Você está na página 1de 7

UNIVERSIDADE DA AMAZNIA

DISCIPLINA GENTICA
PROFESSOR: TARCSIO ANDR AMORIM DE CARVALHO
DUPLICAO, TRANSCRIO E TRADUO GNICA

INFORMAES GERAIS

A gentica molecular procura explicar como a informao hereditria se organiza e se manifesta nos organismos
vivos. Hoje sabemos que os genes so feitos de DNA e que a sua expresso fenotpica ocorre na forma de
molculas de RNA, que so traduzidos em peptdeos. Assim, quando nos referimos ao gene A, B, ou C, normalmente
queremos dizer que esses segmentos codificam um peptdeo A, B ou C que ir exercer alguma funo dentro da
clula ou no organismo. Por outro lado, quando falamos em alelo A, A ou a, isto significa que o gene A capaz de
por meio de seus diferentes alelos codificar um mesmo peptdeo com pequenas diferenas em sua composio de
aminocidos.Essas diferenas podem resultar em alteraes no funcionamento ou na expresso desses peptdeos, o
que pode acabar modificando o fentipo dos indivduos. Sendo assim, esse captulo tem por funo mostrar como a
informao contida na molcula de DNA transformada em ao (o fentipo) dentro e fora das clulas.

DUPLICAO DO DNA

A duplicao dos cromossomos dos eucariotos comea em vrios pontos da molcula de DNA, com a ao de
enzimas helicase e girase separando a dupla fita e levando a formao de vrias "bolhas de replicao", conforme
exemplificado abaixo:

Como pode ser observado, cada bolha tem duas forquilhas de replicao, uma que segue para a esquerda e a outra
para a direita. Sendo assim, determine como a replicao do DNA se d em cada forquilha de replicao, tendo em
vista as diferentes situaes apontadas abaixo:
O por qu da necessidade de primers ou iniciadores para o incio da duplicao do DNA? : as enzimas de
sntese de DNA, chamadas DNA polimerases, no conseguem iniciar produo de uma nova fita dessa molcula
usando apenas o molde monofilamentar de DNA (uma das fitas abertas). Nesse caso, tambm necessrio que,
aderido a esse molde, exista um pequeno segmento de RNA chamado primer ou iniciador - sintetizado por uma RNA
polimerase (ou, nesse caso, por uma primase) - e que oferece uma extremidade 3-OH livre para que a DNA
polimerase continue o processo de duplicao dessa nova fita. Posteriormente, esse primer retirado e substitudo
por DNA:

(A) Abertura da forquilha de replicao, (B) Sntese do primer pela primase e (C) Extenso da sntese de cada fita pela DNA polimerase.

A direo de sntese da nova fita de DNA e o fato das duas fitas moldes correrem em sentido antiparalelo: alm de
necessitar de uma fita molde e de um primer, a DNA polimerase somente consegue sintetizar uma nova molcula de
DNA acrescentando novos nucleotdeos ao carbono 3do acar (o carbono 5 fica localizado na parte oposta a esse
acar). Por isso se diz que a sntese dos cidos nuclicos ocorre no sentido 5 3. Como cada fita da molcula de
DNA corre em sentido inverso, a sua duplicao ocorre em direes opostas. O esquema abaixo mostra o sentido da
duplicao em apenas uma das fitas da molcula de DNA:

Por qu de uma das fitas ser chamada de lagging (lenta) e a outra de leading (rpida)?: pelo fato da molcula
de DNA ser formada por duas fitas que correm em sentido antiparalelo, durante a abertura da forquilha de replicao,
um dos filamentos vai sendo aberto no sentido 5' 3' e o outro no sentido 3' 5'. Assim, embora a progresso da
sntese dessas duas fitas acontea simultaneamente, a medida em que essa forquilha extendida, em uma delas a
DNA polimerase sempre ter uma extremidade 3-OH livre para colocar o prximo nucleotdeo (a fita leading). Na
outra, de tempos em tempos, ser necessria a sntese de um novo primer, para que ela possa continuar esse
processo (a fita lagging), conforme pode ser observado no esquema abaixo

Considerando o modelo de replicao nas bactrias, no modelo acima, a sequncia amarela representa o primer (RNA)
sintetizado pela enzima primase e a sequncia em azul representa a nova fita de DNA produzida pela DNA polimerase III
medida em que a molcula molde de DNA vai sendo aberta. Observe que a direo de sntese da nova molcula de DNA se d no
sentido 5 3. Assim, na fita de cima a duplicao continuar acontecendo de maneira contnua (a fita leading). Por outro lado,
na fita de baixo (a fita lagging), um novo primer dever ser sintetizado mais frente.

Qual o significado da existncia dos fragmentos de Okazaki ?: como vimos, um dos novos filamentos de DNA
sintetizado continuamente pela DNA polimerase III; o outro, precisa ser sintetizado em partes. Fragmentos de
Okazaki so justamente os trechos curtos de primer + DNA (com cerca de 100 a 200 nucleotdeos, nos eucariotos)
produzidos temporariamente na fita de replicao descontnua.

Logo em seguida, os primers so removidos de ambas as fitas pela DNA polimerase I (a seta em vermelho do
esquema abaixo) que, ao mesmo tempo, vai completando a sntese da fita de DNA no trecho liberado. Por fim, os
filamentos adjacentes de DNA so unidos via ligao covalente pelaDNA ligase (o tringulo amarelo que aparece no
esquema abaixo).

TRANSCRIO DO DNA EM RNA

O mecanismo de transcrio do DNA em RNA:

As molculas de cidos nucleicos (DNA e RNA) somente conseguem se parear se estiverem em sentidos opostos.
Esse sentido dado pela posio dos carbonos 5' e 3' da pentose (desoxiribose no DNA e ribose no RNA) presente
nessas molculas, como pode ser observado no esquema apresentado abaixo:

Isso vale para as duas fitas de uma molcula de DNA (por isso se diz que as duas fitas dessa molcula correm em
sentido antiparalelo), para as associaes DNA-RNA, que ocorrem, por exemplo, durante a transcrio, ou RNA-
RNA, que ocorrem, por exemplo, durante a traduo, entre molculas de RNAs mensageiros e RNA transportadores.
Alm disso, a sntese de novas fitas de cidos nucleicos, quer seja DNA ou RNA, somente ocorrem no sentido 5
3. Portanto, a fita que lhe serve de molde deve correr em sentido oposto (3 5). Assim, se formos considerar o
processo de duplicao do trecho de DNA abaixo, este se dar da seguinte forma:

A figura abaixo mostra um mesmo trecho de DNA, s que em cada uma das situaes o stio de incio e de trmino
da transcrio se encontram em posies distintas:

O que significam os termos promotor e finalizador desse esquema? Quais seriam as funes dessas
sequncias que esto presentes nas molculas de DNA? O stio promotor a regio da molcula de DNA que
informa o local em que um determinado gene se origina. O stio promotor composto por sequncias especficas de
nucleotdeos que so reconhecidas pelas enzimas responsveis pela sntese de RNA. depois dessa sequncia que
uma molcula de RNA comea a ser sintetizada. Por outro lado, a regio finalizadora contm uma sequncia
nucleotdica tambm especfica, que indica onde a transcrio da molcula de RNA dever ser encerrada. O
esquema abaixo exemplifica o processo de transcrio bacteriano:
Na situao hipottica A, a transcrio se dar da seguinte forma:

Esta resultar na seguinte molcula de RNA mensageiro (ou RNAm):

5 - AUGGCCGGAUCGGUGGGGCAU - 3'

Na situao hipottica B, a transcrio se dar da seguinte forma:

Esta resultar na seguinte molcula de RNA mensageiro (ou RNAm):

3 - UACCGGCCUAGCCACCCCGUA - 5'

Utilizando a tabela do cdigo gentico disponvel abaixo, determine como seria a sequncia peptdica codificada por
cada um dos dois RNAm produzidos nessas duas situaes.

Devemos prestar ateno ao fato que toda molcula de RNAm que chega em um ribossomo para a traduo gnica
sempre comear a ser lida pela sua extremidade 5. Portanto, a fita de cima dever ser lida da esquerda para a
direita e, a fita de baixo, da direita para a esquerda.

A sequncia de uma molcula de mRNA lida de 3 em 3 nucleotdeos, de uma maneira no sobreposta. Ou seja,
cada trinca de nucleotdeos, tambm chamada de cdon, lida uma nica vez. E existe ao menos um cdon
especfico para cada um dos 20 aminocidos comumente encontrados nos peptdeos.

Usando a tabela do cdigo gentico para traduzirmos esses trechos, descobrimos que esses dois RNAs nos
fornecero as seguintes sequncias peptdicas:

Colocando os peptdeos formados, lado a lado, podemos perceber que eles no tero a mesma sequncia peptdica:

Situao hipottica A: Met-Ala-Gly-Ser-Val-Gly-His

Situao hipottica B: Met-Pro-His-Arg-Ser-Gly-His


TABELA DO CDIGO GENTICO:

Por que as sequncias peptdicas no so idnticas se o trecho de DNA transcrito foi o mesmo? Isso
acontece porque as duas fitas da molcula de DNA no so iguais, mas sim complementares. Ou seja, se em uma
das fitas temos uma adenina, na regio correspondente da outra fita teremos que ter uma timina, e assim por diante.
Por esse motivo que as regies promotoras dos genes so importantes. Elas informam para as enzimas envolvidas
no processo de transcrio no apenas o ponto exato em que a sntese da molcula de RNA dever ser iniciada,
mas tambm qual das duas fitas do DNA dever servir de molde para isso. Por sua vez, essa fita de RNA ir codificar
um peptdeo especfico, que pode ser uma enzima, um hormnio, uma protena de membrana, uma protena de
defesa, e assim por diante.

A TRANSCRIO E A TRADUO

Considerando os diferentes cdons dos mRNA dados a seguir, indique como seria a sequncia da molcula de DNA
que lhe deu origem, quais seriam os respectivos anticdons do tRNA que se ligariam a esses cdons, bem como o
aminocido a ser incorporado no peptdeo:

Como temos apenas a sequncia do RNA mensageiro, podemos comear determinando a sequncia da fita de DNA
que lhe serviu de molde (A). Tendo em vista que o mRNA desse exemplo corre no sentido 53, a fita de DNA que
lhe serviu de molde tem que ser aquela que corre no sentido 35. Tambm devemos nos lembrar sobre a
necessidade de complementariedade entre as bases do DNA/RNA. Ou seja, para termos uma adenina no mRNA, o
DNA precisa ter uma timina, e assim por diante. Lembrando que nos RNAs a timina substituda pela uracila. Nesse
ltimo caso, se no mRNA foi incorporada uma uracila, por que no DNA molde havia uma adenina.
Nesse exemplo tambm j podemos determinar a sequncia de aminoacidos do peptdeo (B). Lembrando que a
sequncia de nucleotdeos do mRNA (os cdons deste) quem determina a sequncia peptdica. Feito isso,
podemos determinar a sequncia da fita complementar da molcula de DNA (C) e da sequncia do anticdon do
tRNA (D), que a regio do tRNA que permite o seu pareamento com o cdon do mRNA. Novamente, sempre
pensando no fato que essas bases precisam ser complementares (G=C e A=T se for DNA, ou G=C e A=U se for
entre RNAs, conforme mostrado pelas setas verdes):

Num organismo, um locus hipottico apresenta a sequncia nucleotdica abaixo:

Com relao especificamente a esse trecho, como ser a sequncia de bases na molcula de pr RNA
mensageiro (pre RNAm)? O pr RNA mensageiro encontrado em eucariotos. Nesses organismos, os genes so
normalmente compostos por dois tipos de sequncias nucleotdicas. Uma delas, chamadas de ntrons, sero
retiradas logo aps a transcrio; as outras, chamadas de xons, normalmente permanecero no RNA mensageiro
maduro, e serviro de molde para codificar a sequncia peptdica nos ribossomos.

Considerando que nesse esquema, o stio promotor se encontra esquerda, o pr RNA dever ter a seguinte
sequncia. Observao: os nucleotdeos na rea em vermelho representam os trechos lidos dos xons e os na rea
em azul, os dos ntrons.

Depois que o pre RNAm for processado, qual ser a sequncia resultante do RNA mensageiro (mRNA)?:
Depois de sintetizado esse pr RNAm normalmente sofre uma srie de modificaes. Uma delas envolve a retirada
dos ntrons (os trechos em azul), resultando na seguinte sequncia codificadora no mRNA maduro:

Qual ser a sequncia de aminocidos codificada por esse RNA mensageiro processado? Depois de pronto, o
mRNA segue para o citoplasma, onde ser traduzido nos ribossomos, a partir da sua poro 5', na seguinte
sequncia peptdica:

Este material foi obtido partir da pgina eletrnica abaixo:


http://www.uel.br/pessoal/rogerio/genetica/respostas/pratica_03.html

Você também pode gostar