Fish & Shellsh Immunology 32 (2012) 291e300

Contents lists available at SciVerse ScienceDirect

Fish & Shellsh Immunology

journal homepage: www.elsevier.com/locate/fsi

IPNV modulation of pro and anti-inammatory cytokine expression in Atlantic

salmon might help the establishment of infection and persistence
Sebastin Reyes-Cerpa a, Felipe E. Reyes-Lpez a, Daniela Toro-Ascuy a, Jorge Ibaez a, Kevin Maisey a,
Ana Mara Sandino b, Mnica Imarai a, *
a
Laboratorio de Inmunologa, Centro de Biotecnologa Acucola (CBA), Facultad de Qumica y Biologa, Universidad de Santiago de Chile, Chile
b
Laboratorio de Virologa, Centro de Biotecnologa Acucola (CBA), Facultad de Qumica y Biologa, Universidad de Santiago de Chile, Chile

a r t i c l e i n f o a b s t r a c t

Article history: IPNV is the agent of a well-characterized acute disease that produces a systemic infection and high
Received 24 August 2011 mortality in farmed sh species and persistent infection in surviving sh after outbreaks. Because
Received in revised form modulation of the host expression of pro and anti-inammatory cytokines can help establish persistence,
15 November 2011
in this study, we examined the expression of IL-1b, IL-8, IFNa1 and IL-10 during acute and persistent
Accepted 20 November 2011
Available online 26 November 2011
IPNV infection of Atlantic salmon. Results showed that IPNV infection induces an increase of the IFNa1
and IL-10 mRNA levels in the spleen and head kidney (HK) of sh after acute experimental infection.
Levels of the pro-inammatory cytokines IL-1b and IL-8 did not rise in the spleen although an increase of
Keywords:
Cytokines
IL-1b, but not of IL-8, was observed in head kidney. In carrier asymptomatic salmon, cytokine gene
IPNV expression of IFNa1 in the spleen and IL-10 in head kidney were also signicantly higher than expression
Salmo salar in non-carrier sh. Interestingly, a decrease of IL-8 expression was also observed. IPNV infection of SHK-1,
Persistence which is a macrophage-like cell line of salmon, also induced an increase of expression of the anti-
inammatory cytokine IL-10 with no effects on the expression of IL-1b and IL-8. The effects are
induced by an unknown mechanism during viral infection because poly I:C and the viral genomic dsRNA
showed the opposite effects on cytokine expression in SHK-1 cells. In summary, IPNV always induces up-
regulation of the anti-inammatory cytokine IL-10 in Atlantic salmon. As this is accompanied by a lack of
induction of the pro-inammatory cytokines IL-1b and IL-8, the anti-inammatory milieu may explain
the high frequency, prevalence and persistence of IPNV in salmon. Effects might be part of the viral
mechanisms of immune evasion.
! 2011 Elsevier Ltd. All rights reserved.

1. Introduction Viral persistence has been characterized in mammals where it

The infectious pancreatic necrosis virus is the aetiological agent
of a well-characterized disease (Infectious pancreatic necrosis, IPN),
which produces systemic infection and mortality in farmed
salmonid species causing negative economic impact [1,2]. In young
salmonids, IPNV produces an acute disease episode with high
mortalities, followed by life-long persistent infection in the survi-
vors. The IPNV carrier sh are asymptomatic and have virus in
many visceral organs and in leucocytes of blood and head kidney at
extremely low multiplicity of infection [3e6]. Fish can periodically
shed infectious IPNV in their feces and reproductive products and
transmit the virus to their progeny and other susceptible species
[7,8].
* Corresponding author. Tel.: 56 2 7181099; fax: 56 2 6812108.
E-mail address: monica.imarai@usach.cl (M. Imarai).
has been observed that a susceptible host may have an infection
associated with cytokine activity inhibition [9e12]. Modulation of
the host expression of anti-inammatory cytokines can help the
establishment of chronic infection [13e15]. The nature of the
inammatory mediators induced following IPNV infections in sh
is poorly characterized. Studies of Atlantic cod have demonstrated
that IPNV induced up-regulation of IL-1b and IL-8 expression in
head kidney cells after 1e2 days post-infection [16]. None of these
cytokines increased in head kidney of Atlantic cod injected i.p with
IPNV between 7 and 42 days [17].
In brown trout, IL-1b and IL-8 expression increased in the spleen
by days 1 and 2 after i.p. inoculation of IPNV [18] and in Atlantic
salmon (Salmon salar), IL-1b expression was not induced in kidney
and gills between days 16 and 34 after challenge by cohabitation
[19], although in gills, constitutive expression was observed. The
induction of other pro-inammatory cytokines after IPNV
infection has not been explored, although IL-1b, IL-6 IL-8, IL-11,

1050-4648/$ e see front matter ! 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fsi.2011.11.018
292 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300

IL-12 expression were detected in six cDNA libraries from liver, Table 1
kidney, spleen, peripheral blood and thymus of infected Atlantic Sequence of primers used for PCR analysis.

halibut [20]. On the other hand, there is little information regarding Gene Primer sequence EMBL accesion Amplicon
anti-inammatory cytokines. The balance of pro-inammatory and size (pb)
anti-inammatory cytokines is a factor that determines the char- b-Actin FW: 50 - ATGGAAGGTGAAATCGCC - 30 AF157514 260
acteristics of infection; therefore it seems important to establish RW: 50 - TGCCAGATCTTCTCCATG - 30
EF1a FW: 50 - CTGAGAGGGAGCGTGGTATC - 30 BT043569 289
the role of cytokines such as IL-10 during acute and chronic IPNV
RW: 50 - GGGGGCTCAGTAGAGTCCAT - 30
infection. Up-regulation of IL-10 may be related to the immuno- IL-1b FW: 50 - AGGGAGGCAGCGGCTACCACAA - 30 AY617117 353
suppressive effects described in IPNV infection [21e23] and to the RW: 50 - GGGGGCTGCCTTCTGACACAT - 30
establishment of IPNV persistence. In fact, IL-10 in mammals is able IL-8 FW: 50 - AGCGGCAGATTCAAACTCAC - 30 BT046706 445
to inhibit monocyte/macrophage antigen presentation, macro- RW: 50 - GTTGTTGGCCAGCATCTTCT - 30
IL-10 FW: 50 - GAACTCCGCACATCCTTCTC - 30 EF165029 301
phage activation, Th1 proliferation and the development and RW: 50 - CGTTGATGTCAAACGGTTTCT - 30
synthesis of Th1 cytokines [24], and there is growing evidence IFNa1 FW: 50 - ATCACAAAACAGAATGCCCC - 30 AY216594 463
indicating that this cytokine has a role in regulating persistent viral RW: 50 - AGACTGACAGGGTCCCACAT - 30
infections [25]. In regard to the anti-viral cytokines, it has been VP2 FW: 50 - TACGAGATCGACCTCCCATC - 30 FN257531 451
RW: 50 - CCACCAGTGTGATTGGTCTG - 30
demonstrated that IPNV induces IFN and interferon stimulated
genes (ISGs) in salmon and trout [19,26e28], which may play a role
in protection when the cytokine is induced prior to infection [29].
1% 2-ME) and 4 mL of 200 mg/mL Proteinase K (Promega) were
Thus, in order to determine whether modulation of the host
added to the supernatant and incubated for 1 h at 50 " C. Then,
expression of pro and anti-inammatory cytokines is associated
nucleic acid extraction was performed with 1 volume of phenol:-
with IPNV persistence, in this work, we have evaluated the gene
chloroform (1:1), stirred for 1 min and centrifuged for 10 min at
expression of IL-1b and IL-8, the anti-viral cytokine IFNa1 and the
10,000g. The RNA present in the aqueous phase was precipitated
anti-inammatory cytokine IL-10 in Atlantic salmon that have been
with absolute ethanol at #20 " C for 15 h. Finally, a pellet was ob-
intraperitoneally challenged with IPNV and in asymptomatic carrier
tained by centrifugation at 4 " C, 10,000g for 30 min at and the
sh surviving a natural outbreak. We also analyzed in vitro expres-
dsRNA was resuspended in 30 mL of nuclease free water.
sion of these cytokines in a macrophage-like cell line (SHK-1)
derived from head kidney of salmon in order to understand the role
2.3. Fish and treatment
of macrophages in the cytokine response. Results showed that anti-
inammatory cytokine IL-10 is always induced during IPNV infec-
Atlantic salmon (S. salar) of 20e30 g were obtained from a local
tion, which may be associated with mechanisms of immune evasion.
salmon farm and maintained in tanks with a freshwater system at
a biomass of 10e12 kg/m3, 14 " C and with continuous support of
2. Materials and methods
oxygen. Fish were fed with commercial trout pellets twice a day
and acclimated for 2 weeks prior to treatment. The presence of
2.1. Cell culture
IPNV was discarded by PCR detection of VP2 in a randomly selected
sample of the sh before experiments. Three groups of eight sh
SHK-1 cells (Salmo salar; ATCC, American Type Culture Collec-
were challenged with intraperitoneal injection of 1.5 $ 10#5 PFU/g
tion, Manassas, VA, USA), which were described as macrophage-
of IPNV [7] for 24, 48 and 96 h. As control, groups of ve sh were
like cells [30], were grown at 16 " C in Leibovitz 15 medium (L15;
intraperitoneally injected with IM and treated for the same periods
Gibco, Invitrogen, Carlsbad, CA, USA), supplemented with 10% fetal
of time. After treatment, all sh were tested for transcripts of the
calf serum (FCS; Hyclone, Thermo Fischer Scientic, Logan, Utah,
viral major capsid protein (VP2) by PCR [31]. For comparison,
USA), 4 mM L-glutamine (Gibco), 2-mercaptoethanol (2-ME; Gibco)
a group of ve sh was challenged with intraperitoneal (ip) injec-
and 50 mg/mL Gentamicin (US Biological, Swampscott, MA, USA).
tion of lipopolysaccharide (LPS) of Escherichia coli (Sigma, St Louis,
Cell cultures of 40e60 passages were used in this study.
MO, USA) (6 mg/kg) [32] and another group injected with Poly I:C
(Sigma) (500 mg) [32,33] and treated for 24 h. As vehicle control,
2.2. Virus
groups of ve sh were intraperitoneally injected with PBS and
treated for the same period of time. At the indicated times, all sh
The IPNV strain Sp (ATCC) was propagated in CHSE-214 cells
were sacriced with 100 mg/mL of benzocaine [20] and spleen, gills
(Salmon Chinook, ATCC) in infectious medium (IM) that contain
and head kidney were extracted and stored at #80 " C.
minimum essential medium (MEM, Gibco) supplemented with 2%
FCS, 100 UI/mL/100 mg/mL penicillin/streptomycin (Gibco) and
2.4. Naturally infected sh
2 mM L-glutamine (Gibco). The viral inocula were titrated by plaque
assay lysis. Briey, serial dilutions of virus (10#1 to 10#11) were
Fifteen sh were obtained after a natural outbreak of IPNV at
prepared in MEM and incubated 1 h in IM. Cells were washed twice
a local farm. No sh showed any clinical signs. Fish were sacriced
with phosphate buffer saline (PBS) and kept for 72 h in semisolid
medium that contain MEM supplemented with 2% FCS, 0.5% low-
Table 2
melting-point agarose (Gibco), 100 UI/mL/100 mg/mL penicillin/ Cycling conditions for standard PCR.
streptomycin (Gibco) and 2 mM L-glutamine (Gibco). After this,
1 mL of 37% formaldehyde (Winkler, Santiago, Chile) was added on Step Temperature (" C) Minutes Cycles

semisolid medium for 30 min to x the cell monolayer. Finally, the 1 94 3:00 1
2 94 0:45 5
agarose was removed and crystal violet was added on each well and
55 0:45
maintained for 30 min. Excess of crystal violet was removed and the 72 0:45
lysis plaques formed were counted. The genomic double-stranded 3 94 0:45 30
RNA (dsRNA) of IPNV (gIPNV) was prepared from 300 mL of 60 0:45
a supernatant of CHSE-214 cells with IPNV-cytopathic effects. 75 mL 72 0:45
4 72 5:00 1
of digestion solution (200 mM Tris, 10 mM EDTA, 50 mM SDS and
 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300 293

Fig. 1. Cytokine gene expression in the spleen of Atlantic salmon. Fish were intraperitoneally injected with LPS, poly I:C or IPNV and the cytokine gene expression was evaluated by
RT-PCR at the indicated time points in the spleen. The normalized relative expression (NRE) of IFNa1 (A), IL-1b (B), IL-8 (C), and IL-10 (D) is shown. Gene expression in treated sh
was normalized to the corresponding expression levels found in sh of the control group (PBS or vehicle). Mean of NRE % SE is shown. (*) Indicates statistical signicant difference
(P < 0.05) determined by the ManneWhitney test (non-parametric T-test).

with an overdose of benzocaine and spleen, gills and head kidney
were collected and stored. Fish were then classied as VP2 () or
VP2 (#) by PCR detection of the mRNA [31].
2.5. SHK-1 treatments
SHK-1 cells were incubated with IPNV at a multiplicity of
infection of 0.1 PFU/mL. The virus was adsorbed during 1 h in SHK-
1 cells in IM, then viral inoculum was eliminated and cells were
incubated for 0, 0.5, 1, 2, 3, 4, 6 and 8 h in L-15 fresh medium at
16 " C. On the other hand, SHK-1 cells were incubated with 100 ng/
mL LPS prepared in supplemented L-15 medium, for 0, 0.5, 1, 2, 3,
4, 6 and 8 h. In addition, cells were transfected with 20 mg/mL Poly
I:C or 6 mg/mL dsRNA genomic IPNV (gIPNV) using Fugene 6
(Roche Diagnostics, Mannheim, Germany) according to the
manufacturers instructions and then were also incubated in
supplemented L-15 medium for 0, 0.5, 1, 2, 3, 4, 6 and 8 h. Each
experiment was performed in quintuplicate. At the indicated time
points, cells were collected by mechanical disruption of the
adherent layer using scrappers and washed twice with phosphate
buffered saline (PBS). The cell suspension was kept on ice imme-
diately after harvesting, then washed and concentrated by
centrifugation. RNA was then extracted from each cell pellet for
gene expression analysis. VP2 expression was also tested in IPNV-
infected SHK-1 cells.
2.6. RNA extraction and cDNA synthesis
Organs and cell pellets were homogenized in 1 mL of TRIsure
(Bioline, London, UK) using Tissue master cell disruptor (Omni,
Kennesaw, GA, U.S.A.) according to the manufacturers protocol.
The total RNA extracted was resuspended in pyrogen free DEPC
treated water (Invitrogen). RNA (1.5 mg) was treated with RQ1
RNase free DNase (Promega) and cDNA synthesis was performed
using reverse transcriptase M-MLV (Promega) and Oligo dT
(Promega). Both procedures were performed according to the
manufacturers instructions.
2.7. Standard PCR
Polymerase chain reaction (PCR) was performed using GoTaq
Polymerase (Promega). For positive control and sample normali-
zation, primers for the housekeeping EF1a (for in vitro assays)
and b-actin (for in vivo assays) genes were used. For semi-quanti-
tative PCR analysis, the cycle number for each gene was kept as
low as practically possible to be within the linear range of PCR
294 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300

Fig. 2. Cytokine gene expression in the head kidney of Atlantic salmon. Fish were intraperitoneally injected with LPS, poly I:C or IPNV and the cytokine gene expression was
evaluated by RT-PCR at the indicated time points in the head kidney. The normalized relative expression (NRE) of IFNa1 (A), IL-1b (B), IL-8 (C), and IL-10 (D) is shown. Gene
expression in treated sh was normalized to the corresponding expression levels found in sh of the control group (PBS or vehicle). Mean of NRE % SE is shown. (*) Indicates
statistical signicant difference (P < 0.05) determined by the ManneWhitney test (non-parametric T-test).

amplication whilst still allowing endpoint gel densitometric
analysis. The linear phase of PCR amplication for all cytokines
ranged between 32 and 38 cycles. The target genes, primer
sequences and predicted amplicon sizes are listed in Table 1 and the
cycling conditions for standard PCR are indicated in Table 2. PCR
reactions were performed using 50 mL containing 10 mL 5X Buffer
Green Reaction (Promega), 3.1 mL of 25 mM MgCl2 (Promega), 1 mL
of 10 mM dNTPs (Bioline), 27.6 mL Ultrapure distilled water (Invi-
trogen), 3 mL of 5 mM forward primer, 3 mL of 5 mM reverse primer,
0.3 mL of 5U/mL GoTaq Polymerase (Promega) and 2 mL of cDNA
template. Control reactions without cDNA templates were per-
formed to ensure that products were not a result of DNA contam-
ination. Amplicons of both the cytokine and the corresponding
reference gene were loaded on the same 2% agarose gel and were
separated by electrophoresis. PCR products were stained with
ethidium bromide and visualized under UV. Finally, semi-
quantitative analyses of mRNA amounts were assessed by gel
densitometric analysis using the Gel-Pro Analyzer 4.0 software.
Gene expression in SHK-1 cells was reported as relative to EF1a
expression and normalized with the relative expression of each
gene in untreated cells. Target gene expression in sh intraperito-
neally challenged was reported as relative to b-actin expression and
normalized relative expression (NRE) was calculated with respect
to the relative expression obtained from sh in the control group
(no treatment). Finally, gene expression in natural infected sh was
reported relative to b-actin expression and normalized to relative
expression of each gene in VP2 (#) sh.
2.8. Statistical analysis
Cytokine gene expression levels in lymphoid organs of sh were
compared by ManneWhitney test. The kinetic of cytokine expres-
sion in stimulated SHK-1 cells was compared by KruskaleWallis
with Dunns multiple comparison test. We used GraphPad v5.0 for
Windows (GraphPad Software) to calculate the mean and SEM and
to perform statistical tests. P values less than 0.05 were considered
signicant.
3. Results
3.1. Cytokine gene expression in an early immune response in vivo
In order to understand how IPNV modulates cytokine response
during the rst hours of infection, we examined IFNa1, IL-1b, IL-8
and IL-10 expression in sh (S. salar) infected with the virus, as
well as in sh treated with pathogen-associated molecular patterns
 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300 295

Fig. 3. Cytokine gene expression in the gills of Atlantic salmon. Fish were intraperitoneally injected with LPS, poly I:C or IPNV and the cytokine gene expression was evaluated by
RT-PCR at the indicated time points in gills. The normalized relative expression (NRE) of IFNa1 (A), IL-1b (B), IL-8 (C), and IL-10 (D) is shown. Gene expression in treated sh was
normalized to the corresponding expression levels found in sh of the control group (PBS or vehicle). Mean of NRE % SE is shown. (*) Indicates statistical signicant difference
(P < 0.05) determined by the ManneWhitney test (non-parametric T-test).

(PAMPs) as a comparison. The response was evaluated in spleen,
head kidney and gills, in order to identify potential differences of
the response induced in these immunological organs. All chal-
lenged sh tested positive for VP2 and none of the control sh
expressed this IPNV transcript. Results of the analysis in spleen
showed that IPNV infection induced a 3-fold increase in the
expression of the anti-viral cytokine IFNa1, which was detected
only after 96 h post-challenge (Fig. 1A). Results also revealed that
there is a basal level of expression of IFNa1 in splenocytes that
increased with Poly I:C (4.7-fold increase). LPS did not produce
effects on the cytokine expression level (Fig. 1A). On the other hand,
IPNV did not increase the pro-inammatory cytokine IL-1b in
splenocytes of infected sh (Fig. 1B), although IL-1b levels increased
in all sh assayed after LPS treatment (3.8-fold increase) and Poly
I:C injection (2.8-fold increase) (Fig. 1B). A basal expression of this
cytokine was also observed in the spleen of non-treated sh.
Similar effects were observed with IL-8, which is an important
chemokine actively expressed during an early infection. Infection
only slightly increased IL-8 transcript levels after 48 h, but did not
reach statistical signicance (Fig. 1C), while LPS and Poly I:C
induces IL-8 expression in splenocytes after treatment (4 and 2.6-
fold increases, respectively) (Fig. 1C). Interestingly, infection with
IPNV induces the expression of IL-10, which is a regulatory and
anti-inammatory cytokine. The increase reached 2-fold after 96 h
post-challenge (Fig. 1D). In this case, the mRNA of the cytokine was
barely detected in sh without treatment and LPS induced an
increase of expression (Fig. 1D). In summary, experiments showed
that IPNV infection of salmon induces an increase of the IFNa1 and
IL-10 mRNA levels in splenocytes that is observable after 96 h
infection. Moreover, levels of the pro-inammatory cytokines IL-1b
and IL-8 did not rise as expected during infection.
Cytokine gene expression was also evaluated in head kidney of
the same experimental groups. As in spleen, IPNV induced an
increase of IFNa1 (4.2-fold) in head kidney of infected salmon that
was observed after 96 h infection (Fig. 2A). As expected, Poly I:C
also induced the anti-viral cytokine (4.8-fold) in head kidney. In
addition, infection induces IL-10, which is detected at all time
points analyzed (Fig. 2D), reaching a 10.5-fold increase at 96 h post-
infection. In regard to pro-inammatory cytokines, expression of
IL-1b is induced in head kidney at all time points tested (Fig. 2B);
however no signicant changes were observed in IL-8 during early
viral infection (Fig. 2C). Therefore, cytokine response to IPNV
infection is similar in head kidney and spleen of salmon, i.e.,
induced the expression of IFNa1 and IL-10, except for IL-1b, that is
also produced in response to infection in head kidney.
In gills, which seem to be mucosal lymphoid organs,
IPNV infection did not cause increase in the expression of any of
the cytokines tested, except there is a tendency for increased
296 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300
Fig. 4. Cytokine gene expression in carrier asymptomatic sh. Normalized relative
expression (NRE) of IFNa1, IL-1b, IL-8, and IL-10 in (A) spleen, (B) head kidney, and (C)
gills of Atlantic salmon is shown. Fish were classied according to the presence (,
n 8) or absence (#, n 7) of viral protein 2 (VP2) of IPNV. The change in the relative
gene expression assayed by PCR in VP2 () sh is normalized with respect to those
obtained from VP2 (#) sh whose value was 1. The results are shown as mean of
NRE % SE. (*) Indicates that mean values of the VP2 () group are signicantly different
from the VP2 (#) group (P < 0.05). Statistical differences were determined by the
ManneWhitney test (non-parametric T-test) between the two groups analyzed.
expression of IL-10 (Fig. 3). Moreover, LPS did not induce cytokine
expression while Poly I:C induced increased levels of IFNa1 (3.1-
fold) and IL-10 (2.4-fold) (Fig. 3D).
3.2. Cytokine gene expression in natural infected salmon
We also analyzed the cytokine gene expression in asymptomatic
carrier salmon. Fish were classied as VP2 () or VP2 (#) according
to PCR detection of the major capsid viral protein (VP2) of IPNV. We
studied 7 sh VP2 (#) and 8 sh VP2 () and cytokine gene
expression from VP2 () sh was normalized to the cytokine levels
of VP2 (#) sh whose expression value was 1. We found a 10-fold
increase of IFNa1 in spleen of VP2 () sh that was statistically
signicant (p 0.0003) (Fig. 4A) and a 3-fold increase of IL-10 in
head kidney (p 0.002) (Fig. 4B). Interestingly, a decrease of IL-8
expression was also observed in head kidney of VP2 () sh
(p 0.043) (Fig. 4B). No differences in cytokine expression in gills
were observed between VP2 () and VP2 (#) sh, although a high
expression of cytokines was present in both cases (Fig. 4C).
3.3. The in vitro effects of IPNV on cytokine gene expression of SHK-
1 cells
The prole of cytokine gene expression produced in response to
IPNV infection was also examined in SHK-1, which is a cell line
derived from leucocytes of salmon head kidney that have proper-
ties of a macrophage. Cells were infected with IPNV at a multiplicity
of infection of 0.1 PFU/mL and samples were taken for analysis after
0.5, 1, 2, 3, 4, 6 and 8 h post-infection. We determined that IPNV did
not induce the expression of IFNa1 (Fig. 5A), nor did the addition of
LPS to the cells (Fig. 5B). However, transfection of cells with poly I:C
induced anti-viral cytokine expression after 4 h post-treatment and
increased up to 9-fold 8 h after treatment (Fig. 5C). In order to
establish whether the viral effect on cytokine expression depends
on the viral particle, we also tested the effects of the genomic
dsRNA of IPNV (gIPNV). Results showed that the transfected dsRNA
induces a 9-fold increase of IFNa1 expression 4 h after treatment,
which diminished after 8 h in a very similar manner to the effect of
poly I:C (Fig. 5D). The case of IL-1b is different, which was expressed
in high basal levels, but none of the treatments induced increased
expression (Fig. 6) except for the almost 4-fold increase observed
with the gIPNV treatment (Fig. 6D). IPNV did not induce IL-8
expression in SHK-1 (Fig. 7A), although cells responded to LPS
and poly I:C (Fig. 7B and C). Transfected gIPNV also induced a 3-fold
increase of IL-8 (Fig. 7D). Finally, the virus was able to induce IL-10,
whose increase was statistically signicant 4 h after infection and
reached 4-fold increase 6 h after infection (Fig. 8A). LPS, poly I:C and
gIPNV did not produce any effect on the cells (Fig. 8BeD). In
conclusion, IPNV infection of the macrophage cell line of salmon
only induced an increase of expression of the anti-inammatory
cytokine IL-10, which seems to be a property of the viral particle
or the infection, because the genomic dsRNA showed the opposite
effects.
4. Discussion
In this work we have evaluated gene expression of the cytokines
IL-1b and IL-8, IL-10 and IFNa1 in spleen, head kidney and gills
during the rst hours of an IPNV experimental infection of Atlantic
salmon and in asymptomatic carrier salmon surviving a natural
IPNV infection.
In regard to the pro-inammatory cytokines, we found that IL-
1b and IL-8 transcripts were constitutively expressed in spleen,
head kidney and gills of all sh without treatment, which is in
agreement with previous studies [34] and might be due to normal
encounters of sh with environmental microorganisms. In addi-
tion, we found that i.p. viral infection did not induce up-regulation
of IL-1b and IL-8 in the spleen, head kidney and the gills after
infection except for IL-1b, which increased in head kidney. Differ-
ences observed between kidney and spleen for IL-1b may be due to
the fact that these lymphoid organs have different type of cells also
associated to differential functions. Indeed, in spleen major cell
types correspond to T and B lymphocytes, whereas in head kidney,
there are a remarkable number of macrophages able to produce
 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300 297

Fig. 5. IFNa1 expression analysis in SHK-1 cells. Normalized relative expression (NRE) of IFNa1 in SHK-1 cells treated with IPNV (A), LPS (B), poly I:C (C), and gIPNV (D) for the
indicated time points are shown. The relative gene expression assayed by PCR in treated cells was normalized with respect to the relative expression in non-stimulated cells. The
results are shown as the mean of NRE % SE. (*) Indicates that values are signicantly different from those of the control cells. Statistical differences were obtained by Kruskal Wallis
and Dunns multiple comparison tests.

large amounts of IL-1b [35]. Production of pro-inammatory cyto-
kines has been studied previously in Atlantic salmon infected with
IPNV. Similarly, authors have reported that no increase of expres-
sion for IL-1b and TNFa (which was not analyzed here) was
detected in any tissues with respect to controls [19,26] or at most,
IL-1b was slightly up-regulated after 24 days after infection [36].
The absence of up-regulation of pro-inammatory cytokines at
early stages of IPNV immune stimulation was not due to the
inability of the sh to respond because treatment with LPS or Poly
I:C increased IL-1b and IL-8 cytokine levels 24 h post-injection. IL-
1b is an essential inammatory cytokine, which together with
chemokines like IL-8, induces endothelial activation for the
recruitment of immunocompetent cells from the circulation in the
infected or injured tissues [37]. Recent evidence has revealed the

Fig. 6. IL-1b expression analysis in SHK-1 cells. Normalized relative expression (NRE) of IL-1b in SHK-1 cells treated with IPNV (A), LPS (B), poly I:C (C), and gIPNV (D) for the
indicated time points are shown. The relative gene expression assayed by PCR in treated cells was normalized with respect to the relative expression in non-stimulated cells. The
results are shown as the mean of NRE % SE. (*) Indicates that values are signicantly different from those of the control cells. Statistical differences were obtained by Kruskal Wallis
and Dunns multiple comparison tests.
298 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300

Fig. 7. IL-8 expression analysis in SHK-1 cells. Normalized relative expression (NRE) of IL-8 in SHK-1 cells treated with IPNV (A), LPS (B), poly I:C (C), and gIPNV (D) for the indicated
time points are shown. The relative gene expression assayed by PCR in treated cells was normalized with respect to the relative expression in non-stimulated cells. The results are
shown as the mean of NRE % SE. (*) Indicates that values are signicantly different from those of the control cells. Statistical differences were obtained by Kruskal Wallis and Dunns
multiple comparison tests.

importance of IL-1b (and IL-18) in anti-viral defenses that are
supported by the enhanced susceptibility of mice lacking the
cytokine receptors to virus infection [38]. Therefore, during salmon
IPNV infection, lack of induction of IL-1b and IL-8 expression in the
immune organs may actually weaken anti-viral activity and impair
resolution of the infection.
Expression of the pro-inammatory cytokines was also assayed
in the lymphoid organs of a group of carrier sh that were collected
from a natural viral outbreak. All sh seemed healthy because they
did not exhibit any clinical signs of disease [1,2] but more than 50%
of the sh contained the mRNA of the major capsid viral protein of
IPNV (VP2), which is consistent with an asymptomatic IPNV carrier

Fig. 8. IL-10 expression analysis in SHK-1 cells. Normalized relative expression (NRE) of IL-10 in SHK-1 cells treated with IPNV (A), LPS (B), poly I:C (C), and gIPNV (D) for the
indicated time points are shown. The relative gene expression assayed by PCR in treated cells was normalized with respect to the relative expression in non-stimulated cells. The
results are shown as the mean of NRE % SE. (*) Indicates that values are signicantly different from those of the control cells. Statistical differences were obtained by Kruskal Wallis
and Dunns multiple comparison tests.
 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300
stage [6]. Similar to the sh with acute infection, expression of the
IL-1b gene tested in spleen, head kidney and gills was not higher in
carrier sh than in those of virus-free sh. Moreover, IL-8 mRNA
levels appeared to be lower in carrier sh. Thus, the results indicate
that the lack of induction of IL-1b and IL-8 is a common feature of
acute and chronic IPNV infection of salmon.
We also tested expression of IL-10, which in mammals has been
described as a potent anti-inammatory cytokine that, among
other functions, modulates the expression of other cytokines
[24,39,40]. The IL-10 homologue gene has been cloned and char-
acterized in several teleost sh species, including Fugu [41], carp
[42], zebrash [43], rainbow trout [44], sea bass [45,46], cod [16]
and goldsh [47]. In the experimental IPNV infection of salmon,
an increase of IL-10 transcripts in spleen and head kidney was
observed 96 h post-infection in all sh tested. Moreover, the group
of IPNV carrier sh presented a high level of IL-10 induction, which
distinguished this group from the non-infected sh. Our results are
in agreement with the role of IL-10 during infections, including
regulation and inhibition of pro-inammatory cytokine expression,
which contributes to the resolution of infections and reduction of
the tissue damage caused by these cytokines [40,48]. Moreover, the
increased expression of IL-10 in IPNV-infected salmon, accompa-
nied by the notable absence of induction of IL-1b and IL-8, indicates
that the virus triggers a clear anti-inammatory response that may
be part of the mechanisms to establish persistence [49]. In fact, it is
well known that several animal viruses exploit the IL-10 immu-
nosuppressive functions to establish chronic or persistent infec-
tions [25]. Interestingly, there is only one previous work where an
attempt was made to detect the IL-10 in salmonids challenged with
IPNV. The results showed an induction of the expression of this
anti-inammatory cytokine in S. salar smolt, but this up-regulation
was detected only after 24 days post-challenge and was not related
with the establishment of viral infection [36].
Infection by viruses also triggers the IFN type I cytokines that are
in the rst line of defense and control downstream anti-viral
immune mechanisms [50,51]. IFN response in sh has also been
described as an anti-viral mechanism [52e55]. Accordingly, results
of this work also showed that during the rst hours of IPNV
experimental infection of salmon, mRNA expression of IFNa was
up-regulated in spleen and head kidney. In addition, high levels of
IFNa1 expression were found in head kidney of carrier sh. Results
are in agreement with previous reports [19,26,36], suggesting that
although an anti-viral response is produced, this is not sufcient to
eliminate the virus. In fact, the interferon response is not associated
with the age-dependant resistance observed in IPNV-infected sh
[27,56], although induction of IFNa1 and Mx by injection of poly I:C
or CpG DNA prior to bath infection with IPNV is partially protective
in post-smolt Atlantic salmon [29].
The development of an effective immune response involves
lymphoid and myeloid cells and complex interactions among them
that are regulated by a wide network of cytokines [57]. To distin-
guish the effects of IPNV infection on immune-competent cells, we
also analyzed cytokine expression after IPNV infection in SHK-1,
which is a cell line derived from a macrophage-enriched cell
culture of S. salar. This cell line has been widely used in different
studies to evaluate immune response mechanisms and
hostepathogen interactions at both transcriptional and trans-
lational levels [58e62]. Expression of pro and anti-inammatory
cytokines after IPNV infection of SHK-1 showed a prole similar
to that observed in intraperitoneally challenged sh during early
stage of infection and to that observed in carrier sh, i.e., IPNV
induced up-regulation of IL-10 expression but does not induce IL-
1b, IL-8 and IFNa1 expression. An important conclusion derived
from these in vitro studies is that the ability to up-regulate IL-10
expression, appears to be a property of the viral particle or the
299
infection, because LPS, poly I:C and even the viral genomic dsRNA
show the opposite effects as they induce IL-1b, IL-8 or IFNa1 but nor
IL-10 in SHK-1. Further research is required to more fully under-
stand IPNV immune evasion mechanisms and the role of IL-10.
Overall, low levels of induction of pro-inammatory cytokine
(IL-1b and IL-8), accompanied by induction of an ineffective IFN
response and up-regulation of the anti-inammatory cytokine IL-
10, compose a highly anti-inammatory milieu during the
immune response of Atlantic salmon to IPNV infection. This type of
response may be the result of the immune evasion mechanism of
IPNV, which could explain the high frequency, prevalence and
persistence of infection observed in cultured sh [63]. IL-10, which
is always induced during viral infection, seems to play a central role
in the establishment of persistence, as it does for other viruses
infecting mammals.
Acknowledgements
The author thanks Teresa Castillo and Teresa Alvarez for tech-
nical support. This work was nancially supported by INNOVA-
CHILE 07CN13-PBT90, INNOVA-CHILE 09MCSS-6698, CONICYT-
PBCT TPI-07 to FERL, CONICYT-Thesis support AT-24100133 to SRC
and fellowship from CONICYT to SRC and KM.
References
[1] Rodriguez Saint-Jean S, Borrego JJ, Perez-Prieto SI. Infectious pancreatic
necrosis virus: biology, pathogenesis, and diagnostic methods. Adv Virus Res
2003;62:113e65.
[2] Reno P. Infectious pancreatic necrosis and associated aquatic birnaviruses.
Fish Dis Disord 1999;3:1e56.
[3] Johansen LH, Sommer AI. In vitro studies of infectious pancreatic necrosis
virus infections in leucocytes isolated from Atlantic salmon (Salmo salar L.).
Aquaculture 1995;132:91e5.
[4] Bowden T,J. Development of a reproducible infectious pancreatic necrosis
virus challenge model for Atlantic salmon, Salmo salar L. J Fish Dis 2002;25:
555e63.
[5] Yu K-Y, MacDonald R, Moore A. Replication of infectious pancreatic necrosis
virus in trout leucocytes and detection of the carrier state. J Fish Dis 1982;5:
401e10.
[6] Munro ES, Gahlawat SK, Acosta F, Ellis AE. In infectious pancreatic necrosis
virus carrier Atlantic salmon, Salmo salar L., post-smolts, almost all kidney
macrophages ex vivo contain a low level of non-replicating virus. J Fish Dis
2006;29:43e8.
[7] Bootland LM, Dobos P, Stevenson RMW. The IPNV carrier state and demon-
stration of vertical transmission in experimentally infected brook trout. Dis
Aquat Organ 1991;10:13e21.
[8] McAllister PE, Schill WB, Owens WJ, Hodge DL. Determining the prevalence of
infectious pancreatic necrosis virus in asymptomatic brook trout Salvelinus
fontinalis: a study of clinical samples and processing methods. Dis Aquat
Organ 1993;15:157e62.
[9] Knipe DM, Howley PM. In: Knipe DM, Howley PM, Grifn DE, Lamb RA,
Martin MA, Roizman B, Straus SE, editors. Fields virology. Philadelphia: Lip-
pincott Williams & Wilkins; 2001. p. 186e90.
[10] Alcami A, Koszinowski UH. Viral mechanisms of immune evasion. Immunol
Today 2000;21:447e55.
[11] Ploegh HL. Viral strategies of immune evasion. Science 1998;280:248e53.
[12] Martinic MM, von Herrath MG. Novel strategies to eliminate persistent viral
infections. Trends Immunol 2008;29:116e24.
[13] Blackburn SD, Wherry EJ. IL-10, T cell exhaustion and viral persistence. Trends
Microbiol 2007;15:143e6.
[14] MacDonald AJ, Duffy M, Brady MT, McKiernan S, Hall W, Hegarty J, et al. CD4 T
helper type 1 and regulatory T cells induced against the same epitopes on the
core protein in hepatitis C virus-infected persons. J Infect Dis 2002;185:
720e7.
[15] Redpath S, Angulo A, Gascoigne NR, Ghazal P. Murine cytomegalovirus
infection down-regulates MHC class II expression on macrophages by
induction of IL-10. J Immunol 1999;162:6701e7.
[16] Seppola M, Larsen AN, Steiro K, Robertsen B, Jensen I. Characterisation and
expression analysis of the interleukin genes, IL-1beta, IL-8 and IL-10, in
Atlantic cod (Gadus morhua L.). Mol Immunol 2008;45:887e97.
[17] Jensen I, Seppola M, Steiro K, Sandaker E, Mennen S, Sommer AI. Susceptibility
of Atlantic cod Gadus morhua juveniles to different routes of experimental
challenge with infectious pancreatic necrosis virus (IPNV). Dis Aquat Organ
2009;85:105e13.
[18] Tafalla C, Rodrguez Saint-Jean S, Prez-Prieto S. Immunological consequences
of the confection of brown trout (Salmo trutta) with infectious hematopoietic
300 S. Reyes-Cerpa et al. / Fish & Shellsh Immunology 32 (2012) 291e300
necrosis virus (IHNV) and infectious pancreatic necrosis virus (IPNV). Aqua-
culture 2006;256:15e22.
[19] Ellis AE, Cavaco A, Petrie A, Lockhart K, Snow M, Collet B. Histology, immu-
nocytochemistry and qRT-PCR analysis of Atlantic salmon, Salmo salar L., post-
smolts following infection with infectious pancreatic necrosis virus (IPNV).
J Fish Dis 2010;33:803e18.
[20] Patel S, Malde K, Lanzen A, Olsen RH, Nerland AH. Identication of immune
related genes in Atlantic halibut (Hippoglossus hippoglossus L.) following
in vivo antigenic and in vitro mitogenic stimulation. Fish Shellsh Immunol
2009;27:729e38.
[21] Knott RM, Munro AL. The persistence of infectious pancreatic necrosis virus in
Atlantic salmon. Vet Immunol Immunopathol 1986;12:359e64.
[22] Tate H, Kodama H, Izawa H. Immunosuppressive effect of infectious pancre-
atic necrosis virus on rainbow trout (Oncorhynchus mykiss). Nippon Juigaku
Zasshi 1990;52:931e7.
[23] Novoa B, Figueras A, Secombes CJ. Effects of in vitro addition of infectious
pancreatic necrosis virus (IPNV) on rainbow trout Oncorhynchus mykiss leu-
cocyte responses. Vet Immunol Immunopathol 1996;51:365e76.
[24] Moore KW, OGarra A, de Waal Malefyt R, Vieira P, Mosmann TR. Interleukin-
10. Annu Rev Immunol 1993;11:165e90.
[25] Wilson EB, Brooks DG. The role of IL-10 in regulating immunity to persistent
viral infections. Curr Top Microbiol Immunol 2011;350:39e65.
[26] McBeath AJ, Snow M, Secombes CJ, Ellis AE, Collet B. Expression kinetics of
interferon and interferon-induced genes in Atlantic salmon (Salmo salar)
following infection with infectious pancreatic necrosis virus and infectious
salmon anaemia virus. Fish Shellsh Immunol 2007;22:230e41.
[27] Dorson M, De Kinkelin P, Torchy C. Interferon synthesis in rainbow trout fry
following infection with infectious pancreatic necrosis virus. Fish Shellsh
Immunol 1992;2:311e3.
[28] Saint-Jean SR, Perez-Prieto SI. Effects of salmonid sh viruses on Mx gene
expression and resistance to single or dual viral infections. Fish Shellsh
Immunol 2007;23:390e400.
[29] Jorgensen JB, Johansen LH, Steiro K, Johansen A. CpG DNA induces protective
antiviral immune responses in Atlantic salmon (Salmo salar L.). J Virol 2003;
77:11471e9.
[30] Dannevig BH, Brudeseth BE, Gjoen T, Rode M, Wergeland HI. Characterisation
of a long-term cell line (SHK-1) developed from the head kidney of Atlantic
salmon (Salmo salar L.). Fish Shellsh Immunol 1997;7:213e26.
[31] Dobos P. The molecular biology of infectious pancreatic necrosis virus (IPNV).
Annu Rev Fish Dis 1995;5:25e54.
[32] Ribas L, Roher N, Martinez M, Balasch JC, Donate C, Goetz FW, et al. Charac-
terization and expression of the transcription factor PU.1 during LPS-induced
inammation in the rainbow trout (Oncorhynchus mykiss). Fish Shellsh
Immunol 2008;24:35e45.
[33] Das BK, Ellis AE, Collet B. Induction and persistence of Mx protein in tissues,
blood and plasma of Atlantic salmon parr, Salmo salar, injected with poly I: C.
Fish Shellsh Immunol 2009;26:40e8.
[34] Tafalla C, Coll J, Secombes CJ. Expression of genes related to the early immune
response in rainbow trout (Oncorhynchus mykiss) after viral haemorrhagic
septicemia virus (VHSV) infection. Dev Comp Immunol 2005;29:615e26.
[35] Congleton JL, Greenlee AR, Ristow SS. Isolation of leukocytes from the Anterior
kidney and spleen of rainbow-trout in a self-generating density gradient.
J Fish Biol 1990;36:575e85.
[36] Ingerslev HC, Ronneseth A, Pettersen EF, Wergeland HI. Differential expres-
sion of immune genes in Atlantic salmon (Salmo salar L.) challenged intra-
peritoneally or by cohabitation with IPNV. Scand J Immunol 2009;69:90e8.
[37] Paul WE. Fundamental immunology, chapter 3: evolution of the immune
system. Philadelphia, PA, USA: Lippincott Williams & Wilkins; 2008.
[38] Rathinam VA, Fitzgerald KA. Inammasomes and anti-viral immunity. J Clin
Immunol 2010;30:632e7.
[39] Moore KW, de Waal Malefyt R, Coffman RL, OGarra A. Interleukin-10 and the
interleukin-10 receptor. Annu Rev Immunol 2001;19:683e765.
[40] Ouyang W, Rutz S, Crellin NK, Valdez PA, Hymowitz SG. Regulation and
functions of the IL-10 family of cytokines in inammation and disease. Annu
Rev Immunol 2011;29:71e109.
[41] Zou J, Clark MS, Secombes CJ. Characterisation, expression and promoter
analysis of an interleukin 10 homologue in the puffer sh, Fugu rubripes.
Immunogenetics 2003;55:325e35.
[42] Savan R, Igawa D, Sakai M. Cloning, characterization and expression analysis
of interleukin-10 from the common carp, Cyprinus carpio L. Eur J Biochem
2003;270:4647e54.
[43] Zhang DC, Shao YQ, Huang YQ, Jiang SG. Cloning, characterization and
expression analysis of interleukin-10 from the zebrash (Danio rerion).
J Biochem Mol Biol 2005;38:571e6.
[44] Inoue Y, Kamota S, Ito K, Yoshiura Y, Ototake M, Moritomo T, et al. Molecular
cloning and expression analysis of rainbow trout (Oncorhynchus mykiss)
interleukin-10 cDNAs. Fish Shellsh Immunol 2005;18:335e44.
[45] Buonocore F, Randelli E, Bird S, Secombes CJ, Facchiano A, Costantini S, et al.
Interleukin-10 expression by real-time PCR and homology modelling analysis
in the European sea bass (Dicentrarchus labrax L.). Aquaculture 2007;270:
512e22.
[46] Pinto RD, Nascimento DS, Reis MI, do Vale A, Dos Santos NM. Molecular
characterization, 3D modelling and expression analysis of sea bass (Dicen-
trarchus labrax L.) interleukin-10. Mol Immunol 2007;44:2056e65.
[47] Grayfer L, Hodgkinson JW, Hitchen SJ, Belosevic M. Characterization and
functional analysis of goldsh (Carassius auratus L.) interleukin-10. Mol
Immunol 2011;48:563e71.
[48] Mege JL, Meghari S, Honstettre A, Capo C, Raoult D. The two faces of inter-
leukin 10 in human infectious diseases. Lancet Infect Dis 2006;6:557e69.
[49] Smail DA, Munro ALS. The virology of teleosts. In: Roberts RJ, editor. Fish
pathology. 3rd ed.; 2001. p. 169e253.
[50] Sen GC. Viruses and interferons. Annu Rev Microbiol 2001;55:255e81.
[51] Stark GR, Kerr IM, Williams BR, Silverman RH, Schreiber RD. How cells
respond to interferons. Annu Rev Biochem 1998;67:227e64.
[52] Robertsen B, Bergan V, Rokenes T, Larsen R, Albuquerque A. Atlantic salmon
interferon genes: cloning, sequence analysis, expression, and biological
activity. J Interferon Cytokine Res 2003;23:601e12.
[53] Robertsen B. The interferon system of teleost sh. Fish Shellsh Immunol
2006;20:172e91.
[54] Rokenes TP, Larsen R, Robertsen B. Atlantic salmon ISG15: expression and
conjugation to cellular proteins in response to interferon, double-stranded
RNA and virus infections. Mol Immunol 2007;44:950e9.
[55] Robertsen B. Expression of interferon and interferon-induced genes in
salmonids in response to virus infection, interferon-inducing compounds and
vaccination. Fish Shellsh Immunol 2008;25:351e7.
[56] Lockhart K, McBeath AJ, Collet B, Snow M, Ellis AE. Expression of Mx mRNA
following infection with IPNV is greater in IPN-susceptible Atlantic salmon
post-smolts than in IPN-resistant Atlantic salmon parr. Fish Shellsh Immunol
2007;22:151e6.
[57] Kindt TJ, Goldsby RA, Osborne BA. Kuby immunology, chapter 12: cytokines.
New York, NY: USA: W.H. Freeman & Company; 2007.
[58] Jensen I, Robertsen B. Effect of double-stranded RNA and interferon on the
antiviral activity of Atlantic salmon cells against infectious salmon anemia
virus and infectious pancreatic necrosis virus. Fish Shellsh Immunol 2002;
13:221e41.
[59] Fast MD, Johnson SC, Eddy TD, Pinto D, Ross NW. Lepeophtheirus salmonis
secretory/excretory products and their effects on Atlantic salmon immune
gene regulation. Parasite Immunol 2007;29:179e89.
[60] Martin SA, Mohanty BP, Cash P, Houlihan DF, Secombes CJ. Proteome analysis
of the Atlantic salmon (Salmo salar) cell line SHK-1 following recombinant
IFN-gamma stimulation. Proteomics 2007;7:2275e86.
[61] Bjornsdottir B, Fast MD, Sperker SA, Brown LL, Gudmundsdottir BK. Effects of
Moritella viscosa antigens on pro-inammatory gene expression in an Atlantic
salmon (Salmo salar Linnaeus) cell line (SHK-1). Fish Shellsh Immunol 2009;
26:858e63.
[62] Gahlawat SK, Ellis AE, Collet B. Expression of interferon and interferoneinduced
genes in Atlantic salmon Salmo salar cell lines SHK-1 and TO following infection
with Salmon AlphaVirus SAV. Fish Shellsh Immunol 2009;26:672e5.
[63] Murray AG. Persistence of infectious pancreatic necrosis virus (IPNV) in
Scottish salmon (Salmo salar L.) farms. Prev Vet Med 2006;76:97e108.