N!-bisacrylylcystamine nucleic acids, mutation analyses, nuclease protection
and N,N!-diallyltartardiamide enable gels to be sol- assays, and other applications requiring the resolution of
ubilized to enable for the easier extraction of sepa- nucleic acids down to the single-base level. Acrylamide
rated products. is supplied to the laboratory in several forms. The pow-
dered form is a dangerous neurotoxin and must be han-
05Buckingham (F)-05 2/6/07 12:30 PM Page 85

Resolution and Detection of Nucleic Acids Chapter 5 85

dled with care. Solutions of mixtures of acrylamide and below 5% will increase pore size. Usually, C is set at
bis-acrylamide are less hazardous and more convenient 3.3% (29:1) for native and 5% (19:1) for standard DNA
to use. Preformed gels are the most convenient, as the and RNA gels.
procedure for preparation of acrylamide gels is more
involved than that for agarose gels.
Capillary Electrophoresis
The composition of polyacrylamide gels is represented
as the total percentage concentration (w/v) of monomer The widest application of capillary electrophoresis has
(acrylamide with cross-linker) T and the percentage been in the separation of organic chemicals such as phar-
of monomer that is cross-linker C. For example, a 6% maceuticals and carbohydrates. It has also been applied
19:1 acrylamide:bis gel has a T value of 6% and a C to the separation of inorganic anions and metal ions. It is
value of 5%. an alternate method to high performance liquid chro-
Unlike agarose gels that polymerize upon cooling, matography (HPLC) for these applications. Capillary
polymeration of polyacrylamide gels requires the use electrophoresis has the advantage of faster analytical runs
of a catalyst. The catalyst may be the nucleation agents, and lower cost per run than HPLC. Increasingly, capillary
ammonium persulfate (APS) plus N,N,N!,N!-tetram- electrophoresis is being used for the separation and
ethylethylenediamine (TEMED), or light activation. APS analysis of nucleic acids, which is explained below.
produces free oxygen radicals in the presence of TEMED In this type of electrophoresis, the analyte is resolved
to drive the free-radical polymerization mechanism. Free in a thin glass (fused silica) capillary that is 30100 cm
radicals can also be generated by a photochemical in length and has an internal diameter of 25100 "m.
process using riboflavin plus TEMED. Excess oxygen Fused silica is used as the capillary tube because it is the
inhibits the polymerization process. Therefore, deaera- most transparent material allowing for the passage of flu-
tion, or the removal of air, of the gel solution is often orescent light. The fused silica is covered with a poly-
done before the addition of the nucleation agents. imide coating for protection. There is an uncoated
Polyacrylamide gels for nucleic acid separation are window where the light is shone on the fragments as they
very thin, e.g., 50 "m, making gel preparation difficult. pass the detector. The fused silica has a negative charge
Systems have been designed to facilitate the preparation along the walls of the capillary generated by the dissoci-
of single and multiple gels. Increasing numbers of labo- ation of hydroxyl ions from the molecules of silicone.
ratories are using preformed polyacrylamide gels to This establishes an electro-osmotic flow when a current
avoid the hazards of working with acrylamide and the is introduced along the length of the capillary. Under the
labor time involved in gel preparation. Use of preformed force of the current, small and negatively charged mole-
gels must be scheduled, keeping in mind the limited shelf cules migrate faster than large and positively charged
life of the product. molecules (Fig. 5-7).
The main advantage of polyacrylamide over agarose is Capillary electrophoresis was originally applied to
the higher resolution capability for small fragments that molecules in solution. Separation was based on their size
can be accomplished with polyacrylamide. A variation of and charge (charge/mass ratio). Optimal separation
1 base pair in a 1-kb molecule (0.1% difference) can be requires the use of the proper buffer to ensure that the
detected in a polyacrylamide gel. Another advantage of solute is charged. Negatively charged molecules are com-
polyacrylamide is that, unlike agarose, the components of pletely ionized at high pH, whereas positively charged
polyacrylamide gels are synthetic; thus, there is not as solutes are completely protonated in low pH buffers.
much difference in batches obtained from different Nucleic acids do not separate well in solution. As the
sources. Further, altering T and C in a polyacrylamide gel size or length of a nucleic acid increases (retarding
can change the pore size and, therefore, the sieving prop- migration), so does its negative charge (speeding migra-
erties in a predictable and reproducible manner. tion), effectively confounding the charge/mass resolu-
Increasing T decreases the pore size proportionally. The tion. Introduction of a polymer inside the capillary
minimum pore size (highest resolution for small mole- restores resolution by retarding migration according to
cules) occurs at a C value of 5%. Variation of C above or size more than charge. It is important that the nucleic acid
05Buckingham (F)-05 2/6/07 12:30 PM Page 86

86 Section 2 Common Techniques in Molecular Biology

testing performed by analyzing short tandem repeat poly-


+ morphisms. It has other applications in the clinical labo-
+ ratory, such as clonality testing, microsatellite instability
+ + +
detection, and bone marrow engraftment analysis.
Specially designed software can use differentially labeled
Net flow molecular weight markers or allelic markers that, when
run through the capillary with the sample, help to iden-
Laser tify sample bands.
The capillary system has the advantages over tradi-
+ tional slab gel electrophoresis of increased sensitivity, so
that smaller amounts of nucleic acid can be analyzed, and
Net flow
immediate detection of desired bands. With multiple
Detector
color detection systems, standards, controls, and test
samples can be run through the capillary together,
thereby eliminating the lane-to-lane variations that can
occur across a gel. Although instrumentation for capillary
Buffer Buffer electrophoresis is costly and detection requires fluores-
cent labeling of samples that can also be expensive, labor
High voltage and run time are greatly decreased as compared with gel
Figure 5-7 Capillary electrophoresis separates particles by electrophoresis. In addition, analytical software can auto-
size (small, fast migration; large, slow migration) and charge matically analyze results that are gathered by the detector
(negative, fast migration; positive, slow migration) in the capillary electrophoresis instrument.

be completely denatured (single-stranded) so that it will


be separated according to its size, because secondary Buffer Systems
structure will affect the migration speed. Generally, 150 The purpose of a buffer system is to carry the current and
nL of denatured nucleic acid in buffer containing for- protect the samples during electrophoresis. This is
mamide is introduced to the capillary, which is held at a accomplished through the electrochemical characteristics
denaturing temperature through the run. of the buffer components.
The sample is injected into the capillary by electroki- A buffer is a solution of a weak acid and its conjugate
netic, hydrostatic, or pneumatic injection. For nucleic base. The pH of a buffered solution remains constant as
acid analysis, electrokinetic injection is used. The plat- the buffer molecules take up or release protons given off
inum electrode close to the end of the capillary undergoes or absorbed by other solutes. The equilibrium between
a transient high-positive charge to draw the sample into acid and base in a buffer is expressed as the dissociation
the end of the capillary. When the current is established, constant, Ka:
the fragments migrate through the capillary. For the res-
[H!][A"]
olution of nucleic acids, capillary electrophoresis is anal-
Ka #
ogous to gel electrophoresis with regard to the
[HA]
electrophoretic parameters. The capillarys small volume,
as compared with that of a slab gel, can dissipate heat where [H!], [A-], and [HA] represent the dissociated
more efficiently during the electrophoresis process. More proton, dissociated base, and associated salt concentra-
efficient heat dissipation allows the technologist to run tions, respectively. Ka is most commonly expressed as its
the samples at higher charge per unit area, which means negative logarithm, pKa, such that
that the samples migrate faster, thereby decreasing the pKa # -log Ka
resolution (run) time. A pKa of 2 (Ka # 10-2) favors the release of protons.
Nucleic acid resolution by capillary electrophoresis is A pKa of 12 (Ka # 10-12) favors the association of
used extensively in forensic applications and parentage protons.
05Buckingham (F)-05 2/6/07 12:30 PM Page 87

Resolution and Detection of Nucleic Acids Chapter 5 87

A given buffer maintains the pH of a solution near its


pKa. The amount the pH of a buffer will differ from the
pKa is expressed as the Henderson-Hasselbach equation:
Advanced Concepts
The migration of buffer ions is not restricted by the
[basic form]
gel matrix, so the speed of their movement under a
pH ! pKa " log
current is governed strictly by the size of the ion and
[acidic form] its charge (charge/mass ratio). Tris is a relatively
If the acidic and the basic forms of the buffer in solu- large molecule, so its charge-to-mass ratio is low,
tion are of equal concentration, pH ! pKa. If the acidic and it moves through the current relatively slowly,
form predominates, the pH will be less than the pKa; if even at high concentrations, giving increased buffer-
the basic form predominates, the pH will be greater than ing capacity.
the pKa.
The Henderson-Hasselbach equation predicts that, in
order to change the pH of a buffered solution by one
point, either the acidic or basic form of the buffer must be
etc., move through the gel more quickly; that is, they
brought to a concentration of 1/10 that of the other form.
increase conductivity without increasing buffering capac-
Therefore, addition of acid or base will barely affect the
ity. This results in too much current passing through the
pH of a buffered solution as long as the acidic or basic
gel as well as faster depletion of the buffer. Therefore,
forms of the buffer are not depleted.
buffer components such as Tris base or borate are pre-
Control of the pH of a gel by the buffer also protects
ferred because they remain partly uncharged at the
the sample molecules from damage. Furthermore, the
desired pH and thus maintain constant pH without high
current through the gel is carried by buffer ions, prevent-
conductivity.
ing severe fluctuations in the pH of the gel.
In addition to pKa, charge, and size, other buffer char-
A buffer concentration must be high enough to provide
acteristics that can be taken into account when choosing
sufficient acidic and basic forms to buffer its solution.
a buffer include toxicity, interaction with other compo-
Raising the buffer concentration, however, also increases
nents, solubility, and ultraviolet absorption.
the conductivity of the electrophoresis system, generat-
The Tris buffers Tris borate EDTA (TBE; 0.089 M Tris-
ing more heat at a given voltage. This can cause problems
base, 0.089 M boric acid, 0.0020 M EDTA), Tris phos-
with gel stability and can increase sample denaturation.
phate EDTA (TPE; 0.089 M Tris-base, 1.3% phosphoric
High buffer concentrations must therefore be offset by
acid, 0.0020 M EDTA) and Tris acetate EDTA (TAE; 0.04
low voltage.
M Tris-base, 0.005 M sodium acetate, 0.002 M EDTA)
In order for nucleic acids to migrate properly, the gel
are most commonly used for electrophoresis of DNA.
system must be immersed in a buffer that conducts the
There are some advantages and disadvantages of both
electric current efficiently in relation to the buffering
TBE and TAE that must be considered before one of these
capacity. Ions with high-charge differences, "2, -2, "3,
buffers is used for a particular application. TBE has a
greater buffering capacity than TAE. Although the ion
species in TAE are more easily exhausted during extended
Advanced Concepts or high-voltage electrophoresis, DNA will migrate twice
as fast in TAE than in TBE in a constant current. TBE is
The Henderson-Hasselbach equation also predicts not recommended for some post-electrophoretic isolation
the concentration of the acidic or basic forms at a procedures. When using any buffer, especially TBE and
given pH. It can be used to calculate the state of ion- TPE, care must be taken that the gel does not overheat
ization, i.e., the predominance of acidic or basic when run at high voltage in a closed container. Finally,
forms, of a species in solution. A buffer should be stock solutions of TBE are prone to precipitation. This
chosen that has a pKa within a half point of the can result in differences in concentration between the
desired pH, which is about 8.0 for nucleic acids. buffer in the gel and the running buffer. Such a gradient
will cause localized distortions in nucleic acid migration
05Buckingham (F)-05 2/6/07 12:30 PM Page 88

88 Section 2 Common Techniques in Molecular Biology

patterns, often causing a salt wave that is visible as a sharp


+
horizontal band through the gel.
Gel
Buffer Additives Buffer
Magnet
Buffer additives are often used to modify sample mole-
cules in ways that affect their migration. Examples of Magnetic stirrer

these additives are formamide, urea, and various deter-


gents. Denaturing agents, such as formamide or urea, Tubing Tubing
break hydrogen bonds between complementary strands Peristaltic
pump
or within the same strand of DNA or RNA. The confor-
mation or solubility of molecules can be standardized by Figure 5-8 A peristaltic pump can be used to recirculate
buffer from the cathode to the anode end while running a
the addition of one or both of these agents. Formamide
denaturing gel.
and heat added to DNA and RNA break and block the
hydrogen bonding sites, hindering complementary
sequences from reannealing. As a result, the molecules pump or by stopping the gel at intervals and transferring
become long, straight, unpaired chains. Urea and heat in the buffer from the cathode to the anode ends.
the gel systems maintain this conformation such that
intrachain hybridization (folding) of the nucleic acid
molecules does not affect migration speeds, and separa-
Electrophoresis Equipment
tion can occur strictly according to the size or length of Gel electrophoresis can be done in one of two confor-
the molecule. mations, horizontal or vertical. In general, agarose gels
Electrophoresis of RNA requires different conditions are run horizontally, and polyacrylamide gels are run ver-
imparted by different additives than are used with DNA. tically.
Because RNA is single-stranded and it tends to fold to Horizontal gels are run in acrylic containers called gel
optimize internal homology, it must be completely dena- boxes or baths that are divided into two parts with a plat-
tured to prevent folding in order to accurately determine form in the middle on which the gel rests (Fig. 5-9).
its size by migration in a gel system. The secondary Platinum wires make up the electrodes in the gel com-
structures formed in RNA are strong and more difficult to partments. The wires are connected to a power source by
denature than DNA homologies. Denaturants used for banana clips or connectors through the walls of the con-
RNA include methylmercuric hydroxide (MMH), which tainer. The gel in the box is submerged with elec-
reacts with amino groups on the RNA preventing base trophoresis buffer filling both compartments and making
pairing between homologous nucleotides, and aldehydes a continuous system through which the current flows.
(e.g., formaldehyde, glyoxal), which also disrupt base The thickness of the gel and the volume of the buffer
pairing. MMH is not used routinely because of its affect migration, so these parameters should be kept con-
extreme toxicity. stant for consistent results. As the gel is submerged
RNA can be separated in 10-mM sodium phosphate, through the loading and electrophoresis process, horizon-
pH 7, or MOPS buffer (20 mM 3-[N-morpholino] tal gels are sometimes referred to as submarine gels. The
propanesulfonic acid, pH 7, 8-mM sodium acetate, 1 mM power supply will deliver voltage, setting up a current
EDTA, pH 8). The RNA sample is incubated in dimethyl that will run through the gel buffer and the gel, carrying
sulfoxide, 1.1 M glyoxal (ethane 1.2 dione) and 0.01 M the charged sample through the matrix of the gel at a
sodium phosphate, pH 7, to denature the RNA prior to speed corresponding to the charge/mass ratio of the sam-
loading the sample on the gel. Due to pH drift (decrease ple molecules.
of pH at the cathode [-] and increase of the pH at the Horizontal agarose gels are cast as square or rectangu-
anode [!]) during the run, the buffer should be recircu- lar slabs of varying size. Purchased gel boxes come with
lated from the anode end of the bath to the cathode end casting trays that mold the gel to the appropriate size for
(Fig. 5-8). This can be accomplished using a peristaltic the gel box. The volume of the gel solution will deter-
05Buckingham (F)-05 2/6/07 12:30 PM Page 89

Resolution and Detection of Nucleic Acids Chapter 5 89

Buffer solution Gel Electrode Vertical gel boxes have separate chambers that are
connected by the gel itself. Electrodes are attached to the
upper and lower buffer chambers to set up the current that
will run through the gel. The gel must be in place before
filling the upper chamber with buffer. Some systems have
a metal plate attached to the back of the gel to maintain
constant temperature across the gel. Maintaining constant
temperature throughout the gel is more of a problem with
vertical gels because the outer edges of the gel cool more
+ than the center, slowing migration in the outer lanes com-
(Black) (Red) pared with lanes in the center of the gel. This is called
Figure 5-9 A typical horizontal submarine gel system. A red gel smiling because similar-sized bands in the cooler
connector is attached to the positive outlet on the power outer lanes will migrate slower than comparable bands in
supply and a black to the negative port. the inside lanes. Ensuring that there is no variation in
temperature across the gel prevents gel smiling from
mine the thickness of the gel. Agarose, supplied as a dry occurring.
powder, is mixed at a certain percentage (w/v) with elec- Vertical gel systems can range from large sequencing
trophoresis buffer and heated on a heat block or by systems (35 cm " 26 cm) to mini-systems (8 cm " 10
microwave to dissolve and melt the agarose. The molten cm). Some mini-systems are big enough to accommodate
agarose is cooled to 55!65!C, and a certain volume is two gels at a time (Fig. 5-10). Mini-systems are used
poured into the casting tray as dictated by the gel box extensively for analyses that do not require single base
manufacturer or application. A comb is then inserted into
the top of the gel to create holes, or wells, in the gel into
Electrode
which the sample will be loaded. The size of the teeth in Buffer solution
the comb will determine the volume of loaded sample
and the number of teeth will determine the number of
wells that are available in the gel to receive samples. The
gel is then allowed to cool, during which time it will
solidify. After the gel has polymerized, the comb is care-
fully removed and the gel is placed into the gel box and
submerged in electrophoresis buffer.

Advanced Concepts
Self-contained agarose gel systems have been devel-
oped to facilitate the electrophoresis process. They Gel
are manufactured in closed plastic cassettes contain- +
Buffer solution
ing buffer, gel, and stain. These are convenient for
routine use, but restrict the gel configuration, i.e., Electrode
number and size of wells, etc. Also, the percentage Figure 5-10 A typical vertical gel apparatus. Polymerized
of agarose or acrylamide is limited to what is avail- gels are clamped into the gel insert (left) and placed in the
able from the manufacturer. Furthermore, the sepa- gel bath (right). The positive electrode will be in contact with
the bottom of the gel and the buffer, filling about a third of
rated nucleic acids can not be removed from these the gel bath. The negative electrode will be in contact with
closed cassettes, limiting their analysis. the top of the gel and a separate buffer compartment in the
top of the insert.
05Buckingham (F)-05 2/6/07 12:30 PM Page 90

90 Section 2 Common Techniques in Molecular Biology

pair resolution. The larger systems are used for sequenc- the gel is loaded, whereas the sharks-tooth combs are
ing or other procedures requiring single-base resolution. made so that the wells can be loaded while the comb is in
The gels are loaded from the top, below a layer of buffer place. When the standard combs are removed from the
in the upper chamber. Long, narrow gel-loading pipette gel, care must be taken not to break or displace the ears
tips that deposit the sample neatly on the floor of the well that were formed by the spaces between the teeth in the
increase band resolution and sample recovery. comb that separate the gel wells.
Vertical gels are cast between glass plates that are sep- Polyacrylamide gels can also be cast in tubes for iso-
arated by spacers. The spacers determine the thickness of electric focusing or two-dimensional gel electrophoresis.
the gel, ranging 0.054 mm. The bottom of the gel is The tubes containing the gels are placed into a chamber
secured by tape or by a gasket in specially designed gel separated as for vertical slab gels. The tubes are held in
casting trays. After addition of polymerization agents, the place by gaskets in the upper chamber. This gel configu-
liquid acrylamide is poured or forced between the glass ration, however, limits the number of samples, as only
plates with a pipet or a syringe. The comb is then placed one sample can be run per gel.
on the top of the gel. During this process, it is important
not to introduce air into the gel or beneath the comb. Gel Loading
Bubbles will form discontinuities in the gel, and oxygen
will inhibit the polymerization of the acrylamide. The Prior to loading the sample containing isolated nucleic
comb is of a thickness equal to that of the spacers so that acid onto the gel, tracking dye and a density agent are
the gel will be the same thickness throughout. As with added to the sample. The density agent (either Ficoll,
horizontal gels, the number and size of the comb teeth sucrose, or glycerol) increases the density of the solution
determine the number of wells in the gel and the sample as compared with the electrophoresis buffer. When the
volume that can be added to each well. Specialized sample solution is dispensed into the wells of the gel
combs, called sharks-tooth combs, are often used for below the surface of the buffer, it sinks into the well
sequencing gels (Fig. 5-11). These combs are placed instead of floating away in the buffer. The tracking dyes
upside down (teeth up, not in contact with the gel) to are used to monitor the progress of the electrophoresis
form a trough on the gel during polymerization. After run. The dyes migrate at specific speeds in a given gel
polymerization is complete, the comb is removed and concentration and usually run ahead of the smallest frag-
placed tooth-side down on top of the gel for loading. ments of DNA (compare Table 5.1, 5.2, and 5.3). They are
With this configuration, the spaces between the comb not associated with the sample DNA, and thus they do not
teeth form the wells as opposed to the teeth themselves affect the separation of the sample DNA. The movement
forming the wells in the horizontal gels. The advantage to of the tracking dye is monitored, and when the tracking
this arrangement is that the lanes are placed immediately dye approaches the end of the well electrophoresis is ter-
adjacent to one another to facilitate lane-to-lane compar- minated. Bromophenol blue is a tracking dye that is used
isons. When used, standard combs are removed before for many applications. Xylene cyanol green is another
example of chromophores that are used as tracking dyes
for both agarose and polyacrylamide gels.

Advanced Concepts
A type of bufferless electrophoresis system sup-
plies buffer in gel form or strips. These are laid next
to the preformed gel on a platform that replaces the
Figure 5-11 Combs for polyacrylamide electrophoresis. electrophoresis chamber. These systems can offer
Regular combs (top) have teeth that form the wells in the
gel. Sharks-tooth combs (bottom) are placed onto the
the additional advantage of precise temperature con-
polymerized gel, and the sample is loaded between the trol during the run.
teeth of the comb.
05Buckingham (F)-05 2/6/07 12:30 PM Page 91

Resolution and Detection of Nucleic Acids Chapter 5 91

rose or acrylamide and exposed to EtBR will emit orange


Advanced Concepts light when illuminated by ultraviolet light at 300 nm.
EtBr was the most widely used dye in early DNA and
Gels in cassette systems and gel strip systems can be RNA analyses. Care must be taken in handling EtBr
loaded without loading buffer because the wells are because it is carcinogenic. After electrophoresis, the
dry, precluding the need for density gradients. As agarose or acrylamide gel can be soaked in a solution of
these systems also have automatic shut-off at the 0.11mg/ml EtBr in running buffer (TAE, TBE, or TPE)
end of the run, tracking dye is usually not necessary, or TE. Alternatively, dye can be added directly to the gel
although some of these systems have a tracking dye before polymerization or to the running buffer. The latter
built into the gel and/or buffer. two measures save time and allow visualization of the
DNA during the run. Dye added to the gel, however, may
form a bright front across the gel that could mask inform-
ative bands. Dye added to the running buffer produces
Detection Systems more consistent staining, although more hazardous
Following are the status of samples during and after elec- waste is generated by this method. Some enclosed gel
trophoresis is accomplished using dyes that specifically systems contain EtBr inside a plastic enclosed gel cas-
associate with nucleic acid. The agents used most fre- sette, limiting exposure and waste. After soaking or run-
quently for this application are fluorescent dyes and sil- ning in EtBr, the DNA illuminated with ultraviolet light
ver stain. will appear as orange bands in the gel. The image can be
captured with a camera or by digital transfer to analytical
software.
Nucleic AcidSpecific Dyes
SyBr green is one of a set of stains introduced in 1995
Intercalating agents intercalate, or stack, between the as another type of nucleic acidspecific dye system. It
nitrogen bases in double-stranded nucleic acid. Ethidium differs from EtBr in that it does not intercalate between
bromide, 3,8-diamino-5-ethyl-6-phenylphenanthridinium bases; it sits in the minor groove of the double helix.
bromide (EtBr), is one of these agents. Under excitation SyBr green in association with DNA or RNA also emits
with ultraviolet light at 300 nm, EtBr in DNA emits vis- light in the orange range. SyBr green staining is 25100
ible light at 590 nm. Therefore, DNA separated in aga- times more sensitive than EtBr (detection level: 60 pg of
double-stranded DNA vs. 5 ng for EtBr). This is due, in
part, to background fluorescence from EtBr in agarose. A
Table 5.3 Tracking Dye Comigration* 1! dilution of the manufacturers 10,000X stock solution
of SyBr green in TAE, TBE, or TE can be used in meth-
Bromophenol Xylene Cyanol
Gel % Blue (Nucleotides) (Nucleotides) ods described for EtBr. A 1/100 dilution of SyBr green
can also be added directly to the DNA sample before
Agarose
electrophoresis. DNA prestaining decreases the amount
0.51.5 300500 40005000
of dye required for DNA visualization but lowers the sen-
2.03.0 80120 700800
sitivity of detection and may, at higher DNA concentra-
4.05.0 2030 100200
tions, interfere with DNA migration through the gel.6
PAGE Because SyBr green is not an intercalating agent, it is not
4 95 450 as mutagenic.7
6 60 240 Although SyBr green has some advantages over EtBr,
8 45 160 many laboratories continue to use the latter dye due to the
10 35 120 requirement for special optical filters for detection of
12 20 70 SyBr green. Scanning and photographic equipment opti-
20 12 45 mized for EtBr would have to be modified for optimal
*Migration depends on buffer type (TAE, TBE, or TPE) and the formula- detection of the SyBr green stains. New instrumentation
tion of agarose, acylamide, and bis. with more flexible detection systems allows utilization of
05Buckingham (F)-05 2/6/07 12:30 PM Page 92

92 Section 2 Common Techniques in Molecular Biology

the SyBr green stains. SyBr green is the preferred dye for a. The gel is blank (no bands, no molecular weight
real-time PCR methods. standard).
b. Only the molecular weight standard is visible.
Silver Stain
3. How does PFGE separate larger fragments more effi-
A more sensitive staining system originally developed for ciently than standard electrophoresis?
protein visualization is silver stain. After electrophoresis,
the sample is fixed with methanol and acetic acid. The gel 4. A 6% solution of 19:1 acylamide is mixed, deaerated,
is then impregnated with ammoniacal silver (silver and poured between glass plates for gel formation.
diamine) solutions or silver nitrate in a weakly acid solu- After an hour, the solution is still liquid. What might
tion.8 Interaction of silver ions with acidic or nucle- be one explanation for the gel not polymerizing?
ophilic groups on the target results in crystallization or
deposition of metallic silver under optimal pH condi- 5. A gel separation of RNA yields aberrantly migrating
tions. The insoluble black silver salt precipitates upon bands and smears. Suggest two possible explanations
introduction of formaldehyde in a weak acid solution or for this observation?
alkaline solution for sliver nitrate. Of the two procedures,
silver diamine is best for thick gels, whereas silver nitrate 6. Why does DNA not resolve well in solution (without
is considered to be more stable.9 a gel matrix)?
Silver staining avoids the hazards of the intercalators,
but silver nitrate is itself also a biohazard. In addition, sil- 7. Why is SyBr green less toxic than EtBr?
ver staining is more complicated than simple intercala-
tion. Color development must be carefully watched as the
precipitate accumulates in order to stop the reaction once References
optimal signal is reached. Overexposure of the gel will 1. Carle G, Frank M, Olson MV. Electrophoretic
result in high backgrounds and masking of results. The separation of large DNA molecules by periodic
increased sensitivity of this staining procedure, however, inversion of the electric field. Science 1986;232:
makes up for its limitations. It is especially useful for 6568.
protein analysis and for detection of limiting amounts of 2. Chu G, Vollrath D, Davis RW. Separation of
product. large DNA molecules by contour-clamped
homogeneous electric fields. Science 1986;
234:158285.
3. Gardiner K, Laas W, Patterson DS. Fractionation
STUDY QUESTIONS of large mammalian DNA restriction fragments
using vertical pulsed-field gradient gel electro-
1. You wish to perform a resolution of your restriction phoresis. Somatic Cell Molecular Genetics 1986;
enzymedigested DNA fragments. The size of the 12:18595.
expected products ranges 500100 bp. You discover 4. Southern E, Anand R, Brown WRA, et al. (1987).
two agarose gels polymerizing on the bench. One is A model for the separation of large DNA molecules
5% agarose; the other is 2% agarose. Which one by crossed field gel electrophoresis. Nucleic Acids
might you use to resolve your fragments? Research 15, 592543.
5. Gemmill R. Pulsed field gel electrophoresis. In
2. After completion of the run of fragments along with Chrambach A, Dunn MJ, Radola, BJ, eds. Advances
the proper molecular weight standard on the agarose of Electrophoresis, vol. 4 Weinheim, Germany:
gel, suppose a. or b. below was observed. What might VCH, 1991:148.
be explanations for these? (Assume you have included 6. Miller S, Taillon-Miller P, Kwok P. Cost-effective
a molecular weight marker in your run.) staining of DNA with SyBr green in preparative
05Buckingham (F)-05 2/6/07 12:30 PM Page 93

Resolution and Detection of Nucleic Acids Chapter 5 93

agarose gel electrophoresis. BioTechniques 1999; 8. Rabilloud T. A comparison between low back-
27(1):3436. ground silver diamine and silver nitrate protein
7. Singer V, Lawlor TE, Yue S. Comparison of SyBr stains. Electrophoresis 1992;13(6):42939.
green I nucleic acid gel stain mutagenicity and ethid- 9. Merrill C. Gel-staining techniques. Methods in
ium bromide mutagenicity in the salmonella/mam- Enzymology 1990;182:47788.
malian microsome reverse mutation assay (Ames 10. Perbal B. A Practical Guide to Molecular Cloning,
test). Mutation Research 1999;439(1):3747. 2nd. ed. New York: John Wiley & Sons, 1988.
06Buckingham (F)-06 2/6/07 5:53 PM Page 94

Chapter 6 Lela Buckingham

Analysis and
Characterization
of Nucleic Acids
and Proteins
OUTLINE OBJECTIVES
RESTRICTION ENZYME MAPPING Describe how restriction enzyme sites are mapped
HYBRIDIZATION TECHNOLOGIES on DNA.
Southern Blots Construct a restriction enzyme map of a DNA plasmid
Northern Blots
Western Blots
or fragment.
PROBES
Diagram the Southern blot procedure.
DNA Probes Explain depurination and denaturation of resolved DNA.
RNA Probes Describe the procedure involved in blotting (transfer)
Other Nucleic Acid Probe Types DNA from a gel to a membrane.
Protein Probes
Probe Labeling Discuss the purpose and structure of probes that are used
Nucleic Acid Probe Design for blotting procedures.
HYBRIDIZATION CONDITIONS, Define hybridization, stringency, and melting temperature.
STRINGENCY Calculate the melting temperature of a given sequence of
DETECTION SYSTEMS dsDNA.
INTERPRETATION OF RESULTS Compare and contrast radioactive and nonradioactive
ARRAY-BASED HYBRIDIZATION DNA detection methods.
Dot/Slot Blots Compare and contrast dot and slot blotting methods.
Genomic Array Technology Describe microarray methodology.
SOLUTION HYBRIDIZATION Discuss solution hybridization.
94
06Buckingham (F)-06 2/6/07 5:53 PM Page 95

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 95

urally occurring plasmids and to engineer the construc-


Restriction Enzyme Mapping tion of recombinant plasmids.
Clinical and forensic analyses require characterization of To make a restriction map, DNA is exposed to several
specific genes or genomic regions at the molecular level. restriction enzymes separately and then in particular com-
Because of their sequence-specific activity (see Chapter binations. Take, for example, a linear fragment of DNA
1), restriction endonucleases provide a convenient tool cut with the enzyme PstI. After incubation with the
for molecular characterization of DNA. enzyme, the resulting fragments are separated by gel elec-
Restriction enzymes commonly used in the laboratory trophoresis. The gel image reveals four fragments,
have four to six base pair recognition sites, or binding/ labeled A, B, C, and D, produced by PstI (Fig. 6-1). From
cutting sites, on the DNA. Any four to six base pair nu- the number of fragments one can deduce the number of
cleotide sequence occurs at random in a sufficiently long PstI sites: three. The sizes of the fragments, as determined
stretch of DNA. Therefore, restriction sites will occur by comparison with known molecular-weight standards,
naturally in DNA. Restriction site mapping, i.e., deter- indicate the distance between these sites or from the site
mining where in the DNA sequence a particular restric- to the end of the fragment. Although PstI analysis of this
tion enzyme recognition site is located, was initially fragment yields a characteristic four-band restriction pat-
developed using small circular bacterial plasmids. The tern, it does not indicate the order of the four restriction
resultant maps were used to identify and characterize nat- products in the original fragment. To begin to determine

DNA

Pst I PstI Pst I

A B C D

DNA

BamHI

E F

Pst I
+
Uncut Pst I Uncut BamHI Uncut Pst I BamHI BamHI

F
A *
*
D
B
C
E *
Figure 6-1 Restriction mapping of a linear DNA fragment (top green bar). The fragment is first
cut with the enzyme PstI. Four fragments result as determined by agarose gel electrophoresis indi-
cating that there are three PstI sites in the linear fragment. The size of the pieces indicates the
distance between the restriction sites. A second cut with BamHI (bottom) yields two fragments, indi
cating one site. Since one BamHI fragment (E) is very small, the BamHI site must be near one end
of the fragment. Cutting with both enzymes indicates that the BamHI site is in the PstI fragment A.
06Buckingham (F)-06 2/6/07 5:53 PM Page 96

96 Section 2 Common Techniques in Molecular Biology

DNA BamHI
+
A B C D BamHI XhoI XhoI

BamHI PstI Pst I Pst I BamHI

4.3 kb 4.0 kb
A C D B 3.7 kb 2.8 kb 1.1 kb

2.3 kb 1.7 kb
1.7 kb
BamHI Pst I Pst I Pst I 1.9 kb
XhoI

Figure 6-2 Two possible maps inferred from the observa- 1.4 kb 1.2 kb 1.2 kb 1.2 kb
tions described in Figure 6-1. The BamHI site positions fragment 1.3 kb
XhoI
A at one end (or the other) of the map. Determination of the 0.7 kb
1.1 kb

correct map requires information from additional enzyme cuts.


Figure 6-3 Restriction mapping of a plasmid. After incubat-
ing plasmid DNA with restriction enzymes, agarose gel elec-
trophoresis banding patterns indicate the number of
the order of the restriction fragments, another enzyme is restriction sites and the distance between them.
used, for example BamHI. Cutting the same fragment
with BamHI yields two pieces, indicating one BamHI site
in this linear fragment (see Fig. 6-1). Observe that one ferences in the nucleotide sequences in human DNA, the
restriction product (F) is very much larger than the other number or location of restriction sites for a given restric-
(E). This means that the BamHI site is close to one end of tion enzyme are not all the same in all individuals. The
the fragment. When the fragment is cut simultaneously location and order of restriction enzyme sites on a DNA
with PstI and BamHI, five products are produced, with fragment is a molecular characteristic of that DNA. The
PstI product A cut into two pieces by BamHI. This indi- resulting differences in the size or number of restriction
cates that A is on one end of the DNA fragment. By meas- fragments are called restriction fragment length poly-
uring the number and length of products produced by morphisms (RFLPs). RFLPs were the basis of the first
other enzymes, the restriction sites can be placed in linear molecular-based human identification and mapping
order along the DNA sequence. Figure 6-2 shows two methods. RFLPs can also be used for the clinical analy-
possible maps based on the results of cutting the fragment sis of structural changes in chromosomes associated with
with PstI and BamHI. With adequate enzymes and disease (translocations, deletions, insertions, etc.).
enzyme combinations, a detailed map of this fragment
can be generated.
Mapping of a circular plasmid is slightly different, as
Hybridization Technologies
there are no free ends (Fig. 6-3). The example shown in Procedures performed in the clinical molecular labora-
the figure is a 4-kb pair circular plasmid with one BamHI tory are aimed at specific targets in genomic DNA. This
site and two XhoI sites. Cutting the plasmid with BamHI requires visualization or detection of a specific gene or
will yield one fragment. The size of the fragment is the region of DNA in the background of all other genes.
size of the plasmid. Two fragments released by XhoI indi- There are several ways to find a particular region of DNA
cate that there are two XhoI sites in the plasmid and that from within an isolated DNA sample. The initial method
these sites are 1.2 and 2.8 kb pairs away from each other. for molecular analysis of specific DNA sites within a
As with linear mapping, cutting the plasmid with XhoI complex background was the Southern blot. Modifica-
and BamHI at the same time will start to order the sites tions of the Southern blot are applied to analysis of RNA
with respect to one another on the plasmid. One possible and protein in order to study gene expression and regula-
arrangement is shown in Figure 6-3. As more enzymes tion (Table 6.1).
are used, the map becomes more detailed.
The pattern of fragments produced by restriction
Southern Blots
enzyme digestion can be used to identify that DNA and
to monitor certain changes in the size, structure, or se- The Southern blot is named for Edwin Southern, who
quence of the DNA. Because of inherited or somatic dif- first reported the procedure.1 In the Southern blot, DNA
06Buckingham (F)-06 2/6/07 5:53 PM Page 97

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 97

cal laboratory, specimen availability may limit the


Table 6.1 Hybridization Technologies
amount of DNA that can be used.
Hybridization After restriction enzyme digestion, the resulting frag-
Method Target Probe Purpose
ments are resolved by gel electrophoresis. The percent-
Southern blot DNA Nucleic acid Gene structure age and nature of the gel will depend on the size of the
Northern blot RNA Nucleic acid Transcript structure, DNA region to be analyzed (see Chapter 5, Tables 5.1
processing, gene and 5.2). As with all electrophoresis, a molecular weight
expression standard should be run with the test samples. After elec-
Western blot Protein Protein Protein processing, trophoresis, it is important to observe the cut DNA.
gene expression Figure 6-4a shows a gel stained with ethidium bromide
Southwestern Protein DNA DNA binding proteins, and illuminated by ultraviolet (UV) light. Genomic DNA
blot gene regulation cut with restriction enzymes should produce a smear rep-
resenting the billions of fragments of all sizes released by
the enzyme cutting. The brightness of the DNA smears
is isolated and cut with restriction enzymes. The frag- should be similar from lane to lane, assuring that equal
ments are separated by gel electrophoresis, depurinated amounts of DNA were added to all lanes. In any lane, a
and denatured, and then transferred to a solid support large aggregate of DNA near the top of the gel indicates
such as nitrocellulose. In the final steps of the procedure, that the restriction enzyme activity was incomplete. A
the DNA fragments are exposed to a labeled probe (com- smear located primarily in the lower region of the lane is
plementary DNA or RNA) that is specific in sequence to a sign that the isolated DNA is degraded. Either of these
the region of interest, unbound probe is removed, and the two latter conditions will prevent accurate analysis. If
signal of the probe is detected to indicate the presence or either is observed, the DNA isolation and/or the restric-
absence (lack of signal) of the sequence in question. The tion digest should be repeated accordingly.
original method entailed hybridization of a radioactively-
labeled probe to detect the DNA region to be analyzed. Preparation of Resolved DNA
As long as there is a probe of known identity, this proce- for Blotting (Transfer)
dure can analyze any gene or gene region in the genome The goal of the Southern blot procedure is to analyze a
at the molecular level. The following sections will specific region of the sample DNA. First, the DNA sam-
describe the parts of the Southern blot procedure in detail ple is digested, i.e., cut using a variety of restriction
as well as discuss modifications of the procedure in order endonucleases, and then the DNA fragments are separated
to analyze RNA and protein. by electrophoresis. The resultant restriction fragments
containing the target sequence to be analyzed are obvi-
Restriction Enzyme Cutting and Resolution ously not distinguishable in the smear from other frag-
After DNA isolation, the first step in the Southern blot ments that do not have the target sequence. Target
procedure is digestion of the DNA with restriction fragments can be detected by hybridization with a homol-
enzymes. The choice of enzymes used will depend on the ogous sequence of single-stranded DNA or RNA labeled
applications. For routine laboratory tests, restriction with a detectable marker. To achieve optimal hydrogen
maps of the target DNA regions will have previously bonding between the probe and its complementary
been determined, and the appropriate enzymes will be sequence in the resolved sample DNA, the double-
recommended. For other methods, such as typing of stranded DNA fragments in the gel must be denatured and
unknown organisms or cloning, several enzymes may be transferred to a nitrocellulose membrane.
tested to find those that will be most informative.
Ten to 50 !g of genomic DNA are used for each Depurination
restriction enzyme digestion for Southern analysis. More Before moving the DNA fragments from the gel to the
or less DNA may be used depending on the sensitivity of membrane for blotting, the double-stranded DNA frag-
the detection system, the volume and configurations of ments must be denatured, or separated, into single
wells, and the abundance of the target DNA. In the clini- strands. This is performed as the DNA remains in place
06Buckingham (F)-06 2/6/07 5:53 PM Page 98

98 Section 2 Common Techniques in Molecular Biology

A B
Figure 6-4 (a.) Genomic DNA fragments cut with restriction enzymes Bgl II, BamHI and Hind III
and separated by gel electrophoresis. (b.) Autoradiogram of the fragments hybridized to a radioac-
tive or chemiluminescent probe. Control lanes, C, show the restriction pattern of normal DNA. Test
lanes, ", show the different restriction patterns that result from the abnormal or translocated DNA.

in the gel. Although short fragments can be denatured


directly as described below, larger fragments (!500 bp)
are more efficiently denatured if they are depurinated T A
before denaturation (Fig. 6-5). Therefore, for large frag-
ments, the gel is first soaked in HCl solution, a process
that removes purine bases from the sugar phosphate C G
backbone. This will loosen up the larger fragments for
more complete denaturation.

G C
Denaturation
Following depurination, the DNA is denatured by
exposing the DNA in the gel to sodium hydroxide. The
strong base (NaOH) promotes breakage of the hydro- A T
gen bonds holding the DNA strands to one another. The
resulting single strands are then available to hydro-
gen-bond with the single-stranded probe. Further, the
single-stranded DNA will bind more tightly than Figure 6-5 An apurinic site in double-stranded DNA.
double-stranded DNA to the nitrocellulose membrane Loss of the guanine (right) leaves an open site but does
upon transfer. not break the sugar phosphate backbone of the DNA.
06Buckingham (F)-06 2/6/07 5:53 PM Page 99

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 99

Advanced Concepts Advanced Concepts


Treatment of DNA with dilute (0.10.25 mM) Binding of single-stranded DNA to nitrocellulose
hydrochloric acid results in hydrolysis of the glyco- does not prevent hydrogen-bond formation of the
sidic bonds between purine bases and the sugar of immobilized DNA with complementary sequences.
the nucleotides. This loss of purines (adenines and Although not covalent, the bond between the mem-
guanines) from the sugar-phosphate backbone of brane and the DNA is much stronger than the hydro-
DNA leaves apurinic sites (Fig. 6-5). The DNA gen bonds that hold complementary strands
backbone remains intact and holds the rest of the together. This allows removal of probes and reprob-
bases in linear order. Removal of some of the purine ing of immobilized fragments if necessary.
bases promotes the subsequent breaking of hydro-
gen bonds between the two strands of the DNA dur-
ing the denaturation step in Southern blotting.
high binding capacity (!400 "g/cm2), which increases
sensitivity. A covalent attachment of nucleic acid to these
membranes is achieved by UV cross-linking.
Blotting (Transfer) Membranes with a positive charge more effectively
Before exposing the denatured sample DNA to the probe, bind small fragments of DNA. These membranes, how-
the DNA must be transferred, or blotted, to a solid sub- ever, are more likely to retain protein or other contami-
strate that will facilitate probe binding and signal detec- nants that will contribute to background after the
tion. This substrate is usually nitrocellulose, nitrocellulose membrane is probed.
on an inert support, nylon or cellulose modified with a Before transfer of the sample, membranes are moist-
diethyl amino ethyl, or a carboxy methyl (CM) chemical ened by floating them on the surface of the transfer
group. Membranes of another type, polyvinyl difluoride buffer. Any dry spots (areas where the membrane does
(PVDF), are used for immobilizing proteins for probing not properly hydrate) will remain white while the rest of
with antibodies (Western blots). the membrane darkens with buffer. If the membrane does
not hydrate evenly, dry spots will inhibit binding of the
Membrane Types sample.
Single-stranded DNA avidly binds to nitrocellulose
membranes with a noncovalent, but irreversible, con- Transfer Methods
nection. The binding interaction is hydrophobic and elec- Transfer can be performed in several ways. The goal of
trostatic between the negatively charged DNA and the all methods is to move the DNA from the gel to a mem-
positive charges on the membrane. Nitrocellulose-based brane substrate for probing.
membranes bind 70150 "g of nucleic acid per square
centimeter. Membrane pore sizes (0.05 microns to 0.45
microns) are suitable for small DNA fragments up to
fragments #20,000 bp in length.
Pure nitrocellulose has a high binding capacity for
Advanced Concepts
proteins as well as nucleic acids. It is the most versatile Diethylaminoethyl (DEAE)-conjugated cellulose
medium for molecular transfer applications. It is also effectively binds nucleic acids and negatively
compatible with different transfer buffers and detection charged proteins. Polyvinylidene difluoride (PVDF)
systems. Nitrocellulose is not as sturdy as other media and charged carboxy methyl cellulose membranes
and becomes brittle with multiple reuses. Reinforced are used only for protein (Western) blotting. These
nitrocellulose is more appropriate for applications where membranes bind nucleic acid and proteins by
multiple probings may be necessary. Mechanically stable hydrophobic and ionic interactions with a binding
membranes can be formulated with a net neutral charge to capacity of 2040 "g/cm2 to 150 "g/cm2 for PVDF.
decrease the background. These membranes have a very
06Buckingham (F)-06 2/6/07 5:53 PM Page 100

100 Section 2 Common Techniques in Molecular Biology

the membrane through electrophoresis buffer as shown in


Advanced Concepts the figure. In the semidry method, the electrodes contact
the gel-membrane sandwich directly, requiring only
Capillary transfer is simple and relatively inexpen- enough buffer to soak the gel and membrane. The tank
sive, as no instruments are required. The transfer, electrophoretic transfer is preferred for large proteins
however, can be less than optimal, especially with resolved on acrylamide gels, whereas the semidry method
large gels. Bubbles or crystals in between the mem- is frequently used for small proteins.
brane and the gel can cause loss of information or Vacuum transfer is a third method of DNA blotting
staining artifacts. The procedure is also slow, taking (Fig. 6-8). This blotting technique uses suction to move
from a few hours to overnight for large fragments. the DNA from the gel to the membrane in a recirculating
buffer. Like electrophoretic transfer, this method trans-
fers the DNA more rapidly, e.g., in hours rather than
days, than capillary transfer. Also, discontinuous transfer
The original method developed by Southern used cap- due to air trapped between the membrane and the gel is
illary transfer (Fig. 6-6). For capillary transfer, the gel is avoided. One disadvantage of the second and third meth-
placed on top of a reservoir of buffer, which can be a shal- ods is the expense and maintenance of the electrophore-
low container or membrane papers soaked in high salt sis and vacuum equipment.
buffer, e.g., 10X saline sodium citrate (10X SSC: 1.5 M After binding the nucleic acid to membranes, the cut,
NaCl, 0.15 M Na citrate) or commercially available trans- denatured DNA is permanently immobilized to the mem-
fer buffers. The nitrocellulose membrane is placed brane by baking the membrane in a vacuum oven (80!C,
directly on the gel, and dry absorbent membranes or paper 3060 min.) or by UV cross-linking, i.e., covalently
towels are stacked on top of the membrane. The buffer is attaching the DNA to the nitrocellulose using UV light
moved by capillary action from the lower reservoir to the energy. The purpose of baking or cross-linking is to pre-
dry material on top of the gel. The movement of the buffer vent the transferred DNA fragments from washing away
through the gel will carry the denatured DNA out of the or moving on the membrane.
gel. When the DNA contacts the nitrocellulose mem- Following immobilization of the DNA, a prehy-
brane, the DNA will bind to it while the buffer will pass bridization step is required to prevent the probe from
through to the membranes or paper towels on top. binding to nonspecific sites on the membrane surface,
A second method, called electrophoretic transfer, which will cause high background. Prehybridization
uses electric current to move the DNA from the gel to the involves incubating the membrane in the same buffer in
membrane (Fig. 6-7). This system utilizes electrodes which the probe will subsequently be introduced. At this
attached to membranes above (anode) and below (cath- point, the buffer does not contain probe. The buffer con-
ode) the gel. The current carries the DNA transversely sists of blocking agents such as Denhardt solution (Ficoll,
from the gel to the membrane. Electrophoretic transfer is polyvinyl pyrrolidane, bovine serum albumin) and salmon
carried out with a tank or by a semidry approach. In sperm DNA. Sodium dodecyl sulfate (SDS, 0.01%) may
the tank method, the electrodes transfer current through also be included, along with formamide, the latter espe-

Dry paper

Nitrocellulose
membrane

Gel
Figure 6-6 Capillary transfer. Driven by capillary
Soaked paper movement of buffer from the soaked paper to the dry
Buffer paper, denatured DNA moves from the gel to the
membrane.
06Buckingham (F)-06 2/6/07 5:53 PM Page 101

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 101

Whatman Nitrocellulose
paper Gel membrane

Figure 6-7 Electrophoretic


transfer. This system uses electric
current to mobilize the DNA from Buffer Support Glass Buffer
the gel to the membrane. plates

cially for RNA probes. The membrane is exposed to the total RNA or 0.53.0 !g polyA RNA, depending on the
prehybridization buffer at the optimal hybridization tem- relative abundance of the transcript under study) can be
perature for 30 minutes to several hours, depending on the applied directly to agarose gels. Agarose concentrations
specific protocol. At this stage the sample is ready for of 0.8%-1.5% are usually employed. Polyacrylamide gels
hybridization with the probe, which will allow visualiza- can also be used, especially for smaller transcripts; for
tion of the specific gene or region of interest. instance, for analysis of viral gene expression.2 Gel elec-
trophoresis of RNA must be carried out under denaturing
Northern Blots conditions for accurate transcript size assessment (see
Chapter 5). Complete denaturation is also required for
The Northern blot is a modification of the Southern blot efficient transfer of the RNA from the gel to the mem-
technique and was designed to investigate RNA structure brane, as with the transfer of DNA in the Southern blot.
and quantity. Although most Northern analyses are per- Because the denaturation is carried out during elec-
formed to investigate levels of gene expression (tran- trophoresis, a separate denaturation step is not required
scription from DNA) and stability, the method can also be for Northern blots. After electrophoresis, representative
used to investigate RNA structural abnormalities result- lanes can be cut from the gel, soaked in ammonium
ing from aberrations in synthesis or processing, such as acetate to remove the denaturant, and stained with acri-
alternate splicing. Splicing abnormalities are responsi- dine orange or ethidium bromide to assess quality and
ble for a number of diseases, such as beta-thalassemias equivalent sample loading (see Chapter 4).
and familial isolated growth hormone deficiency. Analy- Denaturant, such as formaldehyde, must be removed
sis of RNA structure and quantity indirectly reveals muta- from the gel before transfer because it inhibits binding of
tions in the regulatory or splicing signals in DNA. the RNA to nitrocellulose. This is accomplished by rins-
Care must be taken with RNA preparation to maintain ing the gel in de-ionized water. RNA is transferred in 10X
an RNase-free environment. After isolation and quantita- or 20X SSC or 10X SSPE (1.8 M NaCl, 0.1 M sodium
tion of RNA, the samples (up to approximately 30 !g phosphate, pH 7.7, 10 mM EDTA) to nitrocellulose as

Gel
Nitrocellulose
membrane

Porous plate
Figure 6-8 Vacuum transfer. This system uses
suction to move the DNA out of the gel and onto Recirculating buffer
the membrane. Vacuum
06Buckingham (F)-06 2/6/07 5:53 PM Page 102

102 Section 2 Common Techniques in Molecular Biology

gel electrophoresis. Prestained molecular weight stan-


Advanced Concepts dards are run with the samples to orient the membrane
after transfer and to approximate the sizes of the pro-
Some protocols call for destaining of the gel in teins after probing. Standards ranging from 11,700 d
sodium phosphate buffer (acridine orange) or 200 (cytochrome C) to 205,000 d (myosin) are commercially
mM sodium acetate, pH 4.0 (ethidium bromide) available.
before transfer. The latter destaining method may The gel system used may affect subsequent probing of
interfere with the movement of RNA from the gel proteins with antibodies. Specifically, denaturing gels
during transfer. If formaldehyde has been used as a could affect epitopes (antigenic sites on the protein) such
denaturant during electrophoresis, the gel must be that they will not bind with the labeled antibodies. Gel
rinsed and held in de-ionized water. Rinsing is not pretreatment with mild buffers such as 20% glycerol in
necessary if the formaldehyde concentration is less 50 mM Tris-HCl, pH 7.4, can renature proteins before
than 0.4 M. transfer.4
After electrophoresis, proteins can be blotted to mem-
branes by capillary or electrophoretic transfer. Nitro-
cellulose has high affinity for proteins and is easily
described above for DNA. 20X SSC should be used for treated with detergent (0.1% Tween 20 in 0.05 M Tris and
small transcripts (500 bases or less). The blotting proce- 0.15 M sodium chloride, pH 7.6) to prevent binding of
dure for RNA in the Northern blot is carried out in 20X the primary antibody to the membrane itself (blocking)
SSC, similar to the procedure for DNA transfer in the before hybridization. Binding of proteins to nitrocellu-
Southern blot. Prehybridization and hybridization in for- lose is probably hydrophobic as nonionic detergents can
mamide/SSC/SDS prehybridization/hybridization buffers remove proteins from the membrane. Other membrane
are performed also as with Southern blot. If the RNA has types that can be used for protein blotting are PVDF and
been denatured in glyoxal, the membrane must be soaked anion (DEAE) or cation (CM) exchange cellulose.
in warm Tris buffer (65!C) to remove the denaturant
immediately before prehybridization.

Western Blots Advanced Concepts


Another modification of the Southern blot is the Western The Western blot method is used to confirm enzyme-
blot.3 The immobilized target for a Western blot is pro- linked immunoassay results for human immunodefi-
tein. There are many variations on Western blots. ciency virus (HIV) and hepatitis C virus among other
Generally, serum, cell lysate, or extract is separated on organisms. In this procedure, known HIV proteins
SDS-polyacrylamide gels (SDS-PAGE) or isoelectric are separated by electrophoresis and transferred and
focusing gels (IEF). The former resolves proteins accord- bound to a nitrocellulose membrane. The patients
ing to molecular weight, and the latter according to serum is overlaid on the membrane, and antibodies
charge. Dithiothreitol or 2-mercaptoethanol can also be with specificity to HIV proteins bind to their corre-
used to separate proteins into subunits. Polyacrylamide sponding protein. Unbound patient antibodies are
concentrations vary 5%-20%. Depending on the com- washed off, and binding of antibodies is detected by
plexity of the protein and the quantity of the target adding a labeled antihuman immunoglobulin anti-
protein, 150 "g of protein is loaded per well. Before body. If HIV antibodies are present in the patients
loading, the sample is treated with denaturant, such serum, they can be detected with antihuman anti-
as mixing 1:1 with 0.04 M Tris HCl, pH 6.8, 0.1% body probes appearing as a dark band on the blot
SDS. The accuracy and sensitivity of the separation corresponding to the specific HIV protein to which
can be enhanced by using a combination of IEF gels the antibody is specific.
followed by SDS-PAGE or by using two-dimensional
06Buckingham (F)-06 2/6/07 5:53 PM Page 103

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 103

genome, resulting in high background binding to


Probes sequences not related to the target region of interest.
The probe for Southern and Northern blots is a single- Short probes are more appropriate for mutational analysis
stranded fragment of nucleic acid. The purpose of the as they are sensitive to single base mismatches (see
probe is to identify one or more sequences of interest Chapter 8). The probe is constructed so that it has a com-
within a large amount of nucleic acid. The probe there- plementary sequence to the targeted gene. In order to bind
fore should hybridize specifically with the target DNA or to the probe then, the target nucleic acid has to contain the
RNA that is to be analyzed. The probe can be RNA, dena- sequence of interest. There are typically fewer copies of a
tured DNA, or other modified nucleic acids. Peptide specific sequence in the genome, and therefore only a few
nucleic acids (PNAs) and locked nucleic acids have also bands will be apparent after detection.
been used as probes. These structures contain normal Properly prepared and stored DNA probes are rela-
nitrogen bases that can hybridize with complementary tively stable and easy to manufacture. Double-stranded
DNA or RNA, but the bases are connected by backbones DNA probes must be denatured before use. This is usu-
different from the natural phosphodiester backbone of ally accomplished by heating the probe (e.g., 95!C,
DNA and RNA. These modified backbones are resistant 1015 min) in hybridization solution or treating with
to nuclease degradation and, because of a reduced nega- 50% formamide/2X SSC at a lower temperature for a
tive charge on their backbone, can hybridize more read- shorter time (e.g., 75!C, 56 min)
ily to target DNA or RNA.
Probes for Western blots are specific binding proteins RNA Probes
or antibodies. A labeled secondary antibody directed
against the primary binding protein is then used for the RNA probes are often made by transcription from a
visualization of the protein band of interest. synthetic DNA template in vitro. These probes are simi-
lar to DNA probes with equal or greater binding affin-
ity to homologous sequences. Because RNA and DNA
DNA Probes
form a stronger helix than DNA/DNA, the RNA probes
DNA probes are created in several ways. A fragment of may offer more sensitivity than DNA probes in the
the gene to be analyzed can be cloned on a bacterial plas- Southern blot.
mid and then isolated by restriction enzyme digestion RNA probes can be synthesized directly from a plas-
and gel purification. The fragment, after labeling (see mid template or from template DNA produced by PCR
below) and denaturation, can then be used in Southern or (see Chapter 7). Predesigned systems are commercially
Northern blot procedures. available for this purpose. These products include plas-
Other sources of DNA probes include the isolation of mid vector DNA such as pGEM (Promega) or pBluescript
a sequence of interest from viral genomes and in vitro (Stratagene), containing a binding site for RNA poly-
organic synthesis of a piece of nucleic acid that has a par- merase (promoter) and a cloning site for the sequences of
ticular sequence. The latter is used only for short, interest, and a DNA-dependent RNA polymerase from
oligomeric probes. Probes can also be synthesized using Salmonella bacteriophage SP6 or E. coli bacteriophage
the polymerase chain reaction (PCR) (see Chapter 7) to T3 or T7. DNA sequences complementary to the RNA
generate large amounts of specific DNA sequences. transcript to be analyzed are cloned into the plasmid vec-
The length of the probe will, in part, determine the tor using restriction enzymes. The recombinant vector
specificity of the hybridization reaction. Probe lengths containing the gene of interest is then linearized, and the
range from tens to thousands of base pairs. In analysis of RNA probe is transcribed in vitro from the promoter.
the entire genome in a Southern blot, longer probes are RNA probes are labeled by incorporating a radioactive or
more specific for a DNA region because they must match modified nucleotide during the in vitro transcription
a longer sequence on the target. Shorter probes are not process.
usually used in Southern blots because short sequences Either coding or complementary RNA will hybridize
are more likely to be found in multiple locations in the to a double-stranded DNA target. Care must be taken,
06Buckingham (F)-06 2/6/07 5:53 PM Page 104

104 Section 2 Common Techniques in Molecular Biology

however, in designing RNA probes for Northern blots.


The complementary sequence to the target must be used
for the probe. A probe of identical sequence to the target
Advanced Concepts
RNA (coding sequence) will not hybridize. Because of These structures are not only useful in the laboratory,
labeling during synthesis, RNA probes can have a high they are also potentially valuable in the clinic.
specific activity (signal to micrograms of probe) that Several structures have been proposed for use in
increases the sensitivity of the probe. To avoid high antisense gene therapy Fig. 6-10. Introduction of
background, some protocols include digestion of nonhy- sequences complementary to messenger RNA of a
bridized RNA, using a specific RNase, such as RNase A, gene (antisense sequences) will prevent translation
after hybridization is complete. of that mRNA and expression of that gene. If this
RNA probes are generally less stable than DNA probes could be achieved in whole organisms, selected aber-
and cannot be stored for long periods. Synthesis of an rantly expressed genes or even viral genes could be
RNA probe by transcription from a stored template is rel- turned off. One drawback of this technology is the
atively simple and should be performed within a few days degradation of natural RNA and DNA by intracellu-
of use. The DNA template can be removed from the lar nucleases. The nuclease-resistant structures are
probe by treatment with RNase-free DNase. Although more stable and available to hybridize to the target
RNA is already single-stranded, denaturation before use mRNA.
is recommended in order to eliminate secondary structure
internal to the RNA molecule.
Protein Probes
Other Nucleic Acid Probe Types
Western blot protein probes are antibodies that bind
Peptide nucleic acid and locked nucleic acid probes specifically to the immobilized target protein. Polyclonal
(Fig. 6-9 and 6-10) can be synthesized using chemical or monoclonal antibodies can be used for this purpose.
methods.58 These modified nucleic acids have the advan- Polyclonal antibodies are made by immunization with a
tage of being resistant to nucleases that would degrade specific antigen, usually a peptide or protein. Small mol-
DNA and RNA by breaking the phosphodiester back- ecules (haptens) attached to protein carriers, carbohy-
bone. Further, the negative charge of the phosphodiester drates, nucleic acids, and even to whole cells and tissue
backbones of DNA and RNA counteract hydrogen bond- extracts can be used to generate an antibody response.
ing between the bases of the probe and target sequences. Adjuvants, such as Freunds adjuvant, are used to enhance
Structures such as PNA that do not have a negative the antibody titer by slowing the degradation of the pro-
charge hybridize more efficiently. tein and lengthening the time the immune system is

OR OR
NH2
O P O O P O
Base
O O
O Base O Base
N
O

O
NH O Figure 6-9 Peptide nucleic acids have
O O
the phosphodiester bond (left) replaced
O P O R O P O with carbon nitrogen peptide bonds (cen-
ter). Locked nucleic acids are bicyclic
O O nucleoside monomers where the ribose
sugar contains a methylene link between
R R its 2 oxygen and 4 carbon atoms (right).
06Buckingham (F)-06 2/6/07 5:53 PM Page 105

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 105

NH2 NH2
N N
N

HO O O HO ON N
O N3-phosphoramidate NH2
O H3C O NH
O
NH N
Phosphodiester P
P N
O N O O O O O
O O
NH2 O
O N O O OR N
H3C N NH
Methylphosphonate P 2-O-alkyl RNA P
O O ON N O O ON N NH2
O
O N H3C
N N NH
S O NH P
Phosphorothioate P O O N O
O
O O ON N NH2 Morpholino
phosphorodiamidate NH2
NH2 N
H3B O N N
N
P O N N
Borane phosphonate N
O O ON N
H N
Peptide nucleic acid O
O O
P O NH2
3-O-phosphopropylamino
O O NH3
OH

Figure 6-10 Modifications of the phosphodiester backbone of nucleic acids. 28, 29

exposed to the stimulating antigen. The immunoglobulins greater specificity, monoclonal antibodies can be used for
are subsequently isolated from sera by affinity chro- almost any procedure.
matography. In Western blot technology, polyclonal antibodies can
Polyclonal antibodies are a mixture of immunoglobu- give a more robust signal, especially if the target epitopes
lins that are directed at more than one epitope (molecular are partially lost during electrophoresis and transfer.
structure) on the antigen. Monoclonal antibodies are Monoclonal antibodies are more specific and may give
more difficult to produce. Kohler and Milstein first less background; however, if the targeted epitope is lost,
demonstrated that spleen cells from immunized mice these antibodies do not bind, and no signal is generated.
could be fused with mouse myeloma cells to form hybrid Dilution of primary antibody can range from 1/100 to
cells (hybridomas) that could grow in culture and 1/100,000, depending on the sensitivity of the detection
secrete antibodies.9 By cloning the hybridomas (growing system (see below).
small cultures from single cells), preparations of specific
antibodies could be produced continuously. The clones
Probe Labeling
could then be screened for antibodies that best react with
the target antigen. Monoclonal antibodies can be isolated In order to visualize the probe bound to target fragments
from cell culture fluid. Higher titers of antibodies are on the blot, the probe must be labeled and generate a
obtained by inoculating the antibody-producing hy- detectable signal. The original Southern analyses used
bridoma into mice and collecting the peritoneal fluid. The radioactive labeling with 32P. This labeling was achieved
monoclonal antibody is then isolated by chromatography. by introduction of nucleotides containing radioactive
Polyclonal antibodies are useful for immunoprecipitation phosphorus to the probe. Today, many clinical laborato-
methods and can be used for Western blots. With their ries use nonradioactive labeling to avoid the hazard and
06Buckingham (F)-06 2/6/07 5:54 PM Page 106

106 Section 2 Common Techniques in Molecular Biology

expense of working with radiation. Nonradioactive label- RNA probes are transcribed from cloned DNA or
ing methods are based on indirect detection of a tagged amplified DNA. These probes are labeled during their
nucleotide incorporated in or added to the probe. The two synthesis by the incorporation of radioactive, biotiny-
most commonly used nonradioactive tags are biotin lated, or digoxygenin-tagged nucleotides. Unlike double-
and digoxygenin (Fig. 6-11), either of which can be stranded complementary DNA probes and targets that
attached covalently to a nucleotide triphosphate, usually contain both strands of the complementary sequences,
UTP or CTP. RNA probes are single-stranded with only one strand of
There are three basic methods that are used to label a the complementary sequence represented.
DNA probe: end-labeling, nick translation, and random
priming. End-labeling involves the addition of labeled
Nucleic Acid Probe Design
nucleotides to the end of the fragment using terminal
transferase or T4 polynucleotide kinase. In nick transla- The most critical parts of any hybridization procedure are
tion, the labeled nucleotides are inserted into the fragment the design and optimal hybridization of the probe, which
at single-stranded breaks, or nicks, in a double-stranded determines the specificity of the results. With nucleic
probe. DNA polymerase extends the broken end of one acids, the more optimal the hybridization conditions for a
strand using the intact complementary strand for a tem- probe/target interaction, the more specific the probe.
plate and displaces the previously hybridized strand. Longer probes (5005000 bp) offer greater specificity
Random priming generates new single-stranded versions with decreased background, but they may be difficult or
of the probe with the incorporation of the labeled nuc- expensive to synthesize. Long probes are less affected by
leotides. The synthesis of these new strands is primed point mutations or polymorphisms within the sequence
by oligomers of random sequences that are six to ten targeted by the probe or within the probe itself.
bases in length. These short sequences will, at some fre- Shorter probes (!500 bp) are less specific than longer
quency, complement sequences in the probe and prime ones in Southern blotting applications. A short sequence
synthesis of a copy of the probe with incorporated labeled has a higher chance of being repeated randomly in unre-
nucleotides. lated regions of the genome. Short probes are ideal, how-

O
HN NH
O
HO
CH3
X
S CH3

OH
O O
C
O O O CH2
CH CH CH2 NH C (CH2)5 NH C CH2
HN

O N
O

LiO P O H2C O

OLi 3

OH
Figure 6-11 Biotin (top) has a variable side chain (X). The polycyclic digoxygenin (bottom) is
shown covalently attached to UTP (dig-11-UTP). This molecule can be covalently attached or
incorporated into DNA or RNA to make a labeled probe.
06Buckingham (F)-06 2/6/07 5:54 PM Page 107

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 107

target is exposed to the probe. Conditions of high strin-


Advanced Concepts gency are more demanding of probe:target complemen-
tarity. Low stringency conditions are more forgiving. If
Protein probes used in Western blot can be cova- conditions of stringency are set too high, the probe will
lently bound to an enzyme, usually horseradish per- not bind to its target. If conditions are set too low, the
oxidase or alkaline phosphatase. Unconjugated probe will bind unrelated targets, complicating interpre-
antibodies can be detected after binding with a con- tation of the final results.
jugated secondary antibody to the primary probe, Several factors affect stringency. These include temper-
such as mouse antihuman or rabbit antimouse anti- ature of hybridization, salt concentration of the hybridiza-
bodies (Fig 6-12). The secondary antibodies will tion buffer, and the concentration of denaturant such as
recognize any primary antibody by targeting the FC formamide in the buffer. The nature of the probe sequence
region. can also impinge on the level of stringency. A probe with
Label a higher percentage of G and C bases will bind under
more stringent conditions than one with greater numbers
Secondary antibody
of A and T bases. The ideal hybridization conditions
Target protein Primary antibody can be estimated from calculation of the melting tem-
perature, or Tm, of the probe sequence. The Tm is a way
to express the amount of energy required to separate
the hybridized strands of a given sequence (Fig. 6-13).
At the Tm, half of the sequence is double-stranded, and
half is single-stranded. The Tm for a double-stranded
DNA sequence in solution is calculated by the following
Figure 6-12 Probe binding to Western blots may
formula:
include an unlabeled primary antibody that is subse-
quently bound by a secondary antibody carrying a
Tm ! 81.5"C # 16.6 logM # 0.41 (%G # C) $ 0.61
label for detection.
(% formamide) $ (600/n)
where M ! sodium concentration in mol/L and n
! number of base pairs in the shortest duplex.
ever, for mutation analysis, as their binding affinity is RNA:RNA hybrids are more stable than DNA:DNA
sensitive to single base pair changes within a target bind- hybrids due to less constraint by the RNA phosphodiester
ing sequence.
The sequence of the probe can affect its binding
performance as well. A sequence with numerous internal
DS
complementary sequences will fold and hybridize with
itself, which will compete with hybridization to the
intended target. The probe folding or secondary struc-
DS=SS
ture is especially strong in sequences with high GC con-
tent, decreasing the binding efficiency to the target
sequence.
SS
Tm
Hybridization Conditions, Increasing temperature
Stringency Figure 6-13 Melting temperature, Tm, is the point at which
exactly half of a double-stranded sequence becomes single-
Southern blot and Northern blot probing conditions must stranded. The melting temperature is determined at the
be empirically optimized for each nucleic acid target. inflection point of the melt curve. DS, double-stranded; SS,
Stringency is the combination of conditions in which the single-stranded.
06Buckingham (F)-06 2/6/07 5:54 PM Page 108

108 Section 2 Common Techniques in Molecular Biology

backbone. The formulas, therefore, are slightly different.


For RNA:RNA hybrids the formula is: Advanced Concepts
Tm ! 79.8"C # 18.5 logM # 0.58 (%G # C) # 11.8
Cot was used to demonstrate that mammalian DNA
(%G # C) $ 0.35 (% formamide) $ (820/n)
consisted of sequences of varying complexity.
DNA:RNA hybrids have intermediate affinity: Britten and Kohne24 used Eschericia coli and calf
Tm ! 79.8"C # 18.5 logM # 0.58 (%G # C) # 11.8 thymus DNA to demonstrate this. When they meas-
(%G # C) $ 0.50 (% formamide) $ (820/n) ured reassociation of E. coli DNA vs. time, a sig-
The Tm is also a function of the extent of complemen- moid curve was observed, as expected for DNA
tarity between the sequence of the probe and that of the molecules with equal complexity. In comparison,
target sequence. For each 1% difference in sequence, the the calf DNA reassociation was multifaceted and
Tm decreases 1.5"C. Furthermore, the Tm of RNA probes spanned several orders of magnitude (see Fig. 6-14).
is higher. RNA:DNA hybrids increase Tm by 10"15"C. The spread of the curve results from the mixture of
DNA:DNA hybrids increase Tm by 20"$25"C. slowly renaturing unique sequences and rapidly
The Tm for short probes (1420 bases) can be calcu- renaturing repeated sequences (satellite DNA).
lated by a simpler formula:
Tm ! 4"C % number of GC pairs # 2"C % number
of AT pairs
double-stranded sequence to anneal under a given set of
The hybridization temperature of oligonucleotide
conditions.
probes is about 5"C below the melting temperature.
Tm and Cot values can provide a starting point for opti-
The effect of sequence complexity on hybridization effi-
mizing stringency conditions for Southern blot analysis.
ciency can be illustrated by the Cot value. Sequence
Hybridization at a temperature 25"C below the Tm for 13
complexity is the length of unique (nonrepetitive)
Cot1/2 is considered optimal for a double-stranded DNA
nucleotide sequences. After denaturation, complex
probe. Final conditions must be established empirically,
sequences require more time to reassociate than simple
especially for short probes. Stringency conditions for rou-
sequences, such as polyA:polyU. Cot is an expression of
tine analyses, once established, will be used for all subse-
the sequence complexity (Fig. 6-14). Cot is equal to
quent assays. In the event a component of the procedure
the initial DNA concentration (Co) times the time required
is altered, new conditions may have to be established.
to reanneal (t). Cot1/ is the time required for half of a
2 Hybridizations are generally performed in hybridiza-
tion bags or in glass cylinders. Within limits, the sensi-
tivity of the analysis increases with increased probe
Size
1bp 10,000 bp concentration. Because the probe is the limiting reagent,
Complexity
it is practical to keep the volume of the hybridization
DS
solution low. The recommended volume of hybridization
buffer is approximately 10 mL/100 cm2 of membrane
DS=SS
surface area.
Formamide in the hybridization buffer effectively low-
ers the optimal hybridization temperature. This is espe-
SS cially useful for RNA probes and targets that, because of
6 5 4 3 2 1 0 1 secondary structure, are more difficult to denature and
Log Cot tend to have a higher renaturation (hybridization) tem-
Figure 6-14 Reannealing of single-stranded (SS) DNA perature. Incubation of the hybridization system in sealed
to double-stranded (DS) DNA vs. time at a constant con-
bags in a water bath or in capped glass cylinders in rotary
centration yields a sigmoid curve. The complexity of the
DNA sequence will widen the sigmoid curve. Increasing
ovens maintains the blot at the proper temperature.
the length of the double-stranded DNA will shift the curve Short probes (&20 bases) can hybridize in 12 hours.
to the right. In contrast, longer probes require much longer hybridiza-
06Buckingham (F)-06 2/6/07 5:54 PM Page 109

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 109

Radioactive isotope probe


Advanced Concepts
The nature of the probe label will affect hybridiza-
tion conditions. Unlike 32P labeling, the bulky non-
Nitrocellulose
radioactive labels (see Fig. 6-12) disturb the membrane
hybridization of the DNA chain. The temperature of
hybridization with these types of probes will be
lower than that used for radioactively labeled probes.

tion times. For Southern and Northern blots with probes


!1000 bases in length, incubation is carried out for 16 Autoradiograph
hours or more. Raising the probe concentration can in-
crease the hybridization rates. Also, inert polymers, such
as dextran sulfate, polyethylene glycol, or polyacrylic X-ray film
acid, accelerate the hybridization rates for probes longer
than 250 bases.

Detection Systems
This chapter has so far addressed the transfer of elec-
trophoresed DNA, RNA, or protein to a solid membrane
Figure 6-15 A DNA or RNA probe labeled with radioactive
support and hybridization or binding of a specific probe phosphorous atoms (32P or 33P) hybridized to target (homolo-
to the target sequence of interest. The next step in these gous) sequences on a nitrocellulose membrane. The frag-
procedures is to detect whether the probe has bound to ments to which the probe is bound can be detected by
the target molecule and, if it has bound, the relative loca- exposing autoradiography film to the membrane.
tion of the binding. The original 32P-labeled probes
offered the advantages of simple and sensitive detection.
After hybridization, unbound probe is washed off, and
the blot is exposed to light-sensitive film to detect the
fragments that are hybridized to the radioactive probe
Advanced Concepts (Fig. 6-15). Wash conditions must be formulated so that
only completely hybridized probe remains on the blot.
Optimization may not completely eliminate all non- Typically wash conditions are more stringent than those
specific binding of the probe. This will result in used for hybridization.
extra bands in control lanes or cross-hybridizations. Nonradioactive detection systems require a more
At a given level of stringency, any increase to elim- involved detection procedure. For most nonradioactive
inate cross-hybridization will lower the binding to systems, the probe is labeled with a nucleotide covalently
the intended sequences. It becomes a matter of bal- attached to either digoxygenin or biotin. The labeled
ancing the optimal probe signal with the least nucleotide is incorporated into the nucleotide chain of the
amount of non-target binding. Cross-hybridizations probe by in vitro transcription, nick translation, primer ex-
are usually recognizable as bands of the same size in tension, or addition by terminal transferase. Digoxygenin-
multiple runs. It is important to take cross- or biotin-labeled probe is incubated together with the blot
hybridization bands into account in the final inter- with sample(s) containing the target sequence of interest
pretation of the assay results. to allow for hybridization to occur. After hybridization,
unbound probe is washed away. Then, antidigoxygenin
06Buckingham (F)-06 2/6/07 5:54 PM Page 110

110 Section 2 Common Techniques in Molecular Biology

Anti digoxygenin or streptavidin


Advanced Concepts conjugated to alkaline phosphatase

Digoxygenin or biotin
In addition to CSPD and CDP-star (Roche
Diagnostics Corp.), there are several substrates for Probe
chemiluminescent detection that are 12 dioxetane
derivatives such as 3-(2-spiroadamantane)-4-
methoxy-4-(3-phosphoryloxy) phenyl-1,2-dioxe-
tane (AMPPD; Tropix, Inc.). Dephosphorylation of Nitrocellulose
membrane
these compounds by the alkaline phosphatase con-
jugate bound to the probe on the membrane results
in a light-emitting product (see Fig. 6-17).25 Other
luminescent molecules include acridinium ester and
acridinium (N-sulfonyl) carboxamide labels, isolu-
minol, and electrochemiluminescent ruthenium tris-
bipyridyl labels.
The substrate used most often for chromogenic Autoradiography
detection is a mixture of Nitroblue tetrazolium
(NBT) and 5-bromo-4-chloro-3-indolyl phosphate
(BCIP). Upon dephosphorylation of BCIP by alka- X-ray film
line phosphatase, it is oxidized by NBT to give a
dark blue indigo dye as an oxidation product. BCIP
is reduced in the process, and also yields a blue
product (see Fig. 6-18).

Figure 6-16 Indirect non-radioactive detection. The


antibody or streptavidin, respectively, conjugated to alka-
probe is covalently attached to digoxygenin or biotin. After
line phosphatase (AP conjugate, Fig. 6-16) is added to hybridization, the probe is bound by antibodies to digoxy-
reaction mix to bind to the digoxigenin- or biotin-labeled genin or streptavidin conjugated to alkaline phosphatase
probe:target complex. Horseradish peroxidase (HRP) (AP). This complex is exposed to color or light producing
conjugates can also be used in this procedure. After the substrates of AP producing color on the membrane or light
detected with autoradiography film.
binding of the conjugate, the membrane is bathed in a
solution of substrate that, when oxidized by HRP or
dephosphorylated by AP, produces a signal. Substrates designed to minimize these drawbacks. Unlike radioac-
frequently used are dioxetane or tetrazolium dye deriva- tive detection, in which testing the membrane with a
tives, which generate chemiluminescent (Fig. 6-17) or Geiger counter can give an indication of how hot the
chromogenic (Fig. 6-18) signals, respectively (Table 6.2). bands are and consequently how long to expose the mem-
As with radioactive detection, the chemiluminescent brane to the film, chemiluminescent detection may
signal produced by the action of the enzyme on dioxetane require developing films at different intervals to deter-
develops in the dark by autoradiography. Light released mine the optimum exposure time.
by phosphorylation of dioxetane takes place at the loca- For chromogenic detection, a colored signal is pro-
tion on the membrane where the probe is bound and duced when the enzyme interacts with a derivative of a
darkens the light-sensitive film. Chemiluminescent tetrazolium dye and is detected directly on the membrane
detection is often stronger and develops faster than filter. The advantage of this type of detection is that the
radioactive detection. A disadvantage of chemilumines- color can be observed as it develops and the reaction
cent detection is that it is harder to control and sometimes stopped at a time when there is an optimum signal-to-
produces high backgrounds. New substrates have been background ratio. In general, chromogenic detection is
06Buckingham (F)-06 2/6/07 5:54 PM Page 111

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 111

O O O O *
OCH3 PO3 OCH3 O OCH3
O Alkaline O O
O
phosphatase + Light
(chemiluminescence)
PO3=
Figure 6-17 Light is emitted from 1-2 dioxetane substrates after dephosphorylation by alkaline
phosphatase to an unstable structure. This structure releases an excited anion that emits light.

not as sensitive as chemiluminescent detection and can ization of a band on the membrane or film. A band is
also result in a higher background, especially with probes simply seen as a line running across the width of the lane.
labeled by random priming. Analysis of bands, i.e., presence or absence or location in
The key to a successful blotting method is a high the lane, produced by Southern blot can be straightfor-
signal-to-noise ratio. Ideally, the probe and detection ward or complex, depending on the sample and the
systems should yield a specific and robust signal. High design of the procedure. Figure 6-19 is a depiction of a
specific signal, however, may be accompanied by high Southern blot result. The bands shown can be visualized
background (noise). Therefore, sensitivity of detection is either on a membrane or on an autoradiographic film. If
sometimes sacrificed to generate a more specific signal. a gene locus has a known restriction pattern, for instance
in lane 1, then samples can be tested to compare their
restriction patterns. In the figure, the sample in lane 3 has
Interpretation of Results the identical pattern, i.e., both lanes have the same num-
When a specific probe binds to its target immobilized ber of bands, and the bands are all in the same location
on a membrane, the binding is detected as described in on the gel and are likely to be very similar if not identi-
the previous section, with the end result being the visual- cal in sequence to the sample in lane 1. Southern blot

O
O
O P O
Cl O P O Cl OH Cl
O O
Br Br Br HN
O
N Phosphatase NH NH Br
O Cl
BCIP
(colorless, soluble) Oxidation Blue precipitate

Reduction

OCH3 OCH3
N H2CO OCH2
N
N N N N
N
N N N N N N N
NH HN

NO2 NO2
O2N
NO2
NBT Blue precipitate
(yellowish, soluble)
Figure 6-18 Generation of color with BCIP and NBT. Alkaline phosphatase dephosphorylates BCIP which then reduces NBT
making an insoluble blue precipitate.
06Buckingham (F)-06 2/6/07 5:54 PM Page 112

112 Section 2 Common Techniques in Molecular Biology

Table 6.2 Nonradioactive Detection Systems


Type of Detection Enzyme Reagent Reaction Product
Chromogenic HRP 4-chloro-1-naphthol (4CN) Purple precipitate
HRP 3,3-diaminobenzidine Dark brown precipitate
HRP 3,3,5,5,-tetramethylbenzidine Dark purple stain
Alkaline phosphatase 5-bromo-4-chloro-3-indolyl phosphate/nitro- Dark blue stain
blue tetrazolium
Chemiluminescent HRP Luminol/H2O2/p-iodophenol Blue light
Alkaline phosphatase 12 dioxetane derivatives Light
Alkaline phosphatase Disodium 3-(4-methoxyspiro {1,2-dioxetane- Light
3,2-(5-chloro) tricyclo[3.3.1.13,7]decan}
4-yl)-1-phenyl phosphate and derivatives
(CSPD, CDP-Star)

cannot detect tiny deletions or insertions of nucleotides product and that the low signal is not due to technical dif-
or single nucleotide differences unless they affect a spe- ficulties.
cific restriction site. For some assays, cross-hybridization
may confuse results. These artifacts can be identified by
their presence in every lane at a constant size. Array-Based Hybridization
Northern (or Western) blots are usually used for analy- Dot/Slot Blots
sis of gene expression, although they can also be used to
analyze transcript size, transcript processing, and protein There are many variations on Southern hybridization
modification. For these analyses, especially when esti- methods. In cases where the determination of the size of
mating expression, it is important to include an internal the target is not required, DNA and RNA can be more
control to correct for errors in isolation, gel loading, or quickly analyzed using dot blots or slot blots. These pro-
transfer of samples. The amount of expression is then cedures are usually applied to expression, mutation, and
determined relative to the internal control (Fig. 6-20). In amplification/deletion analyses.
the example shown, the target transcript or protein prod- For dot or slot blots, the target DNA or RNA is depos-
uct is expressed in increasing amounts, left to right. The ited directly on the membrane. Various devices, some
internal standardized control (lower band) assures that a
1 2 3 4
sample has low expression of target transcript of protein

M 1 2 3 4

Figure 6-20 Example of a Northern or Western blot result.


Lane 1 contains a positive control transcript or protein (arrow)
to verify the probe specificity and target size. Molecular
weight markers can also be used to estimate size as in
Figure 6-19 Example of a Southern blot result. The first lane Southern analysis. The amount of gene product (expression
(M) contains molecular weight markers. Restriction digests of level) is determined by the intensity of the signal from the test
a genetic region can be compared to determine differences samples relative to a control gene product (lower band in
in structure. Two samples with the same pattern (for example, lanes 24). The control transcript is used to correct for any
lanes 1 and 3) can be considered genetically similar. differences in isolation or loading from sample to sample.
06Buckingham (F)-06 2/6/07 5:54 PM Page 113

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 113

with vacuum systems, have been designed to deposit Genomic Array Technology
the target on the membrane. A pipet can be used for
procedures testing only a few samples. For dot blots, the Array technology can be applied to gene (DNA) analysis
target is deposited in a circle or dot. For slot blots, by performing comparative genome hybridization and to
the target is deposited in an oblong bar (Fig. 6-21). Slot gene expression (RNA or protein) analysis on expression
blots are more accurate for quantitation by densitometry arrays. There are several types of array technologies,
scanning because they eliminate the error that may arise including macroarrays, microarrays, high density oligo-
from scanning through a circular target. If the diameter nucleotide arrays, and microelectronic arrays.
of the scanned area is not exactly the same from one sam-
ple to another, comparative results may be inaccurate. Macroarrays
Dot blots are useful for multiple qualitative analyses In contrast to Northern and Southern blots, dot (and slot)
where many targets are being compared, such as muta- blots offer the ability to test and analyze larger numbers of
tional analyses. samples at the same time. These methodologies are lim-
Dot and slot blots are performed most efficiently on ited, however, by the area of the substrate material, nitro-
less complex samples, such as PCR products or selected cellulose membranes, and the volume of hybridization
mRNA preparations. Without gel resolution of the target solution required to provide enough probe to produce an
fragments, it is important that the probe hybridization adequate signal for interpretation. In addition, although
conditions are optimized for these types of blots because up to several hundred test samples can be analyzed simul-
cross-hybridizations cannot be definitively distinguished taneously, those samples can be tested for only one gene
from true target identification. A negative control (DNA or gene product. A variation of this technique is the
of equal complexity but without the targeted sequence) reverse dot blot, in which several different probes are
serves the baseline for interpretation of these assays. immobilized on the substrate, and the test sample is
When performing expression analysis by slot or dot labeled for hybridization with the immobilized probes. In
blots, it is also important to include an amplification or this configuration, the terminology can be confusing.
normalization control, as shown on the right in Figure 6- Immobilized probe is sometimes referred to as the target,
21. This allows correction for loading or sample differ- and the labeled specimen DNA, RNA, or protein is called
ences. This control can also be analyzed on a separate the probe. Regardless of the designation, the general idea
duplicate membrane to avoid cross-reactions between the is that a known sequence is immobilized at a known loca-
test and control probes. tion on the blot, and the amount of sample that hybridizes
to it is determined by the signal from the labeled sample.
Reverse dot blots on nitrocellulose membranes of sev-
eral to several thousand targets are macroarrays. Radi-
oactive or chemiluminescent signals are typically used to
detect the hybridized targets in the sample. Macroarrays
are created by spotting multiple probes onto nitrocellu-
lose membranes. The hybridization of labeled sample
material is read by eye or with a phosphorimager (a
quantitative imaging device that uses storage phosphor
Figure 6-21 Example configuration of a dot blot (left) and technology instead of x-ray film). Analysis involves com-
a slot blot (right). The target is spotted in duplicate, side by
side, on the dot blot. The last two rows of spots contain posi-
parison of signal intensity from test and control samples
tive, sensitivity and negative control followed by a blank with spotted on duplicate membranes.
no target. The top two rows of the slot blot gel on the left rep- Although macroarrays greatly increase the capacity
resent four samples spotted in duplicate, with positive, sensitiv- to assess numerous targets, this analysis system is still
ity and negative control followed by a blank with no target in
limited by the area of the membrane and the specimen
the last four samples on the right. The bottom two rows repre-
sent a loading or normalization control that is often useful in
requirements. As the target number increases, the volume
expression studies to confirm that equal amounts of DNA or of sample material required increases. This limits the util-
RNA were spotted for each test sample. ity of this method for use on small amounts of test mate-
06Buckingham (F)-06 2/6/07 5:54 PM Page 114

114 Section 2 Common Techniques in Molecular Biology

Solid Split Pin and Thermal Solenoid Piezoelectric Figure 6-22 Pen-type (left) and ink-jet
pin pin ring (right) technologies used to spot arrays.

rial, especially as might be encountered with clinical in triplicate, simultaneous screening of the entire human
specimens. genome on a single chip is within the scope of array tech-
nology.
Microarrays The larger nitrocellulose membrane, then, is replaced
In 1987, the use of treated glass instead of nitrocellulose by a glass microscope slide. The slide carrying the array
or nylon membranes for the production of arrays was of targets is referred to as a chip (Fig. 6-23). Targets are
developed, increasing the versatility of array applica- usually DNA, either cDNAs, PCR products, or oligomers;
tions. With improved spotting technology and the ability however, targets can be DNA, RNA, or protein. Targets
to deposit very small target spots on glass substrates, the are spotted in triplicate and spaced across the chip to
macroarray evolved into the microarray. Tens of thou- avoid any geographic artifacts that may occur from
sands of targets can be screened simultaneously in a very uneven hybridization or other technical problems. Probes
small area by miniaturizing the deposition of droplets are usually cDNA-generated from sample RNA but can,
(Fig. 6-22). Automated depositing systems (arrayers) can as well, be genomic DNA, RNA, or protein.
place more than 80,000 spots on a glass substrate the size
of a microscope slide. The completion of the rough draft
of the human genome sequence revealed that the human
genome may consist of fewer than 30,000 genes. Thus, Advanced Concepts
even with spotting representative sequences of each gene
The analysis of the entire genome or sets of related
genes is the relatively new field of genomics.
Knowing the combinatorial and interrelated func-
Advanced Concepts tions of gene products, observation of the behavior
of sets of genes or genomes, is a more accurate
The first automated arrayer was described in 1995 method for analyzing biological states or responses.
by Patrick Brown at Stanford University.26 This and Stanley Fields27 predicted that the entire collection
later versions of automated arrayers use pen-type of proteins coded by the genome, known as the pro-
contact to place a dot of probe material onto the sub- teome, is likely to be ten times more complex than
strate. Modifications of this technology include the the genome. The study of entire sets of proteins, or
incorporation of ink jet printing systems to deposit proteomics, will also be facilitated by array tech-
specific targets at designated positions using ther- nology using antigen/antibody or receptor/ligand
mal, solenoid, or piezoelectric expulsion of target binding in the array format. Mass spectrometry can
material (see Fig. 6-22). also be applied to the study of proteomics.
06Buckingham (F)-06 2/6/07 5:54 PM Page 115

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 115

Figure 6-23 Microarray, or DNA chip, is a glass slide car-


rying 384 spots. Arrays are sometimes supplied with fluores-
cent nucleotides for use in labeling the test samples, and
software for identification of the spots on the array by the
array reader.

Other methods used to deposit targets on chips include


performing DNA synthesis directly on the glass or
silicon support.10 This technique uses sequence informa-
tion to design oligonucleotides and to selectively mask,
activate, and covalently attach nucleotides at designated Figure 6-25 Microelectronic chip with a ten by ten array
positions on the chip. Proprietary photolithography (center diamond). Each of the 100 stations on the array is
techniques (Affymetrix) allow for highly efficient synthe- attached to a separate electrode (Nanogen).

sis of short oligomers (1025 bases long) on high-density


arrays (Fig. 6-24). These oligomers can then be probed that can be programmed to attract and concentrate the
with labeled fragments of the test sequences. Using this labeled sample. By enhancing the hybridization con-
technology, more than 100,000 targets can be applied ditions separately at each spot on the array, single nuc-
to chips. These types of arrays are called high-density leotide resolution is possible even on longer sample
oligonucleotide arrays and are used for mutation fragments.
analysis, single nucleotide polymorphism analysis, and Sample preparation for array analysis requires fluores-
sequencing. cent labeling of the test sample as microarrays and other
Another type of array method uses microelectronics to high-density arrays are read by automated fluorescent
focus targets to specific positions on the array (Fig. 6-25). detection systems. The most frequent labeling method
Once bound, these targets can be hybridized to labeled used for RNA is synthesis of cDNA or RNA copies with
DNA or RNA samples under controlled conditions. incorporation of labeled nucleotides. For DNA, random
These are microelectronic arrays. In this technol- priming or nick translation is used. Several alternative
ogy, each position on the array is attached to an electrode methods have also been developed.11

Mask Light
Activated
C A T A T
O O O OH OH O O A G C T G
T T T T T T C C T T C C G
DNA

Glass slide 1025 nucleotides


Figure 6-24 Photolithographic target synthesis. A mask (left) allows light activation of on the chip. When a nucleotide is added
only the activated spots will covalently attach it (center). The process is repeated until the desired sequences are generated at
each position on the chip (right).
06Buckingham (F)-06 2/6/07 5:54 PM Page 116

116 Section 2 Common Techniques in Molecular Biology

For gene expression analyses, target probes immobi- Normal reference DNA
lized on the chips are hybridized with labeled mRNA
from treated cells or different cell types to assess the
expression activity of the genes represented on the chip. Test sample DNA
Arrays used for this application are classifie as expres-
sion arrays.12 Expression arrays measure transcript or
protein production relative to a reference control isolated
from untreated or normal specimens (Fig. 6-26).
Another application of array technology is compara-
Microarray CGH
tive genome hybridization (array CGH). This method is
used to screen the genome or specific genomic loci for
deletions and amplifications.13 For this method, genomic
DNA is isolated, fragmented, and labeled for hybridiza-
Chromosome
tion on the chip (Fig. 6-27). This type of method is anal-
ogous to the cytogenetic technique done on metaphase
chromosomes. Array CGH can provide higher resolution
and more defined genetic information than traditional
Locus
cytogenetic analysis, but it is limited to the analysis of
loci represented on the chip. Genomic arrays can be per- Cytogenetic location
formed on fixed tissue and limiting samples. Methods Figure 6-27 Comparative genomic hybridization.
have been developed to globally amplify genomic DNA Reference and test DNA are labeled with different fluors, rep-
resented here as black and green respectively. After hybridiza-
to enhance CGH analysis.14,15 Reading microarrays tion, excess green label indicates amplification of test sample
requires a fluorescent reader and analysis software. After locus. Excess black label indicates deletion of the test sample
determination of background and normalization with locus. Neutral or gray indicates equal test and reference DNA.
standards included on the array, the software averages the
signal intensity from duplicate or triplicate sample data.
The results are reported as a relative amount of the refer- ances more than 23 standard deviations from 1 (test !
ence and test signals. Depending on the program, vari- reference) are considered an indication of significant
increases (test:reference "1) or decreases (test:reference
#1) in the test sample.
Control Treated Control Treated Several limitations to the array technology initially
restrained the use of microarrays in the clinical laboratory.
Lack of established standards and controls for optimal
binding prevents the calibration of arrays from one labo-
Single color Dual color
fluorescent fluorescent
ratory to another. Not enough data have been accumulated
labeling labeling to determine the background nonspecific binding and
cross hybridization that might occur among and within a
given set of sequences on an array. For instance, how
Hybridize Hybridize
much variation would result from comparing two normal
samples together multiple times? Background noise can
also affect the interpretation of array results. Furthermore,
Figure 6-26 Labeling of sample for array analysis. At the passive hybridization of thousands of different sequences
left is single color fluorescent labeling where duplicate chips
will result in different binding affinities under the same
are hybridized separately and compared. On the right is dual
color labeling where test (treated) and reference (control)
stringency conditions, unless immobilized sequences are
samples are labeled with different color fluors and hybridized carefully designed to have similar melting temperatures.
to the same chip. For mutation analysis, the length of the immobilized
06Buckingham (F)-06 2/6/07 5:54 PM Page 117

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 117

probe is limited due to the use of a single hybridization Labeled probe Single-stranded RNA
condition for all sequences. For gene expression applica-
tions, only relative, rather than absolute, quantitation is
possible.
These and other concerns are being addressed to
improve the reliability and consistency of array analysis.
As more data are accumulated, baseline measurements, Hybridization
universal standards, and recommended controls will be
established. Advances in microelectronics and microflu-
idics have also been applied to array design and manu-
facture.16,17
Although arrays are, to date, in limited use in clinical
laboratories, improvements in price and availability of
instrumentation and premade chips increase their value
Nuclease
for medical applications. Minimal sample requirements
and comprehensive analysis with relatively small invest-
ments in time and labor are attractive features of array
technology.

Solution Hybridization
Nuclease +
Solution hybridization is not yet a routine part of clinical
analysis. With the increasing interest in short inter- Full-length probe
fering RNAs (siRNAs) and microRNAs (miRNAs),
which are conveniently analyzed by this type of hybridi-
zation analysis, solution methods may come into more
frequent use. Target RNA hybrid
Solution hybridization has been used to measure
mRNA expression, especially when there are low Figure 6-28 Solution hybridization. Target RNAs are
amounts of target RNA. One version of the method is hybridized to a labeled RNA or DNA carrying the complemen-
called RNase protection, or S1 analysis, after the S1 sin- tary sequence to the target. After digestion by a single strand-
gle strandspecific nuclease. A labeled probe is hybri- specific nuclease, only the target:probe double-stranded
hybrid remains. The hybrid can be visualized by the label on
dized to the target sample in solution. After digestion of
the probe after electrophoresis.
excess probe by a single strandspecific nuclease, the
resulting labeled, double-stranded fragments are resolved
by polyacrylamide gel electrophoresis (Fig. 6-28). S1 hybridize to the target RNA. One probe, the capture
mapping is useful for determining the start point or ter- probe, is biotinylated and will bind specifically to strep-
mination point of transcripts.18,19 This procedure is more tavidin immobilized on a plate or on magnetic beads. The
sensitive than Northern blotting because no target can be other probe, called the detection probe, can be detected
lost during electrophoresis and blotting. It is more appli- by a monoclonal antibody directed against RNA:DNA
cable to expression analysis, the sensitivity being limited hybrids or a covalently attached digoxygenin molecule
with double-stranded DNA targets. that can be used to generate chromogenic or chemilumi-
There are several variations of this type of analysis. nescent signal (see Detection Systems).
Probe:target hybrids can be detected by capture on a solid Solution hybridization can also be applied to the analy-
support or beads rather than by electrophoresis.20,21 For sis of protein-protein interactions and to nucleic
these sandwich-type assays, two probes are used. Both acidbinding proteins, using a gel mobility shift
06Buckingham (F)-06 2/6/07 5:54 PM Page 118

118 Section 2 Common Techniques in Molecular Biology

Increasing probe d. CATCGCGATCTGCAATTACGACGATAA


GTAGCGCTAGACGTTAATGCTGCTATT
Bound Suppose you were to use single strands of these frag-
Free ments as probes for a Southern blot:

2. If the fragments were dissolved in a solution of


Figure 6-29 Gel mobility shift assay showing protein-protein
or protein-DNA interaction. The labeled test substrate is mixed
50% formamide, is the stringency of hybridiza-
with the probe in solution and then analyzed on a polyacry- tion higher or lower than if there were no formamide?
lamide gel. If the test protein binds the probe protein or DNA,
the protein will shift up in the gel assay. 3. If a high concentration of NaCl were added to the
hybridization solution, how would the stringency be
affected?
assay.22,23 After mixing the labeled DNA or protein with
the test material, such as a cell lysate, a change in mobil- 4. Does heating of the solution from 65!C to 75!C dur-
ity, usually a shift to slower migration, indicates binding ing hybridization raise or lower stringency?
of a component in the test material to the probe protein or
nucleic acid (Fig. 6-29). This assay has been used exten-
5. At the end of the procedure, what would the autoradi-
sively to identify trans factors that bind to cis acting ele-
ogram show if the stringency was too high?
ments that control gene regulation.
Solution hybridization can also be used to detect
6. In an array CGH experiment, three test samples were
sequence changes in DNA or mutational analysis. These
hybridized to three microarray chips. Each chip was
applications will be discussed in Chapter 8.
spotted with eight gene probes (Gene A-H). Below are
Hybridization methods offer the advantage of direct
results of this assay expressed as the ratio of test DNA
analysis of nucleic acids at the sequence level, with-
to reference DNA. Are any of the eight genes consis-
out cloning of target sequences. The significance of
tently deleted or amplified in the test samples? If so,
hybridization methodology to clinical applications is
which ones?
the direct discovery of molecular genetic information
from routine specimen types. A wide variety of modifi- Gene Sample 1 Sample 2 Sample 3
cations of the basic blotting methods have and will
be developed for clinical and research applications. A 1.06 0.99 1.01
Although amplification methods, specifically PCR, B 0.45 0.55 0.43
have replaced many blotting procedures, a number of
C 1.01 1.05 1.06
hybridization methods are still used extensively in rou-
tine clinical analysis. D 0.98 1.00 0.97
E 1.55 1.47 1.62

STUDY QUESTIONS F 0.98 1.06 1.01


G 1.00 0.99 0.99
1. Calculate the melting temperature of the following
DNA fragments using the sequences only: H 1.08 1.09 0.90
a. AGTCTGGGACGGCGCGGCAATCGCA
TCAGACCCTG CCGCG CCGTTAGCGT References
b. TCAAAAATCGAATATTTGCTTATCTA 1. Southern E. Detection of specific sequences
AGTTTTTAGCTTATAAACGAATAGAT among DNA fragments separated by gel electro-
c. AGCTAAGCATCGAATTGGCCATCGTGTG phoresis. Journal of Molecular Biology 1975;
TCGATTCGTAGCTTAACCGGTAGCACAC 98:503-17.
06Buckingham (F)-06 2/6/07 5:54 PM Page 119

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 119

2. Murthy S, Kamine J, Desrosiers RC. Viral-encoded 14. Huang Q, Schantz SP, Pulivarthi HR, et al.
small RNAs in herpes virus saimiriinduced Improving degenerate oligonucleotide primed
tumors. EMBO Journal 1986;5(7):1625-32. PCR comparative genomic hybridization for
3. Bowen B, Steinberg J, Laemmli UK, et al. The analysis of DNA copy number changes in
detection of DNA-binding proteins by protein blot- tumors. Genes, Chromosomes and Cancer
ting. Nucleic Acids Research 1980;8(1):1-20. 2000;28:395-403.
4. Dunn D. Effects of the modification of transfer 15. Wang G, Maher E, Brennan C, et al. DNA amplifi-
buffer composition and the renaturation of proteins cation method tolerant to sample degradation.
in gels on the recognition of proteins on western Genome Research 2004;14(11):2357-66.
blots by monoclonal antibodies. Analytical Bio- 16. Edman CF, Raymond DK, Wu E, et al. Electric
chemistry 1986;157(1):144-53. fielddirected nucleic acid hybridization on
5. Koshkin AA, Nielson P, Rajwanshi VK, et al. microchips. Nucleic Acids Research 1997;25(24):
Synthesis of the adenine, cytosine, guanine, 5- 4907-14.
methlycysteine, thymine and uracil bicyclonucleo- 17. Sosnowski RG, Tu E, Butler WF, et al. Rapid deter-
side monomers, oligomerisation, and unprecedented mination of single base mismatch mutations in
nucleic acid recognition. Tetrahedron 1998;54: DNA hybrids by direct electric field control.
3607-30. Proceedings of the National Academy of Sciences
6. Singh SK, Koshkin AA, Wengel J. LNA (locked 1997;94:1119-23.
nucleic acids): Synthesis and high-affinity nucleic 18. Squires C, Krainer A, Barry G, et al. Nucleotide
acid recognition. Chemical Communications sequence at the end of the gene for the RNA
1998;4:455-56. polymerase beta subunit (rpoC). Nucleic Acids
7. Buchardt O, Berg RH, Nielsen PE. Peptide nucleic Research 1981;9(24):6827-40.
acids and their potential applications in biotech- 19. Zahn K, Inui M, Yukawa H. Characterization of a
nology. Trends in Biotechnology 1993;11(9): separate small domain derived from the 5 end of
384-86. 23S rRNA of an alpha-proteobacterium. Nucleic
8. Egholm M, Christensen L, Behrens C, et al. PNA Acids Research 1999;27(21):4241-50.
hybridizes to complementary oligonucleotides 20. Rautio J, Barken KB, Lahdenper J, et al. Sandwich
obeying the Watson-Crick hydrogen-bonding hybridisation assay for quantitative detection of
rules. Nature 1993;365(6446):566-68. yeast RNAs in crude cell lysates. Microbial Cell
9. Kohler G, Milstein C. Continuous cultures of fused Factories 2003;2:4-13.
cells secreting antibody of predefined specificity. 21. Casebolt D, Stephenson CB. Monoclonal antibody
Nature 1975;256:495-97. solution hybridization assay for detection of mouse
10. Lipschultz RJ, Fodor TR, Gingeras DJ, et al. High- hepatitis virus infection. Journal of Clinical Micro-
density synthetic oligonucleotide arrays. Nature biology 1992;30(3):608-12.
Genetics 1999;21:20-24. 22. Malloy P. Electrophoretic mobility shift
11. Richter A, Schwager C, Hentz S, et al. Comparison assays. Methods in Molecular Biology 2000;
of fluorescent tag DNA labeling methods used for 130:235-46.
expression analysis by DNA microarrays. Bio- 23. Park S, Raines RT. Fluorescence gel retardation
Techniques 2002;33(3):620-30. assay to detect protein-protein interactions.
12. Freeman W, Robertson DJ, Vrana KE. Fundamen- Methods in Molecular Biology 2004;261:
tals of DNA hybridization arrays for gene expres- 155-60.
sion analysis. BioTechniques 2000;29(5):1042-55. 24. Britten RJ. Repeated sequences in DNA. Science
13. Oostlander A, Meijer GA, Ylstra B. Microarray- 1968;161:529-40.
based comparative genomic hybridization and its 25. McCapra F. The chemiluminescence of organic
applications in human genetics. Clinical Genetics compounds. Quarterly Review of the Chemical
2004;66(6):488-95. Society 1966; 20:485510.
06Buckingham (F)-06 2/6/07 5:54 PM Page 120

120 Section 2 Common Techniques in Molecular Biology

26. Schena M, Shalon D, Davis RW, et al. Quantitative 28. Wickstrom E. DNA combination therapy to
monitoring of gene expression patterns with a com- stop tumor growth. Cancer Journal 1998;4
plementary DNA microarray. Science 1995;270: (Suppl 1):S43.
467-70. 29. Smith JB. Preclinical antisense DNA therapy of
27. Fields S. Proteomics: Proteomics in genomeland. cancer in mice. Methods in Enzymology 1999;314:
Science 2001;291(5507):1221-24. 537-80.
07Buckingham (F)-07 2/6/07 12:25 PM Page 121

Chapter 7 Lela Buckingham and Maribeth L. Flaws

Nucleic Acid
Amplification

OUTLINE OBJECTIVES
TARGET AMPLIFICATION Compare and contrast among the following in vitro assays
Polymerase Chain Reaction for amplifying nucleic acids: polymerase chain reaction
Transcription-Based Amplification (PCR), branched DNA amplification, ligase chain reac-
Systems
tion, transcription-mediated amplification, and Q! repli-
PROBE AMPLIFICATION case with regard to type of target nucleic acid, principle,
Ligase Chain Reaction major elements of the procedure, type of amplicon pro-
Strand Displacement Amplification
duced, major enzyme(s) employed, and applications.
Q! Replicase
SIGNAL AMPLIFICATION
Describe examples of modifications that have been devel-
Branched DNA Amplification oped for PCR.
Hybrid Capture Assays Discuss how amplicons are detected for each of the ampli-
Cleavage-Based Amplification fication methods.
Cycling Probe
Design forward and reverse primers for a PCR, given the
target sequence.
Differentiate between target amplification and signal
amplification.

121
07Buckingham (F)-07 2/6/07 12:25 PM Page 122

122 Section 2 Common Techniques in Molecular Biology

Early analyses of nucleic acids were limited by the avail- What Mullis had envisioned was PCR. Over the next
ability of material to be analyzed. Generating enough months in the laboratory, he synthesized oligos flanking a
copies of a single gene sequence required propagation of region of the human nerve growth factor and tried to
millions of cells in culture or isolation of large amounts amplify the region from human DNA, but the experiment
of genomic DNA. If a gene had been cloned, many copies did not work. Not sure of the nucleotide sequence infor-
could be generated on bacterial plasmids, but this prepa- mation he had on the human genes, he tried a more
ration was laborious, and some sequences were resistant defined target. The first successful amplification was a
to propagation in this manner. short fragment of the Escherichia coli plasmid, pBR322.
The advent of the ability to amplify a specific DNA The first paper describing a practical application, the
sequence opened the possibility to analyze at the amplification of beta-globin and analysis for diagnosis of
nucleotide level virtually any piece of DNA in nature. patients with sickle cell anemia, was published 2 years
The first specific amplification method of any type was later.3 He called the method a polymerase-catalyzed
the polymerase chain reaction (PCR). Other amplifica- chain reaction because DNA polymerase was the
tion methods have been developed based on making enzyme he used to drive the replication of DNA, and once
modifications of PCR. The methods that have been devel- it started the replication continued in a chain reaction.
oped to amplify nucleic acids can be divided into three The name was quickly shortened to PCR. Since PCR was
groups, based on whether the target nucleic acid itself, a conceived and first performed, it has become increasingly
probe specific for the target sequence, or the signal used user-friendly, more automated, and more amenable to use
to detect the target nucleic acid is amplified. These meth- in a clinical laboratory, with infinite applications possible.
ods are discussed in this chapter.
Basic PCR Procedure
When the cell replicates its DNA it requires the existing
Target Amplification double-stranded DNA that serves as the template to give
The amplification of nucleic acids by target amplifica- the order of the nucleotide bases, the deoxyribonu-
tion involves making copies of a target sequence to such cleotide bases themselves: adenine, thymine, cytosine,
a level (in the millions of copies) that they can be and guanine; DNA polymerase to catalyze the addition of
detected in vitro. This is analogous to growing cells in nucleotides to the growing strand, and a primer to which
culture and allowing the cells to replicate their nucleic DNA polymerase adds subsequent bases (refer to
acid as well as themselves so that, for example, they can Chapter 1 for a detailed explanation).
be visualized on an agar plate. The difference is that wait- PCR essentially duplicates the in vivo replication of
ing for cells to replicate to detectable levels can take days DNA in vitro, using the same components (Table 7.1) to
to weeks or months, whereas replicating the nucleic acid replicate DNA as the cell does in vivo, with the same end
in vitro only takes hours to days. PCR is the first and pro- result, one copy of double-stranded DNA becoming two
totypical method for amplifying target nucleic acid. copies (Fig. 7-1). Within one to two hours PCR can pro-
duce millions of copies called amplicons of DNA. In
contrast it would probably take days for a cell to produce
Polymerase Chain Reaction
the same number of copies in vivo. The real advantage of
Kary Mullis conceived the idea of amplifying DNA in the PCR is the ability to amplify specific targets. Just as
vitro in 1983 while driving one night on a California high- the Southern blot first allowed analysis of specific
way.1,2 In the process of working through a mutation regions in a complex background, PCR presents the
detection method, Mullis came upon a way to double his opportunity to amplify and essentially clone the target
test target, a short region of double-stranded DNA, giving sequences. The amplified target, then, can be subjected to
him 21, or 2, copies. If he repeated the process, the target innumerable analytical procedures.
would double again, giving 22, or 4, copies. After N dou- The components of the PCR, DNR template, primers,
blings, he would have 2N copies of his target. If N ! 30 nucleotides, polymerase, and buffers, are subjected to an
or 40, there would be millions of copies. amplification program. The amplification program con-
07Buckingham (F)-07 2/6/07 12:25 PM Page 123

Nucleic Acid Amplification Chapter 7 123

Historical Highlights
Kary Mullis was working in a laboratory at Cetus contaminating dNTPs. He would then heat the reaction
Corporation, where he synthesized short single- to denature the dNTP-extended oligos and add an
stranded DNA molecules or oligodeoxynucleotides excess of unextended oligos and the ddNTPs. As he
(oligos) used by other laboratories. Mullis also tinkered further considered the modification to his method, he
with the oligos he made. As he drove through the realized that if the extension of an oligo in the prelimi-
mountains of Northern California, Mullis was thinking nary reaction crossed the point where the other oligo
about a method he had designed to detect mutations in bound on the opposite strand, he would make a new
DNA. His scheme was to add radioactive dideoxynu- copy of the region between, similar to how a cell repli-
cleotides, ddATP, ddCTP, ddGTP, ddTTP, to four sepa- cated its DNA during cell division. He considered the
rate DNA synthesis reactions containing oligos, new copy and additional advantage, as it would
template, and DNA polymerase. In each reaction, the improve the sensitivity of this method by doubling the
oligo would bind specifically to the template, and the target. Then he thought, what if he did it again? The tar-
polymerase would extend the oligo with the dideoxy- get would double again. If he added dNTPs intention-
nucleotide but only the dideoxynucleotide that was ally he could do it over and over again. In his own
complementary to the next nucleotide in the template. words: I stopped the car at mile marker 46,7 on
He could then determine in which of the four tubes the Highway 128. In the glove compartment I found some
oligo was extended with a radioactive ddNTP by gel paper and a pen. I confirmed that two to the tenth power
electrophoresis. He thought he might improve the was about a thousand and that two to the twentieth
method by using a double-stranded template and prim- power was about a million and that two to the thirtieth
ing synthesis on both strands, instead of one at a time. power was around a billion, close to the number of base
Because the results of the synthesis reaction would be pairs in the human genome. Once I had cycled this
affected by contaminating deoxynucleotides (dNTPs) reaction thirty times I would be able to [copy] the
in the reagent mix, Mullis considered running a pre- sequence of a sample with an immense signal and
liminary reaction without the ddNTPs to use up any almost no background.82

sists of a specified number of cycles that are divided into


steps during which the samples are held at particular tem-
peratures for designated times. The temperature will then
determine the reaction that occurs, and changing the tem-
Historical Highlights
perature changes the reaction. Table 7.2 shows the steps Mullis original method, using ddNTPs and oligos
of a common three-step PCR cycle. to detect mutations, is still in use today. Fluorescent
PCR starts with one double-stranded DNA target. In polarization-template-directed dye terminator
the first step (denaturation), the double-stranded DNA is incorporation (described in Chapter 9) uses fluo-
denatured into two single strands in order to be replicated rescently labeled ddNTPs to distinguish which
(Fig. 7-2). This is accomplished by heating the sample at ddNTP extends the oligo. Another extension/termi-
94!96!C for several seconds to several minutes, depend- nation assay, Homogeneous MassExtend, is a sim-
ing on the template. The initial denaturation step is ilar method, using mass spectrometry to analyze the
lengthened for genomic or other large DNA template extension products. Both of these methods are part
fragments. Subsequent denaturations can be shorter. of the Human Haplotype Mapping (HapMap) Proj-
The next and most critical step for the specificity of the ect (see Chapter 11).
PCR is the annealing step. In the second step of the PCR
07Buckingham (F)-07 2/6/07 12:25 PM Page 124

124 Section 2 Common Techniques in Molecular Biology

Components of a Typical PCR Reaction


Historical Highlights
Table 7.1

Component Purpose
As Kary Mullis realized early on, the key to the bril- 0.25 mM each primer Directs DNA synthesis to the
liance of PCR is that primers can be designed to tar- (oligodeoxynucleotides) desired region
get specific sequences: I drove on down the road. 0.2 mM each dATP, Building blocks that extend the
In about a mile it occurred to me that the oligonu- dCTP, dGTP, dTTP primers
cleotides could be placed at some arbitrary distance 50 mM KCl Monovalent cation (salt), for opti-
from each other, not just flanking a base pair and mal hybridization of primers to
that I could make an arbitrarily large number of template
copies of any sequence I chose and whats more, 10 mM Tris, pH 8.4 Buffer to maintain optimal pH for
most of the copies after a few cycles would be the the enzyme reaction
same size. That size would be up to me. They would 1.5 mM MgCl2 Divalent cation, required by the
look like restriction fragments on a gel. I stopped enzyme
the car again. Dear Thor!, I exclaimed. I had solved 2.5 units polymerase The polymerase enzyme that ex-
the most annoying problems in DNA chemistry in a tends the primers (adds dNTPs)
single lightening bolt. Abundance and distinction. 102105 copies of template Sample DNA that is being tested.
With two oligonucleotides, DNA polymerase, and
the four nucleoside triphosphates I could make as
much of a DNA sequence as I wanted and I could words, the primers determine the specificity of the ampli-
make it on a fragment of a specific size that I could fication. It is important that the annealing temperature be
distinguish easily.82 optimized with the primers and reaction conditions. An-
nealing temperatures will range 50!70!C and are usually
established empirically. A starting point can be deter-
mined using the Tm of the primer sequences (see Chapter
cycle, the two oligonucleotides that will prime the syn- 6 for a discussion of stringency and hybridization). Reac-
thesis of DNA anneal (hybridize) to complementary se- tion conditions, salt concentration, mismatches, template
quences on the template (Fig. 7-3). The primers dictate condition, and secondary structure will all affect the real
the part of the template that will be amplified; in other Tm of the primers in the reaction.

Region under
investigation
Template DNA
5 3
G A A T CG T CG A GC T GC T A GC T T T G T T CG A
GA A A C A A
Primer Primer

A T CG T C
C T T A GC A GC T CG A CG A T CG A A A C A A GC T
3 5
Template DNA
PCR

5 3
A T CG T CG A GC T GC T A GC T T T G T T
T A GC A GC T CG A CG A T CGA A A C A A Figure 7-1 The components and result of a PCR.
Oligodeoxynucleotides (primers) are designed to
hybridize to sequences flanking the DNA region under
A T CG T CG A GC T GC T A GC T T T G T T investigation. The polymerase extends the primers
T A GC A GC T CG A CG A T CG A A A C A A making many copies of the region flanked by the
3 5 primer sequences, the PCR product.
07Buckingham (F)-07 2/6/07 12:25 PM Page 125

Nucleic Acid Amplification Chapter 7 125

Table 7.2 Elements of a PCR Cycle


Step Temperature (oC) Time (sec) DNA Region of interest
Denaturation 9096 2060 5 3
Annealing 5070 2090 Primer
Extension 6875 1060 Primer
3 5

The third and last step of the PCR cycle is the primer
extension step (Fig. 7-4). This is essentially when DNA Figure 7-3 In the second step of the PCR cycle, annealing,
synthesis occurs. In this step, the polymerase synthesizes the primers hybridize to their complementary sequences on
a copy of the template DNA by adding nucleotides to the each strand of the denatured template. The primers are
hybridized primers. DNA polymerase catalyzes the for- designed to hybridize to the sequences flanking the region of
interest.
mation of the phosphodiester bond between an incoming
dNTP determined by hydrogen bonding to the template
(A:T or G:C) and the base at the 3 end of the primer. In the PCR program, millions of copies of the original
this way, DNA polymerase replicates the template DNA region defined by the primer sequences will have been
by simultaneously extending the primers on both strands generated (Fig. 7-7). Following is a more detailed discus-
of the template. This step occurs at the optimal tempera- sion of each of the components of PCR.
ture of the enzyme, 68!72!C. In some cases, the anneal-
ing temperature is close enough to the extension Components of PCR
temperature that the reaction can proceed with only two The PCR is a method of in vitro DNA synthesis. There-
temperature changes. This is two-step PCR, as opposed fore, to perform PCR, all of the components necessary
to three-step PCR that requires a different temperature for the replication of DNA in vivo are combined in opti-
for all three steps. mal concentrations for replication of DNA to occur in
At the end of the three steps, or one cycle (denatura- vitro. This includes the template to be copied, primers to
tion, primer annealing, and primer extension), one copy prime synthesis of the template, nucleotides, polymerase
of double-stranded DNA has been replicated into two enzyme, and buffer components including monovalent
copies. Increasing the temperature back up to the dena- and divalent cations to provide optimal conditions for
turing temperature starts another cycle (Fig. 7-5), with the accurate and efficient replication.
end result being a doubling in the number of double-
stranded DNA molecules again (Fig. 7-6). At the end of

DNA
5 5 3
Primer

DNA 3 5
Region to be
3
amplified
5

Figure 7-4 DNA polymerase catalyzes addition of


3 deoxynucleotide triphosphates (dNTPs) to the primers,
using the sample DNA as the template. This completes
Figure 7-2 Denaturation of the DNA target. The region to one PCR cycle. Note how in the original template there
be amplified is shown in green. The primers are present in vast was one copy of the green region. Now, after one cycle,
excess. there are two copies.
07Buckingham (F)-07 2/6/07 12:25 PM Page 126

126 Section 2 Common Techniques in Molecular Biology

5 3

5 3
3 5
3 5

5 3

5 3
3 5
3 5

Figure 7-5 The first step (denaturation) of the second cycle, followed by the annealing step in which primers hybridize to the
original template and the newly synthesized product.

Primers get sequence. The placement of the primers will also dic-
The primers are the critical component of the PCR tate the size of the amplified product.
because primers determine the specificity of the PCR. Binding of primers is subject to the same physical lim-
Primers are analogous to the probes in blotting and hybri- itations as probe binding. The primer sequence (% GC)
dization procedures (see Chapter 6). Primers are chemi- and length affect the optimal conditions in which the
cally manufactured on a DNA synthesizer. primer will bind to its target. The approximate melting
Primers are designed to contain sequences homologous temperature, or Tm, of the primers can be calculated using
to sites flanking the region to be analyzed. Primer design the equation for short DNA fragments described in
is therefore a critical aspect of the PCR. Primers are sin- Chapter 6. The primer Tm can serve as a starting point for
gle-stranded DNA fragments, usually 2030 bases in
length. The forward primer must bind to the target DNA
sequence just 5 to the sequences intended to be ampli-
fied. The reverse primer must bind just 5 to the sequence Target region
to be amplified on the opposite strand of the DNA. Thus,
the design of primers requires some knowledge of the tar-

Target region
5 3
3 5

5 3
3 5

3 5
5 3

5 3
3 5
Figure 7-7 In an ideal PCR, the PCR product (amplicon) is
Figure 7-6 After the third step (extension) of the second composed of 2N copies of the target region where N ! num-
cycle, there are four copies of the target region. ber of PCR cycles.
07Buckingham (F)-07 2/6/07 12:25 PM Page 127

Nucleic Acid Amplification Chapter 7 127

The nature of the primer structure determines the accu-


Advanced Concepts racy of binding to its complementary sequence and not
to other sequences. Just as cross-hybridization can occur
For most laboratories, primers are purchased from a with blot hybridization, aberrant primer binding, or mis-
manufacturer by submitting the required sequences, priming, can occur in PCR. A fragment synthesized from
amount required (scale of synthesis), and level of mispriming will carry the primer sequence and become
purification. Standard primer orders are on the a target for subsequent rounds of amplification (Fig. 7-8).
50200nm scale of synthesis. Higher amounts Eventually, misprimed products will consume com-
(150 !m) are more expensive to purchase per base. ponents away from the intended reaction. The resulting
Purification of the synthesized primers may be per- misprimed products may also interfere with proper inter-
formed by cartridge or column binding and washing, pretation of results or subsequent procedures such as
high performance liquid chromatography (HPLC), sequencing (see Chapter 10) or mutation analysis (see
or by polyacrylamide gel electrophoresis (PAGE). Chapter 9).
HPLC and PAGE purification are more expensive Secondary structure (internal folding and hybridiza-
than cartridge purification. Primers may also be tion within DNA strands) can also interfere with PCR.
labeled at the time of synthesis with fluorescent Primer sequences that have internal homologies, espe-
dyes, thiolation, biotinylization, or other modifiers. cially at the 3 end, or homologies with the other member
of the primer pair may not work as well in the PCR. An
artifact often observed in the PCR is the occurrence of
setting the optimal annealing temperature, the critical step primer dimers. These are PCR products that are just
for the specificity of the amplification reaction. Primers double the size of the primers. They result from the bind-
should be designed such that the forward and reverse ing of primers onto each other through short (23 base)
primers have similar Tm so that both will hybridize opti- homologies at their 3 ends and the copying of each
mally at the same annealing temperature. Tm can be primer sequence (Fig. 7-9). The resulting doublet is then
adjusted by increasing the length of the primers or by a very efficient target for subsequent amplification.
placing the primers in areas with more or fewer Gs and Cs The entire primer sequence does not have to bind to the
in the template. template to prime synthesis; however, the 3 nucleotide

Intended target Unintended


sequence sequence
5 3
3 5
Primer

5 3
3 5

Figure 7-8 Mispriming of one primer


creates an unintended product that could
interfere with subsequent interpretation.
Mispriming can also occur in regions unre-
lated to the intended target sequence.
07Buckingham (F)-07 2/6/07 12:25 PM Page 128

128 Section 2 Common Techniques in Molecular Biology

5 3 5 3
3 5
3 5 Primer
Any sequence

3 5
5 3

3 5

5 3
PCR product with
any sequence attached
3 5 Figure 7-10 Any sequence can be added to the 5 end of
the primer. After PCR, the sequence will be on the end of the
Figure 7-9 Formation of primer dimers occurs when there PCR product. These tailed primers can add useful sequences
are three or more complementary bases at the 3 end of the to one, as shown, or both ends of the PCR product.
primers. With the primers in excess, these will hybridize during
the annealing step (vertical lines), and the primers will be
extended by the polymerase (dotted line) using the opposite
primer as the template. The resulting product, denatured in DNA is usually used. Lesser amounts are required for
the next cycle, will compete for primers with the intended more defined template preparations such as cloned target
template. DNA or product from a previous amplification.
The best templates are in good condition, free of con-
taminating proteins, and without nicks or breaks that can
position is critical for extension of the primer. The poly- stop DNA synthesis or cause misincorporation of
merase will not form a phosphodiester bond if the 3 end nucleotide bases. Templates with high GC content and
of the primer is not hydrogen-bonded to the template. secondary structure may prove more difficult to optimize
This characteristic of primer binding has been exploited for amplification. The DNA region affected in Fragile X
to modify the PCR procedure for mutation analysis of the syndrome, 5 to the FMR-1 gene, is an example of such a
template (see Chapter 9). Noncomplementary extensions GC-rich target.
or tails can be added to the 5 end of the primer sequences
to introduce useful additions to the final PCR product, Deoxyribonucleotide Bases
such as restriction enzyme sites, promoters, or binding Nucleotide triphosphates are the building blocks of
sites for other primers. These tailed primers can be DNA. An equimolar mixture of the four deoxynucleotide-
designed to add or alter sequences to one or both ends of triphosphates (dNTPs), adenine, thymine, guanine, and
the PCR product (Fig. 7-10).

DNA Template
The template may be single- or double-stranded DNA.
In a clinical sample, depending on the application, the
Advanced Concepts
template may be derived from the patients genomic or Reagent systems that are designed to amplify targets
mitochondrial DNA or from viruses, bacteria, fungi, or optimally with high GC content are available. These
parasites that might be infecting the patient. Genomic systems incorporate an analog of dGTP, deazaGTP,
DNA will have only one or two copies per cell equivalent to destabilize secondary structure. Deaza-GTP
of single-copy genes to serve as amplification targets. interferes with EtBr staining in gels and is best used
With robust PCR reagents and conditions, nanogram in procedures with other types of detection, such as
amounts of genomic DNA are sufficient for consistent autoradiography.
results. For routine clinical analysis, 100 ng to 1 !g of
07Buckingham (F)-07 2/6/07 12:25 PM Page 129

Nucleic Acid Amplification Chapter 7 129

cytosine, is added to the synthesis reaction in concentra- polymerase to generate large products over 30,000 bases
tions sufficient to support the exponential increase of in length.
copies of the template. The four dNTP concentrations Cloning of the genes coding for these polymerases has
should be higher than the estimated Km of each dNTP led to modified versions of the polymerase enzymes,
(1015 mM, the concentration of substrate at half maxi- such as the Stoffel fragment lacking the N-terminal 289
mal enzyme velocity). Standard procedures require amino acids of Taq polymerase and its inherent 3 to 5
0.10.5 mM concentrations of each nucleotide. Substi- exonuclease activity4. The half-life of the Stoffel frag-
tuted or labeled nucleotides, such as deaza GTP, may be ment at high temperatures is about twice that of Taq poly-
included in the reaction for special applications. These merase, and it has a broader range of optimal MgCl2
nucleotides will require empirical optimization for best concentrations (210 mM) than Taq. This enzyme is rec-
results. ommended for allele-specific PCR and for amplification
of regions with high GC content. Further modified ver-
DNA Polymerase sions of the Taq enzymes retaining 3 to 5 exonuclease,
Automation of the PCR procedure was greatly facili- but not 5 to 3 exonuclease activity, are used where high
tated by the discovery of the thermostable enzyme, Taq fidelity (accurate copying of the template) is important.
polymerase. When Kary Mullis first performed PCR, he Other variants of Taq polymerase, ThermoSequenase
used the DNA polymerase isolated from E. coli. Every and T7 Sequenase, efficiently incorporate dideoxy NTPs
time the sample was denatured, however, the high tem- for application to chain termination sequencing (see
perature denatured the enzyme. Thus, after each round of Chapter 10).
denaturation, additional E. coli DNA polymerase had to
be added to the tube. This was labor-intensive and pro- PCR Buffer
vided additional opportunities for the introduction of con- PCR buffers provide the optimal conditions for
taminants into the reaction tube. The Taq polymerase was enzyme activity. Potassium chloride (20100 mM),
isolated from the thermophilic bacterium, Thermus ammonium sulfate (1530 mM), or other salts of mono-
aquaticus. valent cations are important buffer components. These
Using an enzyme derived from a thermophilic bac- salts affect the denaturing and annealing temperatures of
terium meant that the DNA polymerase could be added the DNA and the enzyme activity. An increase in salt con-
once at the beginning of the procedure and it would centration makes longer DNA products denature more
maintain its activity throughout the heating and cooling slowly than shorter DNA products during the amplifica-
cycles. Other enzymes, such as Tth polymerase from tion process, so shorter molecules will be amplified pref-
Thermus thermophilus, were subsequently exploited erentially. The influence of buffer/salt conditions varies
for laboratory use. Tth polymerase also has reverse with different primers and templates.
transcriptase activity so that it can be used in reverse Magnesium chloride also affects primer annealing and
transcriptase PCR (RT-PCR, see below) where the start- is very important for enzyme activity. Magnesium
ing material is an RNA template. The addition of proof- requirements will vary with each reaction, because each
reading enzymes, e.g., Vent polymerase allows Taq or Tth NTP will take up one magnesium atom. Furthermore, the
presence of ethylenediaminetetraacetic acid (EDTA) or
other chelators will lower the amount of magnesium
Advanced Concepts available for the enzyme. Too few Mg2! ions lower
enzyme efficiency, resulting in a low yield of PCR prod-
Note the nomenclature for the enzymes is derived uct. Overly high Mg2! concentrations promote misincor-
from the organism from which the enzyme comes, poration and thus increase the yield of nonspecific
similar to the nomenclature for restriction enzymes. products. Lower Mg2! concentrations are desirable when
For example, for the Taq polymerase, the T comes fidelity of the PCR is critical. The recommended range of
from the genus name, Thermus, and the aqcomes MgCl2 concentration is 14 mM, in standard reaction
from the species name, aquaticus. conditions. If the DNA samples contain EDTA or other
chelators, the MgCl2 concentration in the reaction mix-
07Buckingham (F)-07 2/6/07 12:25 PM Page 130

130 Section 2 Common Techniques in Molecular Biology

ture should be adjusted accordingly. As with other PCR Early versions of thermal cyclers were designed as
components, the optimal conditions are established heater/coolers with programmable memory to accept the
empirically. Tris buffer and accessory buffer components appropriate reaction conditions. Compared with modern
are also important for optimal enzyme activity and accu- models, the available memory for recording the reac-
rate amplification of the intended product; 10 mM Tris- tion conditions was limited, and sample capacity was
HCl maintains the proper pH of the buffer, usually small. Wax or oil (vapor barriers) had to be added to the
between pH 8 and pH 9.5. reactions to prevent condensation of the sample on the
Accessory components are sometimes used to opti- tops of the tubes during the temperature changes. The
mize reactions. Bovine serum albumin (10100 !g/mL) layer of wax or oil made subsequent sample handling
binds inhibitors and stabilizes the enzyme. Dithiothreitol more difficult. Later, thermal cycler models were
(0.01 mM) provides reducing conditions that may designed with heated lids that eliminated the requirement
enhance enzyme activity. Formamide (1%10%) added for vapor barriers.
to the reaction mixture will lower the denaturing temper- There are numerous manufacturers of thermal cyclers.
ature of DNA with high secondary structure, thereby These instruments differ in heating and/or refrigeration
increasing the availability for primer binding. Chaotropic systems as well as the programmable software within the
agents such as triton X-100, glycerol, and dimethyl sul- units. Samples may be held in open chambers for air
foxide added at concentrations of 1%10% may also heating and cooling or in sample blocks designed to
reduce secondary structure to allow polymerase exten- accommodate 0.2-mL tubes, usually in a 96 well format.
sion through difficult areas. These agents contribute to Some models have interchangeable blocks to accommo-
the stability of the enzyme as well. date amplification in different sizes and numbers of tubes
Enzymes are usually supplied with buffers optimized or slides. A cycler may run more than one block inde-
by the manufacturer. Commercial PCR buffer enhancers pendently at the same time so that different PCR pro-
of proprietary composition may also be purchased to grams can be performed simultaneously. Rapid PCR
optimize difficult reactions. Often, the buffer and its systems are designed to work with very small sample
ingredients are mixed with the nucleotide bases and volumes in chambers that can be heated and cooled
stored as aliquots of a master mix. The enzyme, target, quickly by changing the air temperature surrounding the
and primers are then added when necessary. Dedicated samples. Real-time PCR systems are equipped with flu-
master mixes will also include the primers, so that only orescent detectors to measure PCR product as the reac-
the target sequences must be added. tion proceeds. PCR can also be performed in a microchip
device in which 12 !L samples are forced through tiny
Thermal Cyclers channels etched in a glass chip, passing through temper-
The first PCRs were performed using multiple water ature zones as the chip rests on a specially adapted heat
baths or heat blocks set at the required temperatures for block.5
each of the steps. The tubes were moved from one tem- For routine PCR in the laboratory, an appropriate
perature to another by hand. In addition, before the dis- amount of DNA that has been isolated from a test speci-
covery of thermostable enzymes, new enzyme had to be men is mixed with the other PCR components, either sep-
added after each denaturation step, further slowing the arately or as part of a master mix in 0.20.5mL tubes.
procedure and increasing the chance of error and con- Most thermal cyclers take thin-walled tubes, 0.2-
tamination. mLtube strips or 96 well plates. Preparation of the spec-
Automation of this tedious process was greatly facili- imen for PCR is often referred to as pre-PCR work. To
tated by the availability of the heat stable enzymes. To avoid contamination (see below), it is recommended that
accomplish the PCR, then, an instrument must only man- the pre-PCR work be done in a designated area that is
age temperature according to a scheduled amplification clean and free of amplified products. The sample tubes
program. Thermal cyclers or thermocyclers were thus are then loaded into the thermal cycler. The computer is
designed to rapidly and automatically ramp (change) programmed with the temperatures and times for each
through the required incubation temperatures, holding at step of the PCR cycle, the number of cycles to complete
each one for designated periods. (usually 3050), the conditions for ramping from step to
07Buckingham (F)-07 2/6/07 12:25 PM Page 131

Nucleic Acid Amplification Chapter 7 131

step, and the temperature at which to hold the tubes once Controls for PCR
all of the cycles are complete. The technologist starts the As with any diagnostic assay, running the correct con-
run and walks away until it is complete. trols in PCR is essential for maintaining and ensuring the
After the PCR, a variety of methods are used to analyze accuracy of the assay. With every PCR run, the appropri-
the PCR product. Most commonly, the PCR product is ate controls must be included. Positive controls ensure
analyzed by gel or capillary electrophoresis. Depending that the enzyme is active, the buffer is optimal, the
on the application, the size, presence, or intensity of PCR primers are priming the right sequences, and the thermal
products is observed on the gel. An example of the results cycler is cycling appropriately. A negative control without
from a PCR run is shown in Figure 7-11. DNA (also called a contamination control or reagent

Molecular Reagent
weight blank
markers

(misprime)

PCR
product

(primer
dimers)

Figure 7-11 Example of PCR products after resolution on an agarose gel and staining with
ethidium bromide. Molecular weight markers in lane 1 are used to estimate the size of the PCR
product. The intended product is 100 bp. Artifactual primer dimers in every lane and a misprimed
product in lane 7 can also be observed. Absence of products in lane 8 confirms that there is no
contamination in the master mix.
07Buckingham (F)-07 2/6/07 12:25 PM Page 132

132 Section 2 Common Techniques in Molecular Biology

blank) ensures that the reaction mix is not contaminated Contamination is controlled both physically and chem-
with template DNA or amplified products from a previous ically. Physically, the best way to avoid PCR carryover is
run. A negative control with DNA that lacks the target to separate the pre-PCR areas from the post-PCR analy-
sequence (negative template control) ensures that the sis areas. Positive airflow, air locks, and more extensive
primers are not annealing to unintended sequences of measures are taken by high throughput laboratories that
DNA. In some applications of PCR, an internal control is process large numbers of samples and test for a limited
included. In this type of control (amplification control), number of amplification targets. Most laboratories can
a second set of primers and an unrelated target are added separate these areas by assigning separate rooms or using
to the reaction mix to demonstrate that the reaction is isolation cabinets. Equipment, including laboratory
working even if the test sample is not amplified. gowns and gloves, and reagents should be dedicated to
Amplification controls are performed, preferably in the either pre- or post-PCR. Items can flow from the pre- to
same tube with the test reaction, although it is acceptable the post-PCR area but not in the opposite direction with-
to perform the amplification control on a duplicate sam- out decontamination.
ple. This type of control is most important when PCR Ultraviolet (UV) light has been used to decontaminate
results are reported as positive or negative, by which and maintain pre-PCR areas. UV light catalyzes single-
negative means that the target sequences are not pres- and double-strand breaks in the DNA that will then inter-
ent. The amplification control is critical to distinguish fere with replication. Isolation cabinets are equipped with
between a true negative for the sample and an amplifica- UV light sources that are turned on for about 20 minutes
tion failure (false-negative). after the box has been used. The effectiveness of UV light
may be increased by the addition of psoralens to ampli-
Control of PCR Contamination fication products after analysis. Psoralens intercalate
Contamination is a significant concern for methods that between the bases of double-stranded DNA, and in the
involve target amplification by PCR. The nature of the presence of long-wave UV light they covalently attach to
amplification procedure is such that, theoretically, a sin- the thymidines, uracils, and cytidines in the DNA chain.
gle molecule will give rise to product. This is critical in The bulky adducts of the psoralens prevent denaturation
the clinical laboratory where results may be interpreted and amplification of the treated DNA.
based on the presence, absence, size, or amount of a PCR The efficiency of UV light treatment for decontamina-
product. With modern reagent systems designed for tion depends on the wavelength, energy, and distance of
robust amplification of challenging specimens, such as the light source. Care must be taken to avoid skin or eye
paraffin embedded tissues or samples with low cell num- exposure to UV light. UV light will also damage some
bers, the balance between aggressive amplification of the plastics, so that laboratory equipment may be affected by
intended target and avoidance of a contaminating tem- extended exposure. Although convenient, the efficiency
plate is delicate. For this reason, contamination control is of UV treatment may not be the most effective deconta-
of utmost importance in designing a PCR procedure and minant for every procedure.68
laboratory setup. A widely used method for decontamination and prepa-
Although genomic DNA is a source of spurious PCR ration of the workspace is 10% bleach (7 mM sodium
targets, the major cause of contamination is PCR prod- hypochlorite). Frequently wiping bench tops, hoods, or
ucts from previous amplifications. Unlike the relatively any surface that comes in contact with specimen material
large and scarce genomic DNA, the small, highly con- with dilute bleach or alcohol removes most DNA con-
centrated PCR product DNA can aerosol when tubes are tamination. As a common practice in forensic work,
uncapped and when the DNA is pipetted. This PCR prod- before handling evidence or items that come in contact
uct is a perfect template for primer binding and amplifi- with evidence, gloves are wiped with bleach and allowed
cation in a subsequent PCR using the same primers. to air-dry.
Contamination control procedures, therefore, are mainly Another widely used chemical method of contamina-
directed toward eliminating PCR product from the setup tion control is the dUTP-UNG system. This requires sub-
reaction. stitution of dTTP with dUTP in the PCR reagent master
07Buckingham (F)-07 2/6/07 12:25 PM Page 133

Nucleic Acid Amplification Chapter 7 133

get, the amplicon should be 140 bp in size. Much larger


Advanced Concepts or smaller amplicons are due to mispriming or primer
dimers or other artifacts of the reaction. For some proce-
In addition to breaking the sugar phosphate back- dures, these artifacts do not affect interpretation of results
bone of DNA, UV light also stimulates covalent and, as long as they do not compromise the efficiency of
attachment of adjacent pyrimidines in the DNA the reaction, can be ignored. For other purposes, however,
chain, forming pyrimidine dimers. These boxy extraneous PCR products must be avoided or removed.
structures are the source of mutations in DNA in Misprimes are initially averted by good primer design
some diseases of sun exposure. DNA repair systems and optimal amplification conditions. Even with the best
remove these structures in vivo. Loss of these repair conditions, however, misprimes can occur during prepa-
systems is manifested in diseases such as xeroderma ration of the reaction mix. This is because Taq polymerase
pigmentosum, Cockayne syndrome, and trichoth- has some activity at room temperature. While mixes are
iodystrophy.83 Psoralen in combination with UV prepared and transported to the thermal cycler, the
light is an established treatment for psoriasis and primers and template are in contact at 22!25!C, a condi-
other skin diseases.84,85 tion of very low stringency (see Chapter 6 for a discussion
of stringency). In these conditions, the primers can bind
sequences other than their exact complements in the tar-
get. These misprimed products, then, are already present
mix, which will result in incorporation of dUTP instead before the amplification program begins. Even using
of dTTP into the PCR product. Although some poly- well-designed primers and optimizing amplification con-
merase enzymes may be more or less efficient in incor- ditions, however, does not prevent all mispriming. To fur-
poration of the nucleotide, the dUTP does not affect the ther prevent mispriming, hot-start PCR can be used.
PCR product for most applications. At the beginning of Hot-start setup is done in three ways. In one approach,
each PCR, the enzyme uracil-N-glycosylase (UNG) is the reaction mixes are prepared on ice and placed in the
added to the reaction mix. This enzyme will degrade any thermal cycler after it has been prewarmed to the denatu-
nucleic acid containing uracil, such as contaminating ration temperature. A second way to perform hot-start
PCR product from previous reactions. A short incubation PCR is to use a wax barrier. A bead of wax is placed in
period is added to the beginning of the PCR amplification the reaction tubes with all components of the reaction
program, usually at 50!C for 210 minutes to allow the mix except enzyme and template. The tube is heated to
UNG enzyme to function. The initial denaturation step in 100!C to melt the wax and then cooled to room tempera-
the PCR cycle will degrade the UNG before synthesis of ture. The melted wax will float to the top of the reaction
the new products. Note that this system will not work mix in the tube and congeal into a physical barrier as it
with some types of PCR, such as nested PCR (discussed cools. The template and enzyme are then added on top of
below), because a second round of amplification requires the wax barrier. When the tubes are placed in the thermal
the presence of the first round product. The dUTP-UNG cycler, the wax will melt at the denaturation temperature,
system is used routinely in real-time PCR procedures in and the primers and template will first come in contact at
which contamination control is more important because the proper annealing temperature. The wax also serves as
the contaminant will not be distinguishable from the an evaporation barrier as the reaction proceeds. After
desired amplicon by gel electrophoresis. amplification, however, the wax barrier must be punc-
tured to gain access to the PCR products.
Prevention of Mispriming The third and most frequently used hot-start method is
As shown in Figure 7-11, PCR products are analyzed for the use of sequestered enzymes, such as AmpliTaq Gold
size and purity by electrophoresis. The amplicon size (Applied Biosystems), Platinum Taq (Invitrogen), Jump-
should agree with the size determined by the primer Start Taq (Sigma), and numerous others. These enzymes
placement. For instance, if two 20 b primers were are either supplied in inactive form or the enzyme is inac-
designed to hybridize to sequences flanking a 100 bp tar- tivated by monoclonal antibodies or by other proprietary
07Buckingham (F)-07 2/6/07 12:25 PM Page 134

134 Section 2 Common Techniques in Molecular Biology

methods. Regardless of the inactivation mechanism, the columns or beads provide better recovery than gel elu-
enzyme is inactive until it is activated by heat in the first tion, they may not completely remove residual primers.
denaturation step of the PCR program, preventing any Addition of shrimp alkaline phosphatase (SAP) in
primer extension during reagent mix preparation. combination with exonuclease I (ExoI) is an enzymatic
method for removing nucleotides and primers from PCR
PCR Product Cleanup products prior to sequencing or mutational analyses.
Even the best procedures sometimes result in extraneous During a 15-minute incubation at 37"C, SAP dephospho-
products. Sequence limitations to primer design or reac- rylates nucleotides, and ExoI degrades primers. The
tion conditions may not completely prevent primer enzymes must then be removed by extraction or inacti-
dimers or misprimes. These unintended products are vated by heating at 80"C for 15 minutes. This method is
unacceptable for analytical procedures that demand pure convenient as it is performed in the same tube as the PCR.
product, such as sequencing or some mutation analyses It does not, however, remove other buffer components.
(see Chapters 9 and 10). A direct way of obtaining clean In some post-PCR methods, such a small amount of
PCR product is to resolve the amplification products by PCR product is added to the next reaction that residual
gel electrophoresis and then cut the desired bands from components of the amplification are of no consequence,
the gel and elute the PCR product. The gel slice can be so that no further clean up of the PCR product is required.
digested with enzymes such as !-agarase (New England The choice of clean-up procedure or whether clean up is
BioLabs) or iodine (Fig. 7-12). The agarase enzyme necessary at all will depend on the application.
digests the agarose polymer and releases the DNA into
solution for further purification.
Residual components of the reaction mix, such as left- PCR Modifications
over primers and unused nucleotides, also interfere with PCR today has been adapted for various applications.
some post-PCR applications. Moreover, the buffers used Several modifications are used in the clinical laboratory.
for the PCR may not be compatible with post-PCR pro- Of the large (and increasing numbers) of PCR modifica-
cedures. Amplicons free of PCR components are most tions, following is a description of those in standard use
frequently and conveniently prepared using spin columns in the clinical molecular laboratory. These methods are
(Fig. 7-13) or silica beads. The DNA binds to the column, capable of detecting multiple targets in a single run (mul-
and the rest of the reaction components are rinsed away tiplex PCR), using RNA templates (reverse transcriptase
by centrifugation. The DNA can then be eluted. Although PCR), or such amplified products as templates (nested
PCR) and quantitating starting template (quantitative
PCR, or real-time PCR).
Gel containing DNA
Multiplex PCR
More than one primer pair can be added to a PCR so
that multiple amplifications are primed simultaneously,
resulting in the formation of multiple products. Multiplex
Sieve
Supernatant PCR is especially useful in typing or identification analy-
+ alcohol ses. Individual organisms, from viruses to humans, can be
Centrifuge identified or typed by observing a set of several PCR
products at once. Pathogen typing and forensic identifica-
DNA
tion kits contain multiple sets of primers that amplify
precipitate
polymorphic DNA regions. The pattern of product sizes
Figure 7-12 After gel electrophoresis, the gel band of PCR will be specific for a given type or individual.
product is excised with a clean scalpel or spatula. The gel is
Multiple organisms have been the target of multiplex
disintegrated by centrifugation through a sieve, releasing the
DNA. The DNA in solution can then be separated from the gel PCR in clinical microbiology laboratories.911 One respi-
fragments, precipitated with alcohol and pelleted by a sec- ratory sample, for example, can be used to test for the
ond centrifugation. presence of more than one respiratory virus.12 Organisms
07Buckingham (F)-07 2/6/07 12:25 PM Page 135

Nucleic Acid Amplification Chapter 7 135

Primer
PCR product

Salt
dNTP

Flip column
Figure 7-13 PCR product cleanup and
in spin columns (left) removes residual centrifuge
components in the PCR mix. Amplicon
DNA binds to a silica matrix in the col-
umn while the buffer components flow
Centrifuge
through during centrifugation. The col-
umn is then inverted, and the DNA is
eluted by another centrifugation in low
salt (Tris-EDTA) buffer.

that cause sexually transmitted diseases can be targeted first copies the RNA single strand into a RNA:DNA
in multiplex PCR using one genital swab.13 In a slightly hybrid strand and then uses a hairpin formation on the end
different approach to testing for multiple targets, one set of the newly synthesized DNA strand to prime synthesis
of primers can detect an infectious organism, and a sec- of the homologous DNA strand, replacing the original
ond set can detect the presence of a gene that makes that RNA in the hybrid. The resulting double-stranded DNA is
organism resistant to a particular antimicrobial agent. called cDNA for copy or complementary DNA. This
This has been performed and published for methicillin- product is adequate for PCR.
resistant Staphylococcus aureus.14 Like other DNA polymerases, reverse transcriptase
Multiplex PCR reagents and conditions require more requires priming. Specific primers, oligo dT primers or
complex optimization. Often, target sequences will not random hexamers, are most often used to prime the syn-
amplify with the same efficiency, and primers may inter- thesis of the initial DNA strand. Specific primers will
fere with other primers for binding to the target se- prime cDNA synthesis only from transcripts complemen-
quences. The conditions for the PCR must be adjusted for tary to the primer sequences. The yield of cDNA will be
the optimal amplification of all products in the reaction. relatively low using this approach but highly specific for
This may not be possible in all cases. the target of interest. Oligo dT primers are 18-blong
Multiplexing primers is useful, not only to detect mul- single-stranded polyT sequences that will prime cDNA
tiple targets but also to confirm accurate detection of a synthesis only from messenger RNA with polyA tails.
single target. Internal amplification controls are often Yield of cDNA will be higher with oligo dT primers and
multiplexed with test reactions that are interpreted by the should include all mRNA in the specimen. The highest
presence or absence of product. The control primers and yield of cDNA is achieved with random hexamers or
targets must be chosen so that they do not interfere or decamers. These are 610blong single-stranded oligo-
compete with the amplification of the test region. Internal mers of random sequences. The 610b sequences will
amplification controls are the ideal for positive/negative match sequences in the target RNA with some frequency.
qualitative PCR tests. Random priming will generate cDNA from all RNA (and
DNA) in the specimen. For all strategies of cDNA prepa-
Reverse Transcriptase PCR ration, the specificity of the final product is still deter-
Amplification by PCR requires a double-stranded DNA mined by the PCR primers.
template. If the starting material for a procedure is RNA, RT PCR is used to measure RNA expression profiles,
it must first be converted to double-stranded DNA. This is to detect rRNA, to analyze gene regions interrupted by
accomplished through the action of reverse transcriptase long introns, and to detect microorganisms with RNA
(RT), an enzyme isolated from RNA viruses. This enzyme genomes. For gene expression analysis, the amount of
07Buckingham (F)-07 2/6/07 12:25 PM Page 136

136 Section 2 Common Techniques in Molecular Biology

cDNA reflects the amount of transcript in the preparation. paraffin embedded tissues; however, fixed specimens are
In other applications, genes that are interrupted by long difficult to analyze consistently.17
introns can be made more available for consistent ampli-
fication using cDNA versions lacking the interrupting Nested PCR
sequences. cDNA is often used for sequencing because Increased sensitivity offered by the PCR is very useful
the sequence of the coding region can be determined in clinical applications as clinical specimens are often
without long stretches of introns complicating the analy- limited in quantity and quality. The low level of target
sis. The detection of RNA viruses such as Coronavirus, and the presence of interfering sequences can prevent a
which is responsible for severe acute respiratory syn- regular PCR from working with the reliability required
drome, can be accomplished using RT PCR.15 for clinical applications. Nested PCR is a modifica-
RT PCR was originally performed in two steps: cDNA tion that increases the sensitivity and specificity of the
synthesis and PCR. Tth DNA polymerase, which has RT reaction.1821
activity and proprietary mixtures of RT and sequestered In nested PCR, two pairs of primers are used to
(hot-start) DNA polymerase, are components of one-step amplify a single target in two separate PCR runs. The
RT PCR procedures.16 These methods are more conven- second pair of primers, designed to bind slightly inside of
ient than the two-step procedure, as RNA is added the binding sites of the first pair, will amplify the product
directly to the PCR. The amplification program is modi- of the first PCR in a second round of amplification. The
fied to include an initial incubation of 45!50!C for second amplification will specifically increase the
3060 minutes, during which RT makes cDNA from amount of the intended product. In seminested PCR, one
RNA in the sample. The RT activity will then be inacti- of the second-round primers is the same as the first-round
vated in the first denaturation step of the PCR procedure. primer. Nested and seminested procedures increase
Although RT PCR is a widely used and important specificity and sensitivity of the PCR (Fig. 7-14).
adjunct to molecular analysis, it is subject to the vulner- Several variations of nested and seminested PCR have
abilities of RNA degradation. As with other procedures been devised. For example, as shown in Figure 7-14, the
that target RNA, specimen handling is important for first-round primers can have 5 sequences added (5 tails)
accurate results. Methods have been described for the RT complementary to sequences used for second-round
PCR amplification of challenging specimens, such as primers. This tailed primer method is valuable for multi-

5 3 5 3

3 5 3 5

First round product

Second round product

Figure 7-14 Variations of


nested PCR using nested primers
and seminested second-round
primers (left) and tailed first-
round primers (right).
07Buckingham (F)-07 2/6/07 12:25 PM Page 137

Nucleic Acid Amplification Chapter 7 137

plex procedures in which multiple first-round primers The rationale of qPCR is illustrated in Figure 7-15. If
may differ in their binding efficiencies. Due to the tailed the target copy number in a PCR were graphed versus the
primers, sequences complementary to a single set of number of cycles, the results would be an exponential
second-round primers are added to all of the first-round curve where the number of target copies ! 2N, N being
products. In the second round, then, all products will be the number of cycles. If the copy number is measured by
amplified with the same primers and equal efficiency. detectable fluorescence as shown in the figure, the curve
Although this tailed primer procedure increases sensitiv- looks similar to a bacterial growth curve, with a lag
ity in multiplex reactions, it does not increase specificity. phase, an exponential (log) phase, a linear phase, and a
stationary phase.
Real-Time (Quantitative) PCR In contrast to real-time PCR, analysis of PCR product
Standard PCR procedures will indicate if a particular by the standard method occurs at the end of the PCR sta-
target sequence is present in a clinical sample. For some tionary phase (endpoint analysis). Exhaustion of reac-
situations, though, the clinician is also interested in how tion components and competition between PCR product
much of the target sequence is present. Several ap- and primers during the annealing step slow the PCR prod-
proaches have been taken to estimate the amount of start- uct accumulation after the exponential phase of growth
ing template by PCR. By the nature of amplification, until it finally plateaus. In the endpoint analysis, products
however, calculating direct quantities of starting material of widely different starting template amounts are tested at
becomes complex. Strategies to quantitate starting mate- the plateau where they are all the same (observe the ends
rial by quantitating the end products of PCRs have uti- of the amplification curves shown in Figure 7-15A.).
lized internal controls, i.e., known quantities of starting Using the fluorescent signal to detect the growing target
material, that are co-amplified with the test template. copy number during the amplification process, analysis in
These types of assays, however, suffer from primer in- real-time PCR is performed in the exponential phase of
compatibilities and inconsistent results. Another approach growth where the accumulation of fluorescence is
is to add competitor templates at several known levels to inversely proportional to the amount of starting template.
assess the amount of test material by preferential amplifi- With 10-fold dilutions of known positive standards, a
cation over a known amount of competitor.22 These assays relationship between the starting target copy number and
are also at times unreliable and inconsistent when test and the cycle number at which fluorescence crosses a thresh-
internal control templates differ by more than 10-fold. old amount of fluorescence can be established.
They are most accurate with a 1:1 ratio of test and inter- The PCR cycle at which sample fluorescence crosses
nal control, requiring analysis of multiple dilutions of the threshold is the threshold cycle, or CT. Plotting the
controls for optimal results. target copy number of the diluted standards against CT
A very useful modification of the PCR process is real- for each standard generates the graph shown in Figure
time or quantitative PCR (qPCR).23,24 This method was 7-15B. Once this relationship is established, the starting
initially performed by adding ethidium bromide (EtBr) to amount of an unknown specimen can be determined by
a regular PCR. Because EtBr intercalates into double- the cycle number at which the unknown crosses the fluo-
stranded DNA and fluoresces, it can be used to monitor rescence threshold.
the accumulation of PCR products during the PCR in real
time, i.e., as it is made. The advantage of this method
over standard PCR is the ability to determine the amount
of starting template accurately. These quantitative meas-
urements are performed with the ease and rapidity of
Advanced Concepts
standard PCR without tedious addition of competitor The optimal threshold level is based on the back-
templates or multiple internal controls. A growing num- ground or baseline fluorescence and the peak fluo-
ber of clinically significant parameters, such as copy rescence in the reaction. Instrument software is
numbers of diseased human genes, viral load, tumor load, designed to set this level automatically. Alternatively,
and the effects of treatment, are measured easily with this the threshold may be determined and set manually.
method.2527
07Buckingham (F)-07 2/6/07 12:25 PM Page 138

138 Section 2 Common Techniques in Molecular Biology

107 copies
106 copies
105 copies
100
104 copies
103 copies
102 copies
101 copies
10
Rn

0.1
1 3 5 7 9 21 23 25 27 29 33 35 37 39 41 43 45 47 49
Cycle

40.00
35.00
Threshold cycle (C)

30.00
25.00
20.00 Y = 3.345(x) + 38.808
15.00 R2 = 0.9983 Figure 7-15 A plot of the accumulation of PCR
product over 50 cycles of PCR (A) is a sigmoid
10.00 curve. The generation of fluorescence occurs ear-
lier with more starting template (solid lines) than
5.00
with less (dotted lines). The cycle number at which
0.00 fluorescence increases over a set amount, or fluo-
1.00E+00 1.00E+01 1.00E+02 1.00E+03 1.00E+04 1.00E+05 1.00E+06 1.00E+07 rescence threshold, is inversely proportional to the
Starting Quantity (copies/rxn) amount of starting material.

The first approach to real-time PCR utilized the double-


Advanced Concepts stranded DNA-specific dye EtBr. This method is still used
for routine qPCR, except that EtBr has been replaced by
Fluorescence vs. CT is an inverse relationship. The SYBR green, another double-stranded DNA-specific dye.
more starting material, the fewer cycles are neces- SYBR green is preferred for routine procedures because it
sary to reach the fluorescence threshold. Samples has the specificity and robust fluorescence of EtBr but is
that differ by a factor of 2 in the original concentra- less toxic than EtBr. These dyes bind and fluoresce
tion of target are expected to be 1 cycle apart, with specifically in the double-stranded DNA product of the
the more dilute sample having a CT 1 cycle higher PCR (Fig. 7-16).
than the more concentrated sample. Samples that The use of nonspecific dyes to measure product accu-
differ by a factor of 10 (as in a 10-fold dilution mulation requires a clean PCR free of misprimed prod-
series) would be ~3.3 cycles apart. The slope of a ucts or primer dimers, because these artifactual products
standard curve made with 10-fold dilutions, there- will also generate fluorescence. More specific systems,
fore, should be 3.3. examples of which are described below, have been
devised that utilize probes designed to generate fluores-
07Buckingham (F)-07 2/6/07 12:25 PM Page 139

Nucleic Acid Amplification Chapter 7 139

Advanced Concepts Advanced Concepts


EtBR is a planar molecule that intercalates between The 5 end of a Taqman probe is labeled with one of
the planar nucleotides in the DNA molecule. In a number of dyes with different colors, or peak
doing so, it interferes with DNA metabolism and wavelengths of fluorescence, e.g., FAM (6-carboxy-
replication in vivo and is a mutagen. In contrast, fluorescein), TET (6-tetrachlorofluorescein), HEX
SYBR green binds to the minor groove of the dou- (6-hexachlorofluorescein), JOE (4,5-dichloro-2,7-
ble helix without disturbing the nucleotide bases dimethoxy-fluorescein), Cy3, Cy5 (indodicarbocya-
and thus does not upset DNA metabolism to the nine), and so forth. The probe is covalently bound at
extent that EtBr does. the 3 end with a quencher, such as DABCYL (4-
dimethylaminophenylazobenzoic acid) or TAMRA
(5(6)-carboxytetramethylrhodamine), or nonfluores-
cent quenchers, such as BHQ1, BHQ2 (Black Hole
cence. The probes increase specificity by only yielding Quenchers), and Eclipse. In the TaqMan system, the
fluorescence when they hybridize to the target sequences. quencher prevents fluorescence from the 5 dye until
TaqMan was developed from one of the first probe- they are separated during the synthesis reaction.
based systems for real-time PCR.28 This method exploits
the natural 5 to 3 exonuclease activity of Taq polymerase
to generate signal. The original method reported by
Holland et al. used radioactively labeled probe and meas- end so that it cannot be extended by the polymerase. The
ured activity by the release of radioactive cleavage frag- single-stranded DNA TaqMan probe is covalently
ments. The TaqMan procedure measures fluorescent attached to a fluorescent dye on one end and another dye
signal generated by separation of dye and quencher, a or nonfluorescent molecule that pulls fluorescent energy
system developed by Lee et al.29 Here, a probe composed from the 5 dye (quencher) on the other (Fig. 7-17).
of a single-stranded DNA oligomer homologous to a spe- As the polymerase proceeds to synthesize DNA from
cific sequence in the targeted region of the PCR template the template to which the probe is hybridized, the natural
is used. Note that this probe is present in the PCR in addi- exonuclease activity of Taq polymerase will degrade the
tion to the specific primers used to prime the DNA syn- probe into single and oligonucleotides, thereby removing
thesis reaction. The probe is chemically modified at its 3 the labeled nucleotide from the vicinity of the quencher
and allowing it to fluoresce (Fig. 7-18). Excess probe is
present so that with every doubling of the target se-
quences more probe binds and is digested, and more flu-
5 3
orescence is generated. The TaqMan procedure has been
applied to quantitative determinations in oncology30 and
3 5

Primer
R Probe Q
5 3 5
3 5
5 3
3 5
Figure 7-16 Non-sequencespecific dyes such as EtBr and Figure 7-17 A TaqMan probe hybridizes to the target
SYBR green bind to double-stranded DNA products of the sequences between the primer binding sites. The probe is
PCR. As more copies of the target sequence accumulate, the covalently attached to a fluorescent reporter dye (R) at
fluorescence increases. the 5 end and a quencher (Q) at the 3 end.
07Buckingham (F)-07 2/6/07 12:25 PM Page 140

140 Section 2 Common Techniques in Molecular Biology

R
Q
5
3 5
Molecular beacon
5 3
R Q

3 5

R
Q

R Q
5 3
3 5 3 5
5 3
Figure 7-19 A molecular beacon probe contains
3 5
target specific sequences and a short inverted repeat
Figure 7-18 Taqman signal fluorescence is generated when that hybridizes into a hairpin structure. The 5 end of the
Taq polymerase extends the primers and digests the probe probe has a reporter dye (R), and the 3 end has a
and releases the reported from the vicinity of the quencher. quencher dye (Q).

microbiology.31 Probe design, like primer design, is im- Scorpion-type primers are a variation of Molecular
portant for a successful qPCR amplification.32,33 Beacons.34,35 In contrast to free-labeled probes, the PCR
Another probe-based detection system, Molecular product will be covalently bound to the dye. In this sys-
Beacons, measures the accumulation of product at the tem, target-specific primers are tailed at the 5 end with a
annealing step in the PCR cycle. The signal from sequence homologous to part of the internal primer
Molecular Beacons is detectable only when the probes are sequence, a quencher, a stem-loop structure, and a 5 flu-
bound to the template before displacement by the poly- orophore (Fig. 7-21). The fluor and the quencher are
merase. Here the probe is chemically modified so that it is positioned so that they are juxtaposed when the hairpin in
not degraded during the extension step. Molecular bea- the primer is intact. After polymerization, the secondary
cons are designed with a ~25-bspecific binding sequence structure of the primer is overcome by hybridization of
flanked by a short (~5 b) inverted repeat that will form a the primer sequence with the target sequence, removing
stem and loop structure when the probe is not bound to the the fluor from the quencher. This intramolecular system
template. There is a reporter fluorophor (dye) at the 5 end generates signal faster than the intermolecular Molecular
of the oligomer and quencher at the 3 end. Until specific Beacon strategy and may be preferred for methods
product is present, the probe will form a hairpin structure requiring fast cycling conditions.36
that brings the fluorophore in proximity with the quencher Another frequently used system, fluorescent reso-
(Fig. 7-19). Fluorescence will occur on binding of the nance energy transfer (FRET), utilizes two specific
probe to denatured template during the annealing step probes, one with a 3 fluorophore (acceptor), the other
(Fig. 7-20). When the primers are extended in the PCR, with a 5 catalyst for the fluorescence (donor) that binds
displacement of the probe by Taq will restore the hairpin to adjacent targets.37 Examples of frequently used donor-
(nonfluorescent) structure. Excess probe in the reaction acceptor pairs are fluorescein-rhodamine, fluorescein-(2
mix will assure binding to the increasing amount of target. aminopurine), and fluorescein-Cy5. When the donor and
The amount of fluorescence, therefore, will be directly acceptor are brought within 110 nm (15 bases) through
proportional to the amount of template available for bind- specific DNA binding, excitation energy is transferred
ing and inversely proportional to the CT. from the donor to the acceptor (Fig. 7-22). The acceptor
07Buckingham (F)-07 2/6/07 12:25 PM Page 141

Nucleic Acid Amplification Chapter 7 141

Primer
R Q
R Q

R Q

R Q

R Q
Q
R

Figure 7-21 Scorpion primer/probes are primers tailed


with molecular beacon-type sequences. After extension
of the primer/probe, the target-specific sequences fold
over to hybridize with the newly synthesized target
sequences, separating the reporter (R) from the
R Q quencher (P).

sequences to distinguish types of organisms or to detect


mutations. Refer to Chapter 9 for a description of meth-
ods using fluorescent probes and melt curves to detect
gene mutations. Methods can be combined, e.g., using an
Figure 7-20 Molecular beacons bound to target sequences
fluoresce. Fluorescence doubles with every doubling of target
intercalating dye (acridine orange) as the donor and a
sequences. probe with a single receptor dye (rhodamine).42 As with
standard PCR, large and growing numbers of such meth-
ods have been devised for a variety of applications.
then loses the energy in the form of heat or fluorescence
emission called sensitized emission. The sequences of Arbitrarily Primed PCR
FRET probes are designed such that they bind 15 bases In arbitrarily primed PCR, also known as randomly
from each other on the target sequences. When they are amplified polymorphic DNA or random amplification of
bound to the target, the fluorescence is catalyzed. As with polymorphic DNA (RAPD), short (1015 bases) primers
the molecular beacons, the more template available for with random sequences are used to amplify arbitrary
binding, the more fluorescence will be generated. FRET regions in genomic DNA under low stringency condi-
probes are used frequently in the clinical laboratory for tions.43,44 With this method, PCR products are generated
viral detection and quantitation and for amplification and without knowing the sequence of the target or targeting a
detection of genetic diseases.3841 specific gene. It is possible with this method to obtain
Real-time PCR lends itself to several variations of multiple products, depending how many times a short
technique as exemplified above. These techniques can be sequence appears in the genome; in traditional PCR, only
further modified, e.g., using FRET probes with different one product is generally obtained (Fig. 7-23). Arbitrarily
07Buckingham (F)-07 2/6/07 12:25 PM Page 142

142 Section 2 Common Techniques in Molecular Biology

D R M 1 2 3 4 M

Primer

D R

Figure 7-23 Illustration of results from a RAPD PCR. The first


lane on the left contains molecular weight markers. Strain dif-
ferences are evident from the different band patterns. Lanes
1 and 3 are the same strain, and lanes 2 and 4 are the same
D R strain, but different from that in lanes 1 and 3. Lanes M,
molecular weight markers

Transcription-Based
Amplification Systems
In transcription-based amplification systems (TAS), RNA
D R is the usual target instead of DNA. A DNA copy is
synthesized from the target RNA, and then transcription
of the DNA produces millions of copies of RNA. There
are a number of commercial variations of this process:
transcription-mediated amplification (TMA) (Gen-
Probe), nucleic acid sequencebased amplification
Figure 7-22 FRET probes are separate oligomers, one
(NASBA) (Organon-Teknika), and self-sustaining se-
covalently attached to a donor fluor (D) and one to an quence replication (3SR) (Baxter Diagnostics).
acceptor or reporter fluor (R). The acceptor/reporter Kwoh and colleagues developed the first TAS in
will fluoresce only when both probes are bound next to 1989.46 TAS differs from other nucleic acid amplification
one another on the target sequences. As more target procedures in that RNA is the target as well as the pri-
accumulates, more probes bind, and more fluorescence
is emitted.
mary product. In the original method of TAS, a primer
complementary to sequences in the target RNA that also
has the binding site for RNA polymerase at one end is
primed PCR has been used primarily in the epidemiolog- added to a sample of target RNA. The primer anneals,
ical typing of microorganisms.45 Similar band patterns and reverse transcriptase makes a DNA copy of the target
obtained from performing PCR with the same arbitrary RNA. Heat is used to denature the DNA/RNA hybrid,
primers indicate that two organisms are the same or sim- and a second primer binds to the cDNA and is extended
ilar. The disadvantage of this method, though, is that the by reverse transcriptase producing double-stranded
stringency is low enough that the reproducibility between DNA. RNA polymerase derived from the bacteriophage
runs is not very good, such that two organisms that had T7 then transcribes the cDNA, producing hundreds to
the same PCR product pattern on one day could have two thousands of copies of RNA. The transcribed RNA can
different patterns and look like two different organisms then serve as target RNA to which the primers bind and
when amplified on another day. synthesize more cDNA.
07Buckingham (F)-07 2/6/07 12:25 PM Page 143

Nucleic Acid Amplification Chapter 7 143

(A) (A) RNA polymerase


Promoter
Tailed primer cDNA

RNA target
(B)
Reverse transcriptase
(B) cDNA
RNA

RNase II (C)
(C)
ssDNA

(D)

(D)
Primer
(E) Reverse transcriptase

cDNA (E) Reverse transcriptase

Primer
Figure 7-24 The first step in transcription-based amplifi-
(F)
cation is the production of a complementary double-
stranded DNA copy of the RNA target (A). Synthesis is
performed by reverse transcriptase, which extends a
primer that is tailed with an RNA polymerase binding site
(promoter) sequence (green). The RNA/DNA hybrid (B) is
digested with RNase H, leaving the single-stranded DNA
(C), which is converted to a double strand with a comple-
mentary primer (D). The DNA product will have a promoter
sequence at one end.
Figure 7-25 The cDNA produced by reverse transcriptase
serves as a template for RNA polymerase (A). Many copies of
The original TAS procedure as described above had the RNA are synthesized (B), (C) which are primed by a comple-
mentary primer (D) for synthesis of another RNA/DNA hybrid
disadvantage that heat denaturation was required to dena-
(E). After RNase H degrades the RNA strand, the primer tailed
ture the intermediate RNA/DNA hybrid product. The heat with the promoter sequences synthesizes another template
also denatured the enzymes so that fresh enzyme had to (F), cycling back into the system as (A).
be added after each denaturation step. The process was
simplified with the addition of RNase H derived from E.
coli (Fig. 7-24). RNase H degrades the RNA from the scriptase derived from avian myeloblastosis virus (AMV)
intermediate hybrid, eliminating the heating step. Thus, has inherent RNase H activity. Thus, TAS can be run with
after synthesis of the DNA copy by reverse transcriptase, only two enzymes, AMV reverse transcriptase and T7
the RNA strand is degraded by RNase H. Binding of the RNA polymerase.
second primer and extension of the primer producing TAS has some advantages over PCR and other amplifi-
double-stranded DNA by reverse transcriptase is fol- cation procedures. First, in contrast to PCR and the ligase
lowed by transcription of the cDNA with T7 RNA poly- chain reaction (LCR, discussed below), TAS is an isother-
merase (Fig. 7-25). mal process, negating the requirement for thermal cycling
This modified procedure has been marketed as 3SR, to drive the reactions. Second, targeting RNA allows for
NASBA, or TMA, depending on the manufacturer. An the direct detection of RNA viruses, e.g., Hepatitis C
additional modification and simplification of the proce- Virus47,48 and Human Immunodeficiency Virus.49,50 Even
dure came about with the discovery that the reverse tran- targeting the RNA of other organisms, such as Mycobac-
07Buckingham (F)-07 2/6/07 12:25 PM Page 144

144 Section 2 Common Techniques in Molecular Biology

terium tuberculosis, is more sensitive than targeting the primers. Because the product of LCR is ligated primer,
DNA, because each bacterium, for example, has multiple LCR is better classified as a method of probe amplifica-
copies of RNA, whereas it has only one copy of DNA.51 tion rather than target amplification as the copy number
The NASBA procedure with slight modifications can of target molecules does not change.
also be performed on a DNA target.52 For DNA, the sam- LCR is similar to PCR in that it requires a thermal
ple is heated to denature the DNA, and the first primer cycler to change the temperature to drive the different
anneals and is extended by reverse transcriptase (which reactions. In LCR the tube is heated to denature the tem-
in addition to having RNA-dependent DNA polymerase plate. When the temperature is cooled, the primers anneal
activity also has DNA-dependent DNA polymerase activ- if the complementary sequence is present, and a ther-
ity). The sample is heated again to denature the double mostable ligase joins the two primers (Fig. 7-26). Even a
strands, and the second primer binds and is extended. The 1base pair mismatch at the ligation point will prevent
DNA product has also incorporated the T7 RNA poly- ligation of the primers. Thus, LCR can be used to detect
merase binding site as occurs when RNA is the target. point mutations in a target sequence. The point mutation
Thus, T7 RNA polymerase transcribes the newly repli- that occurs in the beta globulin of patients with sickle cell
cated DNA into hundreds to thousands of RNA copies.53 disease, as compared with normal beta globulin, was one
Detection of M. tuberculosis in smear-positive respira- of the first applications of LCR.54
tory samples, Chlamydia trachomatis in genital speci-
mens, and HIV and cytomegalovirus (CMV) quantitation
Strand Displacement Amplification
in blood are a few of the current applications for TAS.
SDA differs from most of the previously described ampli-
fication methods in that SDA is an isothermal amplifica-
Probe Amplification tion process, i.e., after an initial denaturation step, the
In probe amplification procedures, the number of target reaction proceeds at one temperature.55,56 SDA is more
nucleic acid sequences in a sample is not changed as it is
in target amplification procedures like PCR. Rather, syn-
thetic probes that are specific to the target sequences bind GTACTCTAGCT GTACTCTAGCT
A
to the target where the probes themselves are amplified. T

There are three major procedures that are commercially A


C
available that involve the amplification of probe se- CATGAGATCGA CATGAGATCGA
quences: LCR (Abbott), strand displacement amplifica-
tion (SDA) (Becton Dickinson), and Q! replicase (Vysis). Ligase Ligase
A
C A
Ligase Chain Reaction A
T

C
LCR is a method for amplifying synthetic primers/probes A
A
complementary to target nucleic acid. LCR is similar to C
PCR, but there are a few differences. The entire target T
A
sequence must be known in order to prepare the oligonu- C
cleotide primers for LCR. In PCR, there can be a distance
Figure 7-26 Ligase chain reaction generates a signal
between the primers of up to hundreds of bases that is by repeated ligation of probes complementary to specific
part of the amplified sequence. In LCR, by contrast, the sequences in the test DNA. One complementary oligomer
primers bind adjacent to each other, separated by only is covalently attached to biotin for immobilization (square),
one base. Instead of DNA polymerase synthesizing com- and one has a signal-producing molecule (circle). The two
oligomers will be ligated together only if the sequence of
plementary DNA by extending the primers as occurs in
the target is complementary (left). The oligomers captured
PCR, DNA ligase is used in LCR to ligate the adjacent on a solid substrate by streptavidin will generate signal. If the
primers together. The ligated primers can then serve as a sequence of the target is not complementary (right), the
template for the annealing and ligation of additional captured probe will not yield a signal.
07Buckingham (F)-07 2/6/07 12:25 PM Page 145

Nucleic Acid Amplification Chapter 7 145

(A) Probe with


restriction site
Primer

(B)
Modified
nucleotides
Displaced
strand
(extended
Figure 7-27 The first stage of SDA is the denatura- probe)
tion of the double-stranded target and annealing of
primers and probes tailed with sequences including
a restriction enzyme site (A; only one strand of the (C)
initial target is shown.) A second reaction (B) copies Displaced
the probe, incorporating dATPaS and thereby inacti- probe targets
vating the restriction site on the copied strand (C). Inactive restriction site
This species is the target for amplification in the sec- (due to incorporation
ond stage of the reaction. of modified nucleotides)

similar to LCR than PCR in that the major amplification ing/extension reaction can repeat without denaturation.
products are the probes/primers and not the product of in Thus, the iterative process takes place at about 52!C
vitro synthesis of target DNA. There are two stages to the without temperature cycling. The product of this amplifi-
SDA process. In the first stage (target generation), the tar- cation is millions of copies of the initial probe.
get DNA is denatured by heating to 95!C. At each end of This method was first widely applied to detection of M.
the target sequence, a primer and a probe bind close to tuberculosis.57 Methods using fluorescence polarization
each other (Fig. 7-27). The probes have a recognition to detect the amplified target have been designed to test
sequence for a restriction enzyme. Exonuclease-deficient for M. tuberculosis58 and C. trachomatis.59 Addition of a
DNA polymerase derived from E. coli extends the prim- fluorogenic probe to the reaction produces a fluorescent
ers, incorporating a modified nucleotide, 2-deoxyadeno- signal that corresponds to the amount of amplified target.
sine 5-O-(1-thiotriphosphate) (dATPaS). As the outer This is the basis for the BDProbeTecET test for M. tuber-
primers are extended, they displace the probes, which are culosis,60 C. trachomatis, and Neisseria gonorrhoeae.61
also extended. A second set of complementary primers
then bind to the displaced probes, and DNA polymerase
Q! Replicase
extends the complementary primers, producing a double-
stranded version of the probes. The probes are the target Q# replicase is another method for amplifying probes
DNA for the next stage of the process. that have specificity for a target sequence. The method is
The second stage of the reaction is the exponential named for the major enzyme that is used to amplify probe
probe/target amplification phase (Fig. 7-28). When the sequences. Q# replicase is a RNA-dependent RNA poly-
restriction enzyme is added to the double-stranded probe merase from the bacteriophage Q#.62 The target nucleic
DNA, only one strand of the probe will be cut due to the acid in this assay can be either DNA (which must first be
dATP"S introduced in the extension reaction. This forms denatured) or RNA.
a nick in the DNA that is extended by DNA polymerase, The target nucleic acid is added to a well containing
simultaneously displacing the opposite strand. The dis- reporter probes. The reporter probes are RNA molecules
placed strand is also copied by primers that will restore that have specificity for the target sequence and also con-
the restriction site. As dATP"S is also used in the second- tain a promoter sequence (midivariant-1) that is recog-
stage extension reactions, one strand of each new product nized by the Q# replicase. The reporter probes are
will be resistant to the restriction enzyme, and the nick- allowed to hybridize to the template. The template with
07Buckingham (F)-07 2/6/07 12:25 PM Page 146

146 Section 2 Common Techniques in Molecular Biology

Nick Capture probe A Reporter probe


(A) G
G
G
G
1st
G hybridization
Magnetic
bead Target RNA

G
Magnet C
C
G
G Capture, wash
C G
(B) C G
C

G
C G
C G
(C) C
C
G Release
G
C

Nick
Capture probe B
(D) A 2nd
A
A
A
hybridization
A

Nick
(E) A
T A
T A
T A
T A
T

Reversible
target capture
Nick
and washes
Figure 7-28 In the second phase of SDA, the target T
T A
T A
sequence is nicked by the restriction enzyme, generating a T A
T A
substrate for the polymerase, which extends the nick, displac- A

ing the opposite strand (B, D). The displaced strand is


hybridized by a primer, producing another endonucleolytic Q replicase
target (C, E). The product of both reactions is a copy of the
target with a hemisensitive restriction site (C, top). The reac-
Amplification
tion cycles of the strands are cut and extended.

bound probes is captured onto the side of the well using


Figure 7-29 The Q! replicase method proceeds through a
polyC capture probes and paramagnetic beads so that
series of binding and washing steps.63,64 Probe bound to the
unbound reporter molecules can be washed away (Fig. purified template is then amplified by Q! replicase. The result-
7-29). The template-probe complex is released from the ing RNA can be detected by fluorometry using propidium
polyC magnetic bead and bound to a different capture iodide as a fluorescent label of the synthesized probe or by
probe on a polyT paramagnetic bead. After a series of chromogenic methods.
washes to remove unbound reporter probe, the template-
probe complex is again released from the magnetic bead. eration of 106109 RNA molecules/probe in less than 15
For the amplification step, the probe-bound template is minutes. Because so many RNA molecules are produced,
mixed with the Q! replicase, which replicates the probe product detection can be achieved by colorimetric as well
molecules. This replication is very efficient with the gen- as real time fluorogenic methods. This assay can also be
07Buckingham (F)-07 2/6/07 12:25 PM Page 147

Nucleic Acid Amplification Chapter 7 147

quantitative by running a standard curve to determine the


number of target molecules in the sample. Amplifiers
Q! replicase has been used primarily to amplify the
nucleic acid associated with infectious organisms, par-
ticularly mycobacteria,63, 64 Chlamydia,65 HIV,66 and
CMV,67 but the assays are not commercially available in
the United States at this time. Extender probes

Signal Amplification
Target RNA or DNA
Capture
Signal amplification procedures differ from target ampli-
probes
fication procedures in that the number of target sequences
does not change; instead, large amounts of signal are Solid support
bound to the target sequences that are present in the sam-
ple. Because the number of target sequences does not Figure 7-30 Branched DNA signal amplification of a single
change, signal amplification procedures are inherently target. The target is captured or immobilized to a solid support
better at quantitating the amount of target sequences by capture probes, after which extender probes and blocking
present in the clinical sample. Several signal amplifica- probes create a stable cruciform structure with the amplifiers.
tion methods are available commercially. Each amplifier has hybridization sites for 814 branches, which
in turn bind substrate molecules for alkaline phosphatase.

Branched DNA Amplification


Chiron Corp. developed and markets the branched DNA Amplifiers
(bDNA) amplification system. The target nucleic acid for
this assay can be either DNA or RNA. A series of short
oligomer probes are used to capture the target nucleic
acid, and additional extender probes bind to the target
nucleic acid and then to multiple reporter molecules,68
loading the target nucleic acid with signal.
The bDNA signal amplification procedure is as fol-
lows. The target nucleic acid is released from the cells,
the DNA is denatured if DNA is the target, and the target
nucleic acid binds to capture probes that are fixed to a
solid support (Fig. 7-30). Extender or preamplifier probes
then bind to the captured target. The extender probes
have sequences that are complementary to sequences in Preamplifier
the target molecules as well as to sequences that are in Extender probes
the amplifier molecules. In the first-generation assay, the
extender probes bind to a bDNA amplifier, which in turn
bind multiple alkaline phosphatase-labeled nucleotides. Target RNA or DNA
Capture
Eight multimers or amplifiers, each with 15 branches, probes
bind to each extender probe bound to the target. In the
second- and third-generation assays, the extender probes Solid support
bind preamplifiers, which in turn bind 1415 amplifiers
that can each bind to multiple alkaline phosphatase Figure 7-31 Second-generation bDNA assays use extender
labeled oligonucleotides (Fig. 7-31). Dioxetane is added probes that bind multiple amplifiers, increasing the signal
as the substrate for the alkaline phosphatase, and chemi- intensity and improving limits of detection.
07Buckingham (F)-07 2/6/07 12:25 PM Page 148

148 Section 2 Common Techniques in Molecular Biology

luminescence is measured in a luminometer. This system unique structure that is recognized by antibodies.
has a detection limit of about 50 target mol/mL.69 Antibodies bound to the surface of a microtiter well cap-
There are several advantages to this method. First, there ture the DNA/RNA hybrids. Double-stranded DNA or
is less risk of carryover contamination resulting in a pos- single-stranded RNA will not bind to these antibodies.
itive test in the bDNA assay than in PCR.70 Second, mul- Captured hybrids are detected by the binding of alkaline
tiple capture and extender probes can be incorporated that phosphataseconjugated antiDNA/RNA hybrid antibod-
detect slightly different target sequences as occurs with ies in a typical sandwich assay. The substrate for the alka-
different isolates of hepatitis C virus and HIV. By incor- line phosphatase is added, and chemiluminescence is
porating different probes that recognize slightly different measured. The sensitivity of this assay for Human Papil-
sequences, multiple genotypes of the same virus can still loma Virus has been reported to be about 1000 copies of
be detected by the same basic system. Finally, requiring viral DNA.81 The hybrid capture assay is considered a
that multiple probes bind to the same target increases the signal amplification assay because the amount of target
specificity of the system. It is highly unlikely that all of DNA is not amplified; rather, the DNA is isolated, bound
the required probes would bind nonspecifically to an to a probe, and then label is bound to the target/probe
unrelated target and produce a signal. The bDNA signal hybrid molecule.
amplification assay is currently available for the qualita-
tive and quantitative detection of Hepatitis B Virus, Hepa-
titis C Virus, and HIV-1.6974 Cleavage-Based Amplification
Cleavage-based amplification detects target nucleic acids
Hybrid Capture Assays by using a series of probes that bind to the target and over-
lap. Cleavase is an enzyme that has been isolated from
Digene Diagnostics has marketed the hybrid capture bacteria that recognizes overlapping sequences of DNA
assays primarily for the detection and molecular charac- and makes a cut (cleaves) in the overlapping piece. In
terization of Human Papilloma Virus in genitourinary vivo, this activity is most likely important in repairing
specimens.75,76 It is also available for the detection of DNA. Third Wave Technologies has promoted this
Hepatitis B Virus77,78 and CMV.79,80 In these assays, target method as the basis of its Invader system. Targets for this
DNA is released from cells and binds to single-stranded form of amplification have been DNA polymorphisms,
RNA probes (Fig. 7-32). The DNA/RNA hybrid has a primarily for factor V Leiden mutation detection.86, 87
To start the amplification, the target nucleic acid is
mixed with invader and signal probes (see Chapter 9, Fig.
9-26.). The invader probe and the signal probes bind at
the target, with the 5 end of the signal probe overlapping
with the invader probe. Cleavase recognizes this overlap
and cleaves the signal probe, which can act as an invader
probe in the next step of the reaction. In the second step,
a FRET probe is added that has sequences complemen-
tary to the cleaved signal probe. The 5 end of the FRET
probe has a reporter molecule that is located in proximity
DNA RNA Antibodies Secondary to a quencher molecule. As a result, the intact FRET
probe antibodies probe does not produce a signal. The signal probe (now
Figure 7-32 Hybrid capture starts with hybridization of the an invader probe) binds to the FRET probe, producing an
RNA probe to the denatured DNA target. The RNA/DNA
overlapping region that is recognized by Cleavase. When
hybrid is then bound by hybrid-specific immobilized antibod-
ies. A secondary antibody bound to alkaline phosphatase
Cleavase cuts the FRET probe in the overlapping region,
generates signal in the presence of a chemiluminescent it releases the reporter molecule from the quencher,
substrate (right). resulting in the production of signal. The amount of sig-
07Buckingham (F)-07 2/6/07 12:25 PM Page 149

Nucleic Acid Amplification Chapter 7 149

RNA probe
STUDY QUESTIONS
R
Q
1. The final concentration of Taq polymerase is to be
DNA target 0.01 units/!l in a 50 !l PCR. If the enzyme is sup-
plied as 5 units/!l, how much enzyme would you add
R Q to the reaction?
a. 1 !L
RNase b. 1 !L of a 1:10 dilution of Taq
c. 5 !L of a 1:10 dilution of Taq
R Q d. 2 !L

2. Primer dimers result from:


R a. High primer concentrations
Q
b. Low primer concentrations
c. High GC content in the primer sequences
Figure 7-33 Cycling probe produces fluorescence only
d. 3 complementarity in the primer sequences
when the RNA probe binds to the DNA template. The
RNA/DNA hybrid formed by the probe bound to the tem-
plate is a substrate for RNase H, which digests the RNA 3. Which control is run to detect contamination?
probe and releases the reporter dye (R) from the vicinity a. Negative control
of the quencher (Q). b. Positive control
c. Molecular weight marker
nal can be quantitated and related directly to the amount d. Reagent blank
of target molecules in the sample.
4. Nonspecific extra PCR products can result from:
a. Mispriming
Cycling Probe b. High annealing temperatures
In the cycling probe method of amplification, target c. High agarose gel concentrations
sequences are detected using a synthetic probe consisting d. Omission of MgCl2 from the PCR
of sequences of DNA-RNA-DNA. The probe binds to the
target nucleic acid (Fig. 7-33). RNase H cleaves the RNA 5. Using which of the following is an appropriate way to
from the middle of the probe. This releases the DNA por- avoid PCR contamination?
tions from the probes, freeing the template to bind to a. High fidelity polymerase
additional probe molecules. When the probe is digested, b. Hot-start PCR
the reporter and quencher dye are separated, allowing flu- c. A separate area for PCR set up
orescence to escape from the reporter. The amount of flu- d. Fewer PCR cycles
orescence from the reporter dye (produced when the
target is present) is measured as an indication of the pres- 6. How many copies of a target are made after 30 cycles
ence of target molecules. Alternatively, the presence of of PCR?
chimeric probes that remain when target sequences are a. 2 " 30
not present can also be measured. This method has been b. 230
used to detect genes associated with antimicrobial resist- c. 302
ance in bacteria such as methicillin resistance (mecA) in d. 30/2
Staphylococcus aureus and vancomycin resistance (vanA
and vanB) in Enterococcus.88,89 7. What are the three steps of a standard PCR cycle?
07Buckingham (F)-07 2/6/07 12:25 PM Page 150

150 Section 2 Common Techniques in Molecular Biology

8. Which of the following is a method for purifying a a. Write the primer sequences 5 3 as you would
PCR product? if you were to order them from the DNA synthe-
a. Treat with uracil N glycosylase sis facility.
b. Add divalent cations b. Write the Tm for each primer that you have
c. Put the reaction mix through a spin column designed.
d. Add DEPC
References
9. In contrast to standard PCR, real-time PCR is: 1. Mullis K. The unusual origin of the polymerase
a. Quantitative chain reaction. Scientific American 1990;262:
b. Qualitative 5661, 6465.
c. Labor-intensive 2. Mullis K, Faloona FA. Specific synthesis of DNA in
d. Sensitive vitro via a polymerase-catalyzed chain reaction.
Methods in Enzymology 1987;155:33550.
10. In real-time PCR, fluorescence is not generated by
3. Saiki R, Scharf S, Faloona F, et al. Enzymatic ampli-
which of the following?
fication of beta-globin genomic sequences and
a. FRET probes
restriction site analysis for diagnosis of sickle cell
b. TaqMan probes
anemia. Science 1985;230:135054.
c. SYBR green
4. Lawyer F, Stoffel S, Saiki RK, et al. Isolation, char-
d. Tth polymerase
acterization, and expression in Escherichia coli of
11. Prepare a table that compares PCR, LCR, bDNA, the DNA polymerase gene from Thermus aquaticus.
TMA, Q! Replicase, and Hybrid Capture with Journal of Biological Chemistry 1989;264(11):
regards to the type of amplification, target nucleic 642737.
acid, type of amplicon, and major enzyme(s) for each. 5. Obeid P, Christopoulos TK, Crabtree HJ, et al.
Microfabricated device for DNA and RNA amplifi-
12. Examine the following sequence. You are devising a cation by continuous-flow polymerase chain reaction
test to detect a mutation at the underlined position. and reverse transcription-polymerase chain reaction
5 TATTTAGTTA TGGCCTATAC ACTATTTGTG with cycle number selection. Analytical Chemistry
AGCAAAGGTG ATCGTTTTCT GTTTGAGATT 2003;75(2):28895.
TTTATCTCTT GATTCTTCAA AAGCATTCTG 6. Klaschik S, Lehmann LE , Raadts A , et al. Com-
AGAAGGTGAG ATAAGCCCTG AGTCTCAGCT parison of different decontamination methods for
ACCTAAGAAA AACCTGGATG TCACTGGCCA reagents to detect low concentrations of bacterial
CTGAGGAGC TTTGTTTCAAC CAAGTCATGT 16S DNA by real-time-PCR. Molecular Biotechno-
GCATTTCCAC GTCAACAGAA TTGTTTATTG logy 2002;22(3):23142.
TGACAGTTAT ATCTGTTGTC CCTTTGACCT 7. Meier A, Persing DH , Finken M , et al. Elimina-
TGTTTCTTGA AGGTTTCCTC GTCCCTGGGC tion of contaminating DNA within polymerase
AATTCCGCAT TTAATTCATG GTATTCAGGA chain reaction reagents: Implications for a general
TTACATGCAT GTTTGGTTA AACCCATGAGA approach to detection of uncultured pathogens.
TTCATTCAGT TAAAAATCCA GATGGCGAAT 3 Journal of Clinical Microbiology 1993;31(3):
Design one set of primers (forward and reverse) to gener- 64652.
ate an amplicon containing the underlined base. 8. Fox J, Ait-Khaled M, Webster A, et al. Eliminating
The primers should be 20 bases long. PCR contamination: Is UV irradiation the answer?
The amplicon must be 100150 bp in size. Journal of Virological Methods 1991;33(3):37582.
The primers must have similar melting temperatures (Tm), 9. Waltenbury D, Leduc LG, Ferroni GD. The use of
"/# 2$C. RAPD genomic fingerprinting to study relatedness
The primers should have no homology in the last three 3 in strains of Acidithiobacillus ferrooxidans. Journal
bases. of Microbiological Methods 2005;62(1):10312.
07Buckingham (F)-07 2/6/07 12:25 PM Page 151

Nucleic Acid Amplification Chapter 7 151

10. Tzanakaki G, Tsopanomichalou M, Kesanopoulos cycler technology. Cancer Research 2000;60(12):


K, et al. Simultaneous single-tube PCR assay for the 328189.
detection of Neisseria meningitidis, Haemophilus 20. Gibbons C, Awad-El-Kariem FM. Nested PCR for
influenzae type b and Streptococcus pneumoniae. the detection of Cryptosporidium parvum. Parasito-
Clinical Microbiology and Infection;11(5):38690. logy Today 1999;15(8):345.
11. Nguyen T, Le Van P, Le Huy C, et al. Detection and 21. Knox C, Timms P. Comparison of PCR, nested
characterization of diarrheagenic Escherichia coli PCR, and random amplified polymorphic DNA PCR
from young children in Hanoi, Vietnam. Journal of for detection and typing of Ureaplasma urealyticum
Clinical Microbiology 2005;43(2):75560. in specimens from pregnant women. Journal of
12. Bellau-Pujol S, Vabret A, Legrand L, et al. Clinical Microbiology 1998;36(10):303239.
Development of three multiplex RT-PCR assays for 22. Pinti M, Nasi M, Moretti L, et al. Quantitation of
the detection of 12 respiratory RNA viruses. Journal CD95 and CD95L mRNA expression in chronic
of Virological Methods 2005;126(12):5363. and acute HIV-1 infection by competitive RT-PCR.
13. Gaydos C, Crotchfelt KA, Shah N, et al. Evaluation Annals of the New York Academy of Sciences 2000;
of dry and wet transported intravaginal swabs in 926:4651.
detection of Chlamydia trachomatis and Neisseria 23. Higuchi R, Dollinger G, Walsh PS, et al. Simultane-
gonorrhoeae infections in female soldiers by PCR. ous amplification and detection of specific DNA
Journal of Clinical Microbiology 2002;40(3): sequences. Biotechnology 1992;10:41317.
75861. 24. Higuchi R, Fockler C, Dollinger G, et al. Kinetic
14. Geha D, Uhl JR, Gustaferro CA, et al. Multiplex PCR: Real-time monitoring of DNA amplification
PCR for identification of methicillin-resistant reactions. Biotechnology 1993;11:102630.
staphylococci in the clinical laboratory. Journal of 25. Sherman K, Rouster SD, Horn PS. Comparison of
Clinical Microbiology 1994;32:176872. methodologies for quantification of hepatitis C
15. Hui R, Zeng F, Chan CMF, et al. Reverse transcrip- virus (HCV) RNA in patients coinfected with
tase PCR diagnostic assay for the coronavirus asso- HCV and human immunodeficiency virus:
ciated with severe acute respiratory syndrome. Comparison of methodologies for quantification
Journal of Clinical Microbiology 2004;42(5): of hepatitis C virus (HCV) RNA in patients coin-
199499. fected with HCV and human immunodeficiency
16. Casabianca A, Orlandi C, Fraternale A, et al. A new virus. Clinical Infectious Diseases 2002;35(4):
one-step RT-PCR method for virus quantitation in 48287.
murine AIDS. Journal of Virological Methods 2003; 26. Raab M, Cremer FW, Breitkreutz IN, et al.
110(1):8190. Molecular monitoring of tumour load kinetics pre-
17. Koopmans M, Monroe SS, Coffield LM, et al. Opti- dicts disease progression after non-myeloablative
mization of extraction and PCR amplification of allogeneic stem cell transplantation in multiple
RNA extracts from paraffin-embedded tissue in myeloma. Annals of Oncology 2005;16(4):
different fixatives. Journal of Virological Methods 61117.
1993;43(2):189204. 27. Murthy S, Magliocco AM, Demetrick DJ. Copy
18. Poggio G, Rodriguez C, Cisterna D, et al. Nested number analysis of c-erb-B2 (HER-2/neu) and
PCR for rapid detection of mumps virus in cere- topoisomerase II alpha genes in breast carcinoma
brospinal fluid from patients with neurological dis- by quantitative real-time polymerase chain reaction
eases. Journal of Clinical Microbiology 2000;38 using hybridization probes and fluorescence in situ
(1):27478. hybridization. Archives of Pathology & Laboratory
19. Nakao M, Janssen JW, Flohr T, et al. Rapid and Medicine 2005;129(1):3946.
reliable quantification of minimal residual disease 28. Holland PM, Abramson RD, Watson R, et al. Detec-
in acute lymphoblastic leukemia using rearranged tion of specific polymerase chain reaction product
immunoglobulin and T-cell receptor loci by light by utilizing the 5 to 3 exonuclease activity of Ther-
07Buckingham (F)-07 2/6/07 12:25 PM Page 152

152 Section 2 Common Techniques in Molecular Biology

mus aquaticus DNA polymerase. Proceedings of the 40. Neoh S, Brisco MJ, Firgaira FA, et al. Rapid detec-
National Academy of Sciences 1991;88:727680. tion of the factor V Leiden (1691 G ! A) and
29. Lee LG, Connell CR, Bloch W. Allelic discrimina- haemochromatosis (845 G ! A) mutation by fluo-
tion by nick-translation PCR with fluorogenic rescence resonance energy transfer (FRET) and
probes. Nucleic Acids Research 1993;21:376166. real-time PCR. Journal of Clinical Pathology 1999;
30. Branford S, Hughes TP, Rudzki Z. Monitoring 52(10):76669.
chronic leukemia therapy by real-time quantitative 41. Gundry CN, Bernard PS, Hermann MG, et al. Rapid
PCR in blood is a reliable alternative to bone mar- F508del and F508C assay using fluorescent hybridi-
row cytogenetics. British Journal of Haematology zation probes. Genetic Testing 1999;3:36570.
1999;107:58799. 42. Cardullo RA, Agarwal S, Flores C, et al. Nucleic
31. Kleiber J, Walter T, Haberhausen G, et al. Perform- acid hybridization by nonradioactive fluorescence
ance characteristics of a quantitative homogeneous resonance energy transfer. Proceedings of the
TaqMan RT-PCR test for HCV RNA. Journal of National Academy of Sciences 1988;85:879094.
Molecular Diagnostics 2000;2(3):15866. 43. Welsh J, McClelland M. Fingerprinting genomes
32. Rudert WA, Braun ER, Faas SJ, et al. Double- using PCR with arbitrary primers. Nucleic Acids
labeled fluorescent probes for 5 nuclease assays: Research 1990;18(24):721318.
Purification and performance evaluation. 44. Perucho M, Welsh J, Peinado MA, et al. Finger-
BioTechniques 1997;22:114045. printing of DNA and RNA by arbitrarily primed
33. Livak KJ, Marmaro J, Flood S. Guidelines for polymerase chain reaction: Applications in cancer
designing Taqman fluorescent probes for 5 nucle- research. Methods in Enzymology 1995;254:
ase assays. Applied Biosystems, 1995. 27590.
34. Whitcombe D, Theaker J, Guy SP, et al. Detection 45. Kluytmans J, Berg H, Steegh P, et al. Outbreak of
of PCR products using self-probing amplicons and Staphylococcus schleiferi wound infections: Strain
fluorescence. Nature Biotechnology 1999;17: characterization by randomly amplified polymorphic
804807. DNA analysis, PCR ribotyping, conventional ribo-
35. Nazarenko IA, Bhatnagar SK, Hohman RJ. A typing, and pulsed-field gel electrophoresis. Journal
closed tube format for amplification and detection of Clinical Microbiology 1998;36(8):221419.
of DNA based on energy transfer. Nucleic Acids 46. Kwoh D, Davis GR, Whitfield KM, et al.
Research 1997;25:251621. Transcription-based amplification system and detec-
36. Thelwell NS, Millington S, Solinas A, et al. Mode tion of amplified human immunodeficiency virus
of action and application of Scorpion primers to type 1 with a bead-based sandwich hybridization
mutation detection. Nucleic Acids Research 2000; format. Proceedings of the National Academy of
28:375261. Sciences 1989;86(4):117377.
37. Didenko VV. DNA probes using fluorescence reso- 47. Gorrin G, Friesenhahn M, Lin P, et al. Performance
nance energy transfer (FRET): Designs and applica- evaluation of the VERSANT HCV RNA qualitative
tions. BioTechniques 2001;31(5):110621. assay by using transcription-mediated amplification.
38. Menard A, Dachet F, Prouzet-Mauleon V, et al. Journal of Clinical Microbiology 2003;41(1):
Development of a real-time fluorescence resonance 31017.
energy transfer PCR to identify the main patho- 48. Allain J. Genomic screening for blood-borne viruses
genic Campylobacter spp. Clinical Microbiology in transfusion settings. Clinical and Laboratory
and Infection 2005;11(4):28187. Haematology 2000;22(1):110.
39. Aliyu S, Aliyu MH, Salihu HM, et al. Rapid detec- 49. Kimura T, Rokuhara A,Sakamoto Y, et al. Sensitive
tion and quantitation of hepatitis B virus DNA by enzyme immunoassay for hepatitis B virus core-
real-time PCR using a new fluorescent (FRET) related antigens and their correlation to virus load.
detection system. Journal of Clinical Virology Journal of Clinical Microbiology 2002;40(2):
2004;30(2):19195. 43945.
07Buckingham (F)-07 2/6/07 12:25 PM Page 153

Nucleic Acid Amplification Chapter 7 153

50. Kievits T, van Gemen B, van Strijp D, et al. NASBA culosis complex in respiratory specimens. Journal
isothermal enzymatic in vitro nucleic acid amplifica- of Clinical Microbiology 1999;37(1):13740.
tion optimized for the diagnosis of HIV-1 infection. 61. Little M, Andrews J, Moore R, et al. Strand dis-
Journal of Virological Methods 1991;35(3):27386. placement amplification and homogeneous real-
51. van der Vliet G, Schukkink RA, van Gemen B, et time detection incorporated in a second-generation
al. Nucleic acid sequence-based amplification DNA probe system, BD ProbeTec ET. Clinical
(NASBA) for the identification of mycobacteria. Chemistry 1999;45(6):77784.
Journal of General Microbiology 1993;139(10): 62. Blumenthal T, Carmichael GG. RNA replication:
242329. Function and structure of Qbeta-replicase. Annual
52. Deiman B, van Aarle P, Sillekens P. Characteristics Review of Biochemistry 1979;48:52548.
and applications of nucleic acid sequence-based 63. Shah J, Liu J, Buxton D, et al. Detection of
amplification (NASBA). Molecular Biotechnology Mycobacterium tuberculosis directly from spiked
2002;20(2):16380. human sputum by Q-beta replicaseamplified assay.
53. Romano J, van Gemen B, Kievits T. NASBA: A Journal of Clinical Microbiology 1995;33:32228.
novel, isothermal detection technology for qualita- 64. Shah J, Liu J, Buxton D, et al. Q-beta replicase
tive and quantitative HIV-1 RNA measurements. amplified assay for detection of Mycobacterium
Clinical Laboratory Medicine 1996;16(1):89103. tuberculosis directly from clinical specimens.
54. Barany F. The ligase chain reaction in a PCR world. Journal of Clinical Microbiology 1995;33(6):
PCR Methods and Applications 1991;1(1):516. 143541.
55. Walker G, Fraiser MS, Schram JL, et al. Strand dis- 65. Stefano J, Genovese L, An Q, et al. Rapid and sen-
placement amplification: An isothermal, in vitro sitive detection of Chlamydia trachomatis using a
DNA amplification technique. Nucleic Acids ligatable binary RNA probe and Q beta replicase.
Research 1992;20(7):169196. Molecular and Cellular Probes 1997;11(6):40726.
56. Walker G, Little MC, Nadeau JG, et al. Isothermal 66. Lomeli H, Tyagi S, Pritchard CG, et al. Quantitative
in vitro amplification of DNA by a restriction assays based on the use of replicatable hybridiza-
enzyme/DNA polymerase system. Proceedings of tion probes. Clinical Chemistry 1989;35(9):
the National Academy of Sciences 1992;89(1): 182631.
39296. 67. Fox R, Dotan I, Compton T, et al. Use of DNA
57. Ichiyama S, Ito Y, Sugiura F, et al. Diagnostic value amplification methods for clinical diagnosis in
of the strand displacement amplification method autoimmune diseases. Journal of Clinical Labora-
compared to those of Roche Amplicor PCR and tory Analysis 1989;3(6):37887.
culture for detecting mycobacteria in sputum sam- 68. Horn T, Chang CA, Urdea MS. Chemical synthesis
ples. Journal of Clinical Microbiology 1997;35(12): and characterization of branched oligodeoxyribonu-
38023805. cleotides (bDNA) for use as signal amplifiers in
58. Walker G, Linn CP. Detection of Mycobacterium nucleic acid quantification assays. Nucleic Acids
tuberculosis DNA with thermophilic strand dis- Research 1997;25(23):484249.
placement amplification and fluorescence polariza- 69. Kern D, Collins M, Fultz T, et al. An enhanced-
tion. Clinical Chemistry 1996;42(10):16041608. sensitivity branched-DNA assay for quantification
59. Spears P, Linn CP, Woodard DL, et al. Simultane- of human immunodeficiency virus type 1 RNA in
ous strand displacement amplification and fluores- plasma. Journal of Clinical Microbiology 1996;
cence polarization detection of Chlamydia 34(12):3196202.
trachomatis DNA. Analytical Biochemistry 1997; 70. Lisby G. Application of nucleic acid amplification
247(1):13037. in clinical microbiology. Methods in Molecular
60. Pfyffer G, Funke-Kissling P, Rundler E, et al. Biology 1998;92:129.
Performance characteristics of the BD ProbeTec 71. Konnick E, Williams SM, Ashwood ER, et al.
system for direct detection of Mycobacterium tuber- Evaluation of the COBAS hepatitis C virus (HCV)
07Buckingham (F)-07 2/6/07 12:25 PM Page 154

154 Section 2 Common Techniques in Molecular Biology

TaqMan analyte-specific reagent assay and compar- 80. Hebart H, Gamer D, Loeffler J, et al. Evaluation of
ison to the COBAS Amplicor HCV Monitor V2.0 Murex CMV DNA hybrid capture assay for detec-
and Versant HCV bDNA 3.0 assays. Journal of tion and quantitation of cytomegalovirus infection
Clinical Microbiology 2005;43(5):213340. in patients following allogeneic stem cell transplan-
72. Elbeik T, Markowitz N, Nassos P, et al. Simultane- tation. Journal of Clinical Microbiology 1998;36
ous runs of the Bayer Versant HIV-1 version 3.0 (5):133337.
and HCV bDNA version 3.0 quantitative assays on 81. Schiffman M, Kiviat NB, Burk RD, et al. Accuracy
the System 340 platform provide reliable quantita- and interlaboratory reliability of human papillo-
tion and improved work flow. Journal of Clinical mavirus DNA testing by hybrid capture. Journal of
Microbiology 2004;42(7):312027. Clinical Microbiology 1995;33(3):54550.
73. Gleaves C, Welle J, Campbell M, et al. Multi- 82. Mullis K, The polymerase chain reaction. The
center evaluation of the Bayer Versant HIV-1 Nobel Prize in Chemistry, 1993.
RNA 3.0 assay: Analytical and clinical per- 83. Cleaver J, Crowley E. UV damage, DNA repair and
formance. Journal of Clinical Virology 2002; skin carcinogenesis. Frontiers in Bioscience 2002;
25(2):20516. 7:102443.
74. Yao J, Beld MG, Oon LL, et al. Multicenter evalua- 84. Petering H, Breuer C, Herbst R, et al. Comparison
tion of the Versant hepatitis B virus DNA 3.0 assay. of localized high-dose UVA1 irradiation versus
Journal of Clinical Microbiology 2004;42(2): topical cream psoralen-UVA for treatment of
800806. chronic vesicular dyshidrotic eczema. Journal of
75. Clavel C, Masure M, Levert M, et al. Human papil- the American Academy of Dermatology 2004;50(1):
lomavirus detection by the hybrid capture II assay: 6872.
A reliable test to select women with normal cervi- 85. Naldi L, Griffiths CE. Traditional therapies in the
cal smears at risk for developing cervical lesions. management of moderate to severe chronic plaque
Diagnostic Molecular Pathology 2000;9(3): psoriasis: An assessment of the benefits and risks.
14550. British Journal of Dermatology 2005;152(4):
76. Farthing A, Masterson P, Mason WP, et al. Human 597615.
papillomavirus detection by hybrid capture and its 86. Hessner MJ, Budish MA, Friedman KD. Genotyp-
possible clinical use. Journal of Clinical Pathology ing of factor V G1691A (Leiden) without the use of
1994;47(7):64952. PCR by invasive cleavage of oligonucleotide
77. Barlet V, Cohard M, Thelu MA, et al. Quantitative probes. Clinical Chemistry 2000;46:10511056.
detection of hepatitis B virus DNA in serum using 87. Ledford M, Friedman KD, Hessner MJ, et al. A
chemiluminescence: Comparison with radioactive multi-site study for detection of the factor V
solution hybridization assay. Journal of Virological (Leiden) mutation from genomic DNA using a
Methods 1994;49(2):14151. homogeneous invader microtiter plate fluorescence
78. Poljak M, Marin IJ, Seme K, et al. Second- resonance energy transfer (FRET) assay. Journal of
generation hybrid capture test and Amplicor Molecular Diagnostics. 2000;2:97104.
monitor test generate highly correlated hepatitis 88. Cloney L, Marlowe C, Wong A, et al. Rapid detec-
B virus DNA levels. Journal of Virological tion of mecA in methicillin resistant Staphylococcus
Methods 2001;97(12):16569. aureus using cycling probe technology. Molecular
79. Caliendo A, Yen-Lieberman B, Baptista J, et al. and Cellular Probes. 1999;13(3):1917.
Comparison of molecular tests for detection and 89. Modrusan Z, Marlowe C, Wheeler D, et al.
quantification of cell-associated cytomegalovirus Detection of vancomycin-resistant genes vanA and
DNA. Journal of Clinical Microbiology 2003;41(8): vanB by cycling probe technology. Molecular and
350913. Cellular Probes, 1999; 13(3): 223231.
08Buckingham (F)-08 2/6/07 5:53 PM Page 155

Chapter 8 Lela Buckingham

Chromosomal
Structure and
Chromosomal
Mutations
OUTLINE OBJECTIVES
CHROMOSOMAL STRUCTURE Define mutations and polymorphisms.
AND ANALYSIS
Chromosomal Compaction Distinguish the three types of DNA mutations: genome,
and Histones chromosomal, and gene.
Chromosomal Morphology Describe chromosomal compaction and the proteins
Visualizing Chromosomes involved in chromatin structure.
DETECTION OF GENOME AND Diagram a human chromosome, and label the centromere,
CHROMOSOMAL MUTATIONS
q arm, p arm, and telomere.
Karyotyping
Fluorescence In Situ Hybridization Illustrate the different types of structural mutations that
occur in chromosomes.
State the karyotype of a normal male and female.
Identify the chromosomal abnormality in a given
karyotype.
Compare and contrast interphase and metaphase FISH
analyses.
Distinguish between the effects of balanced and unbal-
anced translocations on an individual and the individuals
offspring.
155
08Buckingham (F)-08 2/6/07 5:53 PM Page 156

156 Section 2 Common Techniques in Molecular Biology

The human genome is all of the genes found in a single be observed microscopically. Mutations at the nucleotide
individual. The human genome consists of 2.9 billion sequence level are detected using biochemical or molec-
nucleotide base pairs of DNA organized into 23 chromo- ular methods. Alterations of the DNA sequence may