Você está na página 1de 25

1.

UPE 2014

H 60 anos, Watson e Crick publicaram um artigo sobre a estrutura do cido desoxirribonucleico (DNA).

Leia, a seguir, trechos traduzidos e adaptados da publicao original.

(Fonte: Watson, J. D. e Crick, FHC - 1953. Molecular Structure of Nucleia Acid. Nature v. 171, n. 4356, p.737-738).

Uma estrutura para o cido nucleico foi proposta anteriormente por Pauling e Corey (1953), na qual o modelo consiste de trs
cadeias entrelaadas com os fosfatos prximos do eixo do filamento e as bases localizadas na parte externa....Fraser tambm
apresenta um modelo de estrutura com trs cadeias. Nesse modelo, os fosfatos esto na parte externa, e as bases, na interna,
unidas por ligaes de hidrognio (...)
Propomos uma estrutura radicalmente diferente para o sal de cido desoxirribonucleico. Essa estrutura tem duas cadeias
helicoidais, cada uma delas enrolada em torno do mesmo eixo (...)
Foi observado experimentalmente, por Chargaff e Wyatt (1952), que a razo entre as quantidades de adenina e timina e a
razo entre guanina e citosina so sempre muito prximas da unidade para o DNA (...)
Os dados de raios-X sobre o DNA, publicados por Atsbury (1974), Wilkins e Randal (1953), so insuficientes, mas compatveis
com os dados experimentais de helicoidizao da molcula (...)
No escapou nossa observao que o emparelhamento especfico que postulamos sugere imediatamente um possvel
mecanismo de cpia para o material gentico. (...)

Sobre a estrutura do DNA e com base no texto, assinale a alternativa CORRETA.

a. A exemplo do modelo de Pauling e Corey, o modelo de Watson e Crick tambm apresenta fosfatos prximos do eixo do
filamento e as bases localizadas na parte externa.

b. No modelo de Fraser, as bases esto ligadas por hidrognio, enquanto no de Watson e Crick, isso feito por meio de
pontes de sulfeto.

c. Utilizando a informao de Chargaff e Wyatt, Watson e Crick concluram: a sequncia de bases em uma nica cadeia sofre
restries, ou seja, uma cadeia ser rica em purinas, e a complementar, rica em pirimidinas.

d. 0 emparelhamento especfico dos nucleotdeos foi a grande novidade na proposta de Watson e Crick, os quais se utilizaram
dos dados de Atsbury, Wilkins e Randal para elaborar essa informao.

e. Quando pares especficos de bases so formados, a sequncia de bases de uma cadeia determina a sequncia da cadeia
complementar, servindo de molde para a cpia do material gentico.

Pgina 1
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
2. UERJ 2013

A mutao no DNA de uma clula eucariota acarretou a substituio, no RNA mensageiro de uma protena, da 15 base
nitrogenada por uma base C.
A disposio de bases da poro inicial do RNA mensageiro da clula, antes de sua mutao, apresentada a seguir:

Observe os cdons correspondentes a alguns aminocidos:

Sabe-se que o cdon de iniciao de leitura AUG.


A probabilidade de que a protena a ser traduzida pelo RNA mensageiro da clula que sofreu mutao no apresente
alteraes na disposio de seus aminocidos de:

a. 0

b. 0,25

c. 0,50

d. 1,00

Pgina 2
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
3. UFG 2013

Os nucleotdeos so constitudos por uma molcula de desoxirribose (D), uma molcula de cido fosfrico (P) e uma base
nitrogenada (adenina, guanina, timina ou citosina). A ligao entre os nucleotdeos ocorre pela interao entre as bases
nitrogenadas especficas, resultando em uma molcula ordenada e bem definida, o DNA. De acordo com essas informaes, a
estrutura plana que representa um fragmento de DNA e o tipo de ligao qumica responsvel pela interao entre as bases
nitrogenadas so, respectivamente,

a.

b.

c.

d.

Pgina 3
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
e.

4. UFRGS 2013

Sabe-se que a replicao do DNA semiconservativa. Com base nesse mecanismo de replicao, assinale com V
(verdadeiro) ou F (falso) as afirmaes abaixo.

( ) O DNA original atua como molde, e cada novo DNA possui uma fita antiga e outra nova.
( ) Os quatro ribonucleosdeos trifosfatados, dATP, dGTP, dCTP e dUTP, devem estar presentes.
( ) O DNA deve ser desnaturado (desenrolado) para tornar-se acessvel ao pareamento das novas bases.
( ) A enzima DNA polimerase adiciona nucleotdeos novos de acordo com o molde de DNA.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,

a. V - V - F - F.

b. F - V - V - V.

c. V - F - V - V.

d. F - V - F - F.

e. F - F - F - V.

5. ULBRA 2012

Com relao ao DNA e ao RNA, correto afirmar o seguinte:

a. Ambos so dupla fita em todos os seres vivos.

b. Ambos so constitudos de ribonucleotdeos.

c. Ambos so polmeros de nucleotdeos.

d. Ambos contm a base U, uracila.

e. Ambos contm a base T, timina.

Pgina 4
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
6. UFRGS 2010

Leia o quadrinho a seguir.

Considere o enunciado a seguir, referente ao significado da resposta de Mafalda, e as trs propostas para complet-Io.

A expresso direo 5' 3' refere-se

1 - ligao entre fosfato e acar no processo de replicao do DNA.


2 - atividade da enzima RNA polimerase no processo de transcrio do RNA.
3 - unio entre os aminocidos no processo de traduo das protenas.

Quais propostas esto corretas?

a. Apenas 1.

b. Apenas 2.

c. Apenas 3.

d. Apenas 1 e 2.

e. 1, 2 e 3.

Pgina 5
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
7. UFSM 2010

Milhares de anos aps o ltimo mamute lanoso caminhar sobre a tundra, os cientistas conseguiram sequenciar 50% do
genoma desse animal extinto, recuperando boa parte do seu material gentico.

Sobre o DNA, possvel afirmar

I - Na molcula do DNA, so encontradas as quatro bases nitrogenadas: adenina, guanina, citosina e timina.
II - A ligao entre as bases complementares da dupla fita do DNA feita atravs de pontes de hidrognio.
III - Se, no filamento de DNA. houver a sequncia TTTCCATGT, haver, no seu filamento complementar, a sequncia
AAAGGUACA.

Est(o) correta(s)

a. apenas I.

b. apenas I e II.

c. apenas II.

d. apenas I e III.

e. apenas II e III.

Pgina 6
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
8. UFSM 2005

Analise as afirmativas:

I. As protenas e os cidos nucleicos so formados por aminocidos.


II. DNA e RNA so os cidos nucleicos encontrados tanto em clulas eucariontes como procariontes.
III. A informao contida no DNA pode ser copiada em uma fita de RNA, atravs do processo denominado transcrio.
IV. A informao presente no RNA pode ser transformada em uma sequncia de aminocidos, atravs do processo
denominado traduo.

Est(o) correta(s)

a. apenas I.

b. apenas I e II.

c. apenas II e III.

d. apenas I, III e IV.

e. apenas II, III e IV.

9. PUC-RS 2005

A sequncia de nucleotdeos ATGCACCT forma um segmento de DNA dupla hlice ao se ligar fita complementar

a. AUGCACCU.

b. UACGUGGA.

c. TACGTGGA.

d. TCCACGTA.

e. ATGCACCT.

Pgina 7
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
10. UCS 2012

O DNA desempenha suas funes por meio do RNA mensageiro (RNAm). A maioria das molculas de RNA, por sua
vez, orienta a produo de protenas.
Considere as seguintes afirmaes em relao aos processos de expresso gnica.

I. Nos procariotos, a transcrio gnica d origem a um pr-RNAm, que posteriormente passa pelo processo de splicing para
gerar o RNAm.
II. Nos eucariotos e procariotos, uma molcula de RNAm passa pela traduo, para dar origem a um peptdeo.
III. Nos eucariotos, o ribossomo pode acoplar-se ao retculo endoplasmtico, durante o processo de traduo.

Das afirmaes acima,

a. apenas I est correta.

b. apenas II est correta.

c. apenas III est correta.

d. apenas I e III esto corretas.

e. apenas II e III esto corretas.

11. PUC-SP 1995

Na aula de Biologia, o professor fez a seguinte afirmao: "A produo de ribossomos depende, indiretamente, da atividade
dos cromossomos".

Em seguida pediu a seus alunos que analisassem a afirmao e a explicassem. Foram obtidas cinco explicaes diferentes,
que se encontram a seguir citadas. Assinale a nica afirmao correta:

a. os cromossomos so constitudos essencialmente por RNA ribossmico e protenas, material utilizado na produo de
ribossomos.

b. os cromossomos so constitudos essencialmente por RNA mensageiro e protenas, material utilizado na produo de
ribossomos.

c. os cromossomos contm DNA; este controla a sntese de ribonucleoprotenas que formaro o nuclolo e que,
posteriormente, faro parte dos ribossomos.

d. os cromossomos so constitudos essencialmente por RNA transportador e protenas, material utilizado na produo de
ribossomos.

e. os cromossomos, produzidos a partir do nuclolo, fornecem material para a organizao dos ribossomos.

Pgina 8
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
12. UFSJ 2012

Em um experimento laboratorial, fez-se a anlise da composio de nucleotdeos do cido nucleico que constitui o material
gentico de quatro organismos hipotticos. Os resultados da anlise esto descritos na tabela abaixo.

Com base nesses resultados, CORRETO afirmar que

a. os organismos A, B e D possuem DNA e RNA.

b. o DNA dos organismos A e D possui duas cadeias polinucleotdicas complementares (dupla hlice).

c. o DNA do organismo C possui uma cadeia polinucleotdica simples.

d. os cidos nucleicos dos organismos B e C so de cadeias polinucleotdicas simples.

Pgina 9
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
13. UFRGS 2012

O quadro abaixo representa o cdigo gentico universal.

A molcula de RNA mensageiro com a sequncia CGAAUGACAAAAGGAUAACGU produz o segmento de protena

a. Met Tre Lis Gli Arg.

b. Tre Arg Met.

c. Arg Met Tre Lis Gli.

d. Met Tre Lis Gli.

e. Leu Arg Met Tre Lis Gli.

Pgina 10
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
14. UEG 2012

Em 1962, Watson e Francis Crick receberam o Prmio Nobel em Fisiologia e em Medicina por terem descoberto o modelo
acurado da estrutura do DNA. Acerca da molcula do DNA e suas caractersticas, correto afirmar:

a. a cadeia de nucleotdeos na constituio do DNA mantida unida por ligaes de nitrognio e fosfato que se formam entre
as bases nitrogenadas.

b. a extremidade da cadeia de DNA, que contm fosfato, chamada 3, e a que contm acar chamada 5.

c. o DNA um polmero de duas cadeias de desoxirribonucleotdeos unidos por ligaes fosfodister.

d. o DNA possui uma fita simples polinucleotdica paralela em torno de um eixo comum, formando uma hlice.

15. PUC-RS 2013

Se compararmos as sequncias de DNA de duas pessoas, veremos que so idnticas

a. apenas nos cromossomos autossmicos.

b. apenas no cromossomo mitocondrial.

c. no cromossomo X, se forem de duas mulheres.

d. no cromossomo Y, se forem de dois homens.

e. em tudo, se forem de gmeos monozigticos.

Pgina 11
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
16. UCS 2015

O invento do microscpio possibilitou o grande avano da cincia, principalmente a citogentica. Segundo a charge abaixo,
pode-se inferir, atravs de anlises citogenticas, a procedncia das clulas.

Assinale a alternativa que est de acordo com a anlise feita pelo cientista na charge acima.

a. possvel confirmar a procedncia de qualquer clula independente de sua origem.

b. Como todas as clulas provm de uma diviso meitica, sua carga gentica idntica do progenitor.

c. A espermatognia, na gametognese masculina, a clula final do processo responsvel pela doao da carga gentica.

d. Toda clula contm o material gentico de clulas preexistentes, devido ao modelo de duplicao semiconservativa do
DNA.

e. A recombinao gentica das clulas gamticas dos parentais evita a identificao da origem.

17. PUC-RJ 2013

As tetraciclinas constituem uma classe de antibiticos produzidos por bactrias do gnero Streptomyces. Elas atuam
impedindo que o RNA transportador se fixe ao ribossomo nas clulas bacterianas.
Em qual processo biolgico este antibitico atua?

a. Transcrio

b. Sntese Proteica

c. Replicao do DNA

d. Diviso celular

e. Recombinao

Pgina 12
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
18. UERN 2012

Em 1978, o geneticista Walter Gilbert props os termos exon para designar as regies de um gene que codifica uma
sequncia de aminocidos, e intron para designar as regies de um gene no traduzidas, localizadas entre os exons.

A Cincia estima que seja de 30 mil o nmero de genes da espcie humana, no entanto, o nmero de protenas diferentes
esteja estimado entre 100 mil a 120 mil. Isso ocorre devido ao()

a. unio de protenas recm-sintetizadas, formando novos compostos.

b. Splicing, isto , cortes e montagens diferentes do mesmo RNA-mensageiro.

c. genes que, ativos em uma clula, podem estar inativados em outra.

d. diferena da carga gentica nos tipos de clulas diferenciados.

Pgina 13
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
19. UEPB 2012

O esquema seguinte representa duas cadeias de cidos nucleicos.

Assinale a alternativa correta.

a. I corresponde a uma cadeia de DNA e II a uma cadeia de RNA, que podem ser observadas em mitocndria e retculo
endoplsmico rugoso.

b. I e II correspondem a duas molculas de RNA e so encontradas apenas no ncleo das clulas.

c. I e II correspondem a duas cadeias de uma molcula de DNA e podem ser encontradas nas mitocndrias e complexo de
Golgi.

d. I e II correspondem a duas cadeias de uma molcula de DNA e encontram-se dispersas no citoplasma.

e. I corresponde a uma cadeia de DNA e II a uma cadeia de RNA, que podem ser encontradas nas mitocndrias e no retculo
endosplasmtico liso.

20. MACKENZIE 2014

Assinale a alternativa correta a respeito do esquema.

a. A seta 1 indica um processo que ocorre no citoplasma.

b. A seta 2 indica um processo que ocorre durante a prfase.

c. Nas clulas eucariotas, o processo indicado pela seta 3 ocorre principalmente no retculo endoplasmtico granular.

d. O processo indicado pela seta 2 denominado transcrio.

e. O processo indicado pela seta 3 ser sempre realizado imediatamente aps o processo indicado pela seta 1.

Pgina 14
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
21. UEPA 2014

Informaes sobre nossos ancestrais podem ser desvendadas pela anlise do DNA. Esta ferramenta permite distinguir entre
os brasileiros, as contribuies genmicas relativas s trs razes ancestrais: europeia, africana e amerndia.

Adaptado de http://cienciahoje.uol.com.br/colunas/derivagenetica/genealogia-linhagens-ancestrais-e-dna

Sobre a molcula orgnica referida no texto, afirma-se que:

I. formada por duas cadeias ou fitas de nucleotdeos, uma em torno da outra, formando uma dupla hlice.
II. Ao longo da vida pode ser exposta a diversos fatores externos que podem danificar sua molcula e modificar sua
mensagem gentica inicial.
III. Em interao com o RNA, ribossomos e outros elementos celulares, promove a sntese de protenas.
IV. Nos eucariotos encontrada no ncleo formando os cromossomos.

A alternativa que contm todas as afirmativas corretas :

a. I, II e III.

b. I, II e IV.

c. I, III e IV.

d. II, III e IV.

e. I, II, III e IV.

22. FUVEST 2015

No processo de sntese de certa protena, os RNA transportadores responsveis pela adio dos aminocidos serina,
asparagina e glutamina a um segmento da cadeia polipeptdica tinham os anticdons UCA, UUA e GUC, respectivamente.
No gene que codifica essa protena, a sequncia de bases correspondente a esses aminocidos

a. U C A U U A G U C

b. A G T A A T C A G

c. A G U A A U C A G

d. T C A T T A G T C

e. T G T T T T C T G

Pgina 15
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
23. UDESC 2015

A figura representa, esquematicamente, um nucleotdeo. Esta molcula de extrema importncia para todos os seres vivos
em razo dos diferentes papis que desempenha no interior das clulas. Um dos papis est relacionado sua capacidade de
formar diferentes polmeros no interior das clulas.

Analise as proposies em relao ao nucleotdeo.

I. Esta estrutura molecular encontrada nas clulas de todos os seres vivos.


II. Existem cinco tipos de bases nitrogenadas que podem se ligar ao acar.
III. O acar, que se une ao fosfato e base nitrogenada, tem em sua estrutura 5 carbonos.
IV. Os nucleotdeos so as unidades que formam os cidos nucleicos.
V. Nucleotdeos se ligam por meio de suas bases nitrogenadas, e tambm estabelecem ligaes entre o acar de um e com o
fosfato do outro.

Assinale a alternativa correta.

a. Somente as afirmativas I, III e V so verdadeiras.

b. Somente as afirmativas I, II e IV so verdadeiras.

c. Somente as afirmativas II, III e IV so verdadeiras.

d. Somente as afirmativas I, II, III e V so verdadeiras.

e. Todas as afirmativas so verdadeiras.

Pgina 16
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
24. IBMEC-RJ 2013

A descoberta do cdigo gentico data do incio da dcada de 1960, quando j se sabia que existia uma relao entre a
sequncia de nucleotdeos presentes nos cidos nucleicos e a sequncia de aminocidos das protenas. Sobre o cdigo
gentico, julgue as afirmativas a seguir:

I. O cdigo gentico considerado universal, pois seu funcionamento idntico para todos os seres vivos.
II. Ele degenerado, pois um mesmo aminocido pode ser codificado por mais de um cdon.
III. Esse cdigo estabelecido por meio da complementaridade entre as bases nitrogenadas e o RNAr (ribossmico).

a. V F F

b. V V V

c. F V V

d. F V F

e. V V F

25. UFG 2013

Observe a sequncia de bases nitrogenadas de um fragmento de DNA apresentado a seguir.

TACAAGGTTCTTTGACTATAATTAGCATTC

A sequncia resultante da transcrio deste fragmento composta de

a. 30% de timina.

b. 40% de timina.

c. 60% de timina.

d. 30% de uracila.

e. 40% de uracila.

26. UECE 2015

Sobre os cidos nucleicos (DNA e RNA) correto afirmar que

a. o RNA formado por segmentos denominados genes, responsveis pela produo de protenas nos seres vivos.

b. o processo de produo de uma molcula de RNA a partir de uma molcula de DNA chamado de traduo.

c. DNA composto por uma desoxirribose e um grupo fosfato, sendo suas quatro bases nitrogenadas: adenina, citosina,
guanina e timina.

d. dentre as bases nitrogenadas, a timina exclusiva do RNA.

Pgina 17
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
27. PUC-RJ 2014

Sobre o processo de replicao do DNA, incorreto afirmar que:

a. Cada molcula de DNA nova composta por um filamento antigo e um filamento recm-sintetizado.

b. No h a necessidade de um primer de RNA para a polimerizao do filamento contnuo.

c. A polimerizao se processa no sentido 53.

d. Mais de um tipo de DNA polimerase participa do processo.

e. Esse processo ocorre bidirecionalmente.

Pgina 18
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
28. UFSM 2013

Ao percorrerem uma trilha ecolgica, os escoteiros encontraram duas plantas que eram fenotipicamente idnticas, porm
tinham aromas distintos, uma exalava citral, outra canela. Com permisso do fiscal, levaram amostras para anlise de DNA. A
seguir, tem-se parte das sequncias obtidas das plantas.

Fonte: AMABIS, J.; MARTHO, G. Biologia - Biologia das Clulas. 3. ed. So Paulo: Moderna, 2010. vol. 1. p. 227. (adaptado)

Com base nessas informaes, determinou-se que as plantas citral e canela so diferentes genotipicamente. Os aminocidos
correspondentes a elas so, respectivamente,

a. leufenglitrpsercisalafen e profenproglifenglifenpro.

b. asnlisprotretreproarglis e glilisgliprolisprolisgli.

c. asnlisprotretreproarglis e profenproglifenglifenpro.

d. leulisglitreserproalalis e prolisproprofenproprogli.

Pgina 19
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
e. leufenglitrpsercisalafen e glilisgliprolisprolisgli.

29. UPE 2013

Nos cidos nucleicos, encontram-se bases nitrogenadas formando pares de relativas especificidades. Ao se analisar o DNA de
uma determinada bactria, encontram-se 38% de bases Citosina (C). Que percentuais de bases Adenina (A), Guanina (G) e
Timina (T) so esperados, respectivamente?

a. 62%, 38%, 62%

b. 24%, 38%, 24%

c. 38%, 12%, 12%

d. 62%, 12%, 12%

e. 12%, 38%, 12%

Pgina 20
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
30. CEFET-MG 2014

Analise o seguinte grfico.

A presena de genomas maiores,mas relativamente com menos genes funcionais, representa uma vantagem adaptativa pelo
fato de reduzir a

a. variabilidade gentica.

b. ocorrncia de transcries.

c. complexidade do material gentico.

d. vulnerabilidade s mutaes deletrias.

e. frequncia dos mecanismos de evoluo.

Pgina 21
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
31.

No mecanismo da transcrio, uma das fitas do DNA (a fita molde) transcrita em RNA mensageiro pela ao de

a. um peptdeo sinalizador iniciador.

b. dois RNAs ribossmicos acoplados.

c. uma enzima denominada RNA polimerase dependente de DNA.

d. uma associao de RNAs ribossmicos com vrios RNAs transportadores

32. FUVEST 2016

No esquema abaixo, est representada uma via metablica; o produto de cada reao qumica, catalisada por uma enzima
especfica, o substrato para a reao seguinte.

Num indivduo que possua alelos mutantes que levem perda de funo do gene

a. A ocorrem falta do substrato 1 e acmulo do substrato 2

b. C no h sntese dos substratos 2 e 3

c. A no h sntese do produto final.

d. A o fornecimento do substrato 2 no pode restabelecer a sntese do produto final.

e. B o fornecimento do substrato 2 pode restabelecer a sntese do produto final.

Pgina 22
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
33. UNIOESTE 2012

Em uma das fitas de DNA de uma espcie de vrus encontram-se 90 Adeninas e 130 Citosinas. Sabendo-se ainda que nesta
fita ocorre um total de 200 bases pricas e 200 bases pirimdicas, assinale a alternativa correta.

a. Na dupla fita de DNA ocorrem 180 Adeninas.

b. Na dupla fita de DNA ocorrem 140 Guaninas.

c. Na fita complementar ocorrem 300 bases pricas e 100 bases pirimdicas.

d. Na fita complementar ocorrem 70 Adeninas e 110 Citosinas.

e. No possvel determinar a composio de bases nitrogenadas da fita complementar.

34. UESPI 2012

Sobre o processo de replicao do DNA nos organismos, correto afirmar o que segue.

a. A enzima DNA polimerase utiliza as fitas do DNA como molde para a replicao e a transcrio, respectivamente.

b. semiconservativa, pois as novas duplas fitas so formadas a partir do DNA me.

c. semelhante em organismos procariotos e eucariotos.

d. mais rpida nos prons que em clulas eucariontes.

e. Ocorre na prfase I do ciclo celular.

35. UERJ 2014

As caractersticas abaixo so referentes aos processos de replicao, transcrio e traduo, que ocorrem em seres vivos.

I. A sntese de protenas tem incio antes mesmo do trmino da transcrio.


II. A grande maioria dos genes contm ntrons, retirados antes da traduo.
III. A sntese de protenas sempre ocorre em ribossomos livres no citoplasma.
IV. O processo de replicao possui uma nica origem.

As caractersticas I, II, III e IV esto associadas, respectivamente, aos organismos indicados em:

a. eucariotos eucariotos procariotos eucariotos

b. eucariotos procariotos eucariotos procariotos

c. procariotos eucariotos procariotos procariotos

d. procariotos procariotos eucariotos procariotos

Pgina 23
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
36. PUC-PR 2016

Entre os diferentes seres vivos existe uma diferena entre a quantidade de pares de bases de DNA por clula. De um modo
geral, existe um incremento de DNA medida que se progride na escala evolutiva. A discrepncia da quantidade de DNA
entre os organismos vivos denominada de paradoxo do valor C. O paradoxo do valor C uma consequncia direta da
comprovao de que a quantidade de DNA nas clulas dos vertebrados est acima do teor mnimo necessrio para armazenar
a informao gentica da espcie. O grfico a seguir mostra a relao de contedo de DNA encontrado em diferentes
organismos.

De acordo com o texto, conclui-se que o paradoxo do valor C diz respeito ao fato de que:

a. a maior parte do genoma de uma clula eucariota no funcional ou apresenta outras funes que no a codificao de
protenas.

b. organismos procariontes apresentam um menor nmero de pares de bases que organismos eucariontes.

c. peixes apresentam um maior nmero de pares de bases que os rpteis.

d. a proporo de pares de bases com atividade de biossntese de protenas, quando o animal se tratar de um mamfero, de
aproximadamente 100%.

e. no decorrer das mudanas evolutivas, na escala filogentica, houve um aumento na quantidade de DNA transcrito.

Pgina 24
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados
37. UERJ 2014

TEXTO PARA A PRXIMA QUESTO:


Leia o texto a seguir para responder (s) seguinte(s) questo(es):

As bases nitrogenadas, quando oxidadas, podem causar emparelhamento errneo durante a replicao do DNA. Por exemplo,
uma guanina oxidada (G*) pode passar a se emparelhar, durante a diviso celular, com timina (T) e no com citosina (C). Esse
erro gera clulas mutadas, com uma adenina (A) onde deveria haver uma guanina (G) normal.

Considere uma clula bacteriana com quatro guaninas oxidadas em um trecho do gene que codifica determinada protena,
conforme mostra a sequncia:

Ao final de certo tempo, essa clula, ao dividir-se, d origem a uma populao de bactrias mutantes.
O nmero mximo de aminocidos diferentes que podero ser substitudos na protena sintetizada por essas bactrias, a partir
da sequncia de DNA apresentada, igual a:

a. 0

b. 1

c. 2

d. 3

GABARITO: 1) e, 2) d, 3) a, 4) c, 5) c, 6) d, 7) b, 8) e, 9) c, 10) e, 11) c, 12) b, 13) d, 14) c, 15) e, 16) d, 17) b, 18) b, 19) a, 20) c, 21) e, 22) d, 23) e, 24) e, 25) d,
26) c, 27) b, 28) a, 29) e, 30) d, 31) c, 32) c, 33) d, 34) c, 35) c, 36) a, 37) c,

Pgina 25
Copyright (c) 2013 - 2016 Stoodi Ensino e Treinamento a Distncia LTDA - EPP - Todos os direitos reservados