Você está na página 1de 7

e) na regio Centro-Oeste, a oscilao da incidncia de

EXERCCIOS febre amarela est relacionada ao aumento crescente

do desmatamento do Cerrado, s constantes alteraes
1. (UFG) Analise os grficos a seguir. microclimticas e reduo do contato humano com o
vetor Aedes aegyptis.

2. (UFRJ) Os grficos a seguir apresentam o

crescimento de uma espcie de bactria e de um
vrus bacterifago em ciclo ltico, ambos em
ambientes sem limitao de recursos.

Desde a dcada de 1930, so conhecidos os

processos de desenvolvimento e controle da febre
amarela e da dengue no Brasil. Entretanto, estas
doenas continuam ocorrendo na maior parte do
territrio brasileiro, com variaes espaciais e
temporais. Neste contexto, verifica-se que,
a) na regio Nordeste, ocorreu, no perodo de 1996 a
2005, uma epidemia de dengue em razo da
concentrao da populao nas cidades, o que facilitou
a proliferao do vetor Aedes aegyptis.
b) na regio Sul, foi notificado o menor nmero de
casos de febre amarela devido distribuio regular Identifique qual grfico (A ou B) representa o
das chuvas ao longo de todos os meses do ano e s crescimento das bactrias e qual representa o
temperaturas elevadas no vero, cujo vetor crescimento dos bacterifagos. Justifique sua
Haemagogus no se reproduz, nestas condies, em resposta.
regies urbanas. _____________________________________________
c) na regio Sudeste, ocorreu, no perodo de 2001 a _____________________________________________
2005, o segundo maior nmero de casos de dengue _____________________________________________
dentre todas as regies por causa da concentrao das
chuvas no vero e da proliferao do vetor
d) na regio Norte, no perodo de 1996 a 2000, foi _____________________________________________
registrado o maior nmero de casos de febre amarela _____________________________________________
em virtude das transformaes socioambientais da _____________________________________________
expanso da agricultura, facilitando a proliferao do
vetor Haemagogus.
3. (PUCRS) A pesquisa 2 investigou qual a poro Com base nos seus conhecimentos e no texto
viral que infectava as bactrias. Para isso, uma acima sobre vrus, classificao, morfologia e
quantidade de vrus bacterifagos teve seu fisiologia dos seres vivos, assinale a alternativa
capsdeo proteico marcado com fluorescncia correta.
vermelha, e seu DNA, com fluorescncia azul. As a) Apenas a proposio III verdadeira.
clulas foram ento infectadas por esses vrus e, b) Apenas as proposies I e II so verdadeiras.
aps, analisadas. O processo de infeco mostrou c) Apenas as proposies III e IV so verdadeiras.
que ______ das bactrias havia ficado _________. d) Apenas as proposies I e IV so verdadeiras.
e) Apenas a proposio II verdadeira.
a) o citoplasma - vermelho
b) o citoplasma - azul 5. (UFPR) Na dcada de 1990 foram descobertas, no
c) o ncleo - vermelho genoma de aves e mamferos, inmeras sequncias
d) a parede celular - azul de DNA que tinham grande similaridade com os
e) a parede celular - vermelha retrovrus infecciosos e por isso foram
denominadas retrovrus endgenos (RVEs).
4. (CFTSC) A influenza A (H1N1), mais conhecida Sabemos hoje que esses estranhos elementos
como Gripe A, marcou o mundo em 2009 constituem 8% do genoma humano.
constituindo-se em uma doena respiratria viral. (Fonte: Instituto Cincia Hoje coluna Deriva Gentica.)
Os vrus influenza so compostos de RNA, e
subdividem-se em trs tipos: A, B e C. Os tipos A e Sobre os retrovrus endgenos, considere as
B causam maior morbidade (doena) e mortalidade seguintes afirmativas:
(mortes) que o tipo C. Geralmente as epidemias e 1. Retrovrus endgenos surgem a partir da
pandemias (epidemia em vrios pases) esto evoluo de genes mutantes do prprio organismo.
associadas ao vrus influenza A. Uma pessoa pode 2. Para que esses elementos surjam, necessria a
ter influenza mais de uma vez, mas no pelo subtipo presena, em algum momento do processo, da
de vrus com o qual tenha sido infectada. Isso enzima transcriptase reversa.
porque a pessoa fica imunizada pelo subtipo de 3. Os retrovrus endgenos so encontrados no
vrus depois de ter a doena. O vrus transmitido citoplasma das clulas infectadas.
de pessoa a pessoa, principalmente por meio da 4. A origem de retrovrus endgeno pode se dar a
tosse, espirro ou de secrees respiratrias de partir da infeco de organismos por vrus que
pessoas infectadas. possuem RNA como material gentico.
Entre os principais medicamentos utilizados no Assinale a alternativa correta.
tratamento da Gripe A encontra-se o Tamiflu, cujo a) Somente a afirmativa 2 verdadeira.
princpio ativo interfere na entrada do vrus em b) Somente as afirmativas 1 e 3 so verdadeiras.
clulas no infectadas e tambm na liberao de c) Somente as afirmativas 2, 3 e 4 so verdadeiras.
partculas virais formadas recentemente a partir de d) Somente as afirmativas 2 e 4 so verdadeiras.
clulas infectadas. e) Somente as afirmativas 1 e 4 so verdadeiras.
Disponvel em: www.saude.gov.br. Acesso em: 06 set. 2009. Texto
adaptado de: www3.pucrs.br/notcias. Acesso em: 06 set. 2009.
6. (FUVEST) Considere as seguintes caractersticas
Leia as proposies abaixo: atribudas aos seres vivos:
I Os seres vivos podem ser classificados em cinco I. Os seres vivos so constitudos por uma ou mais
reinos: Monera, Protista, Plantae, Fungi e Animalia. clulas.
Por serem unicelulares procariontes, os vrus esto II. Os seres vivos tm material gentico interpretado
enquadrados no Reino Monera. por um cdigo universal.
II Por serem partculas infecciosas acelulares, os
III. Quando considerados como populaes, os
vrus so obrigatoriamente parasitas celulares,
necessitando de outros seres vivos para a formao seres vivos se modificam ao longo do tempo.
de novas partculas virais. Admitindo que possuir todas essas caractersticas
III A imunizao de uma pessoa a uma doena seja requisito obrigatrio para ser classificado
virtica aps o contgio ou atravs de vacina se como ser vivo, correto afirmar que:
deve ao sistema imunolgico humano, composto a) os vrus e as bactrias seres vivos, porque ambos
basicamente pelas hemcias ou glbulos preenchem os requisitos I, II e III.
vermelhos. b) os vrus e as bactrias no so seres vivos, porque
IV Os vrus so formados basicamente por cido ambos no preenchem o requisito I.
nucleico envolvido por uma capa proteica c) os vrus no so seres vivos, porque preenchem os
denominada capsdeo. Os vrus da Influenza A requisitos II e III, mas no o requisito I.
apresentam RNA como cido nucleico. O RNA d) os vrus no so seres vivos, porque preenchem o
uma molcula formada por duas cadeias de requisito III, mas no os requisitos I e II.
nucleotdeos em antiparalelo, com estrutura e) os vrus no so seres vivos, porque no preenchem
helicoidal de acordo com o modelo da dupla hlice os requisitos I, II e III.
proposto por Watson e Crick em 1953.
7. (UFPE) A gripe causada pelo Influenza A H1N1
tem provocado uma pandemia sem precedentes, 5 3
com gravidade somente comparada gripe AAAUGCGUUACGAAUGGUAUGCCUACUGAAU
espanhola do incio do sculo passado. Sobre estes
vrus, observe a figura a seguir e considere as 2. a tabela com os cdons representativos do
afirmaes que se seguem. cdigo gentico universal:
UUA Leu UCA Ser UAA pare* UGA pare*
UUG Leu UCG Ser UAG pare* UGG Trp




AUG iniciar* ACG Thr AAG Lys AGG Ser



( ) Os vrus Influenza se ligam s clulas alvo por

Abreviaturas dos aminocidos
meio de espculas (1), que tambm so utilizadas para
Phe = fenilalanina His = histidina
diferenciar os tipos de Influenza.
( ) Aps a entrada na clula, o nucleocapsdeo Leu = leucina Gin = glutanina
deposita no ncleo celular o material gentico de RNA
IIe = isoleucina Asn = aspargina
(2), que replicado (3) e transcrito em RNAm (4).
( ) O RNAm traduzido (5) em protenas das Met = Iniciar (metionina) Lys = lisina
espculas (6) e enzimas, dentre estas, a transcriptase
Val = vallina Asp = cido asprtico
reversa que volta ao ncleo celular (7) para sintetizar
DNA viral. Ser = serina Glu = cido glutmico
( ) A probabilidade que a disseminao desses
Pro = prolina Cys = cistena
vrus seja ainda maior nos perodos de inverno da
Amrica do Norte e da Europa. Thr = Treonina Trp = triptofano
( ) As vacinas produzidas contra o vrus da gripe so
Ala = alanina Arg = arginina
geralmente pouco eficientes devido variao
antignica das espculas H (hemaglutinina) e N Tyr = tirosina Gly = Glicina
(neuraminidase), o que dificulta o reconhecimento dos
a) Qual ser a sequncia de aminocidos que
vrus pelos anticorpos.
resultar da traduo da sequncia inicial de RNA
mensageiro, referente a um dos genes deste vrus
8. (UNIFESP) No ano de 2009, o mundo foi alvo da
indicada em 1?
pandemia provocada pelo vrus influenza A (H1N1), _____________________________________________
causando perdas econmicas, sociais e de vidas. O
referido vrus possui, alm de seus receptores
proteicos, uma bicamada lipdica e um genoma
constitudo de 8 genes de RNA. Considerando:
1. a sequncia inicial de RNA mensageiro referente
a um dos genes deste vrus:
b) Considerando os mecanismos de replicao do interao inicial entre vrus e clula do paciente
genoma viral, qual a principal diferena entre o vrus ocorre atravs da HA. ela que os glbulos brancos
da gripe e o vrus que causa a AIDS? reconhecem e procuram atacar. A HA se liga
_____________________________________________ superfcie de uma clula, fazendo com que ela
_____________________________________________ acione suas defesas e "engula" o vrus com uma
_____________________________________________ bolsa digestiva. Dentro dessa bolsa, a clula solta
_____________________________________________ cidos para digerir o vrus. No entanto, o aumento
_____________________________________________ da acidez provoca a mudana de forma na HA, que
faz com que a membrana do vrus se funda com a
9. (MACKENZIE) O ser humano tem travado
membrana da clula.
batalhas constantes contra os vrus. A mais recente
contra o vrus H1N1, que causa a gripe suna. Dessa forma, o contedo do vrus - seu material
gentico - liberado no interior da clula, e ele
A respeito dos vrus, assinale a alternativa correta.
continua sua reproduo sem ser molestado."
a) So todos endoparasitas celulares. a) Por que o sistema imunolgico de uma pessoa
b) Os antibiticos s so eficazes contra alguns tipos.
no reconhece um vrus mutante, mesmo que j
c) Todos eles possuem o DNA e o RNA como material
gentico. tenha tido uma forma da doena?
d) Atualmente existem vacinas contra todos os tipos. _____________________________________________
e) Alguns deles possuem reproduo sexuada. _____________________________________________
10. (UFOP) O beneficiamento do lixo urbano e o _____________________________________________
tratamento da gua e do esgoto so medidas _____________________________________________
essenciais com que todas as cidades devem se
preocupar. Considerando essas medidas, ponha V b) Explique como o vrus consegue "enganar" uma
(verdadeira) ou F (falsa) em cada uma das clula e infect-la.
alternativas a seguir. _____________________________________________
( ) O beneficiamento do lixo urbano permite a _____________________________________________
obteno de gases para a produo de energia _____________________________________________
e reduz o nmero de organismos transmissores de _____________________________________________
doenas. _____________________________________________
( ) O beneficiamento do lixo urbano permite o
reaproveitamento de material no biodegradvel e, a 12. (UEG) A figura representada a seguir refere-se
partir da matria orgnica, a produo de adubos. ao ranking dos principais municpios goianos com
( ) gua e esgoto no tratados propiciam a
maiores nmeros absolutos de casos de dengue
elevao da incidncia das hepatites A e B e da
registrados at o ms de maro do corrente ano,
disenteria amebiana, devido presena de vrus e
segundo informaes da Gerncia de Vigilncia
cistos, que saem nas fezes dos indivduos
contaminados. Epidemiolgica da Secretaria Estadual de Sade do
( ) gua e esgoto no tratados propiciam o estado de Gois.
aparecimento da esquistossomose, que causada
por vermes do gnero Schistosoma, cujos ovos,
presentes nas fezes dos indivduos doentes, so os
agentes infecciosos humanos.
A sequncia correta
a) V F F - F.
b) V V F - F.
c) F F V - F.
d) V V F - V.

11. (UEL) Leia atentamente o texto adiante e

responda as perguntas propostas a seguir:
"A gripe uma das doenas que mais matou na
histria do homem. Suas epidemias, que ainda
ocorrem todo o ano, j assustaram mais do que a Acerca destas informaes, responda ao que se
AIDS. As epidemias, quase sempre no inverno, pede:
ocorrem quando o vrus sofre uma mutao que o a) cite dois fatores que explicam a diferena entre a
torna mais virulento e irreconhecvel pelos sistemas ocorrncia de casos em Goinia com os demais
imunolgicos das pessoas infectadas. municpios apresentados;
As mutaes ocorrem numa protena chamada HA,
que fica espetada na membrana do vrus. Toda a
_____________________________________________ b) II
_____________________________________________ c) III
_____________________________________________ d) IV
b) explique como se d a transmisso da dengue.
_____________________________________________ 14. (UNESP) Dengue tipo 4 reaparece aps 25 anos
_____________________________________________ A dengue causada por quatro tipos de vrus:
_____________________________________________ DENV-1, DENV-2, DENV-3 e DENV-4. O tipo DENV-4
_____________________________________________ no era encontrado no pas desde 1982, mas
_____________________________________________ exames de sangue feitos em Manaus mostram que a
dengue tipo 4 est de volta ao pas. Embora a
13. (UERJ) A gripe conhecida popularmente como infeco causada pelo DENV-4 no seja, por si s,
gripe suna causada por um vrus influenza A. muito agressiva, o retorno dela , ainda assim, uma
Esse tipo de vrus se caracteriza, dentre outros m notcia para a sade pblica brasileira. Isso
aspectos, por: porque aumenta a possibilidade de que as pessoas
- ser formado por RNA de fita simples (-), incapaz de desenvolvam a forma hemorrgica da doena, muito
atuar como RNA mensageiro ou de sintetizar DNA mais letal.
nas clulas parasitadas; (Notcia veiculada por diferentes agncias, maro de 2009.)

- os RNA complementares do RNA viral poderem ser

traduzidos em protenas pelo aparelhamento celular. Em razo do contido na notcia, pode-se afirmar
Os esquemas a seguir apresentam um resumo de que, antes do reaparecimento do vrus DENV-4,
etapas dos processos de replicao de alguns dos a) eram menores as possibilidades de as pessoas
vrus RNA, aps penetrarem nas clulas. desenvolverem a forma hemorrgica da doena, pois os
tipos virais, embora mais agressivos que o vrus DENV-
4, raramente levavam ao quadro hemorrgico. Com o
reaparecimento de uma quarta variante viral, menos
agressiva, porm letal, a questo da dengue no Brasil
b) havia no Brasil apenas trs tipos virais e, portanto,
eram trs as diferentes possibilidades de uma pessoa
adquirir dengue. Com o reaparecimento de um quarto
tipo, a possibilidade de se adquirir dengue passou a ser
25% maior. A dengue adquirida a partir de qualquer um
desses quatro tipos de vrus, se no tratada pode
evoluir para a forma hemorrgica da doena.
c) havia no Brasil apenas trs tipos virais e, portanto, a
possibilidade de as pessoas virem a adquirir a dengue
era menor. O reaparecimento do vrus DENV-4
aumentou a possibilidade de as pessoas terem um
primeiro contato com qualquer uma das variantes virais
e, consequentemente, desenvolver a dengue, que, se
no tratada, pode evoluir para a forma hemorrgica da
d) uma pessoa que tenha adquirido dengue poderia vir
a desenvolver a forma hemorrgica da doena se
entrasse em contato com mais um dentre os dois outros
tipos virais. Com o reaparecimento de um quarto tipo
viral, aumenta a possibilidade de que esta pessoa entre
em contato com um tipo diferente e desenvolva a forma
hemorrgica da doena.
e) uma pessoa que tenha adquirido dengue poderia vir
a desenvolver a forma hemorrgica da doena se
entrasse novamente em contato com o tipo a partir da
qual desenvolveu a doena. Com o reaparecimento de
um quarto tipo viral, aumenta a possibilidade de que
esta pessoa entre em contato com uma variante de
mesmo tipo e desenvolva a forma hemorrgica da
O tipo de replicao encontrado no vrus infuenza A
est representado no esquema de nmero: 15. (UFG) A dengue uma doena caracterizada,
dentre outros sintomas, por fortes dores de cabea,
a) I febre e diminuio das plaquetas sanguneas. Uma
dificuldade no combate ao Aedes aegypti, mosquito 2: Bactria, B; bacterifago, A. As bactrias possuem
vetor dessa doena, sua elevada capacidade de diviso binria, por isso seu nmero dobra a cada ciclo.
reproduo em ambientes com gua parada. Os bacterifagos so vrus que infectam as bactrias e
A tabela a seguir apresenta dados sobre as fases do utilizam seu metabolismo para formar novos vrus. A
ciclo de vida desse vetor. cada ciclo ltico, um nico bacterifago gera muitos
Relao de diferentes temperaturas do ar e do 3: [B]
nmero de indivduos das diferentes fases do ciclo Apenas o DNA de um bacterifago entra na clula
de vida de Aedes aegypti em ambientes urbano e bacteriana. Como bactrias no possuem ncleo,
natural. espera-se que o citoplasma fique com a colorao azul
devido presena do DNA viral marcado com
Temper Nmero de Nmero de Nmero de fluorescncia daquela cor.
atura ovos larvas adultos
do ar 4: [E]
(C) Cid Flor Cid Flor Cid Flor Os vrus, por serem acelulares, no so classificados
ade esta ade esta ade esta em nenhum dos cinco Reinos. As hemcias tm a
funo de transportar o gs oxignio para as clulas e
Temp. 137 466 565 185 52 15 tecidos, no possuem funo de defesa. O RNA
25 C 9 formado por uma cadeia simples de nucleotdeos.

5: [D]
Temp. 175 591 781 258 68 24
A afirmativa 1 falsa, pois retrovrus endgenos surgem
30 C 5
de mutaes em retrovrus preexistentes, no de genes
mutantes do prprio organismo. A afirmativa 3 falsa
Temp. 224 737 908 300 89 31 porque o material gentico de um retrovrus endgeno
35 C 5 pode ser encontrado no ncleo das clulas infectadas.
As afirmativas 2 e 4 so verdadeiras.
Temp. 297 993 107 363 111 39
40 C 8 6 6: [C]
Os vrus no so seres vivos, pois so acelulares,
apesar de terem material gentico e de, quando
Com base nos dados apresentados, explique:
considerados como populaes, modificarem-se ao
a) a relao direta entre a temperatura e o nmero
longo do tempo.
de indivduos observados nas diferentes fases
desses insetos;
_____________________________________________ Verdadeiro: os vrus Influenza possuem espculas H
_____________________________________________ (hemaglutinina) e N (neuraminidase), o que permite sua
_____________________________________________ diferenciao, por exemplo: H1N1 (Influenza humano),
_____________________________________________ H5N1 (Influenza aviria) etc; se ligam s clulas alvo
_____________________________________________ por meio de espculas H.
Verdadeiro: os vrus Influenza apresentam material
b) a causa da maior incidncia das diferentes fases gentico de RNA que replicado, para formar cpias do
desses insetos em ambientes urbanos quando material gentico viral e transcrito em RNAm, para a
comparados com o ambiente natural. sntese de protenas.
_____________________________________________ Falso: os vrus Influenza no possuem a enzima
_____________________________________________ transcriptase reversa e no transcrevem seu
_____________________________________________ RNA em DNA. Algumas protenas se dirigem ao ncleo
_____________________________________________ (7) para auxiliar na composio do nucleocapsdeo viral.
_____________________________________________ As espculas virais, formadas no citoplasma, se
associam primeiramente a membrana celular (6) e, aps
GABARITO o brotamento da clula, estes vrus carregam uma parte
da membrana com as espculas para compor o
envelope viral.
1: [A]
A regio Nordeste sofreu, no perodo de 1996 a 2005, Verdadeiro: as baixas temperaturas no inverno
uma epidemia de dengue em razo da concentrao da aumentam a frequncia de doenas respiratrias na
populao nas cidades, fato que facilitou a proliferao populao, entre elas, a gripe, aumentando a chance de
do vetor Aedes aegyptis, o mosquito transmissor do novas recombinaes genticas ou mutaes nos
vrus da dengue. subtipos virais.
Verdadeiro: as espculas H e N representam os sntese de protenas virais. Algumas das molculas de
principais antgenos virais do Influenza que estimulam a RNA viral complementar permanecem no ncleo e so
produo de anticorpos. Todavia, frequentemente, utilizadas como molde para a produo de RNA viral,
sofrem modificaes decorrentes de mutaes ou que constituiro o material gentico dos novos vrus.
recombinaes genticas, o que dificulta suas
utilizaes como alvos de vacinas. 14: [D]
Se um indivduo que j contraiu anteriormente um tipo
8: a) A sequncia de aminocidos que resultar da de dengue contrair posteriormente um tipo diferente
traduo da sequncia inicial de RNA mensageiro dessa virose, poder desenvolver a forma hemorrgica
indicada na questo ser: metionina arginina tirosina da doena. Dessa forma, com o reaparecimento do
cido glutmico triptofano tirosina alanina quarto tipo de vrus da dengue, as probabilidades de
tirosina. uma pessoa adquirir dengue hemorrgica aumentam.
b) O vrus da gripe contm RNA viral, que, por
pareamento complementar, produz cpias desse RNA, 15: a) Quanto maior a temperatura, maior o nmero de
que posteriormente sero incorporados aos novos vrus. indivduos, pois a elevao de temperatura reflete a
O vrus HIV um retrovrus. Seu RNA forma, no ncleo elevao do metabolismo e o aumento das divises
da clula hospedeira, uma cadeia de DNA atravs de celulares, resultando em maior taxa de crescimento nas
uma transcrio reversa. Na sequncia, o DNA viral diferentes fases desses insetos.
gerado dar origem a RNA viral que se incorporar aos b) A maior incidncia das diferentes fases do ciclo de
novos vrus. vida de Aedes aegypti em reas urbanas se deve a uma
maior adaptao dessa espcie em reas midas com
9: [A] gua parada (lixo, caixas dgua, pneus velhos etc.),
A alternativa A a correta. Todos os vrus so alm do fato de que, em reas urbanas, os inimigos
endoparasitas celulares obrigatrios, pois necessitam naturais (predadores) dessas diferentes fases de
utilizar os recursos bioqumicos de uma clula para sua desenvolvimento (ovo, larva e adulto) desse inseto
reproduo. Os vrus possuem DNA ou RNA como ocorrem em baixa frequncia ou inexistem, enquanto
material gentico, nunca os dois juntos. em reas naturais existem predadores em maior riqueza
e abundncia.
10: [B]
A hepatite B uma virose transmitida por meio de
relaes sexuais, transfuses sanguneas e contato
com sangue ou secrees humanas contaminadas com
o agente etiolgico (exemplo: compartilhamento de
seringas entre usurios de drogas injetveis). A
esquistossomose adquirida pelo homem por meio da
penetrao ativa de larvas cercarias presentes em
colees de gua doce infestadas por caramujos

11: a) Porque ocorre uma mudana no seu material

gentico, fazendo com que mude a protena de
associao do vrus tornando-o irreconhecvel pelo
sistema imunolgico, que identifica o vrus por essa
b) Alterando sua protena de associao, chamada HA,
que se funde com a membrana da clula.

12: a) Desigualdades sociais, condies de habitao

(infraestrutura urbana), perfil scio cultural da
b) A transmisso se d pela picada do mosquito Aedes
agegypti, que ficou infectado porque picou uma pessoa
Esse mosquito infectado, picando uma pessoa sadia
passa o vrus do dengue e esta pessoa fica doente. A
doena s acomete a populao humana.

13: [B]
As molculas de RNA viral so utilizadas como molde
para produzir molculas complementares, as quais
saem para o citoplasma e atuam como RNAm na