Você está na página 1de 45

Engenharia Gentica

Matria 1 teste

1 Semestre - 2010/2011

3 ano - Mestrado Integrado em Engenharia Biomdica


Instituto Superior Tcnico

Baseado nas aulas e nos livros Principles of Gene Manipulation and Genomics
e Gene Cloning and DNA analysis

Resumo por Ins Amorim


ndice

Potenciais benefcios da Biotecnologia/Engenharia Gentica .................................................................................. 5


Potenciais problemas e consequncias da Biotecnologia/Engenharia Gentica ...................................................... 5
Tcnicas fundamentais de manipulao gentica..................................................................................................... 5
Principais passos na clonagem de um gene .............................................................................................................. 6
Vectores de clonagem: plasmdeos e bacterifagos ................................................................................................. 6
Plasmdeos ............................................................................................................................................................. 6
Classificao de plasmdeos............................................................................................................................... 7
Gama de hospedeiros ........................................................................................................................................ 7
Bacterifagos ......................................................................................................................................................... 8
Fago ................................................................................................................................................................. 8
Fago M13 ............................................................................................................................................................... 9
Preparao de DNA ................................................................................................................................................. 10
DNA total de bactrias......................................................................................................................................... 10
DNA plasmdico lise alcalina ............................................................................................................................. 10
DNA fago ........................................................................................................................................................... 11
DNA fago M13 ..................................................................................................................................................... 11
Manipulao de DNA purificado.............................................................................................................................. 11
Nucleases ............................................................................................................................................................. 12
Polimerases.......................................................................................................................................................... 12
Enzimas que actuam nas extremidades .............................................................................................................. 13
Endonucleases de Restrio ................................................................................................................................ 13
Nomenclatura .................................................................................................................................................. 14
Tipos de endonucleases................................................................................................................................... 14
Tipos de extremidades .................................................................................................................................... 15
Digesto de restrio in vitro............................................................................................................................... 15
Construo de um mapa de restrio ............................................................................................................. 16
Ligases e ligao de DNA ..................................................................................................................................... 16
Introduo de DNA em clulas vivas ....................................................................................................................... 17
Tcnicas de introduo de DNA em bactrias ..................................................................................................... 18
Transformao ................................................................................................................................................. 18
Electrotransformao (ou electroporao) ..................................................................................................... 19
Conjugao bacteriana .................................................................................................................................... 20

2
Conjugao Triparental.................................................................................................................................... 20
Conjugao Biparental..................................................................................................................................... 21
Introduo de fagos em bactrias ....................................................................................................................... 21
Transfeco...................................................................................................................................................... 21
Introduo de DNA em organismos eucariotas ................................................................................................... 21
Introduo de DNA em Saccharomyces cerevisae........................................................................................... 21
Introduo de DNA em clulas animais ........................................................................................................... 22
Introduo de DNA em clulas vegetais .......................................................................................................... 23
PCR Polymerase Chain Reaction ........................................................................................................................... 24
Passos da PCR ...................................................................................................................................................... 24
Material necessrio ......................................................................................................................................... 24
Design de primers ............................................................................................................................................ 25
Produtos de PCR .............................................................................................................................................. 26
Vectores de clonagem para E. coli ........................................................................................................................... 27
Plasmdeos ........................................................................................................................................................... 27
Vectores de clonagem baseados no fago M13........................................................................................................ 29
Vectores de clonagem baseados no fago ............................................................................................................. 31
Bibliotecas genmicas ............................................................................................................................................. 32
Vectores de clonagem para leveduras .................................................................................................................... 32
YEps Plasmdeos epissomais de levedura ............................................................................................................. 33
Outros plasmdeos para levedura ....................................................................................................................... 33
YACs cromossomas artificiais de levedura ........................................................................................................... 34
Processo de clonagem com pYAC3: ................................................................................................................. 34
Vectores de clonagem para plantas superiores ...................................................................................................... 35
Vectores de clonagem para insectos ....................................................................................................................... 35
Obteno de clones para genes especficos ............................................................................................................ 36
Processo de preparao do cDNA: ...................................................................................................................... 36
Hibridao de Southern ....................................................................................................................................... 37
Mutagnese aleatria.............................................................................................................................................. 39
Mutantes de eliminao em bactrias ................................................................................................................ 40
Mutantes de inactivao por insero ................................................................................................................ 43
Mutantes de eliminao em S. cerevisae ............................................................................................................ 43
RNA de interferncia iRNA.................................................................................................................................... 44
Mutagnese dirigida ................................................................................................................................................ 45

3
4
Engenharia Gentica
Potenciais benefcios da Biotecnologia/Engenharia Gentica
Diagnsticos e tratamentos mais precisos;
Melhoramento de colheitas e da sua resistncia a doenas e stress ambiental;
Produo de qumicos, enzimas, aditivos alimentares, medicamentos, polmeros, etc;
Eliminao de poluentes e resduos.

Potenciais problemas e consequncias da Biotecnologia/Engenharia Gentica


Organismos perigosos para outros organismos ou para o ambiente;
Reduo da biodiversidade gentica natural de organismos;
Possvel uso da Eng. Gentica em humanos;
Pouca disponibilidade nos pases mais pobres;
Sobreposio da procura de lucros procura livre de conhecimento.

Gene: fragmento de DNA que codifica para uma determinada protena.

DNA recombinado: qualquer molcula de DNA criada artificialmente que conjuga sequncias de DNA que
geralmente no se encontram juntas na natureza.

Manipulao gentica: qualquer tcnica utilizada para a criao de DNA recombinado.

Clonagem: replicao de DNA recombinado no interior de um organismo hospedeiro de modo a produzir vrias
cpias da mesma sequncia.

Tcnicas fundamentais de manipulao gentica


Plasmdeos e bacterifagos;
Preparao de DNA a partir de clulas vivas;
Manipulao de DNA purificado;
Vectores de clonagem para diferentes organismos;
Mtodos de seleco de clones.

5
Clonagem de genes
Vectores de clonagem: molculas de DNA s quais podem ser adicionados fragmentos de DNA exgeno. Tm
capacidade de replicao so geralmente replices, tendo apenas uma origem de replicao.

Principais passos na clonagem de um gene


Gerar ou isolar um fragmento de DNA;
Inserir o fragmento num vector de clonagem;
Introduzir o vector numa clula hospedeira e replic-lo;
Seleccionar as clulas que contm o fragmento.

Vectores de clonagem: plasmdeos e bacterifagos

Caractersticas dos vectores de clonagem:

Sofrem replicao na clula hospedeira (necessitam por isso de uma origem de replicao para que
sejam produzidas vrias cpias do DNA recombinado (DNA de interesse)) *;
So relativamente pequenos (< 10 Kb), uma vez que as molculas grandes tendem a quebrar durante a
purificao;
Tm marcadores de seleco (como genes de resistncia a antibiticos) que permitem seleccionar os
organismos que contm o gene clonado.

* tm de ser replicativos na clula onde se vai realizar a clonagem.

Plasmdeos
Molculas de DNA circular (geralmente em cadeia dupla) que tm uma existncia independente na
clula (no fazem parte do cromossoma e replicam-se independentemente).
Existem essencialmente em bactrias (nos eucariotas s foram identificados em leveduras).
Contm um ou mais genes responsveis por caractersticas teis s clulas (embora no contenham
genes essenciais). Podem conferir resistncia a antibiticos, factores de fertilidade, produo de compostos
xenobiticos, degradao de toxinas, etc.

Estas caractersticas so importantes quando as bactrias/clulas se encontram sob presso selectiva (i.e. meio
com antibitico). Caso contrrio apenas atrasam o crescimento do organismo devido ao peso metablico
adicional do plasmdeo tornam-se uma desvantagem.

6
Classificao de plasmdeos

Plasmdeos conjugativos: contm os genes tra, que sintetizam o pilus sexual das bactrias e outras estruturas
necessrias conjugao.

Plasmdeos mobilizveis: contm genes mob e so capazes de transferir cpias de si prprios (por conjugao)
para outras clulas.

Plasmdeos autotransmissveis: simultaneamente conjugativos e mobilizveis (tra+mob+).

Plasmdeos integrativos (epissomas): podem existir sob a forma circular ou integrados no cromossoma. A
integrao depende do factor F. Tm um nmero de cpias definido.

Plasmdeos no integrativos: mantm-se sempre no citoplasma, independentes do cromossoma. Tm um maior


nmero de cpias.

So os mais usados: produzem um maior nmero de cpias e no so integrados no cromossoma no se


perdem e no transferem caractersticas para o genoma da clula, o que pode ser prejudicial (i.e. proliferao
de resistncia a antibiticos).

O nmero de cpias de um plasmdeo presente numa bactria varia (desde apenas 1 at mais de 100).
Para efeitos de clonagem preferem-se plasmdeos que apresentem mltiplas cpias de modo a que se possa
obter a maior quantidade possvel da molcula recombinada.

A capacidade de plasmdeos diferentes coexistirem na mesma clula, em simultneo, prende-se com a


sua compatibilidade. Diz-se que dois plasmdeos so incompatveis se da sua interaco resulta a destruio de
um deles. Geralmente plasmdeos compatveis tm mecanismos de replicao diferentes.

Podem definir-se grupos de incompatibilidade que englobam plasmdeos incapazes de coexistir na


mesma clula. So mutuamente incompatveis.

Gama de hospedeiros

A origem de replicao de um plasmdeo determina a sua gama de hospedeiros, i.e., os tipos de


hospedeiros em que pode ser replicada.

Vasta gama de hospedeiros: ori codifica a maioria das protenas necessrias replicao e a regio promotora e
os ribossome binding sites (RBS) so reconhecidos por uma grande diversidade de bactrias - plasmdeos
promscuos.

Baixa gama de hospedeiros: replicam-se em poucos tipos de bactrias.

7
Bacterifagos

Bacterifagos so vrus que infectam especificamente bactrias. Tm uma estrutura simples que
consiste numa molcula de material gentico (geralmente DNA) rodeada por uma cpside (cpsula).

Podem ser de dois tipos:

Head and tail: DNA linear de cadeia dupla. I.e. fago : infecta E.coli.
Filamentoso: DNA circular em cadeia simples. I.e. fago M13: infecta bactrias com pilus sexual.

Fago
DNA linear, cadeia dupla. Infecta E.coli ~ 48,5 Kb

Ciclo ltico: ciclo de vida dos bacterifagos no qual, findo o processo de infeco, as clulas lisam.

1) Fago adere parede celular da bactria e injecta o seu DNA;


2) DNA exgeno utiliza os recursos da clula para se replicar;
3) A transcrio e traduo das protenas codificadas pelo fago leva sntese da sua cpsula;
4) DNA replicado encapsulado, a clula hospedeira lisa e novos fagos so libertados para o meio.

Ciclo lisognico: ciclo no qual um bacterifago se insere no genoma das clulas que infecta e se mantm na
forma de pr-fago.

1) Fago adere parede da bactria e injecta o seu DNA;


2) DNA circulariza no interior da clula;
3) DNA circular integrado no cromossoma e forma um pr-fago. Mantm-se no genoma por indefinidas
geraes, sem manifestar as suas caractersticas, e replicado juntamente com o genoma.
4) Em situaes de stress o fago excisado do cromossoma, passando a estar de novo na forma circular.
Em condies normais, uma protena repressora impede que o fago (integrado no cromossoma) seja activado.
Quando uma molcula est sob stress (UV, falta de nutrientes, etc) o repressor torna-se instvel e desprende-se
do DNA, permitindo a transcrio do fago vai entrar em ciclo ltico.
5) Clula entra em ciclo ltico e so produzidos novos fagos.

Em cada extremidade 5 do fago h projeces de 12 nucletidos que formam sequncias


complementares que permitem a circularizao da molcula de DNA. A essas zonas chama-se locais cos.

So importantes aquando da infeco da bactria (para a circularizao) e tambm durante o ciclo ltico, pois
intervm no processo de multiplicao do genoma do fago.

8
Mtodo do crculo rolante: mtodo de replicao do genoma do fago

O fago est sob a forma circular. Replicao tem incio na regio DSO double-strand origin. O DNA
sofre clivagem e a cadeia 3 serve de primer para a polimerase poder actuar. A cadeia complementar vai sendo
sintetizada e cresce como uma nica molcula contendo muitas cpias do fago.
Na longa cadeia simples so reconhecidos os locais cos e uma endonuclease cliva a o DNA, dando
origem a vrias molculas do genoma do fago.

Fago M13
DNA circular, cadeia simples. Infecta bactrias com pilus sexual ~ 6,5 Kb

Ciclo de infeco: um ciclo no ltico nem lisognico.

1) Fago liga-se a um receptor nas clulas (o pilus sexual) e injecta o seu DNA.
2) DNA em cadeia simples convertido em DNA de cadeia dupla. Passa a funcionar como se fosse um
plasmdeo.
3) DNA replicado atravs do mtodo crculo rolante (produz fragmentos lineares).
4) So transcritas e traduzidas as protenas do fago.
5) DNA recircularizado introduzido na cpside e o fago completo libertado para o meio extracelular.
No se conhece bem o processo de libertao do fago.

H medida que a clula se replica o M13 passa entre progenitores e descendentes, sendo transmitido entre
geraes.

No ocorre lise das clulas pelo que o fago M13, aps infeco de uma bactria, pode ser a replicado
indefinidamente. Pelo facto de no ocorrer lise difcil identificar quais as clulas infectadas. Pode verificar-se
um crescimento mais lento devido ao peso metablico extra acarretado pela presena do fago.

Importncia do M13 como vector de clonagem

Genoma pequeno (< 10 Kb);


A sua forma replicativa em cadeia dupla (existente no interior da clula) funciona como um plasmdeo;
facilmente preparado a partir de uma cultura de E.coli infectadas;
Pode ser reintroduzido nas clulas;
Genes clonados usando um vector M13 podem ser obtidos na forma de cadeia simples de DNA, til para
a sua sequenciao e mutagnese in vitro.

9
Preparao de DNA

DNA total de bactrias

Crescer as clulas em meio nutritivo apropriado; i.e. meio LB


Centrifugar e retirar sobrenadante; elimina-se o meio de crescimento
Prover lise das clulas:
Lisozima: degrada peptidoglicanos; (componentes da parede celular bacteriana)
SDS (detergente): destri os lpidos e lisa a clula; (destri a membrana celular)
Purificar os cidos nucleicos:
Mtodos enzimticos (RNAses, proteases);
Fenol (desnatura/precipita protenas);
Centrifugar forma-se uma fase orgnica e uma fase aquosa (remover esta fase);
Precipitar DNA utilizando lcoois;
Suspender DNA.

DNA plasmdico lise alcalina

Crescer as clulas em meio apropriado;


Lisar as clulas:
Lisozima;
EDTA; promove agregao de ies metlicos e co-factores das DNAses, diminuindo a sua
actividade. Estas enzimas so responsveis pela degradao do DNA aps a lise. Tambm
destabiliza a membrana.
25% sacarose. Aumenta a presso osmtica e atrasa a lise celular.
Desnaturar DNA: (genmico e plasmdico)
NaOH; aumenta o pH (~11/12) e leva desnaturao de todo o DNA;
Renaturar DNA plasmdico:
cido actico; baixa o pH (~4) muito rapidamente e leva renaturao do DNA como o
processo muito rpido s o DNA plasmdico, que tem menores dimenses, consegue
renaturar. O DNA cromossmico precipita e o DNA plasmdico fica em soluo.
Purificar o DNA:
Clorofrmio; limpa a soluo.
Precipitar DNA plasmdico:
Isopropanol.

10
DNA fago

Cultivar clulas inoculadas pelo fago;


Induzir ciclo ltico; para multiplicar o fago.
Centrifugar fago fica no sobrenadante; pois muito leve. O sedimento tem como constituio os
resduos das bactrias.
Remover suspenso de fagos;
Adicionar polmero de polietilenoglicol; remove a gua da superfcie do fago e permite a formao de
agregados maiores, que j precipitam quando centrifugados.
Centrifugar e rejeitar sobrenadante.

DNA fago M13

Cultivar as clulas inoculadas pelo fago;


Extraco por lise alcalina; quando j est no interior da clula, o fago tem um comportamento
semelhante a um plasmdeo.
Fago isolado (exterior da clula);
Remover cpsula:
Fenol; precipita as protenas.
Remover H2O; formam-se duas fases (aquosa com DNA M13 e fenol) separadas por protenas.
Adicionar etanol; precipita DNA.
Centrifugar. DNA M13 forma precipitado.

Manipulao de DNA purificado

Os fragmentos de DNA (obtidos por diversos mtodos) nem sempre esto adaptados aos vectores nos
quais vo ser clonados, pelo que podem necessitar de ser modificados. Essas modificaes incluem:

Diminuio/aumento do seu tamanho;


Cpia em novas molculas de DNA;
Adio/remoo de grupos especficos;
Modificaes de extremidades.

Muitas destas tcnicas de manipulao fazem uso de enzimas existentes naturalmente nas clulas e que
foram purificadas e apuradas para serem utilizadas in vitro. De entre essas enzimas destacam-se:

Nucleases (endonucleases, exonucleases);


DNA polimerases;
Enzimas que actuam nas extremidades;
Endonucleases de restrio;
Ligases.

11
Nucleases

Nucleases (RNAses, DNAses): degradam cidos nucleicos atravs da quebra de ligaes fosfodisteres entre
nucletidos. Fazem hidrlise da ligao entre um grupo fosfato e um grupo hidroxilo.

Exonucleases: removem nucletidos, um de cada vez, a partir das extremidades da molcula de DNA. Encurtam
fragmentos. I.e. BAL 31.

Exonuclease III: s actua em pontas cegas e s digere uma das cadeias.

Endonucleases: quebram ligaes internas (corte aleatrio) na cadeia de DNA. Obtm-se fragmentos de vrios
tamanhos. I.e. S1, cliva cadeias simples.

DNAse I e desoxirribonuclease I: cortam cadeias simples ou duplas.

Quando se utilizam nucleases in vitro tem que se ter ateno ao tempo de incubao pois estas enzimas so
inespecficas e degradam todo o DNA indiferentemente.

DNAse I actua apenas em molculas de DNA pelo que bastante til quando se quer obter apenas RNA.

Polimerases

Polimerases sintetizam novas cadeias de DNA complementares a cadeias de DNA/RNA molde (cadeias
simples pr-existentes). A maioria necessita de um primer (iniciador) regio de cadeia dupla onde se liga a
enzima para iniciar a polimerizao.

Exemplos de polimerases usados em Engenharia Gentica:

DNA polimerase I: liga-se a pequenas zonas de cadeia simples (nicks) de molculas maioritariamente de cadeia
dupla. Sintetiza uma nova cadeia, no sentido 5 3, degradando a cadeia j existente medida que avana
acumula funo de exonuclease no sentido 5 3 (bifuncional).

Em Eng. Gentica isolou-se apenas a parte da pol I com actividade de polimerase, a que se chamou
fragmento Knelow. Evita-se o desperdcio de dNTPs devido actividade da nuclease.

Usa-se frequentemente este fragmento para sintetizar extremidades de fragmentos e transformar


extremidades coesivas em cegas, compatveis com vectores de extremidades cegas.

Polimerases deixam um nick no incio da cadeia que sintetizam. Esse nick corrigido por ligases.

Taq polimerase provm do organismo Thermus aquaticus e termoestvel (resistente desnaturao pelo
calor), sendo a sua temperatura de ~70C. por isso usada em PCR.

Tem a desvantagem de cometer 1 erro por cada 1000 nucletidos. Podem usar-se outras enzimas
termoestveis e que so proofreading. Reconhecem e corrigem erros de replicao. Tm actividade de
endonuclease 3 5. I.e.: Pfu (Pyrococcus furiosus), Pwo (Pyrococcus woosi) e Tma (Thermologa maritima).

12
Transcriptase reversa utiliza moldes de RNA para sintetizar DNA. Est envolvida na replicao de vrus
(retrovrus, i.e. HIV) e utilizada na tcnica de DNA complementar (cDNA).

Permite a clonagem de genes e a sua transferncia de eucariotas para procariotas: a partir de RNA processado
(j sem intres) sintetizada uma cadeia de DNA complementar. Essa cadeia simples pode ser ento
transformada em cadeia dupla de DNA, que agora contm o gene de interesse.

Enzimas que actuam nas extremidades


Estas enzimas actuam no DNA removendo ou adicionando grupos qumicos especficos.

Fosfatase alcalina remove grupos fosfato das extremidades 5 de molculas de DNA. utilizada, por exemplo,
para impedir que vectores de DNA digeridos por endonucleases de restrio voltem a recircularizar.

Quando um vector restringido a probabilidade deste recircularizar superior de ser inserido um fragmento
de DNA pois a insero requer duas ligaes e no apenas uma. Ao eliminar os fosfatos 5 a enzima ligase
deixa de poder actuar e o vector no recirculariza. O fragmento de DNA exgeno (no tratado) contm
extremidades com fosfato e, portanto, consegue ligar-se a uma das cadeias do vector. Na outra cadeia fica um
nick, mas ainda assim a molcula suficientemente estvel para entrar na clula hospedeira, onde os
mecanismos de reparao da mesma vo corrigir o nick.

Transferase terminal adiciona nucletidos no terminal 3 de uma molcula de DNA (actua no sentido 5 3).
muito utilizada para adicionar caudas de homopolmeros a molculas de cDNA para poderem ser clonadas em
vectores.

Clonagem com extremidades coesivas mais eficiente do que com extremidades cegas. Incuba-se o
vector e o fragmento a inserir em meio contendo a enzima transferase terminal e um tipo de nucletidos
(nucletidos complementares em cada meio). Vo ser sintetizadas caudas que funcionam depois como
extremidades coesivas complementares aumenta a eficincia de insero.

Endonucleases de Restrio

Endonucleases de restrio reconhecem determinadas sequncias de DNA e hidrolisam as cadeias nesse


local, dando origem a dois fragmentos . DNA pode ser protegido da aco destas enzimas atravs de metilao.
No actuam em RNA e so sintetizadas, provavelmente, por todas as bactrias.

Experincia, com fagos, que permitiu a identificao das endonucleases de restrio:

E. coli K: tem sistemas de modificao-restrio.

E. coli C: no tem sistemas de modificao-restrio.

13
Um fago no metilado inserido em:

E. coli K: fago reconhecido como DNA intruso e restringido.


E. coli C: fago no reconhecido como estranho e replicado pelos mecanismos da clula. Provoca a lise
das clulas. Os fagos libertados no esto metilados.

Fago metilado inserido em:

E. coli K: o fago metilado est protegido da restrio e, portanto, infecta as clulas, provocando a sua
lise e a libertao de fagos metilados (esta E. coli tem sistema de modificao) que podem infectar E.coli K e C.
E. coli C: mesmo metilado, o fago replicado (esta E. coli no tem mecanismo de restrio) e a clula
infectada, produz mais fagos e sofre lise.

Nomenclatura o nome das endonucleases transmite informao acerca da sua origem.

ABCD

A: 1 letra do gnero

B C: 1 e 2 letras da espcie

D: ordem de isolamento

I.e. Hind II: Hemophilus influenzae, estirpe d, 2 enzima identificada.

Tipos de endonucleases (sistemas modificao-restrio)

Tipo I: uma enzima com diferentes subunidades para reconhecimento, clivagem e metilao. Reconhece
e metila sequncias especficas mas metila at 1000bp frente.
Tipo II: duas enzimas (uma cliva, outra modifica) que reconhecem a mesma sequncia simtrica.
Tipo III: uma enzima com duas subunidades, uma para reconhecimento e modificao, e outra para
clivagem. Reconhece e metila a mesma sequncia, mas cliva 24-26bp depois.
Tipo IV: duas enzimas e local de reconhecimento assimtrico. Clivagem ocorre num dos lados da
sequncia de reconhecimento mas afastado at 20bp.
Tipo V: o mais usado em Eng. Gentica pois as endonucleases no tm a funo de metilao (essa
funo desempenhada por outra enzima do sistema M-R). Reconhecem sequncias simtricas de 6
nucletidos (geralmente) e cortam no meio.

5 C G A T C G 3 leitura 5 3 igual nas duas cadeias

3 G C T A G C 5

Algumas enzimas reconhecem sequncias degeneradas, i.e., que contm locais onde pode existir
qualquer base.

Hinf I reconhece G A N T C. N pode ser qualquer base.

Enzimas de restrio que tm a mesma especificidade (mesmo local de restrio mas provm de
organismos diferentes) designam-se isosquizmeros.

14
Tipos de extremidades

Cegas: enzimas cortam a cadeia dupla de DNA no meio da sequncia de reconhecimento.

NNAGCTNN Alu I NNAG CTNN

NNTCGANN NNCT GANN

Coesivas: enzimas cortam cada cadeia de DNA num local especfico, espaado de 2 a 4 nucletidos,
originando extremidades de cadeia simples.

NNGAATTCNN EcoR I NNG AATTCNN

NNCTTAAGNN NNCTTAA GNN

Endonucleases com diferentes locais de restrio podem produzir as mesmas extremidades coesivas.
Permite que se restrinjam vectores e fragmentos com enzimas diferentes e que as suas extremidades sejam
complementares. No entanto, o vector recombinado obtido pode no ser reconhecido por nenhuma das
endonucleases originais.

Extremidades coesivas so mais eficientes para clonagem. A complementaridade de bases estabiliza


associaes entre fragmentos diferentes (associaes intermoleculares) mas tambm promove associaes
intramoleculares pois torna mais fcil a recircularizao de vectores.

No se sabe ao certo quantos locais de restrio existem numa molcula de DNA para determinada
enzima. Pode prever-se 1 local em cada 44 ou 46 nucletidos para sequncias de restrio de 4 ou 6 bases. No
entanto, estes valores no so exactos, sabendo-se at que o contedo GC de uma sequncia afecta o seu
reconhecimento por diferentes endonucleases. Sequncias ricas em GC tm menos probabilidade de apresentar
sequncias de restrio AT.

A frequncia de locais de restrio determina o nmero e tamanho dos fragmentos restringidos.

Digesto de restrio in vitro

1) Obter DNA (DNA cromossmico, fago, plasmdeo, etc).


2) Adicionar tampo de restrio:
Tris pH 7,4;
MgCl2 Mg2+ necessrio para activar endonucleases;
NaCl acertar potencial inico;
Dithiothreitol estabiliza a enzima e previne inactivao.
3) Introduzir enzima de restrio e incubar a temperatura ptima para a enzima.
4) Parar a reaco: 70 C ou fenol ou EDTA desnatura a enzima ou precipitar DNA lcool e centrifugar.

15
Para determinar o nmero e tamanho dos fragmentos de restrio corre-se o preparado por um gel de
electroforese.

Pode desenhar-se um mapa de restrio onde figuram os locais de restrio de vrias enzimas. Estes
mapas permitem seleccionar as endonucleases a usar nos processos de clonagem.

Construo de um mapa de restrio

Digerir o DNA alvo com enzimas isoladas (digesto simples) e com combinaes (duplas, triplas,);
Determinar o nmero e tamanho dos fragmentos para cada digesto;
Dispor os fragmentos na ordem correcta.

Ligases e ligao de DNA

Ligases so enzimas que fazem a ligao entre fragmentos de DNA passo final na construo de uma
molcula recombinante, na replicao ou recombinao. Promovem a formao de uma ligao fosfodister
entre nucletidos, podendo necessitar de ATP. adicionado ao tampo da enzima. No pode ser congelado
muitas vezes. Nem todas as ligases utilizam os mesmos co-factores.

Em Eng. Gentica usa-se uma ligase purificada a partir de E. coli infectada pelo fago T4, pois esta enzima
tem uma capacidade de catlise elevada.

A ligao de extremidades cegas no muito eficiente pois requer que a ligase e as pontas dos dois
fragmentos estejam simultaneamente prximas. Para aumentar a eficincia da ligao pode:

Aumentar-se a concentrao do fragmento em relao do vector (1:10);


Baixar-se a temperatura at 16 C apesar de esta no ser a temperatura ptima da enzima e da
actividade da enzima ser menor, como a agitao molecular menor h maior probabilidade de os fragmentos e
a ligase se encontrarem e estabelecerem ligao.
Adicionar-se glicerol torna a mistura mais viscosa e limita o movimento das molculas.
Aumentar-se um pouco a concentrao da enzima aumentar demasiado no conveniente porque a
reaco acaba por ser inibida.
Transformar-se as pontas cegas em coesivas. A complementaridade que se estabelece entre as
extremidades fornece uma base estvel para a aco da ligase.

Podem obter-se extremidades coesivas atravs de vrios processos:

Linkers:
Pequenos fragmentos de DNA de cadeia dupla sintetizados in vitro, que tm uma sequncia de
nucletidos que contm locais de restrio para uma ou mais endonucleases.
Os linkers so ligados a ambas as extremidades cegas do fragmento de DNA (por aco de uma
ligase) e de seguida so submetidos a digesto de restrio de modo a produzir extremidades
coesivas.
O fragmento obtido pode ento ser ligado a um vector restringido pela mesma endonuclease.

16
Problema: se existir um local de restrio igual ao do linker no meio do DNA.

Adaptadores:
Pequenos fragmentos de oligonucletidos sintticos que tm uma extremidade cega e outra
extremidade coesiva (correspondente a um local de restrio). Para que os adaptadores no se
liguem entre si extremidade coesiva 5 foi retirado o grupo fosfato (fosfatase alcalina).
Os adaptadores so incubados com o DNA alvo e ligam-se s suas extremidades. Tratamento
com a enzima cinase polinucleotdica fosforila a posio 5 (adiciona um grupo PO32-) e o
fragmento de DNA fica pronto a ser introduzido num vector (restringido com a mesma
endonuclease relativa ao adaptador).

Alguns adaptadores contm locais de restrio adicionais, de modo a facilitar processos de clonagem.

Caudas de homopolmeros:
Adiciona-se um tipo de nucletidos aos terminais 3 do fragmento de DNA e adicionam-se
nucletidos complementares aos terminais 3 do vector de clonagem (a reaco feita por
enzimas terminal-transferases).
As extremidades coesivas das duas molculas so complementares e podem emparelhar,
permitindo depois a aco do fragmento Knelow (caso fique algum nick) e da ligase.

O tamanho das caudas no muito relevante.

Introduo de DNA em clulas vivas

O prximo passo na clonagem de um gene a introduo do DNA recombinado em clulas vivas para
que este possa ser amplificado e purificado.

A purificao necessria pois a amplificao de DNA via culturas de hospedeiros origina vrios tipos de
colnias:

Colnias com self-ligated vector. O vector ligou-se a si prprio, recircularizou.


Colnias com DNA recombinado errado. Um fragmento de DNA diferente do de interesse, ou ligado de
forma errada.
Colnias com o DNA recombinado desejado.

Para isolar os diferentes tipos de fragmentos introduzem-se em clulas vivas (que geralmente s captam um
vector) e cultivam-se em meio selectivo (seleco depende do vector e do hospedeiro).

17
Tcnicas de introduo de DNA em bactrias

O DNA recombinado pode ser introduzido em clulas vivas por diversos mtodos.

Transformao

A transformao o processo natural de captao de DNA por bactrias. Algumas bactrias (como
Streptococcus, Bacillus, Pseudomonas) so naturalmente competentes e adquirem espontaneamente
fragmentos livres de DNA presentes no meio ou, atravs de um processo activo, lisam outras clulas para
obterem o seu DNA.

A competncia apenas se manifesta quando as bactrias se encontram sob stress, como no caso da falta
de nutrientes ou presena de antibiticos. Mecanismo de sobrevivncia. Englobam DNA na esperana que
alguns dos fragmentos lhes possam conferir vantagem no ambiente adverso.

Nem todas as transformaes so estveis e, portanto, nem todos os fragmentos se mantm nas clulas
que os captam.

Fragmentos lineares tm maior probabilidade de serem degradados porque no tm origem de replicao e


podem ser reconhecidos pelos sistemas de restrio bacterianos. No entanto, se uma regio do fragmento tiver
homologia com uma regio do cromossoma pode ocorrer recombinao e o DNA exgeno incorporado no
genoma.

No caso dos plasmdeos, como estes apresentam uma origem de replicao, podem manter-se na clula
sem necessidade de se integrarem no cromossoma.

Mecanismo de transformao natural

Fragmento de DNA liga-se parede da bactria por adeso de uma das cadeias. H formao de um
pilus ao qual o DNA se liga por atraco electrosttica. Cargas negativas do DNA interagem com cargas positivas
dos aminocidos do pilus.
Pilus retrai-se e o DNA fica em contacto com o periplasma (entre a membrana plasmtica e a membrana
externa) e o peptidoglicano. Est no interior da parede celular.
Uma endonuclease corta o DNA em fragmentos mais pequenos (15-40Kb). H um limite para o tamanho
dos fragmentos que entram na clula. H um limite para o tamanho dos fragmentos que entram na clula. Uma
nuclease degrada a cadeia dupla, obtendo-se ssDNA.
A cadeia simples entra na clula por transporte activo e associada a ssB-proteins, no sendo
degradada. O sistema Rec-A procura regies homlogas no cromossoma e se no encontrar nenhuma o DNA
acaba por ser destrudo.

18
Transformao artificial, clssica ou qumica

Bactrias E. coli no naturalmente competentes podem ser induzidas a tornar-se competentes. Para tal:

Recolhem-se clulas numa fase de crescimento activo (fase exponencial).


Centrifuga-se para recolher as bactrias.
Fazem-se ressuspenses sucessivas numa soluo de CaCl2 e banhos de gelo. Tambm se usa Mg. CaCl2
afecta a parede celular e pode ser responsvel pela ligao do DNA superfcie celular. O seu mecanismo de
aco no bem conhecido.
Podem guardar-se as clulas a -80C at posterior utilizao (guardar at 1 ano).
Em banho de gelo, introduzir mistura de ligao que contm o plasmdeo de interesse.
Choque-trmico: 3 minutos a 43C. Apesar de as clulas j estarem competentes o DNA s captado
quando a mistura submetida a choque trmico.
Plaquear a mistura em meio selectivo para a seleco de colones.

A frequncia de transformao baixa (0,01%) e varia com o tamanho dos fragmentos: ideal para
cadeias <10Kb e praticamente nula para fragmentos >50Kb.

importante eliminar os sistemas de restrio de estirpes usadas para recombinao. Evita-se a


degradao dos fragmentos introduzidos, possibilitando a sua clonagem.

Electrotransformao (ou electroporao)

A electrotransformao um mtodo fsico de introduo de DNA em clulas (bactrias, clulas animais


ou vegetais) no qual um pulso elctrico curto e de elevada voltagem aplicado s clulas, criando poros na
membrana plasmtica. O DNA de interesse, que se encontra em suspenso, entra por esses poros e mantm-se
no interior da clula aps reestruturao da membrana.

Esta tcnica rpida e simples mas tem que ser ajustada a cada tipo de organismo, uma vez que os
parmetros elctricos, como a voltagem e a resistncia, no so universais.

Embora no seja o mtodo ideal, a electrotransformao tem uma eficincia superior transformao
clssica. Entre os factores que afectam a eficincia pode destacar-se:

Temperatura;
Parmetros elctricos;
Topologia do DNA: quanto mais pequenos e mais enrolados estiverem os plasmdeos maior a
eficincia.
Clula hospedeira: condies de crescimento, sistemas de restrio, patrimnio gentico, etc.

19
Procedimento experimental
Recolher clulas numa fase de crescimento exponencial.
Centrifugar e recolher clulas.
Ressuspender clulas em gua estril e colocar em banho de gelo. Lavar as clulas vrias vezes com
gua estril/destilada elimina os sais presentes no meio e evita curto-circuito.
Adicionar DNA plasmdico e submeter choque. No deixar bolhas de ar na soluo para evitar curto-
circuito.
Adicionar imediatamente um meio nutritivo. Para promover recuperao celular.
Seleccionar transformantes. Usar meio selectivo.

Conjugao bacteriana

A conjugao bacteriana um processo de transferncia de DNA entre clulas por contacto fsico clula-a-
clula atravs de um canal proteico, o pilus sexual. As protenas necessrias para a sntese do pilus so
codificadas em plasmdeos conjugativos (tra+ mob+), como o factor F+ (fertilidade), um plasmdeo natural de E.
coli. Este plasmdeo tem 2 origens de replicao:

Ori T: origem de transferncia: local reconhecido por uma enzima (endonuclease Tray) que faz um nick
no DNA de cadeia dupla e d incio ao processo de transferncia pelo mtodo do circulo rolante.
Ori: origem de replicao do plasmdeo.

O factor F um plasmdeo bastante grande pelo que foi reduzido para poder ser mais facilmente utilizado
em Eng. Gentica.

Conjugao Triparental

A conjugao triparental utiliza 3 estirpes de bactrias:

Dadora: mob+tra-, contm um gene de interesse.


Ajudante: mob+tra+ e de baixa gama de hospedeiro (plasmdeos no se replicam na estirpe receptora).
Esta estirpe apenas um intermedirio.
Receptora: onde o gene de interesse se vai replicar.

A estirpe dadora adquire o plasmdeo tra+mob+ e fica conjugativa, podendo transferir o seu plasmdeo, que
contm o gene de interesse, para a estirpe receptora.

Usa-se meio selectivo que s permite a sobrevivncia da estirpe receptora. i.e. meio PIA, E. coli no
sobrevive, Pseudomonas sobrevive. (LAB1)

20
Conjugao Biparental

A conjugao biparental utiliza apenas duas estirpes de bactrias:

Dadora: tem gene tra+ no cromossoma e plasmdeo de interesse com gene mob+.
Receptora: no tem gene tra+ e recebe o plasmdeo de interesse por conjugao com a estirpe dadora.

Se a conjugao for feita sobre uma membrana em vez de ser em suspenso obtm-se resultados mais rpidos
porque a proximidade entre as bactrias facilita a formao dos tubos de conjugao.

Introduo de fagos em bactrias

Transfeco

A transfeco o processo equivalente transformao, mas para DNA de fagos.

Qualquer fragmento de DNA pode formar um fago desde que esteja na presena das protenas da
cpsula. O fago monta-se automaticamente. Este facto aproveitado em Eng. Gentica para se introduzirem
molculas de DNA grandes (45-50Kb) em bactrias, uma vez que este processo mais eficiente que
electroporao ou transformao.

Para molculas pequenas a eficincia de electrotransformao e transformao aceitvel e utilizam-se esses


mtodos por serem mais fceis de aplicar.

As protenas da cpsula do fago podem ser obtidas de vrios modos:

Ao introduzir uma mutao nos locais cos do fago impede-se a aco da nuclease e no so gerados os
vrios fragmentos de DNA do fago. As protenas da cpsula so sintetizadas mas no se faz a montagem dos
seus componentes. Induzindo-se a lise celular obtm-se os diversos componentes da cpside, que podem ser
usados para o empacotamento in vitro.
Utilizam-se duas estirpes independentes de E. coli infectadas com fago mas cada estirpe s produz um
tipo de protenas (da cpsula ou da cauda), pelo que os fagos produzidos no so funcionais. De cada estirpe
extrai-se um dos componentes, que podem ser juntos in vitro.

Introduo de DNA em organismos eucariotas

Introduo de DNA em Saccharomyces cerevisae

Cultivar leveduras at crescimento exponencial.


Fragilizar a parede celular. Tratar com acetato de ltio ou de csio ou electrotransformao (meno
usado).
Adicionar DNA plasmdico, fragmentos de DNA, histamina, PEG e TE/Cation MIXX (d viscosidade ao
meio e facilita a aderncia do DNA clula).
Choque trmico (30 minutos, 37C).
Cultivar em meio nutritivo.

21
Introduo de DNA em clulas animais

A introduo de DNA em clulas animais pode ser feita por vrios mtodos:

Transferncia fsica (transfeco fsica):


Micro-injeco;
Bombardeamento de partculas;
Electroporao;
Ultrassons.
Transfeco mediada quimicamente.
Transduo (introduo por vrus).
Transferncia mediada por bactrias.

Nos mtodos de transfeco fsica o DNA introduzido por meios fsicos, que incluem:

Micro-injeco: utilizado apenas em clulas eucariotas grandes e um mtodo invasivo mas rpido.
Uma soluo de DNA de interesse injectada directamente no ncleo da clula por meio de uma agulha ou
pipeta muito fina.
Bombardeamento de partculas (biolstica): esta tcnica foi inicialmente desenvolvida para clulas
vegetais e consiste no bombardeamento, a alta velocidade, de microprojecteis partculas de ouro ou
tungstnio revestidas com o DNA que se quer introduzir na direco das clulas. O DNA exposto adere
superfcie das clulas-alvo e difunde-se atravs da membrana chegando eventualmente ao ncleo e integrando-
se.
Ultrassons: os ultrassons so usados para abrir poros na membrana celular e permitir a entrada de DNA.
Tem que se ter ateno frequncia utilizada pois para frequncias demasiado altas as clulas acabam por lisar.
Electrotransformao: corrente elctrica usada para abrir poros na membrana celular. Quando
comparada com a electrotransformao de bactrias, para clulas animais o pulso aplicado dever ser mais
longo e de menor intensidade (devido dimenso das clulas).

Os mtodos de transfeco qumica incluem:

Clcio-fosfato: com as clulas dispostas em monocamada, adiciona-se fosfato de clcio soluo de


DNA em suspenso e este precipita sobre a superfcie celular, ficando em contacto com as clulas que, por
endocitose, o captam. Eventualmente o DNA chega ao ncleo. Ateno, muito importante que as clulas
estejam em monocamada e no em aglomerados pois apenas as clulas em contacto com o DNA precipitado o
vo precipitar. Quando funciona, esta tcnica muito barata.
Lipossomas: o DNA de interesse inserido em vesculas lipdicas (lipossomas) que se fundem com a
membrana das clulas e permitem a captao de DNA e a sua libertao no citoplasma. DNA entra
eventualmente no ncleo. Criar lipossomas: adicionam-se lpidos a uma soluo de DNA e criam-se micelas
espontaneamente. Algumas dessas micelas vo conter o DNA que queremos introduzir.

A transduo a introduo de DNA em clulas por meio de um vrus. O DNA exgeno adicionado ao
genoma completo do vrus ou usado para substituir um ou mais genes virais, sendo depois introduzido nas
clulas atravs dos mecanismo naturais de infeco viral.

22
Na transferncia mediada por bactrias (bactofection) o DNA-alvo adicionado, na forma de
plasmdeo, a uma bactria que, seguidamente, infecta uma clula animal, transferindo o DNA para o seu
interior.

A introduo de DNA em clulas animais no permite a criao de microrganismos geneticamente modificados.


Para isso seria necessrio transformar clulas embrionrias.

Introduo de DNA em clulas vegetais

Tal como para a introduo de DNA em clulas animais, existem 4 tcnicas fundamentais para a
introduo de DNA em clulas vegetais:

Mtodos fsicos directos

No bombardeamento de partculas utilizam-se normalmente protoplastos (clulas sem parede celular),


mas tambm se podem usar clulas normais. Em qualquer mtodo fsico mais eficiente usar-se plasmdeos (de
preferncia super-enrolados) do que DNA linear. Uma vez no ncleo, o DNA exgeno integra o cromossoma por
um mecanismo de recombinao no homloga que ainda no bem conhecido.

Transferncia qumica directa

Polietileno-glicol: baseia-se no mesmo princpio da precipitao do DNA. No entanto, necessrio tratar


primeiro as clulas de modo a remover a sua parede celular (ficam protoplastos) para que o DNA possa ser
endocitado. No fim da transformao, a parede celular tem de voltar a ser formada.

Transduo viral

Semelhante ao descrito para as clulas animais.

Transferncia mediada por bactrias

Nomeadamente por Agrobacterium tumefaciens. Esta bactria encontra-se junto s razes das plantas e
quando a planta tem um corte, que exponha as suas clulas ao exterior, a bactria infecta essas mesmas clulas.

Estas bactrias possuem o plasmdeo Ti (tumor induction) que responsvel por provocar o crescimento
descontrolado das clulas que infecta. Este plasmdeo contm uma regio, T-DNA, que copiada para o genoma
das clulas. Nesta regio existem genes onc responsveis pela formao de tumores e pela sntese de opinas,
compostos usados como fonte de energia pela bactria.

Em Eng. Gentica introduzem-se genes de interesse na regio do T-DNA de modo a que estes sejam
integrados no genoma da planta. comum alterarem-se os genes onc para evitar o crescimento celular
descontrolado.

Apesar de til, este mtodo apenas permite a transformao de clulas na zona de corte, o que no
vivel quando se quer produzir uma planta totalmente transgnica. Para isso necessrio infectar uma cultura
de clulas, cujos transformantes vo dar origem a novas plantas, j com as caractersticas desejadas.

23
Inocula-se uma suspenso celular com a bactria transformante e seleccionam-se as clulas
transformantes, que so cultivadas num meio nutritivo e com um cocktail de hormonas. O plasmdeo Ti
recombinado no tem genes onc e tem uma marca de seleco que permita identificar as clulas transgnicas.

No entanto, este mtodo no funciona em todos os tipos de plantas.

PCR Polymerase Chain Reaction

Uma reaco de PCR resulta na amplificao selectiva de uma dada regio do DNA. As fronteiras da regio a
amplificar tm que ser conhecidas e tm que ser sintetizados dois pequenos oligonucletidos (primers) que
delimitem essa regio, para que a polimerase possa iniciar a replicao das cadeias do DNA.

Passos da PCR
Desnaturar DNA por aumento da temperatura (at 94-95C).
Hibridao dos primers a temperatura de annealing (50-65C) temperatura utilizada depende das
caractersticas dos primers.
Extenso das cadeias, a 72C, pela enzima Taq polimerase termoestvel e provm do organismo
Thermus aquaticus. No proofreading. Repetem-se 25 a 30 ciclos.
Extenso final permite a sntese de cadeias que possam ter ficado incompletas.

Em cada ciclo so sintetizadas o dobro das cadeias iniciais. Por cada molcula dupla de DNA so
sintetizadas duas molculas. No final da reaco tm-se 2n-2 fragmentos (n o nmero de ciclos e a base 2
provm do facto de nos primeiros dois ciclos serem obtidas duas molculas longas) de DNA alvo.

Material necessrio
H20
dNTPs
Primers
DNA alvo
Taq polimerase
Tampo (enzima)
MgCl2 (cofactor da enzima)

Misturam-se todos os componentes no tubo de PCR. Estes tubos tm tamanho reduzido para que a temperatura
no seu interior seja sempre mais ou menos homognea.

24
Design de primers

Os primers so o ponto-chave para o sucesso da PCR. Se os primers forem mal escolhidos pode no se
obter qualquer produto de PCR ou pode obter-se um ou mais fragmentos errados.

Os primers devem flanquear a regio do DNA que se quer amplificar e serem complementares cadeia
para a qual serviro de molde durante a replicao.

Primer codificante: permite a sntese da cadeia superior, no sentido 5 3. Lido directamente na sequncia
alvo. Primer codificante upper primer.

Primer no-codificante: permite a sntese da cadeia complementar, tambm no sentido 5 3. Complementar


regio final da cadeia alvo que surge com a ordem dos nucletidos invertida.

Primer codificante

5 GTAGCCTAATCCGGATCGT TAGCCTGCAA 3

3 CATCGGATTAGGCCTAGCAATCGGACGTT 5

complementar ao primer no codificante e sequncia invertida

Primer codificante: 5 CTAATCC 3

Primer no-codificante: 5 TCCGAT 3

Nota: os primers no devem ser complementares entre si para no hibridarem um com o outro.

Para garantir a eficincia da reaco de PCR os fragmentos amplificados no devem ser inferiores a 1Kb
nem superiores a 3Kb, embora seja possvel utilizar fragmentos com at 10Kb. Amplificao de fragmentos
maiores requer mtodos especiais.

Um dos primeiros aspectos a ter em conta aquando da escolha de primers o seu tamanho. Primers
demasiado pequenos podem hibridar com vrias zonas e dar origem a produtos indesejados.

8-mer (primer com 8 nucletidos) pode hibridar, estatisticamente, em 46000 locais do genoma humano. J um
17-mer espera-se que apenas encontre uma sequncia complementar em todo o genoma menos provvel
que origine produtos inespecficos.

No entanto, primers demasiado longos tambm no so aconselhveis porque levam mais tempo a
hibridar e diminuem a eficincia da PCR. Na prtica no se utilizam primers com mais de 30 nucletidos. No s
devido diminuio da eficincia da reaco mas tambm porque so muito mais caros de sintetizar.

A temperatura de ligao dos iniciadores tambm muito importante. Deve ser suficientemente alta
para que hibridaes no perfeitas sejam instveis mas no deve ultrapassar a temperatura de fuso dos
primers (Tm), qual eles se mantm sempre dissociados do DNA. 1-2C abaixo da Tm considerada a
temperatura ideal de ligao.

Os primers devem ainda ser desenhados de modo a que os primers codificantes e no-codificantes
tenham temperaturas de ligao semelhantes. Pode jogar-se com o tamanho dos primers.

25
Tm pode ser determinada pela frmula:

Nem sempre se conhece a sequncia do DNA que se quer amplificar pelo que tm que se desenhar os
primers recorrendo sequncia de aminocidos da protena codificada por esse mesmo DNA.

Comparam-se protenas de vrios organismos e identificam-se as zonas consenso (tm os mesmos


aminocidos) e os genes homlogos. A partir da sequncia de aminocidos obtm-se a sequncia de nucletidos
possveis (tem de se ter em conta a degenerescncia do cdigo gentico) e podem ento desenhar-se os
primers.

Nos locais em que podem estar presentes vrias bases utilizam-se bases degeneradas (que emparelham
com qualquer nucletido), como a inosina. Aos primers assim formados d-se o nome de primers degenerados.

Principais regras para o design de primers:

Comprimento 17-28 bases.


Contedo CG de 50-60%.
Terminao 3 com C, G, CG ou GC aumenta eficincia ligao C G estvel para a polimerase.
Tms entre 55 e 80C.
Extremidades 3 no devem ser complementares para evitar a formao de dmeros.
Deve evitar-se complementaridades entre primers para impedir a formao de estruturas secundrias.
Evitar sequncias de 3 ou mais Cs e Gs nas extremidades 3 promovem erros de ligao em
sequncias com contedo CG elevado.

Produtos de PCR

Os produtos de PCR so usados principalmente para 3 fins:

Electroforese em gel;
Clonagem;
Sequenciao.

A clonagem de um produto de PCR no to simples como pode parecer pois a Taq polimerase adiciona
um nucletido, geralmente adeninas, extremidade 3 de cada cadeia que sintetiza, dando origem a fragmentos
de extremidades no cegas.

Para ultrapassar este facto, pode usar-se uma exonuclease para remover as bases extra, mas difcil
prevenir que o DNA de interesse no seja tambm digerido. Pode tambm utilizar-se um vector que tenha
projeces de timina, de modo a que estas emparelhem com as adeninas do fragmento de PCR.

26
No entanto, uma das solues mais utilizadas o design de primers que j incluem locais de restrio na
regio 5. Desde que a extremidade 3 do primer tenha cerca de 70% de complementaridade, o primer hbrida
com a molcula de DNA alvo inicial, permitindo que a regio de restrio seja copiada para os produtos finais de
PCR. Esses produtos podem depois ser restringidos e ligados a vectores com extremidades coesivas.

Vectores de Clonagem
Vectores de clonagem para E. coli

Plasmdeos

Nomenclatura:

pBR322

p: plasmdeo
BR: laboratrio onde foi construdo, cientistas que o desenvolveram
322: distino entre plasmdeos do mesmo laboratrio

pBR322 foi um dos primeiros plasmdeos a serem construdos e apresenta algumas caractersticas muito teis:

pequeno (4363 bp) permite clonagem de fragmentos com 6Kbp e clonado facilmente.
Tem duas marcas de seleco (resistncia a ampicilina e tetraciclina) cada uma com um local de
restrio nico.
Tem vrios locais de restrio nicos que permitem clonar genes com vrios tipos de extremidades
coesivas.
Tem um nmero de cpias razoavelmente elevado e que pode ser aumentado na presena de um
inibidor da sntese proteica, o cloranfenicol (at 1000-3000 cpias).

No entanto, este plasmdeo conjugativo, o que pode no ser muito benfico devido transferncia
indesejada de genes entre espcies.

O plasmdeo pBR322 foi construdo a partir de 3 plasmdeos naturais de E. coli que forneceram:

R1: ampR
R6.5: tetR
pMB1: ori

A seleco de transformantes utilizando-se pBR322 pode ser feita atravs da resistncia ampicilina ou
tetraciclina.

Suponhamos que restringimos o vector com BamHI e introduzimos o gene de interesse na regio que
codifica o gene tetR. As clulas transformantes vo possuir apenas resistncia ampicilina, mas este antibitico
no pode ser usado unicamente para a seleco porque tambm o vector tem ampR. Para ultrapassar este

27
problema fazem-se dois riscados de colnias transformantes em placas contendo meio nutritivo e amp ou tet.
As colnias que no crescerem em meio com tetraciclina so as que desejamos e podemos isol-las a partir do
meio apenas com ampicilina.

Amp Tet
(1) (2)

Estas colnias no crescem em meio com tetraciclina, portanto, so


transformantes. So isoladas a partir da placa 1.

Se clonssemos o gene utilizando a enzima PstI iramos alterar o gene de resistncia ampicilina em vez de
tetraciclina e o processo de seleco seria anlogo.

Se clonssemos o gene utilizando EcoRI no eliminaramos nenhuma marca de seleco e o processo de


seleco das bactrias transformantes seria mais complicado. Poderia ter que se correr o DNA das clulas num
gel para determinar a sua massa molecular.

O plasmdeo pUC8 tem outro tipo de caractersticas:

Elevado nmero de cpias (500-700 por clula).


Identificao de recombinantes num nico passo uso do gene LacZ.
Locais de restrio aglomerados numa nica regio e que permitem que as duas extremidades dos
fragmentos sejam cortadas por enzimas diferentes.
Resistncia ampicilina.

28
A seleco de recombinantes em pUC8 envolve o gene LacZ. Este gene codifica a sntese da protena -
galactosidase, envolvida na degradao da lactose em glucose e galactose.

Algumas estirpes de E. coli tm o gene LacZ modificado no seu genoma e s so capazes de metabolizar
a lactose na presena de plasmdeos, como o pUC8. Em Eng. Gentica utilizam-se estas estirpes para seleccionar
recombinantes, juntamente com um composto anlogo lactose, a X-gal, mas que adquire a cor azul quando
degradado pela -galactosidase, permitindo a identificao de colnias.

A insero de um gene no vector pUC8 inactiva o gene LacZ, o que significa que colnias recombinantes
cultivadas em meio com X-gal no vo ficar azuis. A seleco pode ento ser feita num meio nutritivo com
ampicilina (sobrevivem apenas as clulas transformantes) e X-gal (as colnias brancas so as recombinantes).

Agar + X-gal + IPTG

Recombinantes

No-recombinantes

Vectores de clonagem baseados no fago M13

Os fagos contm genes necessrios replicao codificados em genes das protenas da cpsula, pelo
que no se pode eliminar essas regies. Deste modo, a liberdade para modificar fagos fica mais restringida e s
se conseguem clonar genes pequenos, at 1,5Kb.

No entanto, clonagem em vectores M13 importante pois obtm-se fragmentos de DNA de cadeia
simples, muito utilizadas para sequenciao e mutagnese dirigida.

M13mp7 um vector baseado no fago M13 e que apresenta vrias caractersticas:

Genoma do fago.
Gene LacZ que permite a seleco de recombinates.
Polylinker local mltiplo de clonagem, no interior do LacZ. Tem locais de restrio para EcoRI, BamHI,
SalI e PstI.

29
O mtodo de seleco utilizado para o M13mp7 semelhante ao do pUC8, embora no se tenha
resistncia a ampicilina para seleccionar os transformantes.

Cultivam-se as clulas num meio nutritivo com X-gal e as colnias recombinantes so as pequenas e
brancas: colnias brancas porque significa que o gene LacZ no est funcional e pequenas porque esse facto
indica que as clulas crescem menos devido ao peso metablico adicional do plasmdeo.

Colnias brancas e grandes: no captaram o vector no so sequer transformantes.

Fagemdeo (i.e., pEMBL8) um vector hbrido entre um plasmdeo e um fago M13 criado de modo a permitir a
clonagem de genes de dimenso superior s 1,5Kbp permitidas pelo M13pm7.

A regio de replicao do fago, sem as protenas da cpsula mas contendo uma zona reconhecida pelas
enzimas que transformam o DNA em cadeia simples, inserida num plasmdeo como o pUC8, que apresenta os
genes LacZ e ampR.

Como um fagemdeo no contm a informao relativa sntese das protenas da cpsula, quando se
quer obter um fago tem que se infectar as clulas com um fago ajudante. mais fcil extrair o DNA utilizando as
caractersticas do fago.

Com o fagemdeo pEMBL8 podem clonar-se fragmentos de DNA de cadeia simples com 6Kbp.

30
Vectores de clonagem baseados no fago

Antes de se desenvolverem vectores baseados no fago foi necessrio resolver dois problemas:

S se podiam adicionar fragmentos com 3Kbp fragmentos maiores tornam o fago demasiado grande
para ser encapsulado.
No existiam locais de restrio nicos.

A eliminao de uma regio essencial do genoma do fago, responsvel pela integrao do fago no DNA
cromossmico e sua posterior exciso, permitiu que fossem disponibilizados mais 15Kbp para a clonagem de
fragmentos, perfazendo um total de 18Kbp.

A remoo da regio referida implica que o fago deixa de ser capaz de realizar o ciclo lisognico (realiza
apenas o ciclo ltico), o que at uma caracterstica desejvel para os vectores.

Para eliminar os locais mltiplos de clonagem utilizou-se seleco natural.

Infectam-se E. coli que produzem endonucleases EcoRI. A maioria do DNA restringido mas algumas molculas
mutadas (que contm menos ou nenhum local de restrio para EcoRI) persistem, sendo seleccionadas. Ao fim
de alguns ciclos de infeco obtm-se o DNA com as caractersticas pretendidas.

Vectores de insero: tm um nico local de clonagem, adicionando-se o fragmento de DNA desejado ao vector
local.

Vectores de substituio: tm dois locais de restrio que flanqueiam uma regio do DNA que substituda
pelo fragmento pretendido.

A seleco dos fagos recombinantes feita naturalmente pois apenas os fragmentos de DNA de
dimenso 45Kbp a 52Kbp so empacotados. Deste modo, basta apenas garantir que o vector recombinado se
encontra dentro desta gama de tamanho e que o vector simples tenha menos que 45Kbp para que os nicos
fagos completos que se obtm sejam recombinados.

Os cosmdeos so vectores hbridos entre plasmdeos e fagos que permitem a clonagem de


fragmentos de grandes dimenses. O seu design baseia-se no facto de as enzimas que promovem o
empacotamento do DNA apenas necessitarem de reconhecer locais cos separados de 37-52Kbp.

Um cosmdeo tem ainda uma marca de seleco (i.e.: ampR) e uma origem de replicao. basicamente
um plasmdeo com um local cos. Aprensentam um nico local de restrio e durante o processo de insero
geralmente formam-se catenanos. O processo de empacotamento ainda realizado in vitro e os fagos so
depois usados para infectar E. coli cultivadas em meio selectivo contendo ampicilina.

Capacidade de um cosmdeo: 5,4Kbp - 47Kbp

31
Bibliotecas genmicas

Vectores e outros vectores de elevada capacidade permitem a criao de bibliotecas genmicas. Estas
bibliotecas consistem num conjunto de clones recombinantes que contm todo o DNA de um organismo, sendo
muito teis para estudar genes individualmente. Podem ser guardadas durante muitos anos e partilhadas entre
laboratrios.

Bibliotecas genmicas de eucariotas so feitas a partir de sequncias s quais j foram eliminados os


intres clona-se a partir do RNA.

O nmero de clones necessrio para fazer uma biblioteca genmica pode ser calculado pela frmula:

p: probabilidade de um dado gene estar presente


a: tamanho mdio dos fragmentos de DNA clonados
b: tamanho total do genoma

BAC: bacterial artificial cromossomes (capacidade 100-300Kbp)

Vectores de clonagem para leveduras

A maioria das estirpes de S. cerevisae tem um plasmdeo natural, o plasmdeo 2m que apresenta
algumas caractersticas:

Pequeno (6Kbp).
70-200 cpias por clula.
Tem origem de replicao.
No tem marca de seleco um problema.

As marcas de seleco introduzidas no plasmdeo 2m so geralmente marcas metablicas.

Os organismos hospedeiros vo ser auxotrficos para um determinado aminocido, i.e. vo ter em falta um
gene responsvel pela sntese desse a.a. e s sobrevivem se este for suplementado ao meio de cultura.

Nos vectores para levedura introduz-se os genes que esto no funcionais no hospedeiro e cultivam-se os
transformantes em meio mnimo (sem a.a. adicionados) de modo que s os organismos que captaram o
plasmdeo vo conseguir sobreviver.

32
YEps Plasmdeos epissomais de levedura

YEps so plasmdeos derivados do 2m e so do tipo vai-vm pois replicam tanto em E. coli como em S.
cerevisae.

Um exemplo deste tipo de plasmdeos o YEp13:

Tem origem de replicao do plasmdeo 2m permite replicao em levedura.


Tem gene LEU2 permite seleco de recombinantes em meio mnimo de leucina (seleco em
levedura).
Tem sequncia de pBR322 permite replicao e seleco em E. coli.
20-50 cpias.

Como a extraco de DNA plasmdico em levedura complicada (o plasmdeo pode integrar-se no genoma)
clonam-se sempre os fragmentos primeiro em E. coli. A partir das colnias recombinantes seleccionadas extrai-
se o DNA e introduz-se em S. cerevisae, seleccionando-se depois utilizando meio mnimo.

Os YEps so epissomais, o que significa que se podem integrar no DNA cromossmico da levedura e,
posteriormente, serem retirados. Epissomal Integrativo (integrativo fica inserido no cromossoma para
sempre).

A integrao d-se por recombinao homloga (gene LEU2 do plasmdeo tem regies homlogas ao gene
respectivo no funcional no genoma da levedura) e permite que todas as geraes futuras apresentem as
caractersticas pretendidas.

No entanto, quando o objectivo da clonagem a produo de uma protena para extraco mais eficiente
usar plasmdeos no integrativos pois estes tm um elevado nmero de cpias.

Quando h integrao no genoma, s possvel obter uma cpia do gene em cada organismo.

Outros plasmdeos para levedura

YIps, Yeast Integrative plasmids, so plasmdeos bacterianos que contm um gene de levedura. No so
replicveis em levedura (no contm regies do plasmdeo 2m) pelo que a sua sobrevivncia em S. cerevisae
depende da integrao no genoma.

URA3 um exemplo deste tipo de plasmdeos. Consiste no pBR322 ao qual foi inserido o gene URA3,
que codifica uma protena interveniente na biossntese de nucletidos pirimidinicos (T,C).

YRps, Yeast Replicative plasmids, tm uma origem de replicao para levedura e no se integram no
genoma. So instveis e podem ter entre 5 a 100 cpias.

YRp7 um exemplo deste tipo de plasmdeo e composto pelo pBR322 e tem um gene de levedura,
TRP1, que est envolvido na sntese do triptofano e adjacente a uma origem de replicao em levedura.

YRps no tendem a ser copiados para clulas filhas durante a diviso celular.

33
YACs cromossomas artificiais de levedura

YACs so utilizados para clonar longos (at 1400Kbp) fragmentos de DNA. Tm a estrutura de um
cromossoma e, portanto, apresentam 3 componentes essenciais:

Centrmero: necessrio correcta separao do cromossoma durante a diviso celular.


Telmeros: para replicao das extremidades do cromossoma e proteco contra exonucleases.
Origens de replicao: vrias ao longo do cromossoma permitem a replicao do DNA.

pYAC3, um exemplo de YACs, contm vrios genes responsveis por diferentes caractersticas:

Ori: origem de replicao da levedura.


TEL: duas regies que codificam os telmeros.
CEN4: centrmero.
TRP1: contm informao para ori e informao para a biossntese de triptofano.
URA3: informao para a sntese de pirimidinas.
SUP4: confere cor vermelha.

Tem um local de restrio para a endonuclease SnaBI. TRP1, URA3 e SUP4 so teis para a seleco de
recombinantes.

Processo de clonagem com pYAC3:


Restrio do vector com BamHI (coesivo) e SnaBI (cego).
Obtm-se 3 fragmentos:
Fragmento flanqueado por locais de restrio BamHI descartado.
Brao esquerdo contm TEL, TRP1-ori-CEN4.
Brao direito contm URA3 e TEL.
O gene SUP4 fica dividido entre os dois braos.
Ligao do fragmento de DNA deve ter extremidades coesivas.
Seleco: auxotrofia dupla e cor.

Podem ocorrer diversos tipos de ligao:

2 braos direitos: auxotrofia para triptofano.


2 braos esquerdos: auxotrofia para pirimidinas.
Brao esquerdo + brao direito sem gene: cor vermelha.
Brao esquerdo + brao direito + gene: recombinantes sobrevivem a meio mnimo para triptofano e
pirimidinas e tm cor branca.

(YACs so instveis e podem sofrer recombinao homloga entre si)

11,4 Kb

34
Vectores de clonagem para plantas superiores

Para plantas superiores, os vectores de clonagem mais usados so baseados no Ti, plasmdeo natural de
Agrobacterium tumefaciens.

O plasmdeo Ti tem grandes dimenses ( 200Kbp) e um nico local de restrio, pelo que a sua
manipulao se torna complicada. Para ultrapassar essa dificuldade utilizam-se duas estratgias:

Estratgia vector binrio: a regio do T-DNA no precisa de estar fisicamente associada ao resto do
plasmdeo Ti. Utilizam-se dois plasmdeos no processo de infeco:
Plasmdeo 170Kbp que contm a regio de virulncia e a regio de especificidade para o
hospedeiro. Este plasmdeo permite a infeco das clulas animais mas mantm-se na
agrobactria, no sendo transferido.
Plasmdeo 20Kbp que contm o T-DNA e um nico local de restrio. neste plasmdeo que
inserido o gene de interesse. transferido para as clulas vegetais e sofre recombinao,
integrando-se no DNA cromossmico.

Estratgia de cointegrao: utiliza-se um plasmdeo baseado num vector E. coli mas que contm duas
repeties de 25bp pertencentes ao T-DNA (verificou-se que estas eram as nicas regies envolvidas no
processo de infeco. J no tem oncogene a regio dos oncogenes pode ser substituda por DNA de interesse
no h formao de tumores).

Este plasmdeo, designado Ti desarmado, apresenta ainda o gene LacZ e kanR (resistncia canamicina),
necessrios para a seleco de recombinantes e, devido s repeties de T-DNA, integra-se no genoma das
clulas para os quais transferido.

A clonagem com plasmdeos de Agrobacterium tumefaciens tem a desvantagem de s poder ser usada
em plantas dicotilednias (tipo de plantas com flor). i.e. tomate, tabaco, batatas, ervilhas, feijes.

Quando se pretende uma grande expresso do DNA exgeno comum inserir o novo DNA no genoma
dos cloroplastos, pois estes existem em muita quantidade nas clulas. A introduo do DNA deve ser feita por
meios fsicos.

Vectores de clonagem para insectos

A clonagem de insectos como a Drosophila (mosca da fruta) faz uso de transposes designados
elementos P.

Um transposo uma curta sequncia de DNA (<10Kbp) que se pode mover entre vrias regies do
cromossoma de uma clula. So constitudos por duas repeties invertidas (IR) que flanqueiam o gene da
transposase, a protena responsvel pela mobilidade das sequncias de insero (IS).

Os elementos P podem saltar entre locais do cromossoma e entre um plasmdeo e um cromossoma.

35
Para clonar genes de interesse utilizam-se vectores que contm dois elementos P:

Um deles tem a transposase interrompida pelo DNA que se quer inserir na clula.
O outro tem a transposase intacta mas no tem repeties invertidas no pode ser transferido.

O vector introduzido nas clulas alvo por microinjeco. A transposase sintetizada e a sequncia
transferida para o genoma a que contm o gene de interesse.

Um plasposo um transposo que tem uma origem de replicao.

Obteno de clones para genes especficos

O mtodo mais simples para obter um clone de um determinado gene atravs de PCR. No entanto,
isso nem sempre possvel quando no se conhece a sequncia de nucletidos do gene. Existem duas
estratgias bsicas para permitir a seleco de genes:

Seleco directa de genes de interesse atravs do crescimento em meio selectivo. O gene clonado deve
conferir uma caracterstica que permita a seleco, como uma caracterstica morfolgica, a resistncia a um
antibitico ou uma protena associada a uma via biossinttica (para organismos auxotrficos). Esta tcnica pode
ser extendida a organismos (estirpes) mutantes, nomeadamente a estirpes auxotrficas.
Limitaes: deve existir uma estirpe mutante para o gene em questo e um meio onde apenas os organismos
recombinados sobrevivam.
Aplicaes: pode utilizar-se para a maioria dos genes que codificam para enzimas biossintticas e no est
restringida a E. coli, pois existem outras bactrias e at leveduras auxotrficas.

Identificao a partir de uma biblioteca genmica atravs do uso de sondas Hibridao de Southern.

Numa biblioteca genmica de eucariotas utiliza-se cDNA clonado em plasmdeos, YACs, BACs, etc. Devido
presena de intres recorre-se ao transcritema e no ao genoma das clulas. Deve ter-se tambm em ateno o
facto de clulas diferentes expressarem diferentes genes.

Para seleccionar um gene cuja protena no sintetizada no fgado utilizam-se clulas hepticas e no quaisquer
outras.

Processo de preparao do cDNA:


Extraco de mRNA e sua purificao mRNA processado tem cauda poli A em 3.
Ligao de um primer de TTT
Sntese de uma molcula hbrida (RNA+DNA) por aco da transcriptase reversa.
Degradao da cadeia de RNA pela RNase H esta enzima deixa algumas regies em cadeia dupla, que
vo servir de primer para a DNA polimerase.
Sntese de uma cadeia de DNA pela PolI para alm de sintetizar a cadeia de DNA complementar,
substitui os nucletidos de RNA por dNTPs.
O cDNA de cadeia dupla pode ser clonado num vector e os clones podem ser seleccionados.

36
RNase + PolI

mRNA 5 AUCGCCAAUAAAA 3 cDNA 5 ATCGCCAATAAAA 3

DNA 3 TAGCGGTTATTTT 5 3 TAGCGGTTATTTT 5

Como a expresso dos vrios genes de eucariotas no uniforme, para alguns vo obter-se clones mais
abundantes do que para outros.

A identificao de um clone contendo o gene de interesse pode ser feita atravs de hibridao de cidos
nucleicos, nomeadamente pelo mtodo de Hibridao de Southern.

Hibridao de Southern
Extraco de DNA;
Digesto com endonucleases de restrio;
Electroforese (separam-se os diferentes fragmentos obtidos);
Desnaturao do DNA atravs de uma base (NaOH) no se desnatura por temperatura porque o gel de
electroforese iria derreter. Antes da desnaturao pode fazer-se uma depurinao com HCl.
Transferncia do DNA (cadeia simples) para uma membrana de nylon ou nitrocelulose.
Sobre o gel virado ao contrrio (para o DNA ficar mais perto da superfcie) coloca-se uma membrana de nylon,
seguida de alguns filtros de papel, guardanapos e um peso. O gel est mergulhado num tampo que absorvido
por capilaridade e arrasta consigo o DNA, que fica retido na membrana por foras electrostticas (entre cargas
negativas do DNA e cargas positivas do nylon). Para a fixao total do DNA membrana criam-se ligaes
covalentes atravs da exposio a radiao UV (3-5 min).
Realizar pr-hibridao bloquear membrana.
Adiciona-se membrana DNA heterlogo de um organismo filogeneticamente distinto (geralmente DNA de
esperma de salmo) para que haja pouca complementaridade.
A pr-hibridao feita a baixa temperatura para que todo o DNA hibride, mesmo tendo pouca
complementaridade, e a membrana fique bloqueada.
Hibridao com sonda previamente preparada.
[sais] e temperatura favorece hibridao, mas pode levar a hibridaes inespecficas e rudo de fundo.
A sonda vai competir com o DNA heterlogo e ligar-se apenas s regies onde h homologia (zonas onde
compete com o DNA de pr-hibridao). A hibridao deve ser realizada a uma temperatura suficientemente
alta para no permitir ligaes inespecficas mas no demasiado elevada para que possa ocorrer, de facto,
alguma ligao.
Lavar para remover hbridos instveis lavar a temperatura e agitao adequadas.
Identificar fragmentos-alvo no gene.
Esses fragmentos podem depois ser isolados e utilizados para diversos fins (sequenciao, clonagem, etc).

37
A hibridao tambm pode ser feita directamente de colnias:

Transferir as colnias para uma membrana de nylon ou nitrocelulose.


As colnias correspondem a clones de uma biblioteca genmica, por exemplo.
Degradar clulas e purificar DNA.
Utilizar soluo alcalina (NaOH) e proteases (lisosima). O DNA fica desnaturado.
Fixar DNA membrana.
Exposio a radiao UV (nylon) ou ao calor (80C, 2h) (nitrocelulose).
Hibridar.
Pr-hibridao, hibridao e lavagens. Igual ao processo descrito anteriormente.
Identificar colnias que tm gene de interesse.

As sondas usadas na hibridao devem ter entre 100 e 1000bp (no devem ser muito grandes para no
tornar a sua marcao muito complicada, nem muito pequenas para evitar que se liguem a locais que no as
sequncias alvo), ter pelo menos parte da sua sequncia em comum com o gene de interesse e devem ser
marcadas (marcao radioactiva ou no-radioactiva) de modo a permitir a identificao dos genes alvo.

Marcao radioactiva consiste na incorporao de nucletidos que contm um istopo radioactivo de fsforo
na molcula de DNA. Essa incorporao pode ser feita por:

Nick translation: Adio de nucletidos radioactivos a nicks existentes naturalmente na molcula de


DNA. Este mtodo, por vezes, leva clivagem do DNA. Recorre-se polimerase I.
End-filling: Sntese de regies complementares s extremidades coesivas dos fragmentos da sonda
utilizando dNTPs radioactivos.
S funciona em fragmentos coesivos mas menos violenta que a tcnica anterior. Utiliza-se o fragmento de
Knelow.
Random priming: utilizam-se hexaoligonucletidos aleatrios como primers para sintetizar uma cadeia
complementar. Pelo menos um dos dNTPs adicionados ao meio deve estar marcado radioactivamente.
Usa-se o fragmento de Knelow.

A deteco dos fragmentos com sonda, aps hibridao, feita por autoradiografia.

Marcao no-radioactiva inclui vrios mtodos, por exemplo:

Inserem-se nucletidos associados a uma molcula orgnica, a biotina (biotina dUTP).


A insero pode ser feita por nick translation, end-filling ou random priming.
A biotina tem afinidade protena avidina, que se usa acoplada a marcadores fluorescentes para detectar a
sonda.

38
Mutagnese e Interferncia
Mutagnese e interferncia podem ser feitas por vrios mtodos e em diferentes tipos de organismos:

Bactrias:
Mutagnese aleatria transposo.
Eliminao de genes.
Inactivao por insero.
Levedura:
Mutantes de eliminao simples ou duplos.
Eucariotas:
siRNA (RNA de interferncia).
Mutagnese dirigida.

A eliminao/inactivao de genes pode ser utilizada para criar estirpes mutantes para hospedeiros de
clonagem ou para estudar a aco de um determinado gene.

Mutagnese aleatria

A mutagnese aleatria faz uso de transposes e plasposes.

Transposes so elementos mveis do DNA, com dimenso de 1 a 10Kbp, que podem ser inseridos em diversos
locais do genoma por recombinao no homloga, dando origem a um novo rearranjo dos genes (podem ficar
no funcionais).

Apresentam 3 regies fundamentais:

Transposase: enzima que corta o transposo nas sequncias invertidas e cliva o DNA alvo em locais
aleatrios.
Os restantes passos da transcrio so feitos por enzimas do organismo hospedeiro.
Repeties invertidas: regies da extremidade do transposo que so reconhecidas pela transposase.
Como as sequncias esto invertidas, as duas extremidades so iguais.
Marcas de seleco: genes, por exemplo de resistncia a antibiticos, que permitem a seleco das
molculas que contm o transposo.

Um transposo insere-se aleatoriamente em vrias regies do genoma, podendo interromper regies


promotoras ou codificantes. til quando no se sabe exactamente qual o gene de interesse ou quando se quer
fazer um banco de mutantes. Identificam-se as colnias com o fentipo pretendido e de seguida tenta
identificar-se o gene afectado.

Um transposo pode ser inserido num vector para E. coli, onde replica, e depois ser transferido para
outro tipo de clulas. A, o transposo vai, eventualmente, inserir-se no genoma e silenciar um gene. No
entanto, como o plasmdeo no possui origem de replicao para o organismo hospedeiro diz-se um plasmdeo
suicida.

39
Um plasposo um transposo que contm uma origem de replicao para bactrias entre as
sequncias invertidas, podendo ser convertido num plasmdeo.

pTnMod-OKm um plasposo muito utilizado que replica s em E. coli e mob+.

Na mutagnese aleatria, uma vez identificadas as colnias (cultivadas em meio selectivo) que
apresentam o fentipo pretendido, necessrio recuperar a regio onde o transposo/plasposo se inseriu e
identificar o gene mutado. Para tal procede-se do seguinte modo:

Extrai-se o DNA genmico do mutante;


Digere-se o DNA com enzimas de restrio que no cortem o transposo;
Clonam-se os vrios fragmentos obtidos e inserem-se em E. coli. No se usa um vector. Recircularizam-
se s os fragmentos por interveno de uma ligase. Apenas alguns fragmentos vo ter o transposo.
Seleccionam-se as clulas transformantes que tm o plasmdeo com o fragmento que contm o
transposo.
Utiliza-se a marca de seleco do transposo (resistncia canamicina).
Extrai-se o DNA plasmdico.
Sequenciam-se os fragmentos obtidos.
A sequncia do transposo conhecida por isso pode identificar-se o gene interrompido. Podem ser
desenhados primers para aplicar em PCR e amplificar a regio pretendida a partir do genoma.

No convm que um transposo se tenha inserido em mais do que uma regio do genoma pois assim
torna-se mais difcil identificar o gene de interesse. Para verificar se a insero foi nica, digere-se o genoma e
corre-se num gel de electroforese. Faz-se uma sonda a partir da sequncia do transposo e identificam-se os
fragmentos por hibridao de Southern.

Quando o fentipo alvo codificado por um opero torna-se difcil identificar qual dos genes
realmente o responsvel pela caracterstica procurada. A mutao pode ocorrer num regio promotora,
comprometendo toda a sntese, ou numa regio codificante, silenciando apenas alguns dos genes.

Mutantes de eliminao em bactrias

Quando se elimina um gene do genoma de um organismo, cria-se um mutante de eliminao.

Para eliminar genes de bactrias utiliza-se plasmdeos no replicativos (>1Kbp*) com regies homlogas s
regies que flanqueiam o gene alvo. A eliminao vai basear-se numa recombinao homloga dupla.

*tamanho mnimo para que ocorra recombinao pouco eficiente

Estratgia geral para eliminao do gene E1

40
1) Clonar regies que flanqueiam o gene.

X Y Z locais de restrio
Permitem a ligao dos fragmentos na ordem
correcta.

Pode usar-se vectores suicidas: replicam em E. coli (permitem amplificao do vector) mas no no
organismo onde se quer fazer a eliminao. Como os vectores so suicidas, sabemos que vo ter de se integrar
no genoma ou ento vo ser destrudos.

Espera-se que ocorra recombinao homloga entre o vector e a zona do genoma que contm os genes
clonados. O genoma passa a ter o vector e, portanto, a bactria pode ser seleccionada.

2) Transformar bactrias com o vector produzido e seleccionar os recombinantes simples.

Usar marca de seleco do vector.

Recombinao simples:

3) Sujeitam-se os recombinantes simples a 10 dias de crescimento sob condies de fome.

O stress ambiental aumenta a frequncia de recombinao e mais provvel que ocorra a recombinao que
queremos.

Recombinao dupla: o genoma vai recombinar consigo prprio, podendo ou no eliminar o gene E1.

41
4) Plaqueiam-se as colnias em meio LB suplementado com X-gluc. Seleccionam-se as colnias brancas.

gusA, uma das marcas de seleco do vector utilizado, codifica uma protena que degrada o X-gluc e lhe confere
a cor azul.

Os recombinantes simples tm o vector inserido no genoma e, portanto, degradam o X-gluc, dando origem a
colnias azuis.

Os recombinantes duplos perderam o vector e vo dar origem a colnias brancas.

5) Realizar hibridao de Southern ou PCR para distinguir as estirpes de eliminao das estirpes selvagens.

Quando se usa PCR distinguem-se os genomas mutado e no mutado por electroforese.

Na hibridao utiliza-se o gene E1 como sonda para identificar a estirpe selvagem.

Uma outra estratgia de eliminao, mais simples em termos de seleco, a substituio do gene por uma
cassete interposo que codifica uma protena de resistncia a um antibitico.

Estratgia geral:

1) Clonar regies que flanqueiam o gene num vector.


2) Inserir cassete no local onde estaria o gene E1

Cassete aacC1 resistncia a gentamicina.

3) Transformar bactrias e seleccionar os recombinantes em meio nutritivo contendo gentamicina.

Seleccionam-se recombinantes tanto simples como duplos.

4) Plaquear as colnias obtidas em meios LB com gentamicina e tetraciclina. Seleccionar as colnias que
no crescem em tetraciclina.

Os recombinantes simples vo conter o vector e, por isso, tm resistncia tetraciclina, para alm da resistncia
gentamicina.

Os recombinantes duplos tm a cassete no local do gene e j perderam o vector, pelo que s apresentam
resistncia gentamicina.

5) Confirmar eliminao do gene por PCR ou hibridao de Southern.

42
As cassetes so apropriadas para eliminar genes de operes pois contm um promotor e no tm
terminador. Garante-se que os genes seguintes ainda so transcritos.

No entanto, tm algumas limitaes:

Tem de se manter a presso selectiva constantemente;


A construo do vector mais demorada porque requer 2 passos;
A construo de mutantes duplos inviabilizada pela falta de cassetes com diferentes antibiticos.

Mutantes de inactivao por insero

Quando se suspeita que um gene pode ter propriedades interessantes no se procede logo sua
eliminao. Nestes casos interrompe-se o gene, silenciando-o ou levando sntese de uma protena no
funcional. Esta tcnica tambm utilizada quando no se consegue eliminar determinado gene, provavelmente,
porque ele essencial.

Utiliza-se um vector que contm uma regio homloga ao gene que se quer interromper. Por
recombinao, o vector insere-se no genoma e inactiva o gene.

Se na zona interrompida existir o promotor para genes seguintes pode comprometer-se a sua leitura, o
que pode constituir um problema.

Contm marca de seleco que utilizada para seleccionar os mutantes.

Mutantes de eliminao em S. cerevisae

A recombinao homloga em levedura muito eficiente e precisa, necessitando apenas de 40


nucletidos homlogos para dar incio ao processo.

Para eliminar genes em S. cerevisae utiliza-se a cassete KanMX, que confere resistncia geneticina. Nas
extremidades da cassete inserem-se 40 nucletidos (de cada lado) da sequncia do gene alvo, para que ocorra
recombinao homloga.

43
Estratgia geral de eliminao de ORFs:

1) Design de primers que contenham regies que flanqueiam a cassete e 40 nucletidos do gene alvo.
2) Fazer PCR e inserir produto de amplificao directamente em S. cerevisae.

Esta tcnica difere da eliminao em bactrias pois no preciso clonar fragmentos em E. coli e podem usar-se
fragmentos lineares.

3) Seleccionar colnias na presena de geneticina.


4) Confirmar eliminao do gene atravs de PCR.

As estirpes mutantes so aquelas em que ocorre recombinao dupla.

Em S. cerevisae possvel fazer mutantes mltiplos, mas para isso necessrio eliminar a cassete aps
cada eliminao.

A cassete utilizada agora a KanMX4, que semelhante KanMX mas tem duas regies iguais, as loxp,
que podem recombinar entre si.

A recombinao ocorre na presena do plasmdeo pSM47 e a cassete KanMX4 eliminada. Pode ento
proceder-se eliminao de outros genes.

pSM47 codifica a recombinase Cre, responsvel pela recombinao, e bastante instvel, sendo eliminada aps
algumas replicaes.

As leveduras so organismos dimrficos (podem estar na forma haplide ou diplide) e quando se quer
eliminar um gene essencial (que no pode ser eliminado) trabalha-se com as leveduras na forma diplide.

Para testar se um gene essencial procede-se sua eliminao numa levedura diplide. Fora-se a entrada em
meiose e vo obter-se 4 clulas, das quais apenas 2 tm o gene. Se todas sobreviverem o gene no essencial.

RNA de interferncia iRNA

iRNA um mecanismo natural de regulao da expresso genmica em clulas eucariotas superiores.

So sintetizados RNAs de cadeia dupla (dsRNA) que se ligam a uma protena, chamada DICER, que cliva o
material gentico em pequenas sequncias de 20 nucletidos. Essas sequncias associam-se ao complexo RISC
e so separadas em cadeias simples. O RISC faz um scan ao mRNA e transcritos presentes na clula em busca de
regies homlogas e, quando as encontra, cliva e destri esse mRNA impedido a sntese proteica.

44
Na prtica o gene transcrito na mesma, mas no h sntese de nenhuma protena, pelo que como se
o gene estivesse silenciado.

siRNA (small interfering RNA) so utilizados em Eng. Gentica para silenciar genes.

In vitro, sintetizam-se pequenos dsRNAs, com extemidades coesivas de timina. Introduz-se o RNA nas
clulas e forma-se o complexo RISC, que vai reconhecer e degradar os transcritos do gene que pretendemos
silenciar.

No h formao do complexo DICER porque j se fornecem dsRNAs suficientemente pequenos. Este processo
de silenciamento transitrio pois s funciona enquanto os dsRNAs no forem todos degradados. Contudo
costuma persistir o tempo suficiente para se analisarem as alteraes no fentipo em estudo.

Mutagnese dirigida

A mutagnese dirigida utiliza-se para introduzir pequenas mutaes na sequncia codificante de um


gene.

Pode usar-se o fago M13 para introduzir uma mutao pontual. Sintetiza-se um oligonucletido que
contm a mutao pretendida e este vai hibridar com o DNA de cadeia simples do fago. Aps replicao temos
uma cadeia mutada e outra no.

Para evitar que a cadeia mutada (que no est metilada) seja corrigida, eliminam-se os sistemas de
reparao do hospedeiro. A probabilidade de se obter uma cadeia mutada agora de 50:50.

Pode tambm recorrer-se a PCR para amplificar plasmdeos com mutao (j no preciso usar o M13).
Sintetizam-se 2 primers, ambos com a mutao, e amplifica-se. No final da reaco incuba-se o produto com
DnpI, uma endonuclease de restrio que s reconhece DNA metilado, e eliminam-se as cadeias originais (no
mutadas).

Normalmente usam-se primers 30-40 mer e a mutao deve estar no meio.

45

Você também pode gostar